Powered by Deep Web Technologies
Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Nucleic Acid Standards | Base Pair Geometry  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

A Standard Reference Frame for the Description A Standard Reference Frame for the Description of Nucleic Acid Base-pair Geometry Table 1. Cartesian coordinates of non-hydrogen atoms in the standard reference frames of the five common nitrogenous bases Atom Base x(Å) y(Å) z(Å) Adenine ATOM 1 C1' A A 1 -2.479 5.346 0.000 ATOM 2 N9 A A 1 -1.291 4.498 0.000 ATOM 3 C8 A A 1 0.024 4.897 0.000 ATOM 4 N7 A A 1 0.877 3.902 0.000 ATOM 5 C5 A A 1 0.071 2.771 0.000 ATOM 6 C6 A A 1 0.369 1.398 0.000 ATOM 7 N6 A A 1 1.611 0.909 0.000 ATOM 8 N1 A A 1 -0.668 0.532 0.000 ATOM 9 C2 A A 1 -1.912 1.023 0.000 ATOM 10 N3 A A 1 -2.320 2.290 0.000


Nucleic Acid Softwars  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Nucleic Acid Software Nucleic Acid Software FR3D, a software for finding local and composite recurrent structural motifs in RNA 3D structures. Sarver, M., Zirbel, C.L., Stombaugh, J., Mokdad, A. and Leontis, N.B. (2008) FR3D: finding local and composite recurrent structural motifs in RNA 3D structures. J Math Biol, 56, 215-252. RNAView, a program for quickly generating a display of RNA/DNA secondary structures with tertiary interactions. Yang, H., Jossinet, F., Leontis, N., Chen, L., Westbrook, J., Berman, H.M. and Westhof, E. (2003) Tools for the automatic identification and classification of RNA base pairs. Nucleic Acids Res, 31, 3450-3460. RNAMLview, a program to display and/or edit RNAView 2-dimensional diagrams. 3DNA, a software package for the analysis, rebuilding and visualization of three-dimensional nucleic acid structures.


Nucleic acid detection compositions  

DOE Patents [OSTI]

The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

Prudent, James R. (Madison, WI); Hall, Jeff G. (Madison, WI); Lyamichev, Victor I. (Madison, WI); Brow, Mary Ann (Madison, WI); Dahlberg, James L. (Madison, WI)



Cleavage of nucleic acids  

DOE Patents [OSTI]

The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

Prudent, James R. (Madison, WI); Hall, Jeff G. (Madison, WI); Lyamichev, Victor L. (Madison, WI); Brow, Mary Ann D. (Madison, WI); Dahlberg, James E. (Madison, WI)



Nucleic Acid Standards - Standard Ref. Frame  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Standard Reference Standard Reference Standard Reference Frame Supplemental Information Ideal Geometries X-PLOR Parameters Valence Geometries RNA Ontology Consortium mmCIF Resources PDBML Resources A Standard Reference Frame for the Description of Nucleic Acid Base-pair Geometry A common point of reference is needed to describe the three-dimensional arrangements of bases and base pairs in nucleic acid structures. [1]. For example, parts of a structure, which appear "normal" according to one computational scheme, may be highly unusual according to another and vice versa. It is thus difficult to carry out comprehensive comparisons of nucleic acid structures and to pinpoint unique conformational features in individual structures. In order to resolve these issues, a group of


Nucleic Acid Tools  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Nucleic Acid Tools Nucleic Acid Tools RNA 3D Motif Atlas, a representative collection of RNA 3D internal and hairpin loop motifs. Petrov, A.I., Zirbel, C.L., Leontis, N.B. (2013) Automated classification of RNA 3D motifs and the RNA 3D motif atlas. RNA. Non-redundant List of RNA-containing 3D structures. Leontis, N.B., & Zirbel, C.L. (2012) In Leontis, N. B., Westhof. E. (ed.), RNA 3D structure analysis and prediction. Springer Berlin Heidelberg Vol. 27, pp. 281-298. RNA Base Triple Atlas, a collection of motifs consisting of two RNA basepairs. Abu Almakarem, A.S., Petrov, A.I., Stombaugh, J., Zirbel, C.L. and Leontis, N.B. (2012) Comprehensive survey and geometric classification of base triples in RNA structures. Nucleic Acids Res, 40, 1407-1423. R3D Align, an application for detailed nucleotide to nucleotide


Nucleic Acid Standards - Program List  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

List of Programs and References List of Programs and References CEHS M. A. El Hassan & C. R. Calladine (1995). ``The Assessment of the Geometry of Dinucleotide Steps in Double-Helical DNA: A New Local Calculation Scheme.'' J. Mol. Biol. 251, 648-664. X. J. Lu, M. A. El Hassan & C. A. Hunter (1997). ``Structure and Conformation of Helical Nucleic Acids: Analysis Program (SCHNAaP).''J. Mol. Biol. 273, 668-680. CompDNA (Please refer to Dr. Andrey A. Gorin: agor@sbnmr1.ski.mskcc.org OR Dr. Victor B. Zhurkin: zhurkin@lmmb.nci.nih.gov) A. A. Gorin, V. B. Zhurkin & W. K. Olson (1995). ``B-DNA Twisting Correlates with Base-pair Morphology.'' J. Mol. Biol. 247, 34-48. K. M. Kosikov, A. A. Gorin, V. B. Zhurkin & W. K. Olson (1999). ``DNA Stretching and Compression: Large-scale Simulations of Double Helical


Nucleic acid detection methods  

DOE Patents [OSTI]

The invention relates to methods for rapidly determining the sequence and/or length a target sequence. The target sequence may be a series of known or unknown repeat sequences which are hybridized to an array of probes. The hybridized array is digested with a single-strand nuclease and free 3{prime}-hydroxyl groups extended with a nucleic acid polymerase. Nuclease cleaved heteroduplexes can be easily distinguish from nuclease uncleaved heteroduplexes by differential labeling. Probes and target can be differentially labeled with detectable labels. Matched target can be detected by cleaving resulting loops from the hybridized target and creating free 3-hydroxyl groups. These groups are recognized and extended by polymerases added into the reaction system which also adds or releases one label into solution. Analysis of the resulting products using either solid phase or solution. These methods can be used to detect characteristic nucleic acid sequences, to determine target sequence and to screen for genetic defects and disorders. Assays can be conducted on solid surfaces allowing for multiple reactions to be conducted in parallel and, if desired, automated. 18 figs.

Smith, C.L.; Yaar, R.; Szafranski, P.; Cantor, C.R.



Nucleic Acid Standards - Standard Ref. Frame  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

A Standard Reference Frame for the Description A Standard Reference Frame for the Description of Nucleic Acid Base-pair Geometry Supplementary Material The report is available at Journal of Molecular Biology (2001) 313: 229 - 237 and The Nucleic Acid Cartesian coordinates for A, C, G, T, and U in the optimized reference frame Adenine, Cytosine, Guanine, Thymine, Uracil Standard chemical structures taken from Clowney et al. (1996), J. Am. Chem. Soc., 118, 509-518). These data do not include C1' atoms, which are placed here in the least-squares plane of the base atoms, with the purine C1'-N9 bond length and C1'-N9-C4 valence angle set respectively to 1.46 Å and 126.5° and the pyrimidine C1'-N1 bond and C1-N1-C2 angle to 1.47 Å and 118.1°. These distances and angles are based on the average glycosyl


Self-assembling multimeric nucleic acid constructs  

DOE Patents [OSTI]

The invention is directed to constructs and compositions containing multimeric forms of nucleic acid. Multimeric nucleic acids comprise single-stranded nucleic acids attached via biotin to streptavidin and bound with a functional group. These constructs can be utilized in vivo to treat or identify diseased tissue or cells. Repeated administrations of multimeric nucleic acid compositions produce a rapid and specific amplification of nucleic acid constructs and their attached functional groups. For treatment purposes, functional groups may be toxins, radioisotopes, genes or enzymes. Diagnostically, labeled multimeric constructs may be used to identify specific targets in vivo or in vitro. Multimeric nucleic acids may also be used in nanotechnology and to create self-assembling polymeric aggregates such as membranes of defined porosity, microcircuits and many other products.

Cantor, Charles R. (Boston, MA); Niemeyer, Christof M. (Bremen, DE); Smith, Cassandra L. (Boston, MA); Sano, Takeshi (Boston, MA); Hnatowich, Donald J. (Brookline, MA); Rusckowski, Mary (Southborough, MA)



Self-assembling multimeric nucleic acid constructs  

DOE Patents [OSTI]

The invention is directed to constructs and compositions containing multimeric forms of nucleic acid. Multimeric nucleic acids comprise single-stranded nucleic acids attached via biotin to streptavidin and bound with a functional group. These constructs can be utilized in vivo to treat or identify diseased tissue or cells. Repeated administrations of multimeric nucleic acid compositions produce a rapid and specific amplification of nucleic acid constructs and their attached functional groups. For treatment purposes, functional groups may be toxins, radioisotopes, genes or enzymes. Diagnostically, labeled multimeric constructs may be used to identify specific targets in vivo or in vitro. Multimeric nucleic acids may also be used in nanotechnology and to create self-assembling polymeric aggregates such as membranes of defined porosity, microcircuits and many other products.

Cantor, Charles R. (Boston, MA); Niemeyer, Christof M. (Bremen, DE); Smith, Cassandra L. (Boston, MA); Sano, Takeshi (Boston, MA); Hnatowich, Donald J. (Brookline, MA); Rusckowski, Mary (Southborough, MA)



Sequence Design for a Test Tube of Interacting Nucleic Acid Strands  

Science Journals Connector (OSTI)

Sequence Design for a Test Tube of Interacting Nucleic Acid Strands ... We describe an algorithm for designing the equilibrium base-pairing properties of a test tube of interacting nucleic acid strands. ... A target test tube is specified as a set of desired on-target complexes, each with a target secondary structure and target concentration, and a set of undesired off-target complexes, each with vanishing target concentration. ...

