Powered by Deep Web Technologies
Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

Cotton Cotton Nature Bulletin No. 464 September 29, 1956 Forest Preserve District of Cook County Daniel Ryan, President Roberts Mann, Conservation Editor David H. Thompson, Senior Naturalist COTTON Illinois is considered a northern state. Travelers are astonished when they see fields of cotton in its southernmost counties. They do not realize that Cairo, where the Ohio river empties into the Mississippi, is on the same parallel of latitude as the north boundaries of three cotton- growing states: Oklahoma, New Mexico and Arizona. Cotton, a tropical plant which has been adapted to temperate regions where there is a growing season of six months or more, is the world's most important source of fiber. Man depends mainly upon cotton for his clothing and other textiles. Countless uses have been found for it and its by-products. It enters into the daily life of more of the world's peoples than any other product except salt.


Canadian Section  

Science Conference Proceedings (OSTI)

Bringing together professionals from Canadian geographical regions. Canadian Section Sections achievement application award awards canadian distinguished division fats member membership memorial network nomination oils poster program recognizing r


Cotton Growing  

NLE Websites -- All DOE Office Websites (Extended Search)

Cotton Growing Cotton Growing Name: anna Location: N/A Country: N/A Date: N/A Question: Hi, My name is Anna, and I live in southern Maryland. Everybody i ask says I'm crazy or they don't have a clue about growing cotton. I believe any thing is possible. I would love to grow some not as a crop because i dont have that much room. But ihave even gone to places like SouthernStates and they can't hlep me even find seeds or whatever it is you plant. If yu could please tell me how to get some, along with maybe some instruction to grow it. I would be mighty obliged, Well Thank You Kindly For any help. P.S. please don't tell me you can't grow cotton in Maryland. L, Anna Replies: Dear Anna, The following may be useful: http://muextension.missouri.edu/xplor/agguides/crops/g04268.htm


Why Sequence Cotton?  

NLE Websites -- All DOE Office Websites (Extended Search)

Cotton? Cotton? The Gossypium (cotton) genus presents a novel opportunity to advance our understanding of the natural world and organic evolution, while nurturing bio-based carbon sequestration alternatives to petrochemical use and improving the sustainability of crop production. The genus has spawned one of the world's most important crops (cotton), which sustains one of the world's largest industries (textiles). The value of cotton fiber grown in the USA is typically about $6 billion/yr. Cottonseed oil and meal byproducts add $500 million/yr. More than 440,000 domestic jobs are related to cotton production and processing, with an aggregate influence of about $120 billion/yr on the US gross domestic product and estimated $500 billion/yr worldwide. Increasing the durability and strength of cotton


US Canadian Biofuels Inc | Open Energy Information  

Open Energy Info (EERE)

Canadian Biofuels Inc Jump to: navigation, search Name US Canadian Biofuels Inc. Place Green Bay, Wisconsin Zip 54313 Sector Biofuels Product US Canadian Biofuels Inc is the wholly...


Canadian Environmental Protection Act 2012 (Canada) | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Canadian Environmental Protection Act 2012 (Canada) Canadian Environmental Protection Act 2012 (Canada) Eligibility Agricultural Commercial Construction Developer Fed. Government...


All Cotton | Open Energy Information  

Open Energy Info (EERE)

Cotton Cotton Jump to: navigation, search Name All Cotton Place Goias, Brazil Product Cooperative of Cotton producers in the state of Goias, Brazil, which operates in the biofuel industry. Coordinates 42.680161°, -8.09135° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.680161,"lon":-8.09135,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Sampling nucleotide diversity in cotton  

E-Print Network (OSTI)

showed the highest level of diversity of the species testedin our study for over 1,900 loci. Among species diversitySNP diversity in cotton has a large range that is both



Canadian Section List  

Science Conference Proceedings (OSTI)

Name AffiliationCity, State, CountryCanadian Section2013 Members243 Members as of October 1, 2013Abuzaytoun, ReemDalhousie UniversityHalifax, NS, CanadaAcosta, EdgarUniversity of TorontoToronto, ON, CanadaAlfieri, JocelynSilliker Canada CoMarkham, ON, Cana


Canadian Electrical Association Petition  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

BEFORE THE DEPARTMENT OF ENERGY OFFICE OF ELECTRICITY DELIVERY AND ENERGY RELIABILITY TransAlta Energy Marketing (U.S.) Inc. ) Docket No. EA-216-C PROTEST OF THE CANADIAN ELECTRICITY ASSOCIATION AND THE ELECTRIC POWER SUPPLY ASSOCIATION TO SIERRA CLUB'S NOTICE OF INTERVENTION AND MOTION TO INTERVENE Pursuant to Section 202(e) of the Federal Power Act ("FPA"), 16 U.s.c. § 824(e) (2006) and § 385.211 of the Federal Energy Regulatory Commission's ("FERC") Rules of Practice and Procedure, the Canadian Electricity Association ("CEA") and the Electric Power Supply Association ("EPSA") hereby submit this filing in protest to Sierra Club's Notice ofIntervention and Motion to Intervene and in support of TransAlta Energy Marketing (U.S


Why Sequence the Simplest Cotton Genome?  

NLE Websites -- All DOE Office Websites (Extended Search)

Sequence the Simplest Cotton Genome? Sequence the Simplest Cotton Genome? Cotton is one of the world's most important crops, and it sustains one of the world's largest industries (textiles). The value of cotton fiber and byproducts grown in the USA is typically about $6-7 billion/yr. More than 440,000 domestic jobs are related to cotton processing, with an aggregate influence of ~$120 billion/yr on the US gross domestic product and ~$500 billion/yr worldwide. Increased durability and strength of cotton fiber offers the opportunity to replace synthetic fibers that require more than 200 million barrels of petroleum per year to produce in the USA alone, also increasing use of bio-based products and increasing farm income. Its seed oil, and also byproducts of cotton processing, are potential raw materials


Canadian River Compact (Texas) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Administration Other Agencies You are here Home Savings Canadian River Compact (Texas) Canadian River Compact (Texas) Eligibility Utility Fed. Government Commercial...


Durable and Non-Toxic Topical Flame Retardants for Cotton and Cotton Blends.  

E-Print Network (OSTI)

??Flame retardant chemicals were used as topical finishes on cotton and cotton blended fabric. Comparison of flame resistance and durability of non-bromine/non-antimony flame retardants were (more)

Mathews, Marc Christopher



Cotton Market News Search | Data.gov  

NLE Websites -- All DOE Office Websites (Extended Search)

Cotton Market News Search Agriculture Community Menu DATA APPS EVENTS DEVELOPER STATISTICS COLLABORATE ABOUT Agriculture You are here Data.gov Communities Agriculture Data...


Spider Mites on Cotton in the Midsouth  

E-Print Network (OSTI)

.P. Tunstall (Eds.), Insect Pests of Cotton. CAB, Wallingford. Jeppson, L.R., H.H. Keifer and E.W. Baker. 1975

Behmer, Spencer T.


Unsafe chromium from cotton ginneries and development of a rubberized cotton fabric roller for cotton roller gins  

Science Conference Proceedings (OSTI)

This paper realizes the hazards of chromium contamination and pollution caused in the use of chrome composite leather-clad (CCLC) rollers commonly used in cotton roller ginning industries and attempts to eliminate the chromium contamination and pollution ... Keywords: chromium, cotton, gin, ginning, health, pollution, process, roll, roller, rubber

Vijayan Gurumurthy Iyer; Nikos E. Mastorakis



Unsafe chromium from cotton ginneries and development of a rubberized cotton fabric roller for cotton roller gins  

Science Conference Proceedings (OSTI)

This paper realizes the hazards of chromium contamination and pollution caused in the use of chrome composite leather-clad (CCLC) rollers commonly used in cotton roller ginning industries and attempts to eliminate the chromium contamination and pollution ... Keywords: chromium, cotton, ginning, gins, pollution, rollers

Gurumurthy Vijayan Iyer; Nikos E. Mastorakis



Unsafe chromium from cotton ginneries and development of a rubberized cotton fabric roller for cotton roller gins  

Science Conference Proceedings (OSTI)

This paper realizes the hazards of chromium contamination and pollution caused in the use of chrome composite leather-clad (CCLC) rollers commonly used in cotton roller ginning industries and attempts to eliminate the chromium contamination and pollution ... Keywords: chromium, cotton lint, fibre, ginning, roller, separation

Gurumurthy Vijayan Iyer; Nikos E. Mastorakis



Development of a Seed Cotton Fiber Quality Sensing System For Cotton Fiber Quality Mapping  

E-Print Network (OSTI)

For precision agriculture to work, an automated process to collect spatial-variability data within a field is necessary. Otherwise, data collection is prohibitively expensive and time consuming. Furthermore, to minimize measurement error due to harvesting method, data-collection processes involving normal cotton harvesting and ginning operations must be used. For the case of cotton, an automated prototype system using image processing to measure the micronaire value of cotton fiber during harvest was designed and built in the laboratory. This system was tested with two image-processing algorithms to identify and remove the effects of objects present in the images that were not cotton fiber, and then measure the reflectivity in three Near-Infrared (NIR) wavebands. Both algorithms yielded similar results when used on seed cotton samples. The reflectivity measurement after removing the effects of foreign matter had a strong relationship to standard micronaire measurements (R^2= 0.73 and 0.74 for the ratio-image and single-image algorithms, respectively) with a root mean squared error (RMSE) of 0.28 and 0.27, respectively. The ratio-image pixel classification method classified an average of 58% of the pixels in an image as "cotton", while the single-image method classified an average of 81% of the pixels in each image as cotton. These results do not show as strong a relationship between micronaire and NIR reflectivity of cotton samples as previous research done with very uniform lint cotton calibration samples. This is attributed to the higher content of foreign matter in seed cotton samples. With higher trash cotton and fiber that has not yet been cleaned, results obviously are not as good as when using calibration cotton samples. These results indicate the system can be adapted to perform in-situ measurement of cotton fiber quality, specifically micronaire, and enable harvesters to create quality maps of a field automatically to allow better crop management.

Schielack, Vincent Paul



Canadian River Compact (Texas) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Canadian River Compact (Texas) Canadian River Compact (Texas) Canadian River Compact (Texas) < Back Eligibility Utility Fed. Government Commercial Agricultural Investor-Owned Utility State/Provincial Govt Industrial Construction Municipal/Public Utility Local Government Residential Installer/Contractor Rural Electric Cooperative Tribal Government Low-Income Residential Schools Retail Supplier Institutional Multi-Family Residential Systems Integrator Fuel Distributor Nonprofit General Public/Consumer Transportation Savings Category Water Buying & Making Electricity Home Weatherization Program Info State Texas Program Type Siting and Permitting Provider Canadian River Compact Commission The Canadian River Commission administers the Canadian River Compact which includes the states of New Mexico, Oklahoma, and Texas. Signed in 1950 by

Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


23rd Canadian Conference on Fats and Oils  

Science Conference Proceedings (OSTI)

Archive of the 23rd Canadian Conference on Fats and Oils 23rd Canadian Conference on Fats and Oils Toronto, Canada Canadian Section of the American Oil Chemists' Society (CAOCS) 23rd Canadian Conference on Fats and Oils ...


24th Canadian Conference on Fats and Oils  

Science Conference Proceedings (OSTI)

Archive of the 24th Canadian Conference on Fats and Oils 24th Canadian Conference on Fats and Oils Edmonton, Alberta, Canada Canadian Section of the American Oil Chemists' Society (CAOCS) 24th Canadian Conference on Fats and Oils...


Conservation tillage production systems compared in San Joaquin Valley cotton  

E-Print Network (OSTI)

of overall cotton production costs. These operations reduce48% to 62%, and overall production costs by 14% to ince themore of overall cotton-production costs (Carter 1996). These

Mitchell, Jeffrey; Munk, Dan; Prys, Bob; Klonsky, Karen; Wroble, Jon; De Moura, Rich



Electrical Resistance Investigation of Cotton Fabrics After Treating ...  

Science Conference Proceedings (OSTI)

Presentation Title, Electrical Resistance Investigation of Cotton Fabrics After ... the Piezodielectric Effect of Carbon Fiber Sulphoaluminate Cement Composites.


Cotton Electric Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Cotton Electric Coop, Inc Cotton Electric Coop, Inc Place Oklahoma Utility Id 4401 Utility Location Yes Ownership C NERC Location SPP NERC SPP Yes RTO SPP Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Service High Density-Single Phase Commercial Commercial Service High Density-Three Phase Commercial Commercial Service-Single Phase Commercial Commercial Service-Three Phase Commercial Commercial Time -Of- Use Service-Single Phase Commercial Commercial Time -Of- Use Service-Three Phase Commercial Cotton Gins Industrial General Service High Density-Single Phase Residential


A Look at Bilingual Canadian Immigration Terminology.  

E-Print Network (OSTI)

??The creation of a bilingual terminological glossary results from a closer consideration of the terminology used in Canadian domestic immigration policy. Bilingual French-English terminological records (more)

Riaz, Sabrina



Portfolio Manager Technical Reference: Canadian National Energy...  

NLE Websites -- All DOE Office Websites (Extended Search)

Home Buildings & Plants Portfolio Manager Technical Reference: Canadian National Energy Use Intensity Secondary menu About us Press room Contact Us Portfolio Manager Login...


Canadian Fuel Cell Commercialization Roadmap Update: Progress...  

Open Energy Info (EERE)

Fuel Cell Commercialization Roadmap Update: Progress of Canada's Hydrogen and Fuel Cell Industry Jump to: navigation, search Name Canadian Fuel Cell Commercialization Roadmap...


Precipitation Trends on the Canadian Prairies  

Science Conference Proceedings (OSTI)

The Canadian prairies are a major producer of grain, much of which is produced under rain-fed agriculture. The amount and timing of precipitation are critical to grain production. Information on the precipitation trend is therefore vital to this ...

O. O. Akinremi; S. M. McGinn; H. W. Cutforth



Canadian Hills (Repower) | Open Energy Information  

Open Energy Info (EERE)

Canadian Hills (Repower) Canadian Hills (Repower) Jump to: navigation, search Name Canadian Hills (Repower) Facility Canadian Hills (Repower) Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Atlantic Power Corp Developer Apex Wind Energy Energy Purchaser Oklahoma Municipal Power Authority / SWEPCO Location Calumet OK Coordinates 35.66212553°, -98.12820911° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.66212553,"lon":-98.12820911,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Nano Res (2010) 3: 452458452 Aqueous Supercapacitors on Conductive Cotton  

E-Print Network (OSTI)

Nano Res (2010) 3: 452­458452 Aqueous Supercapacitors on Conductive Cotton Mauro Pasta1,2 , Fabio the fabrication of wearable supercapacitors using cotton fabric as an essential component. Carbon nanotubes in the supercapacitor. Aqueous lithium sulfate is used as the electrolyte in the devices, because it presents no safety

Cui, Yi


Gas developments lead Canadian activity  

SciTech Connect

Canada has an immense supply of natural gas. The Western Sedimentary Basin of Canada is North America`s largest gas-bearing geologic province and extends from British Columbia on Canada`s west coast, eastward through the provinces of Alberta, Saskatchewan and Manitoba and includes portions of the Northwest Territories and the Yukon. The basin supplies most of Canada`s natural gas with nearly 85% of it coming from Alberta. The production of natural gas supplies from conventional fields continues to increase. Major gas discoveries, made in the frontier and offshore regions, are going to be developed as well over time, as the economics and the markets dictate. Furthermore, Canada`s relatively unexplored Arctic and offshore basins, which promise excellent geological potential, will be developed at some point in the future. The paper discusses gas exploration and drilling activities, market access, the future of Canadian natural gas, how price challenges development of heavy oil and tar sands, and extending life of oil fields.

Riahi, M.L.; Perdue, J.M.; Kunkel, B.



2009 Canadian Radiation Oncology Resident Survey  

SciTech Connect

Purpose: Statistics from the Canadian post-MD education registry show that numbers of Canadian radiation oncology (RO) trainees have risen from 62 in 1999 to approximately 150 per year between 2003 and 2009, contributing to the current perceived downturn in employment opportunities for radiation oncologists in Canada. When last surveyed in 2003, Canadian RO residents identified job availability as their main concern. Our objective was to survey current Canadian RO residents on their training and career plans. Methods and Materials: Trainees from the 13 Canadian residency programs using the national matching service were sought. Potential respondents were identified through individual program directors or chief resident and were e-mailed a secure link to an online survey. Descriptive statistics were used to report responses. Results: The eligible response rate was 53% (83/156). Similar to the 2003 survey, respondents generally expressed high satisfaction with their programs and specialty. The most frequently expressed perceived weakness in their training differed from 2003, with 46.5% of current respondents feeling unprepared to enter the job market. 72% plan on pursuing a postresidency fellowship. Most respondents intend to practice in Canada. Fewer than 20% of respondents believe that there is a strong demand for radiation oncologists in Canada. Conclusions: Respondents to the current survey expressed significant satisfaction with their career choice and training program. However, differences exist compared with the 2003 survey, including the current perceived lack of demand for radiation oncologists in Canada.

Debenham, Brock, E-mail: debenham@ualberta.net [Department of Radiation Oncology, Cross Cancer Institute, University of Alberta, Edmonton, Alberta (Canada); Banerjee, Robyn [Department of Radiation Oncology, Tom Baker Cancer Centre, University of Calgary, Calgary, Alberta (Canada); Fairchild, Alysa; Dundas, George [Department of Radiation Oncology, Cross Cancer Institute, University of Alberta, Edmonton, Alberta (Canada); Trotter, Theresa [Department of Radiation Oncology, Tom Baker Cancer Centre, University of Calgary, Calgary, Alberta (Canada); Yee, Don [Department of Radiation Oncology, Cross Cancer Institute, University of Alberta, Edmonton, Alberta (Canada)



Inheritance of cotton fiber length and distribution  

E-Print Network (OSTI)

Fiber quality data from five upland cotton (Gossypium hirsutum L.) genotypes, which were grown at College Station, TX during 2001 and 2002, were subjected to diallel and generation means analyses to determine the potential for improvement of fiber length and to determine the inheritance of length distribution data. Four near-long staple (NLS) upland cotton genotypes and one short-staple genotype were crossed in all combinations, excluding reciprocals. Estimates of general (GCA) and specific combining ability (SCA) for fiber length based on Griffingâ??s diallel Model I, Method 4 were calculated for high volume instrumentation (HVI) upper-half mean (UHM) fiber length and advance fiber information system (AFIS) mean fiber length by weight (FLw), mean fiber length by number (FLn), upper quartile length by weight (Uqlw), fiber length distribution cross entropy (using 3 different standard or check distributions - CEA, CEB, and CEC), fiber length distribution kurtosis (FLwKurt), and fiber length distribution skewness (FLwSkew) for FLw. Across environments, GCA effects were significant for fiber length measurements of UHM, FLw, FLn, Uqlw, and SFCw and distribution measurements of CEA, CEB, FLwKurt, and FLwSkew. On the basis of GCA effects, TAM 94L-25 was the best parent to be used in a cross to improve upland fiber length, while Acala 1517-99 was the parent of choice to improve distribution among the 4 parents tested. The inheritance of AFIS fiber length measurements and distribution data was estimated using parents, F1, F2, and backcross generations. The magnitude and significance of the estimates for non-allelic effects in the parental combinations suggest that epistatic gene effects are present and important in the basic mechanism of AFIS fiber length and length distribution inheritance for the populations studied. Gene effects and variances for all AFIS fiber length and distribution data measurements were inherited differently in different environments and specific parental combination, suggesting environmentally specific mechanisms. Developing genotypes with enhanced fiber length and an optimal fiber length distribution should be a priority to improve spinning performance and product quality of U.S. upland cotton.

Braden, Chris Alan



Eco-friendly rubberized cotton fabric roller for ginning machines  

Science Conference Proceedings (OSTI)

This paper realizes the hazards of chromium contamination and pollution caused by the use of Chrome Composite Leather-Clad (CCLC) rollers commonly used in cotton roller ginning industries and attempts to eliminate the chromium contamination and pollution ...

Gurumurthy Vijayan Iyer; Nikos E. Mastorakis



DOE Joint Genome Institute: Unraveling the Threads: Simplest cotton genome  

NLE Websites -- All DOE Office Websites (Extended Search)

December 19, 2012 December 19, 2012 Unraveling the Threads: Simplest cotton genome offers clues for fiber improvements From the stockings decorating mantles to the new outfits in display windows calling to shoppers, cotton is woven into the fabric of the holiday season. For bioenergy researchers, however, fiber composition matters more than color and texture as each cotton strand is composed of more than two dozen coils of cellulose, a target biomass for next-generation biofuels. In the December 20, 2012 edition of Nature, an international consortium of researchers from 31 institutions including a team from the U.S. Department of Energy Joint Genome Institute (DOE JGI) present a high-quality draft assembly of the simplest cotton (Gossypium raimondii) genome. Additionally,


Sponsors of CIEEDAC: Natural Resources Canada, Canadian Industry Program for Energy Conservation, Aluminium Industry Association, Canadian Petroleum Products Institute, Canadian Portland Cement Association, Canadian Pulp  

E-Print Network (OSTI)

2. Industrial Consumption of Energy, and the Quarterly Report of Energy Supply and Demand 3. Annual Canada (NRCan): 1. Annual Survey of Manufacturers (ASM, from STC) 2. Industrial Consumption of Energy consistent source of historical data related to energy consumption in all Canadian industry by region


Automation of a Wireless Cotton Module Tracking System for Cotton Fiber Quality Mapping  

E-Print Network (OSTI)

The ability to map the profit made across a cotton field would enable producers to see in detail where money is being made or lost on their farms. This ability, which requires sitespecific knowledge of yield, fiber quality, and input costs would further enable them to implement precise field management practices to ensure that they receive the highest return possible on each portion of a field and do not waste materials and other inputs throughout the field. Investigators at Texas A&M previously developed a wireless-GPS system that tracks where a module of cotton comes from within a field. This system is a necessary component in mapping fiber quality, which is a major determiner of price and thus profit. Three drawbacks to the previous wireless-GPS system are that (1) a person must manually trigger the system to send wireless communications when a field machine dumps its load of cotton, (2) multiple field machines of the same type (e.g., two cotton pickers) cannot be used simultaneously on the same system within the same field, and (3) no software is available to automatically produce fiber-quality maps after the data are downloaded from the gin. The first two drawbacks, the need for an automatic communication-triggering system and the needed capability for multiple field machines of the same type are the problems addressed in this work. To solve the first problem, a sensing and control system was added to a harvester to automatically indicate when the machine is dumping a basket load of cotton so that wireless messages can be automatically sent from the harvester to subsequent field machines without human intervention. This automated communication-triggering system was incorporated into the existing wireless- GPS system, rigorously field tested, and ultimately proven to operate as designed. Linking data collected with this system together with classing information will enable producers to create fiber-quality maps, and linking fiber-quality maps with yield and input-cost maps will enable them to create profit maps. Additionally, a radio-frequency identification (RFID) system was integrated with the wireless-GPS system to allow for multiple field machines of the same type. The RFID system was also rigorously field tested and proven to operate as designed. Finally, the entire system was field tested as a whole and operated according to design. Thus, the wireless-GPS module tracking system now operates without human intervention and works with multiple field machines of each type, two additional capabilities required for practical use in large farming operations.

Sjolander, Andrew J.



Canadian Solar Japan KK | Open Energy Information  

Open Energy Info (EERE)

Japan KK Japan KK Jump to: navigation, search Name Canadian Solar Japan KK Place Shinjuku-ku, Tokyo, Japan Zip 160-0022 Sector Solar Product Tokyo-based subsidiary of Canadian Solar, producing solar equipment. Coordinates 35.7015°, 139.709244° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.7015,"lon":139.709244,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Canadian Hills (Mitsubishi) | Open Energy Information  

Open Energy Info (EERE)

Hills (Mitsubishi) Hills (Mitsubishi) Jump to: navigation, search Name Canadian Hills (Mitsubishi) Facility Canadian Hills (Mitsubishi) Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Atlantic Power Corp Developer Apex Wind Energy Energy Purchaser Oklahoma Municipal Power Authority / SWEPCO Location Calumet OK Coordinates 35.69756036°, -98.20438385° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.69756036,"lon":-98.20438385,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Application of fuzzy cognitive maps for cotton yield management in precision farming  

Science Conference Proceedings (OSTI)

The management of cotton yield behavior in agricultural areas is a very important task because it influences and specifies the cotton yield production. An efficient knowledge-based approach utilizing the method of fuzzy cognitive maps (FCMs) for characterizing ... Keywords: Cotton, Decision making, Expert knowledge, Fuzzy cognitive maps, Learning algorithm, Modeling, Soil, Unsupervised learning, Yield

Elpiniki I. Papageorgiou; Athanasios Markinos; Theofanis Gemptos



Canadian Fuel Cell Commercialization Roadmap Update: Progress of Canada's  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » Canadian Fuel Cell Commercialization Roadmap Update: Progress of Canada's Hydrogen and Fuel Cell Industry Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Canadian Fuel Cell Commercialization Roadmap Update: Progress of Canada's Hydrogen and Fuel Cell Industry Focus Area: Hydrogen Topics: Potentials & Scenarios Website: www.chfca.ca/files/IC_FC_PDF_final.pdf Equivalent URI: cleanenergysolutions.org/content/canadian-fuel-cell-commercialization- Language: English Policies: Deployment Programs DeploymentPrograms: Technical Assistance This roadmap update provides an overview of global hydrogen and fuel cell markets as context for the activities of the Canadian industry. It presents


Canadian Environmental Protection Act 2012 (Canada) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Canadian Environmental Protection Act 2012 (Canada) Canadian Environmental Protection Act 2012 (Canada) Canadian Environmental Protection Act 2012 (Canada) < Back Eligibility Agricultural Commercial Construction Developer Fed. Government Fuel Distributor General Public/Consumer Industrial Installer/Contractor Institutional Investor-Owned Utility Local Government Low-Income Residential Multi-Family Residential Municipal/Public Utility Nonprofit Residential Retail Supplier Rural Electric Cooperative Schools State/Provincial Govt Systems Integrator Transportation Tribal Government Utility Savings Category Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making Electricity Water Home Weatherization Solar Wind Program Info Program Type Environmental Regulations Provider Environment Canada The Canadian Environmental Protection Act of 1999 (CEPA 1999) provides the


Canadian Expert Panel on Tobacco Smoke and Breast Cancer Risk  

E-Print Network (OSTI)

Family Institute for Breast Cancer Research Ontario CancerInternational Agency for Research on Cancer, 2000. CancerThe Canadian Cancer Registries Epidemiology Research Group,



The use of indicators in Canadian corporate sustainability reports.  

E-Print Network (OSTI)

??The purpose of this thesis is to explore the use of sustainability indicators in Canadian corporate sustainability reports. The literature review highlights that few details (more)

Roca, Laurence Clement



Canadian Oil and Natural Gas Market Forces at Work Slow Down is ...  

U.S. Energy Information Administration (EIA)

Canadian Oil Sands Outlook EIA 2007 Annual Energy Outlook March 2007 Canadian Association of Petroleum Producers 150 producer member companies Explore for, develop ...


Remote sensing for detection of cotton aphid- (Homoptera : Aphididae) and spider mite- (Acari : Tetranychidae) infested cotton in the San Joaquin Valley  

E-Print Network (OSTI)

using multispectral remote sensing. Proc. Beltwide Cottonusing multispectral remote sensing. Proc. Beltwide CottonRichards, J.A. 1993. Remote sensing digital image analysis.

Reisig, D; Godfrey, L



XAFS at the Canadian Light Source  

Science Conference Proceedings (OSTI)

Canadian Light Source Hard X-ray Micro-Analysis Beamline (HXMA, 06ID-1) is a hard X-ray spectroscopy beamline currently under commissioning. The source of the beamline is a superconducting wiggler covering 5 to 40 keV. The primary optics include a cryogenically cooled double crystal monochromator (Si 111 and 220), white beam vertical collimating and toroidal focusing mirrors. End station experimental capabilities include XAFS (Ge solid state detectors), microprobe (Kirkpatrick-Baez murors, Ge solid state detector and image plate area detector), and diffraction (Huber psi-8 and powder diffraction setups, with diamond anvil cell high pressure sample environment). Commissioning status for the XAFS capabilities is described.

Jiang, D. T. [Canadian Light Source, University of Saskatchewan, Saskatoon, SK S7N 0X4 (Canada); Department of Physics, University of Guelph, Guelph, ON N1G 2W1 (Canada); Chen, N. [Canadian Light Source, University of Saskatchewan, Saskatoon, SK S7N 0X4 (Canada); Department of Geological Sciences, University of Saskatchewan, Saskatoon, SK (Canada); Zhang, L.; Malgorzata, K. [Department of Geological Sciences, University of Saskatchewan, Saskatoon, SK (Canada); Wright, G.; Igarashi, R.; Beauregard, D.; Kirkham, M.; McKibben, M. [Canadian Light Source, University of Saskatchewan, Saskatoon, SK S7N 0X4 (Canada)




SciTech Connect

Rags containing RadPro{reg_sign} solution will be generated during the decontamination of the Plutonium Finishing Plant (PFP). Under normal conditions, the rags will be neutralized with sodium carbonate prior to placing in the drums. The concern with RadPro solutions and cotton rags is that some of the RadPro solutions contain nitric acid. Under the right conditions, nitric acid and cotton rags exothermically react. The concern is, will RadPro solutions react with cotton rags exothermically? The potential for a runaway reaction for any of the RadPro solutions used was studied in Section 5.2 of PNNL-15410, Thermal Stability Studies of Candidate Decontamination Agents for Hanford's Plutonium Finishing Plant Plutonium-Contaminated Gloveboxes. This report shows the thermal behavior of cotton rags having been saturated in one of the various neutralized and non-neutralized RadPro solutions. The thermal analysis was performed using thermogravimetric Analysis (TGA), Differential Thermal Analysis (DTA) and Accelerating Rate Calorimetry (ARC).




Stresses resulting from compression of bulk cotton lint fibers  

E-Print Network (OSTI)

The modulus of elasticity, Poisson's ratio and shear modulus of bulk cotton lint fibers were determined. The cotton lint was compressed in an MTS machine to a predetermined density, and the resilient forces induced by the cotton lint after being compressed were measured. Finite element analysis was used to model force on cotton bale ties, and determine the magnitude of the resilient forces on the bale ties. The nodal forces on the bale tie material were evaluated for three different bale tie materials to determine if bale tie breakage would occur. Young's modulus of bulk lint cotton was found to be 9 MPa and the Poisson's ratio was 0. 1, while 12 MPa was recorded for the shear modulus. The FEA analysis showed that round steel ties, at six ties per bale were loaded at 5.9 % of their tensile yield strength, and at 5.4 % for eight ties per bale. Plastic ties were loaded at 11.9 % of their tensile yield strength at six ties per bale, and at 10.8 % at eight ties per bale. The flat steel ties were loaded at 10.7 % of their tensile yield strength at six ties per bale, and at 9.4 % at eight ties per bale. Depth adjustment on the basis of the sample depth to the actual depth resulted in plastic ties being loaded to 84 % of their tensile yield strength at six ties per bale. Round steel ties were loaded to 62% and the flat steel ties were loaded to 66% at six ties per bale.

Chimbombi, Ezekiel Maswe



The role of grain sorghum in conservation of predatory arthropods of Texas cotton  

E-Print Network (OSTI)

Four separate but complimentary studies investigated the role of grain sorghum as a predator source for Southern Rolling Plains cotton in 2001 and 2002. Objectives were to: (1) determine the timing and magnitude of predator movement between crops, (2) test putative causes of movement by manipulating prey levels at different stages of crop phenology, (3) explore the feeding and reproductive behavior of a common predator colonizing cotton, and (4) examine the effects of grain sorghum and uncultivated areas on cotton predator abundance at an area-wide scale. Rubidium mark-recapture experiments indicated grain sorghum fields produced a net predator gain for adjacent cotton. Analysis suggested two coccinellids, Hippodamia convergens Gurin-Mneville and Scymnus loewii Mulsant, were responsible for the overall pattern of predator movement. Predator movement into cotton did not appear to be concentrated at specific stages of sorghum phenology. Manipulations of aphid levels in field cages were used to determine if prey abundance or phenology influenced the movement of H. convergens into cotton. In both years, more lady beetle adults were collected on cotton during the latest stages of sorghum phenology. In the second year, relatively low aphid densities (15 per plant) appeared to influence the movement of beetles onto caged cotton. Carbon isotope ratios of H. convergens were used to assess adult feeding behavior after colonizing cotton and to determine if prey consumed in sorghum contributed to egg production in cotton. Though aphids were absent 2001, H. convergens adults stayed in cotton, did not produce eggs and apparently consumed few prey. Cotton aphids were present in 2002 and H. convergens isotope ratios changed from prey consumed in cotton. The isotope ratios of egg masses collected in 2002 indicated prey consumed in grain sorghum contributed very little to egg production in cotton. An area-wide pattern analysis suggested the abundance of grain sorghum and uncultivated areas both positively influenced cotton predator levels. While these landscape effects were less important overall than prey levels and cotton planting dates, in some sampling periods landscape composition appeared to be the most important factor in determining cotton predator levels.

Prasifka, Jarrad Reed



Canadian Solar Inc CSI | Open Energy Information  

Open Energy Info (EERE)

CSI CSI Jump to: navigation, search Name Canadian Solar Inc (CSI) Place Kitchener, Ontario, Canada Zip N2K 3S2 Sector Solar Product Canada-incorporated, China-based manufacturer of solar cells and modules; also has some silicon recycling activities and makes UMG Si-based modules. Coordinates 43.45123°, -80.493049° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.45123,"lon":-80.493049,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


The Canadian Regional Data Assimilation and Forecasting System  

Science Conference Proceedings (OSTI)

This paper describes the recent changes to the regional data assimilation and forecasting system at the Canadian Meteorological Center. A major aspect is the replacement of the currently operational global variable resolution forecasting approach ...

Luc Fillion; Monique Tanguay; Ervig Lapalme; Bertrand Denis; Michel Desgagne; Vivian Lee; Nils Ek; Zhuo Liu; Manon Lajoie; Jean-Franois Caron; Christian Pag



A Quality Assurance System for Canadian Hourly Pressure Data  

Science Conference Proceedings (OSTI)

In this study a comprehensive quality assurance (QA) system, which includes the hydrostatic check combined with a statistical homogeneity test, is designed and applied to hourly pressure records (for 19532002) from 761 Canadian stations, to ...

Hui Wan; Xiaolan L. Wang; Val R. Swail



Early Canadian Weather Observers and the Year Without a Summer  

Science Conference Proceedings (OSTI)

The unusual spring and summer weather of the year 1816 in central Canada is discussed using Canadian newspaper accounts together with manuscript records from early amateur weather observers. Many of the spectacular meteorological events of this ...

