Powered by Deep Web Technologies
Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Cleavage of nucleic acids  

DOE Patents [OSTI]

The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

Prudent, James R. (Madison, WI); Hall, Jeff G. (Waunakee, WI); Lyamichev, Victor I. (Madison, WI); Brow; Mary Ann D. (Madison, WI); Dahlberg, James E. (Madison, WI)

2010-11-09T23:59:59.000Z

2

Cleavage of nucleic acids  

DOE Patents [OSTI]

The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

Prudent, James R. (Madison, WI); Hall, Jeff G. (Madison, WI); Lyamichev, Victor L. (Madison, WI); Brow, Mary Ann D. (Madison, WI); Dahlberg, James E. (Madison, WI)

2007-12-11T23:59:59.000Z

3

Nucleic acid detection compositions  

DOE Patents [OSTI]

The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

Prudent, James R. (Madison, WI); Hall, Jeff G. (Madison, WI); Lyamichev, Victor I. (Madison, WI); Brow, Mary Ann (Madison, WI); Dahlberg, James L. (Madison, WI)

2008-08-05T23:59:59.000Z

4

Self-assembling multimeric nucleic acid constructs  

DOE Patents [OSTI]

The invention is directed to constructs and compositions containing multimeric forms of nucleic acid. Multimeric nucleic acids comprise single-stranded nucleic acids attached via biotin to streptavidin and bound with a functional group. These constructs can be utilized in vivo to treat or identify diseased tissue or cells. Repeated administrations of multimeric nucleic acid compositions produce a rapid and specific amplification of nucleic acid constructs and their attached functional groups. For treatment purposes, functional groups may be toxins, radioisotopes, genes or enzymes. Diagnostically, labeled multimeric constructs may be used to identify specific targets in vivo or in vitro. Multimeric nucleic acids may also be used in nanotechnology and to create self-assembling polymeric aggregates such as membranes of defined porosity, microcircuits and many other products. 5 figs.

Cantor, C.R.; Niemeyer, C.M.; Smith, C.L.; Sano, Takeshi; Hnatowich, D.J.; Rusckowski, M.

1996-10-01T23:59:59.000Z

5

Self-assembling multimeric nucleic acid constructs  

DOE Patents [OSTI]

The invention is directed to constructs and compositions containing multimeric forms of nucleic acid. Multimeric nucleic acids comprise single-stranded nucleic acids attached via biotin to streptavidin and bound with a functional group. These constructs can be utilized in vivo to treat or identify diseased tissue or cells. Repeated administrations of multimeric nucleic acid compositions produce a rapid and specific amplification of nucleic acid constructs and their attached functional groups. For treatment purposes, functional groups may be toxins, radioisotopes, genes or enzymes. Diagnostically, labeled multimeric constructs may be used to identify specific targets in vivo or in vitro. Multimeric nucleic acids may also be used in nanotechnology and to create self-assembling polymeric aggregates such as membranes of defined porosity, microcircuits and many other products.

Cantor, Charles R. (Boston, MA); Niemeyer, Christof M. (Bremen, DE); Smith, Cassandra L. (Boston, MA); Sano, Takeshi (Boston, MA); Hnatowich, Donald J. (Brookline, MA); Rusckowski, Mary (Southborough, MA)

1999-10-12T23:59:59.000Z

6

Self-assembling multimeric nucleic acid constructs  

DOE Patents [OSTI]

The invention is directed to constructs and compositions containing multimeric forms of nucleic acid. Multimeric nucleic acids comprise single-stranded nucleic acids attached via biotin to streptavidin and bound with a functional group. These constructs can be utilized in vivo to treat or identify diseased tissue or cells. Repeated administrations of multimeric nucleic acid compositions produce a rapid and specific amplification of nucleic acid constructs and their attached functional groups. For treatment purposes, functional groups may be toxins, radioisotopes, genes or enzymes. Diagnostically, labeled multimeric constructs may be used to identify specific targets in vivo or in vitro. Multimeric nucleic acids may also be used in nanotechnology and to create self-assembling polymeric aggregates such as membranes of defined porosity, microcircuits and many other products.

Cantor, Charles R. (Boston, MA); Niemeyer, Christof M. (Bremen, DE); Smith, Cassandra L. (Boston, MA); Sano, Takeshi (Boston, MA); Hnatowich, Donald J. (Brookline, MA); Rusckowski, Mary (Southborough, MA)

1996-01-01T23:59:59.000Z

7

Double stranded nucleic acid biochips  

DOE Patents [OSTI]

This invention describes a new method of constructing double-stranded DNA (dsDNA) microarrays based on the use of pre-synthesized or natural DNA duplexes without a stem-loop structure. The complementary oligonucleotide chains are bonded together by a novel connector that includes a linker for immobilization on a matrix. A non-enzymatic method for synthesizing double-stranded nucleic acids with this novel connector enables the construction of inexpensive and robust dsDNA/dsRNA microarrays. DNA-DNA and DNA-protein interactions are investigated using the microarrays.

Chernov, Boris; Golova, Julia

2006-05-23T23:59:59.000Z

8

Methods for analyzing nucleic acid sequences  

SciTech Connect (OSTI)

The present invention is directed to a method of sequencing a target nucleic acid. The method provides a complex comprising a polymerase enzyme, a target nucleic acid molecule, and a primer, wherein the complex is immobilized on a support Fluorescent label is attached to a terminal phosphate group of the nucleotide or nucleotide analog. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The time duration of the signal from labeled nucleotides or nucleotide analogs that become incorporated is distinguished from freely diffusing labels by a longer retention in the observation volume for the nucleotides or nucleotide analogs that become incorporated than for the freely diffusing labels.

Korlach, Jonas (Ithaca, NY); Webb, Watt W. (Ithaca, NY); Levene, Michael (Ithaca, NY); Turner, Stephen (Ithaca, NY); Craighead, Harold G. (Ithaca, NY); Foquet, Mathieu (Ithaca, NY)

2011-05-17T23:59:59.000Z

9

Amplification of trace amounts of nucleic acids  

DOE Patents [OSTI]

Methods of reducing background during amplification of small amounts of nucleic acids employ careful analysis of sources of low level contamination. Ultraviolet light can be used to reduce nucleic acid contaminants in reagents and equipment. "Primer-dimer" background can be reduced by judicious design of primers. We have shown clean signal-to-noise with as little as starting material as one single human cell (.about.6 picogram), E. coli cell (.about.5 femtogram) or Prochlorococcus cell (.about.3 femtogram).

Church, George M. (Brookline, MA); Zhang, Kun (Brighton, MA)

2008-06-17T23:59:59.000Z

10

Nucleic acid based fluorescent sensor for copper detection  

DOE Patents [OSTI]

A nucleic acid enzyme responsive to copper, comprising an oligonucleotide comprising a nucleotide sequence of SEQ ID NO:1, wherein the nucleic acid enzyme is not self-cleaving.

Lu, Yi; Liu, Juewen

2013-04-02T23:59:59.000Z

11

Method for nucleic acid isolation using supercritical fluids  

DOE Patents [OSTI]

A method for detecting the presence of a microorganism in an environmental sample involves contacting the sample with a supercritical fluid to isolate nucleic acid from the microorganism, then detecting the presence of a particular sequence within the isolated nucleic acid. The nucleic acid may optionally be subjected to further purification.

Nivens, David E. (11912 Kingsgate Rd., Knoxville, TN 37911); Applegate, Bruce M. (3700 Sutherland Ave. #Q2, Knoxville, TN 37911)

1999-01-01T23:59:59.000Z

12

Supplementary Materials: A Partition Function Algorithm for Interacting Nucleic Acid Strands  

E-Print Network [OSTI]

nucleic acid strands by R and S. Strand R is indexed from 1 to LR, and S is indexed from 1 to LS both in 5 to 3 direction. Note that the two strands interact in opposite directions, e.g. R in 5 3 with S in 3 to the ith nucleotide in R and S by iR and iS respectively. An intramolecular base pair between

Will, Sebastian

13

Nucleic acid analysis using terminal-phosphate-labeled nucleotides  

DOE Patents [OSTI]

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Korlach, Jonas (Ithaca, NY); Webb, Watt W. (Ithaca, NY); Levene, Michael (Ithaca, NY); Turner, Stephen (Ithaca, NY); Craighead, Harold G. (Ithaca, NY); Foquet, Mathieu (Ithaca, NY)

2008-04-22T23:59:59.000Z

14

Detection of nucleic acids by multiple sequential invasive cleavages  

DOE Patents [OSTI]

The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based on charge. The present invention also provides methods for the detection of non-target cleavage products via the formation of a complete and activated protein binding region. The invention further provides sensitive and specific methods for the detection of human cytomegalovirus nucleic acid in a sample.

Hall, Jeff G; Lyamichev, Victor I; Mast, Andrea L; Brow, Mary Ann D

2012-10-16T23:59:59.000Z

15

Method for analyzing nucleic acids by means of a substrate having a microchannel structure containing immobilized nucleic acid probes  

DOE Patents [OSTI]

A method and apparatus for analyzing nucleic acids includes immobilizing nucleic probes at specific sites within a microchannel structure and moving target nucleic acids into proximity to the probes in order to allow hybridization and fluorescence detection of specific target sequences.

Ramsey, J. Michael (Knoxville, TN); Foote, Robert S. (Oak Ridge, TN)

2002-01-01T23:59:59.000Z

16

Nucleic acids, compositions and uses thereof  

DOE Patents [OSTI]

The subject invention provides at least one nucleic acid sequence encoding an aldouronate-utilization regulon isolated from Paenibacillus sp. strain JDR-2, a bacterium which efficiently utilizes xylan and metabolizes aldouronates (methylglucuronoxylosaccharides). The subject invention also provides a means for providing a coordinately regulated process in which xylan depolymerization and product assimilation are coupled in Paenibacillus sp. strain JDR-2 to provide a favorable system for the conversion of lignocellulosic biomass to biobased products. Additionally, the nucleic acid sequences encoding the aldouronate-utilization regulon can be used to transform other bacteria to form organisms capable of producing a desired product (e.g., ethanol, 1-butanol, acetoin, 2,3-butanediol, 1,3-propanediol, succinate, lactate, acetate, malate or alanine) from lignocellulosic biomass.

Preston, III, James F. (Micanopy, FL); Chow, Virginia (Gainesville, FL); Nong, Guang (Gainesville, FL); Rice, John D. (Gainesville, FL); St. John, Franz J. (Baltimore, MD)

2012-02-21T23:59:59.000Z

17

Nucleic acid compositions and the encoding proteins  

SciTech Connect (OSTI)

The subject invention provides at least one nucleic acid sequence encoding an aldouronate-utilization regulon isolated from Paenibacillus sp. strain JDR-2, a bacterium which efficiently utilizes xylan and metabolizes aldouronates (methylglucuronoxylosaccharides). The subject invention also provides a means for providing a coordinately regulated process in which xylan depolymerization and product assimilation are coupled in Paenibacillus sp. strain JDR-2 to provide a favorable system for the conversion of lignocellulosic biomass to biobased products. Additionally, the nucleic acid sequences encoding the aldouronate-utilization regulon can be used to transform other bacteria to form organisms capable of producing a desired product (e.g., ethanol, 1-butanol, acetoin, 2,3-butanediol, 1,3-propanediol, succinate, lactate, acetate, malate or alanine) from lignocellulosic biomass.

Preston, III, James F.; Chow, Virginia; Nong, Guang; Rice, John D.; St. John, Franz J.

2014-09-02T23:59:59.000Z

18

Nucleic Acid Database: a Repository of Three-Dimensional Information about Nucleic Acids  

DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

The Nucleic Acid Database (NDB) provides 3-D structural information about nucleic acids.  It is a relational database designed to facilitate the easy search for nucleic acid structures using any of the stored primary or derived structural features. Reports can then be created describing any properties of the selected structures and structures may be viewed in several different formats, including the mmCIF format, the NDB Atlas format, the NDB coordinate format, or the PDB coordinate format. Browsing structure images created directly from coordinates in the repository can also be done. More than 7000 structures have been released as of May 2014. This website also includes a number of specialized tools and interfaces. The NDB Project is funded by the National Institutes of Health and has been funded by the National Science Foundation and the Department of Energy in the past.

Berman, H.M.; Olson, W.K.; Beveridge, D.L.; Westbrook, J.; Gelbin, A.; Demeny, T.; Hsieh, S.H.; Srinivasan, A.R.; Schneider, B.

19

EGVII endoglucanase and nucleic acids encoding the same  

DOE Patents [OSTI]

The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

2014-02-25T23:59:59.000Z

20

EGVII endoglucanase and nucleic acids encoding the same  

DOE Patents [OSTI]

The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

Dunn-Coleman, Nigel (Los Gatos, CA); Goedegebuur, Frits (Vlaardingen, NL); Ward, Michael (San Francisco, CA); Yao, Jian (Sunnyvale, CA)

2008-11-11T23:59:59.000Z

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Nucleic acid amplification using modular branched primers  

DOE Patents [OSTI]

Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

Ulanovsky, Levy (Westmont, IL)

2001-01-01T23:59:59.000Z

22

Nucleic acid based fluorescent sensor for mercury detection  

DOE Patents [OSTI]

A nucleic acid enzyme comprises an oligonucleotide containing thymine bases. The nucleic acid enzyme is dependent on both Hg.sup.2+and a second ion as cofactors, to produce a product from a substrate. The substrate comprises a ribonucleotide, a deoxyribonucleotide, or both.

Lu, Yi; Liu, Juewen

2013-02-05T23:59:59.000Z

23

E-Print Network 3.0 - archetypical nucleic acid Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

archetypical nucleic acid Search Powered by Explorit Topic List Advanced Search Sample search results for: archetypical nucleic acid Page: << < 1 2 3 4 5 > >> 1 Multiple Sequence...

24

E-Print Network 3.0 - a-form nucleic acid Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sample search results for: a-form nucleic acid Page: << < 1 2 3 4 5 > >> 1 The Right Chemistry: an Updated Nucleic Acids Textbook Summary: The Right Chemistry: an Updated Nucleic...

25

Method for high-volume sequencing of nucleic acids: random and directed priming with libraries of oligonucleotides  

DOE Patents [OSTI]

Random and directed priming methods for determining nucleotide sequences by enzymatic sequencing techniques, using libraries of primers of lengths 8, 9 or 10 bases, are disclosed. These methods permit direct sequencing of nucleic acids as large as 45,000 base pairs or larger without the necessity for subcloning. Individual primers are used repeatedly to prime sequence reactions in many different nucleic acid molecules. Libraries containing as few as 10,000 octamers, 14,200 nonamers, or 44,000 decamers would have the capacity to determine the sequence of almost any cosmid DNA. Random priming with a fixed set of primers from a smaller library can also be used to initiate the sequencing of individual nucleic acid molecules, with the sequence being completed by directed priming with primers from the library. In contrast to random cloning techniques, a combined random and directed priming strategy is far more efficient. 2 figs.

Studier, F.W.

1995-04-18T23:59:59.000Z

26

Method for high-volume sequencing of nucleic acids: random and directed priming with libraries of oligonucleotides  

DOE Patents [OSTI]

Random and directed priming methods for determining nucleotide sequences by enzymatic sequencing techniques, using libraries of primers of lengths 8, 9 or 10 bases, are disclosed. These methods permit direct sequencing of nucleic acids as large as 45,000 base pairs or larger without the necessity for subcloning. Individual primers are used repeatedly to prime sequence reactions in many different nucleic acid molecules. Libraries containing as few as 10,000 octamers, 14,200 nonamers, or 44,000 decamers would have the capacity to determine the sequence of almost any cosmid DNA. Random priming with a fixed set of primers from a smaller library can also be used to initiate the sequencing of individual nucleic acid molecules, with the sequence being completed by directed priming with primers from the library. In contrast to random cloning techniques, a combined random and directed priming strategy is far more efficient.

Studier, F. William (Stony Brook, NY)

1995-04-18T23:59:59.000Z

27

Oligonucleoside alkyl or arylphosphonate derivatives capable of crosslinking with or cleaving nucleic acids  

DOE Patents [OSTI]

A composition for inactivating a target nucleic acid which comprises an oligonucleoside alkyl or arylphosphonate analogue which is complementary to the sequence of the target nucleic acid is provided. It includes a functional group which reacts with the target nucleic acid to render the target nucleic acid inactive or nonfunctional. 16 figs.

Miller, P.S.; Ts'o, P.O.P.

1999-06-15T23:59:59.000Z

28

Oligonucleoside alkyl or arylphosphonate derivatives capable of crosslinking with or cleaving nucleic acids  

DOE Patents [OSTI]

A composition for inactivating a target nucleic acid which comprises an oligonucleoside alkyl or arylphosphonate analogue which is complementary to the sequence of the target nucleic acid and includes a functional group which reacts with the target nucleic acid to render the target nucleic acid inactive or nonfunctional.

Miller, Paul S. (Baltimore, MD); Ts'o, Paul O.P. (Lutherville, MD)

1999-06-15T23:59:59.000Z

29

Isolated menthone reductase and nucleic acid molecules encoding same  

DOE Patents [OSTI]

The present invention provides isolated menthone reductase proteins, isolated nucleic acid molecules encoding menthone reductase proteins, methods for expressing and isolating menthone reductase proteins, and transgenic plants expressing elevated levels of menthone reductase protein.

Croteau, Rodney B; Davis, Edward M; Ringer, Kerry L

2013-04-23T23:59:59.000Z

30

Thermoplastic Microfluidic Device for On-Chip Purification of Nucleic Acids for Disposable  

E-Print Network [OSTI]

Thermoplastic Microfluidic Device for On-Chip Purification of Nucleic Acids for Disposable, Brookline, Massachusetts 02446 A polymeric microfluidic device for solid-phase extraction (SPE applications. Microfluidic approaches to nucleic acid isolation have therefore received great attention

31

Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid  

DOE Patents [OSTI]

A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.

Nasarabadi, Shanavaz (Livermore, CA)

2011-01-11T23:59:59.000Z

32

E-Print Network 3.0 - ampliprep nucleic acid Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Affinity for Nucleic Acids Summary: for Nucleic Acids Coby B. Carlson and Peter A. Beal* Department of Chemistry, UniVersity of Utah, 315 South... if immobilization of a PAC...

33

E-Print Network 3.0 - azobenzene-modified nucleic acid Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Affinity for Nucleic Acids Summary: for Nucleic Acids Coby B. Carlson and Peter A. Beal* Department of Chemistry, UniVersity of Utah, 315 South... if immobilization of a PAC...

34

Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same  

DOE Patents [OSTI]

The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo

2012-10-16T23:59:59.000Z

35

7-9/99 Neuman Chapter 23 Nucleic Acids  

E-Print Network [OSTI]

7-9/99 Neuman Chapter 23 0 Chapter 23 Nucleic Acids from Organic Chemistry by Robert C. Neuman, Jr. Professor of Chemistry, emeritus University of California, Riverside orgchembyneuman@yahoo.com ://web.chem.ucsb.edu/~neuman/orgchembyneuman/> Chapter Outline of the Book

Reed, Christopher A.

36

Multiple Sequence Alignments of Partially Coding Nucleic Acid Sequences  

E-Print Network [OSTI]

Multiple Sequence Alignments of Partially Coding Nucleic Acid Sequences Roman R. Stocsits1 , Ivo L Fe Institute, 1399 Hyde Park Rd., Santa Fe NM 87501, USA Email: Roman R. Stocsits - roman of the available sequence data was pre- sented very recently [12]. SARGLSSTVSLGQFEHWSPR NARNLSDTVS

Stadler, Peter F.

37

Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same  

DOE Patents [OSTI]

The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo

2014-09-30T23:59:59.000Z

38

Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same  

SciTech Connect (OSTI)

The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo

2010-06-22T23:59:59.000Z

39

Mosaic protein and nucleic acid vaccines against hepatitis C virus  

DOE Patents [OSTI]

The invention relates to immunogenic compositions useful as HCV vaccines. Provided are HCV mosaic polypeptide and nucleic acid compositions which provide higher levels of T-cell epitope coverage while minimizing the occurrence of unnatural and rare epitopes compared to natural HCV polypeptides and consensus HCV sequences.

Yusim, Karina; Korber, Bette T. M.; Kuiken, Carla L.; Fischer, William M.

2013-06-11T23:59:59.000Z

40

Cell cycle nucleic acids, polypeptides and uses thereof  

DOE Patents [OSTI]

The invention provides isolated nucleic acids and their encoded proteins that are involved in cell cycle regulation. The invention further provides recombinant expression cassettes, host cells, transgenic plants, and antibody compositions. The present invention provides methods and compositions relating to altering cell cycle protein content, cell cycle progression, cell number and/or composition of plants.

Gordon-Kamm, William J. (Urbandale, IA); Lowe, Keith S. (Johnston, IA); Larkins, Brian A. (Tucson, AZ); Dilkes, Brian R. (Tucson, AZ); Sun, Yuejin (Westfield, IN)

2007-08-14T23:59:59.000Z

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Universal nucleic acids sample preparation method for cells, spores and their mixture  

DOE Patents [OSTI]

The present invention relates to a method for extracting nucleic acids from biological samples. More specifically the invention relates to a universal method for extracting nucleic acids from unidentified biological samples. An advantage of the presently invented method is its ability to effectively and efficiently extract nucleic acids from a variety of different cell types including but not limited to prokaryotic or eukaryotic cells and/or recalcitrant organisms (i.e. spores). Unlike prior art methods which are focused on extracting nucleic acids from vegetative cell or spores, the present invention effectively extracts nucleic acids from spores, multiple cell types or mixtures thereof using a single method. Important that the invented method has demonstrated an ability to extract nucleic acids from spores and vegetative bacterial cells with similar levels effectiveness. The invented method employs a multi-step protocol which erodes the cell structure of the biological sample, isolates, labels, fragments nucleic acids and purifies labeled samples from the excess of dye.

Bavykin, Sergei (Darien, IL)

2011-01-18T23:59:59.000Z

42

Method and apparatus for staining immobilized nucleic acids  

DOE Patents [OSTI]

A method for staining immobilized nucleic acids includes the steps of affixing DNA probes to a solid substrate, moving target DNA material into proximity with the DNA probes, whereby the target DNA hybridized with specific ones of the DNA probes, and moving a fluorescent dye into proximity with the hybridized target DNA, whereby the fluorescent dye binds to the hybridized DNA to enable subsequent detection of fluorescence.

Ramsey, J. Michael (Knoxville, TN); Foote, Robert S. (Oak Ridge, TN); Jacobson, Stephen C. (Knoxville, TN)

2000-01-01T23:59:59.000Z

43

Nucleic acids encoding human trithorax protein  

DOE Patents [OSTI]

In accordance with the present invention, there is provided an isolated peptide having the characteristics of human trithorax protein (as well as DNA encoding same, antisense DNA derived therefrom and antagonists therefor). The invention peptide is characterized by having a DNA binding domain comprising multiple zinc fingers and at least 40% amino acid identity with respect to the DNA binding domain of Drosophila trithorax protein and at least 70% conserved sequence with respect to the DNA binding domain of Drosophila trithorax protein, and wherein said peptide is encoded by a gene located at chromosome 11 of the human genome at q23. Also provided are methods for the treatment of subject(s) suffering from immunodeficiency, developmental abnormality, inherited disease, or cancer by administering to said subject a therapeutically effective amount of one of the above-described agents (i.e., peptide, antagonist therefor, DNA encoding said peptide or antisense DNA derived therefrom). Also provided is a method for the diagnosis, in a subject, of immunodeficiency, developmental abnormality, inherited disease, or cancer associated with disruption of chromosome 11 at q23.

Evans, Glen A. (Encinitas, CA); Djabali, Malek (Marseilles, FR); Selleri, Licia (Del Mar, CA); Parry, Pauline (San Diego, CA)

2001-01-01T23:59:59.000Z

44

Nucleic acid modifications in bacterial pathogens - impact on pathogenesis, diagnosis, and therapy  

E-Print Network [OSTI]

Nucleic acids are subject to extensive chemical modification by all organisms. These modifications display incredible structural diversity, and some are essential for survival. Intriguingly, several of these modifications ...

Russell, Brandon S. (Brandon Skylur)

2014-01-01T23:59:59.000Z

45

BGL7 beta-glucosidase and nucleic acids encoding the same  

DOE Patents [OSTI]

The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

Dunn-Coleman, Nigel; Ward, Michael

2014-03-25T23:59:59.000Z

46

BGL7 beta-glucosidase and nucleic acids encoding the same  

DOE Patents [OSTI]

The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

Dunn-Coleman, Nigel; Ward, Michael

2013-01-29T23:59:59.000Z

47

BGL6 beta-glucosidase and nucleic acids encoding the same  

DOE Patents [OSTI]

The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

Dunn-Coleman, Nigel; Ward, Michael

2014-03-04T23:59:59.000Z

48

BGL6 .beta.-glucosidase and nucleic acids encoding the same  

DOE Patents [OSTI]

The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

Dunn-Coleman, Nigel; Ward, Michael

2012-10-02T23:59:59.000Z

49

BGL4 beta-glucosidase and nucleic acids encoding the same  

DOE Patents [OSTI]

The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl4, and the corresponding BGL4 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL4, recombinant BGL4 proteins and methods for producing the same.

Dunn-Coleman, Nigel (Los Gatos, CA) [Los Gatos, CA; Goedegebuur, Frits (Vlaardingen, NL) [Vlaardingen, NL; Ward, Michael (San Francisco, CA) [San Francisco, CA; Yao, Jian (Sunnyvale, CA) [Sunnyvale, CA

2008-01-22T23:59:59.000Z

50

BGL3 beta-glucosidase and nucleic acids encoding the same  

DOE Patents [OSTI]

The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

Dunn-Coleman, Nigel (Los Gatos, CA); Goedegebuur, Frits (Vlaardingen, NL); Ward, Michael (San Francisco, CA); Yao, Jian (Sunnyvale, CA)

2008-04-01T23:59:59.000Z

51

BGL5 .beta.-glucosidase and nucleic acids encoding the same  

DOE Patents [OSTI]

The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl5, and the corresponding BGL5 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL5, recombinant BGL5 proteins and methods for producing the same.

Dunn-Coleman, Nigel (Los Gatos, CA); Goedegebuur, Frits (Vlaardingen, NL); Ward, Michael (San Francisco, CA); Yao, Jian (Sunnyvale, CA)

2008-03-18T23:59:59.000Z

52

BGL3 beta-glucosidase and nucleic acids encoding the same  

DOE Patents [OSTI]

The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

Dunn-Coleman, Nigel (Los Gatos, CA); Goedegebuur, Frits (Vlaardingen, NL); Ward, Michael (San Francisco, CA); Yao, Jian (Sunnyvale, CA)

2011-06-14T23:59:59.000Z

53

BGL4 beta-glucosidase and nucleic acids encoding the same  

DOE Patents [OSTI]

The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl4, and the corresponding BGL4 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL4, recombinant BGL4 proteins and methods for producing the same.

Dunn-Coleman, Nigel (Los Gatos, CA); Goedegebuur, Frits (Vlaardingen, NL); Ward, Michael (San Francisco, CA); Yao, Jian (Sunnyvale, CA)

2011-12-06T23:59:59.000Z

54

BGL3 beta-glucosidase and nucleic acids encoding the same  

DOE Patents [OSTI]

The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

Dunn-Coleman, Nigel (Los Gatos, CA); Goedegebuur, Frits (Vlaardingen, NL); Ward, Michael (San Francisco, CA); Yao, Jian (Sunnyvale, CA)

2007-09-25T23:59:59.000Z

55

BGL3 beta-glucosidase and nucleic acids encoding the same  

DOE Patents [OSTI]

The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

2012-10-30T23:59:59.000Z

56

BGL7 beta-glucosidase and nucleic acids encoding the same  

DOE Patents [OSTI]

The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

Dunn-Coleman, Nigel (Los Gatos, CA); Ward, Michael (San Francisco, CA)

2008-08-05T23:59:59.000Z

57

Nucleic acid sequence detection using multiplexed oligonucleotide PCR  

DOE Patents [OSTI]

Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

Nolan, John P. (Santa Fe, NM); White, P. Scott (Los Alamos, NM)

2006-12-26T23:59:59.000Z

58

Structure and function of circadian clock proteins and deuterium isotope effects in nucleic acid hydrogen bonds  

E-Print Network [OSTI]

-terminal domain. Hydrogen bonds are of paramount importance in nucleic acid structure and function. Here we show that changes in the width and anharmonicity of vibrational potential energy wells of hydrogen bonded groups can be measured in nucleic acids and can...

Vakonakis, Ioannis

2005-08-29T23:59:59.000Z

59

The present invention relates to automated methods of introducing multiple nucleic acid sequences into one or more target cells.  

DOE Patents [OSTI]

The present invention relates to automated methods of introducing multiple nucleic acid sequences into one or more target cells.