Brian R. Wolfe; Niles A. Pierce



Nucleic Acid Standards - Refinement Parameters  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Refinement Parameters Refinement Parameters The DNA/RNA topology and parameter files for X-PLOR are shown below. These were tested with DNA structures and with protein-DNA complexes. X-PLOR topology file X-PLOR parameter files: X-PLOR parameter file For the refinement of high resolution structures (< 1.7 Angstroms) the parameter file with distinct bond distances and bond angles for both C2'-endo and C3'-endo conformations should be considered: X-PLOR parameter file for high resolution structures "New Parameters for the Refinement of Nucleic Acid Containing Structures." Gary Parkinson, Jaroslav Vojtechovsky, Lester Clowney, Axel Brunger*, and Helen M. Berman. (1996) Acta Cryst. D 52, 57-64 Rutgers University, Department of Chemistry, Piscataway, NJ 08855-0939; *The Howard Hughes Medical Institute and Departments of Molecular and


Amplification of trace amounts of nucleic acids  

DOE Patents [OSTI]

Methods of reducing background during amplification of small amounts of nucleic acids employ careful analysis of sources of low level contamination. Ultraviolet light can be used to reduce nucleic acid contaminants in reagents and equipment. "Primer-dimer" background can be reduced by judicious design of primers. We have shown clean signal-to-noise with as little as starting material as one single human cell (.about.6 picogram), E. coli cell (.about.5 femtogram) or Prochlorococcus cell (.about.3 femtogram).

Church, George M. (Brookline, MA); Zhang, Kun (Brighton, MA)



Detection of nucleic acid sequences by invader-directed cleavage  

DOE Patents [OSTI]

The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based by charge.

Brow, Mary Ann D. (Madison, WI); Hall, Jeff Steven Grotelueschen (Madison, WI); Lyamichev, Victor (Madison, WI); Olive, David Michael (Madison, WI); Prudent, James Robert (Madison, WI)



Nucleic acid based fluorescent sensor for copper detection  

DOE Patents [OSTI]

A nucleic acid enzyme responsive to copper, comprising an oligonucleotide comprising a nucleotide sequence of SEQ ID NO:1, wherein the nucleic acid enzyme is not self-cleaving.

Lu, Yi; Liu, Juewen



Nucleic Acid Standards - Sugar and Phosphate Constituents  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sugar and Phosphate Constituents Sugar and Phosphate Constituents The following tables contain the complete references for the structures used in a statistical survey of well-refined mononucleoside, mononucleotide, dinucleoside monophosphate, and trinucleoside diphosphate crystal structures found in the Cambridge Structural Database and the Nucleic Acid Database that appeared in The Journal of the American Chemical Society (Anke Gelbin, Bohdan Schneider, Lester Clowney, Shu-Hsin Hsieh, Wilma K. Olson, and Helen M. Berman. "Geometric Parameters in Nucleic Acids: Sugar Phosphate Constituents" (1996) 118, 519-529.) Table 1: References for Mononucleoside and Mononucleotide Structures Table 2: References for Dinucleoside Monophosphate and Trinucleoside Diphosphate Structures The following tables are summaries of the bond lengths, angles, and torsion


Nucleic acids, compositions and uses thereof  

DOE Patents [OSTI]

The subject invention provides at least one nucleic acid sequence encoding an aldouronate-utilization regulon isolated from Paenibacillus sp. strain JDR-2, a bacterium which efficiently utilizes xylan and metabolizes aldouronates (methylglucuronoxylosaccharides). The subject invention also provides a means for providing a coordinately regulated process in which xylan depolymerization and product assimilation are coupled in Paenibacillus sp. strain JDR-2 to provide a favorable system for the conversion of lignocellulosic biomass to biobased products. Additionally, the nucleic acid sequences encoding the aldouronate-utilization regulon can be used to transform other bacteria to form organisms capable of producing a desired product (e.g., ethanol, 1-butanol, acetoin, 2,3-butanediol, 1,3-propanediol, succinate, lactate, acetate, malate or alanine) from lignocellulosic biomass.

Preston, III, James F. (Micanopy, FL); Chow, Virginia (Gainesville, FL); Nong, Guang (Gainesville, FL); Rice, John D. (Gainesville, FL); St. John, Franz J. (Baltimore, MD)



Nucleic acid compositions and the encoding proteins  

SciTech Connect (OSTI)

The subject invention provides at least one nucleic acid sequence encoding an aldouronate-utilization regulon isolated from Paenibacillus sp. strain JDR-2, a bacterium which efficiently utilizes xylan and metabolizes aldouronates (methylglucuronoxylosaccharides). The subject invention also provides a means for providing a coordinately regulated process in which xylan depolymerization and product assimilation are coupled in Paenibacillus sp. strain JDR-2 to provide a favorable system for the conversion of lignocellulosic biomass to biobased products. Additionally, the nucleic acid sequences encoding the aldouronate-utilization regulon can be used to transform other bacteria to form organisms capable of producing a desired product (e.g., ethanol, 1-butanol, acetoin, 2,3-butanediol, 1,3-propanediol, succinate, lactate, acetate, malate or alanine) from lignocellulosic biomass.

Preston, III, James F.; Chow, Virginia; Nong, Guang; Rice, John D.; St. John, Franz J.



EGVII endoglucanase and nucleic acids encoding the same  

DOE Patents [OSTI]

The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Nucleic acid amplification using modular branched primers  

DOE Patents [OSTI]

Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

Ulanovsky, Levy (Westmont, IL)



Method for high-volume sequencing of nucleic acids: random and directed priming with libraries of oligonucleotides  

DOE Patents [OSTI]

Random and directed priming methods for determining nucleotide sequences by enzymatic sequencing techniques, using libraries of primers of lengths 8, 9 or 10 bases, are disclosed. These methods permit direct sequencing of nucleic acids as large as 45,000 base pairs or larger without the necessity for subcloning. Individual primers are used repeatedly to prime sequence reactions in many different nucleic acid molecules. Libraries containing as few as 10,000 octamers, 14,200 nonamers, or 44,000 decamers would have the capacity to determine the sequence of almost any cosmid DNA. Random priming with a fixed set of primers from a smaller library can also be used to initiate the sequencing of individual nucleic acid molecules, with the sequence being completed by directed priming with primers from the library. In contrast to random cloning techniques, a combined random and directed priming strategy is far more efficient.

Studier, F. William (Stony Brook, NY)



Oligonucleoside alkyl or arylphosphonate derivatives capable of crosslinking with or cleaving nucleic acids  

DOE Patents [OSTI]

A composition for inactivating a target nucleic acid which comprises an oligonucleoside alkyl or arylphosphonate analogue which is complementary to the sequence of the target nucleic acid is provided. It includes a functional group which reacts with the target nucleic acid to render the target nucleic acid inactive or nonfunctional. 16 figs.

Miller, P.S.; Ts'o, P.O.P.



Isolated menthone reductase and nucleic acid molecules encoding same  

DOE Patents [OSTI]

The present invention provides isolated menthone reductase proteins, isolated nucleic acid molecules encoding menthone reductase proteins, methods for expressing and isolating menthone reductase proteins, and transgenic plants expressing elevated levels of menthone reductase protein.

Croteau, Rodney B; Davis, Edward M; Ringer, Kerry L



Methods And Devices For Characterizing Duplex Nucleic Acid Molecules  

DOE Patents [OSTI]

Methods and devices are provided for characterizing a duplex nucleic acid, e.g., a duplex DNA molecule. In the subject methods, a fluid conducting medium that includes a duplex nucleic acid molecule is contacted with a nanopore under the influence of an applied electric field and the resulting changes in current through the nanopore caused by the duplex nucleic acid molecule are monitored. The observed changes in current through the nanopore are then employed as a set of data values to characterize the duplex nucleic acid, where the set of data values may be employed in raw form or manipulated, e.g., into a current blockade profile. Also provided are nanopore devices for practicing the subject methods, where the subject nanopore devices are characterized by the presence of an algorithm which directs a processing means to employ monitored changes in current through a nanopore to characterize a duplex nucleic acid molecule responsible for the current changes. The subject methods and devices find use in a variety of applications, including, among other applications, the identification of an analyte duplex DNA molecule in a sample, the specific base sequence at a single nulceotide polymorphism (SNP), and the sequencing of duplex DNA molecules.

Akeson, Mark (Santa Cruz, CA); Vercoutere, Wenonah (Santa Cruz, CA); Haussler, David (Santa Cruz, CA); Winters-Hilt, Stephen (Santa Cruz, CA)



Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid  

DOE Patents [OSTI]

A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.

Nasarabadi, Shanavaz (Livermore, CA)



Thermoplastic Microfluidic Device for On-Chip Purification of Nucleic Acids for Disposable  

E-Print Network [OSTI]

Thermoplastic Microfluidic Device for On-Chip Purification of Nucleic Acids for Disposable, Brookline, Massachusetts 02446 A polymeric microfluidic device for solid-phase extraction (SPE applications. Microfluidic approaches to nucleic acid isolation have therefore received great attention


Multiple Sequence Alignments of Partially Coding Nucleic Acid Sequences  

E-Print Network [OSTI]

Multiple Sequence Alignments of Partially Coding Nucleic Acid Sequences Roman R. Stocsits1 , Ivo L Fe Institute, 1399 Hyde Park Rd., Santa Fe NM 87501, USA Email: Roman R. Stocsits - roman of the available sequence data was pre- sented very recently [12]. SARGLSSTVSLGQFEHWSPR NARNLSDTVS

Stadler, Peter F.


7-9/99 Neuman Chapter 23 Nucleic Acids  

E-Print Network [OSTI]

7-9/99 Neuman Chapter 23 0 Chapter 23 Nucleic Acids from Organic Chemistry by Robert C. Neuman, Jr. Professor of Chemistry, emeritus University of California, Riverside orgchembyneuman@yahoo.com ://web.chem.ucsb.edu/~neuman/orgchembyneuman/> Chapter Outline of the Book

Reed, Christopher A.


Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same  

DOE Patents [OSTI]

The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo



Cell cycle nucleic acids, polypeptides and uses thereof  

DOE Patents [OSTI]

The invention provides isolated nucleic acids and their encoded proteins that are involved in cell cycle regulation. The invention further provides recombinant expression cassettes, host cells, transgenic plants, and antibody compositions. The present invention provides methods and compositions relating to altering cell cycle protein content, cell cycle progression, cell number and/or composition of plants.