Kevin Hamilton



The Canadian Regional Data Assimilation System: Operational and Research Applications  

Science Conference Proceedings (OSTI)

The Canadian regional data assimilation system is described. It is a spinup cycle designed to provide the regional finite-element forecast model with more detailed analyses in a dynamically consistent manner. Its operational performance is ...

Clment Chouinard; Jocelyn Mailhot; Herschel L. Mitchell; Andrew Staniforth; Richard Hogue



Canadian gas exports to U. S. set fourth consecutive record  

Science Conference Proceedings (OSTI)

Canadian natural gas exports in 1991 set a record for the fourth year in a row, Canadian Enerdata Ltd. reports. The Markham, Ont., consulting firm the shipments of gas to the U.S., Canada's only export customer for that fuel, jumped 16.8% in 1991 to 1.679 tcf. That volume replaced the previous record of 1.437 tcf exported just 1 year earlier. Enerdata figures show the 1991 export performance increased Canada's share of the U.S. gas market to a record high of 8.7%, up from 7.7% in 1990, 7.1% in 1989, 7.0% in 1988, 5.9% in 1987, and, only 4.6% in 1986. This paper reports that the performance positions Canadian exporters well for larger increases in volume and price as the U.S. gas market tightens and Canadian gas export capacity is increased in the mid-1990s.

Not Available



The Canadian Global Data Assimilation System: Description and Evaluation  

Science Conference Proceedings (OSTI)

A global data assimilation system has been in operation at the Canadian Meteorological Centre (CMC) since March 1991 when it replaced the previous hemispheric system. This paper describes the system and presents an evaluation of its performance ...

Herschel L. Mitchell; Ccilien Charette; Steven J. Lambert; Jacques Hall; Clment Chouinard



Canadian Atlantic Storms Program: The Meteorological Field Project  

Science Conference Proceedings (OSTI)

The field phase of the Canadian Atlantic Storms Program (CASP) was conducted from 15 January to 15 March 1986. The principal objective of the meteorological component of the program was to begin the process of improving the understanding and ...

R. E. Stewart; G. A. Isaac; R. W. Shaw



DOE's Carbon Sequestration Partnership Program Adds Canadian Provinces |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Carbon Sequestration Partnership Program Adds Canadian Carbon Sequestration Partnership Program Adds Canadian Provinces DOE's Carbon Sequestration Partnership Program Adds Canadian Provinces February 16, 2005 - 10:14am Addthis Will Develop, Deploy, and Validate Carbon Sequestration Options WASHINGTON, DC -- The Department of Energy (DOE) today announced that the Provinces of Alberta and British Columbia have joined Saskatchewan and Manitoba as Canadian partners in the Regional Carbon Sequestration Partnership program, the centerpiece of North American efforts to validate and deploy carbon sequestration technologies. The program, a network of federal and state agencies, as well as private sector entities, will determine the most suitable technologies, regulations, and infrastructure for future carbon capture, storage, and sequestration in different areas of

Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Canadian Wind Energy Atlas Potential Website | Open Energy Information  

Open Energy Info (EERE)

Canadian Wind Energy Atlas Potential Website Canadian Wind Energy Atlas Potential Website Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Canadian Wind Energy Atlas Potential Website Focus Area: Renewable Energy Topics: Opportunity Assessment & Screening Website: www.windatlas.ca/en/index.php Equivalent URI: cleanenergysolutions.org/content/canadian-wind-energy-atlas-potential- Language: English Policies: Deployment Programs DeploymentPrograms: Technical Assistance Environment Canada's Wind Energy Atlas website aims at developing new meteorological tools to be used by Canada's wind energy industry. It offers the possibility to browse through the results of the numerical simulations that were run on all of Canada in order to determine its wind energy potential. Consultants and the general public will find valuable data about


DOE's Carbon Sequestration Partnership Program Adds Canadian Provinces |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE's Carbon Sequestration Partnership Program Adds Canadian DOE's Carbon Sequestration Partnership Program Adds Canadian Provinces DOE's Carbon Sequestration Partnership Program Adds Canadian Provinces February 16, 2005 - 10:14am Addthis Will Develop, Deploy, and Validate Carbon Sequestration Options WASHINGTON, DC -- The Department of Energy (DOE) today announced that the Provinces of Alberta and British Columbia have joined Saskatchewan and Manitoba as Canadian partners in the Regional Carbon Sequestration Partnership program, the centerpiece of North American efforts to validate and deploy carbon sequestration technologies. The program, a network of federal and state agencies, as well as private sector entities, will determine the most suitable technologies, regulations, and infrastructure for future carbon capture, storage, and sequestration in different areas of


Canadian Council of Chief Executives | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Canadian Council of Chief Executives Canadian Council of Chief Executives Canadian Council of Chief Executives September 12, 2005 - 10:18am Addthis Remarks Prepared for Energy Secretary Samuel Bodman I am pleased to participate in today's forum with such an impressive group of representatives from the Canadian business sector. My earlier career in business, and my service in two other Cabinet Agencies, have given me a special appreciation for the unique, historic relationship that has always existed between our two nations, which is the subject I wish to speak about today. Canada and the U.S. are neighbors, of course. But our relationship, our partnership, goes much deeper than that. As President Bush said during his trip to Canada in December, the U.S. and Canada have "always agreed on the great principles of liberty derived from


Flame retardant finishing for cotton using a hydroxy-functional organophosphorus oligomer.  

E-Print Network (OSTI)

??New durable flame retardant finishing systems based on a hydroxy-functional organophosphorus oligomer (HFPO) and a bonding agent have been developed for cotton. In this research, (more)

Wu, Weidong



A Comparison of Chemical Pretreatment Methods for Converting Cotton Stalks to Ethanol.  

E-Print Network (OSTI)

??The objective of this study was to investigate the effectiveness of sulfuric acid, sodium hydroxide, hydrogen peroxide, and ozone pretreatments for conversion of cotton stalks (more)

Silverstein, Rebecca Anne



Hierarchical Diagnosis W. R. Cotton Colorado State University  

NLE Websites -- All DOE Office Websites (Extended Search)

W. R. Cotton W. R. Cotton Colorado State University Department of Atmospheric Science Fort Collins, CO 80523 coarse grid of 80 km down to the finest 2.22 km grid, thus explicitly capturing the system as it transitioned from a convective line only to a system with convective and stratiform regions. This simulation serves us in two ways. First, it acts as further verification for the Level 2.5w convective scheme (the "convective engine" for the MCS parameterization). Second, diagnostic analyses guide us in the parameterization of the mesoscale circulations which comprise the fast (and perhaps some slow) manifold processes of an MCS. The diagnostics include conditional sampling of various quantities as well as some Lagrangian tracer analysis to help identify coherent flow branches


Cotton County, Oklahoma: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Cotton County, Oklahoma: Energy Resources Cotton County, Oklahoma: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 34.309094°, -98.3964938° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":34.309094,"lon":-98.3964938,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Canadian natural gas: Review of 1998 and outlook to 2005  

Science Conference Proceedings (OSTI)

The report provides summaries of North American natural gas industry trends, including demand, supply, storage, gas flows, transportation capacities, and Canadian gas export volumes, prices, and revenues. Information is provided on regional and sectoral demand, regional production, reserves, prices, status of pipeline projects, and important developments in Canadian regulatory issues over the past year. Forecasts for the near term (to 2000) and medium term (to 2005) are included.

Not Available



Progress report for the commercialization of a one pass cotton plowdown. Technical progress report, April--June 1996  

SciTech Connect

Progress is described on the design, performance, and commercialization of a one pass cotton plowdown machine. Photos are included.





E-Print Network (OSTI)

The Long Lake integrated bitumen and upgrading project, now under construction by OPTI Canada Inc. and Nexen Inc., is the first application of large-scale gasification in Canada. It also represents the first implementation of a gasification project in conjunction with a heavy oil recovery and upgrading project. The Canadian oil sands are a vast petroleum resource that currently produces over one million barrels per day (bpd) using proven mining and in-situ recovery technologies. Production is projected to rise to over two million bpd by the end of the decade. However the large volumes of natural gas normally needed by the bitumen recovery and upgrading facilities are a significant barrier to economic development of the resource. The Long Lake Project uses a unique combination of technologies to provide a solution to the natural gas supply and cost issue. A key component is a gasification facility using the Shell Gasification Process (SGP) which is integrated with the bitumen upgrading to convert the liquid asphaltene by-product stream into hydrogen for the secondary upgrading step and syngas fuel. An Air Liquide air separation unit (ASU) will provide

unknown authors



A Meteorological Analysis of Important Contributors to the 19992005 Canadian Prairie Drought  

Science Conference Proceedings (OSTI)

Drought is a complex natural hazard that is endemic to the Canadian prairies. The 19992005 Canadian prairie drought, which had great socioeconomic impacts, was meteorologically unique in that it did not conform to the traditional persistent ...

Lisa M. Hryciw; Eyad H. Atallah; Shawn M. Milrad; John R. Gyakum



The Canadian Seasonal to Interannual Prediction System. Part I: Models and Initialization  

Science Conference Proceedings (OSTI)

The Canadian Seasonal to Interannual Prediction System (CanSIPS) became operational at Environment Canada's Canadian Meteorological Centre (CMC) in December 2011, replacing CMC's previous two-tier system. CanSIPS is a two-model forecasting system ...

William J. Merryfield; Woo-Sung Lee; George J. Boer; Viatcheslav V. Kharin; John F. Scinocca; Gregory M. Flato; R. S. Ajayamohan; John C. Fyfe; Youmin Tang; Saroja Polavarapu



Impact of Surface Parameter Uncertainties within the Canadian Regional Ensemble Prediction System  

Science Conference Proceedings (OSTI)

The aim of this study is to assess the impact of uncertainties in surface parameter and initial conditions on numerical prediction with the Canadian Regional Ensemble Prediction System (REPS). As part of this study, the Canadian version of the ...

Christophe Lavaysse; Marco Carrera; Stphane Blair; Normand Gagnon; Ronald Frenette; Martin Charron; M. K. Yau



Physiological applications for determining water use efficiency among cotton genotypes  

E-Print Network (OSTI)

Drought stress can substantially alter plant metabolism by decreasing plant growth and photosynthesis. The lack of rapid and reliable screening criteria and measurement techniques for determining water use efficiency (WUE) of crop plants has greatly restricted progress in this critical area of crop improvement. In grain sorghum (Sorghum bicolor L.), WUE was associated with the transpiration ratio [CO2 assimilation (A) / transpiration rate (E), A:E] from leaf gas exchange measurements. Research is needed to identify drought effects on plant productivity and to exploit the use of this knowledge in breeding and agronomic efforts. Therefore, the objectives of this study were to determine if differences in A:E and other physiological parameters existed between two selected cotton (Gossypium hirsutum L.) genotypes and to evaluate the response of cotton genotypes experiencing water stress at two different growth stages on biomass production and yield. Two experiments were conducted using two cotton genotypes differing in drought tolerance. Each experiment was repeated three times in a randomized complete block design with six replications. In Experiment I, the water stress treatment was induced by withholding water when the plants reached the 4-node growth stage. The water stress treatment in Experiment II was imposed at early bloom. Gas exchange and chlorophyll fluorescence measurements were collected during dry-down and recovery periods to determine water stress effects on plant physiology. Biomass was partitioned following the recovery period, to examine phenotypic responses of plants exposed to water stress. The results of these experiments indicate that A:E is significantly increased as leaf water potential (?L) decreases with no differences in A:E between the two genotypes. Gas exchange measurements showed significant decreases with declining ?L and significant increases upon re-watering; yet, no differences were observed between the two genotypes. Chlorophyll fluorescence was not different between genotypes in either light- or dark-adapted leaves. In Experiment I TAM 89E-51 had a significantly greater seedcotton yield; however, in Experiment II TAMCOT 22 had the greater yield. These experiments suggest that the effects of water stress on cotton are a function of the intensity of the stress and the growth stage in which the stress is experienced.

Bynum, Joshua Brian



Canadian natural gas: Review of 1997 and outlook to 2005  

Science Conference Proceedings (OSTI)

This review provides summaries of North American gas industry trends, including supply, demand, storage, gas flows, prices, transportation capacities, and Canadian gas export volumes, export prices, and revenues. Forecasts of North American demand, supply, gas flows, pipeline capacity, prices, and sales are provided to 2005. The focus of the review is on regional natural gas markets, with detail on the drivers of gas consumption by sector for each region in Canada and the United States. A regulatory analysis section updates developments in Canadian and US pipeline regulation, electric power deregulation and its effect on gas as a power source, and gas distribution.

Not Available




E-Print Network (OSTI)

Over a fourth of the cotton produced in the US since 2002 has been produced in Texas, with most coming from the High Plains. In recent years, Texas has accounted for almost half of all US cotton production (USDA-NASS, 2008b). Most cotton on the High Plains is of more storm-proof varieties that have traditionally been harvested using stripper harvesters. However, improvements in irrigation technology and shifting markets for US cotton have increased interest in picker harvesters in the region. A holistic comparison of picker and stripper harvesters in irrigated cotton on the High Plains of Texas was conducted focusing on differences in system efficiencies, the costs of ginning, fiber and yarn quality, and potential economic returns under comparable crop yields and conditions. Harvester performance was evaluated based on harvest efficiency, time-inmotion, and fuel consumption. Stripper harvesters left less cotton in the field, but most of the cotton left by the picker was of low quality. While the time spent in each operation of harvest was highly dependent on the operator and support equipment available, in general, picker harvesters were able to harvest a unit area of high-yielding cotton more quickly than stripper harvesters. The cost of ginning picked and stripped cotton was evaluated considering current fee schedules from gins on the High Plains. On average, it cost a producer $4.76 more per bale to gin stripped-and-field-cleaned cotton than picked cotton. Fiber quality parameters were compared between harvest treatments based on results from High Volume Instrument (HVI) and Advanced Fiber Information System (AFIS) tests. Samples were ring-spun into carded and carded-and-combed yarns. Differences in fiber quality between harvest treatments were more pronounced when growing conditions were less favorable. Few differences were detected in carded yarn quality between harvest treatments, while more pronounced differences favoring picked cotton were seen in carded-and-combed yarns. A cost-benefit analysis was conducted to determine the production scenarios in which picker and stripper harvesters were most appropriate. Results indicate that, if a producer has sufficient yields coupled with sufficient area to harvest per machine, picker harvesting is a more profitable alternative to producers of on the High Plains.

Faulkner, William B.



Oldham County, Kentucky: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

5.4788065° 5.4788065° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.3560025,"lon":-85.4788065,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Oldham County, Texas: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

6°, -102.6216211° 6°, -102.6216211° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.4247226,"lon":-102.6216211,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Cirriform Rotor Cloud Observed on a Canadian Arctic Ice Cap  

Science Conference Proceedings (OSTI)

A thin rotor cloud was observed on the lee side of Penny Ice Cap in the Canadian Arctic on 21 April 1996. The cloud consisted of thin cirriform layers, so that its motion was clearly observed. By means of time-lapse camera photography, the ...

Hisashi Ozawa; Kumiko Goto-Azuma; Koyuru Iwanami; Roy M. Koerner



Policy Analysis of the Canadian Oil Sands Experience  

SciTech Connect

For those who support U.S. oil sands development, the Canadian oil sands industry is often identified as a model the U.S. might emulate, yielding financial and energy security benefits. For opponents of domestic oil sands development, the Canadian oil sands experience illustrates the risks that opponents of development believe should deter domestic policymakers from incenting U.S. oil sands development. This report does not seek to evaluate the particular underpinnings of either side of this policy argument, but rather attempts to delve into the question of whether the Canadian experience has relevance as a foundational model for U.S. oil sands development. More specifically, this report seeks to assess whether and how the Canadian oil sands experience might be predictive or instructive in the context of fashioning a framework for a U.S. oil sands industry. In evaluating the implications of these underpinnings for a prospective U.S. oil sands industry, this report concentrates on prospective development of the oil sands deposits found in Utah.

None, None


Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Nuclear worries of Canadian youth: Replication and extension  

SciTech Connect

A national survey of Canadian adolescents assessed concern, anxiety, and sources of information about the threat of nuclear war. Results indicated few geographical or gender differences in overall levels of concern, although females were more likely to admit fear and anxiety, and students with activist parents showed more concern. Family ranked below all media as a source of information.

Lewis, C.; Goldberg, S.; Parker, K.R. (Univ. of Alberta, Edmonton (Canada))



Canadian incentives for oil and gas exploration. [Applicability to USA  

Science Conference Proceedings (OSTI)

During the 1970s a number of different exploration and production incentive programs were put in place in Canada, in particular in the Province of Alberta, Canada's principal oil- and gas-producing province. The DOE/RA is evaluating Canadian incentives for oil and gas exploration, and this study is intended to provide information that will help guide DOE/RA in determining the applicability of Canadian incentive programs in US energy policy. The study describes and documents the fiscal structure in which the Canadian oil industry operates. The incentive features of pricing policy, taxation policy, and provincial royalty systems are discussed. A principal focus of the study is on one of the most important of Canada's specific incentive programs, the Alberta Exploratory Drilling Incentive Credit Program (EDICP). The study describes and evaluates the effect of the EDICP on increased oil and gas exploration activity. Similarly, the study also reviews and evaluates other specific incentive programs such as the Alberta Geophysical Incentive Program, Frontier Exploration Allowances, and various tar sand and heavy oil development incentives. Finally the study evaluates the applicability of Canadian incentives to US energy policy.

Not Available



Northern Exposure: An Overview of Canadian Clean Energy Funds  

E-Print Network (OSTI)

in the promotion of renewable energy. Much like their U.S. counterparts, Canadian clean energy funds play Clean Energy Fund Activities 3 interesting differences from U.S. models, including a division extent) provincial government tax revenue, while U.S. clean energy funds typically operate at the state


Field Comparison of the Sampling Efficacy of Two Smear Media: Cotton Fiber and Kraft Paper  

DOE Green Energy (OSTI)

Two materials were compared in field tests at the Defense Waste Processing Facility: kraft paper (a strong, brown paper made from wood pulp prepared with a sodium sulfate solution) and cotton fiber. Based on a sampling of forty-six pairs of smears, the cotton fiber smears provide a greater sensitivity. The cotton fiber smears collected an average of forty-four percent more beta activity than the kraft paper smears and twenty-nine percent more alpha activity. Results show a greater sensitivity with cotton fiber over kraft paper at the 95 percent confidence level. Regulatory requirements for smear materials are vague. The data demonstrate that the difference in sensitivity of smear materials could lead to a large difference in reported results that are subsequently used for meeting shipping regulations or evaluating workplace contamination levels.

Hogue, M.G.



Carbon Dioxide Enrichment: Data on the Response of Cotton to Varying CO2  

NLE Websites -- All DOE Office Websites (Extended Search)

Carbon Dioxide Enrichment: Data on the Response of Cotton to Varying CO2 Carbon Dioxide Enrichment: Data on the Response of Cotton to Varying CO2 Irrigation, and Nitrogen (1992) (NDP-037) DOI: 10.3334/CDIAC/vrc.ndp037 image Data image PDF file Investigators B. A. Kimball, J. R. Mauney, R. L. La Morte, G. Guinn, F. S. Nakayama, J. W. Radin, E. A. Lakatos, S. T. Michell, L. L. Parker, G. J. Peresta, P. E. Nixon III, B. Savoy, S. M. Harris, R. MacDonald, H. Pros, and J. Martinez This NDP presents data on the effects of continuous CO2 enrichment of cotton during five consecutive growing seasons, 1983 to 1987, under both optimal and limiting levels of water and nitrogen. Unlike many prior CO2-enrichment experiments in growth chambers or greenhouses, these studies were conducted on field-planted cotton at close to natural conditions with


Viscoelastic properties of seed cotton and their effect on module shape and density  

E-Print Network (OSTI)

Modules for cotton storage and transport should be constructed with a shape that will resist collecting water to maintain the quality of seed cotton during storage. Meeting this specification requires knowledge of the relationship between the applied compressive force, deformation, and time for seed cotton. Several factors were tested to determine their effects on the height and density of seed cotton during compression, creep loading, and recovery. Models were used to describe these processes. These results were used to develop an algorithm capable of providing information on module shape to the module builder operator. The initial loading density did not affect the compressed density, but a slight effect was observed in the recovered density, due to the weight of the seed cotton. Picker harvested cotton was compressed to a greater density than stripper harvested cotton, but expanded more during recovery, resulting in similar final densities. Multiple compressions increased the density, but this increase was not physically significant after the third compression. Higher moisture content increased the density seed cotton could be compressed to slightly. Viscoelastic behavior was observed; however, the effect on density was small. Both the compression and creep curves were described using mathematical models. A compression model using an asymptotic true strain measure yielded high R2 values; however, some aspect of this process remained unexplained and the equation was limited in its predictive ability. Creep behavior was described using a modified Burgers model. This model was more accurate than the creep model, although a definite trend existed in the creep model residuals. A feedback algorithm was developed based on the observation that the compressed density was primarily dependent on the mass of seed cotton and not the initial density. By measuring the compressed depth of cotton in a module and the hydraulic pressure of the tramper foot cylinder, the resulting shape of the module can be predicted. Improved loading of the module builder is necessary to produce a desirably shaped module. More seed cotton needs to be placed in the center of the module, resulting in a surface that slopes down towards the outer edges.

Hardin, Robert Glen



Canadian natural gas: Review of 1996 and outlook to 2002  

Science Conference Proceedings (OSTI)

This review provides summaries of North American gas industry trends, including supply, demand, storage, gas flows, prices, transportation capacities, and Canadian gas export volumes, export prices, and revenues. Forecasts of North American demand, supply, gas flows, pipeline capacity, prices, and sales are provided to 2002. The appendix reviews regional natural gas markets, with detail on the drivers of gas consumption by sector for each region in Canada and the United States.

Not Available



Interactive Effects of Geography and Host Plant Species on Genetic and Phenotypic Variation of Cotton Fleahopper Populations  

E-Print Network (OSTI)

The cotton fleahopper, Pseudatomoscelis seriatus (Reuter) is a widely distributed insect across the United States. Although, it feeds on several native wild hosts, its agricultural importance lies as an economic pest of cotton in several states in the southern United States. No studies have addressed intraspecific genetic and phenotypic variation of this insect pest at a large geographic scale. I examined genetic variation among cotton fleahopper populations associated with cotton in different geographic locations across the southern United States (Chapter II). Using dominant, neutral, nuclear molecular markers (AFLP, amplified fragment length polymorphism) and mitochondrial DNA sequences, I found that overall genetic differentiation among different geographic populations, collected from cotton in eleven cotton growing states, was low but significant. AFLP revealed the presence of three regional groups representing western (Arizona), central (Texas, Oklahoma, Arkansas, Louisiana, Mississippi and Alabama), and eastern (Florida, Georgia, South Carolina and North Carolina) populations. I examined if there were distinct lineages of cotton fleahoppers associated with three of its host plant species: cotton (Gossypium hirsutum), horsemint (Monarda punctata) and woolly croton (Croton capitatus) in five different locations of Texas by using AFLP markers (Chapter III). I found two distinct host-associated lineages at three locations and local panmixia in the other two locations. I tested if host preference of cotton fleahoppers were affected by geographic variation and prior experience. Conducting choice tests with a Y-tube olfactometer, I found that host preference in cotton fleahoppers for horsemint (one of its native host plants) is conserved and unaffected by individual?s prior experience with cotton (Chapter IV). Finally, I explored the role of host-plant species in morphological differentiation of the cotton fleahopper in two locations that differ in presence of distinct host-associated lineages. Using a geometric-morphometric approach, I detected significant effect of host plant and geography on body morphology and wing shape of cotton fleahopper populations (Chapter V). Length of antenna and rostrum were two important traits associated with morphological divergence of cotton and horsemint associated insect populations. Cotton associated individuals had relatively longer antenna and rostrum compared to individuals associated with horsemint.

Barman, Apurba



Flexible modeling and simulating mission availability within the operational framework for Canadian Naval platforms.  

E-Print Network (OSTI)

??Availability and reliability metrics have become key in-service performance measures in Canadian defence contracting. Previous implementations have evolved due to challenges in application, and were (more)

Koshman, Scott, 1977-



A Struggle Against the Odds: Understanding the Lived Experiences of Canadian Hockey League (CHL) Players.  

E-Print Network (OSTI)

??The purpose of this research was to examine the experiences of Canadian Hockey League (CHL) players using a Foucauldian theory-based analysis. Specifically, this thesis contends (more)

Grygar, Victoria



A science based emission factor for particulate matter emitted from cotton harvesting  

E-Print Network (OSTI)

Poor regional air quality in some states across the US cotton belt has resulted in increased pressure on agricultural sources of particulate matter (PM) from air pollution regulators. Moreover, inaccurate emission factors used in the calculation of annual emissions inventories led to the identification of cotton harvesting as a significant source of PM10 in California and Arizona. As a result, cotton growers in these states are now required to obtain air quality permits and submit management practice plans detailing the actions taken by the producer to reduce fugitive PM emissions from field operations. The objective of this work was to develop accurate PM emission factors for cotton harvesting in terms of total suspended particulate (TSP), PM10, and PM2.5. Two protocols were developed and used to develop PM emission factors from cotton harvesting operations on three farms in Texas during 2006 and 2007. Protocol one utilized TSP concentrations measured downwind of harvesting operations with meteorological data measured onsite in a dispersion model to back-calculate TSP emission flux values. Flux values, determined with the regulatory dispersion models ISCST3 and AERMOD, were converted to emission factors and corrected with results from particle size distribution (PSD) analyses to report emission factors in terms of PM10 and PM2.5. Emission factors were developed for two-row (John Deere 9910) and sixrow (John Deere 9996) cotton pickers with protocol one. The uncertainty associated with the emission factors developed through protocol one resulted in no significant difference between the emission factors for the two machines. Under the second protocol, emission concentrations were measured onboard the six-row cotton picker as the machine harvested cotton. PM10 and PM2.5 emission factors were developed from TSP emission concentration measurements converted to emission rates using the results of PSD analysis. The total TSP, PM10, and PM2.5 emission factors resulting from the source measurement protocol are 1.64 0.37, 0.55 0.12, and 1.58E- 03 4.5E-04 kg/ha, respectively. These emission factors contain the lowest uncertainty and highest level of precision of any cotton harvesting PM emission factors ever developed. Thus, the emission factors developed through the source sampling protocol are recommended for regulatory use.

Wanjura, John David



The Canadian Plug-in Electric Vehicle Survey (CPEVS 2013): Anticipating Purchase, Use, and Grid Interactions  

E-Print Network (OSTI)

Interactions in British Columbia Report Submitted to: BC Hydro BC Ministry of Energy and Mines PRELIMINARY Initiative (ecoEII) BC Hydro The Pacific Institute of Climate Solutions (PICS) The BC Ministry of Energy a sample of Canadian new car buyers in a mixed-mode survey process. Data were collected via the Canadian


An Investigation of Summer Precipitation Simulated by the Canadian Regional Climate Model  

Science Conference Proceedings (OSTI)

In the present paper, a 5-yr baseline integration for the period 198791 was carried out over a Pan-Canadian domain to validate the performance of the third-generation Canadian Regional Climate Model (CRCM). The CRCM simulated the large-scale ...

Yanjun Jiao; Daniel Caya



An economical and market analysis of Canadian wood pellets.  

Science Conference Proceedings (OSTI)

This study systematically examined the current and future wood pellet market, estimated the cost of Canadian torrefied pellets, and compared the torrefied pellets with the conventional pellets based on literature and industrial data. The results showed that the wood pellet industry has been gaining significant momentum due to the European bioenergy incentives and the rising oil and natural gas prices. With the new bioenergy incentives in USA, the future pellets market may shift to North America, and Canada can potentially become the largest pellet production centre, supported by the abundant wood residues and mountain pine beetle (MPB) infested trees.

Peng, J. [University of British Columbia, Vancouver



Host plant resistance to Whiteflies, Bemisia tabaci (Gennadius), Biotype B, (Homoptera: Aleyrodidae) in cotton race stocks for breeding improved cotton cultivars  

E-Print Network (OSTI)

Whiteflies (Bemisia tabaci, Biotype B, Homoptera: Aleyrodidae) are pests of cotton crops, affecting the yield of the crop both indirectly and directly. These pests feed on the leaves of cotton plants and produce "honeydew," a sticky liquid excretion which covers the lint of the open cotton boll creating problems during the processing of the lint. High densities of these pests also can decrease the productivity of the cotton plant by stripping it of vital nutrients. The primary objective of this research was to screen 116 converted cotton race stocks for resistance to sweetpotato whiteflies. Responses of converted race stocks to whiteflies are compared to that of known susceptible commercial cultivars PSC 355 and Delta Pearl. Screens for antibiosis resistance to whitefly were established using excised leaves placed in a nutrient solution ( strength Hoagland's). Cohort populations of whiteflies were established on these leaves and followed daily to determine differences in developmental time as well as percent survival. Resistant candidates were determined using a chi-squared test comparing the ranked sums of leaf averages for the two selection criteria, whitefly developmental time and percent whitefly survival, of each cotton race stock to that of the putative known susceptibles (KS). These tests showed 6 converted race stocks to be significantly different (P ? 0.1) from the KS for at least one of the two selection criteria. Of these converted race stocks, M-9044-0154 and M-9044-0156 showed to have lower whitefly survival than the KS, while M-9644-0188, M-9644-0195, M-0044-0221, and M-9644-0242 showed whitefly to have an increased developmental time. Retesting of these six converted race stocks along with several others identified another race stock line, M-0044-0171, which was significantly different from the KS. Retesting also indicated that M-9644-0188 was different for survival in addition to developmental time which was determined in the original screening. Additional tests were conducted in the greenhouse and field to examine these race stock lines. Greenhouse screenings indicated that M-9044-0156 and M-9644-0188 contained possible non-preference resistance characteristics. Field screenings conducted in Weslaco and College Station, TX in 2002 and 2003 failed to provide useful data due to low densities of insects.

Ripple, Brandon Wayne



Remote sensing for site-specific management of biotic and abiotic stress in cotton  

E-Print Network (OSTI)

This study evaluated the applicability of remote sensing instrumentation for site- specific management of abiotic and biotic stress on cotton grown under a center pivot. Three different irrigation regimes (100%, 75%, and 50% ETc) were imposed on a cotton field to 1) monitor canopy temperatures of cotton with infrared thermometers (IRTs) in order to pinpoint areas of biotic and abiotic stress, 2) compare aerial infrared photography to IRTs mounted on center pivots to correlate areas of biotic and abiotic stress, and 3) relate yield to canopy temperatures. Pivot-mounted IRTs and IR camera were able to differentiate water stress between the irrigation regimes, however, only the IR camera was effectively able to distinguish between biotic (cotton root rot) and abiotic (drought) stress with the assistance of groundtruthing. The 50% ETc regime had significantly higher canopy temperatures, which were reflected in significantly lower lint yields when compared to the 75% and 100% ETc regimes. Deficit irrigation up to 75% ETc had no impact on yield, indicating that water savings were possible without yield depletion.

Falkenberg, Nyland Ray



Cell synchrony and chromosomal protocols for somatic cells of cotton gossypium hirsutum  

SciTech Connect

The intent of this pamphlet is to share information with others who are interested in useful protocols for cotton cytogenetics and cytology. The protocols described are a beginning effort and they are expected to be improved. All methods, results and data given pertain to cultivar MD 51ne. We are not satisfied with our results of in situ hybridization.

Van`t Hof, J.; Lamm, S.S.



Evaluation of consumer demand for selected end-use markets for cotton  

E-Print Network (OSTI)

The U.S. cotton industry is facing a rapidly diminishing share of the domestic and foreign textile markets. To become more competitive in these markets, the textile industry should know where consumer demand is being directed. The objectives of this study were to quantitatively examine the demand for cotton in twelve selected end-uses from 1973 to 1997. Four structural models were developed to explain demand, two of which were built using the results from directed graphs. Changes in fashion and governmental policy were also assessed during this time period. Economic theory and prior literature suggested that the following factors influence demand at the end-use level: Disposable Personal Income, the Consumer Price Index for Apparel and Upkeep, cotton fiber prices lagged one year, polyester fiber prices lagged one year, and population segmented by age and gender. Regression results indicate that the Consumer Price Index, the lagged polyester prices, and the population variables most significantly contribute to the demand for cotton. A negative polyester coefficient was associated in all cases of significance, characterizing cotton and polyester fiber as complements in end-uses. Out-of-sample forecasts were generated for the years 1993 to 1997, and then evaluated using the Theil's U statistic, the Root Mean Square Error, and the Mean Absolute Percentage Error. The forecasts from the full models, those with all variables, outperformed the directed graph models in terms of predictive power. Differences in significant variables and variability in forecasting accuracy among the different end-uses suggests that there is an inherent difficulty in modeling the demand for a fiber in its end-use. A common saying in the fashion industry is that "the only constant is change." A constantly changing industry thus presents difficulty in quantifying, modeling, and forecasting.

Viator, Catherine Longman



Canadian Valley Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Valley Elec Coop, Inc Valley Elec Coop, Inc Jump to: navigation, search Name Canadian Valley Elec Coop, Inc Place Oklahoma Utility Id 2911 Utility Location Yes Ownership C NERC Location SPP Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Irrigation-Rate I Industrial Lage Power-2 ,Distribution Service Commercial Lage Power-2 ,Secondary Service Commercial Large Power -Rate LP,Distribution Serivce Commercial Large Power-2 Commercial Residential - Rate A, Single Phase Residential Residential - Rate A, Three Phase Residential Security Lighting 1000Watt MH Lighting


Molecular cloning and characterization of genomic sequence tags (GSTs) from the PHYA, PHYB, and HY5 gene families of cotton (Gossypium species)  

E-Print Network (OSTI)

The goals of this research project were to identify and characterize the cotton orthologs and paralogs of the Arabidopsis phytochrome genes and the cell elongation factor HY5. Based on close evolutionary relatedness between cotton and Arabidopsis, the similar genes to PHYA, PHYB and HY5 genes from Gossypium species have been identified. GSTs for two paralogous PHYA genes (PHYA1 and PHYA2) from diploid cottons have been cloned, sequenced and characterized. At least four PHYA genes: two PHYA1 and two PHYA2 genes (A&D-genome specific) have been determined in tetraploid cottons that were acquired from diploid ancestors. Cotton PHYA genes share 60-65% nucleotide identity with Arabidopsis PHYA gene. Approximately 80% nucleotide similarity between cotton PHYA1 and PHYA2 has been observed. Both cotton PHYA genes were actively expressed. The expression of A-genome PHYA1 and D-genome PHYA2 has been observed in G. hirsutum seedlings. A CAPS marker (BbvI) has been developed for PHYA1 gene, and a QTL locus that is closely linked (LOD = 4.13) to fiber length has been identified using the PHYA1 CAPS marker. In addition, GST for cotton PHYB gene has been cloned using the similar approach. Cloned cotton PHYB gene shows remarkable conservation within cotton species and shares 85% and 78% nucleotide sequence similarity with Arabidopsis PHYB and PHYD genes, respectively. GSTs for cotton HY5 gene have been cloned and characterized. Tetraploid cottons G. hirsutum and G. barbadense have two genes for HY5: HY5-A and HY5-B, which were acquired from wild diploid ancestors through polyploidization. The D-genome contributed HY5-A gene while the A-genome contributed HY5-B gene. Approximately 50-60% structural similarity between cotton and Arabidopsis HY5 loci has been observed. HY5-A gene was expressed in cotton seedlings while the expression of HY5-B was not observed. Using polymorphic sites in HY5-B genes, CAPS marker (RsaI) has been developed for HY5-B loci. However, no significant linkage was determined in QTL-mapping of an F? fiber length cotton population using HY5-B CAPS. Gossypium derived phytochrome and HY5 genes have the potential to be useful as molecular markers in marker-assisted cotton breeding, to improve cotton fiber quality, resistance to pathogens and insects, and tolerance to environmental adversities.