Church, George M. (Brookline, MA); Wang, Harris H. (Cambridge, MA); Isaacs, Farren J. (Brookline, MA)

2012-04-10T23:59:59.000Z

60

Understanding barriers to efficient nucleic acid delivery with bioresponsive block copolymers  

E-Print Network [OSTI]

The delivery of nucleic acids has the potential to revolutionize medicine by allowing previously untreatable diseases to be clinically addressed. Viral delivery systems have been held back by immunogenicity and toxicity ...

Bonner, Daniel Kenneth

2012-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Studies toward biomimetic claisen condensation using nucleic acid templates and ribozyme catalysis  

E-Print Network [OSTI]

Many different experimental approaches were attempted to achieve carbon-carbon bond formation by nucleic acid template-directed reactions and ribozyme catalysis as potential lipid synthesizing machineries in the RNA world. A novel biomimetic...

Ryu, Youngha

2005-08-29T23:59:59.000Z

62

Stable nitrogen isotope measurements of marine bacterial proteins and nucleic acids: tracers of microbial activity  

E-Print Network [OSTI]

and nucleic acids from cultures and environmental samples were analyzed to determine if protein []15N reliably reflects whole cell []15N. In batch culture experiments, the net fractionation between Vibrio harveyi and bacterial protein extracts, varied as a...

Kovacs, Jeffrey Paul

1996-01-01T23:59:59.000Z

63

Development of polymer and lipid materials for enhanced delivery of nucleic acids and proteins  

E-Print Network [OSTI]

The development of synthetic vectors enabling efficient intracellular delivery of macromolecular therapeutics such as nucleic acids and proteins could potentially catalyze the clinical translation of many gene and protein-based ...

Eltoukhy, Ahmed Atef

2013-01-01T23:59:59.000Z

64

Point of Attachment and Sequence of Immobilized Peptide-Acridine Conjugates Control Affinity for Nucleic Acids  

E-Print Network [OSTI]

for Nucleic Acids Coby B. Carlson and Peter A. Beal* Department of Chemistry, UniVersity of Utah, 315 South) was constructed * To whom correspondence should be addressed. E-mail: beal@ chemistry.chem.utah.edu. Figure 1

Beal, Peter A.

65

Method for producing labeled single-stranded nucleic acid probes  

DOE Patents [OSTI]

Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector, the cloning vector having an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe.

Dunn, John J. (Bellport, NY); Quesada, Mark A. (Middle Island, NY); Randesi, Matthew (Upton, NY)

1999-10-19T23:59:59.000Z

66

Methods of staining target chromosomal DNA employing high complexity nucleic acid probes  

DOE Patents [OSTI]

Methods and compositions for staining based upon nucleic acid sequence that employ nucleic acid probes are provided. Said methods produce staining patterns that can be tailored for specific cytogenetic analyses. Said probes are appropriate for in situ hybridization and stain both interphase and metaphase chromosomal material with reliable signals. The nucleic acid probes are typically of a complexity greater than 50 kb, the complexity depending upon the cytogenetic application. Methods and reagents are provided for the detection of genetic rearrangements. Probes and test kits are provided for use in detecting genetic rearrangements, particularly for use in tumor cytogenetics, in the detection of disease related loci, specifically cancer, such as chronic myelogenous leukemia (CML), retinoblastoma, ovarian and uterine cancers, and for biological dosimetry. Methods and reagents are described for cytogenetic research, for the differentiation of cytogenetically similar but genetically different diseases, and for many prognostic and diagnostic applications.

Gray, Joe W.; Pinkel, Daniel; Kallioniemi, Ol'li-Pekka; Kallioniemi, Anne; Sakamoto, Masaru

2006-10-03T23:59:59.000Z

67

Methods and kits for nucleic acid analysis using fluorescence resonance energy transfer  

DOE Patents [OSTI]

A method for detecting the presence of a target nucleotide or sequence of nucleotides in a nucleic acid is disclosed. The method is comprised of forming an oligonucleotide labeled with two fluorophores on the nucleic acid target site. The doubly labeled oligonucleotide is formed by addition of a singly labeled dideoxynucleoside triphosphate to a singly labeled polynucleotide or by ligation of two singly labeled polynucleotides. Detection of fluorescence resonance energy transfer upon denaturation indicates the presence of the target. Kits are also provided. The method is particularly applicable to genotyping.

Kwok, Pui-Yan (Clayton, MO); Chen, Xiangning (St. Louis, MO)

1999-01-01T23:59:59.000Z

68

Structural aspects of catalytic mechanisms of endonucleases and their binding to nucleic acids  

SciTech Connect (OSTI)

Endonucleases (EC 3.1) are enzymes of the hydrolase class that catalyze the hydrolytic cleavage of deoxyribonucleic and ribonucleic acids at any region of the polynucleotide chain. Endonucleases are widely used both in biotechnological processes and in veterinary medicine as antiviral agents. Medical applications of endonucleases in human cancer therapy hold promise. The results of X-ray diffraction studies of the spatial organization of endonucleases and their complexes and the mechanism of their action are analyzed and generalized. An analysis of the structural studies of this class of enzymes showed that the specific binding of enzymes to nucleic acids is characterized by interactions with nitrogen bases and the nucleotide backbone, whereas the nonspecific binding of enzymes is generally characterized by interactions only with the nucleic-acid backbone. It should be taken into account that the specificity can be modulated by metal ions and certain low-molecular-weight organic compounds. To test the hypotheses about specific and nonspecific nucleic-acid-binding proteins, it is necessary to perform additional studies of atomic-resolution three-dimensional structures of enzyme-nucleic-acid complexes by methods of structural biology.

Zhukhlistova, N. E.; Balaev, V. V.; Lyashenko, A. V.; Lashkov, A. A., E-mail: alashkov83@gmail.com [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)

2012-05-15T23:59:59.000Z

69

Nucleosides, Nucleotides, and Nucleic Acids, 25:915, 2006 Copyright C Taylor & Francis Group, LLC  

E-Print Network [OSTI]

Nucleosides, Nucleotides, and Nucleic Acids, 25:9­15, 2006 Copyright C Taylor & Francis Group, LLC-LABELED NUCLEOTIDE SPACER ARM ON INCORPORATION BY THERMOPHILIC DNA POLYMERASES Christopher J. Lacenere 2 Division incor- porate fluorescently labeled nucleotides sequentially was analyzed by a gel based primer

Stoltz, Brian M.

70

Nucleic Acids Research, 2009, 114 doi:10.1093/nar/gkn1064  

E-Print Network [OSTI]

Nucleic Acids Research, 2009, 1­14 doi:10.1093/nar/gkn1064 Allegro: Analyzing expression- ulate. We present Allegro, a method for de-novo dis- covery of cis-regulatory transcriptional programs by a group of co-regulated genes. We show that Allegro is more accurate and sensitive than existing

Shamir, Ron

71

Nucleic acid molecules conferring enhanced ethanol tolerance and microorganisms having enhanced tolerance to ethanol  

DOE Patents [OSTI]

The present invention provides isolated nucleic acid molecules which encode a mutant acetaldehyde-CoA/alcohol dehydrogenase or mutant alcohol dehydrogenase and confer enhanced tolerance to ethanol. The invention also provides related expression vectors, genetically engineered microorganisms having enhanced tolerance to ethanol, as well as methods of making and using such genetically modified microorganisms for production of biofuels based on fermentation of biomass materials.

Brown, Steven; Guss, Adam; Yang, Shihui; Karpinets, Tatiana; Lynd, Lee; Shao, Xiongjun

2014-01-14T23:59:59.000Z

72

Nucleic acids encoding modified human immunodeficiency virus type 1 (HIV-1) group M consensus envelope glycoproteins  

DOE Patents [OSTI]

The present invention relates, in general, to an immunogen and, in particular, to an immunogen for inducing antibodies that neutralizes a wide spectrum of HIV primary isolates and/or to an immunogen that induces a T cell immune response. The invention also relates to a method of inducing anti-HIV antibodies, and/or to a method of inducing a T cell immune response, using such an immunogen. The invention further relates to nucleic acid sequences encoding the present immunogens.

Haynes, Barton F. (Durham, NC); Gao, Feng (Durham, NC); Korber, Bette T. (Los Alamos, NM); Hahn, Beatrice H. (Birmingham, AL); Shaw, George M. (Birmingham, AL); Kothe, Denise (Birmingham, AL); Li, Ying Ying (Hoover, AL); Decker, Julie (Alabaster, AL); Liao, Hua-Xin (Chapel Hill, NC)

2011-12-06T23:59:59.000Z

73

Nucleic Acid Encoding A Lectin-Derived Progenitor Cell Preservation Factor  

DOE Patents [OSTI]

The invention relates to an isolated nucleic acid molecule that encodes a protein that is effective to preserve progenitor cells, such as hematopoietic progenitor cells. The nucleic acid comprises a sequence defined by SEQ ID NO:1, a homolog thereof, or a fragment thereof. The encoded protein has an amino acid sequence that comprises a sequence defined by SEQ ID NO:2, a homolog thereof, or a fragment thereof that contains an amino acid sequence TNNVLQVT. Methods of using the encoded protein for preserving progenitor cells in vitro, ex vivo, and in vivo are also described. The invention, therefore, include methods such as myeloablation therapies for cancer treatment wherein myeloid reconstitution is facilitated by means of the specified protein. Other therapeutic utilities are also enabled through the invention, for example, expanding progenitor cell populations ex vivo to increase chances of engraftation, improving conditions for transporting and storing progenitor cells, and facilitating gene therapy to treat and cure a broad range of life-threatening hematologic diseases.

Colucci, M. Gabriella (Dugenta, IT); Chrispeels, Maarten J. (La Jolla, CA); Moore, Jeffrey G. (New York, NY)

2001-10-30T23:59:59.000Z

74

Methods of combined bioprocessing and related microorganisms, thermophilic and/or acidophilic enzymes, and nucleic acids encoding said enzymes  

DOE Patents [OSTI]

A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.

Thompson, David N; Apel, William A; Thompson, Vicki S; Ward, Thomas E

2014-04-08T23:59:59.000Z

75

Methods of combined bioprocessing and related microorganisms, thermophilic and/or acidophilic enzymes, and nucleic acids encoding said enzymes  

DOE Patents [OSTI]

A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.

Thompson, David N; Apel, William A; Thompson, Vicki S; Ward, Thomas E

2013-07-23T23:59:59.000Z

76

Nucleic Acids Research, Vol. 20, No. 3 613 An alfalfa cDNA encodes a protein with similarity to  

E-Print Network [OSTI]

Nucleic Acids Research, Vol. 20, No. 3 613 An alfalfa cDNA encodes a protein with similarity to an understanding of the function of these proteins in RNA processing. We have isolated an alfalfa cDNA whose, the putative alfalfa protein is clearly related to the human snRNP-E protein. However, since the protein

Hirt, Heribert

77

Aptamer- and nucleic acid enzyme-based systems for simultaneous detection of multiple analytes  

DOE Patents [OSTI]

The present invention provides aptamer- and nucleic acid enzyme-based systems for simultaneously determining the presence and optionally the concentration of multiple analytes in a sample. Methods of utilizing the system and kits that include the sensor components are also provided. The system includes a first reactive polynucleotide that reacts to a first analyte; a second reactive polynucleotide that reacts to a second analyte; a third polynucleotide; a fourth polynucleotide; a first particle, coupled to the third polynucleotide; a second particle, coupled to the fourth polynucleotide; and at least one quencher, for quenching emissions of the first and second quantum dots, coupled to the first and second reactive polynucleotides. The first particle includes a quantum dot having a first emission wavelength. The second particle includes a second quantum dot having a second emission wavelength different from the first emission wavelength. The third polynucleotide and the fourth polynucleotide are different.

Lu, Yi (Champaign, IL); Liu, Juewen (Albuquerque, NM)

2011-11-15T23:59:59.000Z

78

Site-Selective Binding of Nanoparticles to Double-Stranded DNA via Peptide Nucleic Acid "Invasion"  

SciTech Connect (OSTI)

We demonstrate a novel method for by-design placement of nano-objects along double-stranded (ds) DNA. A molecular intercalator, designed as a peptide nucleic acid (PNA)-DNA chimera, is able to invade dsDNA at the PNA-side due to the hybridization specificity between PNA and one of the duplex strands. At the same time, the single-stranded (ss) DNA tail of the chimera, allows for anchoring of nano-objects that have been functionalized with complementary ssDNA. The developed method is applied for interparticle attachment and for the fabrication of particle clusters using a dsDNA template. This method significantly broadens the molecular toolbox for constructing nanoscale systems by including the most conventional not yet utilized DNA motif, double helix DNA.

Stadler, A.L.; van der Lelie, D.; Sun, D.; Maye, M. M.; Gang, O.

2011-04-01T23:59:59.000Z

79

Quantification of false positive reduction in nucleic acid purification on hemorrhagic fever DNA.  

SciTech Connect (OSTI)

Columbia University has developed a sensitive highly multiplexed system for genetic identification of nucleic acid targets. The primary obstacle to implementing this technology is the high rate of false positives due to high levels of unbound reporters that remain within the system after hybridization. The ability to distinguish between free reporters and reporters bound to targets limits the use of this technology. We previously demonstrated a new electrokinetic method for binary separation of kb pair long DNA molecules and oligonucleotides. The purpose of this project 99864 is to take these previous demonstrations and further develop the technique and hardware for field use. Specifically, our objective was to implement separation in a heterogeneous sample (containing target DNA and background oligo), to perform the separation in a flow-based device, and to develop all of the components necessary for field testing a breadboard prototype system.

James, Conrad D.; Pohl, Kenneth Roy; Derzon, Mark Steven; McClain, Jaime; Achyuthan, Komandoor

2006-11-01T23:59:59.000Z

80

1996 Oxford University Press 47094718Nucleic Acids Research, 1996, Vol. 24, No. 23 Logitlinear models for the prediction of splice sites in  

E-Print Network [OSTI]

© 1996 Oxford University Press 4709­4718Nucleic Acids Research, 1996, Vol. 24, No. 23 Logitlinear the degree of fit to some average signal pattern around known splice sites in a learning set (e.g., 3

Brendel, Volker

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using  

DOE Patents [OSTI]

A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers and probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity. 18 figs.

Weier, H.U.G.; Gray, J.W.

1995-06-27T23:59:59.000Z

82

BIO 548--NUCLEIC ACIDS AND PROTEIN SYNTHESIS--FALL 2014 Coursemaster  

E-Print Network [OSTI]

in organic chemistry, Cell Biology and Genetics is also very useful. Formal lectures in all areas of nucleic for the course. The listed books are recommended as sources of background information for the lectures

83

Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report  

SciTech Connect (OSTI)

The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, and analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: 1) to assess the potential terrorist threat to U.S. agricultural crops, 2) to determine whether suitable assays exist to monitor that threat, and 3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

Kingsley, Mark T.

2001-03-13T23:59:59.000Z

84

Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report  

SciTech Connect (OSTI)

The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, an d analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: (1) to assess the potential terrorist threat to U.S. agricultural crops, (2) to determine whether suitable assays exist to monitor that threat, and (3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

Kingsley, Mark T

2001-03-13T23:59:59.000Z

85

Human retroviruses and AIDS 1996. A compilation and analysis of nucleic acid and amino acid sequences  

SciTech Connect (OSTI)

This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (1) Nuclear Acid Alignments and Sequences; (2) Amino Acid Alignments; (3) Analysis; (4) Related Sequences; and (5) Database Communications. Information within all the parts is updated throughout the year on the Web site, http://hiv-web.lanl.gov. While this publication could take the form of a review or sequence monograph, it is not so conceived. Instead, the literature from which the database is derived has simply been summarized and some elementary computational analyses have been performed upon the data. Interpretation and commentary have been avoided insofar as possible so that the reader can form his or her own judgments concerning the complex information. In addition to the general descriptions of the parts of the compendium, the user should read the individual introductions for each part.

Myers, G.; Foley, B.; Korber, B. [eds.] [Los Alamos National Lab., NM (United States). Theoretical Div.] [eds.; Los Alamos National Lab., NM (United States). Theoretical Div.; Mellors, J.W. [ed.] [Univ. of Pittsburgh, PA (United States)] [ed.; Univ. of Pittsburgh, PA (United States); Jeang, K.T. [ed.] [National Institutes of Health, Bethesda, MD (United States). Molecular Virology Section] [ed.; National Institutes of Health, Bethesda, MD (United States). Molecular Virology Section; Wain-Hobson, S. [Pasteur Inst., Paris (France)] [ed.] [Pasteur Inst., Paris (France); ed.

1997-04-01T23:59:59.000Z

86

Does Water Play a Structural Role in the Folding of Small Nucleic Acids? Eric J. Sorin,* Young Min Rhee,* and Vijay S. Pande*yz  

E-Print Network [OSTI]

Does Water Play a Structural Role in the Folding of Small Nucleic Acids? Eric J. Sorin,* Young Min Rhee,* and Vijay S. Pande*yz Departments of *Chemistry and y Structural Biology, and z Stanford character of the solvent. Here we consider what role the discrete properties of water and ions play

Sorin, Eric J.

87

An unprecedented nucleic acid capture mechanism for excision of DNA damage  

SciTech Connect (OSTI)

DNA glycosylases that remove alkylated and deaminated purine nucleobases are essential DNA repair enzymes that protect the genome, and at the same time confound cancer alkylation therapy, by excising cytotoxic N3-methyladenine bases formed by DNA-targeting anticancer compounds. The basis for glycosylase specificity towards N3- and N7-alkylpurines is believed to result from intrinsic instability of the modified bases and not from direct enzyme functional group chemistry. Here we present crystal structures of the recently discovered Bacillus cereus AlkD glycosylase in complex with DNAs containing alkylated, mismatched and abasic nucleotides. Unlike other glycosylases, AlkD captures the extrahelical lesion in a solvent-exposed orientation, providing an illustration for how hydrolysis of N3- and N7-alkylated bases may be facilitated by increased lifetime out of the DNA helix. The structures and supporting biochemical analysis of base flipping and catalysis reveal how the HEAT repeats of AlkD distort the DNA backbone to detect non-Watson-Crick base pairs without duplex intercalation.

Rubinson, Emily H.; Prakasha Gowda, A.S.; Spratt, Thomas E.; Gold, Barry; Eichmanbrand, Brandt F. (Pitt); (Vanderbilt); (Penn)

2010-11-18T23:59:59.000Z

88

Supplementary Information An In Vitro Translation, Selection, and Amplification System for Peptide Nucleic Acids  

E-Print Network [OSTI]

% trifluoroacetic acid in water for 10 min at room temperature; (iv) reverse-phase HPLC purification of the MMTS1 Supplementary Information An In Vitro Translation, Selection, and Amplification System available reagents and solvents were purchased from Aldrich and used without further purification. All PNA

Liu, David R.

89

Accurate small and wide angle x-ray scattering profiles from atomic models of proteins and nucleic acids  

SciTech Connect (OSTI)

A new method is introduced to compute X-ray solution scattering profiles from atomic models of macromolecules. The three-dimensional version of the Reference Interaction Site Model (RISM) from liquid-state statistical mechanics is employed to compute the solvent distribution around the solute, including both water and ions. X-ray scattering profiles are computed from this distribution together with the solute geometry. We describe an efficient procedure for performing this calculation employing a Lebedev grid for the angular averaging. The intensity profiles (which involve no adjustable parameters) match experiment and molecular dynamics simulations up to wide angle for two proteins (lysozyme and myoglobin) in water, as well as the small-angle profiles for a dozen biomolecules taken from the BioIsis.net database. The RISM model is especially well-suited for studies of nucleic acids in salt solution. Use of fiber-diffraction models for the structure of duplex DNA in solution yields close agreement with the observed scattering profiles in both the small and wide angle scattering (SAXS and WAXS) regimes. In addition, computed profiles of anomalous SAXS signals (for Rb{sup +} and Sr{sup 2+}) emphasize the ionic contribution to scattering and are in reasonable agreement with experiment. In cases where an absolute calibration of the experimental data at q = 0 is available, one can extract a count of the excess number of waters and ions; computed values depend on the closure that is assumed in the solution of the Ornstein–Zernike equations, with results from the Kovalenko–Hirata closure being closest to experiment for the cases studied here.

Nguyen, Hung T. [BioMaPS Institute for Quantitative Biology, Rutgers University, Piscataway, New Jersey 08854 (United States); Pabit, Suzette A.; Meisburger, Steve P.; Pollack, Lois [School of Applied and Engineering Physics, Cornell University, Ithaca, New York 14853 (United States); Case, David A., E-mail: case@biomaps.rutgers.edu [BioMaPS Institute for Quantitative Biology, Rutgers University, Piscataway, New Jersey 08854 (United States); Department of Chemistry and Chemical Biology, Rutgers University, Piscataway, New Jersey 08854 (United States)

2014-12-14T23:59:59.000Z

90

Nucleic acid molecules encoding isopentenyl monophosphate kinase, and methods of use  

DOE Patents [OSTI]

A cDNA encoding isopentenyl monophosphate kinase (IPK) from peppermint (Mentha x piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of isopentenyl monophosphate kinase (SEQ ID NO:2), from peppermint (Mentha x piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for isopentenyl monophosphate kinase, or for a base sequence sufficiently complementary to at least a portion of isopentenyl monophosphate kinase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding isopentenyl monophosphate kinase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant isopentenyl monophosphate kinase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant isopentenyl monophosphate kinase may be used to obtain expression or enhanced expression of isopentenyl monophosphate kinase in plants in order to enhance the production of isopentenyl monophosphate kinase, or isoprenoids derived therefrom, or may be otherwise employed for the regulation or expression of isopentenyl monophosphate kinase, or the production of its products.

Croteau, Rodney B. (Pullman, WA); Lange, Bernd M. (Pullman, WA)

2001-01-01T23:59:59.000Z

91

Nucleic and amino acid sequences relating to a novel transketolase, and methods for the expression thereof  

DOE Patents [OSTI]

cDNAs encoding 1-deoxyxylulose-5-phosphate synthase from peppermint (Mentha piperita) have been isolated and sequenced, and the corresponding amino acid sequences have been determined. Accordingly, isolated DNA sequences (SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7) are provided which code for the expression of 1-deoxyxylulose-5-phosphate synthase from plants. In another aspect the present invention provides for isolated, recombinant DXPS proteins, such as the proteins having the sequences set forth in SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:8. In other aspects, replicable recombinant cloning vehicles are provided which code for plant 1-deoxyxylulose-5-phosphate synthases, or for a base sequence sufficiently complementary to at least a portion of 1-deoxyxylulose-5-phosphate synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding a plant 1-deoxyxylulose-5-phosphate synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant 1-deoxyxylulose-5-phosphate synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant 1-deoxyxylulose-5-phosphate synthase may be used to obtain expression or enhanced expression of 1-deoxyxylulose-5-phosphate synthase in plants in order to enhance the production of 1-deoxyxylulose-5-phosphate, or its derivatives such as isopentenyl diphosphate (BP), or may be otherwise employed for the regulation or expression of 1-deoxyxylulose-5-phosphate synthase, or the production of its products.

Croteau, Rodney Bruce (Pullman, WA); Wildung, Mark Raymond (Colfax, WA); Lange, Bernd Markus (Pullman, WA); McCaskill, David G. (Pullman, WA)

2001-01-01T23:59:59.000Z

92

Nucleic acid isolation  

DOE Patents [OSTI]

A method is provided for isolating DNA from eukaryotic cell and flow sorted chromosomes. When DNA is removed from chromosome and cell structure, detergent and proteolytic digestion products remain with the DNA. These products can be removed with organic extraction, but the process steps associated with organic extraction reduces the size of DNA fragments available for experimental use. The present process removes the waste products by dialyzing a solution containing the DNA against a solution containing polyethylene glycol (PEG). The waste products dialyze into the PEG leaving isolated DNA. The remaining DNA has been prepared with fragments containing more than 160 kb. The isolated DNA has been used in conventional protocols without effect on the protocol.

Longmire, J.L.; Lewis, A.K.; Hildebrand, C.E.

1988-01-21T23:59:59.000Z

93

Nucleic acid isolation process  

DOE Patents [OSTI]

A method is provided for isolating DNA from eukaryotic cell and flow sorted chromosomes. When DNA is removed from chromosome and cell structure, detergent and proteolytic digestion products remain with the DNA. These products can be removed with organic extraction, but the process steps associated with organic extraction reduce the size of DNA fragments available for experimental use. The present process removes the waste products by dialyzing a solution containing the DNA against a solution containing polyethylene glycol (PEG). The waste products dialyze into the PEG leaving isolated DNA. The remaining DNA has been prepared with fragments containing more than 160 kb. The isolated DNA has been used in conventional protocols without affect on the protocol.

Longmire, Jonathan L. (Los Alamos, NM); Lewis, Annette K. (La Jolla, CA); Hildebrand, Carl E. (Los Alamos, NM)

1990-01-01T23:59:59.000Z

94

Nucleic acid biosensors  

DOE Patents [OSTI]

Sensors comprising aptazymes capable of detecting the presence and concentration of effectors, as well as methods of using such sensors, are disclosed.

Lu, Yi (Champaign, IL); Liu, Juewen (Urbana, IL)

2009-11-03T23:59:59.000Z

95

Synthesis, Improved Antisense Activity and Structural Rationale for the Divergent RNA Affinities of 3;#8242;-Fluoro Hexitol Nucleic Acid (FHNA and Ara-FHNA) Modified Oligonucleotides  

SciTech Connect (OSTI)

The synthesis, biophysical, structural, and biological properties of both isomers of 3'-fluoro hexitol nucleic acid (FHNA and Ara-FHNA) modified oligonucleotides are reported. Synthesis of the FHNA and Ara-FHNA thymine phosphoramidites was efficiently accomplished starting from known sugar precursors. Optimal RNA affinities were observed with a 3'-fluorine atom and nucleobase in a trans-diaxial orientation. The Ara-FHNA analog with an equatorial fluorine was found to be destabilizing. However, the magnitude of destabilization was sequence-dependent. Thus, the loss of stability is sharply reduced when Ara-FHNA residues were inserted at pyrimidine-purine (Py-Pu) steps compared to placement within a stretch of pyrimidines (Py-Py). Crystal structures of A-type DNA duplexes modified with either monomer provide a rationalization for the opposing stability effects and point to a steric origin of the destabilization caused by the Ara-FHNA analog. The sequence dependent effect can be explained by the formation of an internucleotide C-F {hor_ellipsis} H-C pseudo hydrogen bond between F3' of Ara-FHNA and C8-H of the nucleobase from the 3'-adjacent adenosine that is absent at Py-Py steps. In animal experiments, FHNA-modified antisense oligonucleotides formulated in saline showed a potent downregulation of gene expression in liver tissue without producing hepatotoxicity. Our data establish FHNA as a useful modification for antisense therapeutics and also confirm the stabilizing influence of F(Py) {hor_ellipsis} H-C(Pu) pseudo hydrogen bonds in nucleic acid structures.

Egli, Martin; Pallan, Pradeep S.; Allerson, Charles R.; Prakash, Thazha P.; Berdeja, Andres; Yu, Jinghua; Lee, Sam; Watt, Andrew; Gaus, Hans; Bhat, Balkrishen; Swayze, Eric E.; Seth, Punit P. (Isis Pharm.); (Vanderbilt)

2012-03-16T23:59:59.000Z

96

acid adenine dinucleotide: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Theoretical Determination of One-Electron Oxidation Potentials for Nucleic Acid Bases Brian T potentials for N-methyl substituted nucleic acid bases guanine, adenine, cytosine,...

97

Structural Rationalization of a Large Difference in RNA Affinity Despite a Small Difference in Chemistry between Two 2'-O-Modified Nucleic Acid Analogs  

SciTech Connect (OSTI)

Chemical modification of nucleic acids at the 2'-position of ribose has generated antisense oligonucleotides (AONs) with a range of desirable properties. Electron-withdrawing substituents such as 2'-O-[2-(methoxy)ethyl] (MOE) confer enhanced RNA affinity relative to that of DNA by conformationally preorganizing an AON for pairing with the RNA target and by improving backbone hydration. 2'-Substitution of the ribose has also been shown to increase nuclease resistance and cellular uptake via changes in lipophilicity. Interestingly, incorporation of either 2'-O-[2-(methylamino)-2-oxoethyl]- (NMA) or 2'-O-(N-methylcarbamate)-modified (NMC) residues into AONs has divergent effects on RNA affinity. Incorporation of 2'-O-NMA-T considerably improves RNA affinity while incorporation of 2'-O-NMC-T drastically reduces RNA affinity. Crystal structures at high resolution of A-form DNA duplexes containing either 2'-O-NMA-T or 2'-O-NMC-T shed light on the structural origins of the surprisingly large difference in stability given the relatively minor difference in chemistry between NMA and NMC. NMA substituents adopt an extended conformation and use either their carbonyl oxygen or amino nitrogen to trap water molecules between phosphate group and sugar. The conformational properties of NMA and the observed hydration patterns are reminiscent of those found in the structures of 2'-O-MOE-modified RNA. Conversely, the carbonyl oxygen of NMC and O2 of T are in close contact, providing evidence that an unfavorable electrostatic interaction and the absence of a stable water structure are the main reasons for the loss in thermodynamic stability as a result of incorporation of 2'-O-NMC-modified residues.