Gordon-Kamm, William J. (Urbandale, IA); Lowe, Keith S. (Johnston, IA); Larkins, Brian A. (Tucson, AZ); Dilkes, Brian R. (Tucson, AZ); Sun, Yuejin (Westfield, IN)



Nucleic acids encoding human trithorax protein  

DOE Patents [OSTI]

In accordance with the present invention, there is provided an isolated peptide having the characteristics of human trithorax protein (as well as DNA encoding same, antisense DNA derived therefrom and antagonists therefor). The invention peptide is characterized by having a DNA binding domain comprising multiple zinc fingers and at least 40% amino acid identity with respect to the DNA binding domain of Drosophila trithorax protein and at least 70% conserved sequence with respect to the DNA binding domain of Drosophila trithorax protein, and wherein said peptide is encoded by a gene located at chromosome 11 of the human genome at q23. Also provided are methods for the treatment of subject(s) suffering from immunodeficiency, developmental abnormality, inherited disease, or cancer by administering to said subject a therapeutically effective amount of one of the above-described agents (i.e., peptide, antagonist therefor, DNA encoding said peptide or antisense DNA derived therefrom). Also provided is a method for the diagnosis, in a subject, of immunodeficiency, developmental abnormality, inherited disease, or cancer associated with disruption of chromosome 11 at q23.

Evans, Glen A. (Encinitas, CA); Djabali, Malek (Marseilles, FR); Selleri, Licia (Del Mar, CA); Parry, Pauline (San Diego, CA)



Nucleic acid modifications in bacterial pathogens - impact on pathogenesis, diagnosis, and therapy  

E-Print Network [OSTI]

Nucleic acids are subject to extensive chemical modification by all organisms. These modifications display incredible structural diversity, and some are essential for survival. Intriguingly, several of these modifications ...

Russell, Brandon S. (Brandon Skylur)



BGL7 beta-glucosidase and nucleic acids encoding the same  

DOE Patents [OSTI]

The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

Dunn-Coleman, Nigel (Los Gatos, CA); Ward, Michael (San Francisco, CA)



BGL3 beta-glucosidase and nucleic acids encoding the same  

DOE Patents [OSTI]

The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian



BGL7 beta-glucosidase and nucleic acids encoding the same  

DOE Patents [OSTI]

The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

Dunn-Coleman, Nigel; Ward, Michael



BGL6 beta-glucosidase and nucleic acids encoding the same  

DOE Patents [OSTI]

The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

Dunn-Coleman, Nigel; Ward, Michael



BGL5 .beta.-glucosidase and nucleic acids encoding the same  

SciTech Connect (OSTI)

The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl5, and the corresponding BGL5 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL5, recombinant BGL5 proteins and methods for producing the same.

Dunn-Coleman, Nigel (Los Gatos, CA); Goedegebuur, Frits (Vlaardingen, NL); Ward, Michael (San Francisco, CA); Yao, Jian (Sunnyvale, CA)



Nucleic acid sequence detection using multiplexed oligonucleotide PCR  

DOE Patents [OSTI]

Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

Nolan, John P. (Santa Fe, NM); White, P. Scott (Los Alamos, NM)




Science Journals Connector (OSTI)

...CLINICAL MEASUREMENTS OF BACTERIA AND VIRUSES USING NUCLEIC ACID TESTS Jernej Pavsic a b Alison S. Devonshire c * Helen Parkes c Heinz...Institute of Virology, Berlin, Germany f . Nucleic acid based tests for infectious diseases currently used in the clinical laboratory...

Jernej Pavi?; Alison S. Devonshire; Helen Parkes; Heinz Schimmel; Carole A. Foy; Maria Karczmarczyk; Ion Gutirrez-Aguirre; Isobella Honeyborne; Jim F. Huggett; Timothy D. McHugh; Mojca Milavec; Heinz Zeichhardt; Jana el


Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Nuclear magnetic resonance studies of drug-nucleic acid interactions at the synthetic DNA level in solution  

Science Journals Connector (OSTI)

Nuclear magnetic resonance studies of drug-nucleic acid interactions at the synthetic DNA level in solution ...

Dinshaw J. Patel



The present invention relates to automated methods of introducing multiple nucleic acid sequences into one or more target cells.  

DOE Patents [OSTI]

The present invention relates to automated methods of introducing multiple nucleic acid sequences into one or more target cells.

Church, George M. (Brookline, MA); Wang, Harris H. (Cambridge, MA); Isaacs, Farren J. (Brookline, MA)



Electron Attachment to the GuanineCytosine Nucleic Acid Base Pair and the Effects of Monohydration and Proton Transfer  

Science Journals Connector (OSTI)

Ashutosh Gupta , Heather M. Jaeger , Katherine R. Compaan , and Henry F. Schaefer , III* ... Wheeler, S. E.; Allen, W. D.; Schaefer, H. F. J. Chem. ...

Ashutosh Gupta; Heather M. Jaeger; Katherine R. Compaan; Henry F. Schaefer; III



Enhancement of Thermal Neutron Induced Killing Effect on Hela Cells Containing Boron-10 Nucleic Acid Derivatives  

Science Journals Connector (OSTI)

The 10B-compounds as the carriers of 10B atoms are one of the keys to make BNCT succeed. Recently, we synthesized some derivatives of nucleic acids containing 10B. The present study deals with the enhanced killin...

Y. Ujeno; M. Akaboshi; K. Akuta; T. Maki



Plants having modified response to ethylene by transformation with an ETR nucleic acid  

DOE Patents [OSTI]

The invention includes transformed plants having at least one cell transformed with a modified ETR nucleic acid. Such plants have a phenotype characterized by a decrease in the response of at least one transformed plant cell to ethylene as compared to a plant not containing the transformed plant cell. Tissue and/or temporal specificity for expression of the modified ETR nucleic acid is controlled by selecting appropriate expression regulation sequences to target the location and/or time of expression of the transformed nucleic acid. The plants are made by transforming at least one plant cell with an appropriate modified ETR nucleic acid, regenerating plants from one or more of the transformed plant cells and selecting at least one plant having the desired phenotype.

Meyerowitz, Elliott M. (Pasadena, CA); Chang, Caren (Pasadena, CA); Bleecker, Anthony B. (Madison, WI)



Studies toward biomimetic claisen condensation using nucleic acid templates and ribozyme catalysis  

E-Print Network [OSTI]

Many different experimental approaches were attempted to achieve carbon-carbon bond formation by nucleic acid template-directed reactions and ribozyme catalysis as potential lipid synthesizing machineries in the RNA world. A novel biomimetic...

Ryu, Youngha



Understanding barriers to efficient nucleic acid delivery with bioresponsive block copolymers  

E-Print Network [OSTI]

The delivery of nucleic acids has the potential to revolutionize medicine by allowing previously untreatable diseases to be clinically addressed. Viral delivery systems have been held back by immunogenicity and toxicity ...

Bonner, Daniel Kenneth



Point of Attachment and Sequence of Immobilized Peptide-Acridine Conjugates Control Affinity for Nucleic Acids  

E-Print Network [OSTI]

for Nucleic Acids Coby B. Carlson and Peter A. Beal* Department of Chemistry, UniVersity of Utah, 315 South) was constructed * To whom correspondence should be addressed. E-mail: beal@ chemistry.chem.utah.edu. Figure 1

Beal, Peter A.


Method for producing labeled single-stranded nucleic acid probes  

DOE Patents [OSTI]

Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector, the cloning vector having an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe.

Dunn, John J. (Bellport, NY); Quesada, Mark A. (Middle Island, NY); Randesi, Matthew (Upton, NY)



Monitoring Gene Expression In Vivo with Nucleic Acid Molecular Switches  

SciTech Connect (OSTI)

The overall objectives of this project were (1) to develop allosteric ribozymes capable of acting as molecular switches for monitoring the levels of both wild-type and mutant mRNA species in living cells and whole animals and (2) to develop highly efficient reagents to deliver nucleic acid molecular switches into living cells, tissues and animals with the ultimate goal of expression profiling specific mRNAs of diagnostic or prognostic value within tumors in animals. During the past year, we have moved our laboratory to Nevada and in the moving process we have lost electronic and paper copies of prior progress reports concerning the construction and biological properties of the molecular switches. Since there was minimal progress during the last year on molecular switches, we are relying on past project reports to provide a summary of our data on this facet of the grant. Here we are summarizing the work done on the delivery reagents and their application to inducing mutations in living cells, which will include work done during the no cost extension.

David C. Ward; Patricia Bray-Ward



Structural aspects of catalytic mechanisms of endonucleases and their binding to nucleic acids  

SciTech Connect (OSTI)

Endonucleases (EC 3.1) are enzymes of the hydrolase class that catalyze the hydrolytic cleavage of deoxyribonucleic and ribonucleic acids at any region of the polynucleotide chain. Endonucleases are widely used both in biotechnological processes and in veterinary medicine as antiviral agents. Medical applications of endonucleases in human cancer therapy hold promise. The results of X-ray diffraction studies of the spatial organization of endonucleases and their complexes and the mechanism of their action are analyzed and generalized. An analysis of the structural studies of this class of enzymes showed that the specific binding of enzymes to nucleic acids is characterized by interactions with nitrogen bases and the nucleotide backbone, whereas the nonspecific binding of enzymes is generally characterized by interactions only with the nucleic-acid backbone. It should be taken into account that the specificity can be modulated by metal ions and certain low-molecular-weight organic compounds. To test the hypotheses about specific and nonspecific nucleic-acid-binding proteins, it is necessary to perform additional studies of atomic-resolution three-dimensional structures of enzyme-nucleic-acid complexes by methods of structural biology.

Zhukhlistova, N. E.; Balaev, V. V.; Lyashenko, A. V.; Lashkov, A. A., E-mail: alashkov83@gmail.com [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)



Supplementary Materials: A Partition Function Algorithm for Interacting Nucleic Acid Strands  

E-Print Network [OSTI]

sets used for verification of our algorithm. 1 Preliminaries Throughout this paper, we denote the twoSupplementary Materials: A Partition Function Algorithm for Interacting Nucleic Acid Strands-Ludwigs-Universit¨at, Freiburg, Germany In this supplementary material, we describe in full the algorithm for computing

Will, Sebastian


1942 Nucleic Acids Research, Vol. 19, No. 8 Sequence and structure of Tetrahymena SRP RNA  

E-Print Network [OSTI]

1942 Nucleic Acids Research, Vol. 19, No. 8 Sequence and structure of Tetrahymena SRP RNA Patrick J EMBL accession no. X56981 Signal recognition particle (SRP) is a ribonucleoprotein required the sequence and proposed structure of an SRP RNA homolog from Tetrahymena, initially identified on the basis

Walter, Peter


Final Report Nucleic Acid System - PCR, Multiplex Assays and Sample Preparation Project  

SciTech Connect (OSTI)

The objective of this project was to reduce to practice the detection and identification of biological warfare pathogens by the nucleic acid recognition technique of PCR (polymerase chain reaction). This entailed not only building operationally functional instrumentation but also developing the chemical assays for detection of priority pathogens. This project had two principal deliverables: (1) design, construct, test and deliver a 24 chamber, multiplex capable suitcase sized PCR instrument, and (2) develop and reduce to practice a multiplex assay for the detection of PCR product by flow cytometry. In addition, significant resources were allocated to test and evaluation of the Hand-held Advanced Nucleic Acid Analyzer (HANAA). This project helps provide the signature and intelligence gathering community the ability to perform, on-site or remote, rapid analysis of environmental or like samples for the presence of a suite of biological warfare pathogens.