Abdurakhmonov, Ibrokhim Yulchievich


Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


An Empirical Blowing Snow Forecast Technique for the Canadian Arctic and the Prairie Provinces  

Science Conference Proceedings (OSTI)

Blowing snow has a major impact on transportation and public safety. The goal of this study is to provide an operational technique for forecasting high-impact blowing snow on the Canadian arctic and the Prairie provinces using historical ...

David G. Baggaley; John M. Hanesiak



Modeling the Distribution of Precipitation Forecasts from the Canadian Ensemble Prediction System Using Kernel Density Estimation  

Science Conference Proceedings (OSTI)

Kernel density estimation is employed to fit smooth probabilistic models to precipitation forecasts of the Canadian ensemble prediction system. An intuitive nonparametric technique, kernel density estimation has become a powerful tool widely used ...

Syd Peel; Laurence J. Wilson



Future Projections of Landfast Ice Thickness and Duration in the Canadian Arctic  

Science Conference Proceedings (OSTI)

Projections of future landfast ice thickness and duration were generated for nine sites in the Canadian Arctic and one site on the Labrador coast with a simple downscaling technique that used a one-dimensional sea ice model driven by ...

J. A. Dumas; G. M. Flato; R. D. Brown



Operational Implementation of the FritschChappell Convective Scheme in the 24-km Canadian Regional Model  

Science Conference Proceedings (OSTI)

The objective and subjective evaluations that led to the implementation of the Fritsch and Chappell (FC) convective scheme in the new 24-km Canadian operational regional model are described in this study. Objective precipitation scores computed ...

Stphane Blair; Andr Mthot; Jocelyn Mailhot; Bernard Bilodeau; Alain Patoine; Grard Pellerin; Jean Ct



EA-189 PanCanadian Energy Services Inc | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EA-189 PanCanadian Energy Services Inc More Documents & Publications EA-98-G WESTERN SYSTEMS POWER POOL EA-98-F, Western Systems Power Pool EA-182-A H.Q Energy Services (U.S)...


Response of the Middle Atmosphere to CO2 Doubling: Results from the Canadian Middle Atmosphere Model  

Science Conference Proceedings (OSTI)

The Canadian Middle Atmosphere Model (CMAM) has been used to examine the middle atmosphere response to CO2 doubling. The radiative-photochemical response induced by doubling CO2 alone and the response produced by changes in prescribed SSTs are ...

V. I. Fomichev; A. I. Jonsson; J. de Grandpr; S. R. Beagley; C. McLandress; K. Semeniuk; T. G. Shepherd



Canadian Atlantic Storms Program: Progress and Plans of the Meteorological Component  

Science Conference Proceedings (OSTI)

The Canadian Atlantic Storms Program (CASP) field project was conducted from 15 January to 15 March 1986 over Atlantic Canada in conjunction with the American Genesis of Atlantic Lows Experiment (GALE). The goals of CASP were to begin the process ...

Ronald E. Stewart



Forecast Skill of the MaddenJulian Oscillation in Two Canadian Atmospheric Models  

Science Conference Proceedings (OSTI)

The output of two global atmospheric models participating in the second phase of the Canadian Historical Forecasting Project (HFP2) is utilized to assess the forecast skill of the MaddenJulian oscillation (MJO). The two models are the third ...

Hai Lin; Gilbert Brunet; Jacques Derome



The Energy Budget of Canadian Shield Subarctic Terrain and Its Impact on Hillslope Hydrological Processes  

Science Conference Proceedings (OSTI)

The objective of the study is to determine the local processes that control the partitioning of the energy budget of shield terrain in the western Canadian subarctic. The magnitude of the spring snowmelt and its potential to flood exposed bedrock ...

Christopher Spence; Wayne R. Rouse



The Canadian Climate Centre Second-Generation General Circulation Model and Its Equilibrium Climate  

Science Conference Proceedings (OSTI)

The Canadian Climate Centre second generation general circulation model (GCMII) is described. The description emphasizes aspects in which the new model differs from the 1984 model (GCMI) as described by Boer and collaborators. Important features ...

N. A. McFarlane; G. J. Boer; J-P. Blanchet; M. Lazare



The Tree-Ring Record of Drought on the Canadian Prairies  

Science Conference Proceedings (OSTI)

Ring-width data from 138 sites in the Canadian Prairie Provinces and adjacent regions are used to estimate summer drought severity during the past several hundred years. The network was divided into five regional groups based on geography, tree ...

Scott St. George; David M. Meko; Martin-Philippe Girardin; Glen M. MacDonald; Erik Nielsen; Greg T. Pederson; David J. Sauchyn; Jacques C. Tardif; Emma Watson



Precipitation and Environmental Conditions during Accretion in Canadian East Coast Winter Storms  

Science Conference Proceedings (OSTI)

Precipitation and environmental conditions occurring during accretion in Canadian east coast winter storms are described and investigated. Accretion is generally associated with snow, freezing rain, and ice pellets within saturated conditions. ...

R. E. Stewart; R. W. Crawford; N. R. Donaldson; T. B. Low; B. E. Sheppard



Radiative Characteristics of the Canadian Climate Centre Second-Generation General Circulation Model  

Science Conference Proceedings (OSTI)

Several observational datasets were used to assess the quality of the radiative characteristics of the Canadian Climate Centre (CCC) second-generation GCM. The GCM data were obtained from the Atmospheric Model Intercomparison Project (AMIP) ...

Howard W. Barker; Zhanqing Li; Jean-Pierre Blanchet



Microscale Numerical Prediction over Montreal with the Canadian External Urban Modeling System  

Science Conference Proceedings (OSTI)

The Canadian urban and land surface external modeling system (known as urban GEM-SURF) has been developed to provide surface and near-surface meteorological variables to improve numerical weather prediction and to become a tool for environmental ...

Sylvie Leroyer; Stphane Blair; Jocelyn Mailhot; Ian B. Strachan



Postulated Feedbacks of Deciduous Forest Phenology on Seasonal Climate Patterns in the Western Canadian Interior  

Science Conference Proceedings (OSTI)

A large portion of the western Canadian interior exhibits a distinctive seasonal pattern in long-term mean surface temperatures characterized by anomalously warmer conditions in spring and autumn than would be expected from a sinusoidal model. ...

E. H. Hogg; D. T. Price; T. A. Black



A Diagnostic Verification of the Precipitation Forecasts Produced by the Canadian Ensemble Prediction System  

Science Conference Proceedings (OSTI)

A comparatively long period of relative stability in the evolution of the Canadian Ensemble Forecast System was exploited to compile a large homogeneous set of precipitation forecasts. The probability of exceedance of a given threshold was ...

Syd Peel; Laurence J. Wilson



Impacts of LandAtmosphere Feedbacks on Deep, Moist Convection on the Canadian Prairies  

Science Conference Proceedings (OSTI)

The purpose of this study was to focus on how anomalies in the normalized difference vegetation index (NDVI; a proxy for soil moisture) over the Canadian Prairies can condition the convective boundary layer (CBL) so as to inhibit or facilitate ...

Julian C. Brimelow; John M. Hanesiak; William R. Burrows



Technologies, markets and challenges for development of the Canadian Oil Sands industry  

E-Print Network (OSTI)

This paper provides an overview of the current status of development of the Canadian oil sands industry, and considers possible paths of further development. We outline the key technology alternatives, critical resource ...

Lacombe, Romain H.



A Short-Range Forecasting Experiment Conducted during the Canadian Atlantic Storms Program  

Science Conference Proceedings (OSTI)

During the Canadian Atlantic Storms Program (CASP), a dedicated forecast center conducted experiments in mesoscale forecasting. Several forecast products, including a marine forecast and a site-specific public forecast, were written every 3 h. ...

K. A. Macdonald; M. Danks; J. D. Abraham



DOE/EIS-0197-SA-01; Delivery of the Canadian Entitlement Final Environmental Impact Statement Supplement to Record of Decision  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Delivery of the Canadian Entitlement Delivery of the Canadian Entitlement Final Environmental Impact Statement Supplement to Record of Decision Summary The United States Entity has decided to supplement an earlier decision regarding the Canadian Entitlement. The United States Entity issued a Delivery of the Canadian Entitlement Record of Decision (ROD) on November 8, 1996. The ROD was based on the Delivery of the Canadian Entitlement Environmental Impact Statement (DOE/EIS- 0197, issued in January 1996). The November 1996 ROD announced the United States Entity decision to fulfill its obligation under the Columbia River Treaty (Treaty) between Canada and the United States of America (United States) by delivering the full Canadian Entitlement (Entitlement) at existing transmission interconnections between the United

Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Evaluation of fracture treatment type on the recovery of gas from the cotton valley formation  

E-Print Network (OSTI)

Every tight gas well needs to be stimulated with a hydraulic fracture treatment to produce natural gas at economic flow rates and recover a volume of gas that provides an acceptable return on investment. Over the past few decades, many different types of fracture fluids, propping agents and treatment sizes have been tried in the Cotton Valley formation. The treatment design engineer has to choose the optimum fluid, optimum proppant, optimum treatment size and make sure the optimum treatment is mixed and pumped in the field. These optimum values also depend on drilling costs, fracturing costs and other economic parameters; such as gas prices, operating costs and taxes. Using information from the petroleum literature, numerical and analytical simulators, and statistical analysis of production data, this research provides a detailed economic evaluation of the Cotton Valley wells drilled in the Elm Grove field operated by Matador Resources to determine not only the optimum treatment type, but also the optimum treatment volume as a function of drilling costs, completion costs, operating costs and gas prices. This work also provides an evaluation of well performance as a function of the fracture treatment type by reviewing production data from the Carthage and Oak Hill Cotton Valley fields in Texas and the Elm Grove field in Louisiana.

Yalavarthi, Ramakrishna



The ecology of Arctic cod (Boreogadus saida) and interactions with seabirds, seals, and whales in the Canadian Arctic.  

E-Print Network (OSTI)

??This thesis investigates the foraging of Arctic cod (Boreogadus saida) and its predators during the summer in the Canadian Arctic. Findings included the identification of (more)

Matley, Jordan



Canadian National Energy Use Database: Statistics and Analysis | Open  

Open Energy Info (EERE)

Canadian National Energy Use Database: Statistics and Analysis Canadian National Energy Use Database: Statistics and Analysis Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Canadian National Energy Use Database: Statistics and Analysis Focus Area: Energy Efficiency Topics: Potentials & Scenarios Website: oee.nrcan.gc.ca/corporate/statistics/neud/dpa/home.cfm?attr=24 Equivalent URI: cleanenergysolutions.org/content/canadian-national-energy-use-database Language: "English,French" is not in the list of possible values (Abkhazian, Achinese, Acoli, Adangme, Adyghe; Adygei, Afar, Afrihili, Afrikaans, Afro-Asiatic languages, Ainu, Akan, Akkadian, Albanian, Aleut, Algonquian languages, Altaic languages, Amharic, Angika, Apache languages, Arabic, Aragonese, Arapaho, Arawak, Armenian, Aromanian; Arumanian; Macedo-Romanian, Artificial languages, Assamese, Asturian; Bable; Leonese; Asturleonese, Athapascan languages, Australian languages, Austronesian languages, Avaric, Avestan, Awadhi, Aymara, Azerbaijani, Balinese, Baltic languages, Baluchi, Bambara, Bamileke languages, Banda languages, Bantu (Other), Basa, Bashkir, Basque, Batak languages, Beja; Bedawiyet, Belarusian, Bemba, Bengali, Berber languages, Bhojpuri, Bihari languages, Bikol, Bini; Edo, Bislama, Blin; Bilin, Blissymbols; Blissymbolics; Bliss, Bosnian, Braj, Breton, Buginese, Bulgarian, Buriat, Burmese, Caddo, Catalan; Valencian, Caucasian languages, Cebuano, Celtic languages, Central American Indian languages, Central Khmer, Chagatai, Chamic languages, Chamorro, Chechen, Cherokee, Cheyenne, Chibcha, Chichewa; Chewa; Nyanja, Chinese, Chinook jargon, Chipewyan; Dene Suline, Choctaw, Chuukese, Chuvash, Classical Newari; Old Newari; Classical Nepal Bhasa, Classical Syriac, Coptic, Cornish, Corsican, Cree, Creek, Creoles and pidgins , Crimean Tatar; Crimean Turkish, Croatian, Cushitic languages, Czech, Dakota, Danish, Dargwa, Delaware, Dinka, Divehi; Dhivehi; Maldivian, Dogri, Dogrib, Dravidian languages, Duala, Dutch; Flemish, Dyula, Dzongkha, Eastern Frisian, Efik, Egyptian (Ancient), Ekajuk, Elamite, English, Erzya, Esperanto, Estonian, Ewe, Ewondo, Fang, Fanti, Faroese, Fijian, Filipino; Pilipino, Finnish, Finno-Ugrian languages, Fon, French, Friulian, Fulah, Ga, Gaelic; Scottish Gaelic, Galibi Carib, Galician, Ganda, Gayo, Gbaya, Geez, Georgian, German, Germanic languages, Gilbertese, Gondi, Gorontalo, Gothic, Grebo, Greek, Modern, Guarani, Gujarati, Gwich'in, Haida, Haitian; Haitian Creole, Hausa, Hawaiian, Hebrew, Herero, Hiligaynon, Himachali languages; Western Pahari languages, Hindi, Hiri Motu, Hittite, Hmong; Mong, Hungarian, Hupa, Iban, Icelandic, Ido, Igbo, Ijo languages, Iloko, Inari Sami, Indic languages, Indo-European languages, Indonesian, Ingush, Interlingue; Occidental, Inuktitut, Inupiaq, Iranian languages, Irish, Iroquoian languages, Italian, Japanese, Javanese, Judeo-Arabic, Judeo-Persian, Kabardian, Kabyle, Kachin; Jingpho, Kalaallisut; Greenlandic, Kalmyk; Oirat, Kamba, Kannada, Kanuri, Kara-Kalpak, Karachay-Balkar, Karelian, Karen languages, Kashmiri, Kashubian, Kawi, Kazakh, Khasi, Khoisan languages, Khotanese; Sakan, Kikuyu; Gikuyu, Kimbundu, Kinyarwanda, Kirghiz; Kyrgyz, Klingon; tlhIngan-Hol, Komi, Kongo, Konkani, Korean, Kosraean, Kpelle, Kru languages, Kuanyama; Kwanyama, Kumyk, Kurdish, Kurukh, Kutenai, Ladino, Lahnda, Lamba, Land Dayak languages, Lao, Latin, Latvian, Lezghian, Limburgan; Limburger; Limburgish, Lingala, Lithuanian, Lojban, Lower Sorbian, Lozi, Luba-Katanga, Luba-Lulua, Luiseno, Lule Sami, Lunda, Luo (Kenya and Tanzania), Lushai, Luxembourgish; Letzeburgesch, Macedonian, Madurese, Magahi, Maithili, Makasar, Malagasy, Malay, Malayalam, Maltese, Manchu, Mandar, Mandingo, Manipuri, Manobo languages, Manx, Maori, Mapudungun; Mapuche, Marathi, Mari, Marshallese, Marwari, Masai, Mayan languages, Mende, Mi'kmaq; Micmac, Minangkabau, Mirandese, Mohawk, Moksha, Mon-Khmer languages, Mongo, Mongolian, Mossi, Multiple languages, Munda languages, N'Ko, Nahuatl languages, Nauru, Navajo; Navaho, Ndebele, North; North Ndebele, Ndebele, South; South Ndebele, Ndonga, Neapolitan, Nepal Bhasa; Newari, Nepali, Nias, Niger-Kordofanian languages, Nilo-Saharan languages, Niuean, North American Indian languages, Northern Frisian, Northern Sami, Norwegian, Nubian languages, Nyamwezi, Nyankole, Nyoro, Nzima, Occitan (post 1500); Provençal, Ojibwa, Oriya, Oromo, Osage, Ossetian; Ossetic, Otomian languages, Pahlavi, Palauan, Pali, Pampanga; Kapampangan, Pangasinan, Panjabi; Punjabi, Papiamento, Papuan languages, Pedi; Sepedi; Northern Sotho, Persian, Philippine languages, Phoenician, Pohnpeian, Polish, Portuguese, Prakrit languages, Pushto; Pashto, Quechua, Rajasthani, Rapanui, Rarotongan; Cook Islands Maori, Romance languages, Romanian; Moldavian; Moldovan, Romansh, Romany, Rundi, Russian, Salishan languages, Samaritan Aramaic, Sami languages, Samoan, Sandawe, Sango, Sanskrit, Santali, Sardinian, Sasak, Scots, Selkup, Semitic languages, Serbian, Serer, Shan, Shona, Sichuan Yi; Nuosu, Sicilian, Sidamo, Sign Languages, Siksika, Sindhi, Sinhala; Sinhalese, Sino-Tibetan languages, Siouan languages, Skolt Sami, Slave (Athapascan), Slavic languages, Slovak, Slovenian, Sogdian, Somali, Songhai languages, Soninke, Sorbian languages, Sotho, Southern, South American Indian (Other), Southern Altai, Southern Sami, Spanish; Castilian, Sranan Tongo, Sukuma, Sumerian, Sundanese, Susu, Swahili, Swati, Swedish, Swiss German; Alemannic; Alsatian, Syriac, Tagalog, Tahitian, Tai languages, Tajik, Tamashek, Tamil, Tatar, Telugu, Tereno, Tetum, Thai, Tibetan, Tigre, Tigrinya, Timne, Tiv, Tlingit, Tok Pisin, Tokelau, Tonga (Nyasa), Tonga (Tonga Islands), Tsimshian, Tsonga, Tswana, Tumbuka, Tupi languages, Turkish, Turkmen, Tuvalu, Tuvinian, Twi, Udmurt, Ugaritic, Uighur; Uyghur, Ukrainian, Umbundu, Uncoded languages, Undetermined, Upper Sorbian, Urdu, Uzbek, Vai, Venda, Vietnamese, Volapük, Votic, Wakashan languages, Walamo, Walloon, Waray, Washo, Welsh, Western Frisian, Wolof, Xhosa, Yakut, Yao, Yapese, Yiddish, Yoruba, Yupik languages, Zande languages, Zapotec, Zaza; Dimili; Dimli; Kirdki; Kirmanjki; Zazaki, Zenaga, Zhuang; Chuang, Zulu, Zuni) for this property.


A Precision Agriculture Approach to Managing Cotton Fiber Quality as a Function of Variable Soil Properties  

E-Print Network (OSTI)

Cotton producers can maximize yield and fiber quality by understanding soil variability throughout the fields, thus receiving premium prices for the cotton lint. A better understanding of how soil water holding capacity affects cotton lint yield and quality can result in improved management practices that can maximize fiber quality while minimizing inputs. The objectives of this study were to 1) create management zones using a soil ECa map, 2) test the usefulness of this map using measurements of lint quality and lint quantity in both irrigated and dryland fields, and 3) determine a relationship between soil water holding capacity fiber quality parameters. The selected site was Texas A&M University s IMPACT center which is located nine miles west of College Station, TX in the Brazos River floodplain. In the 2006 and 2007 growing seasons, 24 measurement locations were selected in a dryland and irrigated cotton field, 12 locations in each field. The sites were selected using a map of soil ECa, three ECa categories and four replications. At each location soil texture, soil water holding capacity, and lint quality (HVI) and quantity were measured. The ECa categories successfully identified significant differences in clay content water holding capacity, lint yield, lint quality, and loan values. The 2006 season was relatively dry. Weather, soil variability, and management affected the yield and yield quality responses. Water availability was not a factor for lint yield or quality in 2007. In this situation, the soil was the primary factor for field heterogeneity. The cotton yield still responded to soil variability but lint quality and loan value was uniform. The uniformity of lint quality and non-uniformity of lint quantity leads to the conclusion that these soils have individual yield thresholds, but without water stress the quality threshold is uniform. This conclusion illuminates opportunities for precision management strategies. One management strategy that may result from this work is to reduce seeding rates in lower production areas of the field, if the plants will compensate for yield to still reach the soils yield potential, perhaps less competition for water would improve lint quality.

Stanislav, Scott



Advanced Analysis of the Responses of Cotton Genotypes Growing Under Water Stress  

E-Print Network (OSTI)

The ever-growing world population raises the concern and necessity of rational use and distribution of limited water resources. Water deficit is the single most dominant abiotic factor limiting cotton (Gossypium hirsutum L.) yield in drought-prone Texas croplands. Characterizing plant traits conferring drought tolerance to cotton genotypes and then transferring this information back to breeders and geneticists have the potential of significantly increasing and stabilizing production statewide. Although a plethora of physiological studies have been conducted and have demonstrated that drought tolerance in plants is likely to be conferred by a combination of plant traits rather than a single trait, this knowledge has not translated into improved breeding lines. Experiments were conducted in 2010 and 2011 in the Drought Tolerance Laboratory (Texas AgriLife Research and Extension Center in Corpus Christi, TX) to analyze the responses of cotton genotypes to different levels of water stress. This facility is equipped with computerized systems capable of continuously monitoring whole-plant water use as well as several environmental parameters. Sixteen cotton genotypes were provided by Monsanto Co. and the Texas AgriLife Cotton Improvement Programs at College Station and Lubbock. Seeds were pre-germinated in wet paper towels and then hand planted in large pots previously filled with fritted clay. A total of 3 and 8 (2010 and 2011, respectively) pots containing plants of each genotype were permanently placed on micro-lysimeters for continuous measurement of water use. Water regimes were imposed in 2010 (well-watered and water-stressed), and 2011 (water-stressed) when plants reached the early-flowering stage and were carried until plants reached maturity (100% open bolls). Data collected showed that genotypes have very distinct water use patterns. The water stress treatment imposed on the test plants negatively affected plant growth that was indicated by a lower plant height, total number of leaves, and main-stem nodes of stressed plants when contrasted to their well-watered counterparts. Stomatal density was remarkably different among genotypes and a higher density was found on the abaxial (lower) leaf surface for all genotypes studied. Root dry mass production had different responses depending upon the severity of the water stress. Highest root dry mass was observed when plants were exposed to a mild stress and lowest when a more severe water restriction was imposed.

Maeda, Murilo 1985-



Recruiting and Retaining Canadian Minor Hockey Players by Local Youth Club Hockey Organizations, Canadas Governing Hockey Organizations, Major Junior, and Intercollegiate Hockey Organizations: Exploring Canadas Elite Level Hockey Development System.  

E-Print Network (OSTI)

??There are two pivotal transition points for Canadian elite level minor hockey players and parents; the first transitional point is when a Canadian player and (more)

Edwards, Jonathon R J



A web application for cotton irrigation management on the U.S. Southern High Plains. Part I: Crop yield modeling and profit analysis  

Science Conference Proceedings (OSTI)

Irrigated cotton (Gossypium Hirsutum L.) production is a central part of west Texas agriculture that depends on the essentially non-renewable water resource of the Ogallala aquifer. Web-based decision support tools that estimate the profit effects of ... Keywords: Cotton, Decision support tools, Irrigation, Ogallala aquifer, Profit estimation

Steven Mauget, Gary Leiker, Shyam Nair



Study of the health effects of chromium rollers used in cotton roller ginning industries and development of an alternative ginning process  

Science Conference Proceedings (OSTI)

This review paper realizes the hazards of chromium contamination and pollution caused by the use of Chrome Composite Leather-Clad (CCLC) rollers commonly used in cotton roller ginning industries and attempts to eliminate the chromium contamination and ... Keywords: chromium, cotton lint, ginning, rollers, rubber canvas

Gurumurthy Vijayan Iyer; Nikos E. Mastorakis



Environmental impact studies of chrome rollers used by cotton roller ginning industries and design and development of pollution free chrome less RCF rollers  

Science Conference Proceedings (OSTI)

This paper discusses the pollution caused by Chrome Composite Leather-Clad (CCLC) rollers commonly used in cotton roller ginning industries and suggests an alternative roller material. The CCLC rollers contain about 18000 to 36000 mg/kg (ppm) total chromium ... Keywords: carcinogenic, chromium, cotton, eco-friendly, ginning, roller, rubberized roller

Gurumurthy Vijayan Iyer; Nikos E. Mastorakis



Testing the Effects of a New Land Surface Scheme and of Initial Soil Moisture Conditions in the Canadian Global Forecast Model  

Science Conference Proceedings (OSTI)

A new land surface scheme developed for the Canadian general circulation model has been introduced into the Canadian global forecast model and tested for a summer case. It features three soil layers, a snow layer, and a vegetation layer; its ...

Yves Delage; Diana Verseghy



Canadian House Dust Study: Lead Bioaccessibility and Speciation  

Science Conference Proceedings (OSTI)

Vacuum samples were collected from 1025 randomly selected urban Canadian homes to investigate bioaccessible Pb (Pb{sub S}) concentrations in settled house dust. Results indicate a polymodal frequency distribution, consisting of three lognormally distributed subpopulations defined as 'urban background' (geomean 58 {micro}g g{sup -1}), 'elevated' (geomean 447 {micro}g g{sup -1}), and 'anomalous' (geomean 1730 {micro}g g{sup -1}). Dust Pb{sub S} concentrations in 924 homes (90%) fall into the 'urban background' category. The elevated and anomalous subpopulations predominantly consist of older homes located in central core areas of cities. The influence of house age is evidenced by a moderate correlation between house age and dust Pb{sub S} content (R{sup 2} = 0.34; n = 1025; p < 0.01), but it is notable that more than 10% of homes in the elevated/anomalous category were built after 1980. Conversely, the benefit of home remediation is evidenced by the large number of homes (33%) in the background category that were built before 1960. The dominant dust Pb species determined using X-ray Absorption Spectroscopy were as follows: Pb carbonate, Pb hydroxyl carbonate, Pb sulfate, Pb chromate, Pb oxide, Pb citrate, Pb metal, Pb adsorbed to Fe- and Al-oxyhydroxides, and Pb adsorbed to humate. Pb bioaccessibility estimated from solid phase speciation predicts Pb bioaccessibility measured using a simulated gastric extraction (R{sup 2} = 0.85; n = 12; p < 0.0001). The trend toward increased Pb bioaccessibility in the elevated and anomalous subpopulations (75% {+-} 18% and 81% {+-} 8%, respectively) compared to background (63% {+-} 18%) is explained by the higher proportion of bioaccessible compounds used as pigments in older paints (Pb carbonate and Pb hydroxyl carbonate). This population-based study provides a nationally representative urban baseline for applications in human health risk assessment and risk management.

P Rasmussen; S Beauchemin; M Chenier; C Levesque; L MacLean; L Marrow; H Jones-Otazo; S Petrovic; L McDonald; H Gardner



The Role of the Canadian Government in Industrial Energy Conservation  

E-Print Network (OSTI)

Canada has undertaken to become self sufficient in energy by 1990. To buy the necessary time to develop domestic supplies, energy transport systems and to extend the time life of energy reserves, we have embarked on an energy conservation program which aims at a 2% growth rate in energy use by the year 1990. The primary objective of the Industry Energy Conservation Program is to achieve a high degree of energy efficiency in manufacturing and process industries. Reduced energy costs in industry achieved through intelligent investment and operating practice is central to the program strategy. The industry program has been developed in consultation with Canadian industry and is completely voluntary on their part. The program has five main elements: 1. Industry Energy Conservation Task Forces 2. Information and awareness packages 3. Fiscal and Financial incentives 4. Industry Data Base Development and 5. Industry policy studies. By selecting the voluntary approach to deal with energy conservation we have maintained the traditional cooperative relationship between government and industry in Canada and have been able to manage a successful energy conservation program with a minimum of government intervention and bureaucracy. Industry sets the energy conservation goals, identifies the opportunities to conserve energy, and finally reports on the improvements in energy efficiency. Government for its part supports industry with a number of program elements designed to overcome the many barriers to energy efficiency which exist in Canada. These programs are deliberately biased to deal with the liquid fuel supply situation in eastern Canada and to encourage the use of wood waste as a fuel. As new barriers to the efficient use of energy are identified these programs are modified accordingly.

Godin, M. A.



Beyond the digital divide in Canadian schools: from access to competency in the use of information technology  

Science Conference Proceedings (OSTI)

This article provides a descriptive analysis of issues related to the access and use of information and communication technology (ICT) among Canadian youth. In particular, it examines the extent to which inequities in the use of and access to ICT exist ... Keywords: Canadian youth, computer access, digital divide, educational technology, gender, information technology, rural, socioeconomic status

E. Dianne Looker; Victor Thiessen



Advanced Photon Source, Canadian Light Source Strengthen Ties, Expand X-ray  

NLE Websites -- All DOE Office Websites (Extended Search)

Rose of APS and CNM One of Four DOE Early Career Award Winners Rose of APS and CNM One of Four DOE Early Career Award Winners Scientists Close-In on Artificial Spider Silk Ekiert Earns 2012 APSUO Franklin Award for Studies of Influenza Virus Clever Apes on WBEZ: Breaking the Fossil Record Gerig to Chair Particle Accelerator School Board APS News Archives: 2012 | 2011 | 2010 | 2009 2008 | 2007 | 2006 | 2005 2004 | 2003 | 2002 | 2001 2000 Subscribe to APS News rss feed Advanced Photon Source, Canadian Light Source Strengthen Ties, Expand X-ray Technology and Research JUNE 18, 2012 Bookmark and Share The interiors of the Canadian Light Source (top) and Advanced Photon Source experiment halls. (CLS photo courtesy of Canadian Light Source) Seeking to solve some of today's greatest global problems, scientists using x-ray light source facilities at national research laboratories in


Trading in power: the potential for US-Canadian electricity exchange  

SciTech Connect

Electricity is one of the most important forms of future energy in the US and Canada. Government officials and utility planners in both countries increasingly view exchanges of electricity by long-term contract as mutually beneficial. Recent developments in world politics, technological and environmental complications, and economic considerations, including supply and price, have combined to make increased electricity trade a promising option. Purchases of firm-capacity Canadian electricity would lower rates for US customers and allow US utilities to postpone construction of new nuclear or coal-fired generating plants. Providing enough domestic capacity to meet projected demand to the year 2000 might require as much as $180 billion in capital investment in the Northeast and Midwest alone. Canadian imports would allow US utilities to diversify their supplies and retire oil-fired plants, and would reduce the need for excess capacity as reserve power. The issues involved in the importing of Canadian power by the US are discussed.



Mapping in-field cotton fiber quality and relating it to soil moisture  

E-Print Network (OSTI)

The overarching goal of this dissertation project was to address several fundamental aspects of applying site-specific crop management for fiber quality in cotton production. A two-year (2005 and 2006) field study was conducted at the IMPACT Center, a portion of the Texas A&M Research farm near College Station, Texas, to explore the spatial variability of cotton fiber quality and quantify its relationship with in-season soil moisture content. Cotton samples and in-situ soil moisture measurements were taken from the sampling locations in both irrigated and dry areas. It was found that generally low variability (CV wireless- and GPS-based system was fabricated and developed for automated module-level fiber quality mapping. The system is composed of several subsystems distributed among harvest vehicles, and the main components of the system include a GPS receiver, wireless transceivers, and microcontrollers. Software was developed in C language to achieve GPS signal receiving, wireless communication, and other auxiliary functions. The system was capable of delineating the geographic boundary of each harvested basket and tracking it from the harvester basket to the boll buggy and the module builder. When fiber quality data are available at gins or classing offices, they can be associated with those geographic boundaries to realize fiber quality mapping. Field tests indicated that the prototype system performed as designed. The resultant fiber quality maps can be used to readily differentiate some HVI fiber parameters (micronaire, color, and loan value) at the module level, indicating the competence of the system for fiber quality mapping and its potential for site-specific fiber quality management. Future improvements needed to make system suitable for a full-scale farming operation are suggested.

Ge, Yufeng



[Testing and commercialization of a cotton stalk shredder and plow]. Technical progress report, July--September, 1995  

Science Conference Proceedings (OSTI)

The paper describes plans to field test several prototypes of plows that cut cotton stalks after harvesting and plows then back into the soil to prepare the field for the next planting. Modifications to the design have been made to allow the soil to more easily slide off the plow to reduce fuel consumption. A prototype has been shipped to Australia for testing in their fields and further product development. A farm machinery manufacturer has been selected to build two full-scale preproduction prototypes. Field testing will be done at sites in California and Arizona, since both have regulations specifying that cotton stalks must be shredded.

Thacker, G.W.



Errors associated with particulate matter measurements on rural sources: appropriate basis for regulating cotton gins  

E-Print Network (OSTI)

Agricultural operations across the United States are encountering difficulties complying with current air pollution regulations for particulate matter (PM). PM is currently regulated in terms of particle diameters less than or equal to a nominal 10 ?m (PM10); however, current legislation is underway to regulate PM with diameters less than or equal to a nominal 2.5 ?m (PM2.5). The goals of this research were to determine the biases and uncertainties associated with current PM10 and PM2.5 sampling methods and to determine the extent to which these errors may impact the determination of cotton gin emission factors. Ideally, PM samplers would produce an accurate measure of the pollutant indicator; for instance, a PM10 sampler would produce an accurate measure of PM less than or equal to 10 ?m. However, samplers are not perfect and errors are introduced because of the established tolerances associated with sampler performance characteristics and the interaction of particle size and sampler performance characteristics. Results of this research indicated that a source emitting PM characterized by a mass median diameter (MMD) of 20 ?m and a geometric standard deviation (GSD) of 1.5 could be forced to comply with a 3.2 and 14 times more stringent regulation of PM10 and PM2.5, respectively, than a source emitting PM characterized by a MMD of 10 ?m and a GSD of 1.5. These estimates are based on both sources emitting the same concentrations of true PM or concentrations corresponding to the particle diameters less than the size of interest. Various methods were used to estimate the true PM10 and PM2.5 emission factors associated with cotton gin exhausts and the extent to which the sampler errors impacted the PM regulation. Results from this research indicated that current cotton gin emission factors could be over-estimated by about 40%. This over-estimation is a consequence of the relatively large PM associated with cotton gin exhausts. These PM sampling errors are contributing to the misappropriation of source emissions in State Implementation Plans, essentially forcing Air Pollution Regulatory Agencies to require additional controls on sources that may be incorrectly classified has high emitters.