Pattanayek, R.; Sethaphong, L.; Pan, C.; Prhavc, M.; Prakash, T.P.; Manoharan, M.; Egli, M. (Tennessee); (Isis Pharmaceuticals Inc.); (Alnylam Pharmaceuticals,); (Vanderbilt)

2010-03-08T23:59:59.000Z

98

Human Retroviruses and AIDS. A compilation and analysis of nucleic acid and amino acid sequences: I--II; III--V  

SciTech Connect (OSTI)

This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (I) HIV and SIV Nucleotide Sequences; (II) Amino Acid Sequences; (III) Analyses; (IV) Related Sequences; and (V) Database Communications. Information within all the parts is updated at least twice in each year, which accounts for the modes of binding and pagination in the compendium.

Myers, G.; Korber, B. [eds.] [Los Alamos National Lab., NM (United States)] [eds.; Los Alamos National Lab., NM (United States); Wain-Hobson, S. [ed.] [Laboratory of Molecular Retrovirology, Pasteur Inst.] [ed.; Laboratory of Molecular Retrovirology, Pasteur Inst.; Smith, R.F. [ed.] [Baylor Coll. of Medicine, Houston, TX (United States). Dept. of Pharmacology] [ed.; Baylor Coll. of Medicine, Houston, TX (United States). Dept. of Pharmacology; Pavlakis, G.N. [ed.] [National Cancer Inst., Frederick, MD (United States). Cancer Research Facility] [ed.; National Cancer Inst., Frederick, MD (United States). Cancer Research Facility

1993-12-31T23:59:59.000Z

99

Geochemical Rate/RNA Integration Study (GRIST): A Pilot Field Experiment for Inter-Calibration of Biogeochemistry and Nucleic Acid Measurements Final Report  

SciTech Connect (OSTI)

The Geochemical Rate/RNA Integration Study (GRIST) project sought to correlate biogeochemical flux rates with measurements of gene expression and mRNA abundance to demonstrate the application of molecular approaches to estimate the presence and magnitude of a suite of biogeochemical processes. The study was headed by Lee Kerkhoff of Rutgers University. In this component of the GRIST study, we characterized ambient nutrient concentrations and measured uptake rates for dissolved inorganic nitrogen (DIN, ammonium, nitrate and nitrite) and dissolved organic nitrogen (urea and dissolved free amino acids) during two diel studies at the Long-Term Ecosystem Observatory (LEO-15) on the New Jersey continental shelf.

Bronk, Deborah

2007-01-08T23:59:59.000Z

100

Final Scientific/Technical Report, DE-FG02-06ER64171, Integrated Nucleic Acid System for In-Field Monitoring of Microbial Community Dynamics and Metabolic Activity – Subproject to Co-PI Eric E. Roden  

SciTech Connect (OSTI)

This report summarizes research conducted in conjunction with a project entitled “Integrated Nucleic Acid System for In-Field Monitoring of Microbial Community Dynamics and Metabolic Activity”, which was funded through the Integrative Studies Element of the former NABIR Program (now the Environmental Remediation Sciences Program) within the Office of Biological and Environmental Research. Dr. Darrell Chandler (originally at Argonne National Laboratory, now with Akonni Biosystems) was the overall PI/PD for the project. The overall project goals were to (1) apply a model iron-reducer and sulfate-reducer microarray and instrumentation systems to sediment and groundwater samples from the Scheibe et al. FRC Area 2 field site, UMTRA sediments, and other DOE contaminated sites; (2) continue development and expansion of a 16S rRNA/rDNA¬-targeted probe suite for microbial community dynamics as new sequences are obtained from DOE-relevant sites; and (3) address the fundamental molecular biology and analytical chemistry associated with the extraction, purification and analysis of functional genes and mRNA in environmental samples. Work on the UW subproject focused on conducting detailed batch and semicontinuous culture reactor experiments with uranium-contaminated FRC Area 2 sediment. The reactor experiments were designed to provide coherent geochemical and microbiological data in support of microarray analyses of microbial communities in Area 2 sediments undergoing biostimulation with ethanol. A total of four major experiments were conducted (one batch and three semicontinuous culture), three of which (the batch and two semicontinuous culture) provided samples for DNA microarray analysis. A variety of other molecular analyses (clone libraries, 16S PhyloChip, RT-PCR, and T-RFLP) were conducted on parallel samples from the various experiments in order to provide independent information on microbial community response to biostimulation.

Eric E. Roden

2009-07-08T23:59:59.000Z

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

B-DNA structure is intrinsically polymorphic: even at the level of base pair positions  

SciTech Connect (OSTI)

Increasingly exact measurement of single crystal X-ray diffraction data offers detailed characterization of DNA conformation, hydration and electrostatics. However, instead of providing a more clear and unambiguous image of DNA, highly accurate diffraction data reveal polymorphism of the DNA atomic positions and conformation and hydration. Here we describe an accurate X-ray structure of B-DNA, painstakingly fit to a multistate model that contains multiple competing positions of most of the backbone and of entire base pairs. Two of ten base-pairs of CCAGGCCTGG are in multiple states distinguished primarily by differences in slide. Similarly, all the surrounding ions are seen to fractionally occupy discrete competing and overlapping sites. And finally, the vast majority of water molecules show strong evidence of multiple competing sites. Conventional resolution appears to give a false sense of homogeneity in conformation and interactions of DNA. In addition, conventional resolution yields an average structure that is not accurate, in that it is different from any of the multiple discrete structures observed at high resolution. Because base pair positional heterogeneity has not always been incorporated into model-building, even some high and ultrahigh-resolution structures of DNA do not indicate the full extent of conformational polymorphism.

Maehigashi, Tatsuya; Hsiao, Chiaolong; Woods, Kristen Kruger; Moulaei, Tinoush; Hud, Nicholas V.; Williams, Loren Dean (GIT)

2012-10-23T23:59:59.000Z

102

Nucleic acids encoding a cellulose binding domain  

DOE Patents [OSTI]

A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production thereof. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques.

Shoseyov, Oded (Karmey Yosef, IL); Shpiegl, Itai (Rehovot, IL); Goldstein, Marc A. (Davis, CA); Doi, Roy H. (Davis, CA)

1996-01-01T23:59:59.000Z

103

Nucleic acids encoding a cellulose binding domain  

DOE Patents [OSTI]

A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques. 15 figs.

Shoseyov, O.; Shpiegl, I.; Goldstein, M.A.; Doi, R.H.

1996-03-05T23:59:59.000Z

104

Ramon Eritja Nucleic Acid Chemistry Group  

E-Print Network [OSTI]

, IQAC-CSIC, CIBER-BBN DNA and RNA in Biophysics #12;DNA and RNA Synthesis tetrazol + (CH2)2(CH2)2 R R R

Ritort, Felix

105

Diagnostic method employing MSH2 nucleic acids  

DOE Patents [OSTI]

The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

de la Chapelle, Albert (Helsingfors, FI); Vogelstein, Bert (Baltimore, MD); Kinzler, Kenneth W. (Baltimore, MD)

1997-01-01T23:59:59.000Z

106

Diagnostic method employing MSH2 nucleic acids  

DOE Patents [OSTI]

The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +}(RER{sup +}) tumor cells. 19 figs.

Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.

1997-12-02T23:59:59.000Z

107

Fatty acid-producing hosts  

DOE Patents [OSTI]

Described are hosts for overproducing a fatty acid product such as a fatty acid. The hosts include an exogenous nucleic acid encoding a thioesterase and, optionally, an exogenous nucleic acid encoding an acetyl-CoA carboxylase, wherein an acyl-CoA synthetase in the hosts are functionally delected. The hosts prefereably include the nucleic acid encoding the thioesterase at an intermediate copy number. The hosts are preferably recominantly stable and growth-competent at 37.degree. C. Methods of producing a fatty acid product comprising culturing such hosts at 37.degree. C. are also described.

Pfleger, Brian F; Lennen, Rebecca M

2013-12-31T23:59:59.000Z

108

E-Print Network 3.0 - acids amino acids Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

State University Collection: Biology and Medicine 77 CHE 427627 THE ORGANIC CHEMISTRY OF BIOLOGICAL MOLECULES Summary: macromolecules: carbohydrates, amino acids, nucleic...

109

E-Print Network 3.0 - acid amino acid Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

State University Collection: Biology and Medicine 77 CHE 427627 THE ORGANIC CHEMISTRY OF BIOLOGICAL MOLECULES Summary: macromolecules: carbohydrates, amino acids, nucleic...

110

E-Print Network 3.0 - anthranilic acid derivatives Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

This acid has been used... -specific nucleic acid ligands via affinity ... Source: Beal, Peter A. - Department of Chemistry, University of Utah Collection: Chemistry 26 Direct...

111

acids structures applied: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Treatment of software French, James C. 5 Parsing nucleic acid pseudoknotted secondary structure: algorithm and applications Computer Technologies and Information Sciences...

112

acid biosensor based: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

biosensors of nucleic acids and proteins for point- of-care (POC. The merger of microfluidics and advanced biosensor technolo- gies offers new promises for POC diagnostics...

113

E-Print Network 3.0 - acid chelate derivatives Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Ca21 and Mg21 by phosphates and nucleic acids. We describe coordination chemistry Source: Williams, Loren - School of Chemistry and Biochemistry, Georgia Institute of Technology...

114

E-Print Network 3.0 - acid hybridization probes Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

tion to hybridization and wash... or the extent to which nucleic acid ... Source: Kelly, John J. - Department of Biology, Loyola University Chicago Collection: Environmental...

115

E-Print Network 3.0 - acid regulates gene Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

DNA binding domain or partner domain type Summary: of the Bipartite response regulator FIS-like Nucleic acid-binding proteins Distribution of DBDs in the TF... R + + + + + ...

116

E-Print Network 3.0 - acid negatively regulates Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

DNA binding domain or partner domain type Summary: of the Bipartite response regulator FIS-like Nucleic acid-binding proteins Distribution of DBDs in the TF... R + + + + + ...

117

E-Print Network 3.0 - acid catabolic pathway Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

metabolism of nutrients1 Summary: , and cell cultures to investigate the interconnectivity of the pathways of macronutrient and nucleic acid... -labeled car- bon skeletons...

118

Structure of the 2-Aminopurine-Cytosine Base Pair Formed in the Polymerase Active Site of the RB69 Y567A-DNA Polymerase  

SciTech Connect (OSTI)

The adenine base analogue 2-aminopurine (2AP) is a potent base substitution mutagen in prokaryotes because of its enhanceed ability to form a mutagenic base pair with an incoming dCTP. Despite more than 50 years of research, the structure of the 2AP-C base pair remains unclear. We report the structure of the 2AP-dCTP base pair formed within the polymerase active site of the RB69 Y567A-DNA polymerase. A modified wobble 2AP-C base pair was detected with one H-bond between N1 of 2AP and a proton from the C4 amino group of cytosine and an apparent bifurcated H-bond between a proton on the 2-amino group of 2-aminopurine and the ring N3 and O2 atoms of cytosine. Interestingly, a primer-terminal region rich in AT base pairs, compared to GC base pairs, facilitated dCTP binding opposite template 2AP. We propose that the increased flexibility of the nucleotide binding pocket formed in the Y567A-DNA polymerase and increased 'breathing' at the primer-terminal junction of A+T-rich DNA facilitate dCTP binding opposite template 2AP. Thus, interactions between DNA polymerase residues with a dynamic primer-terminal junction play a role in determining base selectivity within the polymerase active site of RB69 DNA polymerase.

Reha-Krantz, Linda J.; Hariharan, Chithra; Subuddhi, Usharani; Xia, Shuangluo; Zhao, Chao; Beckman, Jeff; Christian, Thomas; Konigsberg, William (Yale); (Alberta)

2011-11-21T23:59:59.000Z

119

Plant fatty acid hydroxylase  

DOE Patents [OSTI]

The present invention relates to the identification of nucleic acid sequences and constructs, and methods related thereto, and the use of these sequences and constructs to produce genetically modified plants for the purpose of altering the composition of plant oils, waxes and related compounds.

Somerville, Chris (Portola Valley, CA); van de Loo, Frank (Lexington, KY)

2000-01-01T23:59:59.000Z

120

Thermal and acid tolerant beta-xylosidases, genes encoding, related organisms, and methods  

DOE Patents [OSTI]

Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof are provided. Further provided are methods of at least partially degrading xylotriose and/or xylobiose using isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof.

Thompson, David N. (Idaho Falls, ID); Thompson, Vicki S. (Idaho Falls, ID); Schaller, Kastli D. (Ammon, ID); Apel, William A. (Jackson, WY); Lacey, Jeffrey A. (Idaho Falls, ID); Reed, David W. (Idaho Falls, ID)

2011-04-12T23:59:59.000Z

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Thermal and acid tolerant beta xylosidases, arabinofuranosidases, genes encoding, related organisms, and methods  

DOE Patents [OSTI]

Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof are provided. Further provided are methods of at least partially degrading xylotriose, xylobiose, and/or arabinofuranose-substituted xylan using isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof.

Thompson, David N; Thompson, Vicki S; Schaller, Kastli D; Apel, William A; Reed, David W; Lacey, Jeffrey A

2013-04-30T23:59:59.000Z

122

Targeting unique nucleic acid structures with small molecules  

E-Print Network [OSTI]

2 min and then flash cooling on ice for 2 min. Incubated atfor 2 min then flash cooling on ice for 2 min. The extendedminutes, followed by flash cooling on ice for 2 minutes. The

Tam, Victor Kin-man

2007-01-01T23:59:59.000Z

123

Targeting unique nucleic acid structures with small molecules  

E-Print Network [OSTI]

of mono- and disubstitued anthraquinone derivatives with anat opposite ends of the anthraquinone scaffold are employed.

Tam, Victor Kin-man

2007-01-01T23:59:59.000Z

124

E-Print Network 3.0 - acid pdb entries Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

, nucleic acids, and other biological macro- molecules 1-3. The PDB has a 27-year history of service... entries include amino acid or nucle- ... Source: Sussman, Joel L. -...

125

E-Print Network 3.0 - acid utilization final Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

active with 18:1. In plants containing... nucleic acids were resuspended in water. Lithium chloride was then added to a final concentration of 2 m... Fatty Acids1 Hangsik Moon2...

126

Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2;#8242;-deoxyadenosine:dT Base Pairing in DNA  

SciTech Connect (OSTI)

As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 {angstrom} resolution in the presence of Mg{sup 2+}. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA.

Kowal, Ewa A.; Ganguly, Manjori; Pallan, Pradeep S.; Marky, Luis A.; Gold, Barry; Egli, Martin; Stone, Michael P. (Pitt); (Vanderbilt); (Nebraska-Med)

2012-02-15T23:59:59.000Z

127

Producing dicarboxylic acids using polyketide synthases  

DOE Patents [OSTI]

The present invention provides for a polyketide synthase (PKS) capable of synthesizing a dicarboxylic acid (diacid). Such diacids include diketide-diacids and triketide-diacids. The invention includes recombinant nucleic acid encoding the PKS, and host cells comprising the PKS. The invention also includes methods for producing the diacids.

Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D

2013-10-29T23:59:59.000Z

128

E-Print Network 3.0 - acid house juergen Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Division of Cell Biology and Immunology, HZI Summary: , Karst U, Fischer E, Wehland J, Jansch L. Nucleic Acids Res. 2006; 34(Database issue):D402-6. Jenzora A... Research (HZI)...

129

acid amplification test: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

amplification test First Page Previous Page 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Next Page Last Page Topic Index 1 Diagnostic Accuracy of Nucleic Acid...

130

Beta-alanine/alpha-ketoglutarate aminotransferase for 3-hydroxypropionic acid production  

DOE Patents [OSTI]

The present disclosure provides novel beta-alanine/alpha ketoglutarate aminotransferase nucleic acid and protein sequences having increased biological activity. Also provided are cells containing such enzymes, as well as methods of their use, for example to produce malonyl semialdehyde and downstream products thereof, such as 3-hydroxypropionic acid and derivatives thereof.

Jessen, Holly Jean (Chanhassen, MN); Liao, Hans H. (Eden Prairie, MN); Gort, Steven John (Apple Valley, MN); Selifonova, Olga V. (Plymouth, MN)

2011-10-04T23:59:59.000Z

131

Beta-alanine/alpha-ketoglutarate aminotransferase for 3-hydroxypropionic acid production  

SciTech Connect (OSTI)

The present disclosure provides novel beta-alanine/alpha ketoglutarate aminotransferase nucleic acid and protein sequences having increased biological activity. Also provided are cells containing such enzymes, as well as methods of their use, for example to produce malonyl semialdehyde and downstream products thereof, such as 3-hydroxypropionic acid and derivatives thereof.

Jessen, Holly Jean; Liao, Hans H; Gort, Steven John; Selifonova, Olga V

2014-11-18T23:59:59.000Z

132

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus  

SciTech Connect (OSTI)

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Yeo, Hyun Koo; Lee, Jae Young (Dongguk)

2012-04-18T23:59:59.000Z

133

Xylanases, nucleic acids encoding them and methods for making and using them  

DOE Patents [OSTI]

The invention relates to enzymes having xylanase, mannanase and/or glucanase activity, e.g., catalyzing hydrolysis of internal .beta.-1,4-xylosidic linkages or endo-.beta.-1,4-glucanase linkages; and/or degrading a linear polysaccharide beta-1,4-xylan into xylose. Thus, the invention provides methods and processes for breaking down hemicellulose, which is a major component of the cell wall of plants, including methods and processes for hydrolyzing hemicelluloses in any plant or wood or wood product, wood waste, paper pulp, paper product or paper waste or byproduct. In addition, methods of designing new xylanases, mannanases and/or glucanases and methods of use thereof are also provided. The xylanases, mannanases and/or glucanases have increased activity and stability at increased pH and temperature.

Gray, Kevin A; Dirmeier, Reinhard

2013-07-16T23:59:59.000Z

134

BGL7 beta-glucosidase and nucleic acids encoding the same  

DOE Patents [OSTI]

The present invention provides BGL7 polypeptides with the biological activity of a .beta.-glucosidase and a method of producing a recombinant enzyme having .beta.-glucosidase activity.

Dunn-Coleman, Nigel (Los Gatos, CA); Ward, Michael (San Francisco, CA)

2012-03-13T23:59:59.000Z

135

Nucleic acid encoding a self-assembling split-fluorescent protein system  

DOE Patents [OSTI]

The invention provides a protein labeling and detection system based on self-complementing fragments of fluorescent and chromophoric proteins. The system of the invention is exemplified with various combinations of self-complementing fragments derived from Aequorea victoria Green Fluorescent Protein (GFP), which are used to detect and quantify protein solubility in multiple assay formats, both in vitro and in vivo.

Waldo, Geoffrey S. (Santa Fe, NM); Cabantous, Stephanie (Los Alamos, NM)

2011-06-07T23:59:59.000Z

136

Nucleic acid encoding a self-assembling split-fluorescent protein system  

DOE Patents [OSTI]

The invention provides a protein labeling and detection system based on self-complementing fragments of fluorescent and chromophoric proteins. The system of the invention is exemplified with various combinations of self-complementing fragments derived from Aequorea victoria Green Fluorescent Protein (GFP), which are used to detect and quantify protein solubility in multiple assay formats, both in vitro and in vivo.

Waldo, Geoffrey S; Cabantous, Stephanie

2014-04-01T23:59:59.000Z

137

Cellulolytic enzymes, nucleic acids encoding them and methods for making and using them  

DOE Patents [OSTI]

The invention provides polypeptides having any cellulolytic activity, e.g., a cellulase activity, a endoglucanase, a cellobiohydrolase, a beta-glucosidase, a xylanase, a mannanse, a .beta.-xylosidase, an arabinofuranosidase, and/or an oligomerase activity, polynucleotides encoding these polypeptides, and methods of making and using these polynucleotides and polypeptides. In one aspect, the invention is directed to polypeptides having any cellulolytic activity, e.g., a cellulase activity, e.g., endoglucanase, cellobiohydrolase, beta-glucosidase, xylanase, mannanse, .beta.-xylosidase, arabinofuranosidase, and/or oligomerase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. In one aspect, the invention provides polypeptides having an oligomerase activity, e.g., enzymes that convert recalcitrant soluble oligomers to fermentable sugars in the saccharification of biomass. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts. The invention also provides compositions or products of manufacture comprising mixtures of enzymes comprising at least one enzyme of this invention.

Gray, Kevin A. (San Diego, CA); Zhao, Lishan (Emeryville, CA); Cayouette, Michelle H. (San Diego, CA)

2012-01-24T23:59:59.000Z

138

On-line microdialysis sample cleanup for electrospray ionization mass spectrometry of nucleic acid samples  

SciTech Connect (OSTI)

A major limitation of electrospray ionization mass spectrometry (ESI-MS) for oligonucleotide analysis arises due to sodium adduction, a problem that increases with molecular weight. Sodium adduction can preclude useful measurements when limited sample sizes prevent off-line cleanup. A novel and generally useful on-line microdialysis technique is described for the rapid (nearly 1-5 min) DNA sample cleanup for ESI-MS. Mass spectra of oligonucleotides of different size and sequence showing no significant sodium adduct peaks were obtained using the on-line microdialysis system with sodium chloride concentrations as high as 250 mM. Signal-to-noise ratios were also greatly enhanced compared to direct infusion of the original samples. By using ammonium acetate as the dialysis buffer, it was also found that the noncovalent association of double-stranded oligonucleotides could be preserved during the microdialysis process, allowing analysis by ESI-MS. 33 refs., 6 figs.

Liu, C.; Wu, Q.; Harms, A.C.; Smith, R.D. [Pacific Northwest National Lab., Richland, WA (United States)] [Pacific Northwest National Lab., Richland, WA (United States)

1996-09-15T23:59:59.000Z

139

Enhanced Functional Potential of Nucleic Acid Aptamer Libraries Patterned to Increase Secondary Structure  

E-Print Network [OSTI]

the formation of stem-loop structures without imposing any specific sequence or secondary structural requirement carbon-carbon bond formation,3,4 and oxidation or reduction.5 In addition to ac- celerating chemical

Liu, David R.

140

Detection of nucleic acids by graphene-based devices: A first-principles study  

SciTech Connect (OSTI)

Based on first-principles quantum transport calculations, we design a graphene-based biosensor device, which is composed of graphene nanoribbons electrodes and a biomolecule. It is found that when different nucleobases or poly nucleobase chains are located in the nanogap, the device presents completely different transport properties, showing different current informations. And the change of currents from 2 to 5 orders of magnitude for four different nucleobases suggests a great ability of discrimination by utilizing such a device. The physical mechanism of this phenomenon originates from their different chemical composition and structure. Moreover, we also explore the coupling effect of several neighboring bases and the size effect of the nanogap on transport properties. Our results show the possibility of rapid sequencing DNA by measuring such a transverse-current of the device, and provide a new idea for sequencing DNA.

Zhang, Hua [School of Physics and Electronics, Central South University, Changsha 410083 (China); School of Physics and Electronic Science, Changsha University of Science and Technology, Changsha 410114 (China); Xu, Hui, E-mail: xuhui@csu.edu.cn, E-mail: ouyangfp06@tsinghua.org.cn; Ni, Xiang; Lin Peng, Sheng; Liu, Qi; Ping OuYang, Fang, E-mail: xuhui@csu.edu.cn, E-mail: ouyangfp06@tsinghua.org.cn [School of Physics and Electronics, Central South University, Changsha 410083 (China)

2014-04-07T23:59:59.000Z

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Nucleic acids encoding phloem small RNA-binding proteins and transgenic plants comprising them  

DOE Patents [OSTI]

The present invention provides a polynucleotide sequence encoding a component of the protein machinery involved in small RNA trafficking, Cucurbita maxima phloem small RNA-binding protein (CmPSRB 1), and the corresponding polypeptide sequence. The invention also provides genetic constructs and transgenic plants comprising the polynucleotide sequence encoding a phloem small RNA-binding protein to alter (e.g., prevent, reduce or elevate) non-cell autonomous signaling events in the plants involving small RNA metabolism. These signaling events are involved in a broad spectrum of plant physiological and biochemical processes, including, for example, systemic resistance to pathogens, responses to environmental stresses, e.g., heat, drought, salinity, and systemic gene silencing (e.g., viral infections).

Lucas, William J.; Yoo, Byung-Chun; Lough, Tony J.; Varkonyi-Gasic, Erika

2007-03-13T23:59:59.000Z

142

Nucleic Acids Research doi:10.1093/nar/gkn305  

E-Print Network [OSTI]

server for rapidly generating accurate 3D protein structures using only assigned nuclear magnetic no NOE and/or J-coupling data to perform its calculations. CS23D accepts chemical shift files in either. Tests conducted on more than 100 proteins from the BioMagResBank indicate that CS23D converges (i

Lin, Guohui

143

Cellulases, nucleic acids encoding them and methods for making and using them  

DOE Patents [OSTI]

This invention relates to molecular and cellular biology and biochemistry. In one aspect, the invention provides polypeptides having cellulase activity, e.g., endoglucanase, cellobiohydrolase, mannanase and/or .beta.-glucosidase activity, polynucleotides encoding these polypeptides, and methods of making and using these polynucleotides and polypeptides. In one aspect, the invention is directed to polypeptides cellulase activity, e.g., endoglucanase, cellobiohydrolase, mannanase and/or .beta.-glucosidase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts.

Blum, David; Gemsch Cuenca, Joslin; Dycaico, Mark

2013-04-23T23:59:59.000Z

144

Y chromosome specific nucleic acid probe and method for determining the Y chromosome in situ  

DOE Patents [OSTI]

A method for producing a Y chromosome specific probe selected from highly repeating sequences on that chromosome is described. There is little or no nonspecific binding to autosomal and X chromosomes, and a very large signal is provided. Inventive primers allowing the use of PCR for both sample amplification and probe production are described, as is their use in producing large DNA chromosome painting sequences. 9 figs.

Gray, J.W.; Weier, H.U.

1998-11-24T23:59:59.000Z

145

Y chromosome specific nucleic acid probe and method for identifying the Y chromosome in SITU  

DOE Patents [OSTI]

A method for producing a Y chromosome specific probe selected from highly repeating sequences on that chromosome is described. There is little or no nonspecific binding to autosomal and X chromosomes, and a very large signal is provided. Inventive primers allowing the use of PCR for both sample amplification and probe production are described, as is their use in producing large DNA chromosome painting sequences. 9 figs.

Gray, J.W.; Weier, H.U.

1999-03-30T23:59:59.000Z

146

Nucleic Acids Research doi:10.1093/nar/gkn465  

E-Print Network [OSTI]

is a histone acetyltransferase implicated in the regulation of transcriptional silencing, and ORC is the six the temperature sensitivity of the ORC mutants orc2-1 and orc5-1. Moreover, sas2D and orc2-1 have a synthetic and orc5-1 have a synthetic effect on transcriptional silencing at the HMR locus. Moreover, we demon

Bi, Xin

147

Probing structural heterogeneities and fluctuations of nucleic acids and denatured proteins  

E-Print Network [OSTI]

polyelec- trolytes and protein folding in particular, standsdynamics ? protein folding ? single-molecule ?uorescencestructure and dynamics. Protein folding is the most spec-

Laurence, T A; Kong, X X; Jager, M; Weiss, S

2005-01-01T23:59:59.000Z

148

A HANDHELD MAGNETIC SENSING PLATFORM FOR ANTIGEN AND NUCLEIC ACID DETECTION  

E-Print Network [OSTI]

of manufacturing development for superior reliability, scalability, and low-cost. The electrical details cable for communication and power. (b) Disposable Cartridge. The disposable cartridge consists of an electrically connected integrated circuit chip inside a polypropylene well. (c) Chip Surface after Immunoassay

Weinreb, Sander

149

MOLPROBITY: structure validation and all-atom contact analysis for nucleic acids and their complexes  

E-Print Network [OSTI]

is the addition and full optimization of all hydrogen atoms, bothpolar and nonpolar.The results are reported. The all-atom contact analysis (7) featured on the MOLPROBITY site provides a simple but powerful system uses the information from both hydro- gen bonding and all-atom steric compatibility to fully

Richardson, David

150

Single-molecule characterization and engineering of the surfaces of nucleic acid sensors  

E-Print Network [OSTI]

Diamond Nanopure water purification system was used.laboratory water purification system (18.2 M?·cm). In a

Josephs, Eric Alan

2013-01-01T23:59:59.000Z

151

Bioluminescence regenerative cycle (BRC) system: Theoretical considerations for nucleic acid quantification assays  

E-Print Network [OSTI]

. In the BRC system, pyrophosphate (PPi) molecules are released during biopolymerization and are counted

Hassibi, Arjang

152

Thermo-Biolithography: A Technique for Patterning Nucleic Acids and Proteins  

E-Print Network [OSTI]

fluorescent protein (using tyrosinase-initiated conjugation). Because gelatin can be applied and removed under

Rubloff, Gary W.

