Powered by Deep Web Technologies
Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Scottsdale, AZ  

Science Conference Proceedings (OSTI)

... Vice President, Communications, and Chief Marketing Officer, Henry ... Sonora Quest Laboratories Rose Glenn Arizona State Award ... Scottsdale, AZ d ...



Tucson, AZ  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

0 0 Tucson, AZ New coal technologies could lower utility costs By Richaed T. Newesnb lee uf( Engineerlng, and the national posslblity orst lest doubllng the with Its reactor safty and wast dis tility deregulallun hls laborstorlee, such as Los Alasn, net efficiency of cool-bMed power towal problemas. ralied public concerns conlinr the easiteoce of Innovative generetion while at the ame time The mpUctlons In all ofthis for bhout meneng the demunds solutlon in the form of low- and producing a ream of carbon dior- Arlaoes are tignlfcant. Our state for electricity t remaonable cot In zero emlsslon dclan coal (ZEC) tch- Ide that can be aely and poertu has both a wU-elenblhd coal growing states such Arizona with- nolngle. nently sequestered urndrgrouwmL ndustry and a reputatlon for clean


Category:Reno, NV | Open Energy Information  

Open Energy Info (EERE)

NV" NV" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Reno NV Nevada Power Co.png SVFullServiceRestauran... 63 KB SVHospital Reno NV Nevada Power Co.png SVHospital Reno NV Nev... 72 KB SVLargeHotel Reno NV Nevada Power Co.png SVLargeHotel Reno NV N... 68 KB SVLargeOffice Reno NV Nevada Power Co.png SVLargeOffice Reno NV ... 68 KB SVMediumOffice Reno NV Nevada Power Co.png SVMediumOffice Reno NV... 67 KB SVMidriseApartment Reno NV Nevada Power Co.png SVMidriseApartment Ren... 68 KB SVOutPatient Reno NV Nevada Power Co.png SVOutPatient Reno NV N... 66 KB SVPrimarySchool Reno NV Nevada Power Co.png SVPrimarySchool Reno N... 71 KB SVQuickServiceRestaurant Reno NV Nevada Power Co.png SVQuickServiceRestaura... 66 KB SVSecondarySchool Reno NV Nevada Power Co.png


NV Energy- Energy Plus New Homes Program  

Energy.gov (U.S. Department of Energy (DOE))

NV Energy offers the Energy Plus New Homes Program provides rebates to certified builders in the NV Energy service territory that build high-efficiency homes. (Rebates are only available to home...


DOE/NV442 Environmental  

Office of Legacy Management (LM)

NV442 NV442 Environmental Verification Sampling and Analysis Plan for Sediment and, Rulison Drilling Effluent Pond Environmental Restoration This report has been re,produced from the best available copy. Available in paper copy and microfiche. Number of pages in this report: 55 DOE and DOE contractors can obtain copies of this report from: Office of Sciennific and Technical Information, P.O. Box 62, Oak Ridge, TN 37831. (615) 576-8401. This report is publicly available from the Department of Commerce, National Technical Information Service, 5285 Port Royal Road, Springfield. VPi 22 16 1. (703) 487-4650. VERIFICATION SAMPLING AND ANALYSIS PLAN FOR SEDIMENT AND WATER SAMPLING RULISON DRILLING EFFLUENT POND DOE Nevada Operations Office Las Vegas, Nevada


NV Energy Electricity Storage Valuation  

SciTech Connect

This study examines how grid-level electricity storage may benet the operations of NV Energy in 2020, and assesses whether those benets justify the cost of the storage system. In order to determine how grid-level storage might impact NV Energy, an hourly production cost model of the Nevada Balancing Authority (\\BA") as projected for 2020 was built and used for the study. Storage facilities were found to add value primarily by providing reserve. Value provided by the provision of time-of-day shifting was found to be limited. If regulating reserve from storage is valued the same as that from slower ramp rate resources, then it appears that a reciprocating engine generator could provide additional capacity at a lower cost than a pumped storage hydro plant or large storage capacity battery system. In addition, a 25-MW battery storage facility would need to cost $650/kW or less in order to produce a positive Net Present Value (NPV). However, if regulating reserve provided by storage is considered to be more useful to the grid than that from slower ramp rate resources, then a grid-level storage facility may have a positive NPV even at today's storage system capital costs. The value of having storage provide services beyond reserve and time-of-day shifting was not assessed in this study, and was therefore not included in storage cost-benefit calculations.

Ellison, James F.; Bhatnagar, Dhruv; Samaan, Nader A.; Jin, Chunlian



DOE - Office of Legacy Management -- University of Nevada - NV...  

Office of Legacy Management (LM)

AT (49-1)-624); in 1980's, work with uranium ore was still being performed under NRC license. NV.01-1 NV.01-2 NV.01-3 Site Disposition: Eliminated - Radiation levels below...


Category:Tucson, AZ | Open Energy Information  

Open Energy Info (EERE)

Tucson, AZ Tucson, AZ Jump to: navigation, search Go Back to PV Economics By Location Media in category "Tucson, AZ" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Tucson AZ Arizona Public Service Co.png SVFullServiceRestauran... 75 KB SVHospital Tucson AZ Arizona Public Service Co.png SVHospital Tucson AZ A... 88 KB SVLargeHotel Tucson AZ Arizona Public Service Co.png SVLargeHotel Tucson AZ... 82 KB SVLargeOffice Tucson AZ Arizona Public Service Co.png SVLargeOffice Tucson A... 86 KB SVMediumOffice Tucson AZ Arizona Public Service Co.png SVMediumOffice Tucson ... 75 KB SVMidriseApartment Tucson AZ Arizona Public Service Co.png SVMidriseApartment Tuc... 73 KB SVOutPatient Tucson AZ Arizona Public Service Co.png SVOutPatient Tucson AZ...


NV: Nessus Vulnerability Visualization for the Web  

SciTech Connect

Network vulnerability is a critical component of network se- curity. Yet vulnerability analysis has received relatively lit- tle attention from the security visualization community. In this paper we describe nv, a web-based Nessus vulnerability visualization. Nv utilizes treemaps and linked histograms to allow system administrators to discover, analyze, and man- age vulnerabilities on their networks. In addition to visual- izing single Nessus scans, nv supports the analysis of sequen- tial scans by showing which vulnerabilities have been fixed, remain open, or are newly discovered. Nv was also designed to operate completely in-browser, to avoid sending sensitive data to outside servers. We discuss the design of nv, as well as provide case studies demonstrating vulnerability analysis workflows which include a multiple-node testbed and data from the 2011 VAST Challenge.

Harrison, Lane [University of North Carolina, Charlotte; Spahn, Riley B [ORNL; Iannacone, Michael D [ORNL; Downing, Evan P [ORNL; Goodall, John R [ORNL




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NV-TRIBE-SUMMIT LAKE PAIUTE TRIBE NV-TRIBE-SUMMIT LAKE PAIUTE TRIBE Location: Tribe NV-TRIBE-SUMMIT NV LAKE PAIUTE TRIBE American Recovery and Reinvestment Act: Proposed Action or Project Description The Summit Lake Paiute Tribe of Nevada will conduct energy building retrofits on several tribal-owned buildings including: Maintenance Shop (insulate walls and cover insulation to keep in place); Bunkhouse (replace single-pane glass windows, and repair or replace two exit doors); Tribal Administrative Office (replace old electric water heater and three air conditioner/heaters, and replace single-pane glass windows): Community Well Shed (install walls, cover insulation, and replace single-pane glass windows); Cabin #1 and Cabin #2 (insulate and/or replace single-pane windows). Conditions: None


Category:Phoenix, AZ | Open Energy Information  

Open Energy Info (EERE)

AZ AZ Jump to: navigation, search Go Back to PV Economics By Location Media in category "Phoenix, AZ" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Phoenix AZ Arizona Public Service Co.png SVFullServiceRestauran... 75 KB SVHospital Phoenix AZ Arizona Public Service Co.png SVHospital Phoenix AZ ... 88 KB SVLargeHotel Phoenix AZ Arizona Public Service Co.png SVLargeHotel Phoenix A... 85 KB SVLargeOffice Phoenix AZ Arizona Public Service Co.png SVLargeOffice Phoenix ... 87 KB SVMediumOffice Phoenix AZ Arizona Public Service Co.png SVMediumOffice Phoenix... 75 KB SVMidriseApartment Phoenix AZ Arizona Public Service Co.png SVMidriseApartment Pho... 73 KB SVOutPatient Phoenix AZ Arizona Public Service Co.png SVOutPatient Phoenix A...


Category:Flagstaff, AZ | Open Energy Information  

Open Energy Info (EERE)

AZ AZ Jump to: navigation, search Go Back to PV Economics By Location Media in category "Flagstaff, AZ" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Flagstaff AZ Salt River Project.png SVFullServiceRestauran... 70 KB SVHospital Flagstaff AZ Salt River Project.png SVHospital Flagstaff A... 83 KB SVLargeHotel Flagstaff AZ Salt River Project.png SVLargeHotel Flagstaff... 77 KB SVLargeOffice Flagstaff AZ Salt River Project.png SVLargeOffice Flagstaf... 83 KB SVMediumOffice Flagstaff AZ Salt River Project.png SVMediumOffice Flagsta... 73 KB SVMidriseApartment Flagstaff AZ Salt River Project.png SVMidriseApartment Fla... 70 KB SVOutPatient Flagstaff AZ Salt River Project.png SVOutPatient Flagstaff... 74 KB SVPrimarySchool Flagstaff AZ Salt River Project.png


DOE - Office of Legacy Management -- Shoal Test Site - NV 03  

Office of Legacy Management (LM)

Shoal Test Site - NV 03 Shoal Test Site - NV 03 FUSRAP Considered Sites Site: SHOAL TEST SITE (NV.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Sand Springs Range NV.03-1 Location: Near U.S. Highway 50 , Fallon , Nevada NV.03-2 Evaluation Year: 1987 NV.03-2 Site Operations: Underground nuclear detonation site. NV.03-1 Site Disposition: Eliminated - Potential for contamination remote NV.03-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: None at the Surface and Fission Fragments Within the Subsurface NV.03-1 Radiological Survey(s): Yes Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to SHOAL TEST SITE NV.03-1 - Report (NVO-1229-105 Part I); Evaluation of the Project


AZ Biodiesel | Open Energy Information  

Open Energy Info (EERE)

AZ Biodiesel AZ Biodiesel Jump to: navigation, search Name AZ Biodiesel Place Chandler, Arizona Zip 85225 Product AZ Biodiesel is a biodiesel producer that announced plans in July 2008 to relocate and reopen its main processing facility to Gilbert, Arizona. Coordinates 32.307977°, -95.479539° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":32.307977,"lon":-95.479539,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Local Event - Nevada Test Site, Las Vegas, NV | Department of...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Local Event - Nevada Test Site, Las Vegas, NV Local Event - Nevada Test Site, Las Vegas, NV October 26, 2013 10:00AM PDT to October 27, 2013 5:00PM PDT Las Vegas Intertribal...


NV Energy (Southern Nevada)- Solar Hot Water Incentive Program  

Energy.gov (U.S. Department of Energy (DOE))

NV Energy is providing an incentive for its residential customers to install solar water heaters on their homes. As of May 1, 2012, NV Energy electric customers in Southern Nevada who own their...


NV Energy (Southern Nevada) - Residential Energy Efficiency Rebate Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NV Energy (Southern Nevada) - Residential Energy Efficiency Rebate NV Energy (Southern Nevada) - Residential Energy Efficiency Rebate Program NV Energy (Southern Nevada) - Residential Energy Efficiency Rebate Program < Back Eligibility Residential Savings Category Heating & Cooling Commercial Heating & Cooling Cooling Heat Pumps Appliances & Electronics Program Info State Nevada Program Type Utility Rebate Program Rebate Amount Refrigerator/freezer Recycling: $50 Air Conditioners: Up to $1000 Variable Speed Pool Pump: $200 '''Pool Pump and duct system rebates are temporarily suspended. Contact NV Energy for additional information on funding and program availability.''' NV Energy offers rebates for the installation of high efficiency A/C units, air source heat pumps, and pool pumps for residential customers in southern


Category:Las Vegas, NV | Open Energy Information  

Open Energy Info (EERE)

NV" NV" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Las Vegas NV Nevada Power Co.png SVFullServiceRestauran... 63 KB SVHospital Las Vegas NV Nevada Power Co.png SVHospital Las Vegas N... 74 KB SVLargeHotel Las Vegas NV Nevada Power Co.png SVLargeHotel Las Vegas... 69 KB SVLargeOffice Las Vegas NV Nevada Power Co.png SVLargeOffice Las Vega... 68 KB SVMediumOffice Las Vegas NV Nevada Power Co.png SVMediumOffice Las Veg... 70 KB SVMidriseApartment Las Vegas NV Nevada Power Co.png SVMidriseApartment Las... 68 KB SVOutPatient Las Vegas NV Nevada Power Co.png SVOutPatient Las Vegas... 65 KB SVPrimarySchool Las Vegas NV Nevada Power Co.png SVPrimarySchool Las Ve... 69 KB SVQuickServiceRestaurant Las Vegas NV Nevada Power Co.png SVQuickServiceRestaura...


AMG Advanced Metallurgical Group NV | Open Energy Information  

Open Energy Info (EERE)

AMG Advanced Metallurgical Group NV AMG Advanced Metallurgical Group NV Jump to: navigation, search Name AMG Advanced Metallurgical Group NV Place Wayne, Pennsylvania Zip 19087 Product US-based specialty metals company offering metallurgical products and vacuum furnace systems; manufactures high purity polysilicon. References AMG Advanced Metallurgical Group NV[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. AMG Advanced Metallurgical Group NV is a company located in Wayne, Pennsylvania . References ↑ "AMG Advanced Metallurgical Group NV" Retrieved from "http://en.openei.org/w/index.php?title=AMG_Advanced_Metallurgical_Group_NV&oldid=342143" Categories: Clean Energy Organizations


Archaeological data recovery at drill hole U19az, Nevada Test Site, Nye County, Nevada  

Science Conference Proceedings (OSTI)

At the request of the Department of Energy, Nevada Field Office (DOE/NV), the Desert Research Institute (DRI) conducted archaeological data recovery at drill hole U19az on the Nevada Test Site in February 1988 and April 1990. The work focused on a site that was recommended as eligible to the National Register of Historic Places. DOE/NV chose to mitigate adverse impacts to the site though a data recovery program. The mapping and collection of artifacts took place in two discrete areas, covering almost 10 hectares (24.71 acres). In addition to surface collection, 11 test pits and 12 surface scrapes were excavated. Information was sought to address four research questions concerned with the age of the site, the subsistence and demography of the site's inhabitants, and the behavioral implications of their lithic technology. This report describes and presents the results of the data recovery at drill hole U19az. The analyses of the artifacts indicate that the site was inhabited between 5,000 years ago and historic times. Relative artifact abundance indicates the most intense use occurred from about 4,000 to 1,500 years ago.

Lancaster, J.


Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Archaeological data recovery at drill hole U19az, Nevada Test Site, Nye County, Nevada  

SciTech Connect

At the request of the Department of Energy, Nevada Field Office (DOE/NV), the Desert Research Institute (DRI) conducted archaeological data recovery at drill hole U19az on the Nevada Test Site in February 1988 and April 1990. The work focused on a site that was recommended as eligible to the National Register of Historic Places. DOE/NV chose to mitigate adverse impacts to the site though a data recovery program. The mapping and collection of artifacts took place in two discrete areas, covering almost 10 hectares (24.71 acres). In addition to surface collection, 11 test pits and 12 surface scrapes were excavated. Information was sought to address four research questions concerned with the age of the site, the subsistence and demography of the site`s inhabitants, and the behavioral implications of their lithic technology. This report describes and presents the results of the data recovery at drill hole U19az. The analyses of the artifacts indicate that the site was inhabited between 5,000 years ago and historic times. Relative artifact abundance indicates the most intense use occurred from about 4,000 to 1,500 years ago.

Lancaster, J.



BLM-NV-WN-ES-08-01-1310, NV-020-08-01 | Open Energy Information  

Open Energy Info (EERE)

BLM-NV-WN-ES-08-01-1310, NV-020-08-01 BLM-NV-WN-ES-08-01-1310, NV-020-08-01 Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: BLM-NV-WN-ES-08-01-1310, NV-020-08-01 EA at Blue Mountain Geothermal Area for Geothermal/Power Plant Blue Mountain Geothermal Project General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Nevada Geothermal Power Consultant Environmental Management Associates Geothermal Area Blue Mountain Geothermal Area Project Location Nevada Project Phase Geothermal/Power Plant Techniques Development Drilling, Downhole Techniques, Drilling Techniques, Well Testing Techniques Comments Power Plant on Adjacent Private lands Time Frame (days) NEPA Process Time 380 Participating Agencies Lead Agency BLM


Douglas, AZ Natural Gas Pipeline Exports to Mexico (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) Douglas, AZ Natural Gas Pipeline Exports to Mexico (Million Cubic Feet) Douglas, AZ Natural Gas Pipeline Exports to Mexico...


Nogales, AZ Natural Gas Pipeline Exports to Mexico (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) Nogales, AZ Natural Gas Pipeline Exports to Mexico (Million Cubic Feet) Nogales, AZ Natural Gas Pipeline Exports to Mexico...


US Mnt(S) AZ Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

Mnt(S) AZ Mnt(S) AZ Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US Mnt(S) AZ Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 3,000 6,000 9,000 12,000 15,000 US Mnt(S) AZ Site Consumption kilowatthours $0 $500 $1,000 $1,500 $2,000 US Mnt(S) AZ Expenditures dollars ELECTRICITY ONLY average per household * Arizona households use 66 million Btu of energy per home, 26% less than the U.S. average. * The combination of lower than average site consumption of all energy, but above average electricity which is relatively expensive, results in Arizona households spending 3% less for energy than the U.S. average. * More reliance on air conditioning keeps average site electricity consumption in the state high relative to other parts of the U.S.


US Mnt(S) AZ Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

Mnt(S) AZ Mnt(S) AZ Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US Mnt(S) AZ Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 3,000 6,000 9,000 12,000 15,000 US Mnt(S) AZ Site Consumption kilowatthours $0 $500 $1,000 $1,500 $2,000 US Mnt(S) AZ Expenditures dollars ELECTRICITY ONLY average per household * Arizona households use 66 million Btu of energy per home, 26% less than the U.S. average. * The combination of lower than average site consumption of all energy, but above average electricity which is relatively expensive, results in Arizona households spending 3% less for energy than the U.S. average. * More reliance on air conditioning keeps average site electricity consumption in the state high relative to other parts of the U.S.


NV Energy - Energy Smart Schools Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NV Energy - Energy Smart Schools Program NV Energy - Energy Smart Schools Program NV Energy - Energy Smart Schools Program < Back Eligibility Schools Savings Category Heating & Cooling Commercial Heating & Cooling Cooling Home Weatherization Construction Commercial Weatherization Design & Remodeling Other Heating Appliances & Electronics Commercial Lighting Lighting Manufacturing Windows, Doors, & Skylights Program Info State Nevada Program Type Utility Rebate Program Rebate Amount varies; contact program administrator The Energy Smart Schools program helps Nevada school districts reduce energy consumption, improve learning environments, and save money by implementing energy efficiency improvements in new and existing K-12 schools. The Program helps schools identify cost-effective projects, offers


EIS-0413: Searchlight Wind Energy Project, Searchlight, NV | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

13: Searchlight Wind Energy Project, Searchlight, NV 13: Searchlight Wind Energy Project, Searchlight, NV EIS-0413: Searchlight Wind Energy Project, Searchlight, NV Summary The Department of the Interior's Bureau of Land Management, with DOE's Western Area Power Administration as a cooperating agency, prepared this EIS to evaluate the environmental impacts of a proposal to construct and operate 156 wind turbine generators and related facilities on public lands surrounding the town of Searchlight, Nevada. The proposal includes a substation that would be operated by Western. Public Comment Opportunities None available at this time. Documents Available for Download May 16, 2013 EIS-0413: Record of Decision Searchlight Wind Energy Project, Searchlight, NV January 15, 2013 EIS-0413: Final Environmental Impact Statement


NV Energy (Northern Nevada) - Residential Energy Efficiency Rebate Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NV Energy (Northern Nevada) - Residential Energy Efficiency Rebate NV Energy (Northern Nevada) - Residential Energy Efficiency Rebate Program NV Energy (Northern Nevada) - Residential Energy Efficiency Rebate Program < Back Eligibility Residential Savings Category Heating & Cooling Commercial Heating & Cooling Heating Appliances & Electronics Maximum Rebate 30% of cost Program Info State Nevada Program Type Utility Rebate Program Rebate Amount Refrigerator/freezer Recycling: $50 Furnaces: $50-$125 Boilers: $75-$100 Provider Nevada Energy - Northern '''As of November 30, 2011, furnace and boiler rebates have been suspended until further notice. View the program web site for additional details and contact information.''' NV Energy offers rebates for the installation of high efficiency stand-alone gas furnaces and gas boilers for residential customers in


NV Energy, Inc. Smart Grid Project | Open Energy Information  

Open Energy Info (EERE)

NV Energy, Inc. Smart Grid Project NV Energy, Inc. Smart Grid Project Jump to: navigation, search Project Lead NV Energy, Inc. Country United States Headquarters Location Las Vegas, Nevada Recovery Act Funding $$137,877,906 Total Project Value $$275,755,812 Coverage Area Coverage Map: NV Energy, Inc. Smart Grid Project Coordinates 36.114646°, -115.172816° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


A Deeper Look at 2NV | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

Deeper Look at 2NV | National Nuclear Security Administration Deeper Look at 2NV | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > NNSA Blog > A Deeper Look at 2NV A Deeper Look at 2NV Posted By Bob Osborn, NNSA Chief Information Officer computer screens When Administrator D'Agostino extended the challenge to build a single, integrated enterprise through the OneNNSA initiative, we


NV Energy formerly Sierra Pacific Power | Open Energy Information  

Open Energy Info (EERE)

NV Energy (formerly Sierra Pacific Power) NV Energy (formerly Sierra Pacific Power) Place Reno, Nevada Zip 89520 Sector Efficiency Product Nevada-based, subsidiary of NV Energy/Sierra Pacific Resources, electric utility. NV Energy has developed energy efficiency projects. Coordinates 32.944065°, -97.578279° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":32.944065,"lon":-97.578279,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


DOE - Office of Legacy Management -- U S Bureau of Mines Reno Station - NV  

NLE Websites -- All DOE Office Websites (Extended Search)

Reno Station - Reno Station - NV 06 FUSRAP Considered Sites Site: U.S. BUREAU OF MINES RENO STATION (NV.06) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: U.S. BOM Metallurgy Research Center, Dept of the Interior NV.06-1 Location: 1605 Evans Avenue , Reno , Nevada NV.06-1 NV.06-2 Evaluation Year: 1987 NV.06-1 Site Operations: Research and development activities involving uranium. NV.06-2 Site Disposition: Eliminated - Potential for contamination remote NV.06-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium NV.06-2 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to U.S. BUREAU OF MINES RENO STATION NV.06-1 - Memorandum/Checklist; Wallo to the File; Subject: U.S.


NV-063-EA06-098 | Open Energy Information  

Open Energy Info (EERE)

NV-063-EA06-098 NV-063-EA06-098 Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: NV-063-EA06-098 EA at Reese River Geothermal Area for Geothermal/Exploration Reese River Valley Geothermal Exploration Project Environmental Assessment General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Sierra Geothermal Power Geothermal Area Reese River Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Slim Holes, Thermal Gradient Holes Time Frame (days) Application Time 142 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Battle Mountain Managing Field Office BLM Mount Lewis Field Office Funding Agencies none provided


NV-020-08-CX-65 | Open Energy Information  

Open Energy Info (EERE)

NV-020-08-CX-65 NV-020-08-CX-65 Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: NV-020-08-CX-65 CX at Desert Peak Geothermal Area for Geothermal/Exploration, Vibroseis seismic survey at Desert Peak Geothermal site General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Ormat Technologies Inc Geothermal Area Desert Peak Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Passive Seismic Techniques Time Frame (days) Application Time 15 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office none provided Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates


NV-EA-030-07-05 | Open Energy Information  

Open Energy Info (EERE)

NV-EA-030-07-05 NV-EA-030-07-05 Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: NV-EA-030-07-05 EA at Salt Wells Geothermal Area for Geothermal/Exploration Salt Wells Geothermal Drilling EA General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Vulcan Power Company Consultant Tetra Tech, Inc., EMPSi Geothermal Area Salt Wells Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Thermal Gradient Holes Time Frame (days) Application Time 158 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates


NV-020-06-EA-12 | Open Energy Information  

Open Energy Info (EERE)

NV-020-06-EA-12 NV-020-06-EA-12 Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: NV-020-06-EA-12 DNA at {{{GeothermalArea}}} for Geothermal/Exploration, {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant GERLACH GEOTHERMAL LLC Geothermal Area {{{GeothermalArea}}}"{{{GeothermalArea}}}" cannot be used as a page name in this wiki. Project Location Project Phase Geothermal/Exploration Techniques Thermal Gradient Holes Comments Evidence of bond requested but never received. File closed without action. Time Frame (days) Application Time 14 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office


NV Energy (Northern Nevada) - Solar Hot Water Incentive Program |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NV Energy (Northern Nevada) - Solar Hot Water Incentive Program NV Energy (Northern Nevada) - Solar Hot Water Incentive Program NV Energy (Northern Nevada) - Solar Hot Water Incentive Program < Back Eligibility Commercial Fed. Government Local Government Nonprofit Residential Schools State Government Savings Category Heating & Cooling Solar Water Heating Maximum Rebate Residential electric customers: Lesser of 50% or $2,000 Residential gas customers: Lesser of 30% or $3,000 Small commercial gas customers: Lesser of 30% or $7,500 Nonprofits, schools and other public gas customers: Lesser of 50% or $30,000 Program Info Start Date 2/1/2011 State Nevada Program Type Utility Rebate Program Rebate Amount Residential electric customers: Lesser of 50% or $2,000 Residential gas customers: $14.50 per therm Small commercial gas customers: $14.50 per therm


Remote Sensing For Geothermal Exploration Over Buffalo Valley, Nv | Open  

Open Energy Info (EERE)

Sensing For Geothermal Exploration Over Buffalo Valley, Nv Sensing For Geothermal Exploration Over Buffalo Valley, Nv Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: Remote Sensing For Geothermal Exploration Over Buffalo Valley, Nv Details Activities (1) Areas (1) Regions (0) Abstract: Remote sensing is a useful tool for identifying the surface expression of geothermal systems based on characteristic mineral assemblages that result from hydrothermal alteration (Kratt et al., 2004; Vaughan et al., 2005). Buffalo Valley in Pershing and Lander Counties, Nevada, is an area of high potential for geothermal energy production (Shevenell et al., 2004). Geothermal heat is expressed by several hot springs with surface temperatures of up to 79°C (Olmsted et al., 1975). The hot springs and a chain of Quaternary cinder cones appear to be


Energies Nouvelles et Environnement NV ENE | Open Energy Information  

Open Energy Info (EERE)

Energies Nouvelles et Environnement NV ENE Energies Nouvelles et Environnement NV ENE Jump to: navigation, search Name Energies Nouvelles et Environnement NV (ENE) Place Brussels, Belgium Zip B-1150 Sector Solar Product Producer of photovoltaic solar power systems for space and terrestrial use. Coordinates 50.848385°, 4.349685° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":50.848385,"lon":4.349685,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tracking Emission Rate Dynamics of NV Centers in Nanodiamonds  

E-Print Network (OSTI)

Spontaneous emission from crystal centers is influenced by both the photonic local density of states and non-radiative processes. Here we monitor the spontaneous emission of single nitrogen vacancy (NV) centers as their host diamond is reduced in size from a large monolithic crystal to a nanocrystal by successive cycles of oxidation. The size reduction induces a quenching of the NV radiative emission. New non-radiative channels lead to a decrease of the fluorescence intensity and the excited state lifetime. In one case we observe the onset of blinking which may provide a route to understand these additional non-radiative decay channels.

Faraz A Inam; Andrew M Edmonds; Michael J Steel; Stefania Castelletto



NV-020-07-EA-01 | Open Energy Information  

Open Energy Info (EERE)

EA-01 EA-01 Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: NV-020-07-EA-01 EA at Jersey Valley Geothermal Area for Geothermal/Well Field, Geothermal/Exploration, Jersey Valley Geothermal Exploration Project General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Ormat Technologies Inc Consultant Environmental Management Associates Geothermal Area Jersey Valley Geothermal Area Project Location Near Fallon, NV Project Phase Geothermal/Well Field, Geothermal/Exploration Techniques Drilling Techniques, Observation Wells Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office none provided


GRR/Section 3-NV-b - State Land Access | Open Energy Information  

Open Energy Info (EERE)

NV-b - State Land Access < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-NV-b - State Land Access...


DOE - Office of Legacy Management -- Titanium Metals Corp Div of NLO - NV  

Office of Legacy Management (LM)

Titanium Metals Corp Div of NLO - Titanium Metals Corp Div of NLO - NV 07 FUSRAP Considered Sites Site: TITANIUM METALS CORP., DIV. OF NLO (NV.07 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Henderson , Nevada NV.07-1 Evaluation Year: 1994 NV.07-1 Site Operations: Experimental work on electrolyzing uranium contaminated magnesium fluoride. NV.07-2 Site Disposition: Eliminated - Potential for contamination considered remote NV.07-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium NV.07-2 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to TITANIUM METALS CORP., DIV. OF NLO NV.07-1 - DOE Memorandum; Williams to the File; Elimination of the


GRR/Section 13-NV-a - Land Use Assessment | Open Energy Information  

Open Energy Info (EERE)

NV-a - Land Use Assessment < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 13-NV-a - Land Use...