Koopman, R.P.; Langlois, R.G.; Nasarabadi, S.; Benett, W.J.; Richards, J.B.; Hadley, D.R.; Miles, R.R.; Brown, S.B.; Stratton, P.L.; Milanovich, F.P.



Nucleic acid molecules conferring enhanced ethanol tolerance and microorganisms having enhanced tolerance to ethanol  

DOE Patents [OSTI]

The present invention provides isolated nucleic acid molecules which encode a mutant acetaldehyde-CoA/alcohol dehydrogenase or mutant alcohol dehydrogenase and confer enhanced tolerance to ethanol. The invention also provides related expression vectors, genetically engineered microorganisms having enhanced tolerance to ethanol, as well as methods of making and using such genetically modified microorganisms for production of biofuels based on fermentation of biomass materials.

Brown, Steven; Guss, Adam; Yang, Shihui; Karpinets, Tatiana; Lynd, Lee; Shao, Xiongjun



Nucleic acids encoding modified human immunodeficiency virus type 1 (HIV-1) group M consensus envelope glycoproteins  

DOE Patents [OSTI]

The present invention relates, in general, to an immunogen and, in particular, to an immunogen for inducing antibodies that neutralizes a wide spectrum of HIV primary isolates and/or to an immunogen that induces a T cell immune response. The invention also relates to a method of inducing anti-HIV antibodies, and/or to a method of inducing a T cell immune response, using such an immunogen. The invention further relates to nucleic acid sequences encoding the present immunogens.

Haynes, Barton F. (Durham, NC); Gao, Feng (Durham, NC); Korber, Bette T. (Los Alamos, NM); Hahn, Beatrice H. (Birmingham, AL); Shaw, George M. (Birmingham, AL); Kothe, Denise (Birmingham, AL); Li, Ying Ying (Hoover, AL); Decker, Julie (Alabaster, AL); Liao, Hua-Xin (Chapel Hill, NC)



Nucleic Acid Encoding A Lectin-Derived Progenitor Cell Preservation Factor  

DOE Patents [OSTI]

The invention relates to an isolated nucleic acid molecule that encodes a protein that is effective to preserve progenitor cells, such as hematopoietic progenitor cells. The nucleic acid comprises a sequence defined by SEQ ID NO:1, a homolog thereof, or a fragment thereof. The encoded protein has an amino acid sequence that comprises a sequence defined by SEQ ID NO:2, a homolog thereof, or a fragment thereof that contains an amino acid sequence TNNVLQVT. Methods of using the encoded protein for preserving progenitor cells in vitro, ex vivo, and in vivo are also described. The invention, therefore, include methods such as myeloablation therapies for cancer treatment wherein myeloid reconstitution is facilitated by means of the specified protein. Other therapeutic utilities are also enabled through the invention, for example, expanding progenitor cell populations ex vivo to increase chances of engraftation, improving conditions for transporting and storing progenitor cells, and facilitating gene therapy to treat and cure a broad range of life-threatening hematologic diseases.

Colucci, M. Gabriella (Dugenta, IT); Chrispeels, Maarten J. (La Jolla, CA); Moore, Jeffrey G. (New York, NY)



Modified pseudomonas oleovorans phaC1 nucleic acids encoding bispecific polyhydroxyalkanoate polymerase  

DOE Patents [OSTI]

A genetically engineered Pseudomonas oleovorans phaC1 polyhydroxyalkanoate (PHA) polymerase having tailored substrate specificity is provided. The modified PHA polymerase is preferably a "bispecific" PHA polymerase capable of copolymerizing a short chain length monomer and a medium chain length monomer is provided. Methods for making the modified PHA polymerase and for making nucleic acids encoding the modified PHA polymerase are also disclosed, as are methods of producing PHA using the modified PHA polymerase. The invention further includes methods to assay for altered substrate specificity.

Srienc, Friedrich (Lake Elmo, MN); Jackson, John K. (Plymouth, MN); Somers, David A. (Roseville, MN)



Characterization of a Heat-Shock Process for Reduction of the Nucleic Acid Content of Candida utilis  

Science Journals Connector (OSTI)

...molecular weight distribution of the degradation...without appreciable loss of ribonuclease...length of time of heat- shock (step...Immediately after heat-shock- ing, the distribution of nucleic acids...observed in the non-heat-shocked cells...

S. Ohta; S. Maul; A. J. Sinskey; S. R. Tannenbaum



Methods of combined bioprocessing and related microorganisms, thermophilic and/or acidophilic enzymes, and nucleic acids encoding said enzymes  

DOE Patents [OSTI]

A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.

Thompson, David N; Apel, William A; Thompson, Vicki S; Ward, Thomas E


Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Methods of combined bioprocessing and related microorganisms, thermophilic and/or acidophilic enzymes, and nucleic acids encoding said enzymes  

DOE Patents [OSTI]

A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.

Thompson, David N; Apel, William A; Thompson, Vicki S; Ward, Thomas E



Self-organizing molecular photonic structures based on functionalized synthetic nucleic acid (DNA) polymers  

Science Journals Connector (OSTI)

Work has been carried out with the objective of imparting the electronic/photonic property of extended Forster energy transfer into organized structures formed by the programmed self-assembly of synthetic nucleic acid units (fluorescent oligonucleotides and polynucleotides). Forster energy transfer is a non-radiative process by which a fluorescent donor molecule excited at one wavelength is able to transfer its absorbed photonic energy efficiently to a fluorescent acceptor molecule, in close proximity, which then re-emits it at a second wavelength. An extended energy transfer system, with multiple donor molecules, could be considered a molecular photonic antenna or amplifier structure. Relatively efficient extended Forster energy transfer was observed in initial experiments involving multiple fluorescent donor and acceptor oligonucleotides. These results provide a clear demonstration of totally synthetic molecules, with highly specific programmable self-assembling properties, organizing into molecular structures with useful electronic/photonic properties.

M J Heller; R H Tullis



Aptamer- and nucleic acid enzyme-based systems for simultaneous detection of multiple analytes  

DOE Patents [OSTI]

The present invention provides aptamer- and nucleic acid enzyme-based systems for simultaneously determining the presence and optionally the concentration of multiple analytes in a sample. Methods of utilizing the system and kits that include the sensor components are also provided. The system includes a first reactive polynucleotide that reacts to a first analyte; a second reactive polynucleotide that reacts to a second analyte; a third polynucleotide; a fourth polynucleotide; a first particle, coupled to the third polynucleotide; a second particle, coupled to the fourth polynucleotide; and at least one quencher, for quenching emissions of the first and second quantum dots, coupled to the first and second reactive polynucleotides. The first particle includes a quantum dot having a first emission wavelength. The second particle includes a second quantum dot having a second emission wavelength different from the first emission wavelength. The third polynucleotide and the fourth polynucleotide are different.

Lu, Yi (Champaign, IL); Liu, Juewen (Albuquerque, NM)




E-Print Network [OSTI]

in organic chemistry, Cell Biology and Genetics is also very useful. Formal lectures in all areas of nucleic for the course. The listed books are recommended as sources of background information for the lectures


Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report  

SciTech Connect (OSTI)

The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, and analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: 1) to assess the potential terrorist threat to U.S. agricultural crops, 2) to determine whether suitable assays exist to monitor that threat, and 3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

Kingsley, Mark T.



Human retroviruses and AIDS 1996. A compilation and analysis of nucleic acid and amino acid sequences  

SciTech Connect (OSTI)

This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (1) Nuclear Acid Alignments and Sequences; (2) Amino Acid Alignments; (3) Analysis; (4) Related Sequences; and (5) Database Communications. Information within all the parts is updated throughout the year on the Web site, http://hiv-web.lanl.gov. While this publication could take the form of a review or sequence monograph, it is not so conceived. Instead, the literature from which the database is derived has simply been summarized and some elementary computational analyses have been performed upon the data. Interpretation and commentary have been avoided insofar as possible so that the reader can form his or her own judgments concerning the complex information. In addition to the general descriptions of the parts of the compendium, the user should read the individual introductions for each part.

Myers, G.; Foley, B.; Korber, B. [eds.] [Los Alamos National Lab., NM (United States). Theoretical Div.] [eds.; Los Alamos National Lab., NM (United States). Theoretical Div.; Mellors, J.W. [ed.] [Univ. of Pittsburgh, PA (United States)] [ed.; Univ. of Pittsburgh, PA (United States); Jeang, K.T. [ed.] [National Institutes of Health, Bethesda, MD (United States). Molecular Virology Section] [ed.; National Institutes of Health, Bethesda, MD (United States). Molecular Virology Section; Wain-Hobson, S. [Pasteur Inst., Paris (France)] [ed.] [Pasteur Inst., Paris (France); ed.



A Tat-grafted anti-nucleic acid antibody acquires nuclear-localization property and a preference for TAR RNA  

SciTech Connect (OSTI)

Highlights: {yields} We generate '{sub H3}Tat-3D8' by grafting Tat{sub 48-60} peptide to VH CDR of 3D8 scFv antibody. {yields} {sub H3}Tat-3D8 antibody retains nucleic acid binding and hydrolyzing activities. {yields} {sub H3}Tat-3D8 acquires a preference for TAR RNA structure. {yields} Properties of Tat{sub 48-60} is transferred to an antibody via Tat-grafting into a CDR. -- Abstract: The 3D8 single chain variable fragment (3D8 scFv) is an anti-nucleic acid antibody that can hydrolyze nucleic acids and enter the cytosol of cells without reaching the nucleus. The Tat peptide, derived from the basic region of the HIV-1 Tat protein, translocates to cell nuclei and has TAR RNA binding activity. In this study, we generated a Tat-grafted antibody ({sub H3}Tat-3D8) by replacing complementarity-determining region 3 (CDR3) within the VH domain of the 3D8 scFv with a Tat{sub 48-60} peptide (GRKKRRQRRRPPQ). {sub H3}Tat-3D8 retained the DNA-binding and DNA-hydrolyzing activity of the scFv, and translocated to the nuclei of HeLa cells and preferentially recognized TAR RNA. Thus, the properties associated with the Tat peptide were transferred to the antibody via Tat-grafting without loss of the intrinsic DNA-binding and hydrolyzing activities of the 3D8 scFv antibody.