153

Structure-based model for light-harvesting properties of nucleic acid nanostructures  

E-Print Network [OSTI]

Programmed self-assembly of DNA enables the rational design of megadalton-scale macromolecular assemblies with sub-nanometer scale precision. These assemblies can be programmed to serve as structural scaffolds for secondary ...

Pan, Keyao

154

Type I Interferon is Not Just for Viruses: Cytosolic Sensing of Bacterial Nucleic Acids  

E-Print Network [OSTI]

in the recognition of Helicobacter pylori. Gastroenterologypneumophila, Helicobacter pylori, Francisella tularensis,the focus of Chapter 3. Helicobacter pylori is another gram-

Monroe, Kathryn McGee

2011-01-01T23:59:59.000Z

155

STRUCTURAL EFFECTS ON THE CIRCULAR DICHROISM OF ETHIDIUM-NUCLEIC ACID COMPLEXES  

E-Print Network [OSTI]

trup et al. (1978) examined dye binding with pdC- dG-dC-dG (2 dC-dG sites), pdC-dC-dG-dG (l dC-dG site), pdG-dG-dC-dC,1 dC-dG Site). For dye plus pdC-dG-dC-dG, both dC-dG sites

Dahl, Kenneth Steven

2013-01-01T23:59:59.000Z

156

Relations between intraruminal protein and nucleic acid synthesis and forms of urinary nitrogen excreted by sheep  

E-Print Network [OSTI]

alcohol. The samples were coils. cted in duplicates. An attempt was made to determine the volume of the rumen digesta and its passage out of the reticulo-rumen by usi. ng polyethylene glycol. An appropriate amount of polyethylene glycol (2 gm... procedure for poly- ethylene glycol it was not possible to determine the volume of the rumen digesta and rate of passage out of the reticulo-rumen. Fasting Animals At the end of all experimer. . tal feeding and collection periods, the rumens of two...

Razzaque, Md. Abdur

1967-01-01T23:59:59.000Z

157

Integration of On-chip Isotachophoresis and Functionalized Hydrogels for Enhanced-Sensitivity Nucleic Acid Detection  

E-Print Network [OSTI]

of Mechanical Engineering, Stanford University, Stanford, CA 94305, USA *E-mail: juan purchased crown glass microfluidic chips (model NS260) and separate plastic chip caddies from Caliper Life of prepolymer mastermix, ITP buffers, and surface modification reagents Composition of our prepolymer is similar

Santiago, Juan G.

158

Quantitative prediction of 3D solution shape and flexibility of nucleic acid nanostructures  

E-Print Network [OSTI]

DNA nanotechnology enables the programmed synthesis of intricate nanometer-scale structures for diverse applications in materials and biological science. Precise control over the 3D solution shape and mechanical flexibility ...

Kilchherr, F.

159

Nature and Magnitude of Aromatic Stacking of Nucleic Acid Bases. | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear Security Administration the Contributions andDataNational Library of1, 2007 (next release3,3,Nature and Magnitude

160

Progress Report No. AT(11-1)-3083-6 RE: Nucleic Acids and Protein...  

Office of Scientific and Technical Information (OSTI)

Chiu, N., Chiu, A. & Suyama, Y. (1974). J. Mol. Biol. (In the ress). 4. Elder, K.T. & Smith, A.E. (1973). Proc. Natl. Acad. Sci. U.S.A . 70, .. 1 2823-2826. ' 5. Gillespie, D. &...

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Balance of Attraction and Repulsion in Nucleic-Acid Base Stacking:  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc DocumentationP-Series to someone6 M. Babzien, I. Ben-Zvi, P. Study ofJ U LY 2AVS trustee

162

Disposable and removable nucleic acid extraction and purification cartridges for automated flow-through systems  

DOE Patents [OSTI]

Removable cartridges are used on automated flow-through systems for the purpose of extracting and purifying genetic material from complex matrices. Different types of cartridges are paired with specific automated protocols to concentrate, extract, and purifying pathogenic or human genetic material. Their flow-through nature allows large quantities sample to be processed. Matrices may be filtered using size exclusion and/or affinity filters to concentrate the pathogen of interest. Lysed material is ultimately passed through a filter to remove the insoluble material before the soluble genetic material is delivered past a silica-like membrane that binds the genetic material, where it is washed, dried, and eluted. Cartridges are inserted into the housing areas of flow-through automated instruments, which are equipped with sensors to ensure proper placement and usage of the cartridges. Properly inserted cartridges create fluid- and air-tight seals with the flow lines of an automated instrument.

Regan, John Frederick

2014-09-09T23:59:59.000Z

163

Use of plant fatty acyl hydroxylases to produce hydroxylated fatty acids and derivatives in plants  

DOE Patents [OSTI]

The present invention relates to the identification of nucleic acid sequences and constructs, and methods related thereto, and the use of these sequences and constructs to produce genetically modified plants for the purpose of altering the composition of plant oils, waxes and related compounds.

Somerville, Chris (Portola Valley, CA); van de Loo, Frank (Lexington, KY)

2002-01-01T23:59:59.000Z

164

Methods and compounds for chemical ligation  

DOE Patents [OSTI]

Compositions and methods for chemical ligation are provided. Methods for nucleic acid sequencing, nucleic acid assembly and nucleic acid synthesis are also provided.

Church, George M.; Sismour, A. Michael

2013-07-09T23:59:59.000Z

165

The Effect of Dye-Dye Interactions on the Spatial Resolution of Single-Molecule FRET Measurements in Nucleic Acids  

E-Print Network [OSTI]

The Effect of Dye-Dye Interactions on the Spatial Resolution of Single-Molecule FRET Measurements Engineering, Boston University, Boston, Massachusetts ABSTRACT We study the effect of dye-dye interactions-nm separation, provided that dye-dye quenching is accounted for. At these short separations, we find

166

Electronic structure and spectroscopy of nucleic acid bases: Ionization energies, ionization-induced structural changes, and photoelectron spectra  

SciTech Connect (OSTI)

We report high-level ab initio calculations and single-photon ionization mass spectrometry study of ionization of adenine (A), thymine (T), cytosine (C) and guanine (G). For thymine and adenine, only the lowest-energy tautomers were considered, whereas for cytosine and guanine we characterized five lowest-energy tautomeric forms. The first adiabatic and several vertical ionization energies were computed using equation-of-motion coupled-cluster method for ionization potentials with single and double substitutions. Equilibrium structures of the cationic ground states were characterized by DFT with the {omega}B97X-D functional. The ionization-induced geometry changes of the bases are consistent with the shapes of the corresponding molecular orbitals. For the lowest-energy tautomers, the magnitude of the structural relaxation decreases in the following series G > C > A > T, the respective relaxation energies being 0.41, 0.32, 0.25 and 0.20 eV. The computed adiabatic ionization energies (8.13, 8.89, 8.51-8.67 and 7.75-7.87 eV for A,T,C and G, respectively) agree well with the onsets of the photoionization efficiency (PIE) curves (8.20 {+-} 0.05, 8.95 {+-} 0.05, 8.60 {+-} 0.05 and 7.75 {+-} 0.05 eV). Vibrational progressions for the S{sub 0}-D{sub 0} vibronic bands computed within double-harmonic approximation with Duschinsky rotations are compared with previously reported experimental photoelectron spectra.

Bravaya, Ksenia B.; Kostko, Oleg; Dolgikh, Stanislav; Landau, Arie; Ahmed, Musahid; Krylov, Anna I.

2010-08-02T23:59:59.000Z

167

Thermodynamics and Enzymatic Polymerization of Artificial Metallo-Nucleic Acids AND Investigation of Duplex Formation between GAN and RNA  

E-Print Network [OSTI]

°C rt (92%). (c) DMTrCl, pyridine, rt (69%). (d) (iPr) 2 NP(Cl)OEtCN, (iPr) 2 NEt, CH 2 Cl 2 , rt (71%). Scheme 1. 7N,N-diisopropylehylamine ((iPr) 2 NEt) and 2-cyanoehtyl-N,N-

Kim, Eun Kyong

2011-01-01T23:59:59.000Z

168

Nucleic Acids Research, 1993, Vol. 21, No. 9 2247-2248 The nucleosome repeat length of Kluyveromyces lactis is  

E-Print Network [OSTI]

Sorbitol, 20 mM Pipes, 0.1 mM CaCl2, pH = 6.3), and resuspended in the remaining liquid. The suspensions were each added to 25 ml of Ficoll-PMSF solution (9% Ficoll 4000, 20 mM Pipes, 0.5 mM CaCl2, pH = 6

169

Discrimination of Alternative Spliced Isoforms by Real-Time PCR Using Locked Nucleic Acid (LNA) Substituted Primer  

E-Print Network [OSTI]

Determination of quantitative expression levels of alternatively spliced isoforms provides an important approach to the understanding of the functional significance of each isoform. Real-time PCR using exon junction ...

Wan, Guoqiang

170

2001 Oxford University Press Nucleic Acids Research, 2001, Vol. 29, No. 22 46634673 Importance of the conserved nucleotides around the  

E-Print Network [OSTI]

of the conserved nucleotides around the tRNA-like structure of Escherichia coli transfer- messenger RNA for protein nucleotide stretches 16­20 and 333­335 seriously impair protein tagging with only minor changes nucleotides next to the tRNA-like portion is proposed. Overall, the highly conserved nucleotides around the t

Paris-Sud XI, Université de

171

Nucleic Acids Research, 1994, Vol. 22, No. 11 1981 -1987 Interaction between the first and last nucleotides of  

E-Print Network [OSTI]

nucleotides of pre-mRNA introns is a determinant of 3' splice site selection in S.cerevisiae Guillaume be reactivated by a G to C substitution of the last intron nucleotide. These results demonstrate that the inter- action between the first and last intron nucleotides is a conserved feature of nuclear pre-mRNA splicing

Chanfreau, Guillaume

172

Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same  

DOE Patents [OSTI]

The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.

Chee, Mark (Palo Alto, CA); Gingeras, Thomas R. (Santa Clara, CA); Fodor, Stephen P. A. (Palo Alto, CA); Hubble, Earl A. (Mountain View, CA); Morris, MacDonald S. (San Jose, CA)

1999-01-19T23:59:59.000Z

173

1997 Oxford University Press49945002 Nucleic Acids Research, 1997, Vol. 25, No. 24 Information analysis of Fis binding sites  

E-Print Network [OSTI]

analysis of Fis binding sites Paul N. Hengen1, Stacy L. Bartram1,2,+, Lisa E. Stewart1 and Thomas D 30, 1997 ABSTRACT Originally discovered in the bacteriophage Mu DNA inversion system gin, Fis (Factor for Fis to locate its binding sites, we collected a set of 60 experimentally defined wild-type Fis DNA

Schneider, Thomas D.

174

1997 Oxford University Press 13391346Nucleic Acids Research, 1997, Vol. 25, No. 7 Mechanisms of triplex-caused polymerization arrest  

E-Print Network [OSTI]

of triplex-caused polymerization arrest Andrey S. Krasilnikov1,2, Igor G. Panyutin3, George M. Samadashwily1/purine/purine triplexes are known to inhibit DNA polymerization. Here we have studied the mech- anisms of this inhibition temperatures and ambient conditions make them a barrier to polymerization. INTRODUCTION During the last decade

Mirkin, Sergei

175

1996 Oxford University Press 713720Nucleic Acids Research, 1996, Vol. 24, No. 4 Atomic force microscopy of long and short  

E-Print Network [OSTI]

of DNA can be reliably imaged and identified and also what substrates and methods of sample preparation technique for observing DNA. The AFM can image conformations of DNA molecules (3­5), nucleosome Corporation; Wood Dale, IL) and cleaved with tape immediately before use. Silicon. Oxidized silicon substrates

Hansma, Helen

176

Activation of nucleic acid-sensing Toll-like receptors requires cleavage by endolysosomal proteases: a mechanism to avoid autoimmunity  

E-Print Network [OSTI]

receptor DC: dendritic cell pDC: plasmacytoid dendritic celltaken up by plasmacytoid DCs (pDC) and elicit large amountsare also components of the pDC-MyD88 signaling complex (

Ewald, Sarah Elisabeth

2010-01-01T23:59:59.000Z

177

Thermodynamics and Enzymatic Polymerization of Artificial Metallo-Nucleic Acids AND Investigation of Duplex Formation between GAN and RNA  

E-Print Network [OSTI]

cells on a Varian Cary 500 UV-Vis spectrophotometer equipped with a Peltiercell on a Varian Cary 500 UV-Vis spectrophotometer equipped with a Peltier

Kim, Eun Kyong

2011-01-01T23:59:59.000Z

178

Electrical Detection of Nucleic Acid Amplification Using an On-Chip Quasi-Reference Electrode and a PVC REFET  

E-Print Network [OSTI]

and a PVC REFET Eric Salm,, Yu Zhong,,§ Bobby Reddy, Jr.,,§ Carlos Duarte-Guevara,,§ Vikhram Swaminathan that utilizes a platinum QRE to establish a pH-sensitive fluid gate potential and a PVC membrane REFET to enable

Bashir, Rashid

179

1998 Oxford University Press 7379Nucleic Acids Research, 1998, Vol. 26, No. 1 SGD: Saccharomyces Genome Database  

E-Print Network [OSTI]

, Erich T. Hester, Yankai Jia, Gail Juvik, TaiYun Roe, Mark Schroeder, Shuai Weng and David Botstein

Botstein, David

180

Prolactin messenger ribonucleic acid concentrations throughout the ovine estrous cycle: Assessment relative to prolactin serum and pituitary amounts  

SciTech Connect (OSTI)

Prolactin (PRL) mRNA concentrations were assessed by nucleic acid hybridization assays in pituitaries of ewes representing the defined stages of the ovine estrous cycle. Concomitantly, pituitary and serum PRL concentrations were measured in these ewes using radioimmunoassays. It was observed that PRL serum, pituitary and mRNA concentrations tended to increase near the time of the gonadotropin preovulatory surge, particularly between 24 hrs before behavioral estrus to 5 hours after estrus. However, the changes in PRL mRNA, serum and pituitary concentrations were shown not to be statistically significant. These data suggest that PRL production during the sheep estrous cycle is maintained without dramatic changes in synthesis or secretion.

Landefeld, T.; Roulia, V.; Bagnell, T.; Ballard, T.; Levitan, I. (Univ. of Michigan, Ann Arbor (USA))

1991-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

A New Heat Shock Protein That Binds Nucleic Acids* (Received for publication, August 20, 1998, and in revised form, September 28, 1998)  

E-Print Network [OSTI]

production of a number of proteins termed heat shock proteins (Hsps).1 Although heat shock pro- teins were Hsp15-P2 (5 - TCTTGCAGGATCCAGTTATTCACT-3 ), and Taq polymerase (Strat- agene). The PCR product g, 4 °C). All further steps were performed at 4 °C. The cell pellet was resuspended in cold buffer

Bardwell, James

182

Nucleic Acids Research, 2007, Vol. 35, Web Server issue W357W362 doi:10.1093/nar/gkm231  

E-Print Network [OSTI]

://pipe.scs.fsu.edu. To illustrate the utility of these web servers, cons-PPISP and DISPLAR predictions are used to construct of the web servers and illustrate their utility by a structural model, built from predictions of the web similar designs. The input in each case consists of data for a list of residues. In WESA, the list

Weston, Ken

183

Published online 26 November 2007 Nucleic Acids Research, 2008, Vol. 36, No. 2 451461 doi:10.1093/nar/gkm1067  

E-Print Network [OSTI]

September 7, 2007; Revised November 11, 2007; Accepted November 12, 2007 ABSTRACT The Chlorella virus RNA poxviruses, reoviruses, alphaviruses, baculoviruses, West Nile virus and Chlorella virus PBCV-1 encode

Perreault, Jean-Pierre

184

This is a pre-print of a manuscript that will appear in: Nucleic Acids Research, 2005, Vol 33, Oxford University Press.  

E-Print Network [OSTI]

Function Prediction Brett Poulin*, Duane Szafron, Russell Greiner, Roman Eisner and Paul Lu *poulin@cs.ualberta.ca BIOINFORMATICS I We use Markov chains as a pre-processing filter for HMM software (HMMER)[2], removing the most

Alberta, University of

185

Published online 11 August 2009 Nucleic Acids Research, 2009, Vol. 37, No. 18 61616173 doi:10.1093/nar/gkp597  

E-Print Network [OSTI]

. N. M. Glover1, * 1 Department of Biochemistry, University of Alberta, Edmonton, Alberta T6G 2H7 whom correspondence should be addressed. Tel: +1 780 492 2136; Fax: +1 780 492 0886; Email: mark.glover

Glover, Mark

186

Formation and Genotoxicity of Novel Oxidatively Generated Tandem DNA Lesions and N2-(1-carboxyethyl)-2'-deoxyguanosine  

E-Print Network [OSTI]

Nucleic Acids Res. 33, 1593-1603. von Sonntag, C. (1987) TheNucleic Acids Res. 33, 1593-1603. Liu, Z. J. , Gao, Y. , andNucleic Acids Res. 33, 1593-1603. Wang, Y. (2008) Bulky DNA

Jiang, Yong

2009-01-01T23:59:59.000Z

187

RegPredict: an integrated system for regulon inference in prokaryotes by comparative genomics approach  

E-Print Network [OSTI]

motifs by comparative genomics. Nucleic Acids Res. , 28,M.S. (2009) Comparative genomics of regulation of fatty acidcomparative and functional genomics. Nucleic Acids Res. ,

Novichkov, Pavel S.

2010-01-01T23:59:59.000Z

188

Plant fatty acid hydroxylases  

DOE Patents [OSTI]

This invention relates to plant fatty acyl hydroxylases. Methods to use conserved amino acid or nucleotide sequences to obtain plant fatty acyl hydroxylases are described. Also described is the use of cDNA clones encoding a plant hydroxylase to produce a family of hydroxylated fatty acids in transgenic plants. In addition, the use of genes encoding fatty acid hydroxylases or desaturases to alter the level of lipid fatty acid unsaturation in transgenic plants is described.

Somerville, Chris (Portola Valley, CA); Broun, Pierre (Burlingame, CA); van de Loo, Frank (Lexington, KY)

2001-01-01T23:59:59.000Z

189

Process for the preparation of lactic acid and glyceric acid  

DOE Patents [OSTI]

Hexose and pentose monosaccharides are degraded to lactic acid and glyceric acid in an aqueous solution in the presence of an excess of a strongly anionic exchange resin, such as AMBERLITE IRN78 and AMBERLITE IRA400. The glyceric acid and lactic acid can be separated from the aqueous solution. Lactic acid and glyceric acid are staple articles of commerce.

Jackson, James E [Haslett, MI; Miller, Dennis J [Okemos, MI; Marincean, Simona [Dewitt, MI

2008-12-02T23:59:59.000Z

190

STANDARD OPERATING PROCEDURE ACIDS CONTAINING PHOSPHOROUS  

E-Print Network [OSTI]

12.1 STANDARD OPERATING PROCEDURE for ACIDS CONTAINING PHOSPHOROUS Location(s): ___________________________________________________ Chemical(s): Hypophosphorous acid, methylphosphonic acid, phosphonic acid, phosphoric acid, phosphorous

Pawlowski, Wojtek

191

Microorganisms for producing organic acids  

DOE Patents [OSTI]

Organic acid-producing microorganisms and methods of using same. The organic acid-producing microorganisms comprise modifications that reduce or ablate AcsA activity or AcsA homolog activity. The modifications increase tolerance of the microorganisms to such organic acids as 3-hydroxypropionic acid, acrylic acid, propionic acid, lactic acid, and others. Further modifications to the microorganisms increase production of such organic acids as 3-hydroxypropionic acid, lactate, and others. Methods of producing such organic acids as 3-hydroxypropionic acid, lactate, and others with the modified microorganisms are provided. Methods of using acsA or homologs thereof as counter-selectable markers are also provided.

Pfleger, Brian Frederick; Begemann, Matthew Brett

2014-09-30T23:59:59.000Z

192

Separation Nanotechnology of Diethylenetriaminepentaacetic Acid...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Nanotechnology of Diethylenetriaminepentaacetic Acid Bonded Magnetic Nanoparticles for Spent Nuclear Fuel. Separation Nanotechnology of Diethylenetriaminepentaacetic Acid Bonded...

193

Reversible Acid Gas Capture  

ScienceCinema (OSTI)

Pacific Northwest National Laboratory scientist David Heldebrant demonstrates how a new process called reversible acid gas capture works to pull carbon dioxide out of power plant emissions.

Dave Heldebrant

2012-12-31T23:59:59.000Z

194

EMSL - Nuclei acid structure  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

conditions showed a temporary pH decrease, with a concomitant increase in formic acid during exponential growth. Fermentation experiments performed outside of the magnet...

195

Nuclei acid structure | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

conditions showed a temporary pH decrease, with a concomitant increase in formic acid during exponential growth. Fermentation experiments performed outside of the magnet...

196

Controlling acid rain  

E-Print Network [OSTI]

High concentrations of sulfuric and nitric acid in raTn fn the northeastern USA are caused by the large scale combustion of fossil fuels within this region. Average precipitation acidity is pH 4.2, but spatial and temporal ...

Fay, James A.

1983-01-01T23:59:59.000Z

197

(Acid rain workshop)  

SciTech Connect (OSTI)

The traveler presented a paper entitled Susceptibility of Asian Ecosystems to Soil-Mediated Acid Rain Damage'' at the Second Workshop on Acid Rain in Asia. The workshop was organized by the Asian Institute of Technology (Bangkok, Thailand), Argonne National Laboratory (Argonne, Illinois), and Resource Management Associates (Madison, Wisconsin) and was sponsored by the US Department of Energy, the United Nations Environment Program, the United Nations Economic and Social Commission for Asia and the Pacific, and the World Bank. Papers presented on the first day discussed how the experience gained with acid rain in North America and Europe might be applied to the Asian situation. Papers describing energy use projections, sulfur emissions, and effects of acid rain in several Asian countries were presented on the second day. The remaining time was allotted to discussion, planning, and writing plans for a future research program.

Turner, R.S.

1990-12-05T23:59:59.000Z

198

Fatty Acid Carcass Mapping  

E-Print Network [OSTI]

FATTY ACID CARCASS MAPPING A Thesis by STACEY NICOLE TURK Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE May 2008... Major Subject: Animal Science FATTY ACID CARCASS MAPPING A Thesis by STACEY NICOLE TURK Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE...

Turk, Stacey N.

2010-01-14T23:59:59.000Z

199

The utilization of tricarboxylic acid cycle acids and the uptake of succinic acid by Neurospora crassa  

E-Print Network [OSTI]

THE UTILIZATION OF TRICARBOXYLIC ACID CYCLE ACIDS AND THE UPTAKE OF SUCCINIC ACID BY NEUROSPORA CRASSA A Thesis by PATTI LYNN GILLILAND Submitted to the Graduate College of Texas A&M University in partial fulfillment of the requirement... for the degree of MASTER OF SCIENCE August 1978 Ma) or Subject: Microbiology THE UTILIZATION OF TRICARBOXYLIC ACID CYCLE ACIDS AND THE UPTAKE OF SUCCINIC ACID BY NEUROSPORA CRASSA A Thesis by PATTI LYNN GILLILAND Approved as to style and content by...

Gilliland, Patti Lynn

2012-06-07T23:59:59.000Z

200

Focus Sheet | Hydrofluoric Acid Health hazards of hydrofluoric acid  

E-Print Network [OSTI]

Focus Sheet | Hydrofluoric Acid Health hazards of hydrofluoric acid Hydrofluoric acid (HF characterized by weight loss, brittle bones, anemia, and general ill health. Safe use If possible, avoid working to exposures. #12;Focus Sheet | Hydrofluoric Acid Environmental Health and Safety Environmental Programs Office

Wilcock, William

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Optical high acidity sensor  

DOE Patents [OSTI]

An apparatus and method for determining acid concentrations in solutions having acid concentrations of from about 0.1 Molar to about 16 Molar is disclosed. The apparatus includes a chamber for interrogation of the sample solution, a fiber optic light source for passing light transversely through the chamber, a fiber optic collector for receiving the collimated light after transmission through the chamber, a coating of an acid resistant polymeric composition upon at least one fiber end or lens, the polymeric composition in contact with the sample solution within the chamber and having a detectable response to acid concentrations within the range of from about 0.1 Molar to about 16 Molar, a measurer for the response of the polymeric composition in contact with the sample solution, and, a comparer of the measured response to predetermined standards whereby the acid molarity of the sample solution within the chamber can be determined. Preferably, a first lens is attached to the end of the fiber optic light source, the first lens adapted to collimate light from the fiber optic light source, and a second lens is attached to the end of the fiber optic collector for focusing the collimated light after transmission through the chamber.

Jorgensen, Betty S. (Jemez Springs, NM); Nekimken, Howard L. (Los Alamos, NM); Carey, W. Patrick (Lynnwood, WA); O'Rourke, Patrick E. (Martinez, GA)

1997-01-01T23:59:59.000Z

202

A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid  

SciTech Connect (OSTI)

An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

Arceo, Elena; Ellman, Jonathan; Bergman, Robert

2010-05-03T23:59:59.000Z

203

Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters  

DOE Patents [OSTI]

A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

Moens, Luc (Lakewood, CO)

2003-06-24T23:59:59.000Z

204

Acidizing of Sandstone Reservoirs Using HF and Organic Acids  

E-Print Network [OSTI]

Mud acid, which is composed of HCl and HF, is commonly used to remove the formation damage in sandstone reservoirs. However, many problems are associated with HCl, especially at high temperatures. Formic-HF acids have served as an alternative...

Yang, Fei

2012-10-19T23:59:59.000Z

205

acid docosahexaenoic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 38 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

206

acid aspartic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 20 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

207

acid caffeic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 11 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

208

acid succinic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

simulated the laser heating of the succinic acid (this data is still simulation is that infrared heating generates about 10-15 more succinic acid molecules bound to the analyte...

209

acid benzoic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 24 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

210

acid propanoic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 9 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

211

acid oleic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 31 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

212

Acid Placement in Acid Jetting Treatments in Long Horizontal Wells  

E-Print Network [OSTI]

In the Middle East, extended reach horizontal wells (on the order of 25,000 feet of horizontal displacement) are commonly acid stimulated by jetting acid out of drill pipe. The acid is jetted onto the face of the openhole wellbore as the drill pipe...

Sasongko, Hari

2012-07-16T23:59:59.000Z

213

Acid placement and coverage in the acid jetting process  

E-Print Network [OSTI]

Many open-hole acid treatments are being conducted by pumping acid through jetting ports placed at the end of coiled tubing or drill pipe. The filter-cake on the bore-hole is broken by the jet; the acid-soluble material is dissolved, creating...

Mikhailov, Miroslav I.

2009-05-15T23:59:59.000Z

214

Investigating acid rain  

SciTech Connect (OSTI)

A report is given of an address by Kathleen Bennett, Assistant Administrator of Air, Noise and Radiation, Environmental Protection Agency which was presented to the US Senate Committee on the Environment and Public Works. Bennet explained that in view of the many unknowns about acid rain, and the possible substantial cost burden of additional controls, EPA is proceeding with its program to investigate this environmental malady over a 10-year period. The three major areas of the research program are (1) transport, transformation, and deposition processes, (2) effects of acid deposition, and (3) assessments and policy studies. Other issues discussed were global transboundary air pollution and Senate amendments addressing long-range transport. (JMT)

Not Available

1981-01-01T23:59:59.000Z

215

Pantothenic acid biosynthesis in zymomonas  

DOE Patents [OSTI]

Zymomonas is unable to synthesize pantothenic acid and requires this essential vitamin in growth medium. Zymomonas strains transformed with an operon for expression of 2-dehydropantoate reductase and aspartate 1-decarboxylase were able to grow in medium lacking pantothenic acid. These strains may be used for ethanol production without pantothenic acid supplementation in seed culture and fermentation media.

Tao, Luan; Tomb, Jean-Francois; Viitanen, Paul V.

2014-07-01T23:59:59.000Z

216

acid acetic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of asphaltene deposition that occurs during acid treatments of oil reservoirs. Asphaltenes are present to some degree in most hydrocarbons. Due to the molecular weight of the...

217

Acidic gas capture by diamines  

DOE Patents [OSTI]

Compositions and methods related to the removal of acidic gas. In particular, the present disclosure relates to a composition and method for the removal of acidic gas from a gas mixture using a solvent comprising a diamine (e.g., piperazine) and carbon dioxide. One example of a method may involve a method for removing acidic gas comprising contacting a gas mixture having an acidic gas with a solvent, wherein the solvent comprises piperazine in an amount of from about 4 to about 20 moles/kg of water, and carbon dioxide in an amount of from about 0.3 to about 0.9 moles per mole of piperazine.