Waste Toolkit A-Z Battery recycling  

E-Print Network (OSTI)

Waste Toolkit A-Z Battery recycling How can I recycle batteries? The University Safety Office is responsible for arranging battery recycling for departments (see Contact at bottom of page). Colleges must make their own arrangements through a registered hazardous waste carrier. Batteries must not be put

Melham, Tom


Waste Toolkit A-Z Light bulbs  

E-Print Network (OSTI)

Waste Toolkit A-Z Light bulbs Can I recycle light bulbs? It depends what type of bulbs you have for the `hazardous' symbol on the packaging or on the light bulb (crossed out wheelie bin symbol). How can I recycle light bulbs? Standard filament bulbs Put in the waste bin (landfill waste) as these are not classified

Melham, Tom


Tank 241-AZ-102 tank characterization plan  

Science Conference Proceedings (OSTI)

The Defense Nuclear Facilities Safety Board has advised the DOE to concentrate the near-term sampling and analysis activities on identification and resolution of safety issues. The Data Quality Objective (DQO) process was chosen as a tool to be used in the resolution of safety issues. As a result, a revision in the Federal Facilities Agreement and Consent Order (Tri-Party Agreement) milestone M-44 has been made, which states that ``A Tank Characterization Plan (TCP) will also be developed for each double-shell tank (DST) and single-shell tank (SST) using the DQO process ... Development of TCPs by the DQO process is intended to allow users to ensure their needs will be met and that resources are devoted to gaining only necessary information``. This document satisfies that requirement for tank 241-AZ-102 (AZ-102) sampling activities. Tank AZ-102 is currently a non-Watch List tank, so the only DQOs applicable to this tank are the safety screening DQO and the compatibility DQO, as described below. The current contents of Tank AZ-102, as of October 31, 1994, consisted of 3,600 kL (950 kgal) of dilute non-complexed waste and aging waste from PUREX (NCAW, neutralized current acid waste). Tank AZ-102 is expected to have two primary layers. The bottom layer is composed of 360 kL of sludge, and the top layer is composed of 3,240 kL of supernatant, with a total tank waste depth of approximately 8.9 meters.

Schreiber, R.D.



Tank 241-AZ-101 tank characterization plan  

Science Conference Proceedings (OSTI)

The Defense Nuclear Facilities Safety Board has advised the DOE to concentrate the near-term sampling and analysis activities on identification and resolution of safety issues. The Data Quality Objective (DQO) process was chosen as a tool to be used in the resolution of safety issues. As a result, A revision in the Federal Facilities Agreement and Consent Order (Tri-Party Agreement) milestone M-44 has been made, which states that ``A Tank Characterization Plan (TCP) will also be developed for each double-shell tank (DST) and single-shell tank (SST) using the DQO process. Development of TCPs by the DQO process is intended to allow users to ensure their needs will be met and that resources are devoted to gaining only necessary information``. This document satisfies that requirement for Tank 241-AZ-101 (AZ-101) sampling activities. Tank AZ-101 is currently a non-Watch List tank, so the only DQOs applicable to this tank are the safety screening DQO and the compatibility DQO, as described below. The contents of Tank AZ-101, as of October 31, 1994, consisted of 3,630 kL (960 kgal) of dilute non-complexed waste and aging waste from PUREX (NCAW, neutralized current acid waste). Tank AZ-101 is expected to have two primary layers. The bottom layer is composed of 132 kL of sludge, and the top layer is composed of 3,500 kL of supernatant, with a total tank waste depth of approximately 8.87 meters.

Schreiber, R.D.



NV Energy Sierra Pacific Resources | Open Energy Information  

Open Energy Info (EERE)

Resources Resources Jump to: navigation, search Name NV Energy/Sierra Pacific Resources Place Reno, Nevada Zip 89511 Product Sierra Pacific Resources is a holding company whose principal subsidiary is NV Energy (formerly the separate entities Nevada Power Company and Sierra Pacific Power Company). Coordinates 32.944065°, -97.578279° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":32.944065,"lon":-97.578279,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


File:INL-geothermal-nv.pdf | Open Energy Information  

Open Energy Info (EERE)

nv.pdf nv.pdf Jump to: navigation, search File File history File usage Nevada Geothermal Resources Size of this preview: 432 × 600 pixels. Full resolution ‎(2,877 × 3,995 pixels, file size: 847 KB, MIME type: application/pdf) Description Nevada Geothermal Resources Sources Idaho National Laboratory Authors Patrick Laney; Julie Brizzee Related Technologies Geothermal Creation Date 2003-11-01 Extent State Countries United States UN Region Northern America States Nevada File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 12:42, 16 December 2010 Thumbnail for version as of 12:42, 16 December 2010 2,877 × 3,995 (847 KB) MapBot (Talk | contribs) Automated upload from NREL's "mapsearch" data


File:EnergyResourcePermittingNV.pdf | Open Energy Information  

Open Energy Info (EERE)

EnergyResourcePermittingNV.pdf EnergyResourcePermittingNV.pdf Jump to: navigation, search File File history File usage File:EnergyResourcePermittingNV.pdf Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Go to page 1 2 3 4 5 6 7 8 9 10 11 Go! next page → next page → Full resolution ‎(1,275 × 1,650 pixels, file size: 97 KB, MIME type: application/pdf, 11 pages) File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 11:16, 15 October 2012 Thumbnail for version as of 11:16, 15 October 2012 1,275 × 1,650, 11 pages (97 KB) Dklein2012 (Talk | contribs) You cannot overwrite this file. Edit this file using an external application (See the setup instructions for more information) File usage


Formation of Vanadate Conversion Coating on AZ31 Magnesium Alloy  

Science Conference Proceedings (OSTI)

In the present investigation, a chromate-free, corrosion-resistant conversion coating using vanadium based solution was applied to AZ31 magnesium alloy.


RECIPIENT:Desert Research Institute STATE:NV PROJECT Tall Tower...  

NLE Websites -- All DOE Office Websites (Extended Search)

Research Institute STATE:NV PROJECT Tall Tower Wind Energy Monitoring and Numerical Model Validation in Southern Nevada; NREl Tracking TITLE: No. 11-012 Funding Opportunity...



Science Conference Proceedings (OSTI)

This report presents the analyses results for three samples obtained under RPP-PLAN-28509, Sampling and Analysis Plan for Building 241 702-AZ A Train. The sampling and analysis was done in response to problem evaluation request number PER-2004-6139, 702-AZ Filter Rooms Need Radiological Cleanup Efforts.




241-AZ Farm Annulus Extent of Condition Baseline Inspection  

Science Conference Proceedings (OSTI)

This report provides the results of the comprehensive annulus visual inspection for tanks 241- AZ-101 and 241-AZ-102 performed in fiscal year 2013. The inspection established a baseline covering about 95 percent of the annulus floor for comparison with future inspections. Any changes in the condition are also included in this document.

Engeman, Jason K.; Girardot, Crystal L.; Vazquez, Brandon J.



702AZ aging waste ventilation facility year 2000 test procedure  

SciTech Connect

This test procedure was developed to determine if the 702AZ Tank Ventilation Facility system is Year 2000 Compliant. The procedure provides detailed instructions for performing the operations necessary and documenting the results. This verification procedure will document that the 702AZ Facility Systems are year 2000 compliant and will correctly meet the criteria established in this procedure.

Winkelman, W.D.



NV-020-03-26 | Open Energy Information  

Open Energy Info (EERE)

6 6 Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: NV-020-03-26 EA at Desert Peak Geothermal Area for Geothermal/Power Plant, Desert Peak 2 Geothermal Project Environmental Assessment General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant ORNI 3, LLC Consultant Argonne National Laboratory, Environmental Management Associates, Inc. (EMA) Geothermal Area Desert Peak Geothermal Area Project Location Nevada Project Phase Geothermal/Power Plant Techniques Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office none provided Funding Agencies none provided Surface Manager BLM, private Mineral Manager BLM


DOI-BLM-NV-B020-????-???-EA | Open Energy Information  

Open Energy Info (EERE)

B020-????-???-EA B020-????-???-EA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-B020-????-???-EA EA at Grass Valley Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Ormat Technologies Inc Geothermal Area Grass Valley Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Battle Mountain Managing Field Office BLM Mount Lewis Field Office Funding Agencies none provided Surface Manager none provided Mineral Manager none provided Selected Dates Relevant Numbers Lead Agency


EA-NV-030-05-08 | Open Energy Information  

Open Energy Info (EERE)

5-08 5-08 Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: EA-NV-030-05-08 EA at Salt Wells Geothermal Area for Geothermal/Exploration Salt Wells Geothermal Plant Development Final EA General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Nevada Geothermal Specialists, LLC Consultant Tetra Tech, Inc. Geothermal Area Salt Wells Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager none provided Mineral Manager Nevada Selected Dates Application

Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOI-BLM-NV-C010-????-????-CX | Open Energy Information  

Open Energy Info (EERE)

????-????-CX ????-????-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-????-????-CX CX at Dixie Valley Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Ormat Technologies Inc Geothermal Area Dixie Valley Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Thermal Gradient Holes Comments No Doc Number- CX was never processed. Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office none provided Funding Agencies none provided Surface Manager none provided Mineral Manager none provided


DOI-BLM-NV-C010-2011-0001-EA | Open Energy Information  

Open Energy Info (EERE)

DOI-BLM-NV-C010-2011-0001-EA DOI-BLM-NV-C010-2011-0001-EA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2011-0001-EA EA at Coyote Canyon Geothermal Area for Geothermal/Power Plant TGP Coyote Canyon Utilization Project General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Terra-Gen Power LLC Consultant CH2M Hill Ltd Geothermal Area Coyote Canyon Geothermal Area Project Location Churchill County, NV, Churchill County, NV Project Phase Geothermal/Power Plant Techniques Exploration Drilling, Observation Wells, Well Testing Techniques Comments Utilization Time Frame (days) NEPA Process Time 214 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City


DOI-BLM-NV-CO1000-2010-0021-CX | Open Energy Information  

Open Energy Info (EERE)

DOI-BLM-NV-CO1000-2010-0021-CX DOI-BLM-NV-CO1000-2010-0021-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-CO1000-2010-0021-CX CX at Coyote Canyon Geothermal Area for Geothermal/Exploration, {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant TGP Dixie Development LLC Geothermal Area Coyote Canyon Geothermal Area Project Location Churchill County, NV, Churchill County, NV Project Phase Geothermal/Exploration Techniques Magnetotelluric Methods Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager Nevada Mineral Manager BLM


GRR/Section 7-NV-a - Permit to Construct and Permit to Operate | Open  

Open Energy Info (EERE)

7-NV-a - Permit to Construct and Permit to Operate 7-NV-a - Permit to Construct and Permit to Operate < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 7-NV-a - Permit to Construct and Permit to Operate 07NVAPermitToConstructAndPermitToOperate (3).pdf Click to View Fullscreen Contact Agencies Nevada Division of Environmental Protection Triggers None specified Click "Edit With Form" above to add content 07NVAPermitToConstructAndPermitToOperate (3).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative _ 7-NV-a.1 and 6-NV-a.2 - Has an Environmental Review been Completed for Construction? The developer must make sure to undergo an environmental process before


DOI-BLM-NV-CO1000-2010-0022-CX | Open Energy Information  

Open Energy Info (EERE)

DOI-BLM-NV-CO1000-2010-0022-CX DOI-BLM-NV-CO1000-2010-0022-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-CO1000-2010-0022-CX CX at Coyote Canyon Geothermal Area for Geothermal/Exploration, {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Terra-Gen Power LLC Geothermal Area Coyote Canyon Geothermal Area Project Location Churchill County, NV, Churchill County, NV Project Phase Geothermal/Exploration Techniques Electromagnetic Techniques, Magnetotelluric Techniques, Seismic Techniques Time Frame (days) Application Time 213 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided


EA-NV-030-07-006 | Open Energy Information  

Open Energy Info (EERE)

7-006 7-006 Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: EA-NV-030-07-006 EA at Carson Lake Corral Geothermal Area for Geothermal/Well Field Ormat Carson Lake Geothermal Exploration Project General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Ormat Technologies Inc Consultant MHA Environmental Consulting, Inc. Geothermal Area Carson Lake Corral Geothermal Area Project Location Nevada Project Phase Geothermal/Well Field Techniques Exploration Drilling, Slim Holes, Thermal Gradient Holes Time Frame (days) Application Time 345 NEPA Process Time 296 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater


Meeting Location: Las Vegas, NV- DOE Office at Lossee Road  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

11 11 th EM QUALITY ASSURANCE CORPORATE BOARD MEETING Meeting Location: Las Vegas, NV- DOE Office at Lossee Road With Limited Conference Call Capabilities Room: 6404 Agenda for May 1, 2012 1:00-1:15 pm Agenda, Introductions, Status of Action Items from Last Board Meeting Bob Murray (EM-43) 1:15-1:35 pm Discussion and Summary of the Site ISM/QA Declarations Steven Ross (EM-43) 1:35-2:05 pm Status of Phase II Follow-up Reviews for Field Offices including Use and Status of the Standard Review Plan Bob Toro (EM-43) 2:05-2:35 pm Overview of EM QA Program (as provided to DNFSB) Matthew Moury (EM-40) Bob Murray (EM-43) 2:35-3:05 pm (BOARD VOTE)


NV-020-08-DNA-52 | Open Energy Information  

Open Energy Info (EERE)

DNA-52 DNA-52 Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: NV-020-08-DNA-52 DNA at {{{GeothermalArea}}} for Geothermal/Exploration, {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Gerlach Geothermal LLC Geothermal Area {{{GeothermalArea}}}"{{{GeothermalArea}}}" cannot be used as a page name in this wiki. Project Location Project Phase Geothermal/Exploration Techniques Thermal Gradient Holes Comments NOI for TGH at Gavvs Valley Time Frame (days) Application Time 14 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office BLM Black Rock Field Office Funding Agencies none provided


Tank 241-AZ-101 and Tank 241-AZ-102 Airlift Circulator Operation Vapor Sampling and Analysis Plan  

DOE Green Energy (OSTI)

This sampling and analysis plan (SAP) identifies characterization objectives pertaining to sample collection, laboratory analytical evaluation, and reporting requirements for vapor samples obtained during the operation of the tank 241-AZ-101 and 241-AZ-102 airlift circulators (ALCs) and during the initial operation (''bump'') of the tank 241-AZ-101 mixer pumps. The purpose of the ALC operation is to support portions of the operational test procedure (OTP) for Project W-030 (OTP-W030-001) and to perform functional test in support of Project W-151. Project W-030 is the 241-A-702 ventilation upgrade project (241-142-702) and Project W-151 is the 241-AZ-101 Mixer Pump Test. The functional tests will check the operability of the tank 241-AZ-101 ALCs. Process Memo's No. 2E98-082 and No. 2E99-001 (LMHC 1999a, LMHC 1999b) direct the operation of the ALCs and the Industrial Hygiene monitoring respectively. A series of tests will be conducted in which the ALCs in tanks 241-AZ-101 and 241-AZ-102 will be operated at different air flow rates. Vapor samples will be obtained to determine constituents that may be present in the tank headspace during ALC operation at tanks 241-AZ-101 and 241-AZ-102 as the waste is disturbed. During the testing, vapor samples will be obtained from the headspace of tanks 241-AZ-101 and 241-AZ-102 via the unused port on the standard hydrogen monitoring system (SHMS). In addition the last two vapor samples will be collected from the headspace of tank 241-AZ-101 during the operation of the mixer pumps. Each mixer pump will be operated for approximately 5 minutes. Results will be used to provide the waste feed delivery program with environmental air permitting data for tank waste disturbing activities. Because of radiological concerns, the samples will be filtered for particulates. It is recognized that this may remove some organic compounds. The following sections provide the general methodology and procedures to be used in the preparation, retrieval, transport, analysis, and reporting of results from vapor samples retrieved during the ALC testing.




Enhancing Tensile and Compressive Strength of AZ41 Magnesium ...  

Science Conference Proceedings (OSTI)

Al and 1 wt.% Al with 1.5 vol.% nano-sized Al2O3 (50 nm) particulates in to AZ31 magnesium alloy, respectively, using disintegrated melt deposition technique.


DOI-BLM-NV-CO1000-2010-0010-CX | Open Energy Information  

Open Energy Info (EERE)

CX CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-CO1000-2010-0010-CX CX at Coyote Canyon Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Terra-Gen Power LLC Geothermal Area Coyote Canyon Geothermal Area Project Location Churchill County, NV, Churchill County, NV Project Phase Geothermal/Exploration Techniques Electromagnetic Techniques Time Frame (days) Application Time 209 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates


GRR/Section 4-NV-a - State Exploration Process | Open Energy Information  

Open Energy Info (EERE)

4-NV-a - State Exploration Process 4-NV-a - State Exploration Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 4-NV-a - State Exploration Process 04NVAStateExplorationProcess (1).pdf Click to View Fullscreen Contact Agencies Nevada Division of Minerals Nevada Department of Wildlife Nevada Division of Environmental Protection Regulations & Policies NAC 534A.190: Individual Geothermal Well NAC 534A.193: Geothermal Project Area Triggers None specified Click "Edit With Form" above to add content 04NVAStateExplorationProcess (1).pdf 04NVAStateExplorationProcess (1).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative ____ 4-NV-a.1 - Is the Proposed Activity Pre-Drilling Exploration or Exploration


GRR/Section 17-NV-a - Aesthetic Resource Assessment | Open Energy  

Open Energy Info (EERE)

GRR/Section 17-NV-a - Aesthetic Resource Assessment GRR/Section 17-NV-a - Aesthetic Resource Assessment < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 17-NV-a - Aesthetic Resource Assessment 17NVAAestheticResourceAssessment.pdf Click to View Fullscreen Triggers None specified Click "Edit With Form" above to add content 17NVAAestheticResourceAssessment.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative Add Text Print PDF Retrieved from "http://en.openei.org/w/index.php?title=GRR/Section_17-NV-a_-_Aesthetic_Resource_Assessment&oldid=685690" Categories: Regulatory Roadmap State Sections



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOI-BLM-NV-W030-2010-0006-EA; DOE/EA-1810 SAN EMIDIO GEOTHERMAL EXPLORATION PROJECT Geothermal Drilling Permits Geothermal Leases NVN-42707, NVN-75233, and NVN-74196 Exploration Well Numbers 62-4, 68-33, 57-33, 73-9, 84-16, and 87-16 Washoe County, Nevada October 2010 Prepared by: U.S. Bureau of Land Management Winnemucca District Office BLM Black Rock Field Office/Nevada 5100 E. Winnemucca Blvd. Winnemucca NV 89445-2921 U. S. Department of Energy Cooperating Agency Environmental Assessment San Emidio Geothermal Exploration Project It is the mission of the Bureau of Land Management to sustain the health, diversity, and productivity of the public lands for the use and enjoyment of present and future generations. BLM/NV/WN/EA-10/31+1792 DOI-BLM-NV-W030--2010-0006-EA;


GRR/Section 1-NV-a - State Land Use Planning | Open Energy Information  

Open Energy Info (EERE)

-NV-a - State Land Use Planning -NV-a - State Land Use Planning < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 1-NV-a - State Land Use Planning 01NVAStateLandUsePlanning (1).pdf Click to View Fullscreen Contact Agencies Nevada Division of State Lands Regulations & Policies NRS 278: Planning and Zoning Triggers None specified Click "Edit With Form" above to add content 01NVAStateLandUsePlanning (1).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative _ 1-NV-a.1 - Inventory Population Data, Land Use Survey, Housing, and Economic Data According to the Planner's Guide, a land use plan ought to consider:


DOI-BLM-NV-B020-2011-0015-EA | Open Energy Information  

Open Energy Info (EERE)

DOI-BLM-NV-B020-2011-0015-EA EA at Abraham Hot Springs Geothermal Area for GeothermalPower Plant General NEPA Document Info Energy Sector Geothermal energy Environmental...


Local Event - Nevada Test Site, Las Vegas, NV | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Local Event - Nevada Test Site, Las Vegas, NV Local Event - Nevada Test Site, Las Vegas, NV Local Event - Nevada Test Site, Las Vegas, NV October 25, 2013 9:00AM PDT National Day of Remembrance Local Event Where: National Atomic Testing Museum 755 E Flamingo Rd Las Vegas, NV 89119 On June 11th, 2013, Senators Mark Udall (D-CO) and Lamar Alexander (R-TN) introduced a bipartisan resolution to designate October 30 as the fifth annual National Day of Remembrance for former nuclear weapons workers and uranium miners who proudly served their country starting with the Manhattan Project through present day. Representatives from the DOE, Federal Government, and Atomic Testing Museum will speak on behalf of former workers. Admission to the National Atomic Testing Museum will be free for the day. Local coordinators will have a booth and conduct outreach on the


NV/YMP radiological control manual, Revision 2  

Science Conference Proceedings (OSTI)

The Nevada Test Site (NTS) and the adjacent Yucca Mountain Project (YMP) are located in Nye County, Nevada. The NTS has been the primary location for testing nuclear explosives in the continental US since 1951. Current activities include operating low-level radioactive and mixed waste disposal facilities for US defense-generated waste, assembly/disassembly of special experiments, surface cleanup and site characterization of contaminated land areas, and non-nuclear test operations such as controlled spills of hazardous materials at the hazardous Materials (HAZMAT) Spill Center (HSC). Currently, the major potential for occupational radiation exposure is associated with the burial of low-level nuclear waste and the handling of radioactive sources. Planned future remediation of contaminated land areas may also result in radiological exposures. The NV/YMP Radiological Control Manual, Revision 2, represents DOE-accepted guidelines and best practices for implementing Nevada Test Site and Yucca Mountain Project Radiation Protection Programs in accordance with the requirements of Title 10 Code of Federal Regulations Part 835, Occupational Radiation Protection. These programs provide protection for approximately 3,000 employees and visitors annually and include coverage for the on-site activities for both personnel and the environment. The personnel protection effort includes a DOE Laboratory Accreditation Program accredited dosimetry and personnel bioassay programs including in-vivo counting, routine workplace air sampling, personnel monitoring, and programmatic and job-specific As Low as Reasonably Achievable considerations.

Gile, A.L. [comp.] [comp.



Atmospheric Radioxenon Measurements in North Las Vegas, NV  

Science Conference Proceedings (OSTI)

PNNL deployed the ARSA radioxenon measurement system in North Las Vegas for two weeks in February and March 2006 for the purpose of measuring the radioxenon background at a level of sensitivity much higher than previously done in the vicinity of the NTS. The measurements establish what might be expected if future measurements are taken at NTS itself. The measurements are also relevant to test site readiness. A second detector, the PEMS, built and operated by DRI, was deployed in conjunction with the ARSA and contained a PIC, aerosol collection filters, and meteorological sensors. Originally, measurements were also to be performed at Mercury, NV on the NTS, but these were canceled due to initial equipment problems with the ARSA detector. Some of the radioxenon measurements detected 133Xe at levels up to 3 mBq/m3. This concentration of radioxenon is consistent with the observation of low levels of radioxenon emanating from distance nuclear reactors. Previous measurements in areas of high nuclear reactor concentration have shown similar results, but the western US, in general, does not have many nuclear reactors. Measurements of the wind direction indicate that the air carrying the radioxenon came from south of the detector and not from the NTS.

Milbrath, Brian D.; Cooper, Matthew W.; Lidey, Lance S.; Bowyer, Ted W.; Hayes, James C.; McIntyre, Justin I.; Karr, L.; Shafer, D.; Tappen, J.



City of Williams - AZ, Arizona (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Williams - AZ, Arizona (Utility Company) Williams - AZ, Arizona (Utility Company) Jump to: navigation, search Name City of Williams - AZ Place Arizona Utility Id 56535 Utility Location Yes Ownership M NERC Location WECC NERC WECC Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Buying Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png City owned Lights(20,000 Lumens,400 W MV-Pole) Lighting City owned Lights(4,000 Lumens-Pole) Lighting City owned Lights(7,000 Lumens, 175 W MV-Pole) Lighting Customer owned Lights(20,000 Lumens 400 W MV-Pole) Commercial Customer owned Lights(4,000 Lumens-Pole) Lighting

Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Influence of Cerium on Stress Corrosion Cracking in AZ91D  

Science Conference Proceedings (OSTI)

This paper considers the effect of cerium additions on the stress corrosion cracking in the Mg-Al-Zn alloy AZ91D. The two dominant phases in the AZ91D...


AZ-101 Mixer Pump Test Qualification Test Procedures (QTP)  

SciTech Connect

Describes the Qualification test procedure for the AZ-101 Mixer Pump Data Acquisition System (DAS). The purpose of this Qualification Test Procedure (QTP) is to confirm that the AZ-101 Mixer Pump System has been properly programmed and hardware configured correctly. This QTP will test the software setpoints for the alarms and also check the wiring configuration from the SIMcart to the HMI. An Acceptance Test Procedure (ATP), similar to this QTP will be performed to test field devices and connections from the field.




A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. ...


Nogales, AZ Liquefied Natural Gas Exports to Mexico (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Million Cubic Feet) Nogales, AZ Liquefied Natural Gas Exports to Mexico (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2012 8.938 8.916 5.241 3.570 4.280...


Mixer pump test plan for double shell tank AZ-101  

Science Conference Proceedings (OSTI)

Mixer pump systems have been chosen as the method for retrieval of tank wastes contained in double shell tanks at Hanford. This document describes the plan for testing and demonstrating the ability of two 300 hp mixer pumps to mobilize waste in tank AZ-101. The mixer pumps, equipment and instrumentation to monitor the test were installed by Project W-151.




Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


DOI-BLM-NV-W010-2011-0004-CX | Open Energy Information  

Open Energy Info (EERE)

DOI-BLM-NV-W010-2011-0004-CX DOI-BLM-NV-W010-2011-0004-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-W010-2011-0004-CX CX at Dixie Valley Geothermal Area for Geothermal/Exploration, AltaRock Seismic Survey General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant AltaRock Energy Inc Geothermal Area Dixie Valley Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Passive Seismic Techniques Time Frame (days) Application Time 160 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office Humboldt River Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates


EA-1944: Ormat Technologies Brady Hot Springs Project, Churchill County, NV  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

944: Ormat Technologies Brady Hot Springs Project, Churchill 944: Ormat Technologies Brady Hot Springs Project, Churchill County, NV EA-1944: Ormat Technologies Brady Hot Springs Project, Churchill County, NV SUMMARY Ormat Technologies, Inc. (Ormat) proposes to use DOE and cost share funding to study the Brady Hot Springs geothermal Field 15-12RD well. This is an EGS Demonstration project divided into three phases. During Phase 1, Ormat characterized the target well to prepare for stimulation activities in Phase 2, Phase 2: Well Stimulation and Collection/Analysis of Stimulation Monitoring Data and Phase 3: Long-term testing of the system. Phase 2 and 3 activities would occur at Ormat's Brady Hot Springs geothermal field in Churchill County, NV on public lands managed by the Bureau of Land Management (BLM) and Bureau of Reclamation (BOR). Since Phases 2 and 3


GRR/Section 14-NV-d - 401 Water Quality Certification | Open Energy  

Open Energy Info (EERE)

GRR/Section 14-NV-d - 401 Water Quality Certification GRR/Section 14-NV-d - 401 Water Quality Certification < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 14-NV-d - 401 Water Quality Certification 14NVDSection401WaterQualityCertification.pdf Click to View Fullscreen Contact Agencies Nevada Division of Environmental Protection Regulations & Policies Section 401 of the Clean Water Act (33 U.S.C. 1341) Triggers None specified Click "Edit With Form" above to add content 14NVDSection401WaterQualityCertification.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative Section 401 of the Clean Water Act (33 U.S.C. 1341) requires activities in


DOI-BLM-NV-W010-2010-0043-CX | Open Energy Information  

Open Energy Info (EERE)

DOI-BLM-NV-W010-2010-0043-CX DOI-BLM-NV-W010-2010-0043-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-W010-2010-0043-CX CX at Abraham Hot Springs Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Oski Energy LLC Geothermal Area Abraham Hot Springs Geothermal Area Project Location Utah Project Phase Geothermal/Exploration Techniques Seismic Techniques Time Frame (days) Application Time 68 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office Humboldt River Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Application Date 6/2/2010


GRR/Section 5-NV-a - Drilling Well Development | Open Energy Information  

Open Energy Info (EERE)

5-NV-a - Drilling Well Development 5-NV-a - Drilling Well Development < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 5-NV-a - Drilling Well Development 05NVADrillingWellDevelopment.pdf Click to View Fullscreen Contact Agencies Nevada Division of Minerals Nevada Division of Water Resources Regulations & Policies Nevada Revised Statutes (NRS) Nevada Administrative Code (NAC) Triggers None specified Click "Edit With Form" above to add content 05NVADrillingWellDevelopment.pdf 05NVADrillingWellDevelopment.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative A person may not drill or operate a geothermal well or drill an exploratory well without obtaining a permit from the Administrator of the Nevada


GRR/Section 5-FD-b - Drilling Pre-Application Process NV only | Open Energy  

Open Energy Info (EERE)

5-FD-b - Drilling Pre-Application Process NV only 5-FD-b - Drilling Pre-Application Process NV only < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 5-FD-b - Drilling Pre-Application Process NV only 05-FD-b - DrillingApplicationProcess.pdf Click to View Fullscreen Contact Agencies Bureau of Land Management United States Forest Service Regulations & Policies Energy Policy Act of 2005 Geothermal Steam Act of 1970 43 CFR 3261: Drilling Operations, Getting A Permit Triggers None specified Click "Edit With Form" above to add content 05-FD-b - DrillingApplicationProcess.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.