Buser, Michael Dean



Response of cotton (Gossypium hirsutum L.) leaves to profenofos/adjuvant treatment  

E-Print Network (OSTI)

Insecticides may cause phytotoxic effects on crops. Addition of adjuvants may alleviate or aggravate such effects. Investigating the differences in plant responses to insecticide/adjuvant treatments may help in selecting a proper adjuvant to reduce insecticide phytotoxicity. This study examined the responses of cotton (Gossypium hirsutum L.) leaves to profenofos[O-(4-bromo-2chlorophenyl)-O-ethyl S- phosphorothioatel/adjuvant treatments. The specific objectives were performed in four sets of experiments. The objective of the first set of experiments was to determine the effects of adjuvants on profenofos-induced visual injury of cotton plants. Profenofos/adjuvant treatments caused negligible injury, while combinations of profenofos with other insecticides in a tank mix solution caused significantly more injury. Addition of petroleum oil (PO) to the mix caused the greatest injury , while addition of Silwet or Plex caused the least injury. Uptake rates of pesticides are often associated with the observed visual injury. The objective of the second set of experiments was to determine the effects of the adjuvants on the uptake rates of profenofos. Uptake rates were determined at 0, 3, 6, and 9 hours after treatment (HAT). Uptake rates were significantly highest for profenofos+PO at 3 and 6 HAT as compared to profenofos alone or with cotton seed oil (CSO). Uptake rates of profenofos with Silwet or Plex, determined in another experiment, were smaller than uptake rates of profenofos with PO or CSO. Uptake rates of profenofos with adjuvants were related to the observed visual injury in the field. Increases in ethylene production are often indicative of phytotoxic effects on the plants. The objective of the third set of experiments was to determine the effects of profenofos/adjuvant treatment on ethylene production of cotton leaves. Profenofos and profenofos with PO or CSO caused a numerical increase in ethylene production; however, the data were inconclusive due to the variability between replicates. Changes in the ethylene production are often preceded by changes in I-aminocyclopropane-l-carboxylic acid (ACC). The objective of the fourth set of experiments was to determine the effect of profenofos/adjuvant treatment on the rate of ACC production. Profenofos and profenofos with PO or CSO failed to induce changes in the ACC pool.

Seskar, Mirjana



A Comparison of Canadian and U.S. Hydro Operations and Maintenance Practices  

Science Conference Proceedings (OSTI)

Phase 1 of the Comparison of Canadian & American Hydro Operations & Maintenance Practices project indicates that hydroelectric plants in Canada have significantly lower operations and maintenance (O&M) costs than those in the United States. Phase 2, focused on a more in-depth investigation, will begin as soon as permission is granted by the respective plant owners.


Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Four-Dimensional Variational Data Assimilation for the Canadian Regional Deterministic Prediction System  

Science Conference Proceedings (OSTI)

As a second step in the development of the Canadian Regional Data Assimilation System following Fillion et al., this study extends the approach to the four-dimensional variational data assimilation (4D-Var) context. Emphasis is first put on ...

Monique Tanguay; Luc Fillion; Ervig Lapalme; Manon Lajoie



Climate and Climate Change over North America as Simulated by the Canadian RCM  

Science Conference Proceedings (OSTI)

An analysis of several multidecadal simulations of the present (197190) and future (204160) climate from the Canadian Regional Climate Model (CRCM) is presented. The effects on the CRCM climate of model domain size, internal variability of the ...

D. A. Plummer; D. Caya; A. Frigon; H. Ct; M. Gigure; D. Paquin; S. Biner; R. Harvey; R. de Elia



Evolution of the Deep Water in the Canadian Basin in the Arctic Ocean  

Science Conference Proceedings (OSTI)

An overflow of magnitude 0.25 Sv (Sv ? 106 m?3 s?1) has been predicted to enter the Makarov Basin (part of the Canadian Basin in the Arctic Ocean) from the Eurasian Basin via a deep gap in the dividing Lomonosov ridge. The authors argue that this ...

M-L. Timmermans; Chris Garrett



India maintains status quo on cotton exports | 17 January 2011 | www.commodityonline.com http://www.commodityonline.com/news/India-maintains-status-quo-on-cotton-exports-35722-3-1.html[1/18/2011 2:10:28 PM  

E-Print Network (OSTI)

>> Report Buy Gold & Silver Online Now! Search Web Commodity Online Home Bullion Cereal Energy Metals Fibers by Google Steel Prices Steel Mills Gold Price Cotton Trade Cotton News Name * Your Email Total Comments : 0. (The author is Associate Professor at Texas Tech University, USA) Scrap Industry News Aluminum price

Rock, Chris


Soil microbial response to glyphosate-base cotton pest management systems  

E-Print Network (OSTI)

Currently, 74% of cotton acres in the United States are planted with glyphosatetolerant varieties. The average glyphosate-tolerant cotton crop is treated with glyphosate 2.1 times each year in addition to other herbicides, insecticides, and fungicides. The primary objectives of this research were to: 1) describe the influence of glyphosate and pesticides commonly applied at or near the time of cotton planting on soil microbial activity and biomass; 2) study the effect of glyphosate on fluometuron degradation; 3) evaluate the response of Rhizoctonia solani to glyphosate and fluometuron; 4) study changes in glyphosate metabolism that occur as a result of repeated glyphosate applications; and 5) define shifts in the soil microbial community. Additionally, methods for accelerated solvent extraction (ASE) of fluometuron from soils were developed. In one experiment, the addition of glyphosate reduced C-mineralization in soils treated with fluometuron, aldicarb, or mefenoxam + PCNB formulations. However, in a second experiment, C-mineralization increased when glyphosate was applied with fluometuron relative to fluometuron applied alone. Accelerated solvent extraction was used in experiments which demonstrated that application of glyphosate with fluometuron increased the rate of fluometuron degradation in soil relative to fluometuron alone. When glyphosate was added to minimal medium, degradation of fluometuron by R. solani was reduced and less fungal biomass was produced. The total amount of 14C-glyphosate mineralized was reduced when glyphosate was applied 5 times relative to 1, 2, 3, or 4 times. Incorporation of 14Cglyphosate residues into soil microbial biomass was greater following five glyphosate applications than one application 3 and 7 days after application (DAA). Soil fatty acid methyl ester (FAME) profiles were altered by five glyphosate applications relative to one application. Additionally, FAMEs common to gram-negative bacteria were present in higher concentrations following five applications relative to 1, 2, 3, or 4 applications both 7 and 14 DAA. These studies indicated that: 1) glyphosate altered the soil microbial response to other pesticides; 2) fluometuron-degrading microorganisms in soil responded differently to glyphosate; 3) changes in the dissipation or distribution of glyphosate following repeated glyphosate applications were associated with changes in the structural diversity of the soil microbial community.

Lancaster, Sarah Renee



Improvement of Cotton Fiber Maturity and Assessment of Intra-Plant Fiber Variability  

E-Print Network (OSTI)

The temporal system of fruiting on the cotton plant lends itself to bolls at different fruiting sites developing under different environmental conditions and with varied source-sink relationships. To investigate this, intra-plant fiber quality was assessed in four upland cultivars at College Station, Texas for three years and at Lubbock, Texas for two years. It was concluded that fiber quality steadily declines from the bottom sympodial branches towards the upper branches. 'FiberMax 832' had the best fiber quality among all cultivars but it also had the highest degree of variability within the plants. 'Half and Half' and 'Acala 1517-99' appear to have the least amount of intra-plant variability of fiber quality. Bolls from the bottom region of the plant have higher trash content compared to the upper region. To test the impact of fiber quality variability on boll sampling techniques employed, ten sampling protocols were compared against each other for three years in College Station, Texas, for two upland cultivars. Results suggest that randomized boll samples containing 50 bolls worked well to estimate inherent fiber quality for most fiber traits while estimation of trash and lint percent was not predictable based on boll samples. One of the problems associated with intra-plant fiber variability was the presence of immature fibers. In order to determine the potential for improvement of fiber maturity and standard fineness, five upland cotton (Gossypium hirsutum L.) genotypes were subjected to a diallel analysis at College Station, Texas, in 2011. Four cultivars that tend to produce fine and mature fibers and one cultivar that tends to produce coarse fibers were intermated in all combinations, without reciprocals. Estimates of general (GCA) and specific combining ability (SCA) for fiber maturity ratio and standard fineness based on Griffing's diallel Model I, Method 4 were calculated for AFIS and fiber micronaire, length and strength measurements for High Volume Instrument (HVI). Four parents had significant GCA effects and Acala 1517-99 was found to be the best parent for improving standard fineness followed by FiberMax 832 and 'Tamcot HQ-95'. Tamcot HQ-95 was the best parent to improve fiber maturity ratio while 'Deltapine 90' was the best parent to reduce fiber maturity ratio. The specific cross between Acala 1517-99 and Tamcot HQ-95 had the best performance. Diallel analysis indicated that fiber maturity ratio was influenced by non-additive gene effects more than additive gene effects while fiber standard fineness was highly influenced by additive gene effects. Developing cultivars with optimal fiber standard fineness and maturity should be prioritized to address problems associated with neps and short fiber content and improve spinning performance of US cotton.

Kothari, Neha



Operational Implementation of the ISBA Land Surface Scheme in the Canadian Regional Weather Forecast Model. Part I: Warm Season Results  

Science Conference Proceedings (OSTI)

The summertime improvement resulting from the operational implementation of a new surface modeling and assimilation strategy into the Canadian regional weather forecasting system is described in this study. The surface processes over land are ...

Stphane Blair; Louis-Philippe Crevier; Jocelyn Mailhot; Bernard Bilodeau; Yves Delage



A Study of the Extratropical Reintensification of Former Hurricane Earl Using Canadian Meteorological Centre Regional Analyses and Ensemble Forecasts  

Science Conference Proceedings (OSTI)

Former Hurricane Earl reintensified rapidly while traveling through Canadian waters in September 1998. Its central pressure decreased 40 hPa over a 36-h period, and it produced heavy rain on Cape Breton Island, Nova Scotia, and over Newfoundland. ...

Suhong Ma; Harold Ritchie; Jim Abraham; John Gyakum; Ron McTaggart-Cowan; Chris Fogarty



Sea Ice in the Canadian Arctic Archipelago: Modeling the Past (19502004) and the Future (204160)  

Science Conference Proceedings (OSTI)

Considering the recent losses observed in Arctic sea ice and the anticipated future warming due to anthropogenic greenhouse gas emissions, sea ice retreat in the Canadian Arctic Archipelago (CAA) is expected and indeed is already being observed. ...

Tessa Sou; Gregory Flato



Thermal Characteristics and Energy Balance of Various-Size Canadian Shield Lakes in the Mackenzie River Basin  

Science Conference Proceedings (OSTI)

This study addresses the thermal and energy budget characteristics of four different-size Canadian Shield lakes in the Mackenzie River basin during the ice-free season of 2000. The objectives are to characterize and compare the surface ...

Claire J. Oswald; Wayne R. Rouse



Surface Energy Balance of the Western and Central Canadian Subarctic: Variations in the Energy Balance among Five Major Terrain Types  

Science Conference Proceedings (OSTI)

In this study, the surface energy balance of 10 sites in the western and central Canadian subarctic is examined. Each research site is classified into one of five terrain types (lake, wetland, shrub tundra, upland tundra, and coniferous forest) ...

Andrea K. Eaton; Wayne R. Rouse; Peter M. Lafleur; Philip Marsh; Peter D. Blanken



Environmental agreements, EIA follow-up and aboriginal participation in environmental management: The Canadian experience  

SciTech Connect

During the last decade a number of environmental agreements (EAs) have been negotiated in Canada involving industry, government and Aboriginal peoples. This article draws on the Canadian experience to consider the potential of such negotiated agreements to address two issues widely recognised in academic and policy debates on environmental impact assessment (EIA) and environmental management. The first relates to the need to secure indigenous participation in environmental management of major projects that affect indigenous peoples. The second and broader issue involves the necessity for specific initiatives to ensure effective follow-up of EIA. The Canadian experience indicates that negotiated environmental agreements have considerable potential to address both issues. However, if this potential is to be realized, greater effort must be made to develop structures and processes specifically designed to encourage Aboriginal participation; and EAs must themselves provide the financial and other resource required to support EIA follow-up and Aboriginal participation.

O'Faircheallaigh, Ciaran [Department of Politics and Public Policy, Griffith Business School, Griffith University, Brisbane, Nathan, Queensland 4111 (Australia)]. E-mail: Ciaran.Ofaircheallaigh@griffith.edu.au



Improving Cotton Embryo Culture by Simulating In Ovulo Nutrient and Hormone Levels  

Science Conference Proceedings (OSTI)

Plant ovules provide zygotes with a physicochemical environment that supports embryo differentiation, growth, and maturation. The exact nature of this embryogenesis-enabling environment is not well characterized, as evidenced by failed attempts to induce normal embryony from zygotes or proembryos (precotyledonary) on defined media. To identify factors required for cotton (Gossypium hirsutum L.) zygotic embryony in vitro, we previously performed chemical and dissolved oxygen tension analyses of cotton ovule fluids and tissues at multiple stages of embryony in situ. Based on these analyses, we report herein the development of procedures that normalize embryo differentiation, growth, maturation, and germination in vitro, starting with proembryos. Our medium differed from Murashige and Skoog (MS) medium as follows (percentage of MS): N (30%, mostly from ten amino acids), P (815%), K (237%), Mg (85%), Ca (267%), S (506%), Fe (88%), and myoinositol (883%). Levels of other MS nutrients and vitamins, except sucrose, were kept at MS levels. Additionally, we included 100 mg L-1 casein hydrolysate plus the following (mmol L-1): d-glucose (1.8), fructose (4.7), sucrose (62.0), arabinose (7.1), melibiose (3.5), malic acid (11.6), and citric acid (3.8). Mannitol was added to achieve a medium osmotic potential of -1.10 MPa, and an atmospheric O2 tension of 3.3 mol m-3 at the surface of embryos was maintained during culture. When cultured on medium containing 8.0 mol L-1 indole-3-acetic acid, 80-90% of proembryos (as small as 100 cells) of cultivars HS-26 and B-27 increased four- to eightfold in surface area during the first 18 d in culture and germinated thereafter to produce viable plants. Increases in surface area of proembryos cultured on a modified MS medium previously used for somatic embryogenesis were from 0.2- to 0.6-fold. The described embryo culture medium should be useful for studying nutritional and molecular aspects of early embryony and possibly for plant zygote transformation protocols.

Rodney Fuller; Vincent Liddiard; J. Hess; John Carman



The Canadian Energy Information System - An Aid and Opportunity for Industry  

E-Print Network (OSTI)

More than ever before, industry needs sound, succinct information on energy options and opportunities. As one answer to this need, the Canadian Energy Information System provides comprehensive continent-wide distribution of information and fast response to inquiries on significant energy research, development and demonstration projects in Canada, government programs, and energy conferences, seminars and other energy events. It represents an important development in energy information transfer. The system is publicly available on a full-text computer system from anywhere in the country for either information retrieval or input. Unique features include the power to and information from the user's office; a marketing opportunity for his significant innovation projects, conferences and workshops.

McNeil, C. S. L.



Canadian gas exports in the U. S. market: 1995 evaluation and outlook  

Science Conference Proceedings (OSTI)

The report summarizes data and information relating to the North American natural gas industry including supply (US, Canada, regional), demand (focusing on US sectoral demand), prices, and transportation capacities. Section 1 presents a review of industry events in 1995 and section 2 contains forecasts to the year 2000. Section 3 reviews regulatory developments which affect current and future exports of Canadian natural gas, including rolled-in versus incremental tolling, unbundling of local distribution companies, policies on market-based rates, and incentive regulation. The appendix summarizes the current electric industry restructuring process in the United States.

Not Available




SciTech Connect

Apparatases developed for field sampling and measurement of radon are described. A battery-operated air sampler for the collection of radon daughters is described along with a battery-operated, alpha scintillation detector for the measurement of radon daughter products. A method is presented for estimating rate of exposure to U from the excretion rate of U in urine, and evaluation of personnel exposed to U in mine and mill. The principles of airborne hazards control in Canadian mines are outlined and discussed in terms of ventilation, control of radon-laden water, and dust control. (W.L.H.)

Simpson, S.D.; Stewart, C.G.; Yourt, G.R.; Bloy, H.



Canadian Canola: Effects of the Respecification of the Futures Contract on Market Efficiency  

E-Print Network (OSTI)

Canadas canola market is not efficient, i.e., future and spot prices do not converge as the delivery date approaches. The Winnipeg Commodity Exchange recognized the inefficiency, and moved the reference point on July 1, 1996 from Vancouver, where about 60 percent of Canadas canola is exported, to Saskatoon and other inland cities where canola is grown. Canola and soybeans are close substitutes, and the movement of the reference point should have made canola prices mirror soybean prices closer because of an improved futures market. This result did not occur, largely because (1) the Canadian government does not permit canola to move to Vancouver by rail until it has been sold to an exporter and (2) these government restrictions have discouraged the private sector from improving upon the storage and transportation system. This paper shows that the 1995 reforms simply moved the futures market ahead of the bottleneck in the delivery process and failed to make the canola market efficient. It concludes that Canadian government attempts to regulate the transportation of canola prevent the achievement of market efficiency; such efficiency could be realized by

Darren M. Field



The harmonization of Canadian and U.S. window programs and standards. Final report  

SciTech Connect

The window and door industry in North America have a strong interest in harmonizing US and Canadian rating procedures and standards for predicting the thermal performance of their products. The costs and time associated with complying with the requirements in both countries are significant and could be reduced through reciprocity. The purpose of this paper is to compare the US and Canadian rating programs. Joint efforts between the US and Canada can use this information to focus on reconciling the differences and to work towards reciprocity. The following identifies the applicable procedures and standards for both countries, and summarizes the major differences in the products that are covered, the sizes that are used, the U-factor and solar heat gain coefficient calculational and test methods, air leakage measurement, prediction of annual energy use, condensation resistance methods, reporting requirements, and accreditation and certification programs. The major differences between the system s are identified and recommendations are made to achieve reciprocity. The appendix contains a paper that is a synopsis of the findings from this study.




Delivery of the Canadian Entitlement Final Environmental Impact Statement January 1996  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1996/01eis0197_map.html[6/27/2011 12:03:04 PM] 1996/01eis0197_map.html[6/27/2011 12:03:04 PM] Map Section Map #1 Map #2 Map #3 Map #4 Map #5 Map #6 Delivery of the Canadian Entitlement Final Environmental Impact Statement January 1996 file:///I|/Data%20Migration%20Task/EIS-0197-FEIS-1996/eis0197_1.html[6/27/2011 12:03:02 PM] Chapter 1: Purpose of and Need for Action 1.1 Need for Action The Columbia River Treaty (Treaty) between Canada and the United States of America required three storage dams to be constructed on the Columbia River system in Canada and allowed for one in the United States. The dams help control floods in both countries, and the regulated streamflow provided by the three Canadian Treaty reservoirs enables dams downstream in the United States to produce additional power ("downstream power benefits"). Canada and the


[Testing and commercialization of a cotton stalk shredder and plow]. Technical progress report, October--December 1995  

SciTech Connect

This quarterly report describes work on Task 1: Field test and sell prototype to Ellis Equipment, Ltd; Task 2: Design, build, and field test two prototypes; and Task 3: Produce and sell Pegasus to farmers. The equipment has been built to shred stalks, deeply till the soil, and prepare seedbeds for cotton plants. The equipment has been field tested in Australia and is currently being field tested in California and Arizona. Unexpected problems appeared with hard dry soils and this report describes improvements made.

Thacker, G.W.


Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The Stratospheric Extension of the Canadian Global Deterministic Medium-Range Weather Forecasting System and Its Impact on Tropospheric Forecasts  

Science Conference Proceedings (OSTI)

A new system that resolves the stratosphere was implemented for operational medium-range weather forecasts at the Canadian Meteorological Centre. The model lid was raised from 10 to 0.1 hPa, parameterization schemes for nonorographic gravity wave ...

Martin Charron; Saroja Polavarapu; Mark Buehner; P. A. Vaillancourt; Ccilien Charette; Michel Roch; Jose Morneau; Louis Garand; Josep M. Aparicio; Stephen MacPherson; Simon Pellerin; Judy St-James; Sylvain Heilliette



Numerical Prediction of the 1011 June 1985 Squall Line with the Canadian Regional Finite-Element Model  

Science Conference Proceedings (OSTI)

In an effort to improve operational forecasts of mesoscale convective systems (MCSs), a mesoscale version of the operational Canadian Regional Finite-Element (RFE) Model with a grid size of 25 km is used to predict an intense MCS that occurred ...

Stphane Blair; Da-Lin Zhang; Jocelyn Mailhot



Mobile Sounding Observations of a Tornadic Storm near the Dryline: The Canadian, Texas Storm of 7 May 1986  

Science Conference Proceedings (OSTI)

On 7 May 1986 thunderstorms formed during the afternoon near a dryline in the Texas Panhandle under weak synoptic-scale forcing. Five tornadoes and large hail were produced by one storm near Canadian, Texas. The focus of the paper is the analysis ...

Howard B. Bluestein; Eugene W. McCaul Jr.; Gregory P. Byrd; Gary R. Woodall



A comparison of microseismicity induced by gel-proppant-and water-injected hydraulic fractures, Carthage Cotton Valley gas field, East Texas  

E-Print Network (OSTI)

-precision location technique to improve the image resolution of a hydraulic fracture treatment in a tight gas sand, another thick (~ 450-600 m) interval of productive, tight-gas sands interbedded with mudstones (Dutton in the Carthage Cotton Valley gas field of east Texas. Gas is produced from multiple, low-permeability sands


MegaPipe: the MegaCam image stacking pipeline at the Canadian Astronomical Data Centre  

E-Print Network (OSTI)

This paper describes the MegaPipe image processing pipeline at the Canadian Astronomical Data Centre. The pipeline combines multiple images from the MegaCam mosaic camera on CFHT and combines them into a single output image. MegaPipe takes as input detrended MegaCam images and does a careful astrometric and photometric calibration on them. The calibrated images are then resampled and combined into image stacks. The astrometric calibration of the output images is accurate to within 0.15 arcseconds relative to external reference frames and 0.04 arcseconds internally. The photometric calibration is good to within 0.03 magnitudes. The stacked images and catalogues derived from these images are available through the CADC website:

Stephen. D. J. Gwyn



MegaPipe: the MegaCam image stacking pipeline at the Canadian Astronomical Data Centre  

E-Print Network (OSTI)

This paper describes the MegaPipe image processing pipeline at the Canadian Astronomical Data Centre. The pipeline combines multiple images from the MegaCam mosaic camera on CFHT and combines them into a single output image. MegaPipe takes as input detrended MegaCam images and does a careful astrometric and photometric calibration on them. The calibrated images are then resampled and combined into image stacks. The astrometric calibration of the output images is accurate to within 0.15 arcseconds relative to external reference frames and 0.04 arcseconds internally. The photometric calibration is good to within 0.03 magnitudes. The stacked images and catalogues derived from these images are available through the CADC website:

Gwyn, Stephen D J



Delivery of the Canadian Entitlement Final Environmental Impact Statement January 1996  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Summary-1996.html[6/27/2011 12:01:22 PM] Summary-1996.html[6/27/2011 12:01:22 PM] Summary Delivery of the Canadian Entitlement Final Environmental Impact Statement (EIS) Purpose of and Need for Action The Columbia River Treaty (Treaty) between Canada and the United States of America (United States), signed in 1961, required three storage dams to be constructed on the Columbia River system in Canada (Duncan, Keenleyside, and Mica Dams), and allowed for one additional dam in the United States (Libby Dam). The dams help control floods in both countries, and the regulated stream flow provided by the three Treaty reservoirs in Canada enables dams downstream in the United States to produce additional power (the "downstream power benefits"). Under the Treaty, Canada and the United States share the downstream benefits equally.


Delivery of the Canadian Entitlement Final Environmental Impact Statement Record of Decision Summary; 08Nov1996  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Of Energy, Bonneville Power Administration Of Energy, Bonneville Power Administration US Army Corps of Engineers, North Pacific Division Delivery of the Canadian Entitlement Final Environmental Impact Statement Record of Decision Summary The United States Entity (the Administrator of the Bonneville Power Administration [BPA] and the Division Engineer, North Pacific Division of the US Army Corps of Engineers [Corps]) has decided to fulfill its obligation under the Columbia River Treaty (Treaty) between the United States of America (United States) and Canada by delivering Canada's Entitlement under the Treaty to points on the border between Canada and the United States near Blaine, Washington and Nelway, British Columbia (BC). Delivering the full Entitlement at existing interconnections at those locations will require no new transmission facilities in the


Elucidating the solid, liquid and gaseous products from batch pyrolysis of cotton-gin trash.  

E-Print Network (OSTI)

Cotton-gin trash (CGT) was pyrolyzed at different temperatures and reaction times using an externally-heated batch reactor. The average yields of output products (solid/char, liquid/bio-oil, and gaseous) were determined. The heating value (HV) of CGT was measured to be around 15-16 MJ kg- 1 (6500-7000 Btu lb-1). In the first set of tests, CGT was pyrolyzed at 600, 700, and 800C and at 30, 45, and 60 min reaction period. The maximum char yield of 40% by weight (wt.%) was determined at 600C and 30 min settings, however, the HV of char was low and almost similar to the HV of CGT. A maximum gas yield of 40 wt.% was measured at 800C and 60 min and the highest liquid yield of 30 wt.% was determined at 800C and 30 min. In the modified pyrolysis test, the effects of temperature (500, 600, 700, and 800C) on the product yield and other properties were investigated. The experiment was performed using the same reactor purged with nitrogen at a rate of 1000 cm3 min-1. Gas yield increased as temperature was increased while the effect was opposite on char yield. The maximum char yield of 38 wt.% was determined at 500C and 30 min. The char had the largest fraction in the energy output (70-83%) followed by gas (10-20%) and bio-oil (7- 9%). Maximum gas yield of 35 wt.% was determined at 800C. The average yield of CO, H2 and total hydrocarbons (THC) generally increased with increased temperature but CO2 production decreased. Methane, ethane, and propane dominated the THC. The bio-oil yield at 600C was the highest at about 30 wt.% among the temperature settings. The HV of bio-oil was low (2-5 MJ kg-1) due to minimal non-HC compounds and high moisture content (MC). A simple energy balance of the process was performed. The process was considered energy intensive due to the high amount of energy input (6100 kJ) while generating a maximum energy output of only 10%. After disregarding the energy used for preparation and pyrolysis, the energy losses ranged from 30-46% while the energy of the output represent between 55-70% of the input energy from CGT.

Aquino, Froilan Ludana



Application to Export Electric Energy OE Docket No. EA-216-C TransAlta Energy Marketing (U.S) Inc. Canadian Electrical Association Comments  

Energy.gov (U.S. Department of Energy (DOE))

Protest of the Canadian Electricity Association and the Electric Power Supply Association to Sierra Club's Notice of Intervention and Motion to Intervene in favor of the application to export...


Investigation of the Sensitivity of Water Cycle Components Simulated by the Canadian Regional Climate Model to the Land Surface Parameterization, the Lateral Boundary Data, and the Internal Variability  

Science Conference Proceedings (OSTI)

This study investigates the sensitivity of components of the hydrological cycle simulated by the Canadian Regional Climate Model (CRCM) to lateral boundary forcing, the complexity of the land surface scheme (LSS), and the internal variability ...

Biljana Music; Daniel Caya



Impact of farm policy on cotton prices in the United States: a study of cointegrated textile prices  

E-Print Network (OSTI)

Information surrounding new United States farm policy is disseminated and processed by agricultural stake holders world wide. This information can provide the impetus for investors to trade commodities, farmers to plant, ranchers to sell livestock, and numerous other individuals to get involved in the expectation of an associated price change. New agricultural policy, therefore, is a federal government interruption in "business as usual" cycles and serves to create fluctuations in market price relationships. This thesis suggests that long-run equilibria exist and are distinguished by the farm policy present during the twenty years covered. Key words: cointegration, long-run equilibrium, Raw Fiber Equivalent cotton, AIndex, Memphis, and U.S. Ending Stocks.

Cook, Katherine Renee'



Effects of Oilseed Meals and Isothiocyanates (ITCS) on Phymatotrichopsis omnivora (Cotton Root Rot) and Soil Microbial Communities  

E-Print Network (OSTI)

The meals from many oilseed crops contain biocidal chemicals that are known to inhibit the growth and activity of several soil pathogens, though little is known concerning impacts on whole soil microbial communities. We investigated the effect of oilseed meals (SMs) from both brassicaceous plants, including mustard and camelina, as well as non-brassicaceous plants, including jatropha and flax, on P. omnivora (the casual agent of cotton root rot) in Branyon clay soil (at 1 and 5% application rates). We also investigated the effect of SMs from camelina, jatropha, flax, and wheat straw on microbial communities in Weswood loam soil. We also used four types of isothiocyanates (ITCs) including allyl, butyl, phenyl, and benzyl ITC to test their effects on P. omnivora growth on potato dextrose agar (PDA), as well as on soil microbial communities in a microcosm study. Community qPCR assays were used to evaluate relative abundances of soil microbial populations. Soil microbial community composition was determined through tag-pyrosequencing using 454 GS FLX titanium technology, targeting ITS and 16S rRNA gene regions for fungal and bacterial communities, respectively. The results showed that all tested brassicaceous and jatropha SMs were able to inhibit P. omnivora sclerotial germination and hyphal growth, with mustard SM being the most effective. Flax didn't show any inhibitory effects on sclerotial germination. All tested ITCs inhibited P. omnivora OKAlf8 hyphal growth, and the level of inhibition varied with concentration and ITC type. Total soil fungal populations were reduced by ITC addition, and microbial community compositions were changed following SM and ITC application. These changes varied according to the type of SM or ITC added. Our results indicated that SMs of several brassicaceous species as well as jatropha may have potential for reducing cotton root rot as well as some other pathogens. Different SMs releasing varied ITCs may result in differential impacts on soil microorganisms including some pathogens.

Hu, Ping



Symposium-in-Print Interactive Effects of Ultraviolet-B Radiation and Temperature on Cotton Physiology, Growth  

E-Print Network (OSTI)

Current conditions of 211 kJ m 22 day 21 of UV-B radiation and temperatures of>308C during flowering in cotton cultivated regions are projected to increase in the future. A controlled environment study was conducted in sunlit growth chambers to determine the effects of UV-B radiation and temperature on physiology, growth, development and leaf hyperspectral reflectance of cotton. Plants were grown in the growth chambers at three day/night temperatures (24/168C, 30/228C and 36/288C) and three levels of UV-B radiation (0, 7 and 14 kJ m 22 day 21) at each temperature from emergence to 79 days under optimum nutrient and water conditions. Increases in main stem node number and the node of first fruiting branch and decrease in duration to first flower bud (square) and flower were recorded with increase in temperature. Main effects of temperature and UV-B radiation were significant for net photosynthetic rates, stomatal conductance, total chlorophyll and carotenoid concentrations of uppermost, fully expanded leaves during squaring and flowering. A significant interaction between temperature and UV-B radiation was detected for total biomass and its components. The UV-B radiation of 7 kJ m 22 day 21 reduced boll yield by 68% and 97 % at 30/228C and 36/288C, respectively, compared with yield at 0 kJ m 22 day 21 and 30/228C. No bolls were produced in the three temperature treatments under 14 kJ m 22 day 21 UV-B radiation. The first-order interactions between temperature, UV-B radiation and leaf age were significant for leaf reflectance. This study suggests a growth- and process-related temperature dependence of sensitivity to UV-B radiation.

Hyperspectral Reflectance; K. Raja Reddy; Vijaya Gopal Kakani; Duli Zhao; Sailaja Koti; Wei Gao



Carbon dioxide enrichment: Data on the response of cotton to varying CO{sub 2}, irrigation, and nitrogen  

Science Conference Proceedings (OSTI)

This document presents results from field CO{sub 2}-enrichment experiments conducted over five consecutive growing seasons, 1983--1987. These results comprise data concerning the effects of continuous CO{sub 2} enrichment on the growth of cotton under optimal and limiting levels of water and nitrogen. Unlike many prior C0{sub 2} enrichment experiments in growth chambers or greenhouses, these studies were conducted on field-planted cotton at close to natural conditions using the open-top chamber approach. Measurements were made on a variety of crop response variables at intervals during the growing season and upon crop harvest. The initial experiment examined the effects of varying C0{sub 2} concentration only. In the following two seasons, the interactive effects of C0{sub 2} concentration and water availability were studied. In the final two seasons, the effects of the three-way interaction between C0{sub 2} concentration, water availability, and nitrogen fertility were investigated. The data comprise three types of information: identification variables (such as year, institution and situ codes, and treatment regimens), intermediate growth measurements (such as plant height, leaf area index, number of flowers, and dry weight of leaves) taken at various times during the growing season, and crop harvest results (such as lint yield, seed yield, and total aboveground dry biomass). They are available free of charge as a numeric data package (NAP) from the Carbon Dioxide Information Analysis Center. The NAP consists of this document and a magnetic tape (or a floppy diskette, upon request) containing machine-readable files. This document provides sample listings of the CO{sub 2} enrichment response data as they appear on the magnetic tape or floppy diskette and provides detailed descriptions of the design and methodology of these experiments, as well as a complete hard copy listing of all of the data in the form of a supplemental text provided as an appendix.