Jeong, Jong-Geun [Department of Microbiology, Ajou University School of Medicine, San 5, Woncheon-dong, Yeongtong-gu, Suwon 443-749 (Korea, Republic of)] [Department of Microbiology, Ajou University School of Medicine, San 5, Woncheon-dong, Yeongtong-gu, Suwon 443-749 (Korea, Republic of); Kim, Dong-Sik; Kim, Yong-Sung [Department of Molecular Science and Technology, Ajou University, San 5, Woncheon-dong, Yeongtong-gu, Suwon 443-749 (Korea, Republic of)] [Department of Molecular Science and Technology, Ajou University, San 5, Woncheon-dong, Yeongtong-gu, Suwon 443-749 (Korea, Republic of); Kwon, Myung-Hee, E-mail: kwonmh@ajou.ac.kr [Department of Microbiology, Ajou University School of Medicine, San 5, Woncheon-dong, Yeongtong-gu, Suwon 443-749 (Korea, Republic of)] [Department of Microbiology, Ajou University School of Medicine, San 5, Woncheon-dong, Yeongtong-gu, Suwon 443-749 (Korea, Republic of)



Section III-F. Exempt Experiments The following recombinant or synthetic nucleic acid molecules are exempt from the NIH Guidelines and  

E-Print Network [OSTI]

a transposable element, provided the transposable element does not contain any recombinant and/or synthetic DNA or synthetic nucleic acid molecules that consist entirely of DNA segments from different species that exchange DNA by known physiological processes, though one or more of the segments may be a synthetic equivalent

Borenstein, Elhanan


Does Water Play a Structural Role in the Folding of Small Nucleic Acids? Eric J. Sorin,* Young Min Rhee,* and Vijay S. Pande*yz  

E-Print Network [OSTI]

Does Water Play a Structural Role in the Folding of Small Nucleic Acids? Eric J. Sorin,* Young Min Rhee,* and Vijay S. Pande*yz Departments of *Chemistry and y Structural Biology, and z Stanford character of the solvent. Here we consider what role the discrete properties of water and ions play

Sorin, Eric J.


Evaluation of the Alere i Influenza A&B Nucleic Acid Amplification Test by Use of Respiratory Specimens Collected in Viral Transport Medium  

Science Journals Connector (OSTI)

...Influenza AB Nucleic Acid Amplification Test by Use of Respiratory Specimens Collected...to 19 years. Alere i Influenza AB assay test results were compared with viral culture...assays as their first-line diagnostic test for influenza virus infections. Though...

J. Jeremiah Bell; Rangaraj Selvarangan



N-Benzoyloxy-N-methyl-4-aminoazobenzene: Its Carcinogenic Activity in the Rat and Its Reactions with Proteins and Nucleic Acids and Their Constituents in Vitro  

Science Journals Connector (OSTI)

...Carcinogenic Activity in the Rat and Its Reactions with Proteins and Nucleic Acids...From the specificity of the reaction of A'-benzoyloxy- SEPTEMBER...N-BENZOYLOXY-MAB + METHIONINE R CH3 / SN2 s.-/ REACTION pH 7 COO Q/CH3 \\~ ,S,CH3...

Lionel A. Poirier; James A. Miller; Elizabeth C. Miller; and Kei Sato



Cationic Lipid-Nucleic Acid Complexes for Gene Delivery And Silencing: Pathways And Mechanisms for Plasmid Dna And Sirna  

SciTech Connect (OSTI)

Motivated by the promises of gene therapy, there is great interest in developing non-viral lipid-based vectors for therapeutic applications due to their low immunogenicity, low toxicity, ease of production, and the potential of transferring large pieces of DNA into cells. In fact, cationic liposome (CL) based vectors are among the prevalent synthetic carriers of nucleic acids (NAs) currently used in gene therapy clinical trials worldwide. These vectors are studied both for gene delivery with CL-DNA complexes and gene silencing with CL-siRNA (short interfering RNA) complexes. However, their transfection efficiencies and silencing efficiencies remain low compared to those of engineered viral vectors. This reflects the currently poor understanding of transfection-related mechanisms at the molecular and self-assembled levels, including a lack of knowledge about interactions between membranes and double stranded NAs and between CL-NA complexes and cellular components. In this review we describe our recent efforts to improve the mechanistic understanding of transfection by CL-NA complexes, which will help to design optimal lipid-based carriers of DNA and siRNA for therapeutic gene delivery and gene silencing.

Ewert, K.K.; Zidovska, A.; Ahmad, A.; Bouxsein, N.F.; Evans, H.M.; McAllister, C.S.; Samuel, C.E.; Safinya, C.R.; /SLAC



Supplementary Information An In Vitro Translation, Selection, and Amplification System for Peptide Nucleic Acids  

E-Print Network [OSTI]

% trifluoroacetic acid in water for 10 min at room temperature; (iv) reverse-phase HPLC purification of the MMTS1 Supplementary Information An In Vitro Translation, Selection, and Amplification System available reagents and solvents were purchased from Aldrich and used without further purification. All PNA

Liu, David R.


Nucleic acid molecules encoding isopentenyl monophosphate kinase, and methods of use  

DOE Patents [OSTI]

A cDNA encoding isopentenyl monophosphate kinase (IPK) from peppermint (Mentha x piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of isopentenyl monophosphate kinase (SEQ ID NO:2), from peppermint (Mentha x piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for isopentenyl monophosphate kinase, or for a base sequence sufficiently complementary to at least a portion of isopentenyl monophosphate kinase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding isopentenyl monophosphate kinase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant isopentenyl monophosphate kinase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant isopentenyl monophosphate kinase may be used to obtain expression or enhanced expression of isopentenyl monophosphate kinase in plants in order to enhance the production of isopentenyl monophosphate kinase, or isoprenoids derived therefrom, or may be otherwise employed for the regulation or expression of isopentenyl monophosphate kinase, or the production of its products.

Croteau, Rodney B. (Pullman, WA); Lange, Bernd M. (Pullman, WA)



Nucleic and amino acid sequences relating to a novel transketolase, and methods for the expression thereof  

DOE Patents [OSTI]

cDNAs encoding 1-deoxyxylulose-5-phosphate synthase from peppermint (Mentha piperita) have been isolated and sequenced, and the corresponding amino acid sequences have been determined. Accordingly, isolated DNA sequences (SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7) are provided which code for the expression of 1-deoxyxylulose-5-phosphate synthase from plants. In another aspect the present invention provides for isolated, recombinant DXPS proteins, such as the proteins having the sequences set forth in SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:8. In other aspects, replicable recombinant cloning vehicles are provided which code for plant 1-deoxyxylulose-5-phosphate synthases, or for a base sequence sufficiently complementary to at least a portion of 1-deoxyxylulose-5-phosphate synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding a plant 1-deoxyxylulose-5-phosphate synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant 1-deoxyxylulose-5-phosphate synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant 1-deoxyxylulose-5-phosphate synthase may be used to obtain expression or enhanced expression of 1-deoxyxylulose-5-phosphate synthase in plants in order to enhance the production of 1-deoxyxylulose-5-phosphate, or its derivatives such as isopentenyl diphosphate (BP), or may be otherwise employed for the regulation or expression of 1-deoxyxylulose-5-phosphate synthase, or the production of its products.

Croteau, Rodney Bruce (Pullman, WA); Wildung, Mark Raymond (Colfax, WA); Lange, Bernd Markus (Pullman, WA); McCaskill, David G. (Pullman, WA)



Four Moloney murine leukemia virus-infected rat cell clones producing replication-defective particles: protein and nucleic acid analyses.  

Science Journals Connector (OSTI)

...clones producing replication-defective particles: protein and nucleic...below. Viral proteins in the defective particles were labeled with...Fig. 3, lane B), the defective particles produced by the NX...respective marker proteins, car- bonic anhydrase (30K) and...

F K Yoshimura; J M Yamamura



Nucleic acid isolation  

DOE Patents [OSTI]

A method is provided for isolating DNA from eukaryotic cell and flow sorted chromosomes. When DNA is removed from chromosome and cell structure, detergent and proteolytic digestion products remain with the DNA. These products can be removed with organic extraction, but the process steps associated with organic extraction reduces the size of DNA fragments available for experimental use. The present process removes the waste products by dialyzing a solution containing the DNA against a solution containing polyethylene glycol (PEG). The waste products dialyze into the PEG leaving isolated DNA. The remaining DNA has been prepared with fragments containing more than 160 kb. The isolated DNA has been used in conventional protocols without effect on the protocol.

Longmire, J.L.; Lewis, A.K.; Hildebrand, C.E.



Nucleic acid isolation process  

DOE Patents [OSTI]

A method is provided for isolating DNA from eukaryotic cell and flow sorted chromosomes. When DNA is removed from chromosome and cell structure, detergent and proteolytic digestion products remain with the DNA. These products can be removed with organic extraction, but the process steps associated with organic extraction reduce the size of DNA fragments available for experimental use. The present process removes the waste products by dialyzing a solution containing the DNA against a solution containing polyethylene glycol (PEG). The waste products dialyze into the PEG leaving isolated DNA. The remaining DNA has been prepared with fragments containing more than 160 kb. The isolated DNA has been used in conventional protocols without affect on the protocol.

Longmire, Jonathan L. (Los Alamos, NM); Lewis, Annette K. (La Jolla, CA); Hildebrand, Carl E. (Los Alamos, NM)



Nucleic acid biosensors  

DOE Patents [OSTI]

Sensors comprising aptazymes capable of detecting the presence and concentration of effectors, as well as methods of using such sensors, are disclosed.