DOI-BLM-NV-C010-2012-0035-DNA | Open Energy Information  

Open Energy Info (EERE)

DOI-BLM-NV-C010-2012-0035-DNA DOI-BLM-NV-C010-2012-0035-DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2012-0035-DNA DNA at Dead Horse Wells Geothermal Area for Geothermal/Well Field {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Ormat Technologies Inc Geothermal Area Dead Horse Wells Geothermal Area Project Location California Project Phase Geothermal/Well Field Techniques Production Wells Comments Geothermal Drilling Permits 12-A-12, 54A-11, 62-11, and Sundry Notice Well 65-11 Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided


GRR/Section 14-NV-e - Groundwater Discharge Permit | Open Energy  

Open Energy Info (EERE)

GRR/Section 14-NV-e - Groundwater Discharge Permit GRR/Section 14-NV-e - Groundwater Discharge Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 14-NV-e - Groundwater Discharge Permit 14NVEGroundwaterDischargePermit.pdf Click to View Fullscreen Contact Agencies Nevada Division of Environmental Protection Regulations & Policies NAC 445A NRS 445A Triggers None specified Click "Edit With Form" above to add content 14NVEGroundwaterDischargePermit.pdf 14NVEGroundwaterDischargePermit.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative The Nevada Division of Environmental Protection (NDEP) Bureau of Water Pollution Control is responsible for protecting Nevada water quality from


NV Energy (Northern Nevada Gas) - SureBet Business Energy Efficiency Rebate  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NV Energy (Northern Nevada Gas) - SureBet Business Energy NV Energy (Northern Nevada Gas) - SureBet Business Energy Efficiency Rebate Program (Nevada) NV Energy (Northern Nevada Gas) - SureBet Business Energy Efficiency Rebate Program (Nevada) < Back Eligibility Agricultural Commercial Construction Fed. Government Industrial Installer/Contractor Institutional Nonprofit Schools State Government Savings Category Heating & Cooling Commercial Heating & Cooling Heating Other Commercial Weatherization Manufacturing Home Weatherization Insulation Design & Remodeling Appliances & Electronics Water Heating Program Info State Nevada Program Type Utility Rebate Program Rebate Amount High Efficiency Boilers Input MBH $1.25 Boiler Reset Control Boiler $500 Boiler Tune-up Boiler $300 High Efficiency Furnaces Input MBH $1 Commercial Water Heaters Unit $150


DOI-BLM-NV-W030-20??-????-CX | Open Energy Information  

Open Energy Info (EERE)

NV-W030-20??-????-CX NV-W030-20??-????-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-W030-20??-????-CX CX at Mcgee Mountain Geothermal Area for Geothermal/Exploration McGee Mountain Gravity Survey General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Geothermal Technical Partners Geothermal Area Mcgee Mountain Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Gravity Techniques Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office Humboldt River Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Relevant Numbers


GRR/Section 5-FD-b - Drilling Pre-Application Process NV only | Open Energy  

Open Energy Info (EERE)

5-FD-b - Drilling Pre-Application Process NV only 5-FD-b - Drilling Pre-Application Process NV only < GRR(Redirected from GRR/Section 5-FD-b - Drilling Application Process) Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 5-FD-b - Drilling Pre-Application Process NV only 05-FD-b - DrillingApplicationProcess.pdf Click to View Fullscreen Contact Agencies Bureau of Land Management United States Forest Service Regulations & Policies Energy Policy Act of 2005 Geothermal Steam Act of 1970 43 CFR 3261: Drilling Operations, Getting A Permit Triggers None specified Click "Edit With Form" above to add content 05-FD-b - DrillingApplicationProcess.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.

Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


GRR/Section 6-NV-a - Transportation Permit | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 6-NV-a - Transportation Permit GRR/Section 6-NV-a - Transportation Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 6-NV-a - Transportation Permit 06NVATransportationPermit.pdf Click to View Fullscreen Contact Agencies Nevada Department of Transportation Nevada Department of Motor Vehicles Regulations & Policies Nevada Traffic Laws for Size Weight Load Triggers None specified Click "Edit With Form" above to add content 06NVATransportationPermit.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative Nevada Department of Transportation (NDOT) regulates the transport of oversized loads on Nevada's roads. NDOT regulates oversized loads in order


GRR/Section 14-NV-b - NPDES Permit Program | Open Energy Information  

Open Energy Info (EERE)

4-NV-b - NPDES Permit Program 4-NV-b - NPDES Permit Program < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 14-NV-b - NPDES Permit Program 14NVBNPDESPermitProgram.pdf Click to View Fullscreen Contact Agencies Nevada Division of Environmental Protection Nevada Division of Water Resources nevada Regulations & Policies Nevada Revised Statutes (NRS) Nevada Administrative Code (NAC) Nevada Water Pollution Control Law: NRS 445A.300-445A.730 Triggers None specified Click "Edit With Form" above to add content 14NVBNPDESPermitProgram.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative


DOI-BLM-NV-CC-ES-11-10-1793 | Open Energy Information  

Open Energy Info (EERE)

DOI-BLM-NV-CC-ES-11-10-1793 DOI-BLM-NV-CC-ES-11-10-1793 Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-CC-ES-11-10-1793 EIS at Salt Wells Geothermal Area for Geothermal/Power Plant Salt Wells Geothermal Energy Projects EIS General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EIS Applicant Ormat Technologies Inc, Gradient Resources (formerly Vulcan Power), Sierra Pacific Power Co, Consultant EMPSi Geothermal Area Salt Wells Geothermal Area Project Location Nevada Project Phase Geothermal/Power Plant Techniques Development Drilling Time Frame (days) NEPA Process Time 749 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater


DOI-LM-NV-W010-2012-0061-CX | Open Energy Information  

Open Energy Info (EERE)

LM-NV-W010-2012-0061-CX LM-NV-W010-2012-0061-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-LM-NV-W010-2012-0061-CX CX at Desert Queen Geothermal Area for Geothermal/Exploration, Geothermal Temperature Gradient Well Drilling at Desert Queen General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Nevada Bureau of Mines and Geology Geothermal Area Desert Queen Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Thermal Gradient Holes Time Frame (days) Application Time 127 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office Humboldt River Funding Agencies none provided Surface Manager BLM


GRR/Section 15-NV-a - Nevada Clean Air Act Process | Open Energy  

Open Energy Info (EERE)

15-NV-a - Nevada Clean Air Act Process 15-NV-a - Nevada Clean Air Act Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 15-NV-a - Nevada Clean Air Act Process 15NVANevadaCleanAirActProcess.pdf Click to View Fullscreen Contact Agencies Nevada Division of Environmental Protection United States Environmental Protection Agency Regulations & Policies Nevada Revised Statutes (NRS) Nevada Administrative Code (NAC) Triggers None specified Click "Edit With Form" above to add content 15NVANevadaCleanAirActProcess.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative The federal Clean Air Act is administered by the United States


GRR/Section 4-FD-b - Exploration Pre-Application Process (NV only) | Open  

Open Energy Info (EERE)

GRR/Section 4-FD-b - Exploration Pre-Application Process (NV only) GRR/Section 4-FD-b - Exploration Pre-Application Process (NV only) < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 4-FD-b - Exploration Pre-Application Process (NV only) 04FDBExplorationPreApplicationProcess.pdf Click to View Fullscreen Contact Agencies Bureau of Land Management United States Forest Service Regulations & Policies 43 CFR 3251 Exploration Operations: Getting BLM Approval 43 CFR 3261 Drilling Operations: Getting a Permit Triggers None specified Click "Edit With Form" above to add content 04FDBExplorationPreApplicationProcess.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.


GRR/Section 12-NV-a - Flora and Fauna Considerations | Open Energy  

Open Energy Info (EERE)

2-NV-a - Flora and Fauna Considerations 2-NV-a - Flora and Fauna Considerations < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 12-NV-a - Flora and Fauna Considerations 12NVAFloraFaunaConsiderations.pdf Click to View Fullscreen Contact Agencies Nevada Department of Wildlife Nevada State Office of Energy Regulations & Policies NRS 701.600 et seq Triggers None specified Click "Edit With Form" above to add content 12NVAFloraFaunaConsiderations.pdf 12NVAFloraFaunaConsiderations.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative Nevada has a particular state notification and review process for wildlife considerations for all energy projects 10 megawatts or greater. The process


DOI-BLM-NV-C010-2009-0051-CX | Open Energy Information  

Open Energy Info (EERE)

DOI-BLM-NV-C010-2009-0051-CX DOI-BLM-NV-C010-2009-0051-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2009-0051-CX CX at Soda Lake Geothermal Area for Geothermal/Exploration, Magnetotelluric Survey at Soda Lake General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Global Magma Energy Group Geothermal Area Soda Lake Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Magnetotelluric Techniques Comments The Bureau of Reclamation has deferred surface management authority to the BLM for this project. Time Frame (days) Application Time 27 Participating Agencies Lead Agency Nevada Funding Agency none provided Managing District Office Carson City


GRR/Section 18-NV-c - Waste Disposal Permit | Open Energy Information  

Open Energy Info (EERE)

NV-c - Waste Disposal Permit NV-c - Waste Disposal Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 18-NV-c - Waste Disposal Permit 18NVCWasteDisposalPermit.pdf Click to View Fullscreen Contact Agencies Nevada Division of Environmental Protection Regulations & Policies Nevada Revised Statutes (NRS) Nevada Administrative Code (NAC) Triggers None specified Click "Edit With Form" above to add content 18NVCWasteDisposalPermit.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative Within the Nevada Division of Environmental Protection in Nevada, the Bureau of Waste Management (BWM) operates a permitting and compliance


GRR/Section 11-NV-a - Cultural Considerations | Open Energy Information  

Open Energy Info (EERE)

1-NV-a - Cultural Considerations 1-NV-a - Cultural Considerations < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 11-NV-a - Cultural Considerations 11NVACulturalConsiderations (1).pdf Click to View Fullscreen Contact Agencies Nevada State Historic Preservation Office Nevada State Office of Energy Nevada Public Utilities Commission National Park Service Advisory Council on Historic Preservation Regulations & Policies National Historic Preservation Act Native American Graves Protection Act Triggers None specified Click "Edit With Form" above to add content 11NVACulturalConsiderations (1).pdf 11NVACulturalConsiderations (1).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.


DOI-BLM-NV-CO1000-2010-0011-CX | Open Energy Information  

Open Energy Info (EERE)

CO1000-2010-0011-CX CO1000-2010-0011-CX CX at Coyote Canyon Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Terra-Gen Power LLC Geothermal Area Coyote Canyon Geothermal Area Project Location Churchill County, NV, Churchill County, NV Project Phase Geothermal/Exploration Techniques Electromagnetic Techniques Time Frame (days) Application Time 209 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Application Date 6/30/2009 Decision Document Date 1/25/2010 Relevant Numbers Lead Agency Doc Number DOI-BLM-NV-C010-2010-0011-CX


EA-1944: Ormat Technologies Brady Hot Springs Project, Churchill County, NV  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

944: Ormat Technologies Brady Hot Springs Project, Churchill 944: Ormat Technologies Brady Hot Springs Project, Churchill County, NV EA-1944: Ormat Technologies Brady Hot Springs Project, Churchill County, NV SUMMARY Ormat Technologies, Inc. (Ormat) proposes to use DOE and cost share funding to study the Brady Hot Springs geothermal Field 15-12RD well. This is an EGS Demonstration project divided into three phases. During Phase 1, Ormat characterized the target well to prepare for stimulation activities in Phase 2, Phase 2: Well Stimulation and Collection/Analysis of Stimulation Monitoring Data and Phase 3: Long-term testing of the system. Phase 2 and 3 activities would occur at Ormat's Brady Hot Springs geothermal field in Churchill County, NV on public lands managed by the Bureau of Land Management (BLM) and Bureau of Reclamation (BOR). Since Phases 2 and 3


DOI-BLM-NV-C010-2013-0026-DNA | Open Energy Information  

Open Energy Info (EERE)

DOI-BLM-NV-C010-2013-0026-DNA DOI-BLM-NV-C010-2013-0026-DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2013-0026-DNA DNA at Dixie Valley Geothermal Area for Geothermal/Well Field, Above ground drilling water pipeline (temporary) General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant TGP Coyote Canyon LLC Geothermal Area Dixie Valley Geothermal Area Project Location Nevada Project Phase Geothermal/Well Field Techniques Production Wells Time Frame (days) Application Time 56 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM


DOI-BLM-NV-C010-2013-0037-DNA | Open Energy Information  

Open Energy Info (EERE)

DOI-BLM-NV-C010-2013-0037-DNA DOI-BLM-NV-C010-2013-0037-DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2013-0037-DNA DNA at Gabbs Valley Geothermal Area for Geothermal/Well Field, {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant ORNI 47 LLC Geothermal Area Gabbs Valley Geothermal Area Project Location Nevada Project Phase Geothermal/Well Field Techniques Drilling Methods Comments GDP Wild Rose Unit Well 57-11 Time Frame (days) Application Time 1 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM


GRR/Section 3-NV-c - Encroachment Permit for NDOT ROW | Open Energy  

Open Energy Info (EERE)

GRR/Section 3-NV-c - Encroachment Permit for NDOT ROW GRR/Section 3-NV-c - Encroachment Permit for NDOT ROW < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-NV-c - Encroachment Permit for NDOT ROW 03NVCEncroachment (1).pdf Click to View Fullscreen Contact Agencies Nevada Department of Transportation Regulations & Policies NRS Chapter 405 Control and Preservation of Public Highways Triggers None specified Click "Edit With Form" above to add content 03NVCEncroachment (1).pdf 03NVCEncroachment (1).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative The Nevada Department of Transportation (NDOT) grants permits for permanent installations within State rights-of-way and in areas maintained by the


GRR/Section 14-NV-c - Underground Injection Control Permit | Open Energy  

Open Energy Info (EERE)

4-NV-c - Underground Injection Control Permit 4-NV-c - Underground Injection Control Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 14-NV-c - Underground Injection Control Permit 14NVCUndergroundInjectionControlPermit.pdf Click to View Fullscreen Contact Agencies Nevada Division of Environmental Protection Nevada Division of Minerals Nevada Division of Water Resources Bureau of Land Management Regulations & Policies Nevada Revised Statutes (NRS) Nevada Administrative Code (NAC) Triggers None specified Click "Edit With Form" above to add content 14NVCUndergroundInjectionControlPermit.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.


GRR/Section 14-NV-d - Section 401 Water Quality Certification | Open Energy  

Open Energy Info (EERE)

GRR/Section 14-NV-d - Section 401 Water Quality Certification GRR/Section 14-NV-d - Section 401 Water Quality Certification < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 14-NV-d - Section 401 Water Quality Certification 14NVDSection401WaterQualityCertification.pdf Click to View Fullscreen Contact Agencies Nevada Division of Environmental Protection Regulations & Policies Section 401 of the Clean Water Act (33 U.S.C. 1341) Triggers None specified Click "Edit With Form" above to add content 14NVDSection401WaterQualityCertification.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative Section 401 of the Clean Water Act (33 U.S.C. 1341) requires activities in


DOI-BLM-NV-C010-2012-0069-CX | Open Energy Information  

Open Energy Info (EERE)

DOI-BLM-NV-C010-2012-0069-CX DOI-BLM-NV-C010-2012-0069-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2012-0069-CX CX at Abraham Hot Springs Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Ormat Technologies Inc Geothermal Area Abraham Hot Springs Geothermal Area Project Location Utah Project Phase Geothermal/Exploration Techniques Thermal Gradient Holes Time Frame (days) Application Time 27 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates


GRR/Section 14-NV-a - Nonpoint Source Pollution | Open Energy Information  

Open Energy Info (EERE)

NV-a - Nonpoint Source Pollution NV-a - Nonpoint Source Pollution < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 14-NV-a - Nonpoint Source Pollution 14NVANonpointSourcePollution.pdf Click to View Fullscreen Contact Agencies Nevada Division of Environmental Protection Regulations & Policies Nevada Revised Statutes (NRS) Nevada Administrative Code (NAC) Triggers None specified Click "Edit With Form" above to add content 14NVANonpointSourcePollution.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative The Nevada Division of Environmental Protection (NDEP) developed its initial Nonpoint Source Pollution Management Program and Nonpoint Pollution


GRR/Section 6-NV-b - Construction Stormwater Permit | Open Energy  

Open Energy Info (EERE)

NV-b - Construction Stormwater Permit NV-b - Construction Stormwater Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 6-NV-b - Construction Stormwater Permit 06NVBConstructionStormWaterPermit (1).pdf Click to View Fullscreen Contact Agencies Nevada Division of Environmental Protection Regulations & Policies Nevada Revised Statue 445A Nevada Administrative Code 445A.228 to 445A.272 Triggers None specified Click "Edit With Form" above to add content 06NVBConstructionStormWaterPermit (1).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative A developer who disturbs more than one acre and less than five acres must

Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


GRR/Section 19-NV-a - Water Access and Water Rights Issues | Open Energy  

Open Energy Info (EERE)

GRR/Section 19-NV-a - Water Access and Water Rights Issues GRR/Section 19-NV-a - Water Access and Water Rights Issues < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 19-NV-a - Water Access and Water Rights Issues 19NVAWaterAccessAndWaterRightsIssues.pdf Click to View Fullscreen Contact Agencies Nevada Division of Water Resources Nevada Division of Environmental Protection Regulations & Policies Nevada Revised Statutes (NRS) NRS, Chapter 445A - water controls NRS, Chapter 533 - adjudication of vested water rights and appropriation of public waters NRS, Chapter 534 - outlines underground water and well NRS, Chapter 534A - geothermal resources Nevada Administrative Code (NAC) NAC, Chapter 445A - water controls Triggers None specified Click "Edit With Form" above to add content


GRR/Section 20-NV-a - Well Abandonment Process | Open Energy Information  

Open Energy Info (EERE)

20-NV-a - Well Abandonment Process 20-NV-a - Well Abandonment Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 20-NV-a - Well Abandonment Process 20NVAWellAbandonmentProcess (1).pdf Click to View Fullscreen Contact Agencies [[Nevada Division of Minerals]] Regulations & Policies NAC 534A.470 NAC 534A.540 Triggers None specified Click "Edit With Form" above to add content 20NVAWellAbandonmentProcess (1).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the procedure for plugging or abandoning a well in the state of Nevada. The Nevada Division of Minerals ("division")


GRR/Section 5-NV-b - Sundry Notice | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 5-NV-b - Sundry Notice GRR/Section 5-NV-b - Sundry Notice < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 5-NV-b - Sundry Notice 05NVBSundryNotice (2).pdf Click to View Fullscreen Contact Agencies Nevada Division of Minerals Regulations & Policies NAC 534A Geothermal Resources Triggers None specified Click "Edit With Form" above to add content 05NVBSundryNotice (2).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative The Nevada Division of Minerals can issue a sundry notice form for various modifications, minor changes, and routine maintenance of a well that is not covered under the initial permit or application. The developer should


DOI-BLM-NV-W010-2010-0043-CX-2 | Open Energy Information  

Open Energy Info (EERE)

DOI-BLM-NV-W010-2010-0043-CX-2 DOI-BLM-NV-W010-2010-0043-CX-2 Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-W010-2010-0043-CX-2 CX at Abraham Hot Springs Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Geothermal Technical Partners Geothermal Area Abraham Hot Springs Geothermal Area Project Location Utah Project Phase Geothermal/Exploration Techniques Geophysical Techniques, Slim Holes, Thermal Gradient Holes, Well Testing Techniques Time Frame (days) Application Time 148 Participating Agencies Lead Agency BLM Funding Agency DOE Managing District Office Winnemucca Managing Field Office Humboldt River Funding Agencies none provided


DOI-BLM-NV-B020-2009-0030-CX | Open Energy Information  

Open Energy Info (EERE)

NV-B020-2009-0030-CX NV-B020-2009-0030-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-B020-2009-0030-CX CX at Alum Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Sierra Geothermal Power Geothermal Area Alum Geothermal Area Project Location California Project Phase Geothermal/Exploration Techniques Time Frame (days) Application Time 35 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Battle Mountain Managing Field Office BLM Tonopah Field Office Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Application Date 12/11/2008 Decision Document Date 1/15/2009


DOI-BLM-NV-B020-2008-0071-DNA | Open Energy Information  

Open Energy Info (EERE)

DOI-BLM-NV-B020-2008-0071-DNA DOI-BLM-NV-B020-2008-0071-DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-B020-2008-0071-DNA DNA at Reese River Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Sierra Geothermal Partners Geothermal Area Reese River Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Time Frame (days) Application Time 26 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Battle Mountain Managing Field Office BLM Mount Lewis Field Office Funding Agencies none provided Surface Manager none provided Mineral Manager none provided Selected Dates


DOI-BLM-NV-W010-2011-0100-CX | Open Energy Information  

Open Energy Info (EERE)

DOI-BLM-NV-W010-2011-0100-CX DOI-BLM-NV-W010-2011-0100-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-W010-2011-0100-CX CX at Abraham Hot Springs Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Ormat Nevada Inc. Geothermal Area Abraham Hot Springs Geothermal Area Project Location Utah Project Phase Geothermal/Exploration Techniques Time Frame (days) Application Time 149 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office BLM Winnemucca Field Office Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Application Date 1/31/2011


DOI-BLM-NV-C010-2012-0016-DNA | Open Energy Information  

Open Energy Info (EERE)

DOI-BLM-NV-C010-2012-0016-DNA DOI-BLM-NV-C010-2012-0016-DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2012-0016-DNA DNA at Salt Wells Geothermal Area for Geothermal/Well Field {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Ormat Technologies Inc Geothermal Area Salt Wells Geothermal Area Project Location Nevada Project Phase Geothermal/Well Field Techniques Production Wells Comments Geothermal Drilling Permit 85-5 Production Well Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM


GRR/Section 7-NV-c - State PUC Process | Open Energy Information  

Open Energy Info (EERE)

7-NV-c - State PUC Process 7-NV-c - State PUC Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 7-NV-c - State PUC Process 07NVCStatePUCProcess.pdf Click to View Fullscreen Contact Agencies Public Utilities Commission of Nevada Regulations & Policies Nevada Revised Statutes (NRS) Nevada Administrative Code (NAC) Practice Before the PUCN: NAC 703.481 to 703.845 Triggers None specified Click "Edit With Form" above to add content 07NVCStatePUCProcess.pdf 07NVCStatePUCProcess.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative A Certificate of Public Convenience and Necessity (CPCN) is required for the development of both energy generation facilities and transmission


GRR/Section 6-NV-c - Drinking Water Permit | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 6-NV-c - Drinking Water Permit GRR/Section 6-NV-c - Drinking Water Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 6-NV-c - Drinking Water Permit 06NVCDrinkingWaterPermit.pdf Click to View Fullscreen Contact Agencies Nevada Division of Water Resources Nevada Division of Environmental Protection Public Utilities Commission of Nevada Regulations & Policies NRS 445A Water Controls NAC 445A Water Controls (Regulations) Triggers None specified Click "Edit With Form" above to add content 06NVCDrinkingWaterPermit.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative According to NRS 445A, the Nevada Division of Water Resources is charged


DOI-BLM-NV-C010-2012-0051-EA | Open Energy Information  

Open Energy Info (EERE)

-EA -EA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2012-0051-EA EA at Coyote Canyon Geothermal Area for Geothermal/Exploration Coyote Canyon South Geothermal Exploration Project General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Terra-Gen Power LLC Consultant EMPSi Geothermal Area Coyote Canyon Geothermal Area Project Location Churchill County, NV, Churchill County, NV Project Phase Geothermal/Exploration Techniques Exploratory Well Comments This EA covers an extension of a previously approved exploration project, "Coyote Canyon Geothermal Exploration Project." Exploration results indicated the resource may be to the south of the already approved area. The BLM determined that this new EA would be needed to cover this new land area proposed for disturbance.


GRR workshop at GRC scheduled for 10/2 in Reno, NV | OpenEI Community  

Open Energy Info (EERE)

GRR workshop at GRC scheduled for 10/2 in Reno, NV GRR workshop at GRC scheduled for 10/2 in Reno, NV Home > Groups > Geothermal Regulatory Roadmap Kyoung's picture Submitted by Kyoung(155) Contributor 6 September, 2012 - 09:05 GRC + workshop + GRR + Reno + October The GRR workshop at GRC has been scheduled for Tuesday, October 2, 2012 in Reno, NV. During the workshop, we will be reviewing project progress to date, analysis of information gathered, and potential future plans. For more information, please see the workshop wiki page. Groups: Geothermal Regulatory Roadmap Login to post comments Kyoung's blog Latest blog posts Kyoung Geothermal NEPA Workshop at GRC Posted: 14 Oct 2013 - 20:19 by Kyoung Jweers New Robust References! Posted: 7 Aug 2013 - 18:23 by Jweers 1 comment(s) 1 of 15 ›› Groups Menu You must login in order to post into this group.


DOI-BLM-NV-C010-2010-0016-EA | Open Energy Information  

Open Energy Info (EERE)

DOI-BLM-NV-C010-2010-0016-EA DOI-BLM-NV-C010-2010-0016-EA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2010-0016-EA EA at Patua Geothermal Area for Geothermal/Well Field, Geothermal/Power Plant Patua Geothermal Project General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Vulcan Power Company Geothermal Area Patua Geothermal Area Project Location Fernley, Nevada Project Phase Geothermal/Well Field, Geothermal/Power Plant Techniques Airborne Electromagnetic Survey Time Frame (days) Application Time 417 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BOR, Nevada, Privately Held


DOI-BLM-NV-C010-2011-0517-DNA | Open Energy Information  

Open Energy Info (EERE)

DOI-BLM-NV-C010-2011-0517-DNA DOI-BLM-NV-C010-2011-0517-DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2011-0517-DNA DNA at Dead Horse Wells Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Ormat Technologies Inc Geothermal Area Dead Horse Wells Geothermal Area Project Location California Project Phase Geothermal/Exploration Techniques Drilling Techniques Time Frame (days) Application Time 26 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates


GRR/Section 9-NV-a - State Environmental Process | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 9-NV-a - State Environmental Process GRR/Section 9-NV-a - State Environmental Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 9-NV-a - State Environmental Process 09NVAStateEnvironmentalProcess.pdf Click to View Fullscreen Contact Agencies Nevada State Clearinghouse Nevada Public Utilities Commission Nevada Division of Environmental Protection Regulations & Policies Utility Environmental Protection Act NAC 445C - Environmental Requirements Triggers None specified Click "Edit With Form" above to add content 09NVAStateEnvironmentalProcess.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative


DOI-BLM-NV-W030-2010-0006-EA | Open Energy Information  

Open Energy Info (EERE)

DOI-BLM-NV-W030-2010-0006-EA DOI-BLM-NV-W030-2010-0006-EA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-W030-2010-0006-EA EA at San Emidio Desert Geothermal Area for Geothermal/Exploration San Emidio Geothermal Exploration Project General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant US Geothermal Inc Consultant JBR Environmental Consultants Inc. Geothermal Area San Emidio Desert Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Drilling Methods, Flow Test Time Frame (days) NEPA Process Time 725 Participating Agencies Lead Agency DOE Funding Agency DOE Managing District Office Winnemucca Managing Field Office BLM Black Rock Field Office Funding Agencies none provided


Safety analysis for tank 241-AZ-101 mixer pump process test  

Science Conference Proceedings (OSTI)

This document establishes the safety envelope for Project W-151,the process test of two mixer pumps in AWF waste tank 241-AZ-101.

Milliken, N.J., Westinghouse Hanford



A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A-Z Topics lists topics with relevance to a broad cross-section of our Web site's audiences. The items are representative of popular topics or publications, ...


ICME Modeling of a Super Vacuum Die Cast (SVDC) AZ91 ...  

Science Conference Proceedings (OSTI)

... of a super vacuum die cast (SVDC) AZ91 automotive shock tower component. .... PI-7: A Three-dimensional Lattice Boltzmann Model for Columnar Dendrite...


241-AZ Tank Farm Construction Extent of Condition Review for Tank Integrity  

SciTech Connect

This report provides the results of an extent of condition construction history review for tanks 241-AZ-101 and 241-AZ-102. The construction history of the 241-AZ tank farm has been reviewed to identify issues similar to those experienced during tank AY-102 construction. Those issues and others impacting integrity are discussed based on information found in available construction records, using tank AY-102 as the comparison benchmark. In the 241-AZ tank farm, the second DST farm constructed, both refractory quality and tank and liner fabrication were improved.

Barnes, Travis J.; Boomer, Kayle D.; Gunter, Jason R.; Venetz, Theodore J.


Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOI-BLM-NV-C010-2012-0058-DNA | Open Energy Information  

Open Energy Info (EERE)

form form View source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit with form History Facebook icon Twitter icon » DOI-BLM-NV-C010-2012-0058-DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2012-0058-DNA DNA at Dixie Meadows Geothermal Area for Geothermal/Well Field {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Ormat Technologies Inc Geothermal Area Dixie Meadows Geothermal Area Project Location Nevada Project Phase Geothermal/Well Field Techniques Observation Wells Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided


DOI-BLM-NV-W030-2012-0011-DNA | Open Energy Information  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » DOI-BLM-NV-W030-2012-0011-DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-W030-2012-0011-DNA DNA at San Emidio Desert Geothermal Area for Geothermal/Well Field 2012 San Emidio Geothermal 2 Observation Wells General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant US Geothermal Inc Geothermal Area San Emidio Desert Geothermal Area Project Location Nevada Project Phase Geothermal/Well Field Techniques Observation Wells Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office BLM Black Rock Field Office Funding Agencies none provided


DOI-BLM-NV-C010-2009-0018-EA | Open Energy Information  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » DOI-BLM-NV-C010-2009-0018-EA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2009-0018-EA EA at Soda Lake Geothermal Area for Geothermal/Well Field Environmental Assessment: Magma Energy Soda Lake Well 41B-33 General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Magma Energy Geothermal Area Soda Lake Geothermal Area Project Location Nevada Project Phase Geothermal/Well Field Techniques Production Wells Time Frame (days) Application Time 112 NEPA Process Time 3 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater


DOI-BLM-NV-W010-2011-0004-CX | Open Energy Information  

Open Energy Info (EERE)

W010-2011-0004-CX W010-2011-0004-CX (Redirected from DOI-BL-NV-W010-2011-0004-CX) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-W010-2011-0004-CX CX at Dixie Valley Geothermal Area for Geothermal/Exploration, AltaRock Seismic Survey General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant AltaRock Energy Inc Geothermal Area Dixie Valley Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Passive Seismic Techniques Time Frame (days) Application Time 160 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office Humboldt River Funding Agencies none provided Surface Manager BLM


DOI-BLM-NV-C010-2009-0030-CX | Open Energy Information  

Open Energy Info (EERE)

09-0030-CX 09-0030-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2009-0030-CX CX at Carson Lake Corral Geothermal Area for Geothermal/Exploration, {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Vulcan Power Company Geothermal Area Carson Lake Corral Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Thermal Gradient Holes Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Relevant Numbers Lead Agency Doc Number DOI-BLM-NV-W010-2009-0030-CX



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ASSESSMENT ASSESSMENT DOI-BLM-NV-W010-2012-0057-EA DOE/EA-1944 Brady Hot Springs Well 15-12 Hydro-Stimulation January 2013 Prepared by: U.S. Department of the Interior Bureau of Land Management Winnemucca District Office 5100 E. Winnemucca Blvd. Winnemucca, Nevada 89445-2921 Cooperating Agency: U.S. Department of Energy Golden Field Office 1617 Cole Blvd. Golden, Colorado 80401 Winnemucca District Office / Nevada BLM Humboldt River Field Office/Nevada DOI-BLM-NV-W010-2012-0057-EA DOE/EA-1944 It is the mission of the Bureau of Land Management to sustain the health, diversity, and productivity of the public lands for the use and enjoyment of present and future generations. TABLE OF CONTENTS 1.0 INTRODUCTION ...................................................................................................1


DOI-BLM-NV-B020-2011-0048-CX | Open Energy Information  

Open Energy Info (EERE)

form form View source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit with form History Facebook icon Twitter icon » DOI-BLM-NV-B020-2011-0048-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-B020-2011-0048-CX CX at Silver Peak Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant CHB Metal Foote Corporation Geothermal Area Silver Peak Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Time Frame (days) Application Time 36 Participating Agencies Lead Agency BLM Funding Agency none provided


GRR/Section 3-NV-a - State Land Leasing Process and Land Access | Open  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » GRR/Section 3-NV-a - State Land Leasing Process and Land Access < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-NV-a - State Land Leasing Process and Land Access 03NVAStateLandLeasingProcess.pdf Click to View Fullscreen Contact Agencies Nevada Division of State Lands Regulations & Policies Nevada Revised Statutes (NRS) Nevada Administrative Code (NAC) NRS 322.010-322.040 Leases for Extraction of Oil, Coal, Gas or Geothermal Resources Triggers None specified Click "Edit With Form" above to add content 03NVAStateLandLeasingProcess.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.