Sepanski, R.J. [Tennessee Univ., Knoxville, TN (United States). Energy, Environment and Resources Center; Kimball, B.A.; Mauney, J.R.; La Morte, R.L.; Guinn, G.; Nakayama, F.S.; Radin, J.W.; Mitchell, S.T.; Parker, L.L.; Peresta, G.J.; Nixon, P.E. III; Savoy, B.; Harris, S.M.; MacDonald, R.; Pros, H.; Martinez, J. [Agricultural Research Service, Phoenix, AZ (United States); Lakatos, E.A. [Arizona Univ., Tucson, AZ (United States). Dept. of Soil and Water Science



Aggregating physical intensity indicators: results of applying the composite indicator approach to the Canadian industrial sector  

E-Print Network (OSTI)

Issues surrounding the development, application and interpretation of energy intensity indicators are a continuing source of debate in the field of energy policy analysis. Although economic energy intensity indicators still dominate intensity/efficiency studies, the use of physical energy intensity indicators is on the rise. In the past, physical energy intensity indicators were not employed since it was often impossible to develop aggregate (sector-level or nation-wide) measures of physical energy intensity due to the difficulties associated with adding diverse physical products. This paper presents the results of research conducted specifically to address this aggregation problem. The research focused on the development of the Composite Indicator Approach, a simple, practical, alternative method for calculating aggregate physical energy intensity indicators. In this paper, the Composite Indicator Approach is used to develop physical energy intensity indicators for the Canadian industrial and manufacturing sectors, and is then compared to other existing methods of aggregation. The physical composite indicators developed using this approach are also evaluated in terms of their reliability and overall usefulness. Both comparisons suggest that the Composite Indicator Approach can be a useful, and ultimately suitable, way of addressing the aggregation problem typically associated with heterogeneous sectors of the economy. r

Mallika N; John Nyboer; Mark Jaccard



Inventory of current environmental monitoring projects in the US-Canadian transboundary region  

SciTech Connect

This document presents the results of a study commissioned to survey and summarize major environmental monitoring projects in the US-Canadian transboundary region. Projects with field sites located within 400 km (250 mi) of the border and active after 1980 were reviewed. The types of projects included: ambient air-quality monitoring, ambient water-quality monitoring, deposition monitoring, forest/vegetation monitoring and research, soil studies, and ecosystem studies. Ecosystem studies included projects involving the measurement of parameters from more than one monitoring category (e.g., studies that measured both water and soil chemistry). Individual descriptions were formulated for 184 projects meeting the spatial and temporal criteria. Descriptions included the official title for the project, its common abbreviation, program emphasis, monitoring site locations, time period conducted, parameters measured, protocols employed, frequency of sample collection, data storage information, and the principal contact for the project. A summary inventory subdivided according to the six monitoring categories was prepared using a computerized data management system. Information on major centralized data bases in the field of environmental monitoring was also obtained, and summary descriptions were prepared. The inventory and data base descriptions are presented in appendices to this document.

Glantz, C.S.; Ballinger, M.Y.; Chapman, E.G.



A Search for Narrow Vertical Structures in the Canadian Galactic Plane Survey  

E-Print Network (OSTI)

Worms are defined to be dusty, atomic hydrogen (HI) structures which are observed in low resolution data to rise perpendicular to the Galactic plane. Data from the 1'-resolution Canadian Galactic Plane Survey (CGPS) were systematically searched for narrow vertical HI structures which could be resolved worms. Another motivation for the search was to explore the scenario that mushroom-shaped worms like GW123.4-1.5, studied by English and collaborators, could be generated by a single supernova. However no other vertical structures of mushroom-shape morphology were found. We also examined objects previously classified as worm candidates by Koo and collaborators; only 7 have a significant portion of their structure falling in the CGPS range of l=74 deg to 147 deg, -3.5 deg ~ 500 pc tall, thus extending from the Galactic plane into the halo. We provide details about these narrow vertical structures, including comparisons between HI, radio continuum, IR, and CO observations. Our search was conducted by visual inspection and we describe the limitations of this approach since it indicates that only 6 disk-halo features may exist throughout the Milky Way. We also discuss possible origins of structures at high latitudes and the relationship between mushroom-shaped clouds and old supernova remnants.

Ashish Asgekar; Jayanne English; Samar Safi-Harb; Roland Kothes



Effects of Drought-Stress on Cotton (Gossypium hirsutum L.) and Host-Plant Resistance to Western Flower Thrips (Frankliniella Occidentalis Pergande)  

E-Print Network (OSTI)

Herbivory by Western Flower Thrips (Frankliniella occidentalis Pergande) (WFT) and drought-stress due to limited water availability are currently two major factors that can severely impact cotton (Gossypium hirsutum L.) production. This dissertation examines the effects of drought-stress on cotton and host-plant resistance (HPR) to WFT in laboratory conditions, and seeks to identify the physiological and morphological mechanisms that underlie drought-tolerance and HPR. A life-history systems-approach was developed that provides a new level of detail for understanding how environmental variation impacts adult female WFT. The approach was illustrated by investigating the combined effects of cotton genotype, periodic drought-stress, and prey availability on the adult female omnivorous thrips using a factorial design. Three treatment conditions were significantly different, none of which were predicted based on prevailing ecological-hypotheses. At the same time, the approach produced three novel insights about WFT life-history and reproductive strategy. The roles of negative photo-taxis and leaf biomechanical properties were investigated as potential mechanisms that influence WFT foraging-decisions on individual cotyledons. Results showed that WFT foraging-decisions could be considered adaptive, but there was limited support for either of the mechanisms investigated. The physiological responses to drought stress and drought recovery were investigated for three transgenic cotton cultivars and an untransformed wild-type (WT). At peak drought, ABA levels, stomatal area, and stomatal apertures in the transgenic isolone, AtRAV1-1 were 48% lower, 27.7%, and 16.3% smaller than WT. These results suggest that AtRAV1-1 was the most drought-tolerant and support the hypothesis that changes in stomatal morphology may have functionally contributed to drought-tolerance. Lastly, I investigated whether changes in phytohormone concentrations associated with periodic-drought stress in four cotton cultivars (three transgenic and WT) were correlated with WFT feeding, fitness and state-dependent reproductive responses (i.e., the relationship between initial weight and reproduction). Results showed that JA-Ile and JA were positively correlated with state-dependent egg viability and fecundity, respectively, and negatively correlated with total egg viability and fecundity, respectively, supporting the hypothesis that JA and JA-Ile underlie the negative effects on WFT reproduction and the associated shift to state-dependent reproduction.

Fiene, Justin 1983-



Characterization and analysis of the cotton cyclopropane fatty acid synthase family and their contribution to cyclopropane fatty acid synthesis  

Science Conference Proceedings (OSTI)

Cyclopropane fatty acids (CPA) have been found in certain gymnosperms, Malvales, Litchi and other Sapindales. The presence of their unique strained ring structures confers physical and chemical properties characteristic of unsaturated fatty acids with the oxidative stability displayed by saturated fatty acids making them of considerable industrial interest. While cyclopropenoid fatty acids (CPE) are well-known inhibitors of fatty acid desaturation in animals, CPE can also inhibit the stearoyl-CoA desaturase and interfere with the maturation and reproduction of some insect species suggesting that in addition to their traditional role as storage lipids, CPE can contribute to the protection of plants from herbivory. Three genes encoding cyclopropane synthase homologues GhCPS1, GhCPS2 and GhCPS3 were identified in cotton. Determination of gene transcript abundance revealed differences among the expression of GhCPS1, 2 and 3 showing high, intermediate and low levels, respectively, of transcripts in roots and stems; whereas GhCPS1 and 2 are both expressed at low levels in seeds. Analyses of fatty acid composition in different tissues indicate that the expression patterns of GhCPS1 and 2 correlate with cyclic fatty acid (CFA) distribution. Deletion of the N-terminal oxidase domain lowered GhCPS's ability to produce cyclopropane fatty acid by approximately 70%. GhCPS1 and 2, but not 3 resulted in the production of cyclopropane fatty acids upon heterologous expression in yeast, tobacco BY2 cell and Arabidopsis seed. In cotton GhCPS1 and 2 gene expression correlates with the total CFA content in roots, stems and seeds. That GhCPS1 and 2 are expressed at a similar level in seed suggests both of them can be considered potential targets for gene silencing to reduce undesirable seed CPE accumulation. Because GhCPS1 is more active in yeast than the published Sterculia CPS and shows similar activity when expressed in model plant systems, it represents a strong candidate gene for CFA accumulation via heterologous expression in production plants.

Yu X. H.; Shanklin J.; Rawat, R.


Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Evaluation of water production in tight gas sands in the Cotton Valley formation in the Caspiana, Elm Grove and Frierson fields  

E-Print Network (OSTI)

Normally in tight gas sands, water production is not a problem but in such low permeability reservoirs it is difficult to produce gas at commercial flow rates. Since water is more viscous than gas, very little water is normally produced in low permeability reservoirs. The production of large volumes of water from tight gas sands, say 50-100 bbls of water per MMcf of gas constitutes a cause for concern. High water production (>200 bbls of water per MMcf of gas) has been observed in the low permeability Cotton Valley sands in the Caspiana, Elm Grove and Frierson fields of North Louisiana. This research evaluates water production in the above tight gas sands using field data provided by Matador Resource, a member of the Crisman Institute in Texas A&M university. The research is aimed at providing realistic reservoir scenarios of excess water production in tight gas sands. Log analysis, property trends and well production profiles have been used in establishing the different scenarios. The reservoir simulation results and the production trends show a possible water source from faults and fractures connecting the Travis Peak/Smackover sands to the Cotton Valley sands. An improved understanding of the reservoir would help in further field development.

Ozobeme, Charles Chinedu



Role of contact farmers as a source of information in the adoption of selected cotton practices among small-scale farmers in two districts of Paraguay  

E-Print Network (OSTI)

The purpose of this research was to examine the extent and the manner in which contact farmers in the Training and Visit System of agricultural extension in two districts of eastern Paraguay influenced the dissemination of agricultural information among small-scale follower farmers. The study was conducted in October and November of 2000. Survey instruments were translated into Spanish and data were collected by personal interviews, informal conversations, and through participation in farmer meetings. This descriptive study was based on the responses of 35 Contact Farmers (CF) and 42 Follower Farmers (FF). Results showed that demographic characteristics of the two groups did not differ, except for the level of education (CFs' mean = 6.83, FFs' mean = 5.16, t value = 3.07). The forms of communication used by contact farmers and preferred by follower farmers were individual visits and group meetings. Follower farmers preferred contact farmers, friends, and neighbors, and their own experience to information received from agricultural extensionists. Friends, neighbors, and contact farmers were sources of information that follower farmers stated were available on time, understandable, and trustworthy. Key findings for the adoption of five cotton practices were the following: Paraguayan REBA P-279 was the most recommended, but the Argentine Guazuncho II was most grown; only 9.5% reported the use of the fertilizer formulated as 12-12-17-2; cultural methods of weed control were preferred to chemical control; a 5% increase in plant density from the beginning to the end of the project was seen; and 88% reported that they did not have enough information to control cotton diseases. The knowledge gained will be useful for extension workers, administrators, program managers, policymakers, funding organizations, and the general public to formulate guidelines and organize work programs for disseminating information more effectively to small cotton farmers. Results and recommendations will be presented to the board and staff members of the Agricultural Extension Directorate and the Ministry of Agriculture in order to develop strategies for effective methods of communication long needed among all involved in the agricultural extension process.

Diarte Meza, Nelson Antonio



Final Environmental Assessment Small-Scale Geothermal Power Plant and Direct-Use Geothermal Application at AmeriCulture Inc., Cotton City, NM  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Colorado 80401-3393 Colorado 80401-3393 August 26, 2002 DOE/EA-1396 FINDING OF NO SIGNIFICANT IMPACT For the SMALL-SCALE POWER PLANT AND DIRECT-USE GEOTHERMAL APPLICATION At AMERICULTURE, INC., COTTON CITY, NEW MEXICO AGENCY: U.S. Department of Energy, Golden Field Office ACTION: Finding of No Significant impact (FONSI) SUMMARY: The U.S. Department of Energy (DOE) conducted an Environmental Assessment (EA) of the Small-Scale Power Plant and Direct-Use Application at AmeriCulture, Inc. to evaluate potential impacts of construction and operations that would be funded in part by DOE. Small geothermal power plants have the potential for widespread application, but achieving cost- effectiveness in small plant sizes presents a number of challenges. To address these challenges, DOE is supporting the small-scale field verification projects to (1) determine and validate the


Composition of carbonaceous smoke particles from prescribed burning of a Canadian boreal forest: 1. Organic aerosol characterization by gas chromatography  

SciTech Connect

In this study we examine the molecular organic constituents (C8 to C40 lipid compounds) collected as smoke particles from a Canadian boreal forest prescribed burn. Of special interest are (1) the molecular identity of polar organic aerosols, and (2) the amount of polar organic matter relative to the total mass of aerosol particulate carbon. Organic extracts of smoke aerosol particles show complex distributions of the lipid compounds when analyzed by capillary gas chromatography/mass spectrometry. The molecular constituents present as smoke aerosol are grouped into non-polar (hydrocarbons) and polar {minus}2 oxygen atoms) subtractions. The dominant chemical species found in the boreal forest smoke aerosol are unaltered resin compounds (C20 terpenes) which are abundant in unburned conifer wood, plus thermally altered wood lignins and other polar aromatic hydrocarbons. Our results show that smoke aerosols contain molecular tracers which are related to the biofuel consumed. These smoke tracers can be related structurally back to the consumed softwood and hardwood vegetation. In addition, combustion of boreal forest materials produces smoke aerosol particles that are both oxygen-rich and chemically complex, yielding a carbonaceous aerosol matrix that is enriched in polar substances. As a consequence, emissions of carbonaceous smoke particles from large-scale combustion of boreal forest land may have a disproportionate effect on regional atmospheric chemistry and on cloud microphysical processes.

Mazurek, M.A.; Laterza, C.; Newman, L.; Daum, P. [Brookhaven National Lab., Upton, NY (United States); Cofer, W.R. III; Levine, J.S. [National Aeronautics and Space Administration, Hampton, VA (United States). Langley Research Center; Winstead, E.L. [Science Applications International Corporation, Hampton, VA (United States)



Lead Speciation in House Dust from Canadian Urban Homes Using EXAFS Micro-XRF and Micro-XRD  

SciTech Connect

X-ray absorption fine-structure (XAFS) spectroscopy, micro-X-ray fluorescence ({mu}XRF), and micro-X-ray diffraction ({mu}XRD) were used to determine the speciation of Pb in house dust samples from four Canadian urban homes having elevated Pb concentrations (>1000 mg Pb kg{sup -1}). Linear combination fitting of the XAFS data, supported by {mu}XRF and {mu}XRD, shows that Pb is complexed in a variety of molecular environments, associated with both the inorganic and organic fractions of the dust samples. The inorganic species of lead identified were as follows: Pb metal, Pb carbonate, Pb hydroxyl carbonate, Pb oxide, and Pb adsorbed to iron oxyhydroxides. Pb carbonate and/or Pb hydroxyl carbonate occurred in all four dust samples and accounted for 28 to 75% of total Pb. Pb citrate and Pb bound to humate were the organic species identified. The results of this study demonstrate the ability of XAFS to identify Pb speciation in house dust and show the potential to identify Pb sources from new homes versus older homes. Understanding Pb speciation and how it influences bioaccessibility is important for human health risk assessment and risk management decisions which aim to improve indoor environmental health.

L MacLean; S Beauchemin; P Rasmussen



Three-Year Outcomes of a Canadian Multicenter Study of Accelerated Partial Breast Irradiation Using Conformal Radiation Therapy  

SciTech Connect

Purpose: To report 3-year toxicity, cosmesis, and efficacy of a multicenter study of external beam, accelerated partial breast irradiation (APBI) for early-stage breast cancer. Methods and Materials: Between March 2005 and August 2006, 127 women aged {>=}40 years with ductal carcinoma in situ or node-negative invasive breast cancer {<=}3 cm in diameter, treated with breast-conserving surgery achieving negative margins, were accrued to a prospective study involving five Canadian cancer centers. Women meeting predefined dose constraints were treated with APBI using 3 to 5 photon beams, delivering 35 to 38.5 Gy in 10 fractions, twice a day, over 1 week. Patients were assessed for treatment-related toxicities, cosmesis, and efficacy before APBI and at specified time points for as long as 3 years after APBI. Results: 104 women had planning computed tomography scans showing visible seromas, met dosimetric constraints, and were treated with APBI to doses of 35 Gy (n = 9), 36 Gy (n = 33), or 38.5 Gy (n = 62). Eighty-seven patients were evaluated with minimum 3-year follow-up after APBI. Radiation dermatitis, breast edema, breast induration, and fatigue decreased from baseline levels or stabilized by the 3-year follow-up. Hypopigmentation, hyperpigmentation, breast pain, and telangiectasia slightly increased from baseline levels. Most toxicities at 3 years were Grade 1. Only 1 patient had a Grade 3 toxicity with telangiectasia in a skin fold inside the 95% isodose. Cosmesis was good to excellent in 86% (89/104) of women at baseline and 82% (70/85) at 3 years. The 3-year disease-free survival was 97%, with only one local recurrence that occurred in a different quadrant away from the treated site and two distant recurrences. Conclusions: At 3 years, toxicity and cosmesis were acceptable, and local control and disease-free survival were excellent, supporting continued accrual to randomized APBI trials.

Berrang, Tanya S., E-mail: tberrang@bccancer.bc.ca [British Columbia Cancer Agency-Vancouver Island, BC (Canada); University of British Columbia, BC (Canada); Olivotto, Ivo [British Columbia Cancer Agency-Vancouver Island, BC (Canada); University of British Columbia, BC (Canada); Kim, Do-Hoon [Juravinski Cancer Centre, Ontario (Canada); McMaster University, Ontario (Canada); Nichol, Alan [British Columbia Cancer Agency-Vancouver Centre, BC (Canada); University of British Columbia, BC (Canada); Cho, B.C. John [Princess Margaret Hospital, Ontario (Canada); University of Toronto, Ontario (Canada); Mohamed, Islam G. [British Columbia Cancer Agency-Southern Interior, BC (Canada); University of British Columbia, BC (Canada); Parhar, Tarnjit [British Columbia Cancer Agency-Vancouver Centre, BC (Canada); University of British Columbia, BC (Canada); Wright, J.R. [Juravinski Cancer Centre, Ontario (Canada); McMaster University, Ontario (Canada); Truong, Pauline [British Columbia Cancer Agency-Vancouver Island, BC (Canada); University of British Columbia, BC (Canada); Tyldesley, Scott [British Columbia Cancer Agency-Vancouver Centre, BC (Canada); University of British Columbia, BC (Canada); Sussman, Jonathan [Juravinski Cancer Centre, Ontario (Canada); McMaster University, Ontario (Canada); Wai, Elaine [British Columbia Cancer Agency-Vancouver Island, BC (Canada); University of British Columbia, BC (Canada); Whelan, Tim [Juravinski Cancer Centre, Ontario (Canada); McMaster University, Ontario (Canada)



Supplying Synthetic Crude Oil from Canadian Oil Sands: A Comparative Study of the Costs and CO2 Emissions of Mining and In-Situ Recovery  

E-Print Network (OSTI)

, and of unconventional deposits such as heavy oils, tar sands and oil shales. As conventional oil becomes scarcer, the transport sector will remain dependent on petroleum resources, if no oil substitute is available. Fuels from non-conventional oil resources... www.eprg.group.cam.ac.uk E P R G W O R K IN G P A P E R Abstract Supplying Synthetic Crude Oil from Canadian Oil Sands: A Comparative Study of the Costs and CO2 Emissions of Mining and In-situ Recovery EPRG Working Paper 1005...

Mjean, A; Hope, Chris


Supplying Synthetic Crude Oil from Canadian Oil Sands: A Comparative Study of the Costs and CO2 Emissions of Mining and In-situ Recovery  

E-Print Network (OSTI)

High crude oil prices and the eventual decline of conventional oil production raise the issue of alternative fuels such as non-conventional oil. The paper describes a simple probabilistic model of the costs of synthetic crude oil (SCO) produced from Canadian oil sands. Synthetic crude oil is obtained by upgrading bitumen that is first produced through mining or in-situ recovery techniques. This forward-looking analysis quantifies the effects of learning and production constraints on the costs of supplying synthetic crude oil from Canadian bitumen deposits. The results show the uncertainties associated with the future costs of synthetic crude oil. Carbon costs have a large impact of the total costs of synthetic crude oil, in particular in the case of synthetic crude oil from in-situ bitumen, due to the carbon-intensity of the recovery techniques. The influence of each parameter on the supply costs is examined. In the case of mined SCO, the maximum production rate, the ultimate recovery rate and the depletion parameters show the largest influence on the results, while learning parameters dominate in the case of in-situ SCO.

Aurlie Mjean; Chris Hope; Aurlie Mjean; Chris Hope; Aurlie Mjean; Chris Hope



EPRG WORKING PAPER Supplying Synthetic Crude Oil from Canadian Oil Sands: A Comparative Study of the Costs and CO2 Emissions of Mining and In-situ Recovery  

E-Print Network (OSTI)

High crude oil prices and the eventual decline of conventional oil production raise the issue of alternative fuels such as non-conventional oil. The paper describes a simple probabilistic model of the costs of synthetic crude oil (SCO) produced from Canadian oil sands. Synthetic crude oil is obtained by upgrading bitumen that is first produced through mining or in-situ recovery techniques. This forward-looking analysis quantifies the effects of learning and production constraints on the costs of supplying synthetic crude oil from Canadian bitumen deposits. The results show the uncertainties associated with the future costs of synthetic crude oil. Carbon costs have a large impact of the total costs of synthetic crude oil, in particular in the case of synthetic crude oil from in-situ bitumen, due to the carbon-intensity of the recovery techniques. The influence of each parameter on the supply costs is examined. In the case of mined SCO, the maximum production rate, the ultimate recovery rate and the depletion parameters show the largest influence on the results, while learning parameters dominate in the case of in-situ SCO.

Aurlie Mjean; Chris Hope; Aurlie Mjean; Chris Hope



Reprinted from :r Canadian  

E-Print Network (OSTI)

facilities and raw materials. A further prerequisite was a very tight time schedule, which required lie" DUCTS 6" CONC. SLAB ON GRADE (BY OWNER) (150 mm) I" TO 2" SAND BASE (25-50mm) WALL- FOOTING-50 mm) sand base and after placement of the foundations the main retaining #12;'>, '"; ::1 ,il


Canadian Electrical Association Petition  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Marketing (U.S .) Inc. 's ("TEMUS") Application to Export Electric Energy to Canada. CEA and EPSA seek leave to submit this Protest out of time. In the Federal Register...


PARAID: The Gear-Shifting Power-Aware RAID Charles Weddle, Mathew Oldham, Jin Qian, An-I Andy Wang, Florida State University  

E-Print Network (OSTI)

source of power usage. In web servers, disks typically accounts for 24% of the power usage; in proxy servers, 77% [4, 13]. Storage devices can account for as much as 27% of the electricity cost in a typical cooling requirements [18]. The combined effect also limits the density of computer racks. The lower

Wang, Andy


US Department of Energy, Bonneville Power Administration US Army Corps of Engineers, North Pacific Division Columbia River System Operation Review Canadian Entitlement Allocation Extension Agreements Record of Decision; April 29, 1997  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Columbia River System Operation Review Columbia River System Operation Review Final Environmental Impact Statement Canadian Entitlement Allocation Extension Agreements Record of Decision Summary The Administrator and Chief Executive Officer (CEO) of the Bonneville Power Administration (BPA), acting for BPA, and, as Chairman of the United States Entity (the Administrator and the Division Engineer, North Pacific Division of the United States Army Corps of Engineers), acting on behalf of the United States Entity, has decided to adopt for the Canadian Entitlement Allocation Extension Agreements (CEAEA) a federal hydroelectric projects allocation of 72.5 percent and a non-Federal hydroelectric projects allocation of 27.5 percent. The Columbia River Treaty (Treaty), ratified in 1964, required the construction of three


Description of the Canadian Particulate-Fill WastePackage (WP) System for Spent-Nuclear Fuel (SNF) and its Applicability to Ligh-Water Reactor SNF WPS with Depleted Uranium-Dioxide Fill  

NLE Websites -- All DOE Office Websites (Extended Search)

3502 3502 Chemical Technology Division DESCRIPTION OF THE CANADIAN PARTICULATE-FILL WASTE-PACKAGE (WP) SYSTEM FOR SPENT-NUCLEAR FUEL(SNF) AND ITS APPLICABILITY TO LIGHT- WATER REACTOR SNF WPS WITH DEPLETED URANIUM-DIOXIDE FILL Charles W. Forsberg Oak Ridge National Laboratory * P.O. Box 2008 Oak Ridge, Tennessee 37831-6180 Tel: (423) 574-6783 Fax: (423) 574-9512 Email: forsbergcw@ornl.gov October 20, 1997 _________________________ Managed by Lockheed Martin Energy Research Corp. under contract DE-AC05-96OR22464 for the * U.S. Department of Energy. iii CONTENTS LIST OF FIGURES . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v LIST OF TABLES . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . vii ACRONYMS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .



E-Print Network (OSTI)

Ocean Drilling Program Texas A&M University Research Park 1000 Discovery Drive College Station, Texas of this publication may be obtained from the Director, Ocean Drilling Program, Texas A&M University Research Park Program, Texas A&M University, as an account of work performed under the international Ocean Drilling


Pantex Regional Middle School Science Bowl | U.S. DOE Office...  

Office of Science (SC) Website

Oldham, Parmer, Potter, Randall, Roberts, Sherman, and Swisher Date of Electric Car Competition: 4122014 Please contact the regional coordinator for more information on...


Lung cancer mortality between 1950 and 1987 after exposure to fractionated moderate-dose-rate ionizing radiation in the Canadian fluoroscopy cohort study and a comparison with lung cancer mortality in the atomic bomb survivors study  

Science Conference Proceedings (OSTI)

Current lung cancer risk estimates after exposure to low-linear energy transfer radiation such as X rays are based on studies of people exposed to such radiation at high dose rates, for example the atomic bomb survivors. Radiobiology and animal experiments suggest that risks from exposure at low to moderate dose rates, for example medical diagnostic procedures, may be overestimated by such risk models, but data for humans to examine this issue are limited. In this paper we report on lung cancer mortality between 1950 and 1987 in a cohort of 64,172 Canadian tuberculosis patients, of whom 39% were exposed to highly fractionated multiple chest fluoroscopies leading to a mean lung radiation dose of 1.02 Sv received at moderate dose rates. These data have been used to estimate the excess relative risk per sievert of lung cancer mortality, and this is compared directly to estimates derived from 75,991 atomic bomb survivors. Based on 1,178 lung cancer deaths in the fluoroscopy study, there was no evidence of any positive association between risk and dose, with the relative risk at 1 Sv being 1.00 (95% confidence interval 0.94, 1.07), which contrasts with that based on the atomic bomb survivors, 1.60 (1.27, 1.99). The difference in effect between the two studies almost certainly did not arise by chance (P = 0.0001). This study provides strong support from data for humans for a substantial fractionation/dose-rate effect for low-linear energy transfer radiation and lung cancer risk. This implies that lung cancer risk from exposures to such radiation at present-day dose rates is likely to be lower than would be predicted by current radiation risk models based on studies of high-dose-rate exposures. 25 refs., 8 tabs.

Howe, G.R. [Univ. of Toronto, Ontario (Canada)



Microstructural characterization of a Canadian oil sand  

E-Print Network (OSTI)

The microstructure of oil sand samples extracted at a depth of 75 m from the estuarine Middle McMurray formation (Alberta, Canada) has been investigated by using high resolution 3D X-Ray microtomography ($\\mu$CT) and Cryo Scanning Electron Microscopy (CryoSEM). $\\mu$CT images evidenced some dense areas composed of highly angular grains surrounded by fluids that are separated by larger pores full of gas. 3D Image analysis provided in dense areas porosity values compatible with in-situ log data and macroscopic laboratory determinations, showing that they are representative of intact states. $\\mu$CT hence provided some information on the morphology of the cracks and disturbance created by gas expansion. The CryoSEM technique, in which the sample is freeze fractured within the SEM chamber prior to observation, provided pictures in which the (frozen) bitumen clearly appears between the sand grains. No evidence of the existence of a thin connate water layer between grains and the bitumen, frequently mentioned in th...

Dinh, Hong Doan; Nauroy, Jean-Franois; Tang, Anh-Minh; Souhail, Youssef; 10.1139/T2012-072



Seismic retrofitting of deficient Canadian buildings  

E-Print Network (OSTI)

Many developed countries such as Canada and the United States are facing a significant infrastructure crisis. Most of their facilities have been built with little consideration of seismic design and durability issues. As ...

Gemme, Marie-Claude




E-Print Network (OSTI)

+roJsedlnedou+oecuesso.rrde.rro1e91e+souor?cnr+sopo++ocsnldeq 'olqeeFrl8guqsernbocsuoprnoqopo11equo+odellenuueuo4rpdodeIepe000l

Laval, Université

Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Electronic marketplaces and innovation: the Canadian experience  

Science Conference Proceedings (OSTI)

This paper examines electronic marketplaces as one "digital economy" innovation. Great expectations existed for electronic marketplaces in the late 1990s, leading to the establishment of hundreds of new venues for B2B buying and selling. It was ... Keywords: B2B, Canada, SMEs, e-commerce, electronic marketplaces, innovation, international trade

Philip Rosson; Charles Davis



of Canadian in the 20th  

E-Print Network (OSTI)

WITH SURFACTANT-STABILIZED FOAMS As western Canada's oil fields age,the importance of secondary and tertiary- ary process injection wells. The potential economy of using foams creat- ed by greenhouse or natural gas injection was very attractive. However, since crude oils were known to be effective for foam

Schramm, Laurier L.


Best of the Canadian RoCkies  

E-Print Network (OSTI)

to beautiful Moraine Lake; the crystal-clear lake is nestled in the Valley of the Ten Peaks. Return to your adventure on the Athabasca River led by Rocky Mountain River Guides; and a trip on the Jasper Tramway

Connor, Ed


DOE Solar Decathlon: 2005 Teams - Canadian Solar  

NLE Websites -- All DOE Office Websites (Extended Search)

moment in front of its winter-ready house. Computer-generated image of Canada's 2005 Solar Decathlon house. Sleek rooftop PV panels are just one example of team Canada's...


Soil Organic Carbon in Canadian Soils  

NLE Websites -- All DOE Office Websites (Extended Search)

A. J. VandenBygaart, E. G. Gregorich, and D. A. Angers Agriculture and Agri-Food Canada 960 Carling Avenue Ottawa, Ontario K1A 0C5 Abstract To fulfill commitments under the...


Conservation tillage production systems compared in San Joaquin Valley cotton  

E-Print Network (OSTI)

Manage- ment Survey. Conservation Tillage Data. Conserva-Developing information on conservation tillage pro- ductionin California. In: Proc Conservation Tillage 2002: Research

Mitchell, Jeffrey; Munk, Dan; Prys, Bob; Klonsky, Karen; Wroble, Jon; De Moura, Rich



Biogas production Potential of Cotton Seed Cake and Rapeseed Cake.  

E-Print Network (OSTI)

??A Thesis Submitted to the School of Graduate Studies of Addis Ababa University in Partial Fulfillment of the Requirement for the Degree of Master of (more)

Selamawit, Seyoum



Canadian Environmental Protection Act 2012 (Canada) | Open Energy...  

Open Energy Info (EERE)

Wind energy Active Policy Yes Implementing Sector Federal Program Administrator Environment Canada Primary Website http:www.ec.gc.calcpe-cepadefault.asp?langEn&n24374285...


Canadian Precipitation Patterns Associated with the Southern Oscillation  

Science Conference Proceedings (OSTI)

Precipitation responses over Canada associated with the two extreme phases of the Southern Oscillation (SO), namely El Nio and La Nia, are identified. Using the best available precipitation data from 1911 to 1994, both the spatial and temporal ...

Amir Shabbar; Barrie Bonsal; Madhav Khandekar



Canadian oilsands, heavy oil poised for surge in development  

SciTech Connect

Operators in Canada`s oilsands and heavy oil regions are on the brink of a period of growth that could last well into the next century. Several factors are combining in a scenario a National Task Force report on oilsands says could dramatically increase investment and production in the next 25 years. By then, massive oilsands and heavy oil reserves in northern Alberta could account for as much as 50%--perhaps more--of Canada`s oil production. Technological improvements in recovery and processing have slashed production costs and put nonconventional oil on a more competitive footing with declining reserves of conventional crude in western Canada. At the same time, persistent lobbying by industry and a well researched national study have persuaded federal and provincial governments to introduce a new royalty and fiscal regime designed to bolster oilsands investment. New policies give clear incentives to investors to put money into oilsands and heavy oil projects. Policies also will provide a generic tax treatment for all new projects, long a major objective of oilsands promoters. Previously, royalty and tax agreements were negotiated for project case by case. This paper reviews the resource base and the new operational developments resulting from these policies.




Adverse-Weather Trends in the Canadian Arctic  

Science Conference Proceedings (OSTI)

This study provides an assessment of changes in the occurrence frequency of four types of adverse-weather (freezing precipitation, blowing snow, fog, and low ceilings) and no-weather (i.e., no precipitation or visibility obscuration) events as ...

John M. Hanesiak; Xiaolan L. Wang



Recovery and Packaging of Tritium from Canadian Heavy Water Reactors  

Science Conference Proceedings (OSTI)

Fission Reactor / Proceedings of the Second National Topical Meeting on Tritium Technology in Fission, Fusion and Isotopic Applications (Dayton, Ohio, April 30 to May 2, 1985)

W.J. Holtslander; T.E. Harrison; V. Goyette; J.M. Miller


Canadian Council of Chief Executives | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1.6 million barrels of crude oil per day, which is around 15 percent of our oil imports. Net imports of natural gas from Canada into the United States represent about...


The Canadian Mineralogist Vol. 49, pp. 1065-1078 (2011)  

E-Print Network (OSTI)

light emitting diode LEED low-energy electron diffraction left-coiling (adj.) LEH-MT logging equipment

Downs, Robert T.


Glacier change of the Columbia Icefield, Canadian Rocky Mountains, 19192009  

E-Print Network (OSTI)

Commission Survey maps from 1919, eight sets of aerial photographs from 1948 to 1993, and satellite data from, 1997). The Water Survey of Canada monitored Saskatchewan and Athabasca Glaciers from the 1940s in climate. The primary objective of this study is to use Inter- provincial Boundary Commission Survey (IBCS

Menounos, Brian


A study of algal biomass potential in selected Canadian regions.  

DOE Green Energy (OSTI)

A dynamic assessment model has been developed for evaluating the potential algal biomass and extracted biocrude productivity and costs, using nutrient and water resources available from waste streams in four regions of Canada (western British Columbia, Alberta oil fields, southern Ontario, and Nova Scotia). The purpose of this model is to help identify optimal locations in Canada for algae cultivation and biofuel production. The model uses spatially referenced data across the four regions for nitrogen and phosphorous loads in municipal wastewaters, and CO{sub 2} in exhaust streams from a variety of large industrial sources. Other data inputs include land cover, and solar insolation. Model users can develop estimates of resource potential by manipulating model assumptions in a graphic user interface, and updated results are viewed in real time. Resource potential by location can be viewed in terms of biomass production potential, potential CO{sub 2} fixed, biocrude production potential, and area required. The cost of producing algal biomass can be estimated using an approximation of the distance to move CO{sub 2} and water to the desired land parcel and an estimation of capital and operating costs for a theoretical open pond facility. Preliminary results suggest that in most cases, the CO{sub 2} resource is plentiful compared to other necessary nutrients (especially nitrogen), and that siting and prospects for successful large-scale algae cultivation efforts in Canada will be driven by availability of those other nutrients and the efficiency with which they can be used and re-used. Cost curves based on optimal possible siting of an open pond system are shown. The cost of energy for maintaining optimal growth temperatures is not considered in this effort, and additional research in this area, which has not been well studied at these latitudes, will be important in refining the costs of algal biomass production. The model will be used by NRC-IMB Canada to identify promising locations for both demonstration and pilot-scale algal cultivation projects, including the production potential of using wastewater, and potential land use considerations.