Lu, Yi (Champaign, IL); Liu, Juewen (Urbana, IL)



A new microcolumn-type microchip for examining the expression of chimeric fusion genes using a nucleic acid sandwich hybridization technique  

Science Journals Connector (OSTI)

Abstract We report a new type of microcolumn installed in a microchip. The architecture allows use of a nucleic acid sandwich hybridization technique to detect a messenger RNA (mRNA) chain as a target. Data are presented that demonstrate that the expression of a chimeric fusion gene can be detected. The microcolumn was filled with semi-transparent microbeads made of agarose gel that acted as carriers, allowing increased efficiency of the optical detection of fluorescence from the microcolumn. The hybrid between the target trapped on the microbeads and a probe DNA labeled with a fluorescent dye was detected by measuring the intensity of the fluorescence from the microcolumn directly. These results demonstrate an easy and simple method for determining the expression of chimeric fusion genes with no preamplification.

Michihiro Ohnishi; Naoyuki Sasaki; Takuya Kishimoto; Hidetoshi Watanabe; Masatoshi Takagi; Shuki Mizutani; Noriyuki Kishii; Akio Yasuda


Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Phosphorus Incorporation into Nucleic Acids and Proteins of Liver Nuclei of Normal and Azo Dye-fed Rats  

Science Journals Connector (OSTI)

...Energy Commission, Oak Ridge, Tenn. 456 WAJW...within a few hours after sacrifice. Animals...adenylic acid. After the first@ hours...Both groups of workers questioned the...period 1 "8hours after injection and...29:7 "26,1950. S. BouweoER...

Darrell N. Ward and A. Clark Griffin



E-Print Network 3.0 - antisense peptide nucleic Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

-penetrating peptide conjugates of peptide nucleic acids (PNA) as inhibitors of HIV-1 Tat- dependent trans... ) Arginine-rich cell-penetrating peptides with ... Source:...


E-Print Network 3.0 - acids research database Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Press236-237 Nucleic Acids Research, 1996, Vol. 24, No. 1 The Ribonuclease... .S., Gilbert, D.G. and Pace, N. R. (1994)Nucleic Acids Res. 22, 3660-3662. 12;237 Nucleic...


E-Print Network 3.0 - acid induces relaxation Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

nucleic acid aggregation.23... on the stability of very stable nucleic acids.17,29,30,34 Single molecule DNA stretching, also referred to as force-induced... not show any effect...


Diagnostic method employing MSH2 nucleic acids  

DOE Patents [OSTI]

The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

de la Chapelle, Albert (Helsingfors, FI); Vogelstein, Bert (Baltimore, MD); Kinzler, Kenneth W. (Baltimore, MD)



Diagnostic method employing MSH2 nucleic acids  

DOE Patents [OSTI]

The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +}(RER{sup +}) tumor cells. 19 figs.

Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.



Ramon Eritja Nucleic Acid Chemistry Group  

E-Print Network [OSTI]

, IQAC-CSIC, CIBER-BBN DNA and RNA in Biophysics #12;DNA and RNA Synthesis tetrazol + (CH2)2(CH2)2 R R R

Ritort, Felix


Nucleic Acid Homology in the Genus Mycobacterium  

Science Journals Connector (OSTI)

...in an L2-65 Beckman ultracentrifuge. Thermal denaturation. Denaturation temperatures...with immobilized homologous DNA, the thermal stability of the duplexes formed should...different clusters. Because a selective battery of only 42 tests is used, it has been...

Wendy M. Gross; Lawrence G. Wayne



B-DNA structure is intrinsically polymorphic: even at the level of base pair positions  

SciTech Connect (OSTI)

Increasingly exact measurement of single crystal X-ray diffraction data offers detailed characterization of DNA conformation, hydration and electrostatics. However, instead of providing a more clear and unambiguous image of DNA, highly accurate diffraction data reveal polymorphism of the DNA atomic positions and conformation and hydration. Here we describe an accurate X-ray structure of B-DNA, painstakingly fit to a multistate model that contains multiple competing positions of most of the backbone and of entire base pairs. Two of ten base-pairs of CCAGGCCTGG are in multiple states distinguished primarily by differences in slide. Similarly, all the surrounding ions are seen to fractionally occupy discrete competing and overlapping sites. And finally, the vast majority of water molecules show strong evidence of multiple competing sites. Conventional resolution appears to give a false sense of homogeneity in conformation and interactions of DNA. In addition, conventional resolution yields an average structure that is not accurate, in that it is different from any of the multiple discrete structures observed at high resolution. Because base pair positional heterogeneity has not always been incorporated into model-building, even some high and ultrahigh-resolution structures of DNA do not indicate the full extent of conformational polymorphism.

Maehigashi, Tatsuya; Hsiao, Chiaolong; Woods, Kristen Kruger; Moulaei, Tinoush; Hud, Nicholas V.; Williams, Loren Dean (GIT)



E-Print Network 3.0 - acids amino acids Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

State University Collection: Biology and Medicine 77 CHE 427627 THE ORGANIC CHEMISTRY OF BIOLOGICAL MOLECULES Summary: macromolecules: carbohydrates, amino acids, nucleic...


E-Print Network 3.0 - acid amino acid Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

State University Collection: Biology and Medicine 77 CHE 427627 THE ORGANIC CHEMISTRY OF BIOLOGICAL MOLECULES Summary: macromolecules: carbohydrates, amino acids, nucleic...


E-Print Network 3.0 - acid oligomerisation manipulating Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of oxidising proteins or lipids and causing chemi- cal modication to nucleic acids (Gilbert... . The sec- ondary structure is mapped onto the amino acid sequence in Figure 3...


E-Print Network 3.0 - anthranilic acid derivatives Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

This acid has been used... -specific nucleic acid ligands via affinity ... Source: Beal, Peter A. - Department of Chemistry, University of Utah Collection: Chemistry 26 Direct...


Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides  

Science Journals Connector (OSTI)

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3?-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We st...

Yuko Ito; Yumiko Sone; Takaharu Mizutani



E-Print Network 3.0 - acid-sensing ion channel Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

challenge for portable diagnostics is then a miniature label-free nucleic acid sensing platform without any... , conductancecapacitanceFET sensors have a A Nanomembrane-Based...


E-Print Network 3.0 - acid-sensing ion channels Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

challenge for portable diagnostics is then a miniature label-free nucleic acid sensing platform without any... , conductancecapacitanceFET sensors have a A Nanomembrane-Based...


E-Print Network 3.0 - acid-binding protein predicts Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summary: and nucleic-acid binding proteins from eukaryotic cell lysates 12;2 Qproteome Nuclear Protein Handbook 07... Preparation of the cytosolic fraction 8 Preparation of the...


E-Print Network 3.0 - acid sites evolving Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Program Summary: the aptamer will evolve) is sandwiched between two complementary primer binding sites in a stemloop... and evolution of nucleic acids (a process known as in...


E-Print Network 3.0 - acid regulates gene Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

DNA binding domain or partner domain type Summary: of the Bipartite response regulator FIS-like Nucleic acid-binding proteins Distribution of DBDs in the TF... R + + + + + ...


E-Print Network 3.0 - acidic eukaryotic biofilms Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Illinois at Urbana-Champaign Collection: Chemistry 42 APPLIED AND ENVIRONMENTAL MICROBIOLOGY, 0099-22400004.00 0 Summary: .), a soluble nucleic acid dye that emits in...

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


E-Print Network 3.0 - acid anion pair Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Based on Very Rare Tautomers: A Computational Study Summary: , a paramount importance reaction proceeding in biological systems, may stabilize valence anions of nucleic acid......


E-Print Network 3.0 - acid translocation dynamics Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

University Collection: Chemistry 10 DNA heterogeneity and phosphorylation unveiled by single-molecule electrophoresis Summary: are sensitive to the quality of the nucleic acids...



Office of Legacy Management (LM)

Acid/Pueblo Canyon, New Mexico, Site is Acid/Pueblo Canyon, New Mexico, Site is located near the town of Los Alamos, New Mexico, approximately 25 miles northwest of Santa Fe and 60 miles north-northeast of Albuquerque. The site is accessible from Canyon Road, which runs just south of the former waste treatment plant. The plant was situated on a mesa that forms the south rim of Acid Canyon. Acid Canyon is a small tributary near the head



Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acid/Pueblo Canyon, New Mexico, Site. Acid/Pueblo Canyon, New Mexico, Site. This site is managed by the U.S. Department of Energy Office of Legacy Management. Site Description and History The Acid/Pueblo Canyon, New Mexico, Site is located near the town of Los Alamos, New Mexico, approximately 25 miles northwest of Santa Fe and 60 miles north-northeast of Albuquerque. The site is accessible from Canyon Road, which runs just south


Thermal and acid tolerant beta xylosidases, arabinofuranosidases, genes encoding, related organisms, and methods  

DOE Patents [OSTI]

Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof are provided. Further provided are methods of at least partially degrading xylotriose, xylobiose, and/or arabinofuranose-substituted xylan using isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof.

Thompson, David N; Thompson, Vicki S; Schaller, Kastli D; Apel, William A; Reed, David W; Lacey, Jeffrey A



Nucleic Acid Library Construction Using Synthetic DNA Constructs  

Science Journals Connector (OSTI)

The synthesis of a high-diversity double-stranded DNA pool can require hundreds of milliliters of...3,10...). Large volumes are required because the maximum concentration of single-stranded synthetic DNA template...

Hani S. Zaher; Peter J. Unrau



Targeting unique nucleic acid structures with small molecules  

E-Print Network [OSTI]

compressibilities of synthetic and natural DNA duplexes atspecific DNA sequences with synthetic oligonucleotides; b)13 These synthetic oligonucleotides both modify their DNA

Tam, Victor Kin-man



CABIOS REVIEW: The GenBank nucleic acid sequence database  

Science Journals Connector (OSTI)

......International Cooperation CAB/OS REVIEW Vol.1, no.4. 1985 Pages...structural RNA-coding and regulatory regions of DNA as well as messenger...experimental work. Several recent reviews and dedicated volumes have...been sequenced. One might plan the construction of segments......

Christian Burks; James W. Fickett; Walter B. Goad; Minoru Kanehisa; Frances I. Lewitter; Wayne P. Rindone; C. David Swindell; Chang-Shung Tung; Howard S. Bilofsky



Advances in nucleic acid-based detection methods.  

Science Journals Connector (OSTI)

...Proc. Natl. Acad. Sci. USA 80:4045- 4049. 59. Lizardi...Proc. Natl. Acad. Sci. USA 87:8923-8927. 74. Olsiewski...Klausner. 1987. Pushing probes to market. Bio/Technology 5:211-221...Proc. Natl. Acad. Sci. USA 89:392-396. 99. Walker...