Rochelle, Gary (Austin, TX); Hilliard, Marcus (Missouri City, TX)

2011-05-10T23:59:59.000Z

218

Carbonic Acid Pretreatment of Biomass  

SciTech Connect (OSTI)

This project sought to address six objectives, outlined below. The objectives were met through the completion of ten tasks. 1) Solidify the theoretical understanding of the binary CO2/H2O system at reaction temperatures and pressures. The thermodynamics of pH prediction have been improved to include a more rigorous treatment of non-ideal gas phases. However it was found that experimental attempts to confirm theoretical pH predictions were still off by a factor of about 1.8 pH units. Arrhenius experiments were carried out and the activation energy for carbonic acid appears to be substantially similar to sulfuric acid. Titration experiments have not yet confirmed or quantified the buffering or acid suppression effects of carbonic acid on biomass. 2) Modify the carbonic acid pretreatment severity function to include the effect of endogenous acid formation and carbonate buffering, if necessary. It was found that the existing severity functions serve adequately to account for endogenous acid production and carbonate effects. 3) Quantify the production of soluble carbohydrates at different reaction conditions and severity. Results show that carbonic acid has little effect on increasing soluble carbohydrate concentrations for pretreated aspen wood, compared to pretreatment with water alone. This appears to be connected to the release of endogenous acids by the substrate. A less acidic substrate such as corn stover would derive benefit from the use of carbonic acid. 4) Quantify the production of microbial inhibitors at selected reaction conditions and severity. It was found that the release of inhibitors was correlated to reaction severity and that carbonic acid did not appear to increase or decrease inhibition compared to pretreatment with water alone. 5) Assess the reactivity to enzymatic hydrolysis of material pretreated at selected reaction conditions and severity. Enzymatic hydrolysis rates increased with severity, but no advantage was detected for the use of carbonic acid compared to water alone. 6) Determine optimal conditions for carbonic acid pretreatment of aspen wood. Optimal severities appeared to be in the mid range tested. ASPEN-Plus modeling and economic analysis of the process indicate that the process could be cost competitive with sulfuric acid if the concentration of solids in the pretreatment is maintained very high (~50%). Lower solids concentrations result in larger reactors that become expensive to construct for high pressure applications.

G. Peter van Walsum; Kemantha Jayawardhana; Damon Yourchisin; Robert McWilliams; Vanessa Castleberry

2003-05-31T23:59:59.000Z

219

University of California, Irvine Environmental Health and Safety www.ehs.uci.edu Questions Call: (949) 824-6200 Version 2.1 Ethidium bromide is a commonly used stain for identifying nucleic acids in electrophoresis gels. It is  

E-Print Network [OSTI]

&S hazardous waste label and placed in secondary containment. Do not use a biohazardous waste bag to package bromide solutions must be treated as part of the experimental protocol or managed as a hazardous chemical is saturated, the charcoal must be managed as a hazardous chemical waste and disposed of through EH&S. Charcoal

George, Steven C.

220

Comparison of Three Cre-LoxP Based Paired-End Library Construction Methods  

SciTech Connect (OSTI)

Paired-end library sequencing has been proven useful in scaffold construction during de novo whole genome shotgun assembly. The ability of generating mate pairs with > 8 Kb insert sizes is especially important for genomes containing long repeats. To make mate paired libraries for next generation sequencing, DNA fragments need to be circularized to bring the ends together. There are several methods that can be used for DNA circulation, namely ligation, hybridization and Cre-LoxP recombination. With higher circularization efficiency with large insert DNA fragments, Cre-LoxP recombination method generally has been used for constructing >8 kb insert size paired-end libraries. Second fragmentation step is also crucial for maintaining high library complexity and uniform genome coverage. Here we will describe the following three fragmentation methods: restriction enzyme digestion, random shearing and nick translation. We will present the comparison results for these three methods. Our data showed that all three methods are able to generate paired-end libraries with greater than 20 kb insert. Advantages and disadvantages of these three methods will be discussed as well.

Peng, Ze; Nath, Nandita; Tritt, Andrew; Liang, Shoudan; Han, James; Pennacchio, Len; Chen, Feng

2013-03-26T23:59:59.000Z

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Microuidic device reads up to four consecutive base pairs in DNA sequencing-by-synthesis  

E-Print Network [OSTI]

connected through tygon tubing (Cole-Parmer, Vernon Hills, IL) to Lee-valve arrays (Fluidigm Corp., South

Quake, Stephen R.

222

TABASCO: A single molecule, base-pair resolved gene expression simulator  

E-Print Network [OSTI]

Background Experimental studies of gene expression have identified some of the individual molecular components and elementary reactions that comprise and control cellular behavior. Given our current understanding of gene ...

Kosuri, Sriram

223

Metabolism of Thioctic Acid in Algae  

E-Print Network [OSTI]

METABOLISM OF THlOCTlC ACID IN ALGAE TWO-WEEK LOAN COPY ThisMETABOLISM OF THIOCTIC ACID IN ALGAE Hans Grisebach, R. , C.METABOLISM OF THIOCTIC ACID IN ALGAE Hans Grisebach, R. C.

Grisebach, Hans; Fuller, R.C.; Calvin, M.

1956-01-01T23:59:59.000Z

224

E-Print Network 3.0 - acids research database Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

5 > >> 1 The Peptaibol Database: a database for sequences and structures of naturally occurring peptaibols Summary: , Database issue D593D594 DOI: 10.1093nargkh077 Nucleic...

225

Solvent extraction of inorganic acids  

E-Print Network [OSTI]

the solution by a sim?. le process that is economically =ttrsctlve is of con- sider. ble interest~ Dilute "olution; of hydrochloric, nitric and sul- furic acid d; occur in many processes either alone or toga- th: r . 'he use of li. , uid-li~uid extraction...~~ram for hexyl c~rbitol- water-nitric acid 17 ~ Distribution die, r m for hoxl'' ca:-bitol- watcr-sulfur'c acid Table 1. . 'xperimental d ta of amyl alcohol-water-!!Cl Pa, e 33 2. Experimental data of isoamyl alcohol-water- HC1 34 3 ~ Cxperimental data...

Ysrael, Miguel Curie

1965-01-01T23:59:59.000Z

226

Naphthenic acid corrosion literature survey  

SciTech Connect (OSTI)

Naphthenic acid corrosion is a growing concern for refineries processing crudes containing high levels of naphthenic acid. Due to this concern initiatives in place to better understand the mechanism of corrosion for mitigating the corrosion. During the 1996 Fall Corrosion Group, organized existing literature relevant to the literature search. Committee Week, NACE International many refineries have and evaluate methods T-8 Refining Industry a task group, T-8-22, to perform a review and compilation of naphthenic acid corrosion. This paper provides a summary of the literature research.

Babaian-Kibala, E. [Nalco/Exxon Energy Chemicals, Sugar Land, TX (United States); Nugent, M.J. [Tosco Refining Co., Linden, NJ (United States)

1999-11-01T23:59:59.000Z

227

acetic acid solutions: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

228

arachidonic acid activation: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

229

acid inertness studies: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

230

acid activated montmorillonite: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

231

acid amide hydrolase: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been studied....

232

acid chelation phototherapeutic: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

233

acid phosphatase activity: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

234

acetic acid solution: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

235

acetic acid operational: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

236

acid phosphatase activities: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

237

acid sphingomyelinase activity: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

238

acids decreases fibrinolysis: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

239

arachidonic acid activates: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

240

acid decarboxylase activity: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

acid activates nrf2: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

242

acid processing activity: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

243

ascorbic acid enhances: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

244

acid cupric chloride: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

245

In vivo incorporation of unnatural amino acids  

DOE Patents [OSTI]

The invention provides methods and compositions for in vivo incorporation of unnatural amino acids. Also provided are compositions including proteins with unnatural amino acids.

Schultz, Peter G. (La Jolla, CA); Wang, Lei (San Diego, CA); Anderson, John Christopher (San Diego, CA); Chin, Jason W. (Cambridge, GB); Liu, David R. (Lexington, MA); Magliery, Thomas J. (North Haven, CT); Meggers, Eric L. (Philadelphia, PA); Mehl, Ryan Aaron (Lancaster, PA); Pastrnak, Miro (San Diego, CA); Santoro, Stephen William (Cambridge, MA); Zhang, Zhiwen (San Diego, CA)

2012-05-08T23:59:59.000Z

246

Carbonic Acid Shows Promise in Geology, Biology  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The Surprising Secrets of Carbonic Acid Probing the Surprising Secrets of Carbonic Acid Berkeley Lab Study Holds Implications for Geological and Biological Processes October 23,...

247

Mineralogical transformations controlling acid mine drainage...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Mineralogical transformations controlling acid mine drainage chemistry. Mineralogical transformations controlling acid mine drainage chemistry. Abstract: The role of Fe(III)...

248

Phytozome: A Comparative Platform for Green Plant Genomics  

E-Print Network [OSTI]

a growing plant comparative genomics resource. Nucleic AcidsL.A. (2011) The Sol Genomics Network (solgenomics.net):for comparative plant genomics. Nucleic Acids Res, 36, D959-

Goodstein, David M.

2012-01-01T23:59:59.000Z

249

E-Print Network 3.0 - antisense oligonucleotide lna Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

block mRNA translation (3, 4). Below we describe... RNA using locked nucleic acid (LNA) technology. LNAs are nucleic acid analogs in which the ribose ring... is "locked" by a...

250

Seasonalepisodic control of acid deposition  

E-Print Network [OSTI]

This report contains the climatological, technical and economic factors for episodic and seasonal control of emissions in existing power plants. Analyzing a large data set of acid deposition for the years 1982-85, we find ...

Fay, James A.

1988-01-01T23:59:59.000Z

251

Asphaltene damage in matrix acidizing  

E-Print Network [OSTI]

This work addresses the problem of asphaltene deposition that occurs during acid treatments of oil reservoirs. Asphaltenes are present to some degree in most hydrocarbons. Due to the molecular weight of the components these asphaltenes are more...

Hinojosa, Roberto Antonio

2012-06-07T23:59:59.000Z

252

Controlling acid rain : policy issues  

E-Print Network [OSTI]

The policy and regulatory ramifications of U.S. acid rain control programs are examined; particularly, the alternative of a receptor-oriented strategy as constrasted to emission-oriented proposals (e.g., the Mitchell bill) ...

Fay, James A.

1983-01-01T23:59:59.000Z

253

Nitrate and Prussic Acid Poisoning  

E-Print Network [OSTI]

Nitrate and prussic acid poisoning in cattle are noninfectious conditions that can kill livestock. This publication explains the causes and symptoms of these conditions as well as preventive measures and sampling and testing steps....

Stichler, Charles; Reagor, John C.

2001-09-05T23:59:59.000Z

254

Factors controlling naphthenic acid corrosion  

SciTech Connect (OSTI)

A laboratory study was conducted to elucidate the influence of chemical and physical parameters on corrosion of type 1018 carbon steel (CS, UNS G10180) and 5% Cr-0.5% Mo steel in oils containing naphthenic acids (NAs) for application to crude oil refinery systems. Effects of test duration, temperature, and acid concentration were assessed for a range of single acids of varying carbon numbers and for NA mixtures in mineral oil (MO) and in heavy vacuum gas oil (HGVO). In addition, a limited study of the effect of hydrogen sulfide (H{sub 2}S) addition to the acid-oil mixture was conducted. Use of the total acid number (TAN) as a measure of corrosiveness of a crude oil was discredited further. For the same TAN value, molecular size and structure of the acid were shown to have an important influence. Tests conducted in HGVO showed lower corrosion rates than in MO, suggesting inhibition caused by S species in the oil or the steric hindrance of naphtheno-aromatic acids. In oil containing the mixture of NAs, the corrosion rate of type 1018 CS was lower than that for 5% Cr-0.5% Mo steel. The 0.1% H{sub 2}S that passed through the acid-oil mixtures had an inhibiting effect on corrosion. Predicting corrosiveness of a crude oil from the measurement of TAN, distribution of NA composition, and S content and form was particularly challenging. The simple tests used were informative, but further work will be required to establish a standard test method that can provide an adequate ranking of crudes.

Turnbull, A. [National Physical Lab., Teddington (United Kingdom); Slavcheva, E. [Bulgarian Academy of Sciences, Sofia (Bulgaria); Shone, B. [Ty Isa, Nr Mold (United Kingdom)

1998-11-01T23:59:59.000Z

255

The integrated microbial genomes (IMG) system in 2007: data content and analysis tool extensions  

E-Print Network [OSTI]

for genome annotation: PRIAM. Nucleic Acids Research 31 (EC numbers are computed using PRIAM (13), as a complement to

2008-01-01T23:59:59.000Z

256

Multiplex automated genome engineering  

DOE Patents [OSTI]

The present invention relates to automated methods of introducing multiple nucleic acid sequences into one or more target cells.

Church, George M; Wang, Harris H; Isaacs, Farren J

2013-10-29T23:59:59.000Z

257

Acid sorption regeneration process using carbon dioxide  

DOE Patents [OSTI]

Carboxylic acids are sorbed from aqueous feedstocks onto a solid adsorbent in the presence of carbon dioxide under pressure. The acids are freed from the sorbent phase by a suitable regeneration method, one of which is treating them with an organic alkylamine solution thus forming an alkylamine-carboxylic acid complex which thermally decomposes to the desired carboxylic acid and the alkylamine.

King, C. Judson (Kensington, CA); Husson, Scott M. (Anderson, SC)

2001-01-01T23:59:59.000Z

258

Succinic acid production by Anaerobiospirillum succiniciproducens  

E-Print Network [OSTI]

, succinic acid has been produced commercially by chemical processes. Recently, however, fermentative of bacteria produce succinic acid as a fermentation end product,4 7 few species can produce it as the major 10 Previous studies showed that A. succiniciproducens produces succinic acid and acetic acid

259

X-ray Crystal Structures Elucidate the Nucleotidyl Transfer Reaction of Transcript Initiation Using Two Nucleotides  

SciTech Connect (OSTI)

We have determined the X-ray crystal structures of the pre- and postcatalytic forms of the initiation complex of bacteriophage N4 RNA polymerase that provide the complete set of atomic images depicting the process of transcript initiation by a single-subunit RNA polymerase. As observed during T7 RNA polymerase transcript elongation, substrate loading for the initiation process also drives a conformational change of the O helix, but only the correct base pairing between the +2 substrate and DNA base is able to complete the O-helix conformational transition. Substrate binding also facilitates catalytic metal binding that leads to alignment of the reactive groups of substrates for the nucleotidyl transfer reaction. Although all nucleic acid polymerases use two divalent metals for catalysis, they differ in the requirements and the timing of binding of each metal. In the case of bacteriophage RNA polymerase, we propose that catalytic metal binding is the last step before the nucleotidyl transfer reaction.

M Gleghorn; E Davydova; R Basu; L Rothman-Denes; K Murakami

2011-12-31T23:59:59.000Z

260

Instrument Application Capabilities Advantages Disadvantages Recommendations Contact Qiagen Qiacube  

E-Print Network [OSTI]

@uthsc.edu Agilent Bioanalyzer Quality control Profiles for total RNA; enriched mRNA; enriched small RNA; DNA Nucleic acid isolation and purification Total RNA; miRNA; DNA; All prep (all nucleic acid) 2-12 samples Felicia Waller fwaller@uthsc.edu Nanodrop Spectrophotometer Nucleic acids quantification and quality

Cui, Yan

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Red-shifted fluorescent proteins mPlum and mRaspberry and polynucleotides encoding the same  

DOE Patents [OSTI]

Methods using somatic hypermutation (SHM) for producing polypeptide and nucleic acid variants, and nucleic acids encoding such polypeptide variants are disclosed. Such variants may have desired properties. Also disclosed are novel polypeptides, such as improved fluorescent proteins, produced by the novel methods, and nucleic acids, vectors, and host cells comprising such vectors.

Tsien, Roger Y. (La Jolla, CA); Wang, Lei (San Diego, CA)

2008-07-01T23:59:59.000Z

262

Methods for making nucleotide probes for sequencing and synthesis  

DOE Patents [OSTI]

Compositions and methods for making a plurality of probes for analyzing a plurality of nucleic acid samples are provided. Compositions and methods for analyzing a plurality of nucleic acid samples to obtain sequence information in each nucleic acid sample are also provided.

Church, George M; Zhang, Kun; Chou, Joseph

2014-07-08T23:59:59.000Z

263

3284 E Exobiology (theoretical), Complexity in Exobiology (theoretical),  

E-Print Network [OSTI]

to as enzymes. Nucleotides and nucleic acids Nucleotides are mono- mers of nucleic acids, e. g., of RNA bases) that can pair in a specific way. Nucleotides can form polymers, and their sequence carries water molecule is removed in this step. Other nucleotides of interest include peptide nucleic acid

Brandenburg, Axel

264

Method for production of petroselinic acid and OMEGA12 hexadecanoic acid in transgenic plants  

DOE Patents [OSTI]

The present invention relates to a process for producing lipids containing the fatty acid petroselinic acid in plants. The production of petroselinic acid is accomplished by genetically transforming plants which do not normally accumulate petroselinic acid with a gene for a .omega.12 desaturase from another species which does normally accumulate petroselinic acid.

Ohlrogge, John B. (Okemos, MI); Cahoon, Edgar B. (Lansing, MI); Shanklin, John (Upton, NY); Somerville, Christopher R. (Okemos, MI)

1995-01-01T23:59:59.000Z

265

Method for production of petroselinic acid and OMEGA12 hexadecanoic acid in transgenic plants  

DOE Patents [OSTI]

The present invention relates to a process for producing lipids containing the fatty acid, petroselinic acid, in plants. The production of petroselinic acid is accomplished by genetically transforming plants which do not normally accumulate petroselinic acid with a gene for a {omega}12 desaturase from another species which does normally accumulate petroselinic acid. 19 figs.

Ohlrogge, J.B.; Cahoon, E.B.; Shanklin, J.; Somerville, C.R.

1995-07-04T23:59:59.000Z

266

New syntheses of aminoalkylphosphonic acids  

E-Print Network [OSTI]

NEW SYNTHESES OF AMINOALKYLPHOSPHON1C ACIDS A Thesis by John Frederick DeBardeleben, Jr. Su'bmitted to the Graduate School of the Agricultural and Mechanical College of Texas in partial fulfillment of the requirements for the degree of MASTER... OF SCIENCE August 196$ Major Subject: Chemistry NEW SYNTHESES OF AMINOALKYLPHOSPHONIC ACIDS A Thesis BY John Frederick DeBardeleben, Jr. Approved as to style and content hy: (Chairman of Committee) iJ C wc+'. A-c-~-' & (Head of Department...

DeBardeleben, John Frederick

2012-06-07T23:59:59.000Z

267

Acid Catalysis in Modern Organic  

E-Print Network [OSTI]

catalyst for organic synthesis". That is the starting sentence of this book by Yamamoto and Ishihara, which follows their earlier book "Lewis Acids in Organic Synthesis (2000)", and covers the new developments book that should be available in every well-equipped chemistry library. It will certainly be helpful

Snyder, Scott A.

268

HYDROFLUORIC ACID FIRST AID INSTRUCTIONS  

E-Print Network [OSTI]

with large amounts of cool running water. Immediately washing off the acid is of primary importance. 2.Remove Immediately flush eyes for at least 15 minutes with copious cool flowing water. 2 If only one eye is affected by a glass of milk or milk of magnesia. 3 Call 911 for immediate medical assistance. REMEMBER, ALL PERSONNEL

Jalali. Bahram

269

E-Print Network 3.0 - acid acetylsalicylic acid Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acids are kept in storage cabinets under the fume hood... in the plastic box. 3. Place filters in hood, add 50% (approximate concentration) HCl acid (Fisher, certified ACS......

270

E-Print Network 3.0 - acid methoxyacetic acid Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acids are kept in storage cabinets under the fume hood... in the plastic box. 3. Place filters in hood, add 50% (approximate concentration) HCl acid (Fisher, certified ACS......

271

E-Print Network 3.0 - acidic alpha-amino acids Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acids are kept in storage cabinets under the fume hood... in the plastic box. 3. Place filters in hood, add 50% (approximate concentration) HCl acid (Fisher, certified ACS......

272

E-Print Network 3.0 - acid sorbic acid Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acids are kept in storage cabinets under the fume hood... in the plastic box. 3. Place filters in hood, add 50% (approximate concentration) HCl acid (Fisher, certified ACS......

273

E-Print Network 3.0 - acid dichloroacetic acid Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acids are kept in storage cabinets under the fume hood... in the plastic box. 3. Place filters in hood, add 50% (approximate concentration) HCl acid (Fisher, certified ACS......

274

E-Print Network 3.0 - acid n-glycolylneuraminic acid Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acids are kept in storage cabinets under the fume hood... in the plastic box. 3. Place filters in hood, add 50% (approximate concentration) HCl acid (Fisher, certified ACS......

275

E-Print Network 3.0 - acids organic acids Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

in the decomposition of organic material, is the primary source of acidity in unpolluted rainwater. NOTE: Parts per... A ACID RAIN Audrey Gibson ATOC 3500 Thursday, April ......

276

E-Print Network 3.0 - acid propionic acid Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by Explorit Topic List Advanced Search Sample search results for: acid propionic acid Page: << < 1 2 3 4 5 > >> 1 Biodegradation 9: 463473, 1998. 1998 Kluwer Academic...

277

E-Print Network 3.0 - acid linoleic acid Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

FAs (linolenic, linoleic) - - monounsaturated FAs (oleic acid) - olive, canola - hydrogenation... Biol 458 Lecture 6 & 7 Fatty Acids 1 A. Introduction to acyl lipids...

278

Binary electrokinetic separation of target DNA from background DNA primers.  

SciTech Connect (OSTI)

This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

James, Conrad D.; Derzon, Mark Steven

2005-10-01T23:59:59.000Z

279

Modeling of Acid Fracturing in Carbonate Reservoirs  

E-Print Network [OSTI]

The acid fracturing process is a thermal, hydraulic, mechanical, and geochemical (THMG)-coupled phenomena in which the behavior of these variables are interrelated. To model the flow behavior of an acid into a fracture, mass and momentum balance...

Al Jawad, Murtada s

2014-06-05T23:59:59.000Z

280

acidization: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 7 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Fuel cell electrolyte membrane with acidic polymer  

DOE Patents [OSTI]

An electrolyte membrane is formed by an acidic polymer and a low-volatility acid that is fluorinated, substantially free of basic groups, and is either oligomeric or non-polymeric.

Hamrock, Steven J. (Stillwater, MN); Larson, James M. (Saint Paul, MN); Pham, Phat T. (Little Canada, MN); Frey, Matthew H. (Cottage Grove, MN); Haugen, Gregory M. (Edina, MN); Lamanna, William M. (Stillwater, MN)

2009-04-14T23:59:59.000Z

282

Recovery of mercury from acid waste residues  

DOE Patents [OSTI]

Mercury can be recovered from nitric acid-containing fluids by reacting the fluid with aluminum metal to produce mercury metal, and thence quenching the reactivity of the nitric acid prior to nitration of the mercury metal. 1 fig.

Greenhalgh, W.O.

1987-02-27T23:59:59.000Z

283

Recovery of mercury from acid waste residues  

DOE Patents [OSTI]

Mercury can be recovered from nitric acid-containing fluids by reacting the fluid with aluminum metal to produce mercury metal, and then quenching the reactivity of the nitric acid prior to nitration of the mercury metal.

Greenhalgh, Wilbur O. (Richland, WA)

1989-01-01T23:59:59.000Z

284

amino acid intake: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

protein intake (PDI) and net portal appearance rate of amino acids by continuous infusion of para-aminohippuric acid via the mesenteric catheter. The amino-acid appearance...

285

Reactions Between Water Soluble Organic Acids and Nitrates in...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Reactions Between Water Soluble Organic Acids and Nitrates in Atmospheric Aerosols: Recycling of Nitric Acid and Formation of Reactions Between Water Soluble Organic Acids and...

286

acid synthase impacts: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

acid utilization and glucose oxidation. Glucose... Adhikari, Sean 2006-10-30 246 ANTIBODY PURIFICATION USING CAPRYLIC ACID In mildly acidic conditions, the addition of short-chain...

287

Nanoplasmonic molecular ruler for nuclease activity and DNA footprinting  

DOE Patents [OSTI]

This invention provides a nanoplasmonic molecular ruler, which can perform label-free and real-time monitoring of nucleic acid (e.g., DNA) length changes and perform nucleic acid footprinting. In various embodiments the ruler comprises a nucleic acid attached to a nanoparticle, such that changes in the nucleic acid length are detectable using surface plasmon resonance. The nanoplasmonic ruler provides a fast and convenient platform for mapping nucleic acid-protein interactions, for nuclease activity monitoring, and for other footprinting related methods.

Chen, Fanqing Frank; Liu, Gang L; Lee, Luke P

2013-10-29T23:59:59.000Z

288

Unnatural reactive amino acid genetic code additions  

DOE Patents [OSTI]

This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, orthogonal pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

Deiters, Alexander; Cropp, T. Ashton; Chin, Jason W.; Anderson, J. Christopher; Schultz, Peter G.

2014-08-26T23:59:59.000Z

289

Organic Acid Production by Filamentous Fungi  

E-Print Network [OSTI]

-being. Indeed, organic acid fermentations are often not even identified as fungal bioprocesses, having been Aspergillus niger in aerated stirred-tank-reactors can convert glucose to citric acid with greater than 80 lipolytica, and related yeast species, may be in use commercially to produce citric acid (Lopez-Garcia, 2002

290

Unnatural reactive amino acid genetic code additions  

DOE Patents [OSTI]

This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNAsyn-thetases, pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

Deiters, Alexander (La Jolla, CA); Cropp, T. Ashton (Bethesda, MD); Chin, Jason W. (Cambridge, GB); Anderson, J. Christopher (San Francisco, CA); Schultz, Peter G. (La Jolla, CA)

2011-08-09T23:59:59.000Z

291

Unnatural reactive amino acid genetic code additions  

DOE Patents [OSTI]

This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

Deiters, Alexander; Cropp, Ashton T; Chin, Jason W; Anderson, Christopher J; Schultz, Peter G

2013-05-21T23:59:59.000Z

292

Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters  

DOE Patents [OSTI]

A process is disclosed for preparing an acid addition salt of delta-aminolevulinic acid comprising. The process involves dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing the alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

Moens, L.

1999-05-25T23:59:59.000Z

293

Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters  

DOE Patents [OSTI]

A process of preparing an acid addition salt of delta-aminolevulinic acid comprising: dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures thereof to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing said alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

Moens, Luc (Lakewood, CO)

1999-01-01T23:59:59.000Z

294

ARM - Lesson Plans: Acid Rain  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc Documentation RUC : XDCResearch Related InformationAcid Rain Outreach Home Room News

295

Thermal Stability Of Formohydroxamic Acid  

SciTech Connect (OSTI)

The thermal stability of formohydroxamic acid (FHA) was evaluated to address the potential for exothermic decomposition during storage and its use in the uranium extraction process. Accelerating rate calorimetry showed rapid decomposition at a temperature above 65 {degree}?C; although, the rate of pressure rise was greater than two orders of magnitude less than the lower bound for materials which have no explosive properties with respect to transportation. FHA solutions in water and nitric acid did not reach runaway conditions until 150 {degree}?C. Analysis by differential scanning calorimetry showed that FHA melted at 67 {degree}?C and thermally decomposed at 90 {degree}?C with an enthalpy of -1924 J/g. The energics of the FHA thermal decomposition are comparable to those measured for aqueous solutions of hydroxylamine nitrate. Solid FHA should be stored in a location where the temperature does not exceed 20-25 {degree}?C. As a best practice, the solid material should be stored in a climate-controlled environment such as a refrigerator or freezer. FHA solutions in water are not susceptible to degradation by acid hydrolysis and are the preferred way to handle FHA prior to use.

Fondeur, F. F.; Rudisill, T. S.

2011-10-21T23:59:59.000Z

296

CHAPTER 13. ACID RAIN Acid rain was discovered in the 19th century by Robert Angus  

E-Print Network [OSTI]

247 CHAPTER 13. ACID RAIN Acid rain was discovered in the 19th century by Robert Angus Smith, a pharmacist from Manchester (England), who measured high levels of acidity in rain falling over industrial decline of fish populations in the lakes of southern Norway and traced the problem to acid rain. Similar

Jacob, Daniel J.