Passell, Howard David; Roach, Jesse Dillon; Klise, Geoffrey T.



Materials Science and Engineering in the Canadian Oil Sands  

Science Conference Proceedings (OSTI)

While people have heard about these "tar sands" in the news, relatively few know what oil sands are, and how they are extracted/processed. This presentation...


DOE Solar Decathlon: Team Alberta: Showcasing the Canadian Experience  

NLE Websites -- All DOE Office Websites (Extended Search)

Houses Now? Arizona Cornell Illinois Iowa State Kentucky Minnesota Ohio State Penn State Puerto Rico Rice Team Alberta Team Boston Team California Team Germany Team Missouri Team...


The Canadian Mineralogist Vol. 41, pp. 239-250 (2003)  

E-Print Network (OSTI)

of plutonium. The global inventory of plutonium is over 1,400 tonnes, of which approximately 450 tonnes have is less than 10 kg. The fate of plutonium, and other fissile nuclides such as the much more abundant 235U

Downs, Robert T.

Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The Powered Generation: Canadians, Electricity, and Everyday Life.  

E-Print Network (OSTI)

??Most studies of electricity in Canada have examined the process of electrification from a business or political perspective, emphasizing the role of private and public (more)

Gucciardo, Dorotea



Multi-jurisdictional environmental impact assessment: Canadian experiences  

SciTech Connect

This research examines complexities surrounding environmental impact assessment (EIA) in a multi-jurisdictional environment, with a specific focus on opportunities for public participation. With almost universal adoption of EIA, projects are increasingly subject to more than one assessment process. Thus there is demand to facilitate inter-jurisdictional coordination of EIAs. Canada has growing expertise with multijuristictional EIA that serves to illustrate the costs and opportunities associated with three different approaches to coordination: standardization, harmonization and substitution. Findings suggest that, although fraught with issues, harmonization is the most realistic approach for coordinating efforts. Harmonization has the potential to minimize duplication, avoid process uncertainty and increase efficiency and effectiveness in EIA. Furthermore, the analysis demonstrates that a bilateral agreement between jurisdictions is the best approach to harmonization, so long as negotiation of the agreement includes opportunities for meaningful participation, and implementation includes activities designed to communicate the assessment responsibilities of each jurisdiction, activities and schedules to the public. The experience of participants of different coordinated EIAs in Canada serves as counsel for on-going and future efforts to facilitate inter-jurisdictional coordination.

Fitzpatrick, Patricia, E-mail: p.fitzpatrick@uwinnipeg.c [Department of Geography, The University of Winnipeg 515 Portage Ave, Winnipeg, Manitoba, R3B 2E9 (Canada); Sinclair, A. John, E-mail: Jsincla@ms.umanitoba.c [Natural Resources Institute, Sinnott Building, 70 Dysart Rd., University of Manitoba Winnipeg, Manitoba, R3T 2N2 (Canada)



Sustainable Transport in Canadian Cities: Cycling Trends and Policies  

E-Print Network (OSTI)

compares travel behavior, transport policies, and trends ininclude non-motorized transport, land use, and regionalAgence Metropolitaine de Transport, Montreal, Quebec.

Pucher, John; Buehler, Ralph



Sustainable Transport in Canadian Cities: Cycling Trends and Policies  

E-Print Network (OSTI)

transport policies, and trends in Germany and the U.S. Other265279. ???. 2005. Cycling Trends and Policies in Canadianin North America? Recent trends and alternative policies to

Pucher, John; Buehler, Ralph



Flare-gas recovery success at Canadian refineries  

SciTech Connect

It appears that some North American refining companies still cling to an old philosophy that flare gas recovery systems are unsafe, unreliable, uneconomic, or unnecessary. Shell Canada's recent experience with two modern systems has proven otherwise. Two of Shell Canada's refineries, at Sarnia, Ont., and Montreal East, Que., have now logged about 6 years' total operating experience with modern flare gas recovery units. The compression facilities in each utilize a two-stage reciprocating machine, one liquid seal drum per flare stack, and an automated load control strategy. The purpose was to recover the normal continuous flow of refinery flare gas for treatment and use in the refinery fuel gas system.

Allen, G.D.; Chan, H.H.; Wey, R.E.



Energy Use and Savings in the Canadian Industrial Sector  

E-Print Network (OSTI)

The changing role of energy as a production input in the industrial sector in Canada is examined. Energy use patterns are reviewed in terms of the energy input types, both purchased and self-produced, the actual energy form and quality requirements, and the residual energy forms, in particular the rejected gaseous and liquid waste heat streams. The trends in the intensity of energy use are examined, in terms of the energy consumed per unit of production output, and relative to the cost of other production inputs. Energy consumption and intensity have been influenced by many factors: energy prices; energy types used; structural composition and product mix; the state of the national economy and international markets, etc. In addition, energy use management with the achievement of optimum economic efficiency of energy use as the objective became an increasing priority for corporate and national energy planning during the 1970's. The potential for saving energy and money, the costs and benefits, are discussed in the light of evidence from a variety of industry and government sources. It appears that the substitution of energy-saving techniques and technologies as a replacement for the use of energy inputs will remain a high priority during the 1980's.

James, B.



Canadian Metallurgical Quarterly (CMQ):Topic Distributions in the ...  

Science Conference Proceedings (OSTI)

Hot workability of Al alloys is charted in comparison to Mg alloys and steels. ... Frequency Modulation Effect on the Solidification of Alloy 718 Fusion Zone.


Canadian RCM Projected Changes to Extreme Precipitation Characteristics over Canada  

Science Conference Proceedings (OSTI)

Changes to the intensity and frequency of hydroclimatic extremes can have significant impacts on sectors associated with water resources, and therefore it is relevant to assess their vulnerabilities in a changing climate. This study focuses on the ...

B. Mladjic; L. Sushama; M. N. Khaliq; R. Laprise; D. Caya; R. Roy



Canadian County, Oklahoma: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

593784°, -98.0465185° 593784°, -98.0465185° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.5593784,"lon":-98.0465185,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Impact of Canada's Voluntary Agreement on Greenhouse Gas Emissions from Light Duty Vehicles  

E-Print Network (OSTI)

April 5. Canadian Vehicle Manufacturers Association (CVMA),equivalent Canadian Vehicle Manufacturers Associationof the Canadian Vehicle Manufacturers Association, Joe

Lutsey, Nicholas P.



Impact of Canadas Voluntary Agreement on Greenhouse Gas Emissions from Light Duty Vehicles  

E-Print Network (OSTI)

April 5. Canadian Vehicle Manufacturers Association (CVMA),equivalent Canadian Vehicle Manufacturers Associationof the Canadian Vehicle Manufacturers Association, Joe

Lutsey, Nicholas P.



Microsoft Word - 06-22-09 FINAL ECAT Comments on OMB Recovery...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

and cotton "acquisitions of incidental amounts of cotton, other natural fibers, or wool incorporated in an end product, for which the estimated value of the cotton, other...


2002 EIA Models Directory  

U.S. Energy Information Administration (EIA)

Canadian Petroleum Association Statistical Handbook Historical Canadian supply and consumption data Mineral Management Service, Federal ...


"Hypermedia Applications: Education" Bob Cotton and Richard Oliver, Understanding Hypermedia. London  

E-Print Network (OSTI)

to the primacy of the written word has come from its more esoteric cousin, the mathematical expression. Both


Farmers' perception of precision technology: The case of autosteer adoption by cotton farmers  

Science Conference Proceedings (OSTI)

Precision agriculture and autosteer technology are, overall, profitable investments for farmers, as previous literature has established. However, what has not been investigated is whether or not farmers perceive these technologies as such. This research ... Keywords: Autosteer, Farmers' perception, Input cost saving, MNL, Multinomial logit estimation, PA, Precision agriculture, RTK, SCPF, Technology adoption

Jeremy M. D'Antoni; Ashok K. Mishra; Hyunjeong Joo



An Analysis of the INFFC Cotton Futures Time Series: Lower Bounds and Testbed Design Recommendations  

E-Print Network (OSTI)

forecasting ranging from option pricing (Hutchinson et al. [1994]), corporate bond rating (Moody and Utans. Consequently, financial markets forecasting models consider incomplete information, while factors not included]). A serious drawback in comparing different financial markets forecasting techniques is a lack of standard

Obradovic, Zoran


Conservation tillage and cover cropping influence soil properties in San Joaquin Valley cotton-tomato crop  

E-Print Network (OSTI)

2006 147 TREATMENTS CTCC: conservation tillage, covercrop CTNO: conservation tillage only STCC: standard tillage,1.24bc 1.35d * CTCC = conservation tillage, cover crop; CTNO

Veenstra, Jessica; Horwath, William; Mitchell, Jeffrey; Munk, Dan



Conservation tillage systems for cotton advance in the San Joaquin Valley  

E-Print Network (OSTI)

consistently shown that conservation tillage can yield asCA. p 17586. With conservation tillage a crop is seeded9. [CCTCSW] Californias Conservation Tillage and Cropping



Conservation tillage and cover cropping influence soil properties in San Joaquin Valley cotton-tomato crop  

E-Print Network (OSTI)

STNO Fertilizer Cover crop Total Harvest Balance . . . . . .conservation tillage, cover crop CTNO: conservation tillagestandard tillage, cover crop STNO: standard tillage only

Veenstra, Jessica; Horwath, William; Mitchell, Jeffrey; Munk, Dan



Large-Scale Utilization of Saline Groundwater for Irrigation of Pistachios Interplanted with Cotton  

E-Print Network (OSTI)

in the better areas. The Belridge Water District in westernof drip tape SDI with typical Belridge Water District cottonlarge-scale grower in the Belridge Water District of NW Kern

Sanden, Blake; Ferguson, Louise; Kallsen, Craig E.; Marsh, Brian; Hutmacher, Robert B.; Corwin, Dennis


Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Cotton Gin Compost As An Alternative Substrate For Horticultural Crop Production.  

E-Print Network (OSTI)

??Nursery and greenhouse vegetable growers are always concerned about the availability and cost of materials used as substrates in their production systems. In recent years, (more)




Atmospheric Response to a Partial Solar Eclipse over a Cotton Field in Central California  

Science Conference Proceedings (OSTI)

The partial solar eclipse on 11 July 1991 in central California, with 58.3% maximum coverage, provided an exceptional opportunity to study the temporal response of processes in the atmospheric boundary layer to an abrupt change in solar ...

Matthias Mauder; R. L. Desjardins; Steven P. Oncley; Ian MacPherson



Inclusion of a TKE Boundary Layer Parameterization in the Canadian Regional Finite-Element Model  

Science Conference Proceedings (OSTI)

The formulation of the regional model recently implemented by the Atmospheric Environment Service of Canada for its operational 48 h NWP forecasts is presented. The emphasis is put on the parameterization of the physical processes, especially ...

R. Benoit; J. Ct; J. Mailhot



Salience of Charter Schools in Educational Policy Debates in Three Canadian Provinces: 1993-2010.  

E-Print Network (OSTI)

??School choice-the movement towards increased parental and student control over public education-has been endorsed extensively as a means of revitalizing and improving public schools. Part (more)

Mindzak, Michael



Systemic Failures' and `Human Error' in Canadian TSB Aviation Accident Reports between 1996 and 2002  

E-Print Network (OSTI)

Johnson,C.W. Holloway,C.M. In A. Pritchett and A. Jackson (eds), HCI in Aerospace 2004, EURISCO, Toulouse, France pp 25-32

Johnson, C.W.


The Canadian Journal of Statistics Vol. 34, No. 4, 2006, Pages ???-???  

E-Print Network (OSTI)

events and characteristics of targets, such as their gender, on the emotional distress through things, or feeling low in energy. Conger, Elder, Lorenz, Simons & Whitbeck (1994) stated that the farm- lected. From the targets, this included their gender and whether they experienced any negative life

Daniels, Michael J.


This article was downloaded by:[Canadian Research Knowledge Network] On: 25 March 2008  

E-Print Network (OSTI)

that biogas derived from household waste and manure can be used as an efficient fuel source for vehicles. A typical digester design is also shown here. It has been shown that an estimate of biogas production can of biogas production for water hyacinth- cow dung mixture and domestic waste is also shown as a case study

Hossain, M. Enamul


Effect of Initial Oil Saturation on In-Situ Combustion Performance of a Canadian Bitumen  

E-Print Network (OSTI)

In-Situ Combustion (ISC) is a very complex thermal recovery process that is strongly affected by the chemical composition and physical properties of reservoir rock and fluids. Stability of the process depends on the amount of heat continuously generated from the chemical reactions between fuel formed during ISC and injected oxygen. Heat generation depends on the amount of fuel formed, which, in turn, is affected by initial oil saturation (IOS). Thus, in this study, ISC process dynamics were investigated at various saturations on 7.5 API Peace River bitumen, under 3.4 l/min air injection rate. Through one-dimensional combustion tube experiments higher combustion front temperatures were observed for increased IOS. The degree of bitumen upgrading was determined in terms of viscosity and API gravity changes. Correlations for hydrogen-carbon ratio, air requirement, consumed fuel, and combustion front velocity were obtained. Good burning characteristics of Peace River bitumen resulted in stable self-sustained combustion with 26.01% IOS. However, an experiment with 13.39% IOS failed because of insufficient fuel generation. Furthermore, X-Ray cross-sectional images were taken along the combustion tube after each run to support and enhance the interpretation of experimental results. Particularly, fluctuations in concentrations of produced gas composition were explained with computed tomography (CT) data.

Aleksandrov, Denis



Used Oil Policies to Protect the Environment: An Overview of Canadian Experiences  

E-Print Network (OSTI)

chemicals added to motor oil to improve engine performance,Refined products such as motor oil and gasoline are moreliters of motor and lubricating oil (Statistics Canada,

Nixon, Hilary; Saphores, Jean-Daniel



GRADUATE RESEARCH OPPORTUNITIES IN APPLIED SCIENCE Effects of Hydroelectric Operations in Canadian Aquatic Ecosystems  

E-Print Network (OSTI)

. C. CAUDILL Fish Ecology Research Laboratory, Department of Fish and Wildlife Resources, College ascension and fallback over a series of large hydroelectric dams within the migration corridor, were hydroelectric dams, a behaviour termed `fallback'. On average, 15­22% of the fishes from studied runs of chinook

Cooke, Steven J.


Bringing climate change down to earth : science and participation in Canadian and Australian climate change campaigns  

E-Print Network (OSTI)

2004a. Business Plan for ACF Community Outreach Campaign "Professor Ian Lowe AO Elected as ACF President 2004 [cited 2Conservation Foundation. 2005e. ACF's Annual Sustainability

Padolsky, Miriam Elana



14 IEEE Canadian Review -Fall / Automne 2000 1.0 Introduction  

E-Print Network (OSTI)

, or Combined Transmission with Off-Peak Storage 4.0 The White Light Emitting Diode (WLED) [1 White Light Emitting Diodes (WLED), running on batteries recharged through simple methods. The power

Irvine-Halliday, Dave


Homogenization and Trend Analysis of Canadian Near-Surface Wind Speeds  

Science Conference Proceedings (OSTI)

Near-surface wind speeds recorded at 117 stations in Canada for the period from 1953 to 2006 were analyzed in this study. First, metadata and a logarithmic wind profile were used to adjust hourly wind speeds measured at nonstandard anemometer ...

Hui Wan; Xiaolan L. Wang; Val R. Swail



U.S. FOB Costs of Canadian LLoydminster Crude Oil (Dollars per Barrel)  

U.S. Energy Information Administration (EIA)

Referring Pages: F.O.B. Costs of Imported Crude Oil for Selected Crude Streams; F.O.B. Costs of Imported Crude Oil for Selected Crude Streams


16 IEEE Canadian Review -Spring / Printemps 2003 1.0 Introduction  

E-Print Network (OSTI)

similar to a traditional permanent magnet DC motor except that operates without brushes and a mechanical/or an electric motor. Adapted from the standard bicycle, the additional components of an e-bike include a bat- tery, a motor and an electronic controller. The primary role of the controller is to provide smooth

Ng, Wai Tung


Revised Interpolation Statistics for the Canadian Data Assimilation Procedure: Their Derivation and Application  

Science Conference Proceedings (OSTI)

The first part of this paper presents the results of a study of the structure of the observed residuals, or differences, between radiosonde data and the short-range forecasts that are used as trial fields in an operational hemispheric data ...

Herschel L. Mitchell; Ccilien Charette; Clment Chouinard; Bruce Brasnett



Smokeless Tobacco Use among Canadian Youth in Grades 9-12.  

E-Print Network (OSTI)

??Youth represent a substantial portion of smokeless tobacco (ST) users in Canada compared to the general population. Highest prevalence of use is typically seen in (more)

Powell, Jennifer



Long Term Storage with Surveillance of Canadian Prototype Nuclear Power Reactors  

Science Conference Proceedings (OSTI)

Atomic Energy of Canada (AECL) was originally formed by the government of Canada in 1952 to perform research in radiation and nuclear areas. In the mid 1950's Canada decided to limit itself to peaceful uses of nuclear energy and AECL embarked on several research and development programs, one of them being the development of nuclear power plants. This led to the development of the CANDU{sup TM} design of heavy water power reactors, of which there are now 29 operating around the world. This presentation discusses the present state of the first two CANDU{sup TM} prototype reactors and a prototype boiling light water reactor and lessons learnt after being in a long-term storage with surveillance state for more than 20 years. AECL facilities undergo decommissioning by either a prompt or a deferred removal approach. Both approaches are initiated after an operating facility has been declared redundant and gone through final operational shutdown. For the deferred approach, initial decommissioning activities are performed to put the facility into a sustainable, safe, shutdown state to minimize the hazards and costs of the ensuing extended storage with surveillance (SWS) or Safestor phase. At the appropriate time, the facility is dismantled and removed, or put into a suitable condition for re-use. AECL has a number of facilities that were built during its history, and some of these are now redundant or will become redundant in the near future. The deferred removal approach is part of AECL's decommissioning strategy for several reasons: 1. Reduction in radiation doses to workers during the final dismantling, 2. No facilities are available yet in Canada for the management of quantity of wastes arising from decommissioning, 3. Financial constraints presented by the number of facilities that will undergo decommissioning, compared to the availability of funds to carry out the work. This has led to the development of a comprehensive decommissioning plan that includes all of AECL's redundant and presently operating facilities. Several significant issues have arisen over the decades these reactors have been in the SWS phase. With the long time frames encompassed by this approach to decommissioning, the storage and maintenance of facility information for future decommissioning, and the knowledge and training of successive generations of staff to perform facility inspections and maintenance are major issues. Complacency of both staff and management is a potential issue. The problem arises primarily because these facilities have been put into a comparatively low hazard state, are remotely located, and not much changes over time and changes are slow. During the period that these facilities have been in this state, regulatory scrutiny and expectations have increased. This along with continuing changes in regulatory staff requires a continuous education and communication activity with the regulator. Because of the long time frames involved, the building structures continue to deteriorate slowly, and repairs and maintenance are required upon occasion. The costs can be significant, for example, to replace a roof. When these occasions arise, the balance of cost and benefit is always questioned, i.e., 'Wouldn't it be better to spend the money on dismantling rather than fixing?'. One positive note is that ancillary buildings that either have very low radiation hazards or were decontaminated during the initial decommissioning activities have been used for several alternate uses. This has helped to defray costs, and also keeps an interest in maintaining the building structures and systems in good condition during the SWS phase. Over the past few years, the lessons learnt from these and other facilities in SWS, have been addressed in a holistic manner by moving from a short-term, project-oriented approach to a comprehensive, long term stewardship approach. Key to this approach was the development of an integrated plan to decommission all of AECL's facilities. One of the prime results of the implementation of this plan was the development of an organiza

Janzen, Rick [Atomic Energy of Canada Ltd., Chalk River Laboratories, Chalk River, Ontario, K0J 1J0 (Canada)



Temperature and Melt Modeling on the Prince of Wales Ice Field, Canadian High Arctic  

Science Conference Proceedings (OSTI)

Near-surface temperature variability and net annual mass balance were monitored from May 2001 to April 2003 in a network of 25 sites on the Prince of Wales Ice Field, Ellesmere Island, Canada. The observational array spanned an area of 180 km by ...

Shawn J. Marshall; Martin J. Sharp



PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Canadian Research Knowledge Network  

E-Print Network (OSTI)

Miyasato a ; Yumiko Naka a ; Jun-ichi Mamiya a ; Motoi Kinoshita a ; Yanlei Yu b ; Christopher J. Barrett c ; Tomiki Ikeda a a Chemical Resources Laboratory, Tokyo Institute of Technology, Midori-ku, Yokohama, Japan, Mizuho, Miyasato, Ryo, Naka, Yumiko, Mamiya, Jun-ichi, Kinoshita, Motoi, Yu, Yanlei, Barrett, Christopher

Barrett, Christopher

Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The Canadian experimental HT release of June 10, 1987, US measurements  

Science Conference Proceedings (OSTI)

In June 1987, an experiment was performed at the Chalk River Nuclear Laboratories in Ontario, Canada, to study the oxidation of elemental tritium (HT) released to the environment. The experiment involved a 30-minute release of 3.54 TBq (95.7 Ci)of HT to the atmosphere at an elevation of one meter. Scientists from six countries participated in the experiment. The air measurements showed HT concentrations downwind of the release in general agreement with classical atmospheric diffusion (Gaussian) up to the maximum distance measured (400 m). The HTO/HT ratios were shown to slowly increase downwind (approx. 4 x 10/sup /minus/5/ at 50 m to almost 10/sup /minus/3/ at 400 m) as conversion of HT took place. After the release, HTO concentrations in the atmosphere remained elevated. Vegetation samples were also taken since the vegetation and associated soil system have been implicated in the oxidation of HT. Freeze-dried water from vegetation samples was found to be low in HTO immediately after the release suggesting a low direct uptake of HTO in air by vegetation. The tritiated water concentration increased during the first day, peaking during the second day (about 15--30 kBq/L of water at 50 m from the source), and decreasing by the end of the second day. This pattern suggests oxidation in the soil followed by plant uptake through sorption of soil water. This was confirmed by measurements taken by other groups at the experiment site. The HTO in vegetation decreased with distance downwind with the same pattern as the HT measured during the release indicating that the oxidation of HT was linearly related to the HT concentration in the atmosphere during the exposure period. An adequate description of the process can be made through the observed phenomenon of HT deposition into the soil with subsequent rapid oxidation by soil bacteria. 30 refs., 10 figs., 4 tabs.

Jalbert, R.A.; Murphy, C.E.



Evaluation of Snowpack Simulations over the Canadian Rockies with an Experimental Hydrometeorological Modeling System  

Science Conference Proceedings (OSTI)

To improve the representation of the land surface in their operational numerical weather prediction (NWP) models, the Meteorological Research Division of Environment Canada (EC) is developing an external hydrometeorological modeling and data ...

Marco L. Carrera; Stphane Blair; Vincent Fortin; Bernard Bilodeau; Dorothe Charpentier; Isabelle Dor



Delivery of the Canadian Entitlement : Final Environmental Impact Statement : Record of Decision, Summary..  

Science Conference Proceedings (OSTI)

The US Entity (the Administrator of the Bonneville Power Administration (BPA) and the Division Engineer, North Pacific Division of the US Army Corps of Engineers) has decided to fulfill its obligation under the Columbia River Treaty (Treaty) between the US and Canada by delivering Canada`s Entitlement under the Treaty to a point on the US/Canada border near Oliver, British Columbia (BC). Delivering the Entitlement at that location will require BPA to construct and operate a new single-circuit 500-kV transmission line from Grand Coulee or Chief Joseph Substation to the US/Canada border, a distance of 135 to 155 kilometers (85 to 95 miles), depending on the alignment selected. This paper describes the decision process and its environmental impacts.

United States. Bonneville Power Administration.



U.S. FOB Costs of Canadian Bow River Heavy Crude Oil ...  

U.S. Energy Information Administration (EIA)

Referring Pages: F.O.B. Costs of Imported Crude Oil for Selected Crude Streams; F.O.B. Costs of Imported Crude Oil for Selected Crude Streams


U.S. Landed Costs of Canadian Bow River Heavy Crude Oil ...  

U.S. Energy Information Administration (EIA)

Referring Pages: Landed Costs of Imported Crude for Selected Crude Streams; Landed Costs of Imported Crude for Selected Crude Streams


A Semi-Implicit Semi-Lagrangian Regional Climate Model: The Canadian RCM  

Science Conference Proceedings (OSTI)

A new regional climate model (RCM) is presented in this paper and its performance is investigated through a pair of 60-day simulations. This new model is based on the dynamical formulation of the Cooperative Centre for Research in Mesometeorology ...

Daniel Caya; Ren Laprise



Modelling the costs of non-conventional oil: A case study of Canadian bitumen  

E-Print Network (OSTI)

in conventional deposits. The longer- term problem of climate change arises from the fuller and longer-term use of coal, and of unconventional deposits such as heavy oils, tar sands and oil shales. (Grubb, 2001) As conventional oil becomes scarcer, the transport... , it is not mobile at reservoir conditions, (Cupcic, 2003): density Oil shale is a fine-grained sedimentary rock rich in organic matter, (USGS, 2005): oil shales contain kerogen, which is a solid, insoluble organic material...

Mjean, A; Hope, Chris


Modeling the Canadian Electric System to Analyze the CO2 Content of Electric Transportation Fuel  

Science Conference Proceedings (OSTI)

Replacing fossil fuel with electricity for transportation can play an important role in reducing CO2 emissions provided the electricity can be used efficiently and can be produced without emitting significant amounts of CO2. Canada offers a particularly attractive opportunity to replace fossil fuels with electricity in the transportation sector because Canada has historically generated electricity with low emissions of CO2 and because the transportation sector is responsible for a larger percentage of na...




E-Print Network (OSTI)

Sciences (CJPAS-ISSN 1715-9997) is a peer reviewed multi-disciplinary specialist journal aimed at promoting research worldwide in Agricultural Sciences, Biological Sciences, Chemical Sciences, Computer and Mathematical Sciences,

Errol Hassan; Jasen Nelson; Walter Leung; Sara Ali; Hao-feng (howie Lai; Ben Shieh; Richard Callaghan; Gordon Mcgregor Reid; David T Cramb; Pratim K Chattaraj; Matthew Cooper; Andrew Alek Tuen; Anatoly S Borisov; Dale Wrubleski



Software Certification Experience in the Canadian Nuclear Industry: Lessons for the Future  

E-Print Network (OSTI)

independent and diverse shutdowns systems, Shut- down System One (SDS1) and Shutdown System Two (SDS2) were. This was not an easy task, and they turned to Dave Parnas for advice. Parnas' scheme for each of SDS1 and SDS2 was to.e., the regulator felt that if changes were made to SDS1 or SDS2, it would be difficult to evaluate the safety

Lawford, Mark


Software certification experience in the canadian nuclear industry: lessons for the future  

Science Conference Proceedings (OSTI)

The computer controlled shutdown systems for the Nuclear Power Generating Station at Darlington, Canada, have been subject to licensing scrutinization on a number of occasions. After the first licence was approved in 1990, the licensee, Ontario Hydro, ... Keywords: nuclear, safety-critical software, software certification

Alan Wassyng; Mark S. Lawford; Thomas S.E. Maibaum



Bringing climate change down to earth : science and participation in Canadian and Australian climate change campaigns  

E-Print Network (OSTI)

energy saving appliances, hybrid cars, and many others. Asefficient appliances, hybrid cars, or low-flow showerheads.

Padolsky, Miriam Elana



Bringing climate change down to earth : science and participation in Canadian and Australian climate change campaigns  

E-Print Network (OSTI)

celebrities Ron MacLean (hockey broadcaster), Robertdata goes by the nickname "the hockey stick graph" (at leastin Canada, home of many hockey fans). This graph shows the

Padolsky, Miriam Elana



Society of the Canadian Institute of Mining, Metallurgy g y W I I I  

Science Conference Proceedings (OSTI)

Em '"' """l-I.' &. Sponsored by the Extraction & Processing Di- Egg 0 Announcing a I vision of The Minerals, Metals & Materials 50- g E E g c A L L ciety (TMS),...


U.S. Landed Costs of Canadian Light Sour Blend Crude Oil ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2009: 35.41: 35.91: 48.71: 49.82: 56.69: 64.76: 63.14: 66.50: 67.73: 71.74: 74.54: 72.47: 2010: 75.78: W: 79.69 ...


U.S. FOB Costs of Canadian Light Sour Blend Crude Oil (Dollars ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2010: 74.09: W: W: W: 69.80: 69.98: 72.04: 72.18: 71.31: 73.92: 80.12: 83.67: 2011: 83.31: W: W: W: W: W: W: W ...


Effects of fire on regional evapotranspiration in the central Canadian boreal forest  

Science Conference Proceedings (OSTI)

Changes in fire regimes are driving the carbon balance of much of the North American boreal forest, but few studies have examined fire-driven changes in evapotranspiration (ET) at a regional scale. This study used a version of the Biome-BGC process model with dynamic and competing vegetation types, and explicit spatial representation of a large (106 km2) region, to simulate the effects of wildfire on ET and its components from 1948 to 2005 by comparing the fire dynamics of the 1948-1967 period with those of 1968-2005. Simulated ET averaged, over the entire temporal and spatial modeling domain, 323 mm yr-1; simulation results indicated that changes in fire in recent decades decreased regional ET by 1.4% over the entire simulation, and by 3.9% in the last ten years (1996-2005). Conifers dominated the transpiration (EC) flux (120 mm yr-1) but decreased by 18% relative to deciduous broadleaf trees in the last part of the 20th century, when increased fire resulted in increased soil evaporation, lower canopy evaporation, lower EC and a younger and more deciduous forest. Well- and poorly-drained areas had similar rates of evaporation from the canopy and soil, but EC was twice as high in the well-drained areas. Mosses comprised a significant part of the evaporative flux to the atmosphere (22 mm yr-1). Modeled annual ET was correlated with net primary production, but not with temperature or precipitation; ET and its components were consistent with previous field and modeling studies. Wildfire is thus driving significant changes in hydrological processes, changes that may control the future carbon balance of the boreal forest.

Bond-Lamberty, Benjamin; Peckham, Scott D.; Gower, Stith T.; Ewers, Brent



Influence of stand age on the magnitude and seasonality of carbon fluxes in Canadian forests  

E-Print Network (OSTI)

Soil Science, University of Manitoba, Winnipeg, MB R3T 2N2,Sites (BERMS) program) and Manitoba, as well as a few otherburned black spruce in Manitoba; HDF-BC: harvested Douglas-?



Used Oil Policies to Protect the Environment: An Overview of Canadian Experiences  

E-Print Network (OSTI)

Used Oil ($/liter) Alberta Manitoba Saskatchewan $ 0.08-$Provinces Province Alberta Manitoba Saskatchewan BritishAlberta Before After Manitoba Before After Saskatchewan

Nixon, Hilary; Saphores, Jean-Daniel



Effect of stand age on whole ecosystem CO 2 exchange in the Canadian boreal forest  

E-Print Network (OSTI)

in Saskatchewan and Manitoba, Canada, J. Geophys. Res. ,spruce stands in central Manitoba during the 1999 and 2000field observations in central Manitoba black spruce forests.

Litvak, Marcy; Miller, S.; Wofsy, S. C.; Goulden, M.


Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1The Canadian Journal of Human Sexuality, Vol. 20 (1) 2011 Introduction  

E-Print Network (OSTI)

.00 214.00 215.00 216.00 217.00 218.00 WHAM (Bowling Green) WHAM (Golden Mile) WHAM (Cc-Craig Emroch) WHAM (Cc-Margam) WHAM (Cc-Margam) WHAM (Chepstow Park West) WHAM (Clocaenog - North Alwen) WHAM (Clocaenog) WHAM (Clocaenog) WHAM (Clocaenog) WHAM (Nantyr - Coupe 41525 Only) WHAM (Dyfnant - Coupe 44134 Only

Sun, Yu


Calibrated Surface Temperature Forecasts from the Canadian Ensemble Prediction System Using Bayesian Model Averaging  

Science Conference Proceedings (OSTI)

Bayesian model averaging (BMA) has recently been proposed as a way of correcting underdispersion in ensemble forecasts. BMA is a standard statistical procedure for combining predictive distributions from different sources. The output of BMA is a ...

Laurence J. Wilson; Stephane Beauregard; Adrian E. Raftery; Richard Verret



Massive dominance of Epsilonproteobacteria in ormation waters from a Canadian oil sands reservoir  

E-Print Network (OSTI)

of uncertainty? What are the key determining factors? Will a transition to unconventional oil undermine of transition to unconventional oil resources. No political or environmental constraints are allowed to hinder, but in terms of the timing and rate of transition from conventional to unconventional oil resources

Voordouw, Gerrit


Development of an Atlantic Canadian Coastal Water Level Neural Network Model  

Science Conference Proceedings (OSTI)

Coastal water-level information is essential for coastal zone management, navigation, and oceanographic research. However, long-term water-level observations are usually only available at a limited number of locations. This study discusses a ...

Guoqi Han; Yu Shi



Regional Climate Projections of Extreme Heat Events in Nine Pilot Canadian Communities for Public Health Planning  

Science Conference Proceedings (OSTI)

Public health planning needs the support of evidence-based information on current and future climate, that could be used by health professionals and decision-makers to better understand and respond to the health impacts of extreme heat. Climate ...

Barbara Casati; Abderrahmane Yagouti; Diane Chaumont


Canadian Climate Services: Exploring an Appropriate Road Map to Fulfill a Growing Need  

Science Conference Proceedings (OSTI)

Under the actual context of climate and environmental changes, national climate information providers are presently updating their approach to deliver targeted and applied services to their clients. WMO has adopted in 2009 a global framework for climate ...