Mercury Flux Measurements: An Intercomparison and Assessment: Nevada Mercury Emissions Project (NvMEP)  

Science Conference Proceedings (OSTI)

An understanding of the contribution of natural nonpoint mercury sources to regional and global atmospheric mercury pools is critical for developing emission inventories, formulating environmental regulations, and assessing human and ecological health risks. This report discusses the results of the Nevada Mercury Emissions Project (NvMEP) and takes a close look at the emerging technologies used to obtain mercury flux field data. In specific, it provides an intercomparison of mercury flux measurements obt...



COUNTRY INSTITUTION DATE WEB ADDRESS AZERBAIJAN Azerbaijan Medical University 15.03.2011 http://amu.edu.az/  

E-Print Network (OSTI)

COUNTRY INSTITUTION DATE WEB ADDRESS AZERBAIJAN Azerbaijan Medical University 15.03.2011 http://amu.edu.az/ AZERBAIJAN Baku State University 23.09.2011 http://bsu.edu.az/en/ AZERBAIJAN University of Architecture

Di Pillo, Gianni


Identifying Challenging Operating Hours for Solar Intergration in the NV Energy System  

Science Conference Proceedings (OSTI)

Abstract-- In this paper, the ability of the Nevada (NV) Energy generation fleet to meet its system balancing requirements under different solar energy penetration scenarios is studied. System balancing requirements include capacity, ramp rate, and ramp duration requirements for load following and regulation. If, during some operating hours, system capability is insufficient to meet these requirements, there is certain probability that the balancing authoritys control and reliability performance can be compromised. These operating hours are considered as challenging hours. Five different solar energy integration scenarios have been studied. Simulations have shown that the NV Energy system will be potentially able to accommodate up to 942 MW of solar photovoltaic (PV) generation. However, the existing generation scheduling procedure should be adjusted to make it happen. Fast-responsive peaker units need to be used more frequently to meet the increasing ramping requirements. Thus, the NV Energy system operational cost can increase. Index TermsSolar Generation, Renewables Integration, Balancing Process, Load Following, Regulation.

Etingov, Pavel V.; Lu, Shuai; Guo, Xinxin; Ma, Jian; Makarov, Yuri V.; Chadliev, Vladimir; Salgo, Richard



Category:Utility Rate Impacts on PV Economics By Location | Open Energy  

Open Energy Info (EERE)

Utility Rate Impacts on PV Economics By Location Utility Rate Impacts on PV Economics By Location Jump to: navigation, search Impact of Utility Rates on PV Economics Montgomery, AL Little Rock, AR Flagstaff, AZ Phoenix, AZ Tucson, AZ Arcata, CA LA, CA San Francisco, CA Boulder, CO Eagle County, CO Pueblo, CO Bridgeport, CT Wilmington, DE Miami, FL Tampa, FL Atlanta, GA Savannah, GA Des Moines, IA Mason, IA Boise, ID Chicago, IL Springfield, IL Indianapolis, IN Goodland, KS Wichita, KS Lexington, KY New Orleans, LA Shreveport, LA Boston, MA Baltimore, MD Caribou, ME Portland, ME Detroit, MI Houghton-Lake, MI Traverse City, MI International Falls, MN Minneapolis, MN Kansas City, MO Jackson, MS Billings, MT Greensboro, NC Wilmington, NC Bismarck, ND Minot, ND Omaha, NE Concord, NH Atlantic City, NJ Albuquerque, NM Las Vegas, NV Reno, NV New York, NY



Gasoline and Diesel Fuel Update (EIA)




Gasoline and Diesel Fuel Update (EIA)




Annual Energy Outlook 2012 (EIA)



DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


DOE Challenge Home Case Study, Mandalay Homes, Phoenix, AZ, Affordable  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mandalay Mandalay Homes Phoenix, AZ BUILDING TECHNOLOGIES OFFICE DOE Challenge Home builders are in the top 1% of builders in the country meeting the extraordinary levels of excellence and quality specifi ed by the U.S. Department of Energy. Every DOE Challenge Home starts with ENERGY STAR for Homes Version 3 for an energy-effi cient home built on a solid foundation of building science research. Then, even more advanced technologies are designed in for a home that goes above and beyond current code to give you the superior quality construction, HVAC, appliances, indoor air quality, safety, durability, comfort, and solar-ready components along with ultra-low or no utility bills. This provides homeowners with a quality home that will last for generations to come.


Influence of Aluminum Content on Grain Refinement and Strength of AZ31 Magnesium GTA Weld Metal  

SciTech Connect

The goal is to characterize the effect of Al content on AZ31 weld metal, the grain size and strength, and examine role of Al on grain refinement. The approach is to systematically vary the aluminum content of AZ31 weld metal, Measure average grain size in weld metal, and Measure cross-weld tensile properties and hardness. Conclusions are that: (1) increased Al content in AZ31 weld metal results in grain refinement Reason: higher undercooling during solidification; (2) weld metal grain refinement resulted in increased strength & hardness Reason: grain boundary strengthening; and (3) weld metal strength can be raised to wrought base metal levels.

Babu, N. Kishore [Singapore Institute of Manufacturing Technology; Cross, Carl E. [Los Alamos National Laboratory



Microsoft Word - DRAFT DSW NV PA 12_12_13 lmm  

NLE Websites -- All DOE Office Websites (Extended Search)

12/12/13 PROGRAMMATIC AGREEMENT AMONG THE U.S. DEPARTMENT OF ENERGY-WESTERN AREA POWER ADMINISTRATION, ADVISORY COUNCIL ON HISTORIC PRESERVATION, NEVADA STATE HISTORIC PRESERVATION OFFICER, NEVADA STATE LANDS DEPARTMENT, BUREAU OF LAND MANAGEMENT, BUREAU OF RECLAMATION, AND NATIONAL PARK SERVICE REGARDING MAINTENANCE AND MINOR CONSTRUCTION ACTIVITIES AT EXISTING WESTERN TRANSMISSION LINES, FACILITIES AND PROPERTIES IN NEVADA WHEREAS, the United States Department of Energy, Western Area Power Administration (Western) operates and maintains, through its Desert Southwest Regional Office (DSW) and Sierra Nevada Regional Office (SNR), an extensive electrical power delivery system throughout the state of Nevada (NV), which includes transmission lines, substations, communication sites and ancillary

Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOI-BLM-NV-C010-2012-0068-DNA | Open Energy Information  

Open Energy Info (EERE)

DNA DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2012-0068-DNA DNA at Tungsten Mountain Geothermal Area for Geothermal/Well Field {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Ormat Technologies Inc Geothermal Area Tungsten Mountain Geothermal Area Project Location Nevada Project Phase Geothermal/Well Field Techniques Observation Wells Comments Geothermal Drilling Permit Well # 14-23 Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates


DOI-BLM-NV-C010-2013-0020-DNA | Open Energy Information  

Open Energy Info (EERE)

DNA DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2013-0020-DNA DNA at Patua Geothermal Area for Geothermal/Well Field Gradient Resources Geothermal Drilling Permit General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Gradient Resources Geothermal Drilling Permit Application Well 14-28 Geothermal Area Patua Geothermal Area Project Location Fernley, Nevada Project Phase Geothermal/Well Field Techniques Production Wells Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BOR Mineral Manager BLM Selected Dates


DOI-BLM-NV-C010-2010-0006-EA | Open Energy Information  

Open Energy Info (EERE)

-EA -EA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2010-0006-EA EA at Gabbs Valley Geothermal Area for Geothermal/Exploration Gabbs Valley and Dead Horse Wells Geothermal Exploration Projects General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Ormat Technologies Inc Consultant Environmental Management Associates Geothermal Area Gabbs Valley Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Downhole Techniques, Drilling Techniques, Exploration Drilling, Well Testing Techniques Time Frame (days) Application Time 363 NEPA Process Time 363 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City


DOI-BLM-NV-B020-2011-0026-EA | Open Energy Information  

Open Energy Info (EERE)

26-EA 26-EA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-B020-2011-0026-EA EA at Silver Peak Geothermal Area for Geothermal/Exploration Clayton Valley Geothermal Exploration Project General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Ram Power Consultant EPG, Inc., Environmental Management Associates Geothermal Area Silver Peak Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Drilling Techniques, Exploration Drilling, Well Testing Techniques Comments Project abandoned; Unitization #: NVN-89376X Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Battle Mountain


DOI-BLM-NV-B020-2008-????-CX | Open Energy Information  

Open Energy Info (EERE)

CX CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-B020-2008-????-CX CX at Silver Peak Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Sierra Geothermal Power Geothermal Area Silver Peak Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Time Frame (days) Application Time 27 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Battle Mountain Managing Field Office BLM Tonopah Field Office Funding Agencies none provided Surface Manager none provided Mineral Manager none provided Selected Dates Application Date 9/29/2008


DOI-BLM-NV-B020-2008-????-?? | Open Energy Information  

Open Energy Info (EERE)

?? ?? Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-B020-2008-????-?? {{{EnvironmentalAnalysisType}}} at Reese River Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type Applicant Sierra Geothermal Power Geothermal Area Reese River Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Seismic Techniques, Thermal Gradient Holes Time Frame (days) Application Time 0 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Battle Mountain Managing Field Office BLM Mount Lewis Field Office Funding Agencies none provided Surface Manager none provided


NV Energy (Southern Nevada) - SureBet Business Energy Efficiency Rebate  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Southern Nevada) - SureBet Business Energy Efficiency Southern Nevada) - SureBet Business Energy Efficiency Rebate Program NV Energy (Southern Nevada) - SureBet Business Energy Efficiency Rebate Program < Back Eligibility Agricultural Commercial Construction Fed. Government Industrial Installer/Contractor Institutional Local Government Nonprofit Schools State Government Savings Category Heating & Cooling Commercial Heating & Cooling Cooling Home Weatherization Construction Commercial Weatherization Design & Remodeling Other Heating Appliances & Electronics Commercial Lighting Lighting Manufacturing Windows, Doors, & Skylights Program Info State Nevada Program Type Utility Rebate Program Rebate Amount '''Existing Facilities''' T-8 Lamps: $2 - $7/lamp T-8/T-5 High Bay Replacement for HID: $0.30/watt reduced Delamping of T-12: $4 - $9


DOI-BLM-NV-C010-2010-0010-EA | Open Energy Information  

Open Energy Info (EERE)

EA EA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2010-0010-EA EA at Dixie Valley Geothermal Area for Geothermal/Exploration Coyote Canyon and Dixie Meadows Geothermal Exploration General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Terra-Gen Power LLC Consultant CH2M Hill Ltd Geothermal Area Dixie Valley Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Downhole Techniques, Drilling Techniques, Exploration Drilling, Well Testing Techniques Time Frame (days) Application Time 265 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater


DOI-BLM-NV-C010-2011-0516-EA | Open Energy Information  

Open Energy Info (EERE)

516-EA 516-EA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2011-0516-EA EA at Dixie Meadows Geothermal Area for Geothermal/Exploration, Geothermal/Well Field Dixie Meadows Geothermal Exploration Project General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Ormat Technologies Inc Consultant JBR Environmental Consultants, Inc. Geothermal Area Dixie Meadows Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration, Geothermal/Well Field Techniques Drilling Techniques, Thermal Gradient Holes Time Frame (days) Application Time 308 NEPA Process Time 510 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City


DOI-BLM-NV-C010-2012-0046-DNA | Open Energy Information  

Open Energy Info (EERE)

-DNA -DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2012-0046-DNA DNA at Tungsten Mountain Geothermal Area for Geothermal/Well Field {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Ormat Technologies Inc Geothermal Area Tungsten Mountain Geothermal Area Project Location Nevada Project Phase Geothermal/Well Field Techniques Observation Wells Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Decision Document Date 4/16/2012 Relevant Numbers


DOI-BLM-NV-C010-2011-0016-EA | Open Energy Information  

Open Energy Info (EERE)

EA EA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2011-0016-EA EA at Patua Geothermal Area for Well Field Patua Geothermal Project Phase II General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Gradient Resources Consultant Panorama Environmental, Inc. Geothermal Area Patua Geothermal Area Project Location Fernley, Nevada Project Phase Well Field Techniques Exploratory Well, Thermal Gradient Holes Time Frame (days) NEPA Process Time 327 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Nevada Managing Field Office Carson City Funding Agencies none provided Surface Manager BLM, BOR Mineral Manager BLM Selected Dates


DOI-BLM-NV-C010-2012-0029-EA | Open Energy Information  

Open Energy Info (EERE)

29-EA 29-EA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2012-0029-EA EA at Tungsten Mountain Geothermal Area for Geothermal/Well Field Tungsten Mountain Geothermal Exploration Project General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Ormat Technologies Inc Consultant Environmental Management Associates Geothermal Area Tungsten Mountain Geothermal Area Project Location Nevada Project Phase Geothermal/Well Field Techniques Downhole Techniques, Drilling Techniques, Exploration Drilling, Well Testing Techniques Time Frame (days) NEPA Process Time 407 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City


DOI-BLM-NV-B020-2010-0106-CX | Open Energy Information  

Open Energy Info (EERE)

-0106-CX -0106-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-B020-2010-0106-CX CX at Alum Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Sierra Geothermal Power Geothermal Area Alum Geothermal Area Project Location California Project Phase Geothermal/Exploration Techniques Hyperspectral Imaging, Magnetic Techniques, Magnetotellurics, Slim Holes, Z-Axis Tipper Electromagnetics Comments airborne thermal survey Time Frame (days) Application Time 182 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Battle Mountain Managing Field Office BLM Tonopah Field Office


Dynamic polarization of single nuclear spins by optical pumping of NV color centers in diamond at room temperature  

E-Print Network (OSTI)

We report a versatile method to efficiently polarize single nuclear spins in diamond, which is based on optical pumping of a single NV color center and mediated by a level-anti crossing in its excited state. A nuclear spin polarization higher than 98% is achieved at room temperature for the 15N nuclear spin associated to the NV center, corresponding to $\\mu$K effective nuclear spin temperature. We then show simultaneous deterministic initialization of two nuclear spins (13C and 15N) in close vicinity to a NV defect. Such robust control of nuclear spin states is a key ingredient for further scaling up of nuclear-spin based quantum registers in diamond.

V. Jacques; P. Neumann; J. Beck; M. Markham; D. Twitchen; J. Meijer; F. Kaiser; G. Balasubramanian; F. Jelezko; J. Wrachtrup




NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


DOE - Office of Legacy Management -- Monument Valley Mill Site - AZ 0-01  

Office of Legacy Management (LM)

Monument Valley Mill Site - AZ 0-01 Monument Valley Mill Site - AZ 0-01 FUSRAP Considered Sites Site: Monument Valley Mill Site (AZ.0-01) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: Also see Monument Valley, Arizona, Processing Site Documents Related to Monument Valley Mill Site Data Validation Package for the June 2009 Water Sampling at the Monument Valley, Arizona, Processing Site; LMS/MON/S0609; October 2009 Natural and Enhanced Attenuation of Soil and Ground Water at Monument Valley, Arizona, and Shiprock, New Mexico 2006 Status Report June 2008 Data Validation Package for 2007 Groundwater Sampling at the Monument Valley, AZ Processing Site


A Review on Severe Plastic Deformation of the Magnesium Alloy AZ31  

Science Conference Proceedings (OSTI)

... Ukraine, Poland, Korea, Iran, Israel and China. In this paper an effort is made to review the work done on AZ31 using SPD processes to improve its properties.


NV Energy Large-Scale Photovoltaic Integration Study: Intra-Hour Dispatch and AGC Simulation  

SciTech Connect

The uncertainty and variability with photovoltaic (PV) generation make it very challenging to balance power system generation and load, especially under high penetration cases. Higher reserve requirements and more cycling of conventional generators are generally anticipated for large-scale PV integration. However, whether the existing generation fleet is flexible enough to handle the variations and how well the system can maintain its control performance are difficult to predict. The goal of this project is to develop a software program that can perform intra-hour dispatch and automatic generation control (AGC) simulation, by which the balancing operations of a system can be simulated to answer the questions posed above. The simulator, named Electric System Intra-Hour Operation Simulator (ESIOS), uses the NV Energy southern system as a study case, and models the systems generator configurations, AGC functions, and operator actions to balance system generation and load. Actual dispatch of AGC generators and control performance under various PV penetration levels can be predicted by running ESIOS. With data about the load, generation, and generator characteristics, ESIOS can perform similar simulations and assess variable generation integration impacts for other systems as well. This report describes the design of the simulator and presents the study results showing the PV impacts on NV Energy real-time operations.

Lu, Shuai; Etingov, Pavel V.; Meng, Da; Guo, Xinxin; Jin, Chunlian; Samaan, Nader A.



NV energy electricity storage valuation : a study for the DOE Energy Storage Systems program.  

SciTech Connect

This study examines how grid-level electricity storage may benefit the operations of NV Energy, and assesses whether those benefits are likely to justify the cost of the storage system. To determine the impact of grid-level storage, an hourly production cost model of the Nevada Balancing Authority (%22BA%22) as projected for 2020 was created. Storage was found to add value primarily through the provision of regulating reserve. Certain storage resources were found likely to be cost-effective even without considering their capacity value, as long as their effectiveness in providing regulating reserve was taken into account. Giving fast resources credit for their ability to provide regulating reserve is reasonable, given the adoption of FERC Order 755 (%22Pay-for-performance%22). Using a traditional five-minute test to determine how much a resource can contribute to regulating reserve does not adequately value fast-ramping resources, as the regulating reserve these resources can provide is constrained by their installed capacity. While an approximation was made to consider the additional value provided by a fast-ramping resource, a more precise valuation requires an alternate regulating reserve methodology. Developing and modeling a new regulating reserve methodology for NV Energy was beyond the scope of this study, as was assessing the incremental value of distributed storage.

Ellison, James F.; Bhatnagar, Dhruv; Samaan, Nader [Pacific Northwest National Laboratory, Richland, WA; Jin, Chunlian [Pacific Northwest National Laboratory, Richland, WA



System Description for Tank 241-AZ-101 Waste Retrieval Data Acquisition System  

SciTech Connect

The proposed activity provides the description of the Data Acquisition System for Tank 241-AZ-101. This description is documented in HNF-5572, Tank 241-AZ-101 Waste Retrieval Data Acquisition System (DAS). This activity supports the planned mixer pump tests for Tank 241-AZ-101. Tank 241-AZ-101 has been selected for the first full-scale demonstration of a mixer pump system. The tank currently holds over 960,000 gallons of neutralized current acid waste, including approximately 12.7 inches of settling solids (sludge) at the bottom of the tank. As described in Addendum 4 of the FSAR (LMHC 2000a), two 300 HP mixer pumps with associated measurement and monitoring equipment have been installed in Tank 241-AZ-101. The purpose of the Tank 241-AZ-101 retrieval system Data Acquisition System (DAS) is to provide monitoring and data acquisition of key parameters in order to confirm the effectiveness of the mixer pumps utilized for suspending solids in the tank. The suspension of solids in Tank 241-AZ-101 is necessary for pretreatment of the neutralized current acid waste and eventual disposal as glass via the Hanford Waste Vitrification Plant. HNF-5572 provides a basic description of the Tank 241-AZ-101 retrieval system DAS, including the field instrumentation and application software. The DAS is provided to fulfill requirements for data collection and monitoring. This document is not an operations procedure or is it intended to describe the mixing operation. This USQ screening provides evaluation of HNF-5572 (Revision 1) including the changes as documented on ECN 654001. The changes include (1) add information on historical trending and data backup, (2) modify DAS I/O list in Appendix E to reflect actual conditions in the field, and (3) delete IP address in Appendix F per Lockheed Martin Services, Inc. request.



Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Final results of double-shell tank 241-AZ-101 ultrasonic inspection  

SciTech Connect

This document presents the results and documentation of the nondestructive ultrasonic examination of tank 241-AZ-101. A tank inspection supplier was retained to provide and use an ultrasonic examination system (equipment, procedures, and inspectors) to scan a limited area of double-shell tank 241-AZ-101 primary tank wall and welds. The inspection found one reportable indication of thinning and no reportable pitting, corrosion, or cracking.




DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


DOI-BLM-NV-C010-2012-0057-CX | Open Energy Information  

Open Energy Info (EERE)

CX CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2012-0057-CX CX at Dixie Meadows Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Ormat Technologies Inc Geothermal Area Dixie Meadows Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Thermal Gradient Holes Time Frame (days) Application Time 25 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Application Date 5/24/2012 Decision Document Date 6/18/2012


DOI-BLM-NV-C010-2011-0015-CX | Open Energy Information  

Open Energy Info (EERE)

5-CX 5-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2011-0015-CX CX at Patua Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Gradient Resources Geothermal Area Patua Geothermal Area Project Location Fernley, Nevada Project Phase Geothermal/Exploration Techniques Time Frame (days) Application Time 23 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BOR Mineral Manager none provided Selected Dates Application Date 1/18/2011 Decision Document Date 2/10/2011


DOI-BLM-NV-C010-2012-0019-DNA | Open Energy Information  

Open Energy Info (EERE)

-DNA -DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2012-0019-DNA DNA at Salt Wells Geothermal Area for Geothermal/Well Field {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Ormat Technologies Inc Geothermal Area Salt Wells Geothermal Area Project Location Nevada Project Phase Geothermal/Well Field Techniques Observation Wells Comments GDP Well 18-5 Observation Well Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Application Document Type GPD


DOI-BLM-NV-063-EA08-091 | Open Energy Information  

Open Energy Info (EERE)

-EA08-091 -EA08-091 Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-063-EA08-091 EA at Buffalo Valley Hot Springs Geothermal Area for Geothermal/Power Plant Jersey Valley and Buffalo Valley Geothermal Development Projects General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Ormat Technologies Inc Consultant Environmental Management Associates; Great Basin Ecology; Cogstone Resource Management; Kautz Environmental Consultants Geothermal Area Buffalo Valley Hot Springs Geothermal Area Project Location Nevada Project Phase Geothermal/Power Plant Techniques Production Wells Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Battle Mountain


DOI-BLM-NV-CO1000-2010-0009-CX | Open Energy Information  

Open Energy Info (EERE)

10-0009-CX 10-0009-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-CO1000-2010-0009-CX CX at Dixie Meadows Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Terra-Gen Power LLC Geothermal Area Dixie Meadows Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Electromagnetic Techniques Time Frame (days) Application Time 209 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Application Date 6/30/2009


DOI-BLM-NV-C010-2013-0023-DNA | Open Energy Information  

Open Energy Info (EERE)

3-0023-DNA 3-0023-DNA DNA at Dead Horse Wells Geothermal Area for Geothermal/Well Field {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Ormat Technologies Inc Geothermal Area Dead Horse Wells Geothermal Area Project Location California Project Phase Geothermal/Well Field Techniques Observation Wells Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Application Document Type GPD Decision Document Date 1/31/2013 Relevant Numbers Lead Agency Doc Number DOI-BLM-NV-C010-2013-0023-DNA Serial Number NVN-083929 Lease Numbers


DOI-BLM-NV-C010-2012--044-DNA | Open Energy Information  

Open Energy Info (EERE)

-044-DNA -044-DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2012--044-DNA DNA at {{{GeothermalArea}}} for Geothermal/Power Plant, Ormatt Nevada Sundry Notice -Geotechnical Work General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Ormatt Nevada, Inc Geothermal Area {{{GeothermalArea}}}"{{{GeothermalArea}}}" cannot be used as a page name in this wiki. Project Location Project Phase Geothermal/Power Plant Techniques Drilling Methods Comments Sundry Notice to drill 3 boreholes to evaluate engineering characteristics of potential power plant location Time Frame (days) Participating Agencies Lead Agency Nevada Funding Agency none provided Managing District Office Carson City


DOI-BLM-NV-W010-2010-0041-CX | Open Energy Information  

Open Energy Info (EERE)

W010-2010-0041-CX W010-2010-0041-CX CX at Brady Hot Springs Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Stephen D. Muir Geothermal Area Brady Hot Springs Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Seismic Techniques Time Frame (days) Application Time 115 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office Humboldt River Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Application Date 4/2/2010 Application Document Type POO Decision Document Date 7/26/2010 Relevant Numbers Lead Agency Doc Number DOI-BLM-NV-W010-2010-0041-CX


DOI-BLM-NV-C010-2012-0073-DNA | Open Energy Information  

Open Energy Info (EERE)

2-0073-DNA 2-0073-DNA DNA at Tungsten Mountain Geothermal Area for Geothermal/Well Field Ormat Nevada Inc. Geothermal Drilling Permit 24-23 General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Ormat Technologies Inc Geothermal Area Tungsten Mountain Geothermal Area Project Location Nevada Project Phase Geothermal/Well Field Techniques Observation Wells Comments Geothermal Drilling Permit 24-23 Observation Well Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Decision Document Date 9/26/2012 Relevant Numbers Lead Agency Doc Number DOI-BLM-NV-C010-2012-0073-DNA


DOI-BLM-NV-C010-2012-0005-DNA | Open Energy Information  

Open Energy Info (EERE)

05-DNA 05-DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2012-0005-DNA DNA at McCoy Geothermal Area for Geothermal/Well Field {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Magma Energy Geothermal Area McCoy Geothermal Area Project Location Nevada Project Phase Geothermal/Well Field Techniques Observation Wells Comments GDP Well # 62-8 and 17-20 Time Frame (days) Application Time 1 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Application Date 2011/10/18


DOI-BLM-NV-B020-2012-0214-EA | Open Energy Information  

Open Energy Info (EERE)

2-0214-EA 2-0214-EA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-B020-2012-0214-EA EA at Silver Peak Geothermal Area for Geothermal/Exploration Silver Peak Area Geothermal Exploration Project General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Rockwood Lithium Inc Consultant Environmental Management Associates, Inc. Geothermal Area Silver Peak Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Drilling Techniques, Well Testing Techniques Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Battle Mountain Managing Field Office BLM Tonopah Field Office Funding Agencies none provided


GRR/Section 4-NV-b - Temporary Use of Ground Water for Exploration | Open  

Open Energy Info (EERE)

b - Temporary Use of Ground Water for Exploration b - Temporary Use of Ground Water for Exploration < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 4-NV-b - Temporary Use of Ground Water for Exploration 04NVBTemporaryUseOfGroundWaterForExploration.pdf Click to View Fullscreen Contact Agencies Nevada Division of Water Resources Regulations & Policies NAC 534.444 Waiver to use water to explore for oil, gas or geothermal resources Triggers None specified Click "Edit With Form" above to add content 04NVBTemporaryUseOfGroundWaterForExploration.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative The Nevada Division of Water Resources (NDWR) may grant a waiver of the


DOI-BLM-NV-W010-2010-0004-EA | Open Energy Information  

Open Energy Info (EERE)

-EA -EA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-W010-2010-0004-EA EA at New York Canyon Geothermal Area for Geothermal/Exploration New York Canyon Geothermal Exploration Project General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Terra-Gen Power LLC Consultant CH2M Hill Ltd Geothermal Area New York Canyon Geothermal Area Project Location Lovelock, Nevada Project Phase Geothermal/Exploration Techniques Exploration Drilling, Well Testing Techniques Time Frame (days) Application Time 326 NEPA Process Time 354 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office Humboldt River Funding Agencies none provided


DOI-BLM-NV-C010-2012-0028-DNA | Open Energy Information  

Open Energy Info (EERE)

C010-2012-0028-DNA C010-2012-0028-DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2012-0028-DNA DNA at Dead Horse Wells Geothermal Area for Geothermal/Well Field {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Ormat Technologies Inc Geothermal Area Dead Horse Wells Geothermal Area Project Location California Project Phase Geothermal/Well Field Techniques Flow Test, Injectivity Test Comments Sundry Notice: Flow Test Well 85-11 and simultaneously Inject Test Well 68-1 and 24A-6 Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided


DOI-BLM-NV-C010-2012-0020-DNA | Open Energy Information  

Open Energy Info (EERE)

-DNA -DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2012-0020-DNA DNA at Salt Wells Geothermal Area for Geothermal/Well Field {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Ormat Technologies Inc Geothermal Area Salt Wells Geothermal Area Project Location Nevada Project Phase Geothermal/Well Field Techniques Observation Wells Comments Geothermal Drilling Permit 11A-32 Observation Well Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Decision Document Date 1/27/2012


NV Energy (Northern Nevada) - SureBet Business Energy Efficiency Rebate  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Northern Nevada) - SureBet Business Energy Efficiency Northern Nevada) - SureBet Business Energy Efficiency Rebate Program NV Energy (Northern Nevada) - SureBet Business Energy Efficiency Rebate Program < Back Eligibility Agricultural Commercial Construction Fed. Government Industrial Installer/Contractor Institutional Local Government Nonprofit Schools State Government Savings Category Heating & Cooling Commercial Heating & Cooling Cooling Home Weatherization Construction Commercial Weatherization Design & Remodeling Other Heating Appliances & Electronics Commercial Lighting Lighting Manufacturing Windows, Doors, & Skylights Program Info State Nevada Program Type Utility Rebate Program Rebate Amount '''Existing Facilities''' T-8 Lamps: $2 - $7/lamp New T8/T5 Fixture: $0.30/watt reduced T-8/T-5 High Bay Replacement for HID: $0.30/watt reduced


DOI-BLM-NV-C010-2011-0514-EA | Open Energy Information  

Open Energy Info (EERE)

-EA -EA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2011-0514-EA EA at McCoy Geothermal Area for Geothermal/Well Field McCoy II Geothermal Exploration Project General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Magma Energy Geothermal Area McCoy Geothermal Area Project Location Nevada Project Phase Geothermal/Well Field Techniques Time Frame (days) NEPA Process Time 560 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Application Document Type ROW Scoping Initiated Date 2010/04/06

Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOI-BLM-NV-W010-2011-0001-EA | Open Energy Information  

Open Energy Info (EERE)