297

Fate of Acids in Clouds 1. Combination with bases dissolved in clouds: acids neutralized  

E-Print Network [OSTI]

problems. E#11;ects of Acid Rain 1. Vegetation: SO 2 is toxic to plants #15; Leaves damaged below pH 3 rain { Athens and Rome cathedrals and statues: pollution leads to acid rain #15; SteelFate of Acids in Clouds 1. Combination with bases dissolved in clouds: acids neutralized NH 3 (g

Schofield, Jeremy

298

Radioiodinated fatty acid analogs for myocardial imaging  

SciTech Connect (OSTI)

Fatty acids are the preferred substrate for the normoxic heart. About sixty percent of the energy required by the myocardium is provided by fatty acid [beta]-oxidation. Many scientists have focused on the alterations in fatty acid metabolism in the ischemic heart for the development of radiolabelled fatty acids for functional imaging of the heart. Three main categories of compounds were synthesized: tetrazoles (1 and 2), glycidic and [alpha]-methylene acids (3-5), and analogs of oleic acid (6,7 and 7A). The tetrazole group has a similar pKa and size to that of a carboxyl group; however, such fatty acid analogs cannot undergo normal fatty acid metabolism. Glycidic and [alpha]-methylene analogs are potential irreversible inhibitors of fatty acid metabolism. Oleic acid analogs were investigated to assess the affect of stereochemical consequences on biodistribution. The key intermediates in the synthesis of the target compounds were [omega]-nitrophenyl alkylcarboxylic acids and alcohols, which were made using a variety of cross-coupling reactions. The Wittig reaction, which was used in the synthesis of tetrazole 1 and glycidic acid 3, gave low yields of the cross-coupled products. The remaining target compounds were synthesized by condensation of appropriate RCu (CN) ZnI and substituted benzyl bromides or by Pd[sup II] catalyzed cross-coupling of substituted arylhalides with suitable alkynes. The latter two reactions produced much higher yields of the desired products. All of the target compounds were radiolabeled with [sup 125]I by various Cu(I) catalyzed radioiodine exchange procedures and were then subjected to tissue biodistribution (TD) studies in rats. Except for the 15-(4-iodophenyl)-2-methylene-pentadecanoic acid (5), all of the fatty acid analogs failed to surpass clinically-used 15-(4-iodophenyl)pentadecanoic acid (IPPA) in their ability to be taken up and retained by the rat myocardium.

Ruyan, M.K.

1993-01-01T23:59:59.000Z

299

Solid phase sequencing of biopolymers  

DOE Patents [OSTI]

This invention relates to methods for detecting and sequencing target nucleic acid sequences, to mass modified nucleic acid probes and arrays of probes useful in these methods, and to kits and systems which contain these probes. Useful methods involve hybridizing the nucleic acids or nucleic acids which represent complementary or homologous sequences of the target to an array of nucleic acid probes. These probes comprise a single-stranded portion, an optional double-stranded portion and a variable sequence within the single-stranded portion. The molecular weights of the hybridized nucleic acids of the set can be determined by mass spectroscopy, and the sequence of the target determined from the molecular weights of the fragments. Nucleic acids whose sequences can be determined include DNA or RNA in biological samples such as patient biopsies and environmental samples. Probes may be fixed to a solid support such as a hybridization chip to facilitate automated molecular weight analysis and identification of the target sequence.

Cantor, Charles (Del Mar, CA); Koster, Hubert (La Jolla, CA)

2010-09-28T23:59:59.000Z

300

Micro-electro-mechanical systems phosphoric acid fuel cell  

DOE Patents [OSTI]

A phosphoric acid fuel cell system comprising a porous electrolyte support, a phosphoric acid electrolyte in the porous electrolyte support, a cathode electrode contacting the phosphoric acid electrolyte, and an anode electrode contacting the phosphoric acid electrolyte.

Sopchak, David A. (Livermore, CA); Morse, Jeffrey D. (Martinez, CA); Upadhye, Ravindra S. (Pleasanton, CA); Kotovsky, Jack (Oakland, CA); Graff, Robert T. (Modesto, CA)

2010-12-21T23:59:59.000Z

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Micro-electro-mechanical systems phosphoric acid fuel cell  

DOE Patents [OSTI]

A phosphoric acid fuel cell system comprising a porous electrolyte support, a phosphoric acid electrolyte in the porous electrolyte support, a cathode electrode contacting the phosphoric acid electrolyte, and an anode electrode contacting the phosphoric acid electrolyte.

Sopchak, David A. (Livermore, CA); Morse, Jeffrey D. (Martinez, CA); Upadhye, Ravindra S. (Pleasanton, CA); Kotovsky, Jack (Oakland, CA); Graff, Robert T. (Modesto, CA)

2010-08-17T23:59:59.000Z

302

acid bacteria isolates: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

acids are solids not liquids. They sublime under vacuum to compare the strengths of solid acids with liquid acids therefore led us to obtain a measure of acidity in dilute...

303

acid bacteria isolated: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

acids are solids not liquids. They sublime under vacuum to compare the strengths of solid acids with liquid acids therefore led us to obtain a measure of acidity in dilute...

304

Testing of organic acids in engine coolants  

SciTech Connect (OSTI)

The effectiveness of 30 organic acids as inhibitors in engine coolants is reported. Tests include glassware corrosion of coupled and uncoupled metals. FORD galvanostatic and cyclic polarization electrochemistry for aluminum pitting, and reserve alkalinity (RA) measurements. Details of each test are discussed as well as some general conclusions. For example, benzoic acid inhibits coupled metals well but is ineffective on cast iron when uncoupled. In benzoic acid inhibits coupled metals well but is ineffective on cast iron when uncoupled. In general, the organic acids provide little RA when titrated to a pH of 5.5, titration to a pH of 4.5 can result in precipitation of the acid. Trends with respect to acid chain length are reported also.

Weir, T.W. [ARCO Chemical Co., Newtown Square, PA (United States)

1999-08-01T23:59:59.000Z

305

Carboxylic acid accelerated formation of diesters  

DOE Patents [OSTI]

This invention pertains to accelerating the rate of formation of 1,1-dicarboxylic esters from the reaction of an aldehyde with a carboxylic acid anhydride or a ketene in the presence of a non-iodide containing a strong Bronsted acid catalyst by the addition of a carboxylic acid at about one bar pressure and between about 0 and 80 C in the substantial absence of a hydrogenation or carbonylation catalyst.

Tustin, G.C.; Dickson, T.J.

1998-04-28T23:59:59.000Z

306

Organic Phosphoric Acid of the Soil.  

E-Print Network [OSTI]

TEXAS AGRICULTURAL EXPERIMENT STATIONS BULLETIN NO. +6CT /36 CHEMICAL SECTION, FEBRUARY, 191 1 I TECHNICAL BULLETIN Organic Phosphoric Acid of the Soil BY G. S. FRAPS, Chemist POSTOFFICE College Station, Brazos County, 'Texas. ,\\ustin... . ................................................ introduction 5 .............................. hmmonia-Soluble Phosphoric Acid 5 ................ Solubility of Phosphates in Ammonia 6 I Fixation of Phosphoric Acid from Ammonia .......... 7 Effect of Ratio of Soil to Solvent in Extraction of Phos- I I...

Fraps, G. S. (George Stronach)

1911-01-01T23:59:59.000Z

307

Acid rain information book. Draft final report  

SciTech Connect (OSTI)

Acid rain is one of the most widely publicized environmental issues of the day. The potential consequences of increasingly widespread acid rain demand that this phenomenon be carefully evaluated. Reveiw of the literature shows a rapidly growing body of knowledge, but also reveals major gaps in understanding that need to be narrowed. This document discusses major aspects of the acid rain phenomenon, points out areas of uncertainty, and summarizes current and projected research by responsible government agencies and other concerned organizations.

None

1980-12-01T23:59:59.000Z

308

Carboxylic acid accelerated formation of diesters  

DOE Patents [OSTI]

This invention pertains to accelerating the rate of formation of 1,1-dicarboxylic esters from the reaction of an aldehyde with a carboxylic acid anhydride or a ketene in the presence of a non-iodide containing a strong Bronsted acid catalyst by the addition of a carboxylic acid at about one bar pressure and between about 0.degree. and 80.degree. C. in the substantial absence of a hydrogenation or carbonylation catalyst.

Tustin, Gerald Charles (Kingsport, TN); Dickson, Todd Jay (Kingsport, TN)

1998-01-01T23:59:59.000Z

309

Novel Regenerated Solvent Extraction Processes for the Recovery of Carboxylic Acids or Ammonia from Aqueous Solutions Part I. Regeneration of Amine-Carboxylic Acid Extracts  

E-Print Network [OSTI]

production of citric acid by fermentation, recovery of theof Citric Acid from Aqueous Fermentation Solutions byof citric acid was 1.1.1 Lactic Acid Currently, fermentation

Poole, L.J.

2008-01-01T23:59:59.000Z

310

Acid Doped Membranes for High Temperature PEMFC  

Broader source: Energy.gov [DOE]

Presentation on Acid Doped Membranes for High Temperature PEMFC to the High Temperature Membrane Working Group, May 25, 2004 in Philadelphia, PA.

311

Organic acid-tolerant microorganisms and uses thereof for producing organic acids  

DOE Patents [OSTI]

Organic acid-tolerant microorganisms and methods of using same. The organic acid-tolerant microorganisms comprise modifications that reduce or ablate AcsA activity or AcsA homolog activity. The modifications increase tolerance of the microorganisms to such organic acids as 3-hydroxypropionic acid (3HP), acrylic acid, and propionic acid. Further modifications to the microorganisms such as increasing expression of malonyl-CoA reductase and/or acetyl-CoA carboxylase provide or increase the ability of the microorganisms to produce 3HP. Methods of generating an organic acid with the modified microorganisms are provided. Methods of using acsA or homologs thereof as counter-selectable markers include replacing acsA or homologs thereof in cells with genes of interest and selecting for the cells comprising the genes of interest with amounts of organic acids effective to inhibit growth of cells harboring acsA or the homologs.

Pfleger, Brian Frederick; Begemann, Matthew Brett

2014-05-06T23:59:59.000Z

312

E-Print Network 3.0 - acid eicosapentaenoic acid Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sample search results for: acid eicosapentaenoic acid Page: << < 1 2 3 4 5 > >> 1 Fish or Fish Oil in the Diet and Heart Attacks MAURICE E. STANSBY Summary: . Further...

313

E-Print Network 3.0 - acids eicosapentaenoic acid Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sample search results for: acids eicosapentaenoic acid Page: << < 1 2 3 4 5 > >> 1 Fish or Fish Oil in the Diet and Heart Attacks MAURICE E. STANSBY Summary: . Further...

314

2006 DOE Hydrogen Program Poly (p-phenylene Sulfonic Acid)s with...  

Broader source: Energy.gov (indexed) [DOE]

2006 DOE Hydrogen Program Poly (p-phenylene Sulfonic Acid)s with Frozen-in Free Volume for use in High Temperature Fuel Cells 2006 DOE Hydrogen Program Poly (p-phenylene Sulfonic...

315

2006 DOE Hydrogen Program Poly (p-phenylene Sulfonic Acid)s with...  

Broader source: Energy.gov (indexed) [DOE]

Poly(p-phenylene Sulfonic Acid)s with Frozen-in Free Volume for use in High Temperature Fuel Cells Morton Litt and Peter Pintauro Case Western Reserve University Cleveland, Ohio...

316

acid-dependent ribonucleic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 40 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

317

Decomposition Studies of Triphenylboron, Diphenylborinic Acid and Phenylboric Acid in Aqueous Alkaline Solutions Containing Copper  

SciTech Connect (OSTI)

This report documents the copper-catalyzed chemical kinetics of triphenylboron, diphenylborinic acid and phenylboric acid (3PB, 2PB and PBA) in aqueous alkaline solution contained in carbon-steel vessels between 40 and 70 degrees C.

Crawford, C.L. [Westinghouse Savannah River Company, AIKEN, SC (United States); Peterson, R. A.

1997-02-11T23:59:59.000Z

318

BNL Citric Acid Technology: Pilot Scale Demonstration  

SciTech Connect (OSTI)

The objective of this project is to remove toxic metals such as lead and cadmium from incinerator ash using the Citric Acid Process developed at Brookhaven National Laboratory. In this process toxic metals in bottom ash from the incineration of municipal solid waste were first extracted with citric acid followed by biodegradation of the citric acid-metal extract by the bacterium Pseudomonas fluorescens for metals recovery. The ash contained the following metals: Al, As, Ba, Ca, Cd, Cr, Cu, Fe, Mg, Mn, Ni, Pb, Se, Sr, Ti, and Zn. Optimization of the Citric Acid Process parameters which included citric acid molarity, contact time, the impact of mixing aggressiveness during extraction and pretreatment showed lead and cadmium removal from incinerator ash of >90%. Seeding the treated ash with P. fluorescens resulted in the removal of residual citric acid and biostabilization of any leachable lead, thus allowing it to pass EPA?s Toxicity Characteristic Leaching Procedure. Biodegradation of the citric acid extract removed >99% of the lead from the extract as well as other metals such as Al, Ca, Cu, Fe, Mg, Mn, Ti, and Zn. Speciation of the bioprecipitated lead by Extended X-ray Absorption Fine Structure at the National Synchrotron Light Source showed that the lead is predominantly associated with the phosphate and carboxyl functional groups in a stable form. Citric acid was completely recovered (>99%) from the extract by sulfide precipitation technique and the extraction efficiency of recovered citric acid is similar to that of the fresh citric acid. Recycling of the citric acid should result in considerable savings in the overall treatment cost. We have shown the potential application of this technology to remove and recover the metal contaminants from incinerator ash as well as from other heavy metal bearing wastes (i.e., electric arc furnace dust from steel industry) or soils. Information developed from this project is being applied to demonstrate the remediation of lead paint contaminated soils on Long Island.

FRANCIS, A J; DODGE,; J, C; GILLOW, J B; FORRESTER, K E

1999-09-24T23:59:59.000Z

319

Further Investigation of Fluoboric Acid in Sandstone Acidizing Using ^(11)B and ^(19)F NMR  

E-Print Network [OSTI]

Although fluoboric acid (HBF_(4)) has long been known as one of the low-damaging acid treatments for clayey sandstone formations, little is known of its chemistry which could explain the mixed results of fluoboric acid in actual field application. A...

Pituckchon, Arpajit

2014-05-01T23:59:59.000Z

320

Electrostatic precipitation of condensed acid mist  

SciTech Connect (OSTI)

This project addresses the acid mist that is formed by condensation of sulfuric acid vapor in flue gas from coal-fired utility boilers. An acid mist can be formed whenever the flue gas temperature approaches the prevailing acid dew point. This commonly occurs when the gas is subjected to rapid adiabatic cooling in a wet scrubber system for flue gas desulfurization. Acid mists can also sometimes result from unexpected temperature excursions caused by air inleakage, load cycling, and start-up operations. A wet electrostatic precipitator (WESP) is the best control option for acid mist. The mist would blind a fabric filter and attach glass fiber fabrics. A wet ESP is required because the acid would quickly corrode the plates in a conventional dry ESP. The wet ESP also offers the advantages of no rapping reentrainment and no sensitivity to fly ash resistivity. Therefore, this program has been structured around the use of a compact, wet ESP to control acid mist emissions. Progress to date is discussed. 7 refs., 1 fig.

Not Available

1990-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Electrostatic precipitation of condensed acid mist  

SciTech Connect (OSTI)

This project addresses the acid mist that is formed by condensation of sulfuric acid vapor in flue gas from coal-fired utility boilers. An acid mist can be formed whenever the flue gas temperature approaches the prevailing acid dew point. This commonly occurs when the gas is subjected to rapid adiabatic cooling in a wet scrubber system for flue gas desulfurization. Acid mists can also sometimes result from unexpected temperature excursions caused by air inleakage, load cycling, and start-up operations. A wet electrostatic precipitator (WESP) is the best control option for acid mist. The mist would blind a fabric filter and attack glass fiber fabrics. A wet ESP is required because the acid would quickly corrode the plates in a conventional dry ESP. The wet ESP also offers the advantages of no rapping reentrainment and no sensitivity to fly ash resistivity. Therefore, this program has been structured around the use of a compact, wet ESP to control acid mist emissions. 7 refs.

Not Available

1990-01-01T23:59:59.000Z

322

Nanoparticles modified with multiple organic acids  

DOE Patents [OSTI]

Surface-modified nanoparticles of boehmite, and methods for preparing the same. Aluminum oxyhydroxide nanoparticles are surface modified by reaction with selected amounts of organic acids. In particular, the nanoparticle surface is modified by reactions with two or more different carboxylic acids, at least one of which is an organic carboxylic acid. The product is a surface modified boehmite nanoparticle that has an inorganic aluminum oxyhydroxide core, or part aluminum oxyhydroxide core and a surface-bonded organic shell. Organic carboxylic acids of this invention contain at least one carboxylic acid group and one carbon-hydrogen bond. One embodiment of this invention provides boehmite nanoparticles that have been surface modified with two or more acids one of which additional carries at least one reactive functional group. Another embodiment of this invention provides boehmite nanoparticles that have been surface modified with multiple acids one of which has molecular weight or average molecular weight greater than or equal to 500 Daltons. Yet, another embodiment of this invention provides boehmite nanoparticles that are surface modified with two or more acids one of which is hydrophobic in nature and has solubility in water of less than 15 by weight. The products of the methods of this invention have specific useful properties when used in mixture with liquids, as filler in solids, or as stand-alone entities.

Cook, Ronald Lee (Lakewood, CO); Luebben, Silvia DeVito (Golden, CO); Myers, Andrew William (Arvada, CO); Smith, Bryan Matthew (Boulder, CO); Elliott, Brian John (Superior, CO); Kreutzer, Cory (Brighton, CO); Wilson, Carolina (Arvada, CO); Meiser, Manfred (Aurora, CO)

2007-07-17T23:59:59.000Z

323

Nitrates and Prussic Acid in Forages  

E-Print Network [OSTI]

When nitrates and prussic acid accumulate in forage, the feed may not be safe for livestock consumption. Learn the symptoms of nitrate and prussic acid poisoning and which plants are most likely to pose a risk to livestock. Also learn sampling...

Provin, Tony; Pitt, John L.

2003-01-06T23:59:59.000Z

324

Amino acid analogs for tumor imaging  

DOE Patents [OSTI]

The invention provides novel amino acid compounds of use in detecting and evaluating brain and body tumors. These compounds combine the advantageous properties of 1-amino-cycloalkyl-1-carboxylic acids, namely, their rapid uptake and prolonged retention in tumors with the properties of halogen substituents, including certain useful halogen isotopes including fluorine-18, iodine-123, iodine-125, iodine-131, bromine-75, bromine-76, bromine-77 and bromine-82. In one aspect, the invention features amino acid compounds that have a high specificity for target sites when administered to a subject in vivo. Preferred amino acid compounds show a target to non-target ratio of at least 5:1, are stable in vivo and substantially localized to target within 1 hour after administration. An especially preferred amino acid compound is [{sup 18}F]-1-amino-3-fluorocyclobutane-1-carboxylic acid (FACBC). In another aspect, the invention features pharmaceutical compositions comprised of an {alpha}-amino acid moiety attached to either a four, five, or a six member carbon-chain ring. In addition, the invention features analogs of {alpha}-aminoisobutyric acid.

Goodman, M.M.; Shoup, T.

1998-10-06T23:59:59.000Z

325

Amino acid analogs for tumor imaging  

DOE Patents [OSTI]

The invention provides novel amino acid compounds of use in detecting and evaluating brain and body tumors. These compounds combine the advantageous properties of 1-amino-cycloalkyl-1-carboxylic acids, namely, their rapid uptake and prolonged retention in tumors with the properties of halogen substituents, including certain useful halogen isotopes including fluorine-18, iodine-123, iodine-125, iodine-131, bromine-75, bromine-76, bromine-77 and bromine-82. In one aspect, the invention features amino acid compounds that have a high specificity for target sites when administered to a subject in vivo. Preferred amino acid compounds show a target to non-target ratio of at least 5:1, are stable in vivo and substantially localized to target within 1 hour after administration. An especially preferred amino acid compound is [{sup 18}F]-1-amino-3-fluorocyclobutane-1-carboxylic acid (FACBC). In another aspect, the invention features pharmaceutical compositions comprised of an {alpha}-amino acid moiety attached to either a four, five, or a six member carbon-chain ring. In addition, the invention features analogs of {alpha}-aminoisobutyric acid.

Goodman, M.M.; Shoup, T.

1998-09-15T23:59:59.000Z

326

Amino acid analogs for tumor imaging  

DOE Patents [OSTI]

The invention provides novel amino acid compounds of use in detecting and evaluating brain and body tumors. These compounds combine the advantageous properties of 1-amino-cycloalkyl-1-carboxylic acids, namely, their rapid uptake and prolonged retention in tumors with the properties of halogen substituents, including certain useful halogen isotopes including fluorine-18, iodine-123, iodine-125, iodine-131, bromine-75, bromine-76, bromine-77 and bromine-82. In one aspect, the invention features amino acid compounds that have a high specificity for target sites when administered to a subject in vivo. Preferred amino acid compounds show a target to non-target ratio of at least 5:1, are stable in vivo and substantially localized to target within 1 hour after administration. An especially preferred amino acid compound is ›.sup.18 F!-1-amino-3-fluorocyclobutane-1-carboxylic acid (FACBC). In another aspect, the invention features pharmaceutical compositions comprised of an .alpha.-amino acid moiety attached to either a four, five, or a six member carbon-chain ring. In addition, the invention features analogs of .alpha.-aminoisobutyric acid.

Goodman, Mark M. (Atlanta, GA); Shoup, Timothy (Decatur, GA)

1998-09-15T23:59:59.000Z

327

Amino acid analogs for tumor imaging  

DOE Patents [OSTI]

The invention provides novel amino acid compounds of use in detecting and evaluating brain and body tumors. These compounds combine the advantageous properties of 1-amino-cycloalkyl-1-carboxylic acids, namely, their rapid uptake and prolonged retention in tumors with the properties of halogen substituents, including certain useful halogen isotopes including fluorine-18, iodine-123, iodine-125, iodine-131, bromine-75, bromine-76, bromine-77 and bromine-82. In one aspect, the invention features amino acid compounds that have a high specificity for target sites when administered to a subject in vivo. Preferred amino acid compounds show a target to non-target ratio of at least 5:1, are stable in vivo and substantially localized to target within 1 hour after administration. An especially preferred amino acid compound is ›.sup.18 F!-1-amino-3-fluorocyclobutane-1-carboxylic acid (FACBC). In another aspect, the invention features pharmaceutical compositions comprised of an .alpha.-amino acid moiety attached to either a four, five, or a six member carbon-chain ring. In addition, the invention features analogs of .alpha.-aminoisobutyric acid.

Goodman, Mark M. (Atlanta, GA); Shoup, Timothy (Decatur, GA)

1998-10-06T23:59:59.000Z

328

Naphthenic acid corrosion by Venezuelan crudes  

SciTech Connect (OSTI)

Venezuelan crudes can contain levels of naphthenic acids that cause corrosion in distillation units designed for sweet crudes. This naphthenic acid corrosion can be mitigated in several ways, the most common of which is selective alloying. This paper will provide information from field experience on how various refineries worldwide have upgraded materials to run Venezuelan crudes in a cost effective way.

Hopkinson, B.E.; Penuela, L.E. [Lagoven, S.A., Judibana (Venezuela). Amuay Refinery

1997-09-01T23:59:59.000Z

329

Naphthenic acid corrosion in crude distillation units  

SciTech Connect (OSTI)

This paper summarizes corrosion experience in crude distillation units processing highly naphthenic California crude oils. Correlations have been developed relating corrosion rates to temperature and total acid number. There is a threshold acid number in the range of 1.5 to 2 mg KOH/g below which corrosion is minimal. High concentrations of hydrogen sulfide may raise this threshold value.

Piehl, R.L.

1988-01-01T23:59:59.000Z

330

Metabolic Flux Analysis for Succinic Acid Production by Recombinant Escherichia  

E-Print Network [OSTI]

; Samuelov et al., 1991). Escherichia coli produces several metabolic products by fermentation: acetic acid the final succinic acid concentration obtained was 9.5 g/L and the ratio of succinic acid to acetic acid being expended on the production of succinic acid by microbial fermentation using renewable feedstocks

331

Surfactant Screening to Alter the Wettability and Aid in Acidizing Carbonate Formations  

E-Print Network [OSTI]

, known as high temperature organic acids (HTO acids), have been found to be useful in acidizing subterranean formations at temperatures up to 400oF. Some of these acids are oxalic acid, malonic acid, pimelic acid, succinic acid, glutaric acid, adipic... acid and their mixtures. In addition to creating wormholes in carbonate formations, HTO acids can remove carbonate scale at high temperatures and cause very low corrosion to the tubing and casing. 6 1.2 Role of Surfactants in Acidizing 1...

Yadhalli Shivaprasad, Arun Kumar

2013-02-26T23:59:59.000Z

332

Difunctional carboxylic acid anions in oilfield waters  

SciTech Connect (OSTI)

Recent models of porosity enhancement during sandstone diagenesis have called upon the metal complexing ability of difunctional carboxylic acid anions in subsurface waters to explain aluminosilicate dissolution. Although carboxylic acid anions have been known to exist in oilfield waters since the turn of the century, until now the existence of significant concentrations of difunctional carboxylic acid anions has not been documented. Data from this study show that difunctional carboxylic acid anions can exist in concentrations up to 2640 ppm, and can account for nearly 100% of the organic acid anions in some oilfield waters. Formation water samples with exceptionally high concentrations of difunctional carboxylic acid anions are found in reservoirs which are at maximum levels of thermal exposure, and which are presently in the 80-100/sup 0/C thermal window. Plagioclase dissolution experiments performed with natural oilfield waters and artificial solutions indicate that waters with high difunctional acid anion concentrations are capable, by organo-metallic complexation, of being apparently oversaturated with respect to total aluminum concentrations compared to the inorganic solubility of kaolinite by several orders of magnitude. Dissolution experiments simulating a specific geologic environment (Stevens Sandstone, southern San Joaquin Basin, California; using natural oilfield waters and Stevens Sandstone core samples), produced plagioclase and calcite dissolution textures similar to those noted in well cores from the Stevens Sandstone, as well as raising total aluminum concentrations in these experimental solutions several orders of magnitude over the solubility of kaolinite.

MacGowan, D.B.; Surdam, R.C.

1988-01-01T23:59:59.000Z

333

Experimental Study of Acid Fracture Conductivity of Austin Chalk Formation  

E-Print Network [OSTI]

Acid fracture conductivity and the effect of key variables in the etching process during acid fracturing can be assessed at the laboratory scale. This is accomplished by using an experimental apparatus that simulates acid injection fluxes comparable...

Nino Penaloza, Andrea

2013-05-01T23:59:59.000Z

334

Experimental High Velocity Acid Jetting in Limestone Carbonates  

E-Print Network [OSTI]

Acid jetting is a well stimulation technique that is used in carbonate reservoirs. It typically involves injecting acid down hole at high flow rates through small orifices which cause high velocities of acid to strike the borehole wall...

Holland, Christopher

2014-04-30T23:59:59.000Z

335

acid-base imbalance: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

acid generates a material (PE-C02H Deutch, John 59 Acid-Based Synthesis of Monodisperse Rare-Earth-Doped Colloidal SiO2 Spheres Materials Science Websites Summary: Acid-Based...

336

aqueous tartaric acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

with limited success.2,3 During the last decade, attention to sulfuric acid anodizing and boric-sulfuric acid Paris-Sud XI, Universit de 255 Si isotope systematics of acidic...

337

Production of Succinic Acid for Lignocellulosic Hydrolysates  

SciTech Connect (OSTI)

The purpose of this Cooperative Research and Development Agreement (CRADA) is to add and test new metabolic activities to existing microbial catalysts for the production of succinic acid from renewables. In particular, they seek to add to the existing organism the ability to utilize xylose efficiently and simultaneously with glucose in mixtures of sugars or to add succinic acid production to another strain and to test the value of this new capability for production of succinic acid from industrial lignocellulosic hydrolyasates. The Contractors and Participant are hereinafter jointly referred to as the 'Parties'. Research to date in succinic acid fermentation, separation and genetic engineering has resulted in a potentially economical process based on the use of an Escherichia coli strain AFP111 with suitable characteristics for the production of succinic acid from glucose. Economic analysis has shown that higher value commodity chemicals can be economically produced from succinic acid based on repliminary laboratory findings and predicted catalytic parameters. The initial target markets include succinic acid itself, succinate salts, esters and other derivatives for use as deicers, solvents and acidulants. The other commodity products from the succinic acid platform include 1,4-butanediol, {gamma}-butyrolactone, 2-pyrrolidinone and N-methyl pyrrolidinone. Current economic analyses indicate that this platform is competitive with existing petrochemical routes, especially for the succinic acid and derivatives. The report presents the planned CRADA objectives followed by the results. The results section has a combined biocatalysis and fermentation section and a commercialization section. This is a nonproprietary report; additional proprietary information may be made available subject to acceptance of the appropriate proprietary information agreements.

Davison, B.H.; Nghiem, J.