Amadou Bokoye; Louise Bussires; Andr Cotnoir; Jacinthe Lacroix; Luc Vescovi


Canadian Residential Energy End-use Data and Analysis Centre CREEDAC, Dalhousie University  

E-Print Network (OSTI)

-mail: creedac@dal.ca WWW: http://www.dal.ca/daltech/creedac Appliance Choice Functions (CREEDAC-1999: Merih Aydinalp Alan S. Fung V. Ismet Ugursal April, 1999 #12;Appliance Choice Functions Page i/55...........................................................................................32 #12;Appliance Choice Functions Page ii/55 CREEDAC March 1999 LIST OF TABLES Table 1. The number


Canadian Residential Energy End-use Data and Analysis Centre CREEDAC, Dalhousie University  

E-Print Network (OSTI)

], the Modified STAR-HOUSING database (STAtistically Representative HOUSING Stock) [Scanada, 1992, Thermal the Modified STAR-HOUSING database, the 1993/94 "200-House Audit" project, HOT2000 default values and minor annual unit energy consumption (UEC) of houses in the SHEU database. The accuracy of the annual energy


Canadian Residential Energy End-use Data and Analysis Centre CREEDAC, Dalhousie University  

E-Print Network (OSTI)

envelope by adding insulation, and the replacement of the existing heating system and appliances by higher 3 1,437 N/A 40 266 0.03 Cooking appliances 11 374 N/A 40 284 0.03 High efficiency lighting 99 719 9 Appliance Upgrade Scenarios Minor Appliance Upgrade Scenarios Energy Savings For the entire housing stock


Canadian Residential Energy End-use Data and Analysis Centre CREEDAC, Dalhousie University  

E-Print Network (OSTI)

of the data from the 1997 Survey of Household Energy Use (1997 SHEU) database (Statistics Canada, 1998), the Modified STAR-HOUSING database (STAtistically Representative HOUSING Stock) (Scanada, 1992; Ugursal, 1994), the 1993/94 "200-House Audit" project (NRCan, 1994), the 1994 New Housing Survey (NHS) database (NRCan


Canadian Residential Energy End-use Data and Analysis Centre CREEDAC, Dalhousie University  

E-Print Network (OSTI)

of the existing heating system and appliances by higher efficiency units, as well as minor retrofits 51 31 82 50 30 80 310 190 500 1.15 0.88 1.03 Appliance Upgrade Scenarios Replace with high.02 Cooking appliances 11 -71 106 35 0 10 10 -50 70 20 -0.19 0.32 0.04 Minor Appliance Upgrade Scenarios High


Canadian Residential Energy End-use Data and Analysis Centre CREEDAC, Dalhousie University  

E-Print Network (OSTI)

-mail:creedac@dal.ca http://www.dal.ca/~daltech ENERGUIDE FOR HOUSES DATABASE ANALYSIS (CREEDAC-2001-04-03) Submitted to Database Analysis CREEDAC Page v LIST OF TABLES Table 1. The typical EnerGuide Rating and corresponding;EGH Database Analysis CREEDAC Page 1 1 INTRODUCTION The objective of this study is to analyze the EnerGuide


Proceedings of The Canadian Society for Mechanical Engineering Forum 2010 CSME FORUM 2010  

E-Print Network (OSTI)

supply and demand pipeline with 3 phase high voltage transmission from generation sources (nuclear, coal, cities, towns and smaller communities, providing lower voltages in local distribution networks supplying

Victoria, University of


On the Surface-Convection Feedback during Drought Periods on the Canadian Prairies  

Science Conference Proceedings (OSTI)

Linkages between the terrestrial ecosystem and precipitation play a critical role in regulating regional weather and climate. These linkages can manifest themselves as positive or negative feedback loops, which may either favor or inhibit the ...

Julian C. Brimelow; John M. Hanesiak; William R. Burrows



Influence of stand age on the magnitude and seasonality of carbon fluxes in Canadian forests  

E-Print Network (OSTI)

Estimating annual carbon dioxide eddy ?uxes using open-pathJ. , 2010. Ecosystem carbon dioxide ?uxes after disturbanceEnvironmental controls over carbon dioxide and water vapor



Nuclear Technology & Canadian Oil Sands: Integration of Nuclear Power with In-Situ Oil Extraction  

E-Print Network (OSTI)

the feasibility of integrating a nuclear power plant with Steam- Assisted Gravity Drainage (SAGD), an oil region enhance the feasibility of using nuclear power plants to meet the energy needs [5]. Both mining Electricity A second production scenario is the cogeneration of thermal power and electricity to meet the #12


Bringing climate change down to earth : science and participation in Canadian and Australian climate change campaigns  

E-Print Network (OSTI)

Biological Citizens after Chernobyl. Princeton: Princetonover farm safety after the Chernobyl disaster (1992b, 1996).

Padolsky, Miriam Elana



Proceedings of the Seventh Canadian Conference on Computational Geometry, Laval University, Quebec, August, 1995, pp. 7984.  

E-Print Network (OSTI)

For a number of years, we have worked on a project on finding tight packings of polygonal objects in two dimen computational geometry and mathematical programming to the task of compaction: quickly finding tight packings is very difficult to simulate. Consider the problems of animating the sand in an hourglass or the sand

Milenkovic, Victor


Concours Fermat Canada Canadian Team Honour Roll / Palmars des quipes l'chelle nationale  

E-Print Network (OSTI)


Le Roy, Robert J.


Toward Random Sampling of Model Error in the Canadian Ensemble Prediction System  

Science Conference Proceedings (OSTI)

An updated global ensemble prediction system became operational at the Meteorological Service of Canada in July 2007. The new elements of the system include the use of 20 members instead of 16, a single dynamical core [the Global Environmental ...

Martin Charron; Grard Pellerin; Lubos Spacek; P. L. Houtekamer; Normand Gagnon; Herschel L. Mitchell; Laurent Michelin


Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Projected Changes to Streamflow Characteristics over Western Canada as Simulated by the Canadian RCM  

Science Conference Proceedings (OSTI)

Intensification of the global hydrological cycle and increase in precipitation for some regions around the world, including the northern mid- to high latitudes, is expected in a changing climate. Changes in the amount of seasonal precipitation and ...

V. Poitras; L. Sushama; F. Seglenieks; M. N. Khaliq; E. Soulis



KEEPING THE FUTURE BRIGHT 2004 Canadian Electricity Human Resource Sector Study  

E-Print Network (OSTI)

consisting of about 50 percent methane and 50 percent carbon dioxide. Biogas production typically begins one or two years after waste placement and may last for decades. Biogas production may vary significantly


Department of Energy, Bonneville Power Administration Delivery of the Canadian Entitlement  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

349 349 Federal Register / Vol. 64, No. 75 / Tuesday, April 20, 1999 / Notices which is available free at either of the preceding sites. If you have questions about using the pdf, call the U.S. Government Printing officer toll free at 1-888-293-6498. Note: The official version of this document is the document published in the Federal Register. Program Authority: 20 U.S.C. 7131. Dated: April 16, 1999. (Catalog of Federal Domestic Assistance Number 84.184H Office of Elementary and Secondary Education-Safe and Drug-Free Schools and Communities National Programs-Federal Activities -State and Regional Coalition Grant Competition to Prevent High-Risk Drinking Among College Students) Judith Johnson, Acting Assistant Secretary for Elementary and Secondary Education. [FR Doc. 99-10025 Filed 4-19-99; 8:45 am]



Gasoline and Diesel Fuel Update (EIA)

Canadian Bow River Heavy Canadian Light Sour Blend Canadian Lloydminster Ecuadorian Oriente Ecuadorian Napo 1983 Average ... - - 25.62 - 25.27 28.90 - 1984 Average...


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

energy.govsavingscanada-oil-and-gas-operations-act-canada Rebate Canadian River Compact (Texas) The Canadian River Commission administers the Canadian River Compact which...


Canadas Voluntary Agreement on Vehicle Greenhouse Gas Emissions: When the Details Matter  

E-Print Network (OSTI)

17.10.2005). Canadian Vehicle Manufacturers Association,of the Canadian Vehicle Manufacturers Association, JoeTherefore, the Canadian vehicle manufacturers are committed

Lutsey, Nicholas P.; Sperling, Dan



Texas | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Canadian River Compact (Texas) The Canadian River Commission administers the Canadian River Compact which includes the states of New Mexico, Oklahoma, and Texas. Signed in 1950 by...


Ethanol production of semi-simultaneous saccharification and fermentation from mixture of cotton gin waste and recycled paper sludge  

E-Print Network (OSTI)

4 ORIGINAL PAPER Ethanol production of semi-simultaneousAbstract Ethanol production from the steam-exploded mixtureperiod during ethanol production of SSF from the mixture.

Shen, Jiacheng; Agblevor, Foster A.



ABSTRACT: The effect of the cotton storage trisaccharide raf-finose and cottonseed storage protein (CSP) in combination on  

E-Print Network (OSTI)

(CSP) in combination on aflatoxin production by Aspergillus flavus was investigated. The ability and CSP was the sole nitrogen source, aflatoxin levels were stimulated up to fourfold above those or raffinose was capable of providing accessible carbon to A. flavus. Raffi- nose and CSP in developing

Cotty, Peter J.


Government Policy, Housing, and the Origins of Securitization, 1780 - 1968  

E-Print Network (OSTI)

sell cotton in Russia, wheat and flour in the Philippines,government of China to buy wheat, flour, and cotton (Nourse,

Quinn, Sarah Lehman



Characterizing and predicting ultrafine particle counts in Canadian classrooms during the winter months: Model development and evaluation  

SciTech Connect

School classrooms are potentially important micro-environments for childhood exposures owing to the large amount of time children spend in these locations. While a number of airborne contaminants may be present in schools, to date few studies have examined ultrafine particle (0.02-1 {mu}m) (UFP) levels in classrooms. In this study, our objective was to characterize UFP counts (cm{sup -3}) in classrooms during the winter months and to develop a model to predict such exposures based on ambient weather conditions and outdoor UFPs, as well as classroom characteristics such as size, temperature, relative humidity, and carbon dioxide levels. In total, UFP count data were collected on 60 occasions in 37 occupied classrooms at one elementary school and one secondary school in Pembroke, Ontario. On average, outdoor UFP levels exceeded indoor measures by 8989 cm{sup -3} (95% confidence interval (CI): 6382, 11 596), and classroom UFP counts were similar at both schools with a combined average of 5017 cm{sup -3} (95% CI: 4300, 5734). Of the variables examined only wind speed and outdoor UFPs were important determinants of classrooms UFP levels. Specifically, each 10 km/h increase in wind speed corresponded to an 1873 cm{sup -3} (95% CI: 825, 2920) decrease in classroom UFP counts, and each 10 000 cm{sup -3} increase in outdoor UFPs corresponded to a 1550 cm{sup -3} (95% CI: 930, 2171) increase in classroom UFP levels. However, high correlations between these two predictors meant that the independent effects of wind speed and outdoor UFPs could not be separated in multivariable models, and only outdoor UFP counts were included in the final predictive model. To evaluate model performance, classroom UFP counts were collected for 8 days at two new schools and compared to predicted values based on outdoor UFP measures. A moderate correlation was observed between measured and predicted classroom UFP counts (r=0.63) for both schools combined, but this relationship was not valid on days in which a strong indoor UFP source (electric kitchen stove) was active in schools. In general, our findings suggest that reasonable estimates of classroom UFP counts may be obtained from outdoor UFP data but that the accuracy of such estimates are limited in the presence of indoor UFP sources.

Weichenthal, Scott [Department of Epidemiology, Biostatistics and Occupational Health, Faculty of Medicine, McGill University, 1130 Pine Avenue West, Room B10, Charles Meredith House, Montreal, Que., H3A 1A3 (Canada)], E-mail: sweich@po-box.mcgill.ca; Dufresne, Andre; Infante-Rivard, Claire; Joseph, Lawrence [Department of Epidemiology, Biostatistics and Occupational Health, Faculty of Medicine, McGill University, 1130 Pine Avenue West, Room B10, Charles Meredith House, Montreal, Que., H3A 1A3 (Canada)



Evolution of the Arctic Ocean Salinity, 200708: Contrast between the Canadian and the Eurasian Basins  

Science Conference Proceedings (OSTI)

The authors investigate the variability of salinity in the Arctic Ocean and in the Nordic and Labrador Seas over recent years to see how the freshwater balance in the Arctic and the exchanges with the North Atlantic have been affected by the ...

Camille Lique; Gilles Garric; Anne-Marie Treguier; Bernard Barnier; Nicolas Ferry; Charles-Emmanuel Testut; Fanny Girard-Ardhuin



9th Annual North American Waste to Energy Conference A CANADIAN PERSPECTIVE ON WASTE-TO-ENERGY  

E-Print Network (OSTI)

-TO-ENERGY Ninth Annual North American Waste-To-Energy Conference May 6-9, 2001 Miami, Florida Rob C. Rivers, CET on a real time basis, via remote modem from the Region's and MacViro offices. · Providing for monthly area for the waste prior to being loaded into the incinerator. The storage area has a capacity

Columbia University


Evolving Priorities: Canadian Oil Policy and the United States in the years leading up to the Oil Crisis of 1973.  

E-Print Network (OSTI)

??This study investigates the relationship between the oil industries of Canada and the United States in the years leading up to the 1973 oil crisis. (more)

Muller, Ian



Internal Variability of the Canadian RCMs Hydrological Variables at the Basin Scale in Quebec and Labrador  

Science Conference Proceedings (OSTI)

The effect of a regional climate models (RCMs) internal variability (IV) on climate statistics of annual series of hydrological variables is investigated at the scale of 21 eastern Canada watersheds in Quebec and Labrador. The analysis is ...

Marco Braun; Daniel Caya; Anne Frigon; Michel Slivitzky



P2-26: X-ray Micro-Laue Diffraction in 3D at the Canadian Light ...  

Science Conference Proceedings (OSTI)

P1-04: 3D Microstructural Characterization of Uranium Oxide as a Surrogate Nuclear ... P1-15: Gating System Optimisation Design Study of a Cast Automobile ... P2-27: Characterization of Carbonate Rocks through X-ray Microtomography.


Ice Volume and Subglacial Topography for Western Canadian Glaciers from Mass Balance Fields, Thinning Rates, and a Bed Stress Model  

Science Conference Proceedings (OSTI)

A method is described to estimate the thickness of glacier ice using information derived from the measured ice extent, surface topography, surface mass balance, and rate of thinning or thickening of the ice column. Shear stress beneath an ice ...

Garry K. C. Clarke; Faron S. Anslow; Alexander H. Jarosch; Valentina Radi?; Brian Menounos; Tobias Bolch; Etienne Berthier



Lead speciation in indoor dust: a case study to assess old paint contribution in a Canadian urban house  

SciTech Connect

Residents in older homes may experience increased lead (Pb) exposures due to release of lead from interior paints manufactured in past decades, especially pre-1960s. The objective of the study was to determine the speciation of Pb in settled dust from an urban home built during WWII. X-ray absorption near-edge structure (XANES) and micro-X-ray diffraction (XRD) analyses were performed on samples of paint (380-2,920 mg Pb kg{sup -1}) and dust (200-1,000 mg Pb kg{sup -1}) collected prior to renovation. All dust samples exhibited a Pb XANES signature similar to that of Pb found in paint. Bulk XANES and micro-XRD identified Pb species commonly found as white paint pigments (Pb oxide, Pb sulfate, and Pb carbonate) as well as rutile, a titanium-based pigment, in the <150 {micro}m house dust samples. In the dust fraction <36 {micro}m, half of the Pb was associated with the Fe-oxyhydroxides, suggesting additional contribution of outdoor sources to Pb in the finer dust. These results confirm that old paints still contribute to Pb in the settled dust for this 65-year-old home. The Pb speciation also provided a clearer understanding of the Pb bioaccessibility: Pb carbonate > Pb oxide > Pb sulfate. This study underscores the importance of taking precautions to minimize exposures to Pb in house dust, especially in homes where old paint is exposed due to renovations or deterioration of painted surfaces.

Beauchemin, Suzanne; MacLean, Lachlan C.W.; Rasmussen, Pat E. (Health Canada); (NRC)



Annual Report of the Columbia River Treaty, Canadian and United States Entities: 1 October 1992--30 September 1993.  

DOE Green Energy (OSTI)

This annual Columbia River Treaty Entity Report is for the 1993 Water Year, 1 October 1992 through 30 September 1993. It includes information on the operation of Mica, Arrow, Duncan, and Libby reservoirs during that period with additional information covering the reservoir system operating year, 1 August 1992 through 31 July 1993. The power and flood control effects downstream in Canada and the United States are described. This report is the twenty-seventh of a series of annual reports covering the period since the ratification of the Columbia River Treaty in September 1964.

Columbia River Treaty Operating Committee; B.C. Hydro; United States. Bonneville Power Administration



Annual Report of the Columbia River Treaty, Canadian and United States Entities, October 1, 1995--September 30, 1996.  

DOE Green Energy (OSTI)

Agreements approved by the Entities during the period of this report include: (1) Columbia River Treaty Entity Agreement on the Detailed Operating Plan for Columbia River Storage for 1 August 1995 through 31 July 1996, signed 31 January 1996. (2) Columbia River Treaty Entity Agreement on the Detailed Operating Plan for Columbia River Storage for 1 August 1996 through 31 July 1997, signed 29 August 1996. (3) Columbia River Treaty Entity Agreement on Resolving the Dispute on Critical Period Determination, the Capacity Entitlement for the 1998/99, 1999/00, and 2000/01 AOP/DDPB`s, and Operating Procedures for the 2001/02 and Future AOP`s, signed 29 August 1996.

Columbia River Treaty Operating Committee; B.C. Hydro; United States. Bonneville Power Administration


Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


An attempt to value Canadian oil and natural gas reserves : an extension of the hotelling valuation principle .  

E-Print Network (OSTI)

??The importance of the Hotelling Valuation Principle (HVP) in economic study lies in its ability to examine and drive the decision of how much of (more)

Shumlich, Michael



A Real-Time North American Forecast at 10-km Resolution with the Canadian MC2 Meso-LAM  

Science Conference Proceedings (OSTI)

The next generation of high-performance computers will be based on clusters of shared-memory symmetric multiprocessor (SMP) nodes interconnected by a low-latency, high-bandwidth network. In this paper, the parallel performance of the ...

S. J. Thomas; M. Desgagn; R. Benoit



Disjointed connections : the presidential permitting of tar sands oil pipelines at the U.S.-Canadian border.  

E-Print Network (OSTI)

??The fuel for dynamic change in the United States energy relationship with Canada lies in immense deposits of tar sands beneath the boreal forests of (more)

Tomasovic, Brian Scott



Lead Speciation in Indoor Dust: A Case Study to Assess Old Paint Contribution in a Canadian Urban House  

SciTech Connect

Residents in older homes may experience increased lead (Pb) exposures due to release of lead from interior paints manufactured in past decades, especially pre-1960s. The objective of the study was to determine the speciation of Pb in settled dust from an urban home built during WWII. X-ray absorption near-edge structure (XANES) and micro-X-ray diffraction (XRD) analyses were performed on samples of paint (380-2,920 mg Pb kg{sup -1}) and dust (200-1,000 mg Pb kg{sup -1}) collected prior to renovation. All dust samples exhibited a Pb XANES signature similar to that of Pb found in paint. Bulk XANES and micro-XRD identified Pb species commonly found as white paint pigments (Pb oxide, Pb sulfate, and Pb carbonate) as well as rutile, a titanium-based pigment, in the <150 m house dust samples. In the dust fraction <36 {mu}m, half of the Pb was associated with the Fe-oxyhydroxides, suggesting additional contribution of outdoor sources to Pb in the finer dust. These results confirm that old paints still contribute to Pb in the settled dust for this 65-year-old home. The Pb speciation also provided a clearer understanding of the Pb bioaccessibility: Pb carbonate > Pb oxide > Pb sulfate. This study underscores the importance of taking precautions to minimize exposures to Pb in house dust, especially in homes where old paint is exposed due to renovations or deterioration of painted surfaces.

S Beauchemin; L MacLean; P Rasmussen



Annual Report of the Columbia River Treaty, Canadian and United States Entities, 1 October 1993--30 September 1994.  

DOE Green Energy (OSTI)

The report describes the operation of Mica, Arrow, Duncan, and Libby reservoirs for the 1994 Water Year, 1 Oct 1993 through 30 Sept 1994, with additional information covering the reservoir system operating year, 1 August 1993 through 31 July 1994. The report is divided into: introduction, treaty organization, operating arrangements, weather and streamflow, reservoir operation, and power and flood control accomplishments.

Columbia River Treaty Operating Committee; B.C. Hydro; United States. Bonneville Power Administration



A lower crustal perspective on the stabilization and reactivation of continental lithosphere in the western Canadian shield  

E-Print Network (OSTI)

New geochronological, thermochronological, geological and isotopic data from an extensive (> 20,000 km) exposure of high-pressure granulites (0.8 to > 1.5 GPa, >750 ?C) in the East Lake Athabasca region of the Snowbird ...

Flowers, Rebecca Marie



A replicated survey of software testing practices in the Canadian province of Alberta: What has changed from 2004 to 2009?  

Science Conference Proceedings (OSTI)

Software organizations have typically de-emphasized the importance of software testing. In an earlier study in 2004, our colleagues reported the results of an Alberta-wide regional survey of software testing techniques in practice. Five years after that ... Keywords: Canada, Software testing practices, Survey

Vahid Garousi; Tan Varma



Radial-fit bolts save millions  

Science Conference Proceedings (OSTI)

The Radial Fit Coupling Bolt, developed by Pilgrim International in Oldham, England, is a device for coupling turbine shafts. It has been available for more than six years, and has now completed a full outage cycle. Bolts removed during a routine service outage at two nuclear power stations were undamaged, and could not only be reused but each reinstalled in minutes. Several power stations in England and the US which installed radial fit coupling bolts to turbines five years ago are now finding dramatic savings in outage costs, through the greater ease of separation and reassembly of turbine shafts, and the reusability of the bolts. 2 figs.

Jeffs, E.




Gasoline and Diesel Fuel Update (EIA)

Year Quarter Month Angolan Cabinda Canadian Bow River Canadian Lloydminster Ecuadorian Oriente Gabon Rabi-Kouanga 1978 Average ... 13.32 - - 12.87 - 1979 Average ......


July 2002.pub  

NLE Websites -- All DOE Office Websites (Extended Search)

research organizations. For more information, contact the Canadian Clean Power Coalition, Peter Symons, psymons@telusplanet.net. Canadian Corporate Newswire, "Saskatchewan Joins...


An analysis of the level of trust texas cotton producers place in the texas newspaper media: a qualitative determination of the behavioral characteristics of trust.  

E-Print Network (OSTI)

??Newspapers have long played a role in providing information to a wide-range of audiences. Newspapers offer a well-known mode of communication for a variety of (more)

Foster, Jerod W



The use of multi-temporal MODIS images with ground data to distinguish cotton from maize and sorghum fields in smallholder agricultural landscapes of Southern Africa  

Science Conference Proceedings (OSTI)

In this study, we test whether we can significantly p Gossypium hirsutum L. fields from maize Zea mays L. and sorghum Sorghum ...

Mbulisi Sibanda; Amon Murwira



GMOs in animal agriculture: time to consider both costs and benefits in regulatory evaluations  

E-Print Network (OSTI)

81%), corn (35%), and canola (30%) crops grown globally areGE corn, soybean, cotton, canola, wheat, potato, alfalfa,Soybeans Maize (Corn) Cotton Canola Page 9 of 14 animal feed

Van Eenennaam, Alison L



Vol.15 No.1 JULY 2011 ISSN:1174-3646 Earthquake Hazard Centre Newsletter, Vol. 15 No. 1, July 2011  

E-Print Network (OSTI)

. The preparation involved adhering cotton canvas to a plywood wall surface with polymer gel and gesso, impregnating

Frean, Marcus


U.S. International Trade in Goods and Services | Data.gov  

NLE Websites -- All DOE Office Websites (Extended Search)

Glassplate, Glassware, Gloucester, gold, Good, goods, cotton, nontextile, textile, wool, grade, Gramercy, Grand, Grande, Grant, Great, Greece, Green, Greenland,...


Effect of Nanometer-Sized Titanium Dioxide on the Piezodielectric ...  

Science Conference Proceedings (OSTI)

Abstract Scope, Carbon fiber sulphoaluminate cement composites prepared by ... Electrical Resistance Investigation of Cotton Fabrics After Treating with...


Pegasus plow  

DOE Green Energy (OSTI)

The Pagasus plow is a new implement for one-pass cotton plowdown. The Pagasus is unique in that it is capable of burying the whole cotton stalk without shredding. A very simple and reliable machine, the Pagasus gives the cotton farmer the option of using controlled traffic tillage without sacrificing good residue burial of easy machine maintenance.

Thacker, G.W.



U.S. Natural Gas Imports and Exports: 2004  

U.S. Energy Information Administration (EIA)

Statistical Handbook. 5 Canadian Association of Petroleum Producers, Statistical Handbook. http://www.capp.ca.


MIT Joint Program on the Science and Policy of Global Change  

E-Print Network (OSTI)

a Canadian supplied heavy water (CANDU) reactor that was ostensibly operated for non-military purposes


An Analysis of the Ontario Power Authority's  

E-Print Network (OSTI)

Research Council of Canada, Atomic Energy of Canada Ltd., and the Canadian Deuterium Uranium (CANDU) Owners

Bunch, Martin J.

Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


May 2010, Volume 49, No. 5 19 Simulation of Bacterial Souring Control  

E-Print Network (OSTI)

the vast residual oil resources in the many Canadian waterflooded oil fields. The possibilities are truly

Voordouw, Gerrit


The genetic basis of multiple sclerosis: a model for MS susceptibility  

E-Print Network (OSTI)

NJ, Sadovnick AD, Ebers GC, the Canadian Collaborative Study Group: Twin concordance and sibling recurrence rates

Goodin, Douglas S



~ Book Lists & Content Area Connections~ For PJ Teachers Who Love to Read  

E-Print Network (OSTI)

~ Book Lists & Content Area Connections~ For PJ Teachers Who Love to Read http Children's Book Awards Track Canadian children's & YA book awards at the Canadian Children's Book Centre Canadian Library Association Book of the Year for Children Elizabeth Mrazik-Cleaver Canadian Picture Book

Ellis, Randy



E-Print Network (OSTI)

Laboratory, at the 1977 Canadian Symposium un Theoretical Chemistry at the University of New Brunswick,

Authors, Various



India to allow cotton exports from November | 29 September 2010 | www.commodityonline.com http://www.commodityonline.com/news/India-to-allow-cotton-exports-from-November-32138-3-1.html[9/29/2010 8:15:53 AM  

E-Print Network (OSTI)

chain--raw material and component producers, product assemblers, wholesalers, retailer merchants" certification, woody biomass for fuel energy, competition for wood inputs between biofuels and traditional wood increased research into developing of renewable fuels. Although first-generation biofuels are dependent

Rock, Chris


The Canadian MC2: A Semi-Lagrangian, Semi-Implicit Wideband Atmospheric Model Suited for Finescale Process Studies and Simulation  

Science Conference Proceedings (OSTI)

This paper attempts to document the developmental research and early mesoscale results of the new fully nonhydrostatic atmospheric model called MC2 (mesoscale compressible community). Its numerical scheme is the semi-implicit semi-Lagrangian ...

Robert Benoit; Michel Desgagn; Pierre Pellerin; Simon Pellerin; Yves Chartier; Serge Desjardins



Manhood, Rivalry, and the Creation of a Canadian "Hockey World": Media Coverage of Early Stanley Cup Hockey Challenges, 1894-1907.  

E-Print Network (OSTI)

??This study examines media narratives of high-level amateur and professional hockey in Canada during the late nineteenth and early twentieth centuries. In particular, this project (more)

Lorenz, Stacy Lyle



APPROXIMATE YEARLY BUDGET, 20112012 (summer, fall, winter) the table below shows an estimate of the yearly cost per person for studying in montral. all amounts are in Canadian  

E-Print Network (OSTI)

) immigration (temporary residents) 300 $ arrival from abroad (hotel, meals...) 500 $ winter clothing 800.santeetudiante.com (in french only). 9 these amounts include furniture, utilities (water, electricity, heating

Skorobogatiy, Maksim


Learning from the Past - Evaluating Forecasts for Canadian Oil Sands Production with Data; Utvrdering av historiska prognoser av oljesand i Kanada.  

E-Print Network (OSTI)

?? Crude oil plays an important role for the global energy system. As there is ample evidence that conventional oil production will have peaked by (more)

Hehl, Friedrich



What on EarthA Canadian Newsletter for the Earth Sciences Volume5. Number 1, December 2007 ISSN 1703-5104  

E-Print Network (OSTI)

together and seizing opportunities has clearly contributed to her many successes. Marcel R. Coutu BSc Earth Sciences '76 Calgary, Alberta Mr Coutu has more than 25 years of experience in the resource and energyLines where he helped finance its mainline expansion and international projects. Mr Coutu worked many years

Le Roy, Robert J.


FACE: Free-Air CO{sub 2} Enrichment for plant research in the field  

DOE Green Energy (OSTI)

Research programs concerning the effects of Carbon Dioxide(CO){sub 2} on cotton plants are described. Biological responses studied include foliage response to CO{sub 2} fluctuations; yield of cotton exposed to CO{sub 2} enrichment; responses of photosynthesis and stomatal conductance to elevated CO{sub 2} in field-grown cotton; cotton leaf and boll temperatures; root response to CO{sub 2} enrichment; and evaluations of cotton response to CO{sub 2} enrichment with canopy reflectance observations.

Hendrey, G.R. [ed.



FACE: Free-Air CO[sub 2] Enrichment for plant research in the field  

DOE Green Energy (OSTI)

Research programs concerning the effects of Carbon Dioxide(CO)[sub 2] on cotton plants are described. Biological responses studied include foliage response to CO[sub 2] fluctuations; yield of cotton exposed to CO[sub 2] enrichment; responses of photosynthesis and stomatal conductance to elevated CO[sub 2] in field-grown cotton; cotton leaf and boll temperatures; root response to CO[sub 2] enrichment; and evaluations of cotton response to CO[sub 2] enrichment with canopy reflectance observations.

Hendrey, G.R. (ed.)



Pumping test and fluid sampling report, Mansfield No. 1 well, Palo Duro Basin: Report of the Geologic Project Manager, Permian Basin  

SciTech Connect

This report describes pumping test and fluid sampling activities performed at the Mansfield No. 1 well in Oldham County about 10 miles north of Vega, Texas. The well site was selected by TBEG and is located along the northern margin of the Palo Duro Basin in an area of active dissolution with the Permian salt sections. The objectives of the pumping test and fluid sampling program were to collect data to determine the hydrologic characteristics (formation pressure and permeability) of deep water bearing formations, and to obtain formation fluid samples for analyses (gas and fluid chemistry) in order to evaluate fluid migration and age relationships in the Permian Basin. 4 refs., 8 figs., 2 tabs.

Not Available



Step-by-Step Instructions  

NLE Websites -- All DOE Office Websites (Extended Search)

Kentucky Kentucky based upon the simple prescriptive option of the 2012 IECC. It does not provide a guarantee for meeting the IECC. This guide is not designed to reflect the actual energy code, with amendments, if any, adopted in Kentucky and does not, therefore, provide a guarantee for meeting the state energy code. For details on the energy code adopted by Kentucky, including how it may differ from the IECC, please contact your local building code official. Additional copies of this guide are available on www.reca-codes.com. CLIMATE ZONE 4 Adair Edmonson Knox Nicholas Allen Elliott LaRue Ohio Anderson Estill Laurel Oldham Ballard Fayette Lawrence Owen Barren Fleming Lee Owsley Bath Floyd Leslie Pendleton Bell Franklin Letcher Perry Boone Fulton Lewis Pike


Categorical Exclusion Determinations: Kentucky | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

April 11, 2011 April 11, 2011 CX-005602: Categorical Exclusion Determination Jet Drilling With Energized Fluids CX(s) Applied: B3.6, B3.7 Date: 04/11/2011 Location(s): Bowling Green, Kentucky Office(s): Fossil Energy, National Energy Technology Laboratory March 25, 2011 CX-005559: Categorical Exclusion Determination Heating, Ventilation, and Air Conditioning Efficiency and Replacement Project CX(s) Applied: B1.4, B2.2, B2.5, B5.1 Date: 03/25/2011 Location(s): Oldham County, Kentucky Office(s): Civilian Radioactive Waste Management, Energy Efficiency and Renewable Energy February 10, 2011 CX-005220: Categorical Exclusion Determination Kentucky Farm Energy Efficiency and Renewable Energy Partnership Market Title CX(s) Applied: B5.1 Date: 02/10/2011 Location(s): Goshen, Kentucky Office(s): Energy Efficiency and Renewable Energy, National Energy


Step-by-Step Instructions  

NLE Websites -- All DOE Office Websites (Extended Search)

Texas based Texas based upon the simple prescriptive option of the 2012 IECC. It does not provide a guarantee for meeting the IECC. This guide is not designed to reflect the actual energy code, with amendments, if any, adopted in Texas and does not, therefore, provide a guarantee for meeting the state energy code. For details on the energy code adopted by Texas, including how it may differ from the IECC, please contact your local building code official. Additional copies of this guide are available on www.reca-codes.com. CLIMATE ZONE 4 Armstrong Cochran Gray Hutchinson Oldham Sherman Bailey Dallam Hale Lamb Parmer Swisher Briscoe Deaf Smith Hansford Lipscomb Potter Yoakum Carson Donley Hartley Moore Randall Castro Floyd Hockley Ochiltree Roberts


Wildorado Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Wildorado Wind Farm Wildorado Wind Farm Jump to: navigation, search Name Wildorado Wind Farm Facility Wildorado Wind Ranch Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Edison Mission Group Developer Cielo Wind Power Energy Purchaser Xcel Energy Location Oldham TX Coordinates 35.302005°, -102.314005° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.302005,"lon":-102.314005,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


R&D Tax Policy During the 1980s: Success of Failure?  

E-Print Network (OSTI)

1992. "Tax Incentives for R&D: What Do the Data Tell Us?"Implicit Tax Effects of the R&D Tax Credit." Wharton School,on Canadian Industrial R&D Expenditures." Canadian Public

Hall, Bronwyn H.



1000 PHYTOPATHOLOGY Ecology and Population Biology  

E-Print Network (OSTI)

from Canadian canola, no fingerprints were shared among Canadian, North Carolina, and Louisiana (8,10,11,14) have shown that, in Canada, each field crop of canola (Brassica napus L. or B. rapa L

Kohn, Linda M.


Comparing Price Forecast Accuracy of Natural Gas Models and Futures Markets  

E-Print Network (OSTI)

National Laboratory Canadian Energy Research Institute U.S.Administration Energy Markets All U.S. energy marketsAll Canadian and U.S. energy markets All U.S. energy markets

Wong-Parodi, Gabrielle; Dale, Larry; Lekov, Alex


Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Summer Drought Patterns in Canada and the Relationship toGlobal Sea Surface Temperatures  

Science Conference Proceedings (OSTI)

Canadian summer (JuneAugust) Palmer Drought Severity Index (PDSI) variations and winter (December February) global sea surface temperature (SST) variations are examined for the 63-yr period of 19402002. Extreme wet and dry Canadian summers are ...

Amir Shabbar; Walter Skinner



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



A Superbend X-Ray Microdiffraction Beamline at the Advanced Light Source  

E-Print Network (OSTI)

Synchrotron Light Source (NSLS), Canadian Light Source (with groups at the APS and NSLS, the ALS has pioneered some

Tamura, N.



conference registration form  

Science Conference Proceedings (OSTI)

Tour 2: CESL Plant & Canadian Autoparts Toyota $ 80 ______. TOTAL REGISTRATION FEE (CAN$). $ . HOTEL RESERVATIONS. PLEASE RESERVE YOUR...