M J Wolcott



Targeting unique nucleic acid structures with small molecules  

E-Print Network [OSTI]

2 min and then flash cooling on ice for 2 min. Incubated atfor 2 min then flash cooling on ice for 2 min. The extendedminutes, followed by flash cooling on ice for 2 minutes. The

Tam, Victor Kin-man



Automated nucleic acid chain tracing in real time  

Science Journals Connector (OSTI)

A method is presented for the automatic building of nucleotide chains into electron density which is fast enough to be used in interactive model-building software. Likely nucleotides lying in the vicinity of the current view are located and then grown into connected chains in a fraction of a second. When this development is combined with existing tools, assisted manual model building is as simple as or simpler than for proteins.

Cowtan, K.



Composition of the Nucleic Acids of Some Algae  

Science Journals Connector (OSTI)

... The algae were grown in sterile culture. The flasks, containing 1-5 1. of suitable ... kept in a temperature-controlled room and illuminated from below with daylight fluorescent light. The algae were harvested every ten days to two weeks by centrifugation. Navicula pelliculosa and Nitzschia ...




Nucleic acid-based nanoengineering: novel structures for biomedical applications  

Science Journals Connector (OSTI)

...Nanoscale surfacing for regenerative medicine. Wiley Interdiscip. Rev. Nanomed...C. , Langer, R. 2009 Impact of nanotechnology on drug delivery. ACS Nano 3, 16-20...Heath, J. R. , Davis, M. E. 2008 Nanotechnology and cancer. Annu. Rev. Med. 59...



A method for de novo nucleic acid diagnostic target discovery  

Science Journals Connector (OSTI)

......UCRs within the bacteria domain for 15 test groups, including pathogenic, probiotic...which often necessitate a rapid diagnostic test development. As a result, methods that...groups were selected from these genomes to test this proposed UCR-identification method......

Yeting Zhang; Yazhou Sun



Synthesis of Neomycin-DNA/ Peptide Nucleic Acid  

E-Print Network [OSTI]

binding to HIV-1 RNA molecules prevents binding of the cognate viral proteins Tat and Rev to TAR[16 response element RNA motifs[7­ 9] of HIV-1, and a variety of catalytic RNA molecules such as group I

Stuart, Steven J.


E-Print Network 3.0 - acid sensing ion Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Mass Spectrometry 240 (2005) 261272 Insights into nucleic acid reactivity through gas-phase Summary: is predicted to be near that of HCl; the high acidity of N1 H would correlate...


Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2;#8242;-deoxyadenosine:dT Base Pairing in DNA  

SciTech Connect (OSTI)

As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 {angstrom} resolution in the presence of Mg{sup 2+}. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA.

Kowal, Ewa A.; Ganguly, Manjori; Pallan, Pradeep S.; Marky, Luis A.; Gold, Barry; Egli, Martin; Stone, Michael P. (Pitt); (Vanderbilt); (Nebraska-Med)



E-Print Network 3.0 - acid hybridization assay Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

nucleotide polymorphisms by the GOOD assay. Nucleic Acids Res 28: e100 (30) Gut, I.G., Jeffery, W... in the array is used to control hybridization stringency (38) TaqMan ......


A Three-Dimensional RNA Motif in Potato spindle tuber viroid Mediates Trafficking from Palisade Mesophyll to Spongy Mesophyll in Nicotiana benthamiana  

Science Journals Connector (OSTI)

...geometric base pairing family and provide the basis...defined for base pair families (Leontis et al., 2002b...The Pfam protein families database. Nucleic Acids...E. (2006). The building blocks and motifs of...organizes the structure of multi-helix loops in 16 S...

Ryuta Takeda; Anton I. Petrov; Neocles B. Leontis; Biao Ding



Research Article: Error compensation of tRNA misacylation by codon-anticodon mismatch prevents translational amino acid misinsertion  

Science Journals Connector (OSTI)

Codon-anticodon mismatches and tRNA misloadings cause translational amino acid misinsertions, producing dysfunctional proteins. Here I explore the original hypothesis whether mismatches tend to compensate misacylation, so as to insert the amino acid ... Keywords: Alignment, Base pairings, Developmental stability, Homology, Post-transcriptional tRNA transformation, RNA duplex stability, Wobble position, tRNA synthetase

Herv Seligmann


Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Activation of hepatic stem cell compartment in the rat: role of transforming growth factor alpha, hepatocyte growth factor, and acidic fibroblast growth factor in early proliferation  

Science Journals Connector (OSTI)

...Experimental Carcinogenesis, National Cancer Institute, Building 37, Room 3C28, 9000 Rockville Pike, Bethesda...from glyceraldehyde-3-phosphate dehydrogenase multi-genic family. Nucleic Acids Res., 13: 1431-1442, 1985...

RP Evarts; Z Hu; K Fujio; ER Marsden; and SS Thorgeirsson



Sequential Injection Analysis System for the Sandwich Hybridization-Based Detection of Nucleic Acids  

Science Journals Connector (OSTI)

A dynamic range of 1?1000 pmol was obtained for a synthetic DNA sequence that was homologous to a segment in the B. anthracis atxA mRNA. ... A bead-immobilized biotinylated DNA capture probe and a fluorescein-labeled DNA reporter probe hybridize specifically to an unlabeled synthetic DNA target, which was complementary to both probes for method development. ... The sequences of the synthetic DNA probes and primers for NASBA were purchased from Operon (Alamada, CA) and are listed in Table 1. ...

Katie A. Edwards; Antje J. Baeumner



Integration of On-chip Isotachophoresis and Functionalized Hydrogels for Enhanced-Sensitivity Nucleic Acid Detection  

E-Print Network [OSTI]

of Mechanical Engineering, Stanford University, Stanford, CA 94305, USA *E-mail: juan purchased crown glass microfluidic chips (model NS260) and separate plastic chip caddies from Caliper Life of prepolymer mastermix, ITP buffers, and surface modification reagents Composition of our prepolymer is similar

Santiago, Juan G.


Quantitative prediction of 3D solution shape and flexibility of nucleic acid nanostructures  

E-Print Network [OSTI]

DNA nanotechnology enables the programmed synthesis of intricate nanometer-scale structures for diverse applications in materials and biological science. Precise control over the 3D solution shape and mechanical flexibility ...

Kilchherr, F.


Antisense peptide nucleic acid-functionalized cationic nanocomplex for in vivo mRNA detection  

Science Journals Connector (OSTI)

...Department of Chemistry and Chemical Engineering, Texas...that make them an ideal platform for development of antisense...20], is an ideal platform for the development...Materials All solvents and chemicals were purchased from...were purchased from EMD Chemicals, Inc. The amphiphilic...



Cellulases, nucleic acids encoding them and methods for making and using them  

DOE Patents [OSTI]

This invention relates to molecular and cellular biology and biochemistry. In one aspect, the invention provides polypeptides having cellulase activity, e.g., endoglucanase, cellobiohydrolase, mannanase and/or .beta.-glucosidase activity, polynucleotides encoding these polypeptides, and methods of making and using these polynucleotides and polypeptides. In one aspect, the invention is directed to polypeptides cellulase activity, e.g., endoglucanase, cellobiohydrolase, mannanase and/or .beta.-glucosidase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts.

Blum, David; Gemsch Cuenca, Joslin; Dycaico, Mark



Nucleic Acids Research doi:10.1093/nar/gkn465  

E-Print Network [OSTI]

is a histone acetyltransferase implicated in the regulation of transcriptional silencing, and ORC is the six the temperature sensitivity of the ORC mutants orc2-1 and orc5-1. Moreover, sas2D and orc2-1 have a synthetic and orc5-1 have a synthetic effect on transcriptional silencing at the HMR locus. Moreover, we demon

Bi, Xin


Probing structural heterogeneities and fluctuations of nucleic acids and denatured proteins  

E-Print Network [OSTI]

polyelec- trolytes and protein folding in particular, standsdynamics ? protein folding ? single-molecule ?uorescencestructure and dynamics. Protein folding is the most spec-

Laurence, T A; Kong, X X; Jager, M; Weiss, S



Detection of nucleic acids by graphene-based devices: A first-principles study  

SciTech Connect (OSTI)

Based on first-principles quantum transport calculations, we design a graphene-based biosensor device, which is composed of graphene nanoribbons electrodes and a biomolecule. It is found that when different nucleobases or poly nucleobase chains are located in the nanogap, the device presents completely different transport properties, showing different current informations. And the change of currents from 2 to 5 orders of magnitude for four different nucleobases suggests a great ability of discrimination by utilizing such a device. The physical mechanism of this phenomenon originates from their different chemical composition and structure. Moreover, we also explore the coupling effect of several neighboring bases and the size effect of the nanogap on transport properties. Our results show the possibility of rapid sequencing DNA by measuring such a transverse-current of the device, and provide a new idea for sequencing DNA.

Zhang, Hua [School of Physics and Electronics, Central South University, Changsha 410083 (China); School of Physics and Electronic Science, Changsha University of Science and Technology, Changsha 410114 (China); Xu, Hui, E-mail: xuhui@csu.edu.cn, E-mail: ouyangfp06@tsinghua.org.cn; Ni, Xiang; Lin Peng, Sheng; Liu, Qi; Ping OuYang, Fang, E-mail: xuhui@csu.edu.cn, E-mail: ouyangfp06@tsinghua.org.cn [School of Physics and Electronics, Central South University, Changsha 410083 (China)



Optimizing Screening for Acute Human Immunodeficiency Virus Infection with Pooled Nucleic Acid Amplification Tests  

Science Journals Connector (OSTI)

...pooling algorithm selection a Factor(s...Laboratory setting Training, quality assurance...complexity No. of personnel Possible frequency...Kim, H. 2007. Operating characteristics...testing theory, operating characteristics...here can guide the selection of a pooling algorithm...

Daniel J. Westreich; Michael G. Hudgens; Susan A. Fiscus; Christopher D. Pilcher



Stable nitrogen isotope measurements of marine bacterial proteins and nucleic acids: tracers of microbial activity  

E-Print Network [OSTI]

Stable nitrogen isotopes ([]15N) can trace elemental cycling in aquatic ecosystems if the enzyme mediated fractionations associated with nutrient uptake and assimilation are negligible or consistently predictable. In this study, bacterial proteins...