10-2011-0001-EA 10-2011-0001-EA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-W010-2011-0001-EA EA at Grass Valley Geothermal Area for Geothermal/Exploration, Geothermal/Well Field Leach Hot Springs Geothermal Exploration Project General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Ormat Technologies Inc Consultant JBR Environmental Consultants, Inc. Geothermal Area Grass Valley Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration, Geothermal/Well Field Techniques Development Drilling, Exploration Drilling, Well Testing Techniques Time Frame (days) Application Time 345 NEPA Process Time 274 Participating Agencies Lead Agency BLM Funding Agency none provided


DOI-BLM-NV-C010-2011-0527-CX | Open Energy Information  

Open Energy Info (EERE)

27-CX 27-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2011-0527-CX CX at Dixie Valley Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant AltaRock Energy Inc Geothermal Area Dixie Valley Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Passive Seismic Techniques Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Decision Document Date 6/6/2011 Relevant Numbers Lead Agency


DOI-BLM-NV-W030-2012-0020-CX | Open Energy Information  

Open Energy Info (EERE)

20-CX 20-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-W030-2012-0020-CX CX at Pinto Hot Springs Geothermal Area for Geothermal/Exploration, Pinto Hot Springs Geothermal Gradient Well Drilling General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Nevada Bureau of Mines and Geology Geothermal Area Pinto Hot Springs Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Thermal Gradient Holes Time Frame (days) Application Time 128 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office BLM Black Rock Field Office Funding Agencies none provided Surface Manager none provided


DOI-BLM-NV-B020-2011-0017-CX | Open Energy Information  

Open Energy Info (EERE)

1-0017-CX 1-0017-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-B020-2011-0017-CX CX at Silver Peak Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant CHB Metal Foote Corporation Geothermal Area Silver Peak Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Time Frame (days) Application Time 49 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Battle Mountain Managing Field Office BLM Tonopah Field Office Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Application Date 10/22/2010 Decision Document Date 12/10/2010


DOI-BLM-NV-W010-2012-0005-EA | Open Energy Information  

Open Energy Info (EERE)

2-0005-EA 2-0005-EA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-W010-2012-0005-EA EA at New York Canyon Geothermal Area for Geothermal/Power Plant, Geothermal/Transmission, Geothermal/Well Field New York Canyon Geothermal Utilization and Interconnect Project General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Terra-Gen Power LLC Consultant EMPSi Geothermal Area New York Canyon Geothermal Area Project Location Lovelock, Nevada Project Phase Geothermal/Power Plant, Geothermal/Transmission, Geothermal/Well Field Techniques Development Drilling, Downhole Techniques Time Frame (days) Application Time 735 NEPA Process Time 509 Participating Agencies Lead Agency BLM


DOI-BLM-NV-C010-2010-0008-EA | Open Energy Information  

Open Energy Info (EERE)

C010-2010-0008-EA C010-2010-0008-EA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2010-0008-EA EA at Soda Lake Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Magma Energy Consultant JBR Environmental Consultants, Inc. Geothermal Area Soda Lake Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Downhole Techniques, Drilling Techniques, Exploration Drilling, Well Testing Techniques Time Frame (days) Application Time 292 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided


DOI-BLM-NV-C010-2010-0008-CX | Open Energy Information  

Open Energy Info (EERE)

0-0008-CX 0-0008-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2010-0008-CX CX at Dixie Meadows Geothermal Area for Geothermal/Exploration Dixie Meadows Seismic Survey General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Terra-Gen Power LLC Geothermal Area Dixie Meadows Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Electromagnetic Techniques Time Frame (days) Application Time 209 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Application Date 6/30/2009


DOI-BLM-NV-C010-2013-0007-DNA | Open Energy Information  

Open Energy Info (EERE)

07-DNA 07-DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2013-0007-DNA DNA at Dead Horse Wells Geothermal Area for Geothermal/Well Field {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Ormat Technologies Inc Geothermal Area Dead Horse Wells Geothermal Area Project Location California Project Phase Geothermal/Well Field Techniques Observation Wells Comments Geothermal Drilling Permit Well 38-12 Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates


DOI-BLM-NV-W010-2012-0057-EA | Open Energy Information  

Open Energy Info (EERE)

57-EA 57-EA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-W010-2012-0057-EA EA at Brady Hot Springs Geothermal Area for Geothermal/Well Field Brady Hot Springs Well 15-12 Hydro-Stimulation General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Brady Power Partners Geothermal Area Brady Hot Springs Geothermal Area Project Location Nevada Project Phase Geothermal/Well Field Techniques Downhole Techniques Time Frame (days) Application Time 378 Participating Agencies Lead Agency BLM Funding Agency DOE Managing District Office Winnemucca Managing Field Office Humboldt River Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Application Date 1/5/2012


DOE/NV-441 Nevada Environmental Restoration Project Rulison Drilling Effluent  

Office of Legacy Management (LM)

Ru\-- 7-2-4@ Ru\-- 7-2-4@ DOE/NV-441 Nevada Environmental Restoration Project Rulison Drilling Effluent Pond Site Long-Term Groundwater Monitoring Plan July 1996 Environmental Restoration U.S. Department of Energy This report has been reproduced from the best available copy. Available in paper copy and microfiche. Number of pages in this report: 5 1 DOE and DOE contractors cari obtain copies of this report from: Office of Scientific and Technical Information, P.O. Box 62, Oak Ridge, TN 3783 1. (61 5) 576-8401. This report is publicly available from the Department of Commerce, National Technical Information Service, 5285 Port Royal Road, Springfield, VA 22 16 1. (703) 487-4650. RULISON DRILLING EFFLUENT POND SITE LONG-TERM GROUNDWATER MONITORING PLAN DOE Nevada Operations Office


DOI-BLM-NV-C010-2012-0048-DNA | Open Energy Information  

Open Energy Info (EERE)

48-DNA 48-DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2012-0048-DNA DNA at Salt Wells Geothermal Area for Geothermal/Well Field, Enell Salt Wells LLC Geothermal Drilling Permits 44-35, 61-2, 68-35, and 16-36 General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Enel Salt Wells LLC Geothermal Area Salt Wells Geothermal Area Project Location Nevada Project Phase Geothermal/Well Field Techniques Observation Wells Comments Geothermal Drilling Permits 44-35, 61-2, 68-35, and 16-36 Observation Wells Time Frame (days) Participating Agencies Lead Agency Nevada Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater


DOI-BLM-NV-W010-2010-0040-CX | Open Energy Information  

Open Energy Info (EERE)

W010-2010-0040-CX W010-2010-0040-CX CX at {{{GeothermalArea}}} for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Presco Energy LLC Geothermal Area {{{GeothermalArea}}}"{{{GeothermalArea}}}" cannot be used as a page name in this wiki. Project Location Project Phase Geothermal/Exploration Techniques Reflection Survey Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office Humboldt River Funding Agencies none provided Surface Manager BLM, BOR Mineral Manager BLM, BOR Selected Dates Application Date 1/25/2010 Relevant Numbers Lead Agency Doc Number DOI-BLM-NV-W030-2010-???-CX Serial Number NVN-088196


DOI-BLM-NV-0063-EA06-100 | Open Energy Information  

Open Energy Info (EERE)

0063-EA06-100 0063-EA06-100 Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-0063-EA06-100 EA at {{{GeothermalArea}}} for Geothermal/Exploration Jersey Valley Geothermal Exploration Project General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Ormat Technologies Inc Geothermal Area {{{GeothermalArea}}}"{{{GeothermalArea}}}" cannot be used as a page name in this wiki. Project Location Project Phase Geothermal/Exploration Techniques Drilling Techniques, Well Testing Techniques Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office Humboldt River Funding Agencies none provided


DOI-BLM-NV-C010-2012-0050-EA | Open Energy Information  

Open Energy Info (EERE)

EA EA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2012-0050-EA EA at Dead Horse Wells Geothermal Area for Geothermal/Well Field, Geothermal/Power Plant Wild Rose Geothermal Project General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Ormat Technologies Inc Consultant EMPSi Geothermal Area Dead Horse Wells Geothermal Area Project Location California Project Phase Geothermal/Well Field, Geothermal/Power Plant Techniques Development Drilling, Drilling Techniques Time Frame (days) Application Time 245 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided


DOI-BLM-NV-CO10-2011-0501-EA | Open Energy Information  

Open Energy Info (EERE)

CO10-2011-0501-EA CO10-2011-0501-EA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-CO10-2011-0501-EA EA at Patua Geothermal Area for Geothermal/Well Field Gradient Resources, Inc. Patua Geothermal Project Phase II General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Gradient Resources Geothermal Area Patua Geothermal Area Project Location Fernley, Nevada Project Phase Geothermal/Well Field Techniques Production Wells, Thermal Gradient Holes Time Frame (days) NEPA Process Time 85 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM, BOR


DOI-BLM-NV-E030-2011-0017-CX | Open Energy Information  

Open Energy Info (EERE)

E030-2011-0017-CX E030-2011-0017-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-E030-2011-0017-CX CX at Abraham Hot Springs Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant USGS Geothermal Area Abraham Hot Springs Geothermal Area Project Location Utah Project Phase Geothermal/Exploration Techniques Time Frame (days) Application Time 134 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office BLM Elko District Office Managing Field Office none provided Funding Agencies none provided Surface Manager BLM Mineral Manager none provided Selected Dates Application Date 2/24/2011


DOI-BLM-NV-B020-2010-????-CX | Open Energy Information  

Open Energy Info (EERE)

10-????-CX 10-????-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-B020-2010-????-CX CX at Abraham Hot Springs Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Ormat Technologies Inc Geothermal Area Abraham Hot Springs Geothermal Area Project Location Utah Project Phase Geothermal/Exploration Techniques Thermal Gradient Holes Time Frame (days) Application Time 36 Participating Agencies Lead Agency BLM Funding Agency DOE Managing District Office Battle Mountain Managing Field Office BLM Mount Lewis Field Office Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Application Date 12/20/2010


GRR/Section 18-NV-a - Underground Storage Tank | Open Energy Information  

Open Energy Info (EERE)

a - Underground Storage Tank a - Underground Storage Tank < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 18-NV-a - Underground Storage Tank 18NVAUndergroundStorageTank.pdf Click to View Fullscreen Contact Agencies Nevada Division of Environmental Protection Regulations & Policies Nevada Revised Statutes (NRS) Nevada Administrative Code (NAC) Triggers None specified Click "Edit With Form" above to add content 18NVAUndergroundStorageTank.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative The Nevada Division of Environmental Protection (NDEP) administers the Underground Storage Tank (UST) Program for the State of Nevada.


DOI-BLM-NV-C010-2011-0004-CX | Open Energy Information  

Open Energy Info (EERE)

CX CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2011-0004-CX CX at Dixie Valley Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant AltaRock Energy Inc Geothermal Area Dixie Valley Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Seismic Techniques Time Frame (days) Application Time 77 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager none provided Selected Dates Application Date 11/4/2010 Decision Document Date 1/20/2011


GRR/Section 18-NV-b - State RCRA Process | Open Energy Information  

Open Energy Info (EERE)

b - State RCRA Process b - State RCRA Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 18-NV-b - State RCRA Process 18NVBStateRCRAProcess.pdf Click to View Fullscreen Contact Agencies Nevada Division of Environmental Protection Regulations & Policies Nevada Revised Statutes (NRS) Nevada Administrative Code (NAC) Triggers None specified Click "Edit With Form" above to add content 18NVBStateRCRAProcess.pdf 18NVBStateRCRAProcess.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative Within the Nevada Division of Environmental Protection in Nevada, the Bureau of Waste Management (BWM) operates a permitting and compliance

Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOI-BLM-NV-C010-2013-0022-DNA | Open Energy Information  

Open Energy Info (EERE)

22-DNA 22-DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2013-0022-DNA DNA at Dixie Meadows Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Ormat Technologies Inc Geothermal Area Dixie Meadows Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Thermal Gradient Holes Comments Core hole/TGH Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Application Document Type NOI


GRR/Section 4-NV-c - Monitoring Well Waiver | Open Energy Information  

Open Energy Info (EERE)

c - Monitoring Well Waiver c - Monitoring Well Waiver < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 4-NV-c - Monitoring Well Waiver 04NVCMonitoringWellWaiver (1).pdf Click to View Fullscreen Contact Agencies Nevada Division of Water Resources Regulations & Policies NAC 534.148 Monitoring Well defined NAC 534.441 Waiver to drill monitoring well Triggers None specified Click "Edit With Form" above to add content 04NVCMonitoringWellWaiver (1).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative The Nevada Division of Water Resources (NDWR) may grant a waiver of the general drilling requirements for good cause shown. One common form of


DOI-BLM-NV-W010-2009-0018-CX | Open Energy Information  

Open Energy Info (EERE)

-0018-CX -0018-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-W010-2009-0018-CX CX at Abraham Hot Springs Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Gradient Resources Geothermal Area Abraham Hot Springs Geothermal Area Project Location Utah Project Phase Geothermal/Exploration Techniques Geophysical Methods Time Frame (days) Application Time 7 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office Humboldt River Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Application Date 2/19/2009


DOI-BLM-NV-C010-2011-0504-CX | Open Energy Information  

Open Energy Info (EERE)

04-CX 04-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2011-0504-CX CX at Patua Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Gradient Resources Geothermal Area Patua Geothermal Area Project Location Fernley, Nevada Project Phase Geothermal/Exploration Techniques Time Frame (days) Application Time 32 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City, Winnemucca Managing Field Office none provided Funding Agencies none provided Surface Manager BOR Mineral Manager none provided Selected Dates Application Date 4/22/2011 Decision Document Date 5/24/2011


DOI-BLM-NV-E030-20??-????-?? | Open Energy Information  

Open Energy Info (EERE)

0-20??-????-?? 0-20??-????-?? Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-E030-20??-????-?? EA at Abraham Hot Springs Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Standard Steam Trust LLC Geothermal Area Abraham Hot Springs Geothermal Area Project Location Utah Project Phase Geothermal/Exploration Techniques Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office BLM Elko District Office Managing Field Office none provided Funding Agencies none provided Surface Manager none provided Mineral Manager none provided Selected Dates Relevant Numbers Lead Agency


DOI-BLM-NV-C010-2011-0014-CX | Open Energy Information  

Open Energy Info (EERE)

4-CX 4-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2011-0014-CX CX at Patua Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Gradient Resources Geothermal Area Patua Geothermal Area Project Location Fernley, Nevada Project Phase Geothermal/Exploration Techniques Reflection Survey Time Frame (days) Application Time 8 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BOR Mineral Manager none provided Selected Dates Application Date 1/5/2011 Decision Document Date 1/13/2011


DOI-BLM-NV-C010-2011-0019-CX | Open Energy Information  

Open Energy Info (EERE)

9-CX 9-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-C010-2011-0019-CX CX at Gabbs Valley Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Geoglobal US Gabbs LLC Geothermal Area Gabbs Valley Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Time Frame (days) Application Time 0 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager none provided Selected Dates Application Date 2/17/2011 Decision Document Date 2/17/2011


DOI-BLM-NV-B010-2011-0015-EA | Open Energy Information  

Open Energy Info (EERE)

-2011-0015-EA -2011-0015-EA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-B010-2011-0015-EA EA at McGuiness Hills Geothermal Area for Geothermal/Power Plant McGinness Hills Geothermal Development Project General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Ormat Technologies Inc Consultant Great Basin Ecology, Inc.; JBR Environmental Consultants; NAVCON; WCRM, Inc. Geothermal Area McGuiness Hills Geothermal Area Project Location Nevada Project Phase Geothermal/Power Plant Techniques Drilling Techniques, Production Wells, Well Testing Techniques Comments McGinnis Hills Geothermal Area, not on Master list of geothermal areas - no adjacent areas are appropriate. Time Frame (days)


DOI-BLM-NV-W030-2010-0021-CX | Open Energy Information  

Open Energy Info (EERE)

30-2010-0021-CX 30-2010-0021-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-W030-2010-0021-CX CX at San Emidio Desert Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant US Geothermal Inc Geothermal Area San Emidio Desert Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Seismic Techniques Time Frame (days) Application Time 132 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office BLM Black Rock Field Office Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Application Date 4/23/2010


DOI-BLM-NV-W030-2011-0007-CX | Open Energy Information  

Open Energy Info (EERE)

7-CX 7-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-W030-2011-0007-CX CX at San Emidio Desert Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant US Geothermal Inc Geothermal Area San Emidio Desert Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Seismic Techniques Time Frame (days) Application Time 39 Participating Agencies Lead Agency BLM Funding Agency US Department of Energy Office of Energy Efficiency and Renewable Energy (DOE EERE) Managing District Office Winnemucca Managing Field Office BLM Black Rock Field Office Funding Agencies none provided Surface Manager BLM,


DOI-BLM-NV-W010-2010-0039-CX | Open Energy Information  

Open Energy Info (EERE)

-0039-CX -0039-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NV-W010-2010-0039-CX CX at Abraham Hot Springs Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Terra-Gen Power LLC Geothermal Area Abraham Hot Springs Geothermal Area Project Location Utah Project Phase Geothermal/Exploration Techniques Micro-Earthquake Time Frame (days) Application Time 64 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office Humboldt River Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Application Date 5/12/2010


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


EIS-0440: Quartzsite Solar Energy Project, La Paz County, AZ | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

0: Quartzsite Solar Energy Project, La Paz County, AZ 0: Quartzsite Solar Energy Project, La Paz County, AZ EIS-0440: Quartzsite Solar Energy Project, La Paz County, AZ Summary This EIS evaluates the environmental impacts of interconnecting a proposed 100-megawatt concentrating solar power plant to Western's Bouse-Kofa 161-kilovolt transmission line. The proposal includes amending the Bureau of Land Management Resource Management Plan. Cooperating agencies in the preparation of this EIS are Bureau of Land Management (Yuma Field Office ), U.S. Army Corps of Engineers, U.S. Army Garrison (Yuma Proving Grounds), Arizona Game and Fish Department, and the Arizona Department of Environmental Quality. Further information is available for this Project on the Western Area Power Administration Website Public Comment Opportunities


DOE - Office of Legacy Management -- Tuba City Mill Site - AZ 0-02  

Office of Legacy Management (LM)

Mill Site - AZ 0-02 Mill Site - AZ 0-02 FUSRAP Considered Sites Site: Tuba City Mill Site (AZ.0-02 ) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: Also see Tuba City, Arizona, Disposal Site Documents Related to Tuba City Mill Site 2012 Annual Site Inspection and Monitoring Report for Uranium Mill Tailings Radiation Control Act Title I Disposal Sites-Tuba City, Arizona, Disposal Site. LMS/S09461. February 2013 2008 UMTRCA Title I Annual Report January 2009 Tuba City, Arizona February 2009 Groundwater and Surface Water Sampling at the Tuba City, Arizona Disposal Site May 2009 This fact sheet provides information about the Uranium Mill Tailings


DOE Solar Decathlon: News Blog » AZ State/New Mexico  

NLE Websites -- All DOE Office Websites (Extended Search)

AZ State/New Mexico AZ State/New Mexico Below you will find Solar Decathlon news from the AZ State/New Mexico archive, sorted by date. Transportation Issues Challenge Teams on the Second Day of Assembly Tuesday, September 24, 2013 By Richard King On the second day of assembly, everyone seems to be settling in for the long haul. Either they were exhausted from working 18 hours straight on Monday or the adrenalin of the first day excitement had worn off. Either way, there was a constant but steadier pace to the work today. The U.S. Department of Energy Solar Decathlon is a marathon, not a sprint, and the teams understand that. Photo of two decathletes wearing hard hats, safety glasses, and safety vests. Safety is our number one priority. Here, two members of the Vienna University of Technology team display their safety equipment, including


EIS-0440: Quartzsite Solar Energy Project, La Paz County, AZ | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

40: Quartzsite Solar Energy Project, La Paz County, AZ 40: Quartzsite Solar Energy Project, La Paz County, AZ EIS-0440: Quartzsite Solar Energy Project, La Paz County, AZ Summary This EIS evaluates the environmental impacts of interconnecting a proposed 100-megawatt concentrating solar power plant to Western's Bouse-Kofa 161-kilovolt transmission line. The proposal includes amending the Bureau of Land Management Resource Management Plan. Cooperating agencies in the preparation of this EIS are Bureau of Land Management (Yuma Field Office ), U.S. Army Corps of Engineers, U.S. Army Garrison (Yuma Proving Grounds), Arizona Game and Fish Department, and the Arizona Department of Environmental Quality. Further information is available for this Project on the Western Area Power Administration Website Public Comment Opportunities


Tank 241-AZ-101 Mixer Pump Test Vapor Sampling and Analysis Plan  

Science Conference Proceedings (OSTI)

This sampling and analysis plan (SAP) identifies characterization objectives pertaining to sample collection, laboratory analytical evaluation, and reporting requirements for vapor samples obtained during the operation of mixer pumps in tank 241-AZ-101. The primary purpose of the mixer pump test (MPT) is to demonstrate that the two 300 horsepower mixer pumps installed in tank 241-AZ-101 can mobilize the settled sludge so that it can be retrieved for treatment and vitrification. Sampling will be performed in accordance with Tank 241-AZ-101 Mixer Pump Test Data Quality Objective (Banning 1999) and Data Quality Objectives for Regulatory Requirements for Hazardous and Radioactive Air Emissions Sampling and Analysis (Mulkey 1999). The sampling will verify if current air emission estimates used in the permit application are correct and provide information for future air permit applications.



Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tank 241-AZ-101 Mixer Pump Test Vapor Sampling and Analysis Plan  

Science Conference Proceedings (OSTI)

This sampling and analysis plan (SAP) identifies characterization objectives pertaining to sample collection, laboratory analytical evaluation, and reporting requirements for vapor samples obtained during the operation of mixer pumps in tank 241-AZ-101. The primary purpose of the mixer pump test (MPT) is to demonstrate that the two 300 horsepower mixer pumps installed in tank 241-AZ-101 can mobilize the settled sludge so that it can be retrieved for treatment and vitrification. Sampling will be performed in accordance with Tank 241-AZ-101 Mixer Pump Test Data Quality Objective (Banning 1999) and Data Quality Objectives for Regulatory Requirements for Hazardous and Radioactive Air Emissions Sampling and Analysis (Mulkey 1999). The sampling will verify if current air emission estimates used in the permit application are correct and provide information for future air permit applications.




Tank 241-AZ-101 Mixer Pump Test Vapor Sampling and Analysis Plan  

SciTech Connect

This sampling and analysis plan (SAP) identifies characterization objectives pertaining to sample collection, laboratory analytical evaluation, and reporting requirements for vapor samples obtained during the operation of mixer pumps in tank 241-AZ-101. The primary purpose of the mixer pump test (MPT) is to demonstrate that the two 300 horsepower mixer pumps installed in tank 241-AZ-101 can mobilize the settled sludge so that it can be retrieved for treatment and vitrification Sampling will be performed in accordance with Tank 241-AZ-101 Mixer Pump Test Data Quality Objective (Banning 1999) and Data Quality Objectives for Regulatory Requirements for Hazardous and Radioactive Air Emissions Sampling and Analysis (Mulkey 1999). The sampling will verify if current air emission estimates used in the permit application are correct and provide information for future air permit applications.




H2A.Z Acidic Patch Couples Chromatin Dynamics to Regulation of Gene Expression Programs during ESC Differentiation  

E-Print Network (OSTI)

The histone H2A variant H2A.Z is essential for embryonic development and for proper control of developmental gene expression programs in embryonic stem cells (ESCs). Divergent regions of amino acid sequence of H2A.Z likely ...

Subramanian, Vidya


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


RECIPIENT:Nevada State Office of Energy STATE:NV PROJECT Renewable Energy and Energy Efficiency Revolving Loan Program -  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Nevada State Office of Energy STATE:NV Nevada State Office of Energy STATE:NV PROJECT Renewable Energy and Energy Efficiency Revolving Loan Program - Enigma Energy TITLE: Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number cm Number DE-FOA"()000052 DE-EE-OOOOO84 GFO-0000084-012 EE84 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4S1.1A), I have made the foUowmg determination: Cx, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation. and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders. owners, consultants. designers). organizations (such as utilities). and state


Capacity Value of PV and Wind Generation in the NV Energy System  

Science Conference Proceedings (OSTI)

Calculation of photovoltaic (PV) and wind power capacity values is important for estimating additional load that can be served by new PV or wind installations in the electrical power system. It also is the basis for assigning capacity credit payments in systems with markets. Because of variability in solar and wind resources, PV and wind generation contribute to power system resource adequacy differently from conventional generation. Many different approaches to calculating PV and wind generation capacity values have been used by utilities and transmission operators. Using the NV Energy system as a study case, this report applies peak-period capacity factor (PPCF) and effective load carrying capability (ELCC) methods to calculate capacity values for renewable energy sources. We show the connection between the PPCF and ELCC methods in the process of deriving a simplified approach that approximates the ELCC method. This simplified approach does not require generation fleet data and provides the theoretical basis for a quick check on capacity value results of PV and wind generation. The diminishing return of capacity benefit as renewable generation increases is conveniently explained using the simplified capacity value approach.

Lu, Shuai; Diao, Ruisheng; Samaan, Nader A.; Etingov, Pavel V.




SciTech Connect

This report documents the preparation of three actual Hanford tank waste samples for shipment to the Savannah River National Laboratory (SRNL). Two of the samples were dissolved saltcakes from tank 241-AN-103 (hereafter AN-103) and tank 241-SX-105 (hereafter SX-105); one sample was a supernate composite from tanks 241-AZ-101 and 241-AZ-102 (hereafter AZ-101/102). The preparation of the samples was executed following the test plans LAB-PLAN-10-00006, Test Plan for the Preparation of Samples from Hanford Tanks 241-SX-105, 241-AN-103, 241-AN-107, and LAB-PLN-l0-00014, Test Plan for the Preparation of a Composite Sample from Hanford Tanks 241-AZ-101 and 241-AZ-102 for Steam Reformer Testing at the Savannah River National Laboratory. All procedural steps were recorded in laboratory notebook HNF-N-274 3. Sample breakdown diagrams for AN-103 and SX-105 are presented in Appendix A. The tank samples were prepared in support of a series of treatability studies of the Fluidized Bed Steam Reforming (FBSR) process using a Bench-Scale Reformer (BSR) at SRNL. Tests with simulants have shown that the FBSR mineralized waste form is comparable to low-activity waste glass with respect to environmental durability (WSRC-STI-2008-00268, Mineralization of Radioactive Wastes by Fluidized Bed Steam Reforming (FBSR): Comparisons to Vitreous Waste Forms and Pertinent Durability Testing). However, a rigorous assessment requires long-term performance data from FBSR product formed from actual Hanford tank waste. Washington River Protection Solutions, LLC (WRPS) has initiated a Waste Form Qualification Program (WP-5.2.1-2010-001, Fluidized Bed Steam Reformer Low-level Waste Form Qualification) to gather the data required to demonstrate that an adequate FBSR mineralized waste form can be produced. The documentation of the selection process of the three tank samples has been separately reported in RPP-48824, Sample Selection Process for Bench-Scale Steam Reforming Treatability Studies Using Hanford Waste Samples.




A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A. Abbreviations, energy related; About ...


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. G. Gabon Country Energy Profile;


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. L. Landfill Gas; Laos Country Energy Profile ;


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A. Abbreviations, energy related; About U.S ...


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. F. Factors Affecting Natural Gas Prices ...


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. D. Daily Spot Prices of Crude Oil; Dealer Tank Wagon ...


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. O. Ocean Thermal Energy Conversion ...


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



Tank 241-AZ-101 criticality assessment resulting from pump jet mixing: Sludge mixing simulation  

SciTech Connect

Tank 241-AZ-101 (AZ-101) is one of 28 double-shell tanks located in the AZ farm in the Hanford Site`s 200 East Area. The tank contains a significant quantity of fissile materials, including an estimated 9.782 kg of plutonium. Before beginning jet pump mixing for mitigative purposes, the operations must be evaluated to demonstrate that they will be subcritical under both normal and credible abnormal conditions. The main objective of this study was to address a concern about whether two 300-hp pumps with four rotating 18.3-m/s (60-ft/s) jets can concentrate plutonium in their pump housings during mixer pump operation and cause a criticality. The three-dimensional simulation was performed with the time-varying TEMPEST code to determine how much the pump jet mixing of Tank AZ-101 will concentrate plutonium in the pump housing. The AZ-101 model predicted that the total amount of plutonium within the pump housing peaks at 75 g at 10 simulation seconds and decreases to less than 10 g at four minutes. The plutonium concentration in the entire pump housing peaks at 0.60 g/L at 10 simulation seconds and is reduced to below 0.1 g/L after four minutes. Since the minimum critical concentration of plutonium is 2.6 g/L, and the minimum critical plutonium mass under idealized plutonium-water conditions is 520 g, these predicted maximums in the pump housing are much lower than the minimum plutonium conditions needed to reach a criticality level. The initial plutonium maximum of 1.88 g/L still results in safety factor of 4.3 in the pump housing during the pump jet mixing operation.

Onishi, Y.; Recknagle, K.



DOE/NV--514 U.S. Department of Energy Nevada Operations Office  

E-Print Network (OSTI)

This document presents a general plan to investigate the nature and extent of COPCs at CAUs composed of collection systems and distribution systems (i.e., leachfields) used to dispose of various effluents. All of the features related to the effluent disposal are collectively referred to as "leachfield systems" in this Work Plan. The purpose of the corrective action investigation(s) is to: . Identify the presence, distribution, and nature of COPCs at leachfield systems including septic tanks, leachfields, and associated wastewater collection systems. . Provide sufficient information and data to develop and evaluate appropriate corrective actions for leachfield CAUs. This Work Plan was developed using the U.S. Environmental Protection Agency (EPA) Data Quality Objectives (DQOs) (EPA, 1994c) process to clearly define the goals for collecting and using environmental data and to design a data collection program that will satisfy these goals. General DQOs applicable to the leachfield CAUs were identified in a scoping meeting between the DOE/NV Leachfield Work Plan Section: 1.0 Revision: 1 Date: 12/28/98 and the NDEP as described in Section3.0. Corrective Action Unit-specific DQO scoping meetings will be held prior to the preparation of the CAIPs. 1.2 Scope The scope of this Work Plan is to provide general information concerning the investigation of the leachfield CAUs, thereby eliminating redundant documentation and streamlining the corrective action investigation process. The scope of the CAIPs is the resolution of problem statement(s) identified in the DQO process. The general problem identified for the leachfield CAUs is that various potentially hazardous or radioactive effluents may have been released at the CAUs and that existing data are insufficient to support the d...