2002-06-01T23:59:59.000Z

338

Naphthenic acid corrosion in refinery settings  

SciTech Connect (OSTI)

Naphthenic acid corrosion has been a problem in the refining industry for many years. Recently interest in this problem has grown because crudes that contain naphthenic acid are being recovered from areas which were not known to produce this type of crude, such as china, India, and Africa. New techniques for identifying naphthenic acid corrosion and chemical treatments for preventing this attack are presented. Refinery case studies include stream analysis, failure analysis, and inhibitor use. Laboratory tests to show the effect of hydrogen sulfide and phosphorus-based inhibitors are discussed.

Babaian-Kibala, E. (Nalco Chemical Co., Sugar Land, TX (United States)); Craig, H.L. Jr. (Mobil Research and Development Corp., Paulsboro, NJ (United States)); Rusk, G.L. (Mobil Oil Co., Torrance, CA (United States)); Blanchard, K.V.; Rose, T.J.; Uehlein, B.L. (Nalco Chemical Co., Paulsboro, NJ (United States)); Quinter, R.C. (Sun Co., Newtown Square, PA (United States)); Summers, M.A. (Sun Co., Marcus Hook, PA (United States))

1993-04-01T23:59:59.000Z

339

E-Print Network 3.0 - acid rain compliance Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

produces salt and water. 2. Acid rain... is rain that is slightly acidic due to pollution in the air. Acid rain greatly affects the ecosystems... is acid ... Source:...

340

E-Print Network 3.0 - acidic potassium permanganate Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

State University General Guidelines Summary: acid Aminoalkanoic acids with 6 or fewer carbon atoms and the ammonium, sodium and potassium salts... of these acids. Amino acids...

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Experimental Investigation for the Effects of the Core Geometry on the Optimum Acid Flux in Carbonate Acidizing  

E-Print Network [OSTI]

Previous matrix acidizing experimental research showed that there exists an optimum acid interstitial velocity (Vi-opt) that results in the minimum volume of acid used while providing the best stimulation results. There are already several...

Jin, Xiao

2013-11-21T23:59:59.000Z

342

Acid Initiation of Ammonia-Borane Dehydrogenation for Hydrogen...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acid Initiation of Ammonia-Borane Dehydrogenation for Hydrogen Storage. Acid Initiation of Ammonia-Borane Dehydrogenation for Hydrogen Storage. Abstract: An abstract for this...

343

Characterizing Surface Acidic Sites in Mesoporous-Silica-Supported...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Surface Acidic Sites in Mesoporous-Silica-Supported Tungsten Oxide Catalysts Using Solid State NMR and Quantum Characterizing Surface Acidic Sites in Mesoporous-Silica-Supported...

344

Lewis Acid-Base Interactions between Polysulfides and Metal Organic...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Lewis Acid-Base Interactions between Polysulfides and Metal Organic Framework in Lithium Sulfur Batteries. Lewis Acid-Base Interactions between Polysulfides and Metal Organic...

345

amino acid pattern: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acid Sequence Analysis Pradipta Maji and Sankar K. Pal, Fellow, IEEE Abstract--In most pattern recognition algorithms, amino acids feature space. It is designed using an amino...

346

amino acid selective: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acid Sequence Analysis Pradipta Maji and Sankar K. Pal, Fellow, IEEE Abstract--In most pattern recognition algorithms, amino acids feature space. It is designed using an amino...

347

amino acid selection: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acid Sequence Analysis Pradipta Maji and Sankar K. Pal, Fellow, IEEE Abstract--In most pattern recognition algorithms, amino acids feature space. It is designed using an amino...

348

amino acid mutations: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acid Sequence Analysis Pradipta Maji and Sankar K. Pal, Fellow, IEEE Abstract--In most pattern recognition algorithms, amino acids feature space. It is designed using an amino...

349

amino acid recognition: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acid Sequence Analysis Pradipta Maji and Sankar K. Pal, Fellow, IEEE Abstract--In most pattern recognition algorithms, amino acids feature space. It is designed using an amino...

350

amino acid insertion: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

their distribution in known structures with experimental data such as amino acid transfer free energy scales (water to membrane center and water Senes, Alessandro 2 Amino Acid...

351

Selective Removal of Lanthanides from Natural Waters, Acidic...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Removal of Lanthanides from Natural Waters, Acidic Streams and Dialysate. Selective Removal of Lanthanides from Natural Waters, Acidic Streams and Dialysate. Abstract: The...

352

adenylic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

preservation A Rauramaa A Tommila J Ltd, Espoo Reseach Centre, PO Box 44, 02271 Espoo, Finland Formic acid is known to improve silage hygienic quality. Formic acid based...

353

acid rain program: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

preservation A Rauramaa A Tommila J Ltd, Espoo Reseach Centre, PO Box 44, 02271 Espoo, Finland Formic acid is known to improve silage hygienic quality. Formic acid based...

354

Formation of iron complexs from trifluoroacetic acid based liquid...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of iron complexs from trifluoroacetic acid based liquid chromatography mobile phases as interference ions in liquid Formation of iron complexs from trifluoroacetic acid based...

355

Hydrogen-bond acidic functionalized carbon nanotubes (CNTs) with...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Hydrogen-bond acidic functionalized carbon nanotubes (CNTs) with covalently-bound hexafluoroisopropanol groups. Hydrogen-bond acidic functionalized carbon nanotubes (CNTs) with...

356

Membrane Stresses Induced by Overproduction of Free Fatty Acids...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Membrane Stresses Induced by Overproduction of Free Fatty Acids in Escherichia coli. Membrane Stresses Induced by Overproduction of Free Fatty Acids in Escherichia coli. Abstract:...

357

Electrodeposition From Acidic Solutions of Nickel Bis(benzenedithiolat...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

From Acidic Solutions of Nickel Bis(benzenedithiolate) Produces a Hydrogen-Evolving Ni-S Film on Glassy Carbon Electrodeposition From Acidic Solutions of Nickel...

358

acid bacteria inducing: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summary: The Fate of Amino Acid in Soil Experiments: Bacteria, Roots and Fungi Melissa Campbell Clark of amino acid in soil using radioactive isotopes, however many experiments...

359

acid bacteria enhance: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

de 4 The Fate of Amino Acid in Soil Experiments: Bacteria, Roots and Fungi Melissa Campbell Environmental Sciences and Ecology Websites Summary: The Fate of Amino Acid in...

360

acid biosynthesis revealed: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Websites Summary: bioavailability of aluminum triggered by in- dustrialization and acid rain 20. The presence of organic acidsThe Metabolism of Aluminum Citrate and...

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

acid biosynthesis inhibitors: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Websites Summary: bioavailability of aluminum triggered by in- dustrialization and acid rain 20. The presence of organic acidsThe Metabolism of Aluminum Citrate and...

362

abscisic acid biosynthesis: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Websites Summary: bioavailability of aluminum triggered by in- dustrialization and acid rain 20. The presence of organic acidsThe Metabolism of Aluminum Citrate and...

363

aspartic acid racemization: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

rate of racemization for amino acids preserved in planktonic foraminifera climate change. Keywords: amino acid racemization, Quaternary geochronology, Arctic Ocean, planktonic...

364

acid neutralization capacity: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Websites Summary: itself against acidification and is used to monitor the effect of acid rain on watersheds. From 1993MASTERS REPORT ANALYSIS AND MODELING OF ACID...

365

acid neutralizing capacity: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Websites Summary: itself against acidification and is used to monitor the effect of acid rain on watersheds. From 1993MASTERS REPORT ANALYSIS AND MODELING OF ACID...

366

acid levels metabolic: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Websites Summary: bioavailability of aluminum triggered by in- dustrialization and acid rain 20. The presence of organic acidsThe Metabolism of Aluminum Citrate and...

367

acid function biosynthesis: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Websites Summary: bioavailability of aluminum triggered by in- dustrialization and acid rain 20. The presence of organic acidsThe Metabolism of Aluminum Citrate and...

368

acid biosynthesis leads: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Websites Summary: bioavailability of aluminum triggered by in- dustrialization and acid rain 20. The presence of organic acidsThe Metabolism of Aluminum Citrate and...

369

acid biosynthesis synthesis: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Websites Summary: bioavailability of aluminum triggered by in- dustrialization and acid rain 20. The presence of organic acidsThe Metabolism of Aluminum Citrate and...

370

acid biosynthesis genes: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Websites Summary: bioavailability of aluminum triggered by in- dustrialization and acid rain 20. The presence of organic acidsThe Metabolism of Aluminum Citrate and...

371

Effects of Fuel Dilution with Biodiesel on Lubricant Acidity...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Effects of Fuel Dilution with Biodiesel on Lubricant Acidity, Oxidation and Corrosion Effects of Fuel Dilution with Biodiesel on Lubricant Acidity, Oxidation and Corrosion...

372

Effects of Continuous Triiodothyronine Infusion on Citric Acid...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Continuous Triiodothyronine Infusion on Citric Acid Cycle in the Normal Immature Swine Heart under Extracorporeal Effects of Continuous Triiodothyronine Infusion on Citric Acid...

373

Studying Cellulose Fiber Structure by SEM, XRD, NMR and Acid...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Studying Cellulose Fiber Structure by SEM, XRD, NMR and Acid Hydrolysis. Abstract: Cotton linters were partially hydrolyzed in dilute acid and the morphology of remaining...

374

acid increases expression: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

that are especially sensitive to increasing nutrient Gotelli, Nicholas J. 378 ANTIBODY PURIFICATION USING CAPRYLIC ACID In mildly acidic conditions, the addition of short-chain...

375

acid isopropyl ester: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

stable thermodynamically and hydration free energies obtained Yu, Fangqun 192 ANTIBODY PURIFICATION USING CAPRYLIC ACID In mildly acidic conditions, the addition of short-chain...

376

acid vinyl ester: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

stable thermodynamically and hydration free energies obtained Yu, Fangqun 280 ANTIBODY PURIFICATION USING CAPRYLIC ACID In mildly acidic conditions, the addition of short-chain...

377

acid inhibits production: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sciences and Ecology Websites Summary: Animals excrete three main nitrogen products, ammonia, urea and uric acid (Fig. 1), as well as some and amino acids. The term ammonia...

378

acid monoethyl ester: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

stable thermodynamically and hydration free energies obtained Yu, Fangqun 180 ANTIBODY PURIFICATION USING CAPRYLIC ACID In mildly acidic conditions, the addition of short-chain...

379

acid copolymeric hydrogels: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

stable thermodynamically and hydration free energies obtained Yu, Fangqun 278 ANTIBODY PURIFICATION USING CAPRYLIC ACID In mildly acidic conditions, the addition of short-chain...

380

acid hydrolysis: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

stable thermodynamically and hydration free energies obtained Yu, Fangqun 213 ANTIBODY PURIFICATION USING CAPRYLIC ACID In mildly acidic conditions, the addition of short-chain...

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

acid synthase type: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

stable thermodynamically and hydration free energies obtained Yu, Fangqun 328 ANTIBODY PURIFICATION USING CAPRYLIC ACID In mildly acidic conditions, the addition of short-chain...

382

acid ester prodrugs: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

stable thermodynamically and hydration free energies obtained Yu, Fangqun 194 ANTIBODY PURIFICATION USING CAPRYLIC ACID In mildly acidic conditions, the addition of short-chain...

383

acid allyl ester: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

stable thermodynamically and hydration free energies obtained Yu, Fangqun 239 ANTIBODY PURIFICATION USING CAPRYLIC ACID In mildly acidic conditions, the addition of short-chain...

384

acid phenylethyl ester: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

stable thermodynamically and hydration free energies obtained Yu, Fangqun 180 ANTIBODY PURIFICATION USING CAPRYLIC ACID In mildly acidic conditions, the addition of short-chain...

385

acrylic acid esters: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

stable thermodynamically and hydration free energies obtained Yu, Fangqun 242 ANTIBODY PURIFICATION USING CAPRYLIC ACID In mildly acidic conditions, the addition of short-chain...

386

acid dimethyl ester: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

stable thermodynamically and hydration free energies obtained Yu, Fangqun 227 ANTIBODY PURIFICATION USING CAPRYLIC ACID In mildly acidic conditions, the addition of short-chain...

387

acid decarboxylase expression: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

the expressions. Anna Sthl; Petra Sundstrm; Kristina Hk 2005-01-01 180 ANTIBODY PURIFICATION USING CAPRYLIC ACID In mildly acidic conditions, the addition of short-chain...

388

acid phosphatase 5a: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

stable thermodynamically and hydration free energies obtained Yu, Fangqun 193 ANTIBODY PURIFICATION USING CAPRYLIC ACID In mildly acidic conditions, the addition of short-chain...

389

acid based hydrogels: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

mix of multiple different monomers. These silicone are themselves a complex mix of water, boric acid, hyaluronic acid and other constituents including surfactants suitable surface...

390

acid propyl ester: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

stable thermodynamically and hydration free energies obtained Yu, Fangqun 191 ANTIBODY PURIFICATION USING CAPRYLIC ACID In mildly acidic conditions, the addition of short-chain...

391

acid phenethyl ester: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

stable thermodynamically and hydration free energies obtained Yu, Fangqun 178 ANTIBODY PURIFICATION USING CAPRYLIC ACID In mildly acidic conditions, the addition of short-chain...

392

acid synthase activity: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

use Rippe, Karsten 53 Z .Comparative Biochemistry and Physiology Part B 128 2001 445 450 Purification and characterization of the fatty acid Chemistry Websites Summary: fatty acid...

393

Systems Virology Identifies a Mitochondrial Fatty Acid Oxidation...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Fatty Acid Oxidation Enyzme, Dodecenoyl Coenzyme A Delta Isomerase, Required for Systems Virology Identifies a Mitochondrial Fatty Acid Oxidation Enyzme, Dodecenoyl Coenzyme...

394

Lactic acid fermentation of crude sorghum extract  

SciTech Connect (OSTI)

Crude extract from sweet sorghum supplemented with vetch juice was utilized as the carbohydrate source for fermentative production of lactic acid. Fermentation of media containing 7% (w/v) total sugar was completed in 60-80 hours by Lactobacillus plantarum, product yield averaging 85%. Maximum acid production rates were dependent on pH, initial substrate distribution, and concentration, the rates varying from 2 to 5 g/liter per hour. Under limited medium supplementation the lactic acid yield was lowered to 67%. The fermented ammoniated product contained over eight times as much equivalent crude protein (N x 6.25) as the original medium. Unstructured kinetic models were developed for cell growth, lactic acid formation, and substrate consumption in batch fermentation. With the provision of experimentally determined kinetic parameters, the proposed models accurately described the fermentation process. 15 references.

Samuel, W.A.; Lee, Y.Y.; Anthony, W.B.

1980-04-01T23:59:59.000Z

395

A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid  

E-Print Network [OSTI]

R.G.B and J.A.E. ). Keywords: biomass · carboxylic acids ·10.1002/cssc.201000111 A Direct, Biomass-Based Synthesis ofaro- matic compounds from biomass resources could provide a

2010-01-01T23:59:59.000Z

396

Electrostatic control of acid mist emissions  

SciTech Connect (OSTI)

This paper describes a two-phased study of the control of acid mist emissions using a compact, wet electrostatic precipitator (WESP). The goal of the study was to determine the degree of acid mist control that could be achieved when a compact WESP is used to replace or augment the mist eliminators in a flue gas desulfurization (FGD) system. Phase I of the study examined the electrical operation of a lab-scale WESP collecting an acid mist from a coal combustion pilot plant equipped with a spray chamber. The results of this study were used to develop and validate a computer model of the WESP. In Phase II, measurements were made at two utility scrubber installations to determine the loadings of acid mist, fly ash, and scrubber carryover. These measurements were used as input to the model to project the performance of a retrofitted WESP.

Dahlin, R S [Southern Research Inst., Birmingham, AL (United States)] [Southern Research Inst., Birmingham, AL (United States); Brown, T D [USDOE Pittsburgh Energy Technology Center, PA (United States)] [USDOE Pittsburgh Energy Technology Center, PA (United States)

1991-01-01T23:59:59.000Z

397

Phosphonic acid based ion exchange resins  

DOE Patents [OSTI]

An ion exchange resin is described for extracting metal ions from a liquid waste stream. An ion exchange resin is prepared by copolymerizing a vinylidene diphosphonic acid with styrene, acrylonitrile and divinylbenzene. 9 figures.

Horwitz, E.P.; Alexandratos, S.D.; Gatrone, R.C.; Chiarizia, R.

1994-01-25T23:59:59.000Z

398

3D characterization of acidized fracture surfaces  

E-Print Network [OSTI]

generated by the profilometer identified hydrodynamic channels that could not be identified by the naked eye in acidized surfaces. The plots clarified the existence of rock heterogeneities and revealed how the processes of dissolution function in chalk rock...

Malagon Nieto, Camilo

2007-09-17T23:59:59.000Z

399

NH Acid Rain Control Act (New Hampshire)  

Broader source: Energy.gov [DOE]

The Act is implemented under New Hampshire's acid deposition control program established under the Rules to Control Air Pollution in Chapter Env-A 400. The goal of the Act is to reduce emissions...

400

Long range transport of acid rain precursors  

E-Print Network [OSTI]

A model of the long range transport of primary and secondary pollutants derived by Fay and Rosenzweig (1) is applied to the problem of the transport of acid rain precursors. The model describes the long term average (annual ...

Fay, James A.

1983-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Heterogeneous Reactions of Epoxides in Acidic Media  

E-Print Network [OSTI]

Epoxides have been recently identified as one of the intermediate species in the gas phase oxidation of alkenes. This study investigates the reaction of isoprene oxide and alpha-pinene oxide with sulfuric acid to identify the potential of epoxides...

Lal, Vinita

2012-02-14T23:59:59.000Z

402

Plant response to leonardite and humic acid  

E-Print Network [OSTI]

Leonardite and humic acid have been reported to improve plant growth by many investigators in very controlled settings. The objectives of this study were twofold. First, to determine if the use of leonardite as a fertilizer supplement improved crop...

Duval, John Robert

1996-01-01T23:59:59.000Z

403

NO reduction using sublimation of cyanuric acid  

DOE Patents [OSTI]

A method of reducing the NO content of a gas stream comprises contacting the gas stream with an amount of HNCO at a temperature effective for heat-induced decomposition of cyanuric acid, said amount and temperature being effective for the resultant lowering of the NO content of the gas stream, said cyanuric acid being particulate and having a particle size of less than 90 {micro}m. 1 fig.

Perry, R.A.

1996-05-21T23:59:59.000Z

404

Relative reactivities of solid benzoic acids  

E-Print Network [OSTI]

RELATIVE REACTIVITIES OF SOLID BENZOIC ACIDS A Thesis By EDWIN J, WARWAS Submitted to the Graduate College of the Texas A8rM University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE January 1967' Major... Subject: Chemistry RELATIVE REACTIVITIES OF SOLID BENZOIC ACIDS A Thesis By EDWIN J. WARWAS Submitted to the Graduate College of the Texas ASSAM University in partial fulfillment of the requirements for the degree of MAST ER OF S CIENCE January...

Warwas, Edwin James

2012-06-07T23:59:59.000Z

405

Primer on lead-acid storage batteries  

SciTech Connect (OSTI)

This handbook was developed to help DOE facility contractors prevent accidents caused during operation and maintenance of lead-acid storage batteries. Major types of lead-acid storage batteries are discussed as well as their operation, application, selection, maintenance, and disposal (storage, transportation, as well). Safety hazards and precautions are discussed in the section on battery maintenance. References to industry standards are included for selection, maintenance, and disposal.

NONE

1995-09-01T23:59:59.000Z

406

Elastic electron scattering from formic acid  

SciTech Connect (OSTI)

Following our earlier study on the dynamics of low energy electron attachment to formic acid, we report the results of elastic low-energy electron collisions with formic acid. Momentum transfer and angular differential cross sections were obtained by performing fixed-nuclei calculations employing the complex Kohn variational method. We make a brief description of the technique used to account for the polar nature of this polyatomic target and compare our results with available experimental data.

Trevisan, Cynthia S.; Orel, Ann E.; Rescigno, Thomas N.

2006-07-31T23:59:59.000Z

407

PREDICTING TEMPERATURE BEHAVIOR IN CARBONATE ACIDIZING TREATMENTS  

E-Print Network [OSTI]

PREDICTING TEMPERATURE BEHAVIOR IN CARBONATE ACIDIZING TREATMENTS A Thesis by XUEHAO TAN Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree... of MASTER OF SCIENCE May 2009 Major Subject: Petroleum Engineering PREDICTING TEMPERATURE BEHAVIOR IN CARBONATE ACIDIZING TREATMENTS A Thesis by XUEHAO TAN Submitted to the Office of Graduate Studies of Texas A&M University...

Tan, Xuehao

2010-01-16T23:59:59.000Z

408

Biologically produced acid precipitable polymeric lignin  

DOE Patents [OSTI]

A water soluble, acid precipitable polymeric degraded lignin (APPL), having a molecular weight of at least 12,000 daltons, and comprising, by percentage of total weight, at least three times the number of phenolic hydroxyl groups and carboxylic acid groups present in native lignin. The APPL may be modified by chemical oxidation and reduction to increase its phenolic hydroxyl content and reduce the number of its antioxidant inhibitory side chains, thereby improving antioxidant properties.

Crawford, Don L. (Moscow, ID); Pometto, III, Anthony L. (Moscow, ID)

1984-01-01T23:59:59.000Z

409

Electrostatic precipitation of condensed acid mist  

SciTech Connect (OSTI)

Southern Research Institute is developing a compact, wet electrostatic precipitator (WESP) to control acid mist missions from high-sulfur coal combustion. The WESP is being developed as a retrofit technology for existing coal-fired power plants, particularly those equipped with wet flue gas desulfurization (FGD) scrubbers. Acid mist emissions can be a significant problem at these facilities because the sulfuric acid vapor in the flue gas is converted to a very fine mist that is not collected in the scrubber system. Conventional mist eliminators are not adequate in this application due to the very fine size of the mist droplets. The potential for corrosion also makes it difficult to use a fabric filter or a conventional, dry ESP in this application. Therefore, this research project has been structured around the development of a compact WESP that could be retrofit on top of an existing scrubber or within an existing flue gas duct. This paper describes the development and testing of a prototype WESP for the utility acid mist application. Testing was conducted with combustion of sulfur-doped gas to simulate the acid mist alone, and with a combination of coal and sulfur-doped gas to simulate the mixture of acid mist and fly ash downstream from a scrubber. The performance of the WESP test unit was modeled using two different cylindrical-geometry computer models: a current-seeking'' model and a current-specific'' model. 8 refs., 15 figs., 7 tabs.

Dahlin, R.S.

1989-11-01T23:59:59.000Z

410

The inability of rats to synthesize linoleic acid from cis-2-octenoic acid  

E-Print Network [OSTI]

THE INABILITY OF RATS TO SYNTHESI2E LINOLEIC ACID FROM CIS-2-OCTENOIC ACID A Thesis Robert Eugene Anderson Submitted to the Graduate College of the Texas A g: M University in partia1 fulfillment of the requirerents for the degree of MASTER... OF SCIENCE January 1965 Major Subjeot: Bioohemistry THE INABILITY OF RATS TQ SYNTHESIEE LINOLEIC ACID FROM CIS-2E)CTENOIC ACID A Thesis Robert, Eugene Anderson Approved as to style and content by: Chair n of Committee)~ (Head of Depart~ant, Member...

Anderson, Robert Eugene

2012-06-07T23:59:59.000Z

411

Effects of Acid Additives on Spent Acid Flowback through Carbonate Cores  

E-Print Network [OSTI]

Limestone and the non-emulsifying agent M-NEA the worst for Texas Cream Chalk for spent acid recovery after gas flowback....

Nasir, Ehsaan Ahmad

2012-07-16T23:59:59.000Z

412

E-Print Network 3.0 - acid-amino acid conjugates Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

amino acids is reported with the incorporation of one example into a ... Source: Beal, Peter A. - Department of Chemistry, University of Utah Collection: Chemistry 13 An...

413

Electrostatic precipitation of condensed acid mist  

SciTech Connect (OSTI)

This report deals with the second part (Phase 2) of a two-phased study of the control of acid mist emissions using a compact, wet electrostatic precipitator (WESP). The goal of the study was to determine the degree of acid mist control that could be achieved when a compact WESP was used to replace or augment the mist eliminators in a flue gas desulfurization (FGD) system. Phase 1 of the study examined the electrical operation of a lab-scale WESP collecting an acid mist from a coal combustion pilot plant equipped with a spray chamber. The results of this study were used to develop and validate a computer model of the WESP. In Phase 2, measurements were made at two utility scrubber installations to determine the loadings of acid mist, fly ash, and scrubber carryover. These measurements were used as input to the computer model to project the performance of retrofitted WESPs at both of the utility test sites. Phase 1 results showed that excellent electrical operating conditions could be achieved, but very high loadings of acid mist or the fine fly ash tended to degrade electrical operation because of space charge suppression of the corona current. Measurements made at the utility sites under Phase 2 showed that acid mist accounted for 40 to 57% of the total particulate mass, while fly ash and scrubber solids accounted for 40 to 55% and 1.0 to 3.4%. Impactor samples from both test sites showed an increase in acid content with decreasing particle size. 9 refs., 14 figs., 13 tabs.

Dahlin, R.S.

1991-04-01T23:59:59.000Z

414

Solid phase sequencing of biopolymers  

DOE Patents [OSTI]

This invention relates to methods for detecting and sequencing target nucleic acid sequences, to mass modified nucleic acid probes and arrays of probes useful in these methods, and to kits and systems which contain these probes. Useful methods involve hybridizing the nucleic acids or nucleic acids which represent complementary or homologous sequences of the target to an array of nucleic acid probes. These probes comprise a single-stranded portion, an optional double-stranded portion and a variable sequence within the single-stranded portion. The molecular weights of the hybridized nucleic acids of the set can be determined by mass spectroscopy, and the sequence of the target determined from the molecular weights of the fragments. Probes may be affixed to a solid support such as a hybridization chip to facilitate automated molecular weight analysis and identification of the target sequence.

Cantor, Charles R.; Hubert, Koster

2014-06-24T23:59:59.000Z

415

Energy densification of biomass-derived organic acids  

DOE Patents [OSTI]

A process for upgrading an organic acid includes neutralizing the organic acid to form a salt and thermally decomposing the resulting salt to form an energy densified product. In certain embodiments, the organic acid is levulinic acid. The process may further include upgrading the energy densified product by conversion to alcohol and subsequent dehydration.

Wheeler, M. Clayton; van Walsum, G. Peter; Schwartz, Thomas J.; van Heiningen, Adriaan

2013-01-29T23:59:59.000Z

416

Correlation between Fibroin Amino Acid Sequence and Physical Silk Properties*  

E-Print Network [OSTI]

moth (Ephe- stia kuehniella), and Indian meal moth (Plodia inter- punctella). The amino acid repeats

Â?urovec, Michal

417

Transcription factor-based biosensors for detecting dicarboxylic acids  

DOE Patents [OSTI]

The invention provides methods and compositions for detecting dicarboxylic acids using a transcription factor biosensor.

Dietrich, Jeffrey; Keasling, Jay

2014-02-18T23:59:59.000Z

418

Sulfuric acid deposition from stratospheric geoengineering with sulfate aerosols  

E-Print Network [OSTI]

aerosols can potentially result in an increase in acid deposition. [4] Acid rain has been studiedSulfuric acid deposition from stratospheric geoengineering with sulfate aerosols Ben Kravitz,1 Alan limit of hydration of all sulfate aerosols into sulfuric acid. For annual injection of 5 Tg of SO2

Robock, Alan

419

System for agitating the acid in a lead-acid battery  

DOE Patents [OSTI]

A system and method for agitating the acid in a large lead-sulfuric acid storage battery of the calcium type. An air-lift is utilized to provide the agitation. The air fed to the air-lift is humidified prior to being delivered to the air-lift.

Weintraub, Alvin (Schenectady, NY); MacCormack, Robert S. (Glenville, NY)

1987-01-01T23:59:59.000Z

420

Evaluation of acid fracturing based on the "acid fracture number" concept  

E-Print Network [OSTI]

Acid fracturing is one of the preferred methods to stimulate wells in carbonate reservoirs. It consists of injecting an acid solution at high enough pressure to break down the formation and to propagate a two-wing crack away from the wellbore...

Alghamdi, Abdulwahab

2006-08-16T23:59:59.000Z

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Sulfuric acid-sulfur heat storage cycle  

DOE Patents [OSTI]

A method of storing heat is provided utilizing a chemical cycle which interconverts sulfuric acid and sulfur. The method can be used to levelize the energy obtained from intermittent heat sources, such as solar collectors. Dilute sulfuric acid is concentrated by evaporation of water, and the concentrated sulfuric acid is boiled and decomposed using intense heat from the heat source, forming sulfur dioxide and oxygen. The sulfur dioxide is reacted with water in a disproportionation reaction yielding dilute sulfuric acid, which is recycled, and elemental sulfur. The sulfur has substantial potential chemical energy and represents the storage of a significant portion of the energy obtained from the heat source. The sulfur is burned whenever required to release the stored energy. A particularly advantageous use of the heat storage method is in conjunction with a solar-powered facility which uses the Bunsen reaction in a water-splitting process. The energy storage method is used to levelize the availability of solar energy while some of the sulfur dioxide produced in the heat storage reactions is converted to sulfuric acid in the Bunsen reaction.