WORKING PAPER SERIES MIT-IPC-Energy Innovation Working Paper 09-002  

E-Print Network (OSTI)

historically been the Canadian CANDU design.) There is today a fairly high degree of uniformity in the nuclear


Molecular Phylogenetics and Evolution 43 (2007) 11511166 www.elsevier.com/locate/ympev  

E-Print Network (OSTI)

Jones of the Pilgrim Trust, then visiting the Flexners in the Canadian woods, and asking him to coment

Austin, Christopher C.


Clean Energy Technologies: A Preliminary Inventory of the Potential for Electricity Generation  

E-Print Network (OSTI)

Cogeneration Iron & Steel Industry All plants and sitesSteel Industry..in the Canadian Steel Industry, Ottawa, Canada: CANMET.

Bailey, Owen; Worrell, Ernst



Hydrogen Storage  

Science Conference Proceedings (OSTI)

Applied Neutron Scattering in Engineering and Materials Science Research: Hydrogen Storage Sponsored by: Metallurgical Society of the Canadian Institute of...


For switchgrass cultivated as biofuel in California, invasiveness limited by several steps  

E-Print Network (OSTI)

biology of Canadian weedsSorghum halepense (L. ) Pers. Cansuch as johnsongrass (Sorghum halepense (L. ) Pers. ) and

DiTomaso, Joseph M; Barney, Jacob N; Mann, J Jeremiah; Kyser, Guy



Technology Cross-pollination I - Programmaster.org  

Science Conference Proceedings (OSTI)

Oct 30, 2013... Society of the Canadian Institute of Mining Metallurgy and Petroleum ... equipment suppliers, engineering firms, government agencies,...


Carmanah Technologies Corporation | Open Energy Information  

Open Energy Info (EERE)

Canadian manufacturer of solar balance of systems (mounts, converters, inverters), battery chargers, and distributor of PV modules. References Carmanah Technologies...


Perspectives for Emerging Materials Professionals  

Science Conference Proceedings (OSTI)

Mar 31, 2013 ... Materials Science and Engineering in the Canadian Oil Sands - Challenges & Opportunities Materials Science and Engineering: The Gateway...


Reaching Rural Communities: Videoconferencing in K-12 Dance Education  

E-Print Network (OSTI)

in the classroom: communications technology across thecommunication in a graduate seminar. Canadian Journal of learning and technology.

Parrish, Mila Dr.



Ni-Co 2013  

Science Conference Proceedings (OSTI)

Metallurgical Society of the Canadian Institute of Mining Metallurgy and Petroleum ... GDMB Society for Mining, Metallurgy, Resource and Environmental ...


Lower 48 Natural Gas Supply Outlook Through 2020  

Reports and Publications (EIA)

Presented by: James KendallPresented to: Canadian Energy Research InstituteCalgary, AlbertaMarch 4, 2002

Information Center



2012 Brief: Average wholesale natural gas prices fell 31% in ...  

U.S. Energy Information Administration (EIA)

Nuclear & Uranium. Uranium fuel ... Falling Eastern Canadian natural gas production coupled with reduced LNG deliveries into New ... After ...


Essays in Team Economics  

E-Print Network (OSTI)

418. [13] Lavoie, M. , Grenier G. , Coulombe, S. , CanadianSimilarly, in hockey, Lavoie, Grenier and Coulombe (1987)

Tumlinson, Justin



NIST Global Standards Information Events  

Science Conference Proceedings (OSTI)

... Canada: Canadian Energy Efficient Building Policies. ... States: Beyond the Code -- Energy, Carbon, and ... Privacy policy / security notice / accessibility ...


NIST Global Standards Information The United States  

Science Conference Proceedings (OSTI)

... Canada: Canadian Energy Efficient Building Policies. ... States: Beyond the Code -- Energy, Carbon, and ... Privacy policy / security notice / accessibility ...


Non-pollutingAutomobiles IEEE transactions on Vehicular TechnologY, VOL 43, No 4, Nov 94  

E-Print Network (OSTI)

). The project given to the Canadian and Chinese students was to build a Stirling engine using the CDIO approach

Szabados, Barna

Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Short-Term Energy Outlook - Energy Information Administration  

U.S. Energy Information Administration (EIA)

tight oil formations and Canadian oil sands. EIA slightly increased its forecast for Canadas oil sands output ...


Short-Term Energy Outlook - U.S. Energy Information Administration ...  

U.S. Energy Information Administration (EIA)

... respectively, resulting from continued production growth in U.S. onshore tight oil formations and from Canadian oil sands.


Opportunities and Challenges to Careers in Materials Science and ...  

Science Conference Proceedings (OSTI)

... employer (job location (domestic or foreign, staff versus management, etc.) ... Materials Science and Engineering in the Canadian Oil Sands - Challenges &...


Cavitation Erosion  

Science Conference Proceedings (OSTI)

Oct 30, 2013 ... Advances in Hydroelectric Turbine Manufacturing and Repair: Cavitation Erosion Sponsored by: Metallurgical Society of the Canadian Institute...


Novel Technologies - Programmaster.org  

Science Conference Proceedings (OSTI)

Oct 28, 2013 ... Advances in Hydroelectric Turbine Manufacturing and Repair: Novel Technologies Sponsored by: Metallurgical Society of the Canadian...


Excursions in Chemical Dynamics  

E-Print Network (OSTI)

2009). [118] F. A. Cotton, Chemical Applications of GroupExcursions in Chemical Dynamics by Shervin Fatehi AFall 2010 Excursions in Chemical Dynamics Copyright 2010 by

Fatehi, Shervin



High Definition Dynamic Reservoir Characterization for CO2 Management, Delhi Field, Louisiana  

E-Print Network (OSTI)

Guyana Europe, Asia and Pacific Crude petroleum Azerbaijan, Papua New Guinea, Brunei Darussalam, Norway & coconut oil Kiribati Cotton Pakistan, Uzbekistan Azerbaijan, Tajikistan, Turkmenistan Source: Cashin


The Impact of Agricultural Biotechnology on Supply and Land-Use  

E-Print Network (OSTI)

Economic impact of bt corn in the philippines. Philippineheat? evidence from us corn and soybean yields. Technicalthe main GE crops- cotton, corn, and soybeans. We find that

Barrows, Geoffrey; Sexton, Steven; Zilberman, David



Research and adoption of biotechnology strategies could improve California fruit and nut crops  

E-Print Network (OSTI)

An soybean, corn and canola. To date, geneti- example of oneneered soy, maize, cotton and canola were due to yield gains

Haroldsen, Victor M; Paulino, Gabriel; Chi-ham, Cecilia; Bennett, Alan B



Agricultural and Resource Economics Update  

E-Print Network (OSTI)

corn, soybeans, cotton, canola, sugarbeets, alfalfa, papaya,processed products such as canola oil, produced with GMing. In contrast, the same canola oil would have to bear a



The Ascomycete Verticillium longisporum Is a Hybrid and a Plant Pathogen with an Expanded Host Range  

E-Print Network (OSTI)

Canadas major oilseed crop: Canola. Can J Plant Pathol 21:oat, cotton, coffee and canola [2]. Hybrids often exhibit

Subbarao, Krishna V



Regulating the Regulators: The Increased Role for the Federal Judiciary in Monitoring the Debate over Genetically Modified Crops  

E-Print Network (OSTI)

crops: soy, corn, and canola. 5 1 In 1996, three millionall soy, corn, cotton, and canola sold in the United States

Denton, Blake



Technical Sessions Parameterization of Convective Clouds, Mesoscale...  

NLE Websites -- All DOE Office Websites (Extended Search)

and Convective-Generated Clouds W. R. Cotton Department of Atmospheric Science Colorado State University Fort Collins, CO 80523 This presentation is a summary of research...


Production, characterisation and properties of carbon nanotube fibres  

E-Print Network (OSTI)

-state spinning, which is roughly analogous to yarn spinning of cotton or wool, aims to circumvent the limitations posed by suspension processing. The process involves mechanically orienting a pre-grown CNT mass of various forms ( carpets, cotton etc.) in to a... -state spinning, which is roughly analogous to yarn spinning of cotton or wool, aims to circumvent the limitations posed by suspension processing. The process involves mechanically orienting a pre-grown CNT mass of various forms ( carpets, cotton etc.) in to a...

Sundaram, Rajyashree Meenakshi



Selective Recovery of Gold from E-wastes by Using Cellulosic Wastes  

Science Conference Proceedings (OSTI)

This technology was extended to prepare similar adsorption gels from cellulosic wastes like spent paper and spent cotton. These adsorption gels were tested for...


Biosorption Characteristics of Pb(II) from Aqueous Solution onto ...  

Science Conference Proceedings (OSTI)

Abstract Scope, Poplar cotton, a cellulosic material, was found to adsorb the metals ions effectively. In present study, the biosorption characteristics of Pb(II) onto...



Office of Legacy Management (LM)

Cotton, Robert Gosslee, Jonathan Sowell, Clayton Weaver FINAL REPORT July 30, 1981 Work performed by Radiological Site Assessment Program Manpower Education, Research, and...


Neutral Oil Loss During Alkali Refining - ResearchGate  

U.S. Energy Information Administration (EIA)

Neutral Oil Loss During Alkali Refining. Albert J. Dijkstra. Journal of Oil & Fat Industries (Impact ... Experiments with cotton oil and soybean o ...


JOM - Materials Technology @ TMS  

Science Conference Proceedings (OSTI)

Mar 10, 2010 ... The garment represents a futuristic makeover of that traditional and popular clothing material standby, cotton. Scientists in the Textiles...


Symposium Poster Session  

Science Conference Proceedings (OSTI)

A37 Unconventional Method of Nitriding of 316l Austenitic Steel A38 Role of ..... I24 The Study of Cotton Finishing by Artemsia Argyi Oil Microcapsules.

Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


D19 FePBNbCr Soft Magnetic Glassy Alloys SENNTIX with Low ...  

Science Conference Proceedings (OSTI)

A37 Unconventional Method of Nitriding of 316l Austenitic Steel A38 Role of ..... I24 The Study of Cotton Finishing by Artemsia Argyi Oil Microcapsules.


About this Abstract  

Science Conference Proceedings (OSTI)

A37 Unconventional Method of Nitriding of 316l Austenitic Steel A38 Role of ..... I24 The Study of Cotton Finishing by Artemsia Argyi Oil Microcapsules.


A34 Possibility of Removing Platinum from the Used Catalytic ...  

Science Conference Proceedings (OSTI)

A37 Unconventional Method of Nitriding of 316l Austenitic Steel A38 Role of ..... I24 The Study of Cotton Finishing by Artemsia Argyi Oil Microcapsules.


I11 Self-Accommodation Morphology in Ti-Nb-Al Shape Memory Alloy  

Science Conference Proceedings (OSTI)

A37 Unconventional Method of Nitriding of 316l Austenitic Steel A38 Role of ..... I24 The Study of Cotton Finishing by Artemsia Argyi Oil Microcapsules.


G26 Effect of Atomic Layer Deposited NiThin Films on the ...  

Science Conference Proceedings (OSTI)

A37 Unconventional Method of Nitriding of 316l Austenitic Steel A38 Role of ..... I24 The Study of Cotton Finishing by Artemsia Argyi Oil Microcapsules.


C22 Twinning Behavior in AZ31-B Polycrystal Texture Subjected to ...  

Science Conference Proceedings (OSTI)

A37 Unconventional Method of Nitriding of 316l Austenitic Steel A38 Role of ..... I24 The Study of Cotton Finishing by Artemsia Argyi Oil Microcapsules.


A22 A Study on Tool Wear of Sheet Metal Stamping Die Using ...  

Science Conference Proceedings (OSTI)

A37 Unconventional Method of Nitriding of 316l Austenitic Steel A38 Role of ..... I24 The Study of Cotton Finishing by Artemsia Argyi Oil Microcapsules.


L3 Hydrogen Storage in Nitrides by the Use of Ammonia as a ...  

Science Conference Proceedings (OSTI)

A37 Unconventional Method of Nitriding of 316l Austenitic Steel A38 Role of ..... I24 The Study of Cotton Finishing by Artemsia Argyi Oil Microcapsules.


Fermilab | Take Five for Goal Zero | Gloves | Fleece Garden Gloves  

NLE Websites -- All DOE Office Websites (Extended Search)

Fleece Garden Gloves Fleece Garden Gloves Description Color Finish Uses FNAL Stock Number Fleecy cotton Knit wrist Comfortable and breathable Yellow with red stitching Fleece...


Virtual Modelling of Strategic Materials through the Vehicle Life Cycle  

Science Conference Proceedings (OSTI)

A Study On CuInSe2 Thin Films Deposited by Spray Pyrolysis Technique ... Using Ammonia Modification Epoxy-polymer Supported on the Spherical Cotton.


P-3: As(III) Oxidation with Bacteria and AP  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


Study on Process Parameters for Electromagnetic Joining Using 3D ...  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


Effect of Base Metal Microstructure on Tensile Properties and ...  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


Existence of Niobium in Ductile Iron and its Effect on the Morphology ...  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


Characterization of the Orthotropic Elastic Constants of a Micronic ...  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


Study on Sodium Roasting and Chromium Extracting of Fe-Cr Spinels  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


New Vermiculite-Copper Nanoparticle Product with Antibacterial ...  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


P-18: The Effect of Temperature on Complex Permittivity and ...  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


Nickel Smelter Slag Microstructure and Its Effect on Slag Leachability  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


Preparation and Characterization of High-Magnetization ...  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.

Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Recovery of Metals from Molybdenite Concentrate by ...  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


Study of Electrolyte Impurity Precipitates at the Kennecott Refinery  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


TT Chen Honorary Symposium on Hydrometallurgy ...  

Science Conference Proceedings (OSTI)

Jul 31, 2011 ... Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc...


P-8: Electrochemical Reduction of TiO2-Rich Slag to High-Titanium ...  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


Simulating the Blanking of Preg Robbers in Gold Ores by Treating ...  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


A Review of the Behavior and Deportment of Lead, Bismuth ...  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


P-12: Measurement of Contact Angle for Iron Ore Particles  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


Phase Equilibrium and Characterization Studies of Binary Organic ...  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


Direct Leaching Alternatives for Zinc Concentrates  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


Recent Trends in the Processing of Complex Sulphide Ores  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


P-19: Thermal Characterization of Jute Fibers by TGA/DTG and DSC  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


Formation of Titanium Liquid Alloy by Mechanical Mixing and ...  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


Leaching of Lithium Cobalt Dioxide Using Citric-Thiosulfate Solutions  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


Preparation of ?-Diketone Modified Silica Gel and its Application to ...  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


Mechanical Pretreatment of Lead Based Alloy Anode for Zinc ...  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


P-9: Evaluation of Banana Fibers Density with Different Diameters  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


Mechanism and Thermodynamics of Floating Slimes Formation  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


Scorodite Solubility and Storage Management Systems for Arsenic ...  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


Dissolution of Platinum,Palladium and Rhodium in 250g/l NaCl ...  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.


P-1: A Kinetics Study on the Hydrometallurgical Recovery of ...  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.

Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Animal Protection  

Science Conference Proceedings (OSTI)

... treated for nausea and other gas-related symptoms. ... lucrative export commodity after oil.2 The ... World Extra-Fine Cotton Outlook," paper presented to ...



LDC debt and policy linkages in the determination of world commodity prices  

E-Print Network (OSTI)

Coarse Grain, Rice, and Cotton Prices Explanatory VariablesDependent Variables\\ Wheat Prices Impact (standard error)Inter La DW I Coarse Grain Prices Impact (standard error)

Rausser, Gordon C.; Brazelon, Coleman



southeastern geographer, 44(1) 2004: pp. 814 Rethinking the Region  

E-Print Network (OSTI)

-runners, allow- ing for the sale of cotton to European mar- kets and the purchase of all-important guns and steel

Gamble, Douglas W.


Certification of the Standard Reference Material 1473b,  

Science Conference Proceedings (OSTI)

... For sale by the Superintendent of Documents, US Government Printing Office ... Cotton gun cleaning patches and 38 caliber gun bore brushes with ...



Thse prpare l'Institut FEMTO-ST (Dpartement Energie, UMR CNRS 6174) dans le cadre de la Fdration de Recherche FC LAB (FR CNRS 3539) et en cotutelle avec l'Universit de Cocody-Abidjan, Cte d'Ivoire  

E-Print Network (OSTI)

,000/gm: $400M #12;Canadian CANDU reactor summary · 22 CANDU reactors in Canada · 8 were taken out-Canadian CANDU reactor summary · 12 reactors: Argentina (1), India (2), S. Korea (4), Pakistan (1), Romania (2 there will be 20 operating Canadian CANDU reactors · Reactors licensed for 40 years · Tritium is recovered from


The MichelsonMorley Experiment as a Primer on Validation 1 March 2002  

E-Print Network (OSTI)

,000/gm: $400M #12;Canadian CANDU reactor summary · 22 CANDU reactors in Canada · 8 were taken out-Canadian CANDU reactor summary · 12 reactors: Argentina (1), India (2), S. Korea (4), Pakistan (1), Romania (2 there will be 20 operating Canadian CANDU reactors · Reactors licensed for 40 years · Tritium is recovered from

Stevenson, D. E. "Steve"


Contribution of the PALB2 c.2323C>T [p. Q775X] Founder mutation in well-defined breast and/or ovarian cancer families and unselected ovarian cancer cases of French Canadian descent  

E-Print Network (OSTI)

] mutation carrier fam carrier in family F1469. Abbreviations: bilateral breast cancer (Bi Br), cerebra melanoma (Mel), stomach cancer (Sto), and uterine cancer (Ut). Age at asce diagnosis of cancer. Tischkowitz et al. BMC Medical Genetics 2013, 14:5 Page 4...

Tischkowitz, Marc; Sabbaghian, Nelly; Hamel, Nancy; Pouchet, Carly; Foulkes, William D; Mes-Masson, Anne-Marie; Provencher, Diane M; Tonin, Patricia N



Analyzing Injury in Canadian Youth Ice Hockey through a Mixed Method Observational Design: Moving Beyond the Mechanisms of Injury to the Socio-Cultural Complexities of Implementing Injury Prevention Strategies .  

E-Print Network (OSTI)

??Ice hockey is a sport known for its speed and skill. However, its intensely physical nature is associated with the potential risk of injury, which (more)

Adams, Stephen



APPROXIMATE YEARLY BUDGET, 2013-2014 (fall and winter) the table below shows an estimate of the yearly cost per person for studying in Montral. all amounts are in Canadian  

E-Print Network (OSTI)

) immigration (temporary residents) 300 $ arrival from abroad (hotel, meals...) 500 $ winter clothing 800 at santeetudiante.com. 9 these amounts include furniture, utilities (water, electricity, heating), a telephone land


2010 KPMG LLP, a Canadian limited liability partnership and a member firm of the KPMG network of independent member firms affiliated with KPMG International Cooperative ("KPMG International"), a Swiss entity. All rights reserved. Printed in Canada.  

E-Print Network (OSTI)

· Alberta · No PST · Arguably first province to harmonize! · British Columbia · 12% HST (July 1, 2010 ­ Transitional Rules ·Continuous supplies · Includes property or services supplied by means of · Wire, pipeline

Ma, Bin


UBC Social Ecological Economic Development Studies (SEEDS) Student Report An Investigation into Rapidly Renewable Materials  

E-Print Network (OSTI)

into Rapidly Renewable Materials: Bamboo and Cotton Mohammad Hassan Jafarian Thanet (Vic) Ying-udomrat Xiao of a project/report". #12;Page 1 An Investigation into Rapidly Renewable Materials: Bamboo and Cotton Prepared of renewable resources. Renewable resources, whether it is energy or material, are the ones that can


Molecular Ecology (2003) 12, 22512259 doi: 10.1046/j.1365-294X.2003.01896.x 2003 Blackwell Publishing Ltd  

E-Print Network (OSTI)

, are a stinging hazards to workers or livestock, and their mounds damage equipment. However, fire ants can beneficial insects in cotton. Benefits · Cotton growers have a better understanding of the role of fire ants to reach the kernels, suggesting fire ant control in peanuts would provide little benefit. Team Members

Swanson, Bradley J.


Agronomy Notes Volume 33:2 February 2009  

E-Print Network (OSTI)

of these crops, but as genetic technology has resulted in less use of pesticide, growers are being charged more and only show adverse side effects such as crop damage after application. In the photo, the fake products ....................................... Page 2 Cotton Cotton, Corn, Soybean-What Crops will be Profitable? Page 2 Forage Winter Grazing

Watson, Craig A.


NEWS & VIEWS nature nanotechnology | VOL 3 | AUGUST 2008 | www.nature.com/naturenanotechnology 459  

E-Print Network (OSTI)

be harnessed, it will be possible to design wearable sensors or to build power generators and energy storage-absorbing cotton to repel water nearly as efficiently as the lotus leaf. Furthermore, the treated fabrics alternatives to soft linings in marine and outdoor applications. Furthermore, cotton fabrics coated

Devoret, Michel H.


High Efficiency Fans and High Efficiency Electrical Motors  

E-Print Network (OSTI)

Replacing nominal efficient electrical motors with premium efficiency can save on electrical power costs in cotton gins. Connected horsepower load on industrial air fans is approximately 60% of the total horsepower in a typical cotton gin. By replacing old inefficient centrifugal fans with new higher efficiency fans, additional power savings can be achieved.

Breedlove, C. W.




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PanCanadian Energy Services Inc. PanCanadian Energy Services Inc. Order No. EA-189 I. BACKGROUND Exports of electricity from the United States to a foreign country are regulated and require authorization under section 202(e) of the Federal Power Act (FPA) (16 U.S.C. §824a(e)). On July 20, 1998, PanCanadian Energy Services Inc. (PanCanadian) applied to the Office of Fossil Energy (FE) of the Department of Energy (DOE) for authorization to transmit electric energy to Canada as a power marketer. PanCanadian does not own or control any electric generating or transmission facilities, nor does it have a franchised service area. PanCanadian proposes to purchase surplus electric energy from electric utilities and other suppliers within the United States and to export this energy on its own behalf to Canada. The


Simulation of effects of climate change on surface water balances of agricultural lands. Final technical report, 30 September 1992-29 September 1994  

Science Conference Proceedings (OSTI)

In this project, the authors used the simulation model ENWATBAL and a stochastic weather generator (WXGEN) to evaluate the impact of climatic change on water balances of cotton and sorghum, major crops in Texas that differ in their response to elevated CO2. Specific objectives were: test the accuracy of the ENWATBAL model for the study of climate change; determine the sensitivities of soil water evaporation and transpiration of cotton and sorghum to single and multifactor changes in climate and CO2; and assess effects of gradual climate change on water balances of cotton and sorghum in west Texas.

Heilman, J.L.; McFarland, M.J.



EIA - Natural Gas Pipeline System - Midwest Region  

U.S. Energy Information Administration (EIA)

Natural Gas Pipelines in the Midwest Region Overview | Domestic Gas | Canadian Imports | Regional Pipeline Companies & Links. Overview Twenty-six interstate and at ...


Detecting changes in fish communities in response to habitat rehabilitation: a comparison of multimetric and multivariate approaches.  

E-Print Network (OSTI)

??Bioassessment can be performed through several methods and with different bioindicators. In Canadian Areas of Concern (AOC), fishes are used as a proxy for site (more)

Granados, Monica



Ideology in the discourse of Montreal-based private language schools' websites.  

E-Print Network (OSTI)

??The Canadian language training sector is a booming industry for those interested in capitalizing on the worldwide demand for English, such as private language schools. (more)

Abrile, Juan.


Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Glossary - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Green pricing programs allow electricity customers to express their willingness to pay for renewable energy ... (i.e., FERC Gas Tariff, Canadian Gas, Mexican ...


The Conscious Landscape: Reinterpreting and Reinhabiting the La Colle Falls Hydro Dam.  

E-Print Network (OSTI)

??The ruins of the La Colle Falls Hydro Dam encompass two very distinct topographies: the physical landscape of the vast Canadian Northwest, and the complex (more)

Hurd, Jason John



Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

Canadian bacon, egg and cheese Texas toast - Breakfast: sausage gravy omelet - Tuna melt - Smart cuisine: finger-lickin' baked chicken - Mom's meatloaf - Spicy buffalo...


Sustainable Energy Technologies Ltd | Open Energy Information  

Open Energy Info (EERE)

Product Canadian manufacturer of power inverters for solar, wind, fuel cells, and power storage sectors. References Sustainable Energy Technologies Ltd1 LinkedIn Connections...


Investigating the impacts of time-of-use electricity rates on lower-income and senior-headed households: A case study of Milton, Ontario (Canada).  

E-Print Network (OSTI)

??Through the Smart Metering Initiative in the Canadian province of Ontario, all residential electricity customers will be converted from a tiered rate regime to a (more)

Simmons, Sarah Ivy



NERSC/DOE BES Requirements Workshop Worksheet - Thomas Devereaux  

NLE Websites -- All DOE Office Websites (Extended Search)

estimate to use as a starting point for discussions. Facilities Used or Using NERSC OLCF ACLF NSF Centers Other: local cluster, Canadian Grid Architectures Used Cray XT IBM...


Federal Register Notice for On-Board Fuel Processing Go/No-Go...  

NLE Websites -- All DOE Office Websites (Extended Search)

Notices 5331 electric load in the states of Ohio, Michigan, Pennsylvania, New York, Vermont, Massachusetts, Connecticut, and New Jersey and the Canadian province of Ontario. The...


The Future of Food in Suburbia.  

E-Print Network (OSTI)

??This thesis addresses resilience for the future of Canadian suburbs, through the lens of buildings and food, particularly against the backdrop of peak oil and (more)

Khalid, Sarah



PP-23 Netley Corporation | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Corporation to construct, operate, and maintain electric transmission facilities at the U.S-Canadian border. PP-23 Netley Corporation More Documents & Publications PP-22-4 British...


PP-230 International Transmission Company | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Company to construct, operate, and maintain electric transmission facilities at the U.S-Canadian border. PP-230 International Transmission Company More Documents &...


PP-13 Federal Power Commission | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Commission to construct, operate, and maintain electric transmission facilities at the U.S-Canadian border. PP-13 Federal Power Commission More Documents & Publications PP-231...


Evaluation of metrics and baselines for tracking greenhouse gas emissions trends: Recommendations for the California climate action registry  

E-Print Network (OSTI)

Development of Energy Intensity Indicators for CanadianLaurin, 2001b). Energy intensity indicators include energyGHG indicator or an energy intensity indicator. Reporting of

Price, Lynn; Murtishaw, Scott; Worrell, Ernst



Introduction to Nuclear Engineering Introduction to Nuclear Engineering  

E-Print Network (OSTI)

Cardiopulmonary Resuscitation CSA Canadian Standards Association D&D Decontamination and Decommissioning DC, dc Association NNSA National Nuclear Security Administration #12;NRTL Nationally Recognized Testing Laboratory

Corley, Bill


Projections of Full-Fuel-Cycle Energy and Emissions Metrics  

E-Print Network (OSTI)

Canadian Association of Petroleum Producers. http://Natural Gas, Coal, and Petroleum. Environ. Sci. Technol.tml#overview. . 2012j. Petroleum & Other Liquids Data.

Coughlin, Katie




Science Conference Proceedings (OSTI)

Mar 5, 2013 ... Sponsored by: The Minerals, Metals and Materials Society, Metallurgical Society of the Canadian Institute of Mining Metallurgy and Petroleum,...


Hydrometallurgy: Materials and Equipment  

Science Conference Proceedings (OSTI)

Sponsorship, Metallurgical Society of the Canadian Institute of Mining Metallurgy and Petroleum. Organizer(s), Akram Alfantazi, Univ of British Columbia


Investigation on the Benefits of Safety Margin Improvement in CANDU Nuclear Power Plant Using an FPGA-based Shutdown System.  

E-Print Network (OSTI)

??The relationship between response time and safety margin of CANadian Deuterium Uranium (CANDU) nuclear power plant (NPP) is investigated in this thesis. Implementation of safety (more)

She, Jingke



Development of 3-D Neutronic Kinetic Model and Control for CANDU Reactors.  

E-Print Network (OSTI)

??The development of a three dimensional (3-D) neutronic kinetic modeling process aiming at control system design for CANadian Deuterium Uranium (CANDU) reactors is carried out (more)

Xia, Lingzhi




NLE Websites -- All DOE Office Websites (Extended Search)

of Eubranchipus bundyi (Forbes) (Crustacea: Anostraca) in a temporary vernal pond of Alberta. Canadian Journal of Zoology 55:280-287. D'Agostino, A. 1980. The vital...


Low Dose Radiation Program: Links - Organizations Funding Radiation...  

NLE Websites -- All DOE Office Websites (Extended Search)

Funding Radiation Research Australian Radiation Protection and Nuclear Safety Agency Canadian Nuclear Safety Commission Centers for Medical Countermeasures Against Radiological and...

Note: This page contains sample records for the topic "oldham cotton canadian" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Redesign and shock analysis of HALIFAX class frigate gas turbine uptake structure.  

E-Print Network (OSTI)

??The gas turbine exhaust uptakes in the HALIFAX class frigates of the Canadian Navy have experienced thermally-induced fatigue cracking since soon after the commissioning of (more)

Summers, Simon A. (Simon Andrew)



Report on Applicability of Residential Ventilation Standards in California  

E-Print Network (OSTI)

Annual Book of ASTM Standards. Vol. 04.11. American SocietyCalifornia's Energy Efficiency Standards for Residential andSystems" Canadian Standards Association, Mississauga,

Sherman, Max H.; McWilliam, Jennifer A.



Using Calibrated Simulation to Quantify The energy Savings From Residential Passive Solar Design in Canada.  

E-Print Network (OSTI)

??Energy savings from passive solar design applied to a typical Canadian house were quantified using calibrated whole building energy simulation. A detailed energy simulation model (more)

Zirnhelt, Hayes E.



Highway 407Highway 407 Matt Morioka,  

E-Print Network (OSTI)

and Excellence Silver Award - Service Delivery (2008) The Canadian Council for Public-Private Partnerships Council for Public-Private Partnerships #12;THANK YOUTHANK YOU #12;

Prevedouros, Panos D.


Next Generation Nanosatellite Systems: Mechanical Analysis and Test.  

E-Print Network (OSTI)

??The Canadian Nanosatellite Advanced Propulsion System is the second generation cold-gas propulsion system. Its purpose is to provide the millinewton thrust required for formation control (more)

Ligori, Michael C.



Farm Credit Canada Energy Loan (Canada)  

Energy.gov (U.S. Department of Energy (DOE))

The Energy Loan helps Canadian producers or agri-business owners considering renewable energy purchase and install on-farm energy sources, such as:


Form 101 Part II: Research Proposal - CECM - Simon Fraser University  

E-Print Network (OSTI)

the benefits expected to accrue to Canadian industry, to the academic institution, ..... However, Steel, in unpublished work, had already implemented a simpler...


Energy Efficiency Improvement and Cost Saving Opportunities for the U.S. Iron and Steel Industry An ENERGY STAR(R) Guide for Energy and Plant Managers  

E-Print Network (OSTI)

Management in the Flemish Steel Industry: the Arcelor Gentfor the iron and steel industry. Parekh, P. (2000).in the Canadian Steel Industry, Ottawa, Canada: CANMET.

Worrell, Ernst



Development of Bottom-up Representation of Industrial Energy Efficiency Technologies in Integrated Assessment Models for the Iron and Steel Sector  

E-Print Network (OSTI)

1982. Energy and the Steel Industry, Brussels, Belgium:in the Canadian Steel Industry, Ottawa, Canada: CANMET.in the Iron and Steel Industry, in: Proceedings 1997 ACEEE

Xu, T.T.



Department of Energy - Saskatchewan  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

who choose to install a Canadian Geoexchange Coalition (CGC) certified geothermal heating andor a renewable electricity system.

This program is applicable to all...


Nathalie Prevost - Publications - CECM  

E-Print Network (OSTI)

Publications. Ph.D. Thesis The Physics of Language: Towards a Phase Transition of Language Change. Canadian Artificial Intelligence(CAI) magazine


Nathalie Prevost nprevost@cecm.sfu.ca www.cecm.sfu.ca/~thalie ...  

E-Print Network (OSTI)

Canadian Artificial Intelligence, Automn 2000, no 47, pp.9-16. N. Prevost, R.E. Jennings, L. Jorgenson, F. David Fracchia,. "Visualization in Propositional Logic" ...


Freely Floating Exchange Rates Do Not Systematically Overshoot  

E-Print Network (OSTI)

Canadian-U.S. exchange rate, Review of Financial Economics,economy under flexible exchange rates, Journal of Monetary1976, Expectations and Exchange Rate Dynamics, Journal of

Pippenger, John



The carbon disclosure project, an evolution in international environmental corporate governance : motivations and determinants of market response to voluntary disclosures.  

E-Print Network (OSTI)

??This paper examines the factors associated with Canadian firms voluntarily disclosing climate change information through the Carbon Disclosure Project. Five hypotheses are presented to explain (more)

Wegener, Matt



TransForum v9n1 - Water Use in Biofuel Production  

NLE Websites -- All DOE Office Websites (Extended Search)

irrigation water, oil-well injection water and process water for five fuel pathways: bioethanol from corn, ethanol from cellulosic feedstocks, gasoline from Canadian oil sands,...


TransForum Volume 9, No. 1 - Spring 2009  

NLE Websites -- All DOE Office Websites (Extended Search)

water, oil-well injec- tion water and process water for five fuel pathways: bioethanol from corn, ethanol from cellulosic feedstocks, gasoline from Canadian oil sands,...


Short rotation culture of willow clones across Canada : growth requirements and implications for soil nutrients and greenhouse gas balances .  

E-Print Network (OSTI)

??The cultivation of willow (Salix spp.) is being investigated as a potential feedstock for biomass energy in the Canadian prairies. For this purpose, and despite (more)

Ens, Joel



I:\\Eco-SSLs\\Contaminant Specific Documents\\Arsenic\\Final 5-26...  

NLE Websites -- All DOE Office Websites (Extended Search)

(CCME). 1996. Canadian Soil Quality Guidelines for Vanadium: Environmental, Supporting Document - Final Draft. December 1996. CRC. 1994. Handbook of Chemistry and Physics....


Natural Gas Exports Price - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Estimates for Canadian pipeline volumes are derived from the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates of dry natura ...


Part of the Climate Change Problem . . . and the Solution? Chinese-Made Wind Power Technology and Opportunities for Dissemination  

E-Print Network (OSTI)

Lin Gan. 2002. Wind energy development in China:4. 24 Canadian Wind Energy Association (CanWEA). ofOxford;XinjiangWind EnergyCompanywebsite:http://

Lewis, Joanna I.