Environmental Restoration Division; Controlled Copy No; Revision No



Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)


Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



File:NREL-az-80m.pdf | Open Energy Information  

Open Energy Info (EERE)

az-80m.pdf az-80m.pdf Jump to: navigation, search File File history File usage Arizona Annual Average Wind Speed at 80 Meters Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 1.24 MB, MIME type: application/pdf) Description Arizona Annual Average Wind Speed at 80 Meters Sources National Renewable Energy Laboratory Related Technologies Wind Creation Date 2010-01-15 Extent State Countries United States UN Region Northern America States Arizona File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 15:00, 21 December 2010 Thumbnail for version as of 15:00, 21 December 2010 1,275 × 1,650 (1.24 MB) MapBot (Talk | contribs) Automated upload from NREL's "mapsearch" data


File:USDA-CE-Production-GIFmaps-AZ.pdf | Open Energy Information  

Open Energy Info (EERE)

AZ.pdf AZ.pdf Jump to: navigation, search File File history File usage Arizona Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 249 KB, MIME type: application/pdf) Description Arizona Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Arizona External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:11, 27 December 2010 Thumbnail for version as of 16:11, 27 December 2010 1,650 × 1,275 (249 KB) MapBot (Talk | contribs) Automated bot upload


DOE - Office of Legacy Management -- Tuba City AEC Ore Buying Station - AZ  

NLE Websites -- All DOE Office Websites (Extended Search)

AEC Ore Buying Station - AEC Ore Buying Station - AZ 0-02A FUSRAP Considered Sites Site: Tuba City AEC Ore Buying Station (AZ.0-02A) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: The history of domestic uranium procurement under U.S. Atomic Energy Commission (AEC) contracts identifies a number of ore buying stations (sampling and storage sites) that were operated during the period late-1949 through the mid-1960s. During this period the AEC established ore-buying stations in new uranium producing areas where it appeared that ore production would be sufficient to support a uranium milling operation. The ideal scenario was to accumulate a sufficient stockpile of ore and


Anemometer Data (Wind Speed, Direction) for Pascua Yaqui, AZ (2003 - 2004)  

Open Energy Info (EERE)

Pascua Yaqui, AZ (2003 - 2004) Pascua Yaqui, AZ (2003 - 2004) Dataset Summary Description Wind data collected from Pascua Yaqui Indian Reservation in Arizona from an anemometer as part of the Native American anemometer loan program. Monthly mean wind speed is available for 2003 through 2004, as is wind direction and turbulence data. Data is reported from a height of 20 m. The data was originally made available by Wind Powering America, a DOE Office of Energy Efficiency & Renewable Energy (EERE) program. A dynamic map displaying all available data from DOE anemometer loan programs is available http://www.windpoweringamerica.gov/anemometerloans/projects.asp. Source EERE Date Released December 02nd, 2010 (3 years ago) Date Updated December 02nd, 2010 (3 years ago) Keywords wind


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA) Indexed Site

A-Z Index A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ A Abbreviations, energy related About U.S. Natural Gas Pipelines (U.S. & state) Acid rain (U.S., Census division, & state) Definition Emissions data Overview Acquisitions and Divestitures by Foreign Direct Investors in U.S. Energy (report) Activities for kids Additions to storage (natural gas; includes U.S. & state) Underground, by all operators Underground, by storage type Liquefied natural gas additions and withdrawals Addresses of electric companies Utility Nonutility AEO (See Annual Energy Outlook) AER (Annual Energy Review - report with annual U.S. data back to 1949) Afghanistan Country Analysis Brief Africa - Country Analysis Briefs Air-conditioning, number of households with


Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


Evaluation of 241-AZ tank farm supporting phase 1 privatization waste feed delivery  

Science Conference Proceedings (OSTI)

This evaluation is one in a series of evaluations determining the process needs and assessing the adequacy of existing and planned equipment in meeting those needs at various double-shell tank farms in support of Phase 1 privatization. A number of tank-to-tank transfers and waste preparation activities are needed to process and feed waste to the private contractor in support of Phase 1 privatization. The scope of this evaluation is limited to process needs associated with 241-AZ tank farm during the Phase 1 privatization.




,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


CSER 96-014: criticality safety of project W-151, 241-AZ-101 retrieval system process test  

Science Conference Proceedings (OSTI)

This Criticality Safety Evaluation Report (CSER) documents a review of the criticality safety implications of a process test to be performed in tank 241-AZ-101 (101-AZ). The process test will determine the effectiveness of the retrieval system for mobilization of solids and the practicality of the system for future use in the underground storage tanks at Hanford. The scope of the CSER extends only to the testing and operation of the mixer pumps and does not include the transfer of waste from the tank. Justification is provided that a nuclear criticality is extremely unlikely, if not impossible, in this tank.

Vail, T.S., Fluor Daniel Hanford



Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


Pump Jet Mixing and Pipeline Transfer Assessment for High-Activity Radioactive Wastes in Hanford Tank 241-AZ-102  

SciTech Connect

The authors evaluated how well two 300-hp mixer pumps would mix solid and liquid radioactive wastes stored in Hanford double-shell Tank 241-AZ-102 (AZ-102) and confirmed the adequacy of a three-inch (7.6-cm) pipeline system to transfer the resulting mixed waste slurry to the AP Tank Farm and a planned waste treatment (vitrification) plant on the Hanford Site. Tank AZ-102 contains 854,000 gallons (3,230 m{sup 3}) of supernatant liquid and 95,000 gallons (360 m{sup 3}) of sludge made up of aging waste (or neutralized current acid waste). The study comprises three assessments: waste chemistry, pump jet mixing, and pipeline transfer. The waste chemical modeling assessment indicates that the sludge, consisting of the solids and interstitial solution, and the supernatant liquid are basically in an equilibrium condition. Thus, pump jet mixing would not cause much solids precipitation and dissolution, only 1.5% or less of the total AZ-102 sludge. The pump jet mixing modeling indicates that two 300-hp mixer pumps would mobilize up to about 23 ft (7.0 m) of the sludge nearest the pump but would not erode the waste within seven inches (0.18 m) of the tank bottom. This results in about half of the sludge being uniformly mixed in the tank and the other half being unmixed (not eroded) at the tank bottom.

Y Onishi; KP Recknagle; BE Wells



WM'05 Conference, February 27 March 3, 2005, Tucson, AZ WM-5202 INTERNATIONAL APPROACH TO MONITORING FOR RADIOACTIVELY  

E-Print Network (OSTI)

acceptable scrap metal radiation monitoring and response protocol. Second, international training programs radiation exposure to workers and the public, this unwanted radioactive scrap material causes environmentalWM'05 Conference, February 27 ­ March 3, 2005, Tucson, AZ WM-5202 1 INTERNATIONAL APPROACH


RECIPIENT:Desert Research Institute STATE:NV PROJECT Tall Tower Wind Energy Monitoring and Numerical Model Validation in Southern Nevada; NREl Tracking  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Desert Research Institute STATE:NV Desert Research Institute STATE:NV PROJECT Tall Tower Wind Energy Monitoring and Numerical Model Validation in Southern Nevada; NREl Tracking TITLE: No. 11-012 Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number NREl-11-012 G010337 Based on my review of the information concerning the proposed action, as NEPA CompHance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, audits), data analYSis (including computer modeling), document preparation (such as conceptual deSign or feasibility studies, analytical energy supply and demand studies), and dissemination (including, but not limited to, document mailings, publication, and distribution;


Record of Technical Change {number_sign}2 for ''Corrective Action Investigation Plan for Corrective Action Unit 240: Area 25 Vehicle Washdown, Nevada Test Site, Nevada,'' Revision 0, DOE/NV--532  

Science Conference Proceedings (OSTI)

This Record of Technical Change updates the technical informatioin provided in ''Corrective Action Investigation Plan for Corrective Action Unit 240: Area 25 Vehicle Washdown, Nevada Test Site, Nevada,'' Revision 0, DOE/NV--532.

USDOE Nevada Operations Office




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5 5 Recipient: County ut Pinal, AZ ENERGY EFFICIENCY AND CONSERVATION BLOCK GRANTS NEPA COMPLIANCE FORM Activities Determination/ Categorical Exclusion Reviewer's Specific Instructions and Rationale (Restrictions and Allowable Activity) Activity 1 - Energy Efficiency Audits A9, All This NEPA determination is limited to conducting audits/compiling the results of the audits/and making recommendations only. (see Activity 4 for audit implementation activities) Activity 2 - Energy Efficiency Municipal Partnership A9, All, B5.1 Waste Stream Clause Historic Preservation Clause Engineering clause Activity 3 - Ironwood-Gantzel Roadway Traffic Lights Synchronization A9 None Activity 4 - Energy Efficiency Corrective Measures Implementation A9, All, B5.1 Waste Stream Clause Historic Preservation Clause

Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

emergency wood pole emergency wood pole replacement at 59 structures located along the Coolidge-Oracle 115-kV T.L. , near Cooiidge, Florence & Oracle Junction, Pinal County, AZ, RECORD OF CATEGORICAL EXCLUSION DETERMINATION A. Proposed Action: Western plans to replace deteriorated wood poles, cross arms and X-braces at 59 existing H-frame or 3-pole-turning structures (Table 1) located along the Coolidge-Oracle 115-kV Transmission Line in Pinal County, Arizona (Figure 1), Built in 1943, its aging components are beyond repair and require replacement. These poles performed poorly during structural tests, and we consider them unstable, This project ensures the safety of Western's workers and the public as well as reliability of the bulk electric system, Western will accomplish the work by clearing vegetation and blading a level pad at


Tank 241-AZ-101 prototype corrosion probe four month status report  

SciTech Connect

High-level nuclear wastes at the Hanford Site are stored underground in carbon steel double-shell and single-shell tanks. The installation of a prototype corrosion monitoring system into double-shell tank 241-AZ-101 was completed in August, 1996. The system monitors fluctuations in corrosion current and potential (electrochemical noise) occurring on three electrode arrays immersed in the waste liquid and in the vapor space above the waste. The system also supports the use of Tafel and linear polarization resistance testing. By monitoring and analyzing the data from these techniques, changes in the corrosive characteristics of the waste have been rapidly detected and correlated with operational changes in the tank.

Edgemon, G.L., Westinghouse Hanford



Evaluation of cracking in the 241-AZ tank farm ventilation line at the Hanford Site  

Science Conference Proceedings (OSTI)

In the period from April to October of 1988, a series of welding operations on the outside of the AZ Tank Farm ventilation line piping at the Hanford Site produced unexpected and repeated cracking of the austenitic stainless steel base metal and of a seam weld in the pipe. The ventilation line is fabricated from type 304L stainless steel pipe of 24 inch diameter and 0.25 inch wall thickness. The pipe was wrapped in polyethylene bubble wrap and buried approximately 12 feet below grade. Except for the time period between 1980 and 1987, impressed current cathodic protection has been applied to the pipe since its installation in 1974. The paper describes the history of the cracking of the pipe, the probable cracking mechanisms, and the recommended future action for repair/replacement of the pipe.




Geobotanical Remote Sensing Applied to Targeting New Geothermal Resource Locations in the U.S. Basin and Range with a Focus on Dixie Meadows, NV  

DOE Green Energy (OSTI)

This paper presents an overview of the work our collaboration is doing to increase the detailed mapped resource base for geothermal exploration in the Western US. We are imaging several large areas in the western US with high resolution airborne hyperspectral and satellite multispectral sensors. We have now entered the phase where the remote sensing techniques and tools we are developing are mature enough to be combined with other geothermal exploration techniques such as aeromagnetic, seismic, well logging and coring data. The imaging sensors and analysis techniques we have developed have the ability to map visible faults, surface effluents, altered minerals, subtle hidden faults. Large regions are being imaged at reasonable costs. The technique of geobotanical remote sensing for geothermal signatures is based on recent successes in mapping hidden faults, high temperature altered mineralization, clays, hot and cold springs and CO2 effluents the Long Valley Caldera and Mammoth Mountain in California. The areas that have been imaged include Mammoth Mountain and the Long Valley Caldera, Dixie Meadows NV, Fish Lake Valley NV, and Brady Hot Springs. Areas that are being imaged in the summer of 2003 are the south moat of the Long Valley Caldera, Mammoth Mountain western Pickles, Nash, Kasameyer, Foxall, Martini, Cocks, Kennedy-Bowdoin, McKnight, Silver, Potts, flanks, Mono Inyo chain north of Mammoth Mountain in CA, and the Humboldt Block in NV. This paper focuses on presenting the overview of the high-resolution airborne hyperspectral image acquisition that was done at Dixie Meadows NV in August 2002. This new imagery is currently being analyzed and combined with other field data by all of the authors on this paper. Results of their work up until the time of the conference will be presented in papers in the remote sensing session.

Pickles, W. L.; Nash, G. D.; Calvin, W. M.; Martini, B. A.; Cocks, P. A.; Kenedy-Bowdoin, T.; Mac Knight, R. B.; Silver, E. A.; Potts, D. C.; Foxall, W.; Kasameyer, P.; Waibel, A. F.



St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


241-AZ-101 Mixer Pump Demonstration Test Gamma Cart Acceptance Test Procedure and Quality Test Plan (ATP and QTP)  

Science Conference Proceedings (OSTI)

Shop Test of the Gamma Cart System to be used in the AZ-101 Mixer Pump Demonstration Test. Tests hardware and software. This procedure involves testing the Instrumentation involved with the Gamma Cart System, local and remote, including: depth indicators, speed controls, interface to data acquisition software and the raising and lowering functions. This Procedure will be performed twice, once for each Gamma Cart System. This procedure does not test the accuracy of the data acquisition software.




241-AZ-101 Mixer Pump Demonstration Test Gamma Cart Acceptance Test Procedure and Quality Test Plan (ATP and QTP)  

SciTech Connect

Shop test of the sludge mobilization cart system to be used in the AZ-101 Mixer Pump Demonstration Test Tests hardware and software. This procedure involves testing the Instrumentation involved with the Gamma Cart System, local and remote, including depth indicators, speed controls, interface to data acquisition software and the raising and lowering functions. This Procedure will be performed twice, once for each Gamma Cart System. This procedure does not test the accuracy of the data acquisition software.





U.S. Energy Information Administration (EIA) Indexed Site

Liquids Reserve Class Liquids Reserve Class No 2001 liquids reserves 0.1 - 10 Mbbl 10.1 - 100 Mbbl 100.1 - 1,000 Mbbl 1,000.1- 10,000 Mbbl 10,000.1 - 100,000 Mbbl Basin Outline AZ UT NM CO 1 2 Index Map for 2 Paradox-San Juan Panels 2001 Reserve Summary for All Paradox-San Juan Basin Fields Total Total Total Number Liquid Gas BOE of Reserves Reserves Reserves Fields (Mbbl) (MMcf) (Mbbl) Paradox-San Juan 250 174,193 20,653,622 3,616,464 Basin CO NM IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO BASIN BASIN BLAN CO BLAN CO BASIN BASIN BASIN BASIN BASIN BASIN BISTI BAL LAR D BASIN BISTI BLA NCO S OT ERO BAL LAR D LIND RITH W BASIN BLA NCO BLA NCO S BLA NCO S TAPAC ITO GAVIL AN BASIN BLA NCO The mapped oil and gas field boundary outlines were created by the Reserves and Production Division, Office of Oil and Gas, Energy Information Administration pursuant to studies required by



U.S. Energy Information Administration (EIA) Indexed Site

BOE Reserve Class BOE Reserve Class No 2001 reserves 0.1 - 10 MBOE 10.1 - 100 MBOE 100.1 - 1,000 MBOE 1,000.1- 10,000 MBOE 10,000.1 - 100,000 MBOE > 100,000 MBOE Basin Outline AZ UT NM CO 1 2 Index Map for 2 Paradox-San Juan Panels 2001 Reserve Summary for All Paradox-San Juan Basin Fields Total Total Total Number Liquid Gas BOE of Reserves Reserves Reserves Fields (Mbbl) (MMcf) (Mbbl) Paradox-San Juan 250 174,193 20,653,622 3,616,464 Basin CO NM IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO BASIN BASIN BLAN CO BLAN CO BASIN BASIN BASIN BASIN BASIN BASIN BISTI BAL LAR D BASIN BISTI BLA NCO S OT ERO BAL LAR D LIND RITH W BASIN BLA NCO BLA NCO S BLA NCO S TAPAC ITO GAVIL AN BASIN BLA NCO The mapped oil and gas field boundary outlines were created by the Reserves and Production Division, Office of Oil and Gas, Energy Information Administration pursuant to studies required by



U.S. Energy Information Administration (EIA) Indexed Site

Gas Reserve Class Gas Reserve Class No 2001 gas reserves 0.1 - 10 MMCF 10.1 - 100 MMCF 100.1 - 1,000 MMCF 1,000.1- 10,000 MMCF 10,000.1 - 100,000 MMCF > 100,000 MMCF Basin Outline AZ UT NM CO 1 2 Index Map for 2 Paradox-San Juan Panels 2001 Reserve Summary for All Paradox-San Juan Basin Fields Total Total Total Number Liquid Gas BOE of Reserves Reserves Reserves Fields (Mbbl) (MMcf) (Mbbl) Paradox-San Juan 250 174,193 20,653,622 3,616,464 Basin CO NM IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO BASIN BASIN BLAN CO BLAN CO BASIN BASIN BASIN BASIN BASIN BASIN BISTI BAL LAR D BASIN BISTI BLA NCO S OT ERO BAL LAR D LIND RITH W BASIN BLA NCO BLA NCO S BLA NCO S TAPAC ITO GAVIL AN BASIN BLA NCO The mapped oil and gas field boundary outlines were created by the Reserves and Production Division, Office of Oil and Gas, Energy Information Administration pursuant to studies required by


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani


Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Estimate of the Distribution of Solids Within Mixed Hanford Double-Shell Tank AZ-101: Implications for AY-102  

SciTech Connect

This paper describes the current level of understanding of the suspension of solids in Hanford double-shell waste tanks while being mixed with the baseline configuration of two 300-horsepower mixer pumps. A mixer pump test conducted in Tank AZ-101 during fiscal year 2000 provided the basis for this understanding. Information gaps must be filled to demonstrate the capability of the baseline feed delivery system to effectively mix, sample, and deliver double-shell tank waste to the Hanford Tank Waste Treatment and Immobilization Plant (WTP) for vitrification.

Wells, Beric E.; Ressler, Jennifer J.



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



Supporting Solar Power in Renewables Portfolio Standards: Experience from the United States  

E-Print Network (OSTI)

NJ Credit Multipliers Specific Technology Solar Energy *:NJ, NM, NV, OH, OR, PA Specific Application Distributed Generation : AZ, CO, NM, NY Solar Energy :

Wiser, Ryan



EIS-0403: DOE and BLM Notice of Availability of the Final Programmatic...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Environmental Impact Statement Final Programmatic Environmental Impact Statement for Solar Energy Development in Six Southwestern States (AZ, CA, CO, NV, NM, and UT) The Bureau...


Environmental Impact Statements (EIS) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Disposition July 24, 2012 EIS-0403: Final Programmatic Environmental Impact Statement Solar Energy Development in Six Southwestern States (AZ, CA, CO, NV, NM, and UT) May 31,...


EIS-0403: EPA Notice of Availability of the Final Programmatic...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Environmental Impact Statement Final Programmatic Environmental Impact Statement for Solar Energy Development in Six Southwestern States (AZ, CA, CO, NV, NM, and UT) The U.S....


3610 N. 44th Street, Suite 250, Phoenix, AZ 85018 ● Phone 602-808-2004 ●  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

10 N. 44th Street, Suite 250, Phoenix, AZ 85018 ● Phone 602-808-2004 ● Fax 602-808-2099 ● www.sunzia.net 10 N. 44th Street, Suite 250, Phoenix, AZ 85018 ● Phone 602-808-2004 ● Fax 602-808-2099 ● www.sunzia.net October 17, 2013 Transmitted via electronic mail to juliea.smith@hq.doe.gov and christopher.lawrence@hq.doe.gov Subject: SunZia Southwest Transmission Project comments on Department of Energy's August 29, 2013 Federal Register Notice regarding Improving Performance of Federal Permitting and Review of Infrastructure Projects. The following comments are provided to the Department of Energy (DOE) in response to the agency's request for information on (RFI) the draft Integrated Interagency Pre-Application (IIP) Process. These comments reflect the views and suggestions of the SunZia Southwest Transmission Project (SunZia). The Bureau of Land Management is the lead agency for processing our right-of-


Cost Comparison for the Transfer of Select Calcined Waste Canisters to the Monitored Geologic Repository at Yucca Mountain, NV  

SciTech Connect

This report performs a life-cycle cost comparison of three proposed canister designs for the shipment and disposition of Idaho National Laboratory high-level calcined waste currently in storage at the Idaho Nuclear Technology and Engineering Center to the proposed national monitored geologic repository at Yucca Mountain, Nevada. Concept A (2 10-ft) and Concept B (2 15-ft) canisters are comparable in design, but they differ in size and waste loading options and vary proportionally in weight. The Concept C (5.5 17.5-ft) canister (also called the super canister), while similar in design to the other canisters, is considerably larger and heavier than Concept A and B canisters and has a greater wall thickness. This report includes estimating the unique life-cycle costs for the three canister designs. Unique life-cycle costs include elements such as canister purchase and filling at the Idaho Nuclear Technology and Engineering Center, cask preparation and roundtrip consignment costs, final disposition in the monitored geologic repository (including canister off-loading and placement in the final waste disposal package for disposition), and cask purchase. Packaging of the calcine "as-is" would save $2.9 to $3.9 billion over direct vitrification disposal in the proposed national monitored geologic repository at Yucca Mountain, Nevada. Using the larger Concept C canisters would use 0.75 mi less of tunnel space, cost $1.3 billion less than 10-ft canisters of Concept A, and would be complete in 6.2 years.

Michael B. Heiser; Clark B. Millet



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Better Buildings Neighborhood Program: Indianapolis, Indiana  

NLE Websites -- All DOE Office Websites (Extended Search)

Indianapolis, Indianapolis, Indiana to someone by E-mail Share Better Buildings Neighborhood Program: Indianapolis, Indiana on Facebook Tweet about Better Buildings Neighborhood Program: Indianapolis, Indiana on Twitter Bookmark Better Buildings Neighborhood Program: Indianapolis, Indiana on Google Bookmark Better Buildings Neighborhood Program: Indianapolis, Indiana on Delicious Rank Better Buildings Neighborhood Program: Indianapolis, Indiana on Digg Find More places to share Better Buildings Neighborhood Program: Indianapolis, Indiana on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC


Better Buildings Neighborhood Program: Better Buildings Partners  

NLE Websites -- All DOE Office Websites (Extended Search)

Better Better Buildings Partners to someone by E-mail Share Better Buildings Neighborhood Program: Better Buildings Partners on Facebook Tweet about Better Buildings Neighborhood Program: Better Buildings Partners on Twitter Bookmark Better Buildings Neighborhood Program: Better Buildings Partners on Google Bookmark Better Buildings Neighborhood Program: Better Buildings Partners on Delicious Rank Better Buildings Neighborhood Program: Better Buildings Partners on Digg Find More places to share Better Buildings Neighborhood Program: Better Buildings Partners on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY


Better Buildings Neighborhood Program: Jacksonville, Florida  

NLE Websites -- All DOE Office Websites (Extended Search)

Jacksonville, Jacksonville, Florida to someone by E-mail Share Better Buildings Neighborhood Program: Jacksonville, Florida on Facebook Tweet about Better Buildings Neighborhood Program: Jacksonville, Florida on Twitter Bookmark Better Buildings Neighborhood Program: Jacksonville, Florida on Google Bookmark Better Buildings Neighborhood Program: Jacksonville, Florida on Delicious Rank Better Buildings Neighborhood Program: Jacksonville, Florida on Digg Find More places to share Better Buildings Neighborhood Program: Jacksonville, Florida on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC


Hybrid Al/SiC Composite Optics for IFE Applications W. Kowbel, MER Corp., Tucson, AZ And M. Tillack, UCSD, La Jolla, CA  

E-Print Network (OSTI)

Hybrid Al/SiC Composite Optics for IFE Applications W. Kowbel, MER Corp., Tucson, AZ And M. Tillack support of the mirror is a SiC composite. The SiC composite is chosen for the following reasons: 1) Very the mechanical deformations of the mirror's surface are minimized. 3) SiC is a low activation material, so

Tillack, Mark


Evaluating the improvement of corrosion residual strength by adding 1.0 wt.% yttrium into an AZ91D magnesium alloy  

SciTech Connect

The influence of yttrium on the corrosion residual strength of an AZ91D magnesium alloy was investigated detailedly. Scanning electron microscope was employed to analyze the microstructure and the fractography of the studied alloys. The microstructure of AZ91D magnesium alloy is remarkably refined due to the addition of yttrium. The electrochemical potentiodynamic polarization curve of the studied alloy was performed with a CHI 660b electrochemical station in the three-electrode system. The result reveals that yttrium significantly promotes the overall corrosion resistance of AZ91D magnesium alloy by suppressing the cathodic reaction in corrosion process. However, the nucleation and propagation of corrosion pits on the surface of the 1.0 wt.% Y modified AZ91D magnesium alloy indicate that pitting corrosion still emerges after the addition of yttrium. Furthermore, stress concentration caused by corrosion pits should be responsible for the drop of corrosion residual strength although the addition of yttrium remarkably weakens the effect of stress concentration at the tip of corrosion pits in loading process.

Wang Qiang [Key Laboratory of Automobile Materials (Jilin University), Ministry of Education, College of Materials Science and Engineering, Jilin University, Changchun, 130025 (China); Liu Yaohui, E-mail: liuyaohui2005@yahoo.com [Key Laboratory of Automobile Materials (Jilin University), Ministry of Education, College of Materials Science and Engineering, Jilin University, Changchun, 130025 (China); Fang Shijie [Department of Mechanical and Electrical Engineering, Luoyang Institute of Science and Technology, Luoyang 471023 (China); Song Yulai; Zhang Dawei; Zhang Lina; Li Chunfang [Key Laboratory of Automobile Materials (Jilin University), Ministry of Education, College of Materials Science and Engineering, Jilin University, Changchun, 130025 (China)



Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



Reconnaissance geochemical assessment of the Clover Mountains Bureau of Land Management Wilderness Study Area (NV-050-139), Lincoln County, Nevada  

SciTech Connect

This report presents the results of a mineral survey of the Clover Mountains Wilderness Study Area, Lincoln County, Nevada. The Clover Mountains Geology-Energy-Minerals (GEM) Resource Area (GRA) includes the Clover Mountains Wilderness Study Area (WSA) NV 050-0139. The GRA is located in south-central Lincoln County, Nevada, near the town of Caliente. There are two mining districts on the periphery of the WSA: (1) the Pennsylvania district, just northwest of the WSA, which is still active and has produced about $50,000 worth of gold, silver, and copper; (2) the Viola district, on the southern boundary of the WSA, the total production of which was less than $400,000, mostly from fluorspar. No patented or unpatented claims exist within the WSA. The rocks exposed in the WSA are almost entirely Tertiary rhyolites; below these rocks are Paleozoic and Mesozoic sedimentary rocks that have been locally mineralized, as in the Pennsylvania district. Stream-sediment and heavy-mineral-concentrate samples were collected and analyzed spectrographically by the US Geological Survey. The analytical results indicate that anomalous concentrations of thorium and barium occur along the western border of the WSA. Minor thorium, barium, and tin anomalies are scattered throughout the WSA. 6 refs., 5 tabs. (ACR)

Hoffman, J.D.; Day, G.W.




SciTech Connect

This report documents melter and off-gas performance results obtained on the DM 1200 HLW Pilot Melter during processing of simulated HLW AZ-101 feed. The principal objectives of the DM1200 melter testing were to determine the achievable glass production rates for simulated HLW AZ-101 feed; determine the effect of bubbling rate and feed solids content on production rate; characterize melter off-gas emissions; characterize the performance of the prototypical off-gas system components as well as their integrated performance; characterize the feed, glass product, and off-gas effluents; and to perform pre- and post-test inspections of system components. The test objectives (including test success criteria), along with how they were met, are outlined in a table.




HLW Feed Delivery AZ101 Batch Transfer to the Private Contractor Transfer and Mixing Process Improvements [Initial Release at Rev 2  

SciTech Connect

The primary purpose of this business case is to provide Operations and Maintenance with a detailed transfer process review for the first High Level Waste (HLW) feed delivery to the Privatization Contractor (PC), AZ-101 batch transfer to PC. The Team was chartered to identify improvements that could be implemented in the field. A significant penalty can be invoked for not providing the quality, quantity, or timely delivery of HLW feed to the PC.



Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural



Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration


Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.



Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."



Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of


Characterization of High Strain Rate Mechanical behavior of AZ31 magnesium alloy using 3D Digital Image Correlation  

Science Conference Proceedings (OSTI)

Characterization of the material mechanical behavior at sub-Hopkinson regime (0.1 to 1000 s{sup -1}) is very challenging due to instrumentation limitations and the complexity of data analysis involved in dynamic loading. In this study, AZ31 magnesium alloy sheet specimens are tested using a custom designed servo-hydraulic machine in tension at nominal strain rates up to 1000 s{sup -1}. In order to resolve strain measurement artifacts, the specimen displacement is measured using 3D Digital Image correlation instead from actuator motion. The total strain is measured up to {approx} 30%, which is far beyond the measurable range of electric resistance strain gages. Stresses are calculated based on the elastic strains in the tab of a standard dog-bone shaped specimen. Using this technique, the stresses measured for strain rates of 100 s{sup -1} and lower show little or no noise comparing to load cell signals. When the strain rates are higher than 250 s{sup -1}, the noises and oscillations in the stress measurements are significantly decreased from {approx} 250 to 50 MPa. Overall, it is found that there are no significant differences in the elongation, although the material exhibits slight work hardening when the strain rate is increased from 1 to 100 s{sup -1}.