Norman, John H. (LaJolla, CA)

1983-12-20T23:59:59.000Z

422

Asthmatic responses to airborne acid aerosols  

SciTech Connect (OSTI)

Controlled exposure studies suggest that asthmatics may be more sensitive to the respiratory effects of acidic aerosols than individuals without asthma. This study investigates whether acidic aerosols and other air pollutants are associated with respiratory symptoms in free-living asthmatics. Daily concentrations of hydrogen ion (H+), nitric acid, fine particulates, sulfates and nitrates were obtained during an intensive air monitoring effort in Denver, Colorado, in the winter of 1987-88. A panel of 207 asthmatics recorded respiratory symptoms, frequency of medication use, and related information in daily diaries. We used a multiple regression time-series model to analyze which air pollutants, if any, were associated with health outcomes reported by study participants. Airborne H+ was found to be significantly associated with several indicators of asthma status, including moderate or severe cough and shortness of breath. Cough was also associated with fine particulates, and shortness of breath with sulfates. Incorporating the participants' time spent outside and exercise intensity into the daily measure of exposure strengthened the association between these pollutants and asthmatic symptoms. Nitric acid and nitrates were not significantly associated with any respiratory symptom analyzed. In this population of asthmatics, several outdoor air pollutants, particularly airborne acidity, were associated with daily respiratory symptoms.

Ostro, B.D.; Lipsett, M.J.; Wiener, M.B.; Selner, J.C. (California Department of Health Services, Berkeley (USA))

1991-06-01T23:59:59.000Z

423

E-Print Network 3.0 - acid analysis including Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

predict the relative acid strength of a set... section. Findings Our analysis led to the identification of four distinct mental models of acid and acid... models of acid and acid...

424

Use of linalool synthase in genetic engineering of scent production  

DOE Patents [OSTI]

A purified S-linalool synthase polypeptide from Clarkia breweri is disclosed as is the recombinant polypeptide and nucleic acid sequences encoding the polypeptide. Also disclosed are antibodies immunoreactive with the purified peptide and with recombinant versions of the polypeptide. Methods of using the nucleic acid sequences, as well as methods of enhancing the smell and the flavor of plants expressing the nucleic acid sequences are also disclosed. 5 figs.

Pichersky, E.

1998-12-15T23:59:59.000Z

425

Use of linalool synthase in genetic engineering of scent production  

DOE Patents [OSTI]

A purified S-linalool synthase polypeptide from Clarkia breweri is disclosed as is the recombinant polypeptide and nucleic acid sequences encoding the polypeptide. Also disclosed are antibodies immunoreactive with the purified peptide and with recombinant versions of the polypeptide. Methods of using the nucleic acid sequences, as well as methods of enhancing the smell and the flavor of plants expressing the nucleic acid sequences are also disclosed.

Pichersky, Eran (Chelsea, MI)

1998-01-01T23:59:59.000Z

426

Water and UV degradable lactic acid polymers  

DOE Patents [OSTI]

A water and UV light degradable copolymer of monomers of lactic acid and a modifying monomer were selected from the class consisting of ethylene and polyethylene glycols, propylene and polypropylene glycols, P-dioxanone, 1,5 dioxepan-2-one, 1,4 -oxathialan-2-one, 1,4-dioxide and mixtures. These copolymers are useful for waste disposal and agricultural purposes. Also disclosed is a water degradable blend of polylactic acid or modified polylactic acid and high molecular weight polyethylene oxide where the high molecular weight polyethylene oxide is present in the range of from about 2% by weight to about 50% by weight, suitable for films. A method of applying an active material selected from the class of seeds, seedlings, pesticides, herbicides, fertilizers and mixtures to an agricultural site is also disclosed.

Bonsignore, P.V.; Coleman, R.D.

1994-11-01T23:59:59.000Z

427

Water and UV degradable lactic acid polymers  

DOE Patents [OSTI]

A water and UV light degradable copolymer of monomers of lactic acid and a modifying monomer selected from the class consisting of ethylene and polyethylene glycols, propylene and polypropylene glycols, P-dioxanone, 1,5 dioxepan-2-one, 1,4 -oxathialan-2-one, 1,4-dioxide and mixtures thereof. These copolymers are useful for waste disposal and agricultural purposes. Also disclosed is a water degradable blend of polylactic acid or modified polylactic acid and high molecular weight polyethylene oxide wherein the high molecular weight polyethylene oxide is present in the range of from about 2% by weight to about 50% by weight, suitable for films. A method of applying an active material selected from the class of seeds, seedlings, pesticides, herbicides, fertilizers and mixtures thereof to an agricultural site is also disclosed.

Bonsignore, Patrick V. (Joliet, IL); Coleman, Robert D. (Wheaton, IL)

1994-01-01T23:59:59.000Z

428

Water and UV degradable lactic acid polymers  

DOE Patents [OSTI]

A water and UV light degradable copolymer is described made from monomers of lactic acid and a modifying monomer selected from the class consisting of ethylene glycol, propylene glycol, P-dioxanone, 1,5 dioxepan-2-one, 1,4-oxathialan-2-one, 1,4-dioxide and mixtures thereof. These copolymers are useful for waste disposal and agricultural purposes. Also disclosed is a water degradable blend of polylactic acid or modified polylactic acid and high molecular weight polyethylene oxide wherein the high molecular weight polyethylene oxide is present in the range of from about 2 by weight to about 50% by weight, suitable for films. A method of applying an active material selected from the class of seeds, seedlings, pesticides, herbicides, fertilizers and mixtures thereof to an agricultural site is also disclosed.

Bonsignore, P.V.; Coleman, R.D.

1996-10-08T23:59:59.000Z

429

Water and UV degradable lactic acid polymers  

DOE Patents [OSTI]

A water and UV light degradable copolymer of monomers of lactic acid and a modifying monomer selected from the class consisting of ethylene glycol, propylene glycol, P-dioxanone, 1,5 dioxepan-2-one, 1,4-oxathialan-2-one, 1,4-dioxide and mixtures thereof. These copolymers are useful for waste disposal and agricultural purposes. Also disclosed is a water degradable blend of polylactic acid or modified polylactic acid and high molecular weight polyethylene oxide wherein the high molecular weight polyethylene oxide is present in the range of from about 2 by weight to about 50% by weight, suitable for films. A method of applying an active material selected from the class of seeds, seedlings, pesticides, herbicides, fertilizers and mixtures thereof to an agricultural site is also disclosed.

Bonsignore, Patrick V. (Joliet, IL); Coleman, Robert D. (Wheaton, IL)

1996-01-01T23:59:59.000Z

430

IMPROVED PROCESSES TO REMOVE NAPHTHENIC ACIDS  

SciTech Connect (OSTI)

In the first year of this project, we have established our experimental and theoretical methodologies for studies of the catalytic decarboxylation process. We have developed both glass and stainless steel micro batch type reactors for the fast screening of various catalysts with reaction substrates of model carboxylic acid compounds and crude oil samples. We also developed novel product analysis methods such as GC analyses for organic acids and gaseous products; and TAN measurements for crude oil. Our research revealed the effectiveness of several solid catalysts such as NA-Cat-1 and NA-Cat-2 for the catalytic decarboxylation of model compounds; and NA-Cat-5{approx}NA-Cat-9 for the acid removal from crude oil. Our theoretical calculations propose a three-step concerted oxidative decarboxylation mechanism for the NA-Cat-1 catalyst.

Aihua Zhang; Qisheng Ma; William A. Goddard; Yongchun Tang

2004-04-28T23:59:59.000Z

431

Photoenhanced anaerobic digestion of organic acids  

DOE Patents [OSTI]

A process is described for rapid conversion of organic acids and alcohols anaerobic digesters into hydrogen and carbon dioxide, the optimal precursor substrates for production of methane. The process includes addition of photosynthetic bacteria to the digester and exposure of the bacteria to radiant energy (e.g., solar energy). The process also increases the pH stability of the digester to prevent failure of the digester. Preferred substrates for photosynthetic bacteria are the organic acid and alcohol waste products of fermentative bacteria. In mixed culture with methanogenic bacteria or in defined co-culture with non-aceticlastic methanogenic bacteria, photosynthetic bacteria are capable of facilitating the conversion or organic acids and alcohols into methane with low levels of light energy input.

Weaver, Paul F. (Golden, CO)

1990-01-01T23:59:59.000Z

432

Formic acid fuel cells and catalysts  

DOE Patents [OSTI]

An exemplary fuel cell of the invention includes a formic acid fuel solution in communication with an anode (12, 134), an oxidizer in communication with a cathode (16, 135) electrically linked to the anode, and an anode catalyst that includes Pd. An exemplary formic acid fuel cell membrane electrode assembly (130) includes a proton-conducting membrane (131) having opposing first (132) and second surfaces (133), a cathode catalyst on the second membrane surface, and an anode catalyst including Pd on the first surface.

Masel, Richard I.; Larsen, Robert; Ha, Su Yun

2010-06-22T23:59:59.000Z

433

Acid mine water aeration and treatment system  

DOE Patents [OSTI]

An in-line system is provided for treating acid mine drainage which basically comprises the combination of a jet pump (or pumps) and a static mixer. The jet pump entrains air into the acid waste water using a Venturi effect so as to provide aeration of the waste water while further aeration is provided by the helical vanes of the static mixer. A neutralizing agent is injected into the suction chamber of the jet pump and the static mixer is formed by plural sections offset by 90 degrees.

Ackman, Terry E. (Finleyville, PA); Place, John M. (Bethel Park, PA)

1987-01-01T23:59:59.000Z

434

Effect of Conjugated Linoleic Acid or Oleic Acid Addition on Fatty Acid Composition Profiles of Poultry Meat  

E-Print Network [OSTI]

on the omega-6 fatty acid accumulation in broiler chicken breast and thigh meat. Eight broilers from each treatment were processed at 4 and 6 weeks of age, respectively. Regarding the diets containing five different fat sources, broiler chickens fed CLA...

Shin, Dae Keun

2011-08-08T23:59:59.000Z

435

A method to attenuate U(VI) mobility in acidic waste plumes using humic acids  

SciTech Connect (OSTI)

Acidic uranium (U) contaminated plumes have resulted from acid-extraction of plutonium during the Cold War and from U mining and milling operations. A sustainable method for in-situ immobilization of U under acidic conditions is not yet available. Here, we propose to use humic acids (HAs) for in-situ U immobilization in acidic waste plumes. Our laboratory batch experiments show that HA can adsorb onto aquifer sediments rapidly, strongly and practically irreversibly. Adding HA greatly enhanced U adsorption capacity to sediments at pH below 5.0. Our column experiments using historically contaminated sediments from the Savannah River Site under slow flow rates (120 and 12 m/y) show that desorption of U and HA were non-detectable over 100 pore-volumes of leaching with simulated acidic groundwaters. Upon HA-treatment, 99% of the contaminant [U] was immobilized at pH < 4.5, compared to 5% and 58% immobilized in the control columns at pH 3.5 and 4.5, respectively. These results demonstrated that HA-treatment is a promising in-situ remediation method for acidic U waste plumes. As a remediation reagent, HAs are resistant to biodegradation, cost effective, nontoxic, and easily introducible to the subsurface.

Wan, J.; Dong, W.; Tokunaga, T.K.

2011-02-01T23:59:59.000Z

436

Strategies for enhancing the effectiveness of metagenomic-based enzyme discovery in lignocellulytic microbial communities  

E-Print Network [OSTI]

for genome annotation: PRIAM. Nucleic Acids Research 31:November 2008 release of PRIAM [12], modified for nucleotide232,025) at EPRIAM enzyme-specific sequence profiles

DeAngelis, K.M.

2010-01-01T23:59:59.000Z

437

Metagenomics: DNA sequencing of environmental samples  

E-Print Network [OSTI]

for genome annotation: PRIAM. Nucleic Acids Res 31, 6633-9 (software/gendb/cgi-bin/login.cgi > 81 and PRIAM priam/ > 82 . In general,

Tringe, Susannah Green; Rubin, Edward M.

2005-01-01T23:59:59.000Z

438

Using IMG: Comparative Analysis with the Integrated Microbial Genomes System  

E-Print Network [OSTI]

for genome annotation: PRIAM. Nucleic Acids Research 31 (RPS-BLAST against the PRIAM database (12), as a complementBLAST computations. Computation COG PRIAM Tool Low- Maximum

2008-01-01T23:59:59.000Z

439

Metal resistant plants and phytoremediation of environmental contamination  

DOE Patents [OSTI]

The present disclosure provides a method of producing transgenic plants which are resistant to at least one metal ion by transforming the plant with a recombinant DNA comprising a nucleic acid encoding a bacterial arsenic reductase under the control of a plant expressible promoter, and a nucleic acid encoding a nucleotide sequence encoding a phytochelatin biosynthetic enzyme under the control of a plant expressible promoter. The invention also relates a method of phytoremediation of a contaminated site by growing in the site a transgenic plant expressing a nucleic acid encoding a bacterial arsenate reductase and a nucleic acid encoding a phytochelatin biosynthetic enzyme.

Meagher, Richard B.; Li, Yujing; Dhankher, Om P.

2010-04-20T23:59:59.000Z

440

Ethanol production in non-recombinant hosts  

DOE Patents [OSTI]

Non-recombinant bacteria that produce ethanol as the primary fermentation product, associated nucleic acids and polypeptides, methods for producing ethanol using the bacteria, and kits are disclosed.

Kim, Youngnyun; Shanmugam, Keelnatham; Ingram, Lonnie O.

2013-06-18T23:59:59.000Z

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Site-Specific DNA Structural and Dynamic Features Revealed by...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

the level of an individual nucleotide. As these probes can be attached to arbitrary nucleotides within a nucleic acid sequence, they may provide a means to “scan” a...

442

These guidelines describe Nature's standards for experimental methods and characterization of new compounds. Please provide adequate data  

E-Print Network [OSTI]

biopolymeric materials (oligosaccharides, peptides, nucleic acids, and so on), direct structural analysis) or electrophoretic analyses can be used to demonstrate purity for small molecules and biopolymeric materials. Methods

Napp, Nils

443

Evolutionary Genomics of Prokaryotic Viruses.  

E-Print Network [OSTI]

??Evolutionary history of biological entities is recorded within their nucleic acid sequences and can (sometimes) be deciphered by thorough genomic analysis. In this study we… (more)

Krupovic, Mart

2010-01-01T23:59:59.000Z

444

E-Print Network 3.0 - amptd-mediated capture pcr Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Source: Utah, University of - State of Utah Center of Excellence for Biomedical Microfluidics Collection: Engineering 11 Published online 13 November 2007 Nucleic Acids...

445

electronic reprint Crystallography  

E-Print Network [OSTI]

distributions from 1 to 100 nm, and shape and orientation distributions, in liquids, powders and bulk samples, aluminas, microemulsions, nucleic acids, proteins, mesoporous materials, inorganic polymers, coal samples

Gruner, Sol M.

446

Lateral flow devices  

DOE Patents [OSTI]

An analytical test for an analyte comprises (a) a base, having a reaction area and a visualization area, (b) a capture species, on the base in the visualization area, comprising nucleic acid, and (c) analysis chemistry reagents, on the base in the reaction area. The analysis chemistry reagents comprise (i) a substrate comprising nucleic acid and a first label, and (ii) a reactor comprising nucleic acid. The analysis chemistry reagents can react with a sample comprising the analyte and water, to produce a visualization species comprising nucleic acid and the first label, and the capture species can bind the visualization species.

Mazumdar, Debapriya (Urbana, IL); Liu, Juewen (Urbana, IL); Lu, Yi (Champaign, IL)

2010-09-21T23:59:59.000Z

447

HexServer: an FFT-based protein docking server powered by graphics processors  

E-Print Network [OSTI]

MACINDOE,G. MAVRIDIS,L. VENKATRAMAN,V. DEVIGNES,M. RITCHIE,D.W. Nucleic Acids Research Oxford University Press

MACINDOE, G.; MAVRIDIS, L.; VENKATRAMAN, V.; DEVIGNES, M.; RITCHIE, D.W.; Nucleic Acids Research Oxford University Press [More Details

448

E-Print Network 3.0 - argonaute2 suppresses drosophila Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2003; doi:10.1038nature02123. Published online 16 November 2003. Summary: ., Izaurralde, E. & Sattler, M. Structure and nucleic-acid binding of the Drosophila Argonaute 2...

449

Development of a polylactic acid (PLA) polymer with an acid-sensitive N-ethoxybenzylimidazole (NEBI) crosslinker as a drug delivery system  

E-Print Network [OSTI]

of a Polylactic Acid (PLA) Polymer with an Acid-Sensitive N-of Poly-lactic Acid (PLA) and N- ethoxybenzylimidazoles (2 Poly-lactic Acid (PLA) and Functionalized Derivatives of

Hang, Leibniz Fangtinq

2012-01-01T23:59:59.000Z

450

Myristic acid participation in cholesterol metabolism  

E-Print Network [OSTI]

. 5 3170 7217 10382 , 43 1. 4 1456 4147 5603 . 35 1360 1914 3274 . 70 868 790 1658 1. 0 2103 3060 5163 . 68 1137 4045 5182 . 28 29 Table D. Liver cholesterol radioactivity as effected by the addition of myristic and linoleic acids to a 2g...

Sidelman, Zvi

1967-01-01T23:59:59.000Z

451

Corrosion free phosphoric acid fuel cell  

DOE Patents [OSTI]

A phosphoric acid fuel cell with an electrolyte fuel system which supplies electrolyte via a wick disposed adjacent a cathode to an absorbent matrix which transports the electrolyte to portions of the cathode and an anode which overlaps the cathode on all sides to prevent corrosion within the cell.

Wright, Maynard K. (Bethel Park, PA)

1990-01-01T23:59:59.000Z

452

Heterogeneous organic acid uptake on soot surfaces  

E-Print Network [OSTI]

observed the interaction between a number of carboxylic acids and soot from different fuel sources and formation mechanisms. A low pressure fast flow reactor was used to control the contact between the solid phase soot and gas phase organics, while chemical...

Levitt, Nicholas Paul

2009-05-15T23:59:59.000Z

453

The thermodynamic properties of some aminophosphonic acids  

E-Print Network [OSTI]

constant differ by at least three pK units. 1 1. Samuel Glasstone, An Introduction to Electrochemistry, D. Van Nostrand Co. , Inc. , New York, Chapter 9, $25, (1954-). Each amino acid investigated satisfied the afore- said condition in that there were...

Austin, James Richard

1967-01-01T23:59:59.000Z

454

Improved Processes to Remove Naphthenic Acids  

SciTech Connect (OSTI)

In the past three years, we followed the work plan as we suggested in the proposal and made every efforts to fulfill the project objectives. Based on our large amount of creative and productive work, including both of experimental and theoretic aspects, we received important technical breakthrough on naphthenic acid removal process and obtained deep insight on catalytic decarboxylation chemistry. In detail, we established an integrated methodology to serve for all of the experimental and theoretical work. Our experimental investigation results in discovery of four type effective catalysts to the reaction of decarboxylation of model carboxylic acid compounds. The adsorption experiment revealed the effectiveness of several solid materials to naphthenic acid adsorption and acidity reduction of crude oil, which can be either natural minerals or synthesized materials. The test with crude oil also received promising results, which can be potentially developed into a practical process for oil industry. The theoretical work predicted several possible catalytic decarboxylation mechanisms that would govern the decarboxylation pathways depending on the type of catalysts being used. The calculation for reaction activation energy was in good agreement with our experimental measurements.

Aihua Zhang; Qisheng Ma; Kangshi Wang; Yongchun Tang; William A. Goddard

2005-12-09T23:59:59.000Z

455

Preparation of Some Substituted Terephthalic Acids  

E-Print Network [OSTI]

, with the dilithiation of 2,5-dibromotoluene with t-BuLi at ­78 8C, followed by reaction with dry ice and subsequent acid (3) is esterified,[9] then side-chain brominated with NBS, to produce dimethyl 2

Benin, Vladimir

456

Producing a trimethylpentanoic acid using hybrid polyketide synthases  

DOE Patents [OSTI]

The present invention provides for a polyketide synthase (PKS) capable of synthesizing trimethylpentanoic acid. The present invention also provides for a host cell comprising the PKS and when cultured produces the trimethylpentanoic acid. The present invention also provides for a method of producing the trimethylpentanoic acid, comprising: providing a host cell of the present invention, and culturing said host cell in a suitable culture medium such that the trimethylpentanoic acid is produced, optionally isolating the trimethylpentanoic acid, and optionally, reducing the isolated trimethylpentanoic acid into a trimethylpentanol or an iso-octane.

Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D

2014-10-07T23:59:59.000Z

457

Effect of fulvic acid on the kinetics of aluminum fluoride complexation in acidic waters  

SciTech Connect (OSTI)

Both fluoride ion and fulvic acid are important aluminum binding ligands present in soil and surface waters. As such they play a role in the speciation and toxicity of natural waters that have increased aluminum concentration due to acid precipitation. We report here a kinetic study of aluminum complexation in the presence of both of these naturally occurring ligands. An overall mechanism has been identified and rate constants have been obtained for several of the reactions involved. We find that an a priori model of the two ligands in competition for aluminum is incorrect. In fact, the rate of fluoride ion consumption is increased by the presence of fulvic acid. Evidence is presented that this effect is due to several equilibria, some of which involve mixed-ligand species. The important equilibria in this three-component system are identified and discussed, as are aluminum speciation and toxicity in acidic waters.

Plankey, B.J.; Patterson, H.H.

1988-12-01T23:59:59.000Z

458

Investigating the Effect of Oil Saturation on Acid Propagation during Matrix Acidization of Carbonate Rocks  

E-Print Network [OSTI]

The existence of an optimum injection rate for wormhole propagation, and face dissolution at low injection rates during matrix acidizing are well established. However, little has been documented that describes how the presence of residual oil...

Kumar, Rahul Pradeep

2014-01-02T23:59:59.000Z

459

Modeling Acid Transport and Non-Uniform Etching in a Stochastic Domain in Acid Fracturing  

E-Print Network [OSTI]

Success of acid fracturing depends on uneven etching along the fracture surfaces caused by heterogeneities such as variations in local mineralogy and variations in leakoff behavior. The heterogeneities tend to create channeling characteristics...

Mou, Jianye

2010-10-12T23:59:59.000Z

460

Acidizing Dolomite Reservoirs Using HCL Acid Prepared with Seawater: Problems and Solutions  

E-Print Network [OSTI]

with seawater and no scale inhibitors. Scale inhibitors were also tested for effectiveness in reducing calcium sulfate scale during acidizing. Static jar tests of three phosphonate-based, two sulphonated polymer-based, and one polyacrylic-based scale...

Arensman, Dennis G

2014-04-28T23:59:59.000Z

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

A study of the distribution of fatty acids in the system: cottonseed oil-oleic acid-isopropanol-water  

E-Print Network [OSTI]

STUDY OF THE DISTHIBUTION OF FATTY ACIDS IN THE SYSTEM: COTTONSEED OIL - OLEIC ACID - ISOFHOPANOL - WATER A Thesis By Frank E. Lamb January 1948 A STUDY QF TNE DISTRIBUTION OF FATTY ACIDS IN TRE SYSTEM: COTTONSEED OII, - OIEIC ACID - ISOPROPANOL...A STDDY OF THI' DISTBIRliTION OF FATTY ACIDS IN THE SYSTEM: COTTONSFED OIL - OLEIC ACID - ISOPBOPANOL - YlATEB A Thesis Frank E. Lomb January 1948 Approval as to style and content recommended: Head ' t Te epartm nt of hem cal Engineer ng A...

Lamb, Frank E

1948-01-01T23:59:59.000Z

462

High Temperature Fuel Cell (Phosphoric Acid) Manufacturing R...  

Broader source: Energy.gov (indexed) [DOE]

Fuel Cell (Phosphoric Acid) Manufacturing R&D High Temperature Fuel Cell (Phosphoric Acid) Manufacturing R&D Presented at the NREL Hydrogen and Fuel Cell Manufacturing R&D Workshop...

463

acid methyl esters: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

3 (> 170 o C). Each fraction was analyzed composition of fatty acid ethyl esters using gas chromatography (GC). The result showed that the yield medium chain fatty acid ethyl...

464

acidic antigenic fractions: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

3 (> 170 o C). Each fraction was analyzed composition of fatty acid ethyl esters using gas chromatography (GC). The result showed that the yield medium chain fatty acid ethyl...

465

acid methyl ester: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

3 (> 170 o C). Each fraction was analyzed composition of fatty acid ethyl esters using gas chromatography (GC). The result showed that the yield medium chain fatty acid ethyl...

466

An antibacterial hydroxy fusidic acid analogue from Acremonium crotocinigenum  

E-Print Network [OSTI]

against a panel of multidrug-resistant (MDR) and methicillin-resistant Staphylococcus aureus (MRSA reserved. Keywords: Acremonium crotocinigenum; Fusidane triterpene; Fusidic acid; Antibacterial; MRSA; MDR, fusidic acid, a widely used therapeutic for methicillin-resistant Staphylococcus aureus (MRSA) infections

Griffith, Gareth

467

TRL Acid and Solvent Wet Processing Rules and Guidelines  

E-Print Network [OSTI]

: General rules and guidelines for wet chemical processing in TRL. Author: KFlo hood and when transporting or handling chemicals. An acid-proof apron, sleeveTRL Acid and Solvent Wet Processing Rules and Guidelines Purpose

Reif, Rafael

468

Study of Acid Response of Qatar Carbonate Rocks  

E-Print Network [OSTI]

reservoirs. Recently papers published from industry discussed the techniques, planning, and optimization of acid stimulation for Qatar carbonate. To the best of author’s knowledge, no study has focused on the acid reaction to Qatar carbonates. The lack...

Wang, Zhaohong

2012-02-14T23:59:59.000Z

469

Development and testing of an advanced acid fracture conductivity apparatus  

E-Print Network [OSTI]

wells. Acid fracturing is a standard practice to increase the production rate and to improve ultimate recovery in carbonate reservoirs. There have been successful cases in most carbonate reservoirs around the world. However acid fracture performance...

Zou, ChunLei

2006-08-16T23:59:59.000Z

470

acid binding proteins: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The adipocyte fatty acid-binding protein aP2 regulates systemic glucose (more) Shum, Bennett Oh Vic 2007-01-01 2 Fatty acid-binding protein in bovine skeletal muscle Texas A&M...

471

acid dopac binds: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The adipocyte fatty acid-binding protein aP2 regulates systemic glucose (more) Shum, Bennett Oh Vic 2007-01-01 2 Fatty acid-binding protein in bovine skeletal muscle Texas A&M...

472

Determination of Total Lipids as Fatty Acid Methyl Esters (FAME...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

will be replaced by an ester bond between the fatty acid and a methyl group, producing methyl esters of the fatty acids (FAME) and free glycerol. 1.4 The FAME are then...

473

Lubrication from mixture of boric acid with oils and greases  

DOE Patents [OSTI]

Lubricating compositions are disclosed including crystalline boric acid and a base lubricant selected from oils, greases and the like. The lubricity of conventional oils and greases can also be improved by adding concentrates of boric acid.

Erdemir, A.

1995-07-11T23:59:59.000Z

474

acid mononucleotide adenylyltransferase: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 14 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

475

aminoadipic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 7 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

476

aminocaproic acid eaca: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 7 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

477

acid hydrazone dpktch: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 11 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

478

aminolevulinic acid dehydratase: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 18 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

479

aminobutyric acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 36 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

480

acid controls expression: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

12 13 14 15 16 17 18 19 20 21 22 23 24 25 Next Page Last Page Topic Index 1 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

aminolevulinic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 12 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

482

acid riboside salvage: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 30 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

483

anf 4-hydroxyhomocitric acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 15 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

484

acid dioxygenase hpd: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 37 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

485

acid ascorbyl palmitate: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 27 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

486

acid dehydratase alad: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 15 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

487

acetoacetic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 8 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

488

acid lna taqman: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 46 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

489

amygdalic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 8 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

490

acid phosphoribosyltransferase 1-deficient: Topics by E-print...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 19 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

491

adipic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 11 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

492

acid dmsa renography: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 8 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

493

anthranilic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 10 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

494

aminocaproic acids: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 7 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

495

acid glycosaminoglycan mucopolysaccharide: Topics by E-print...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 34 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

496

acidic oligosaccharides paos: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 40 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

497

aminobutyric acids: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 36 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

498

asparaginic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 17 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

499

arsonic acids: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 10 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

500

anthraquinonic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 12 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...