Wang, Yanli [ORNL; Xu, Hanbing [ORNL; ERDMAN III, DONALD L [ORNL; Starbuck, J Michael [ORNL; Simunovic, Srdjan [ORNL




SciTech Connect

This report documents the preparation of three actual Hanford tank waste samples for shipment to the Savannah River National Laboratory (SRNL). Two of the samples were dissolved saltcakes from tank 241-AN-103 (hereafter AN-103) and tank 241-SX-105 (hereafter SX-105); one sample was a supernate composite from tanks 241-AZ-101 and 241-AZ-102 (hereafter AZ-101/102). The preparation of the samples was executed following the test plans LAB-PLAN-10-00006, Test Plan for the Preparation of Samples from Hanford Tanks 241-SX-105, 241-AN-103, 241-AN-107, and LAB-PLN-10-00014, Test Plan for the Preparation of a Composite Sample from Hanford Tanks 241-AZ-101 and 241-AZ-102 for Steam Reformer Testing at the Savannah River National Laboratory. All procedural steps were recorded in laboratory notebook HNF-N-274 3. Sample breakdown diagrams for AN-103 and SX-105 are presented in Appendix A. The tank samples were prepared in support of a series of treatability studies of the Fluidized Bed Steam Reforming (FBSR) process using a Bench-Scale Reformer (BSR) at SRNL. Tests with simulants have shown that the FBSR mineralized waste form is comparable to low-activity waste glass with respect to environmental durability (WSRC-STI-2008-00268, Mineralization of Radioactive Wastes by Fluidized Bed Steam Reforming (FBSR): Comparisons to Vitreous Waste Forms and Pertinent Durability Testing). However, a rigorous assessment requires long-term performance data from FB SR product formed from actual Hanford tank waste. Washington River Protection Solutions, LLC (WRPS) has initiated a Waste Form Qualification Program (WP-S.2.1-20 1 0-00 1, Fluidized Bed Steam Reformer Low-level Waste Form Qualification) to gather the data required to demonstrate that an adequate FBSR mineralized waste form can be produced. The documentation of the selection process of the three tank samples has been separately reported in RPP-48824, 'Sample Selection Process for Bench-Scale Steam Reforming Treatability Studies Using Hanford Waste Samples.'




Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office

Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA



NLE Websites -- All DOE Office Websites (Extended Search)

dependent on waste stream characteristics. 3.2.6 Handling Waste packages that require remote handling may incur additional cost for the generator and delay waste profile...


A-Z Index  

NLE Websites -- All DOE Office Websites (Extended Search)

Demand Response Demand Response Quick Assessment Tool (DRQAT) DER-CAM Design Intent Tool Distributed Energy DOE-2...


A-Z Index  

NLE Websites -- All DOE Office Websites (Extended Search)

China Energy Group Climate Combustion Technologies Group Commercial Buildings Commercial Buildings Communications Office Contact Us Cookstove Efficiency and Emissions Testing...


A-Z Index  

NLE Websites -- All DOE Office Websites (Extended Search)

BATT Fabrication Laboratory Batteries and Fuel Cells Building Controls Virtual Test Bed Building Technology and Urban Systems Buildings Energy Efficiency...


A-Z Index  

NLE Websites -- All DOE Office Websites (Extended Search)

Electricity Grid Electricity Markets Electricity Reliability Electrochemical Technologies Group Electronics, Lighting and Networks Group Energy Analysis Energy Analysis and...


A-Z Index  

NLE Websites -- All DOE Office Websites (Extended Search)

Productivity High Technology and Industrial Systems Home Energy Saver for Consumers Home Energy Saver for Professionals...


miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



The Role of Friction Stir Welding on the Microstructure and Mechanical Properties of AZ31B-H24 Mg alloy  

Science Conference Proceedings (OSTI)

In this study, an attempt was made to join AZ31B magnesium alloy by friction stir welding (FSW) process. A single tool with cylindrical screw threaded pin was used to investigate the effect of welding parameters on microstructure and mechanical properties of stir zone (SZ). Several welds were made at different rotational ({omega}) and traverse ({upsilon}) speeds, while the {omega}/{upsilon} ratios were kept constant. The optical and scanning electron microscopy were used to study the variation of microstructure across the welds. Moreover, micro-hardness and tensile tests were carried out to evaluate the mechanical properties of joints. It was found that {omega} plays more significant role on the resulted grain structure than {upsilon}, and at a constant {omega}/{upsilon} ratio, decreasing rotational speed decreased the size of grains, and hence, improved the hardness value and the tensile strength of the SZ.

Darzi, Kh.; Saeid, T. [Advanced Materials Research Center - Faculty of Materials Engineering, Sahand University of Technology - Tabriz (Iran, Islamic Republic of)



Time-Temperature-Transformation Study of Simulated Hanford Tank Waste (AZ-101) and Optimization of Glass Formulation for Processing Such Waste  

SciTech Connect

This paper presents the current results of a study for the optimization of the quality of the wasteform to be produced by vitrification of Hanford High Level Waste (HLW). A simulant of the content of Hanford Tank AZ-101 has been used for the experiments. A first phase of the research focused on the wasteform composition and showed that a high quality and chemical-resistant wasteform can be formed incorporating 60 weight % of dried waste into a borosilicate glass enriched with zinc oxide and boric acid and provided some indication about the heat treatment of the melt. A second phase of the study, still in progress, refines these findings. A detailed crystallinity survey of the waste form after various heat treatments has been performed, culminating in the development of a time-temperature-transformation (TTT) diagram. The results of the first phase of research and preliminary results from the second phase are described.

Ramsey, W. G.; Kauffman, B. M.; Bricka, M.; Meaker, T. F.; Giordana, A.; Smith, J. D.; Miller, F. S.; Bohannan, E.; Powell, J.; Reich, M.; Jordan, J.; Venter, L.; Barletta, R. E.; Ramsey, A. A.; Maise, G. M.; Manowitz, B.; Steinberg, M.; Salzano, F.



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)



Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Other Participants 1992 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

, Sparks , NV Gateway High School , Monroeville , PA Grant High School, Portland , OR Hanford High School , Richland , WA Harrison High School , Farmington Hills , MI Henry M....



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



Better Buildings Neighborhood Program: San Jose  

NLE Websites -- All DOE Office Websites (Extended Search)

San Jose to San Jose to someone by E-mail Share Better Buildings Neighborhood Program: San Jose on Facebook Tweet about Better Buildings Neighborhood Program: San Jose on Twitter Bookmark Better Buildings Neighborhood Program: San Jose on Google Bookmark Better Buildings Neighborhood Program: San Jose on Delicious Rank Better Buildings Neighborhood Program: San Jose on Digg Find More places to share Better Buildings Neighborhood Program: San Jose on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Jose, California San Jose Leverages Partnerships to Improve Low-Income Households' Energy

Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Wind Program: Stakeholder Engagement and Outreach  

Wind Powering America (EERE)

Outreach Outreach Printable Version Bookmark and Share The Stakeholder Engagement and Outreach initiative of the U.S. Department of Energy's Wind Program is designed to educate, engage, and enable critical stakeholders to make informed decisions about how wind energy contributes to the U.S. electricity supply. Highlights Resources Wind Resource Maps State Activities What activities are happening in my state? AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Installed wind capacity maps. Features A image of a house with a residential-scale small wind turbine. Small Wind for Homeowners, Farmers, and Businesses Stakeholder Engagement & Outreach Projects


Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012


Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central


Better Buildings Neighborhood Program: Maine - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- SEP to - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Maine - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Maine - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Maine - SEP on Google Bookmark Better Buildings Neighborhood Program: Maine - SEP on Delicious Rank Better Buildings Neighborhood Program: Maine - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Maine - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Maine - SEP Maine Makes Multifamily Units Energy-Efficient and Cost-Effective


Better Buildings Neighborhood Program: Seattle, Washington  

NLE Websites -- All DOE Office Websites (Extended Search)

Seattle, Seattle, Washington to someone by E-mail Share Better Buildings Neighborhood Program: Seattle, Washington on Facebook Tweet about Better Buildings Neighborhood Program: Seattle, Washington on Twitter Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Google Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Delicious Rank Better Buildings Neighborhood Program: Seattle, Washington on Digg Find More places to share Better Buildings Neighborhood Program: Seattle, Washington on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA


Better Buildings Neighborhood Program: San Diego  

NLE Websites -- All DOE Office Websites (Extended Search)

Diego to Diego to someone by E-mail Share Better Buildings Neighborhood Program: San Diego on Facebook Tweet about Better Buildings Neighborhood Program: San Diego on Twitter Bookmark Better Buildings Neighborhood Program: San Diego on Google Bookmark Better Buildings Neighborhood Program: San Diego on Delicious Rank Better Buildings Neighborhood Program: San Diego on Digg Find More places to share Better Buildings Neighborhood Program: San Diego on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Diego County, California Energy Upgrade California Motivates Home Improvements in San Diego County


Better Buildings Neighborhood Program: Alabama - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Alabama - Alabama - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Alabama - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Alabama - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Google Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Delicious Rank Better Buildings Neighborhood Program: Alabama - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Alabama - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Alabama - SEP Alabama Program Takes a Dual Approach to Energy Efficiency Upgrades


Better Buildings Neighborhood Program: Virginia - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Virginia - Virginia - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Virginia - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Virginia - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Google Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Delicious Rank Better Buildings Neighborhood Program: Virginia - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Virginia - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Virginia - SEP Virginia's Regional Energy Alliances Help Forge a State Program for


Better Buildings Neighborhood Program: Austin, Texas  

NLE Websites -- All DOE Office Websites (Extended Search)

Austin, Texas Austin, Texas to someone by E-mail Share Better Buildings Neighborhood Program: Austin, Texas on Facebook Tweet about Better Buildings Neighborhood Program: Austin, Texas on Twitter Bookmark Better Buildings Neighborhood Program: Austin, Texas on Google Bookmark Better Buildings Neighborhood Program: Austin, Texas on Delicious Rank Better Buildings Neighborhood Program: Austin, Texas on Digg Find More places to share Better Buildings Neighborhood Program: Austin, Texas on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Austin, Texas Austin Energy Accelerates Residential and Multifamily Efficiency Upgrades


Better Buildings Neighborhood Program: Michigan - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Michigan - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Michigan - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Google Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Delicious Rank Better Buildings Neighborhood Program: Michigan - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Michigan - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Michigan - SEP Better Buildings Means Better Business for Michigan


Better Buildings Neighborhood Program: Toledo, Ohio  

NLE Websites -- All DOE Office Websites (Extended Search)

Toledo, Ohio Toledo, Ohio to someone by E-mail Share Better Buildings Neighborhood Program: Toledo, Ohio on Facebook Tweet about Better Buildings Neighborhood Program: Toledo, Ohio on Twitter Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Google Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Delicious Rank Better Buildings Neighborhood Program: Toledo, Ohio on Digg Find More places to share Better Buildings Neighborhood Program: Toledo, Ohio on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Toledo, Ohio A Broad Approach to Energy Efficiency in Northwest Ohio



Gasoline and Diesel Fuel Update (EIA)

LNG Imports LNG Imports Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming



Gasoline and Diesel Fuel Update (EIA)

Specific LNG Terminals Specific LNG Terminals Generic LNG Terminals Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Specific LNG Terminals Generic LNG Terminals Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana


Origins of the extragalactic background at 1mm from a combined analysis of the AzTEC and MAMBO data in GOODS-N  

E-Print Network (OSTI)

We present a study of the cosmic infrared background, which is a measure of the dust obscured activity in all galaxies in the Universe. We venture to isolate the galaxies responsible for the background at 1mm; with spectroscopic and photometric redshifts we constrain the redshift distribution of these galaxies. We create a deep 1.16mm map (sigma ~ 0.5mJy) by combining the AzTEC 1.1mm and MAMBO 1.2mm datasets in GOODS-N. This combined map contains 41 secure detections, 13 of which are new. By averaging the 1.16mm flux densities of individually undetected galaxies with 24um flux densities > 25uJy, we resolve 31--45 per cent of the 1.16mm background. Repeating our analysis on the SCUBA 850um map, we resolve a higher percentage (40--64 per cent) of the 850um background. A majority of the background resolved (attributed to individual galaxies) at both wavelengths comes from galaxies at z > 1.3. If the ratio of the resolved submillimeter to millimeter background is applied to a reasonable scenario for the origins o...

Penner, Kyle; Chapin, Edward L; Greve, Thomas R; Bertoldi, Frank; Brodwin, Mark; Chary, Ranga-Ram; Conselice, Christopher J; Coppin, Kristen; Giavalisco, Mauro; Hughes, David H; Ivison, Rob J; Perera, Thushara; Scott, Douglas; Scott, Kimberly; Wilson, Grant



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

2 2 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

4 4 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT



Science Conference Proceedings (OSTI)

This document provides the final report on data and results obtained from a series of nine tests performed on the one-third scale DuraMelter{trademark} 1200 (DM1200) HLW Pilot Melter system that has been installed at VSL with an integrated prototypical off-gas treatment system. That system has replaced the DM1000 system that was used for HLW throughput testing during Part B1 [1]. Both melters have similar melt surface areas (1.2 m{sup 2}) but the DM1200 is prototypical of the present RPP-WTP HLW melter design whereas the DM1000 was not. These tests were performed under a corresponding RPP-WTP Test Specification and associated Test Plans. The nine tests reported here were preceded by an initial series of short-duration tests conducted to support the start-up and commissioning of this system. This report is a followup to the previously issued Preliminary Data Summary Reports. The DM1200 system was deployed for testing and confirmation of basic design, operability, flow sheet, and process control assumptions as well as for support of waste form qualification and permitting. These tests include data on processing rates, off-gas treatment system performance, recycle stream compositions, as well as process operability and reliability. Consequently, this system is a key component of the overall HLW vitrification development strategy. The primary objective of the present series of tests was to determine the effects of a variety of parameters on the glass production rate in comparison to the RPP-WTP HL W design basis of 400 kg/m{sup 2}/d. Previous testing on the DMIOOO system [1] concluded that achievement of that rate with simulants of projected WTP melter feeds (AZ-101 and C-106/AY-102) was unlikely without the use of bubblers. As part of those tests, the same feed that was used during the cold-commissioning of the West Valley Demonstration Project (WVDP) HLW vitrification system was run on the DM1000 system. The DM1000 tests reproduced the rates that were obtained at the larger WVDP facility, lending confidence to the tests results [1]. Since the inclusion or exclusion of a bubbler has significant design implications, the Project commissioned further tests to address this issue. In an effort to identify factors that might increase the glass production rate for projected WTP melter feeds, a subsequent series of tests was performed on the DM100 system. Several tests variables led to glass production rate increases to values significantly above the 400 kg/m2/d requirement. However, while small-scale melter tests are useful for screening relative effects, they tend to overestimate absolute glass production rates, particularly for un-bubbled tests. Consequently, when scale-up effects were taken into account, it was not clear that any of the variables investigated would conclusively meet the 400 kg/m{sup 2}/d requirement without bubbling. The present series of tests was therefore performed on the DM1200 one-third scale HLW pilot melter system to provide the required basis for a final decision on whether bubblers would be included in the HLW melter. The present tests employed the same AZ-101 waste simulant and glass composition that was used for previous testing for consistency and comparability with the results from the earlier tests.




Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A




SciTech Connect

This report documents melter and off-gas performance results obtained on the DM1200 HLW Pilot Melter during processing of AZ-101 HLW simulants. The tests reported herein are a subset of six tests from a larger series of tests described in the Test Plan for the work; results from the other tests have been reported separately. The solids contents of the melter feeds were based on the WTP baseline value for the solids content of the feeds from pretreatment which changed during these tests from 20% to 15% undissolved solids resulting in tests conducted at two feed solids contents. Based on the results of earlier tests with single outlet 'J' bubblers, initial tests were performed with a total bubbling rate of 651 pm. The first set of tests (Tests 1A-1E) addressed the effects of skewing this total air flow rate back and forth between the two installed bubblers in comparison to a fixed equal division of flow between them. The second set of tests (2A-2D) addressed the effects of bubbler depth. Subsequently, as the location, type and number of bubbling outlets were varied, the optimum bubbling rate for each was determined. A third (3A-3C) and fourth (8A-8C) set of tests evaluated the effects of alternative bubbler designs with two gas outlets per bubbler instead of one by placing four bubblers in positions simulating multiple-outlet bubblers. Data from the simulated multiple outlet bubblers were used to design bubblers with two outlets for an additional set of tests (9A-9C). Test 9 was also used to determine the effect of small sugar additions to the feed on ruthenium volatility. Another set of tests (10A-10D) evaluated the effects on production rate of spiking the feed with chloride and sulfate. Variables held constant to the extent possible included melt temperature, plenum temperature, cold cap coverage, the waste simulant composition, and the target glass composition. The feed rate was increased to the point that a constant, essentially complete, cold cap was achieved, which was used as an indicator of a maximized feed rate for each test. The first day of each test was used to build the cold cap and decrease the plenum temperature. The remainder of each test was split into two- to six-day segments, each with a different bubbling rate, bubbler orientation, or feed concentration of chloride and sulfur.



Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


AZ CO2 Storage Pilot  

NLE Websites -- All DOE Office Websites (Extended Search)

CO2 Storage Pilot Regional Carbon Sequestration Partnerships Initiative Review Meeting Pittsburgh, Pennsylvania October 7, 2008 John Henry Beyer, Ph.D. WESTCARB Program Manager, Geophysicist 510-486-7954, jhbeyer@lbl.gov Lawrence Berkeley National Laboratory Earth Sciences Division, MS 90-1116 Berkeley, CA 94720 2 WESTCARB region has major CO2 point sources 3 WESTCARB region has many deep saline formations - candidates for CO2 storage WESTCARB also created GIS layers for oil/gas fields and deep coal basins Source: DOE Carbon Sequestration Atlas of the United States and Canada 4 - Aspen Environmental - Bevilacqua-Knight, Inc. Arizona Utilities CO2 Storage Pilot Contracting and Funding Flow Department of Energy National Energy Technology Laboratory Lawrence Berkeley National


State Laboratory Contact Information AZ  

Science Conference Proceedings (OSTI)

... David Pfahler Brad Stover ... Joe Benavides Harvey Fischer Daniel Gibbons Preston Adachi Philip Wright Shauna Pereiro Lisa Corn Pat Sanders ...




SciTech Connect

This manual contains the radiological control requirements to be used for all radiological activities conducted by programs under the purview of the U.S. Department of Energy (DOE), National Nuclear Security Administration Nevada Site Office (NNSA/NSO) and the Yucca Mountain Office of Repository Development (YMORD). Compliance with these requirements will ensure compliance with Title 10 Code of Federal Regulations Part 835 (10 CFR 835), Occupational Radiation Protection. Programs covered by this manual are located at the Nevada Test Site (NTS); Nellis Air Force Base and North Las Vegas, Nevada; Santa Barbara and Pleasanton, California; and at Andrews Air Force Base, Maryland. In addition, field work by NNSA/NSO at other locations is also covered by this manual.




DRI Renewable Energy Center (REC) (NV)  

Science Conference Proceedings (OSTI)

The primary objective of this project was to utilize a flexible, energy-efficient facility, called the DRI Renewable Energy Experimental Facility (REEF) to support various renewable energy research and development (R&D) efforts, along with education and outreach activities. The REEF itself consists of two separate buildings: (1) a 1200-ft2 off-grid capable house and (2) a 600-ft2 workshop/garage to support larger-scale experimental work. Numerous enhancements were made to DRI's existing renewable power generation systems, and several additional components were incorporated to support operation of the REEF House. The power demands of this house are satisfied by integrating and controlling PV arrays, solar thermal systems, wind turbines, an electrolyzer for renewable hydrogen production, a gaseous-fuel internal combustion engine/generator set, and other components. Cooling needs of the REEF House are satisfied by an absorption chiller, driven by solar thermal collectors. The REEF Workshop includes a unique, solar air collector system that is integrated into the roof structure. This system provides space heating inside the Workshop, as well as a hot water supply. The Workshop houses a custom-designed process development unit (PDU) that is used to convert woody biomass into a friable, hydrophobic char that has physical and chemical properties similar to low grade coal. Besides providing sufficient space for operation of this PDU, the REEF Workshop supplies hot water that is used in the biomass treatment process. The DRI-REEF serves as a working laboratory for evaluating and optimizing the performance of renewable energy components within an integrated, residential-like setting. The modular nature of the system allows for exploring alternative configurations and control strategies. This experimental test bed is also highly valuable as an education and outreach tool both in providing an infrastructure for student research projects, and in highlighting renewable energy features to the public.

Hoekman, S. Kent; Broch, Broch; Robbins, Curtis; Jacobson, Roger; Turner, Robert



len Jr. Bl!ukr.'.lrd NV  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

some time. For example, Southen has been collaborating with DOE on an Integrated Distribution Management System ("IDMS") since 2005. IDMS began as a demonstration project on how...


PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab




SciTech Connect

This report documents melter and off-gas performance results obtained on the DM1200 HLW Pilot Melter during processing of AZ-101 and C-106/AY-102 HLW simulants. The tests reported herein are a subset of three tests from a larger series of tests described in the Test Plan for the work; results from the remaining tests will be reported separately. Three nine day tests, one with AZ-101 and two with C-106/AY-102 feeds were conducted with variable amounts of added sugar to address the effects of redox. The test with AZ-101 included ruthenium spikes to also address the effects of redox on ruthenium volatility. One of tests addressed the effects of increased flow-sheet nitrate levels using C-106/AY-102 feeds. With high nitrate/nitrite feeds (such as WTP LAW feeds), reductants are required to prevent melt foaming and deleterious effects on glass production rates. Sugar is the baseline WTP reductant for this purpose. WTP HLW feeds typically have relatively low nitrate/nitrite content in comparison to the organic carbon content and, therefore, have typically not required sugar additions. However, HLW feed variability, particularly with respect to nitrate levels, may necessitate the use of sugar in some instances. The tests reported here investigate the effects of variable sugar additions to the melter feed as well as elevated nitrate levels in the waste. Variables held constant to the extent possible included melt temperature, bubbling rate, plenum temperature, cold cap coverage, the waste simulant composition, and the target glass composition. The principal objectives of the DM1200 melter testing were to determine the achievable glass production rates for simulated HLW feeds with variable amounts of added sugar and increased nitrate levels; characterize melter off-gas emissions; characterize the performance of the prototypical off-gas system components as well as their integrated performance; characterize the feed, glass product, and off-gas effluents; and perform pre- and post test inspections of system components. The specific objectives (including test success criteria) of this testing, along with how each objective was met, are outlined in a table.




Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Corrective Action Investigation Plan for Corrective Action Unit 500: Test Cell A Septic System, Nevada Test Site, Nevada, Revision 0, DOE/NV--528 UPDATED WITH TECHNICAL CHANGE No.1  

DOE Green Energy (OSTI)

This Corrective Action Investigation Plan (CAIP) addresses one of three leachfield systems associated with Test Cell A, which is located in Area 25 at the Nevada Test Site (NTS). The NTS is approximately 105 kilometers (km) (65 miles [mi]) northwest of Las Vegas, Nevada (see Leachfield Work Plan Figure 1-1). Corrective Action Unit 500 is comprised of the Test Cell A Septic System (CAS 25-04-05) and the associated leachfield system presented in Figure 1-1 (FFACO, 1996). The leachfield is located 60 meters (m) (200 feet [ft]) southeast of the Building 3124 gate, and approximately 45 m (150 ft) southwest of Building 3116 at Test Cell A. Test Cell A operated during the 1960s to support nuclear rocket reactor testing as part of the Nuclear Rocket Development Station (NRDS) (SNPO, 1970). Various operations within Buildings 3113B (Mechanical Equipment Room), 3115 (Helium Compressor Station), 3116 (Pump House), a water tank drain and overflow, a ''yard and equipment drain system'' outside of Building 3116, and a trailer have resulted in potentially hazardous effluent releases to the leachfield system (DOE, 1988a). The leachfield system components include discharge lines, manways, a septic tank, an outfall line, a diversion chamber, and a 15 by 30 m (50 by 100 ft) leachfield (see Leachfield Work Plan Figure 3-1 for explanation of terminology). In addition, engineering drawings show an outfall system that may or may not be connected to the CAU 500 leachfield. In general, effluent contributed to the leachfield was sanitary wastewater associated with floor drains, toilet and lavatory facilities in Building 3113B and floor drains in the remaining source buildings. The surface and subsurface soils in the vicinity of the collection system, outfall, and leachfield may have been impacted by effluent containing contaminants of potential concern (COPCs) generated by support activities associated with Test Cell A reactor testing operations.





Science Conference Proceedings (OSTI)

The principal objectives of the DM1200 melter tests were to determine the effects of feed rheology, feed solid content, and bubbler configuration on glass production rate and off-gas system performance while processing the HLW AZ-101 and C-106/AY-102 feed compositions; characterize melter off-gas emissions; characterize the performance of the prototypical off-gas system components, as well as their integrated performance; characterize the feed, glass product, and off-gas effluents; and perform pre- and post test inspections of system components. The specific objectives (including test success criteria) of this testing, along with how each objective was met, are outlined in a table. The data provided in this Final Report address the impacts of HLW melter feed rheology on melter throughput and validation of the simulated HLW melter feeds. The primary purpose of this testing is to further validate/verify the HLW melter simulants that have been used for previous melter testing and to support their continued use in developing melter and off-gas related processing information for the Project. The primary simulant property in question is rheology. Simulants and melter feeds used in all previous melter tests were produced by direct addition of chemicals; these feed tend to be less viscous than rheological the upper-bound feeds made from actual wastes. Data provided here compare melter processing for the melter feed used in all previous DM100 and DM1200 tests (nominal melter feed) with feed adjusted by the feed vendor (NOAH Technologies) to be more viscous, thereby simulating more closely the upperbounding feed produced from actual waste. This report provides results of tests that are described in the Test Plan for this work. The Test Plan is responsive to one of several test objectives covered in the WTP Test Specification for this work; consequently, only part of the scope described in the Test Specification was addressed in this particular Test Plan. For the purpose of comparison, the tests reported here were performed with AZ-102 and C-106/AY-102 HLW simulants and glass compositions that are essentially the same as those used for recent DM1200 tests. One exception was the use of an alternate, higher-waste-loading C-106/AY-102 glass composition that was used in previous DM100 tests to further evaluate the performance of the optimized bubbler configuration.




Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah




Science Conference Proceedings (OSTI)

This document provides the final report on data and results obtained from commissioning tests performed on the one-third scale DuraMelter{trademark} 1200 (DM 1200) HLW Pilot Melter system that has been installed at VSL with an integrated prototypical off-gas treatment system. That system has replaced the DM1000 system that was used for HLW throughput testing during Part BI [1]. Both melters have similar melt surface areas (1.2 m{sup 2}) but the DM1200 is prototypical of the present RPP-WTP HLW melter design whereas the DM1000 was not. These tests were performed under a corresponding RPP-WTP Test Specification and associated Test Plan. This report is a followup to the previously issued Preliminary Data Summary Report. The DM1200 system will be used for testing and confirmation of basic design, operability, flow sheet, and process control assumptions as well as for support of waste form qualification and permitting. This will include data on processing rates, off-gas treatment system performance, recycle stream compositions, as well as process operability and reliability. Consequently, this system is a key component of the overall HLW vitrification development strategy. The results presented in this report are from the initial series of short-duration tests that were conducted to support the start-up and commissioning of this system prior to conducting the main body of development tests that have been planned for this system. These tests were directed primarily at system 'debugging,' operator training, and procedure refinement. The AZ-101 waste simulant and glass composition that was used for previous testing was selected for these tests.



Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



1) Under the tool bar has a  

E-Print Network (OSTI)

(Xcel: 30% by 2020) TX: 5,880 MW by 2015 AZ: 15% by 2025 CA: 20% by 2010 *NV: 20% by 2015 ME: 30 and shuts down. The automated protection system restores connections to the areas that had lost power The automated protection system restores connections. Too few seconds have passed for the control center to act

Boisvert, Jeff


U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

1 Regional maps Figure F4. Oil and gas supply model regions Figure F4. Oil and Gas Supply Model Regions Atlantic WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA...


Disparities in Health Insurance and Access to Care for Residents Across U.S. Cities  

E-Print Network (OSTI)

High Rates of Uninsurance El Paso, TX Jersey City, NJ LosHigh Rates of Uninsurance El Paso, TX Jersey City, NJ LosNJ Las Vegas, NVAZ Salt Lake City, UT Charlotte, NCSC MSAs with High Rates

Brown, E. Richard; Wyn, Roberta; Teleki, Stephanie




Science Conference Proceedings (OSTI)

This report provides data, analyses, and conclusions from a series of tests that were conducted at the Vitreous State Laboratory of The Catholic of America (VSL) to determine the processing rates that are achievable with AZ-101 HLW simulants and corresponding melter feeds on a DuraMelter 100 (DM100) vitrification system. One of the most critical pieces of information in determining the required size of the RPP-WTP HLW melter is the specific glass production rate in terms of the mass of glass that can be produced per unit area of melt surface per unit time. The specific glass production rate together with the waste loading (essentially, the ratio of waste-in to glass-out, which is determined from glass formulation activities) determines the melt area that is needed to achieve a given waste processing rate with due allowance for system availability. Tests conducted during Part B1 (VSL-00R2590-2) on the DM1000 vitrification system installed at the Vitreous State Laboratory of The Catholic University of America showed that, without the use of bubblers, glass production rates with AZ-101 and C-106/AY-102 simulants were significantly lower than the Project design basis rate of 0.4 MT/m{sup 2}/d. Conversely, three-fold increases over the design basis rate were demonstrated with the use of bubblers. Furthermore, an un-bubbled control test using a replica of the melter feed used in cold commissioning tests at West Valley reproduced the rates that were observed with that feed on the WVDP production melter. More recent tests conducted on the DM1200 system, which more closely represents the present RPP-WTP design, are in general agreement with these earlier results. Screening tests conducted on the DM10 system have provided good indications of the larger-scale processing rates with bubblers (for both HL W and LAW feeds) but significantly overestimated the DM1000 un-bubbled rate observed for C-106/AY-102 melter feeds. This behavior is believed to be a consequence of the role of heat transfer in rate attainment and the much greater role of wall effects in heat transfer when the melt pool is not agitated. The DM100 melter used for the present tests has a surface area of 0.108 m{sup 2}, which is approximately 5 times larger than that of the DM10 (0.021 m{sup 2}) and approximately 11 times smaller than that of the DM1000 (1.2 m{sup 2}) (the DM1000 has since been replaced by a pilot-scale prototypical HLW melter, designated the DM1200, which has the same surface area as the DM1000). Testing on smaller melters is the most economical method for obtaining data over a wide range of operating conditions (particularly at extremes) and for guiding the more expensive tests that are performed at pilot-scale. Thus, one objective of these tests was to determine whether the DM100 melters are sufficiently large to reproduce the un-bubbled melt rates observed at the DM1000 scale, or to determine the extent of any off-set. DM100-scale tests can then be used to screen feed chemistry variations that may serve to increase the un-bubbled production rates prior to confirmation at pilot scale. Finally, extensive characterization data obtained on simulated HLW melter feeds formed from various glass forming additives indicated that there may be advantages in terms of feed rheology and stability to the replacement of some of the hydroxides by carbonates. A further objective of the present tests was therefore to identify any deleterious processing effects of such a change before adopting the carbonate feed as the baseline. Data from the WVDP melter using acidified (nitrated) feeds, and without bubbling, showed productions rates that are higher than those observed with the alkaline RPP feeds at the VSL. Therefore, the effect of feed acidification on production rate also was investigated. This work was performed under Test Specification, 'TSP-W375-00-00019, Rev 0, 'HLW-DM10 and DM100 Melter Tests' dated November 13, 2000 and the corresponding Test Plan. It should be noted, however, that the RPP-WTP Project directed a series of changes to the Test Plan as the result





NLE Websites -- All DOE Office Websites (Extended Search)

POWGEN POWGEN E XPERIMENT Before y ou a rrive/Send y our s amples: 1. C onfirmation: The c onfirmation o f a ll r elevant i nformation f or y our b eamtime i s d one t hrough o ur I ntegrated Proposal T racking S ystem ( IPTS: h ttp://www.ornl.gov/sci/iums/ipts/). B efore a rriving f or b eamtime, you w ill n eed t o c onfirm 1 ) L ab n eeds, 2 ) S amples, 3 ) S ample E nvironment, 4 ) S afety a nd 4 ) Experiment t ime. This i s y our f inal c hance t o e nter t he c orrect s ample i nformation a nd a nything t hat i s n ot c onfirmed cannot b e m easured d uring y our b eamtime. A dding s imilar s amples a s s tated i n y our p roposal w ill most l ikely t rigger n o a dditional r eview. H owever, r emember i f y ou a re e ntering d rastically d ifferent samples f rom y our a pproved p roposal t hey w ill g o t hrough a f urther a pproval a nd


DIPLOMAMUNKA Az RkpK fehrje termeltetse  

E-Print Network (OSTI)

.................................................................................5 1.3.3. A nif és fix gének


EV Project Chevrolet Volt Vehicle Summary Report  

NLE Websites -- All DOE Office Websites (Extended Search)

events (mi) 25.8 Avg number of charging events per day when the vehicle was driven 1.4 EV Project Chevrolet Volt Vehicle Summary Report Region: Phoenix, AZ Metropolitan Area...


Buildings Energy Data Book: 3.9 Educational Facilities  

Buildings Energy Data Book (EERE)

6 6 2010 Regional New Construction and Renovations Expenditures for Public K-12 Schools ($Million) Region New Schools Additions Renovation Total Region 1 (CT, MA, ME, NH, RI, VT) Region 2 (NJ, NY, PA) Region 3 (DE, MD, VA, WV) Region 4 (KY, NC, SC, TN) Region 5 (AL, FL, GA, MS) Region 6 (IN, MI, OH) Region 7 (IL, MN, WI) Region 8 (IA, KS, MO, NE) Region 9 (AR, LA, OK, TX) Region 10 (CO, MT, ND, NM, SD, UT, WY) Region 11 (AZ, CA, HI, NV) Region 12 (AK, ID, OR, WA) Total Source(s): School Planning & Management, 16th Annual School Construction Report, Feb. 2011 p. CR3 8,669.5 3,074.1 2,796.8 14,540.4 1,605.4 407.3 275.2 2,287.9 258.2 181.8 158.1 598.1 1,653.9 479.6 387.8 2,521.2 548.2 130.9 93.3 772.4 309.3 206.1 135.3 650.7 217.6 231.4 187.8 636.8 1,338.0 327.6 175.9 1,841.4 359.6 286.3 278.9 924.8



Gasoline and Diesel Fuel Update (EIA)

1 1 55 0 2 4 6 8 10 Residential Onsystem Commercial Onsystem Industrial Onsystem Vehicle Fuel Electric Utilities Dollars per Thousand Cubic Feet 0 30 60 90 120 150 180 210 240 270 300 330 Dollars per Thousand Cubic Meters 1997 1998 1999 2000 2001 25. Average Price of Natural Gas Delivered to Consumers in the United States, 1997-2001 Figure Note: Prices are calculated from onsystem sales. Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition" and Federal Energy Regulatory Commission (FERC), Form FERC- 423, "Monthly Report of Cost and Quality of Fuels for Electric Plants." Energy Information Administration / Natural Gas Annual 2001 56 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Mexico Trinidad Canada Canada Nigeria Oman Qatar Trinidad Gulf of Mexico Gulf of Mexico Gulf of Mexico Canada Trinidad Trinidad Gulf of Mexico Malaysia 13,623 Figure 8. Interstate Movements of Natural Gas in the United States, 2003 (Million Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Energy Information Administration / Natural Gas Annual 2003 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 366,224 655,731 666,614 633,960 144,284 43,869 536,776 63,133 36,848



Gasoline and Diesel Fuel Update (EIA)

6 6 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 27. Average City Gate Price of Natural Gas in the United States, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Energy Information Administration (EIA), Form EIA-857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Constant dollars: Prices were converted to 2001 dollars using the chain-type


Residential Demand Module  

Gasoline and Diesel Fuel Update (EIA)

and clothes drying. In addition to the major equipment-driven and clothes drying. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric Energy Information Administration/Assumptions to the Annual Energy Outlook 2006 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Figure 5. United States Census Divisions Source:Energy Information Administration,Office of Integrated Analysis and Forecasting. Report #:DOE/EIA-0554(2006) Release date: March 2006


AEOSup ltr to Dear Customer  

Gasoline and Diesel Fuel Update (EIA)

WA WA OR CA ID NV UT AZ NM CO WY MT ND SD NE KS OK TX MN IA MO AR LA WI IL KY IN OH WV TN MS AL GA SC NC VA PA NY VT ME NH MA RI CT NJ DE MD D.C. FL MI Electricity Supply Regions 1 ECAR 2 ERCOT 3 MAAC 4 MAIN 5 MAPP 6 NY 7 NE 8 FL 9 STV 10 SPP 11 NWP 12 RA 13 CNV 13 11 12 2 10 5 9 8 1 6 7 3 AK 15 14 H I 14 AK 15 H I Figure 2. Electricity Market Module (EMM) Regions 1. ECAR = East Central Area Reliability Coordination Agreement 2. ERCOT = Electric Reliability Council of Texas 3. MACC = Mid-Atlantic Area Council 4. MAIN = Mid-America Interconnected Network 5. MAPP = Mid-Continent Area Power Pool 6. NY = Northeast Power Coordinating Council/ New York 7. NE = Northeast Power Coordinating Council/ New England 8. FL = Southeastern Electric Reliability Council/ Florida 9. STV = Southeastern Electric Reliability Council /excluding Florida 10. SPP


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2013 Annual Energy Outlook 2013 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2013



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value


DOE/EIA-0131(96) Distribution Category/UC-960 Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

ID ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Interstate Movements of Natural Gas in the United States, 1996 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL KY (T) MA ME (T) AL LA MA NH (T) AL MO (T) MA NJ (T) AL SC MD DC CT RI RI MA DE MD VA DC MA CT (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 906,407 355,260 243,866 220 384,311 576,420 823,799 842,114 27,271 126,012 133 602,841 266 579,598 16,837 268,138 48,442 182,511 219,242 86,897 643,401 619,703 8,157 937,806 292,711 869,951 12,316 590,493 118,256


Microsoft Word - Figure_14_15.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 360 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Figure 14. Average Price of Natural Gas Delivered to Residential Consumers, 1980-2004 Figure 15. Average City Gate Price of Natural Gas in the United States, 2004 (Dollars per Thousand Cubic Feet) Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." Constant dollars: Prices were converted to 2004 dollars using the chain-type price indexes for Gross Domestic Product


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act 2 Metric Tons Heavy Metal (MTHM) 3 Based on actual data through 2002 , as provided in the RW-859, and projected discharges for 2003-2010 which are rounded to two significant digits. Reflects trans-shipments as of end-2002. End of Year 2010 SNF & HLW Inventories 1 Approximately 64,000 MTHM 2 of Spent Nuclear Fuel (SNF) 3 & 275 High-Level Radioactive Waste (HLW) Canisters CT 1,900 TX 2,000 MD 1,200 VT 610 RI MT WY NE 790 SD ND OK KS 600 TX 2,000 LA 1,200 AR 1,200 IA 480 MN 1,100 WI 1,300 KY TN 1,500 MS 780 AL 3,000 GA 2,400 FL 2,900 NC 3,400 VA 2,400 WV OH 1,100 PA 5,800 ME 540 NJ 2,400 DE MI 2,500 MA 650 NH 480 IN SC 3,900 CO MO 670 IL 8,400 NY 3,300 CA 2,800 AZ 1,900 NM OR 360 NV UT WA 600 ID < 1 Commercial HLW 275 Canisters (~640 MTHM)



Gasoline and Diesel Fuel Update (EIA)

0.00-1.99 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1996 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1996 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: In 1996, consumption of natural gas for agricultural use

Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

18 18 Energy Information Administration / Natural Gas Annual 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 0 1 2 3 4 5 6 7 T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o A l a b a m a K a n s a s A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 1997 1998 1999 2000 2001 2001 16. Marketed Production of Natural Gas in Selected States, 1997-2001 Figure Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI



Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Australia Australia Trinidad Qatar Malaysia Canada Mexico Interstate Movements of Natural Gas in the United States, 1999 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL TX MA NH CT RI MD DC DE MD RI MA MA CT VA DC (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 837,902 415,636 225,138 232 308,214 805,614 803,034 800,345 685 147 628,589 9,786 790,088 17,369 278,302 40,727 214,076 275,629 51,935 843,280 826,638 9,988 998,603 553,440 896,187 11,817 629,551 98,423


Green Power Network: Can I Buy Green Power in My State?  

NLE Websites -- All DOE Office Websites (Extended Search)

Can I Buy Green Power in my State? Community Renewable Energy Development Consumer Protection Large Purchasers of Green Power Can I Buy Green Power in My State? Click on your state below to find out which organizations offer green power in your state. The results will include utility green pricing programs, retail green power products offered in competitive electricity markets, and renewable energy certificate (REC) products sold separate from electricity. For additional information about these distinct products, see our Overview of Green Power Markets. Map of the United States. AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Alabama Alaska Arizona Arkansas California Colorado Connecticut Connecticut Delaware Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Maryland Massachusetts Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Hampshire New Jersey New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Vermont Virginia Washington West Virginia Wisconsin Wyoming Washington, DC



Gasoline and Diesel Fuel Update (EIA)

Supply Supply 17 Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity


San Juan Montana Thrust Belt WY Thrust Belt Black Warrior  

U.S. Energy Information Administration (EIA) Indexed Site

San San Juan Montana Thrust Belt WY Thrust Belt Black Warrior Paradox - San Juan NW (2) Uinta- Piceance Paradox - San Juan SE (2) Florida Peninsula Appalachian- NY (1) Appalachian OH-PA (2) Appalachian Eastern PA (3) Appalachian Southern OH (4) Appalachian Eastern WV (5) Appalachian WV-VA (6) Appalachian TN-KY (7) Piceance Greater Green River Eastern OR-WA Ventura Williston Williston NE (2) Williston NW (1) Williston South (3) Eastern Great Basin Ventura West, Central, East Eastern OR-WA Eastern Great Basin Appalachian Denver Florida Peninsula Black Warrior W Y T h ru st B e lt Powder River Paradox- Uinta- Grtr Green River MT Thrust Belt Powder River North (1) Powder River South (2) Denver North (1) Denver South (3) Denver Middle (2) TX CA MT AZ ID NV NM CO IL OR UT KS WY IA NE SD MN ND OK FL WI MO AL WA GA AR LA MI IN PA NY NC MS TN KY VA OH SC


Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

TESTIMONY TESTIMONY STATEMENT OF JOHN C. LAYTON INSPECTOR GENERAL DEPARTMENT OF ENERGY BEFORE THE SUBCOMMITTEE ON OVERSIGHT AND INVESTIGATIONS UNITED STATES HOUSE OF REPRESENTATIVES 10:00 A.M. October 23, 1997 SUMMARY OF STATEMENT BY JOHN C. LAYTON The Office of Inspector General, Department of Energy (DOE), has identified deficiencies in the administration of performance-based contracts. For example, we found: Incentive fees were excessive in relation to the cost of the work. * An incentive fee of $225,000 was paid to replace a ventilation fan when the cost of this work for the year was only $25,000. Incentive fees were paid for work completed before the establishment of the performance objective. * A $776,000 incentive fee was paid for work completed on experiments before the


Nevada Environmental Restoration Project DOE/NV-368 Project Chariot...  

Office of Legacy Management (LM)

of cosmic rays to the background radiation field iraries with altitude and geomagnetic latitude. The earth's magnetic field traps some of the cosmic rays, I so a larger...


NNSA Network Vision (2NV) | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

version Facebook Twitter Youtube Flickr NNSA Blog October 2013 (1) September 2013 (18) August 2013 (17) July 2013 (20) June 2013 (19) May 2013 (25) April 2013 (17) March 2013...


NV Energy (Northern Nevada) - SureBet Business Energy Efficiency...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Equipment: 4 - 200 Ice Machines: 50 - 500 Commercial Custom Retrofit: 0.10kWh on peak; 0.05kWh off peak Air Cooled Units: 8 - 15ton, plus bonus efficiency...


NV Energy (Southern Nevada) - SureBet Business Energy Efficiency...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Equipment: 4 - 1,000 Ice Machines: 50 - 500 Commercial Custom Retrofit: 0.10kWh on peak; 0.05kWh off peak Air Cooled Units: 12 - 18ton, plus bonus efficiency...



E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


eb surface alloying of magnesium alloys az31 b and az91 d  

Science Conference Proceedings (OSTI)

Jul 20, 2012 ... If the price of this product displays as $0.00 for your customer category, you may download it for free. You must, however, add it to your cart and...


Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


APPENDIX A DISTRIBUTION LIST Federal Government Agencies Army Corps of Engineers, Sacramento District Headquarter Office  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DISTRIBUTION LIST Federal Government Agencies Army Corps of Engineers, Sacramento District Headquarter Office Engineering/Design Branch, Regulatory Branch, Planning Branch 1325 J Street, Room 1350 Sacramento, California 95814 Phone: (916) 557-5250 Fax: (916) 557-5306 Department of the Interior San Francisco Regional Office - AS, AZ, CA, CNMI, GU, HI, NV Ms. Patricia Sanderson Port Regional Environmental Officer Department of the Interior 333 Bush Street San Francisco, CA 94104 Phone: 415-296-3350 Email: patricia_port@ios.doi.gov Website: http://www.doi.gov/pmb/oepc/san-francisco.cfm EPA Region 9 - AS, AZ, CA, GU, HI, MP, NV Mr. Scott Sysum Department of Energy Reviewer Environmental Review Office Environmental Protection Agency


Microsoft Word - Figure_3_4.doc  

Gasoline and Diesel Fuel Update (EIA)

7 7 None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s A l a b a m a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2002 2003 2002 Figure 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2002-2003 Figure 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2003 (Million Cubic Feet) GOM = Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly and Annual Quantity and Value of Natural Gas Report," and the United States Mineral Management


Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

Natural Gas Marketed Production ",35,"Monthly","9/2013","1/15/1973" Natural Gas Marketed Production ",35,"Monthly","9/2013","1/15/1973" ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","ng_prod_whv_a_epg0_vgm_mmcf_m.xls" ,"Available from Web Page:","http://www.eia.gov/dnav/ng/ng_prod_whv_a_epg0_vgm_mmcf_m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"12/19/2013 6:54:27 AM" "Back to Contents","Data 1: Natural Gas Marketed Production " "Sourcekey","N9050US2","N9050FX2","N9050AL2","N9050AK2","N9050AZ2","N9050AR2","N9050CA2","N9050CO2","N9050FL2","N9050IL2","N9050IN2","N9050KS2","N9050KY2","N9050LA2","N9050MD2","N9050MI2","N9050MS2","N9050MO2","N9050MT2","N9050NE2","N9050NV2","N9050NM2","N9050NY2","N9050ND2","N9050OH2","N9050OK2","N9050OR2","N9050PA2","N9050SD2","N9050TN2","N9050TX2","N9050UT2","N9050VA2","N9050WV2","N9050WY2"



Gasoline and Diesel Fuel Update (EIA)

6 6 Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:

Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

0 0 Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 2000 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1996-2000 Figure T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a O t h e r S t a t e s 0 1 2 3 4 5 6 7 0 30 60 90 120 150 180 Trillion Cubic Feet Billion Cubic Meters 1996 1997 1998 1999 2000 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly


A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2012 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT...



Gasoline and Diesel Fuel Update (EIA)

176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY...


U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)




Science Conference Proceedings (OSTI)

Jul 20, 2012 ... If the price of this product displays as $0.00 for your customer category, you may download it for free. You must, however, add it to your cart and...


Nogales, AZ Liquefied Natural Gas Exports to Mexico  

Gasoline and Diesel Fuel Update (EIA)

250 282 2006-2012 Pipeline Prices 6.79 7.88 4.04 4.86 4.47 3.31 2006-2012 Liquefied Natural Gas Volumes 16 0 0 0 0 34 1998-2012 Liquefied Natural Gas Prices 15.27 -- -- -- --...


Dynamic Response of Magnesium Alloy AZ31B and Aluminum ...  

Science Conference Proceedings (OSTI)

Symposium, Measurements and Modeling of Advanced Automotive and Structural Materials at Intermediate and High Strain Rates. Presentation Title, Dynamic...


132- Microstructure and Composition Modifications in a Mg AZ80 ...  

Science Conference Proceedings (OSTI)

086- Improvement in Gas Tightness of YSZ Coatings Produced by Atmospheric Plasma ... 145- The Synergy of XRD and XRF in a Shale and Slate Analysis.


SME Annual Meeting Feb. 28-Mar. 03, 2010, Phoenix, AZ  

E-Print Network (OSTI)

-066 DESIGNING AND MODELING WIRELESS MESH COMMUNICATIONS IN UNDERGROUND COAL MINES K. R. Griffin, Virginia Tech recent regulatory developments in underground coal communication systems, the implementation of these new technologies were limited. After several coal mining accidents in early 2006, the United States Congress


SME Annual Meeting Feb. 28-Mar. 03, 2010, Phoenix, AZ  

E-Print Network (OSTI)

-090 DECREASED CARBON FOOTPRINT THROUGH EFFECTIVE COAL DEGASIFICATION S. Keim, Virginia Tech, Blacksburg, VA K industry sector. Specifically, the combustion of one ton of coal produces between one and three tons of carbon dioxide, dependent upon the carbon content and heating value of the combusted coal. Additionally


Nogales, AZ Liquefied Natural Gas Exports to Mexico  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Exports by Point of Exit (Volumes in Million Cubic Ft., Prices in Dollars per Thousand Cubic Ft.)


DOE Research and Development Accomplishments Site Index (A-Z...  

Office of Scientific and Technical Information (OSTI)

A - Z Index A B C D E F G H I J K L M N O P Q R S T U V W X Y Z A Abrikosov, Alexei Abrikosov, Alexei: Publications activated complex theory of reaction rates adenosine...


Anemometer Data (Wind Speed, Direction) for Pascua Yaqui, AZ...  

Open Energy Info (EERE)

Powering America, a DOE Office of Energy Efficiency & Renewable Energy (EERE) program. A dynamic map displaying all available data from DOE anemometer loan programs...


Improving Melt Cleanliness and Mechanical Properties of AZ91E ...  

Science Conference Proceedings (OSTI)

Conference Tools for COM 2011 ... Presenter/Author Tools ... that has been linked to changing weather patterns and other extreme weather phenomenon.


Corrosion Mechanism of Anodized AZ91D and Its Biological ...  

Science Conference Proceedings (OSTI)

... Templates Facilitates Neural Stem Cell Adhesion, Proliferation and Differentiation ... Improving the Resistance of Ceramic Surfaces to Biofilm Formation ... Sol-Gel Synthesis of Bio-Active Nanoporous Sodium Zirconate Coated on 316L...


DOI-BLM-NV-C010-2012-0070-CX | Open Energy Information  

Open Energy Info (EERE)

C010-2012-0070-CX C010-2012-0070-CX CX at Dixie Valley Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant US Navy Geothermal Program Office Geothermal Area Dixie Valley Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Magnetotelluric Methods, Reflection Survey Time Frame (days) Application Time 115 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Stillwater Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Application Date 4/30/2012 Revised Application Date 7/27/2012 Decision Document Date 8/23/2012 Relevant Numbers



Office of Legacy Management (LM)

0845 0845 IT U S VECAS LIBRARY UC-703 I?. DESERT RESEARCH INSTITUTE 3 I 'UNIVERSITY OF . ? .NEVADA SYSTEM Jenny B. Chapman Sam L. Hokett EVALUATION OF GROUNDWATER MONITORING AT O F F S m NUCLEAR TEST AREAS March 1991 WATER RESOURCES CENTER Publication #45085 DISCLAIMER Portions of this document may be illegible in electronic image products. Images are produced from the best available original document. EVALUATION OF GROUNDWATER MONITORING AT OFFSITE NUCLEAR TEST AREAS b-r Jenny B. Chapman Sam L Hokett Water Resources Center Desett Research Institute University of Nevada System Publication X45085 prepared for Nevada Operations Office U . S . :Department of Energy IAS Vegas, Nevada March 1991 The work upon which this report is based was supported by the U . S


Geothermal Prospecting using Hyperspectral Imaging and Field Observations, Dixie Meadows, NV  

DOE Green Energy (OSTI)

In an ongoing project to relate surface hydrothermal alteration to structurally controlled geothermal aquifers, we mapped a 16 km swath of the eastern front of the Stillwater Range using Hyperspectral fault and mineral mapping techniques. The Dixie Valley Fault system produces a large fractured aquifer heating Pleistocene aged groundwater to a temperature of 285 C at 5-6 km. Periodically over the last several thousand years, seismic events have pushed these heated fluids to the surface, leaving a rich history of hydrothermal alteration in the Stillwater Mountains. At Dixie Hot Springs, the potentiometric surface of the aquifer intersects the surface, and 75 C waters flow into the valley. We find a high concentration of alunite, kaolinite, and dickite on the exposed fault surface directly adjacent to a series of active fumaroles on the range front fault. This assemblage of minerals implies interaction with water in excess of 200 C. Field spectra support the location of the high temperature mineralization. Fault mapping using a Digital Elevation Model in combination with mineral lineation and field studies shows that complex fault interactions in this region are improving permeability in the region leading to unconfined fluid flow to the surface. Seismic studies conducted 10 km to the south of Dixie Meadows show that the range front fault dips 25-30 to the southeast (Abbott et al., 2001). At Dixie Meadows, the fault dips 35 to the southeast, demonstrating that this region is part of the low angle normal fault system that produced the Dixie Valley Earthquake in 1954 (M=6.8). We conclude that this unusually low angle faulting may have been accommodated by the presence of heated fluids, increasing pore pressure within the fault zone. We also find that younger synthetic faulting is occurring at more typical high angles. In an effort to present these findings visually, we created a cross-section, illustrating our interpretation of the subsurface structure and the hypothesized locations of increased permeability. The success of these methods at Dixie Meadows will greatly improve our understanding of other Basin and Range geothermal systems.

Kennedy-Bowdoin, T; Silver, E; Martini, B; Pickles, W



NV Energy (Northern Nevada Gas) - SureBet Business Energy Efficiency...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Trap 50 Pipe Wrap-Hot Water or Steam Boiler Linear Foot 4 Domestic Hot Water Pipe Wrap Linear Foot 2 Roof Insulation SF-Roof Area 0.10 Demand Controlled Ventilation...

Note: This page contains sample records for the topic "nv az mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

prepared to disclose and analyze environmental effects of developing and testing a geothermal reservoir by using enhanced geothermal system (EGS) technologies, as proposed by...


Electron-Mediated Nuclear-Spin Interactions Between Distant NV Centers  

E-Print Network (OSTI)

We propose a scheme enabling controlled quantum coherent interactions between separated nitrogen-vacancy centers in diamond in the presence of strong magnetic fluctuations. The proposed scheme couples nuclear qubits employing the magnetic dipole-dipole interaction between the electron spins and, crucially, benefits from the suppression of the effect of environmental magnetic field fluctuations thanks to a strong microwave driving. This scheme provides a basic building block for a full-scale quantum information processor or quantum simulator based on solid-state technology.

A. Bermudez; F. Jelezko; M. B. Plenio; A. Retzker



RECIPIENT:Nevada State Office of Energy STATE:NV PROJECT Renewable...  

NLE Websites -- All DOE Office Websites (Extended Search)

improvements in generator efficiency and appliance efficiency ratings. development of energy-efficient manufacturing or industrial practices. and small-scale conservation and...


DOI-BLM-NV-C010-2011-00016-EA | Open Energy Information  

Open Energy Info (EERE)

roads. These facilities would be connected to the previously proposed geothermal power plant for the Patua Phase I project or to a new nominal 60MW net geothermal power...


GRR/Section 8-NV-a - Transmission | Open Energy Information  

Open Energy Info (EERE)

of wastewater, which support or service an electric generating plant. 2. Electric transmission lines and transmission substations that: (a) Are designed to operate at 200...


Microsoft Word - DRAFT DSW NV PA 9_6_13 lmm  

NLE Websites -- All DOE Office Websites (Extended Search)



NV Energy Solar Integration Study: Cycling and Movements of Conventional Generators for Balancing Services  

DOE Green Energy (OSTI)

With an increasing penetration level of solar power in the southern Nevada system, the impact of solar on system operations needs to be carefully studied from various perspectives. Qualitatively, it is expected that the balancing requirements to compensate for solar power variability will be larger in magnitude; meanwhile, generators providing load following and regulation services will be moved up or down more frequently. One of the most important tasks is to quantitatively evaluate the cycling and movements of conventional generators with solar power at different penetration levels. This study is focused on developing effective methodologies for this goal and providing a basis for evaluating the wear and tear of the conventional generators

Diao, Ruisheng; Lu, Shuai; Etingov, Pavel V.; Ma, Jian; Makarov, Yuri V.; Guo, Xinxin



DOI-BLM-NV-C010-2011-0501-EA | Open Energy Information  

Open Energy Info (EERE)

501-EA 501-EA EA at Patua Geothermal Area for Geothermal/Well Field Patua Geothermal Project Phase II General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type EA Applicant Gradient Resources Consultant Panorama Environmental, Inc. Geothermal Area Patua Geothermal Area Project Location Fernley, Nevada Project Phase Geothermal/Well Field Techniques Development Drilling, Exploration Drilling, Well Testing Techniques Time Frame (days) Application Time 494 NEPA Process Time 327 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Carson City Managing Field Office Sierra Front, Stillwater Funding Agencies none provided Surface Manager BLM, BOR, Private Mineral Manager BLM Selected Dates Application Date 2011/01/14


survey of the Badlands Wilderness Study Area (NV-OIO-184). Elko County. Nevada.  

E-Print Network (OSTI)

This open file report summarizes the results of a Bureau of Mines wilderness study and will be incorporated in a joint report with the Geological Survey. The report is preliminary and has not been edited or reviewed for conformity with the Bureau of Mines editorial standards. Work on this study was conducted by personnel from Intermountain Field

Terry J. Kreidler



DOE/NV--629 U.S. Department of Energy Nevada Operations Office  

E-Print Network (OSTI)

this document. Septic systems are a subset of leachfield systems that include septic tanks designed to prevent solids from reaching associated leachfields. The underground discharge point addressed by CAS 25-51-01 includes several design features similar to leachfield systems. Effluents generated within the facilities were routed through collection systems and disposed of using distribution systems (i.e., leachfields). Collection systems are designed to channel effluent generated by various sources and transport it to a central disposal location. Within this document, the term "collection system" includes the piping and any septic tanks and diversion structures or distribution boxes between the edge of the source building foundation and the distribution system. Within this document, the term "distribution system" refers to the distribution manifolds, stems, and pipes (or "lines") or other features required to dispose of effluent supplied by the associated collection system. See Section 3.0 of the Leachfield Work Plan for an additional explanation of leachfield system terminology. Potentially hazardous and radioactive wastes were or may have been discharged to these leachfields and the UDP. Within this document, "effluent" is generally applied to all liquid waste disposed of in leachfield systems without regard to toxic, hazardous, or radioactive properties. Effluent discharged to the CAU 262 leachfields is considered potentially contaminated with various constituents but the probabilities of actual contamination are highly variable. "Sanitary effluent" is considered equivalent to domestic sewage, "process effluent" is considered potentially hazardous, and "radioactive effluent" is considered potentially radioactive and hazardous. Each facility includes one "posted" and ...

Environmental Restoration Division; Septic Systems



" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

1 Televisions in Homes in West Region, Divisions, and States, 2009" 1 Televisions in Homes in West Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"West Census Region" ,,,"Mountain Census Division",,,,,,,"Pacific Census Division" ,,,,"Mountain North Sub-Division",,,"Mountain South Sub-Division" ,"Total U.S.1 (millions)",,,"Total Mountain North",,,"Total Mountain South" ,,"Total West","Total Mountain",,,"ID, MT, UT, WY",,,,"Total Pacific",,"AK, HI, OR, WA" "Televisions",,,,,"CO",,,"AZ","NM, NV",,"CA" "Total Homes",113.6,24.8,7.9,3.9,1.9,2,4,2.3,1.7,16.9,12.2,4.7


Microsoft Word - LL-WM08 Paper 8351.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Phoenix, AZ Phoenix, AZ Monitoring the Performance of an Alternative Landfill Cover at the Monticello, Utah, Uranium Mill Tailings Disposal Site W.J. Waugh, M.K. Kastens, L.R.L. Sheader Environmental Sciences Laboratory* 2597 B ¾ Road, Grand Junction, CO 81503 C.H. Benson University of Wisconsin 1415 Engineering Drive, Madison, WI 53706 W.H. Albright Desert Research Institute 2215 Raggio Parkway, Reno, NV 89512 P.S. Mushovic U.S. Environmental Protection Agency 1595 Wynkoop Street, Denver, CO 80202 ABSTRACT The U.S. Department of Energy Office of Legacy Management (DOE) and the U.S. Environmental Protection Agency (EPA) collaborated on the design and monitoring of an alternative cover for the Monticello uranium mill tailings disposal cell, a Superfund site in


Obama Administration Announces Additional $63,817,400 for Local...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

AZ Mohave County 408,700 AZ Navajo County 473,900 AZ Pima County 3,981,900 AZ Pinal County 2,060,800 AZ Yavapai County 548,200 AZ Yuma County 427,700 In addition,...


Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2