Kovacs, Jeffrey Paul



Nucleic Acid Content of Splenic Lymphocytes in Normal and Leukemic Mice  

Science Journals Connector (OSTI)

...lymphocyte of normal mouse. MATERIALS AND METHODS Spleens...plotted in a scatter diagram in which the abscissa...points in the scatter diagram fell into a MENTENet...depolymerization of nuclear material (5), attests its...by a less traumatic handling. The dog lymphocytes...

M. L. Menten; M. Willms; and W. D. Wright



Nucleic acid encoding a self-assembling split-fluorescent protein system  

DOE Patents [OSTI]

The invention provides a protein labeling and detection system based on self-complementing fragments of fluorescent and chromophoric proteins. The system of the invention is exemplified with various combinations of self-complementing fragments derived from Aequorea victoria Green Fluorescent Protein (GFP), which are used to detect and quantify protein solubility in multiple assay formats, both in vitro and in vivo.

Waldo, Geoffrey S; Cabantous, Stephanie



Antisense peptide nucleic acid-functionalized cationic nanocomplex for in vivo mRNA detection  

Science Journals Connector (OSTI)

...University, , St Louis, MO 63130, USA 2 Department of Medicine, Washington University, , St Louis, MO 63110, USA 3 Department...National Institutes of Health as a Programme of Excellence in Nanotechnology (HHSN268201000046C). The Welch Foundation is gratefully...



Cellulolytic enzymes, nucleic acids encoding them and methods for making and using them  

DOE Patents [OSTI]

The invention provides polypeptides having any cellulolytic activity, e.g., a cellulase activity, a endoglucanase, a cellobiohydrolase, a beta-glucosidase, a xylanase, a mannanse, a .beta.-xylosidase, an arabinofuranosidase, and/or an oligomerase activity, polynucleotides encoding these polypeptides, and methods of making and using these polynucleotides and polypeptides. In one aspect, the invention is directed to polypeptides having any cellulolytic activity, e.g., a cellulase activity, e.g., endoglucanase, cellobiohydrolase, beta-glucosidase, xylanase, mannanse, .beta.-xylosidase, arabinofuranosidase, and/or oligomerase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. In one aspect, the invention provides polypeptides having an oligomerase activity, e.g., enzymes that convert recalcitrant soluble oligomers to fermentable sugars in the saccharification of biomass. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts. The invention also provides compositions or products of manufacture comprising mixtures of enzymes comprising at least one enzyme of this invention.

Gray, Kevin A. (San Diego, CA); Zhao, Lishan (Emeryville, CA); Cayouette, Michelle H. (San Diego, CA)



Volume 3 no.12 December 1976 Nucleic Acids Research Chromatinv bodies: isolation, subfractionation and physical characterization  

E-Print Network [OSTI]

and chemical cross-linking (42-57), X-ray and neutron scattering (4, 47, 48-62), and estimates of histone

Olins, Ada L.


On-line microdialysis sample cleanup for electrospray ionization mass spectrometry of nucleic acid samples  

SciTech Connect (OSTI)

A major limitation of electrospray ionization mass spectrometry (ESI-MS) for oligonucleotide analysis arises due to sodium adduction, a problem that increases with molecular weight. Sodium adduction can preclude useful measurements when limited sample sizes prevent off-line cleanup. A novel and generally useful on-line microdialysis technique is described for the rapid (nearly 1-5 min) DNA sample cleanup for ESI-MS. Mass spectra of oligonucleotides of different size and sequence showing no significant sodium adduct peaks were obtained using the on-line microdialysis system with sodium chloride concentrations as high as 250 mM. Signal-to-noise ratios were also greatly enhanced compared to direct infusion of the original samples. By using ammonium acetate as the dialysis buffer, it was also found that the noncovalent association of double-stranded oligonucleotides could be preserved during the microdialysis process, allowing analysis by ESI-MS. 33 refs., 6 figs.

Liu, C.; Wu, Q.; Harms, A.C.; Smith, R.D. [Pacific Northwest National Lab., Richland, WA (United States)] [Pacific Northwest National Lab., Richland, WA (United States)



Critical Assessment of Nucleic Acid Electrostatics via Experimental and Computational Investigation of an Unfolded  

E-Print Network [OSTI]

of an Unfolded State Ensemble Yu Bai,,,§ Vincent B. Chu,| Jan Lipfert,,# Vijay S. Pande,§,3 Daniel Herschlag solutions allows analysis of the change in the conformational ensemble of this simple motif as salt For many of these ncRNAs, folding from a disordered unfolded state is a critical first step

Herschlag, Dan


Nucleic acid encoding a self-assembling split-fluorescent protein system  

DOE Patents [OSTI]

The invention provides a protein labeling and detection system based on self-complementing fragments of fluorescent and chromophoric proteins. The system of the invention is exemplified with various combinations of self-complementing fragments derived from Aequorea victoria Green Fluorescent Protein (GFP), which are used to detect and quantify protein solubility in multiple assay formats, both in vitro and in vivo.

Waldo, Geoffrey S. (Santa Fe, NM); Cabantous, Stephanie (Los Alamos, NM)



Disposable and removable nucleic acid extraction and purification cartridges for automated flow-through systems  

DOE Patents [OSTI]

Removable cartridges are used on automated flow-through systems for the purpose of extracting and purifying genetic material from complex matrices. Different types of cartridges are paired with specific automated protocols to concentrate, extract, and purifying pathogenic or human genetic material. Their flow-through nature allows large quantities sample to be processed. Matrices may be filtered using size exclusion and/or affinity filters to concentrate the pathogen of interest. Lysed material is ultimately passed through a filter to remove the insoluble material before the soluble genetic material is delivered past a silica-like membrane that binds the genetic material, where it is washed, dried, and eluted. Cartridges are inserted into the housing areas of flow-through automated instruments, which are equipped with sensors to ensure proper placement and usage of the cartridges. Properly inserted cartridges create fluid- and air-tight seals with the flow lines of an automated instrument.

Regan, John Frederick


Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network [OSTI]

of manufacturing development for superior reliability, scalability, and low-cost. The electrical details cable for communication and power. (b) Disposable Cartridge. The disposable cartridge consists of an electrically connected integrated circuit chip inside a polypropylene well. (c) Chip Surface after Immunoassay

Weinreb, Sander


Single-molecule characterization and engineering of the surfaces of nucleic acid sensors  

E-Print Network [OSTI]

Diamond Nanopure water purification system was used.laboratory water purification system (18.2 M?cm). In a

Josephs, Eric Alan



3660-3662 Nucleic Acids Research, 1994, Vol. 22, No. 17 The Ribonuclease P database  

E-Print Network [OSTI]

.Brown*, Elizabeth S.Haas, Donald G.Gilbert' and Norman R.Pace1 Department of Microbiology, North Carolina State

Brown, James W.


Compound Formation of Crystal Violet with Nucleic Acid and Gelatin and its Significance in Dye Bacteriostasis  

Science Journals Connector (OSTI)

...July 25, 1929 In 1924, Steam and Steam outlined a chemical theory...bacteriostasis by dyes, based on the amphoteric behavior...free, containing, on ignition 0.08 per cent residue...medium constituents (Steam and Steam, 1928) or...

Allen E. Stearn



Branden & Tooze, Ch. 7 Deoxyribose nucleic acids are made of three parts  

E-Print Network [OSTI]

) repressor (KOX1) · HIV-1 encodes two regulatory proteins, Tat and Rev · Engineered ZFPs can bind the Rev;Pasqualini et al, Nat Med 8, 1353 (2002) Growing blood vessels #12;Inhibiting HIV-1 replication · Gene

Park, Sheldon


Improved Phosphoramidite Building Blocks for the Synthesis of the Simplified Nucleic Acid GNA  

E-Print Network [OSTI]

K. Schlegel and Eric Meggers* Fachbereich Chemie, Philipps-UniVersita¨t Marburg, Hans-Meerwein-Strasse, 35032 Marburg, Germany meggers@chemie.uni-marburg.de ReceiVed February 19, 2009 An improved synthesis

Meggers, Eric


Interaction of Nucleic Acids and Lipids from Tumour Cells with Anticancer Drugs: An Seira Spectroscopy Data  

Science Journals Connector (OSTI)

It is known that malignant tumour progression in the direction of the emergence of tumour drug resistance is one of the main factors resulting in the failure of cancer treatment. As tumour progression is based...

G. I. Dovbeshko; O. P. Repnytska



Relations between intraruminal protein and nucleic acid synthesis and forms of urinary nitrogen excreted by sheep  

E-Print Network [OSTI]

- uble nitrogen. This. , as a consequence, limited the interpretation of 75 percent ethanol insoluble nitrogen of rumen di. geste as repre- senting pure microbi. al nitrogen, The results of the chemical fractionation of the rumen digests obtained from... AND DISCUSSION V. SUNMARY AND CONCLUSIONS. LITERATURE CITED 12 43 7S APPENDIX 78 LIST OP TABLES Table Page 1. Ingredient Composition of Semipurified Ration 2. Distribution of Nitrogen in Rumen Digests 13 44 3. Adenine and Guanine Content of Rumen...

Razzaque, Md. Abdur



Effects of Phosphate Bond Energy on Nucleic Acid Stability in Tumor Homogenates  

Science Journals Connector (OSTI)

...A combination of detailed energy balance phenotyping and measures...AL+EX groups separately). Energy balance phenotyping Mice in...refs. 30, 31) using dual-energy X-ray absorptiometry (GE...mammary glands, including a mix of epithelial cells, adipocytes...

G. A. LePage



Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus  

SciTech Connect (OSTI)

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Yeo, Hyun Koo; Lee, Jae Young (Dongguk)



Inhibition of Host Cell Ribosomal Ribonucleic Acid Methylation by Foot-and-Mouth Disease Virus  

Science Journals Connector (OSTI)

...chromatography, which has a high resolving power for the nucleic acids (based on secondary...and J. Polatnick. 1968. The site of foot-and-mouth disease virus ribonucleic...and G. Vande Woude. 1966. Studies on foot-and-mouth disease virus ribonucleic...

Richard Ascione; George F. Vande Woude



Use of plant fatty acyl hydroxylases to produce hydroxylated fatty acids and derivatives in plants  

DOE Patents [OSTI]

The present invention relates to the identification of nucleic acid sequences and constructs, and methods related thereto, and the use of these sequences and constructs to produce genetically modified plants for the purpose of altering the composition of plant oils, waxes and related compounds. 35 figs.

Somerville, C.; Loo, F. van de



Effect of Nikethamide (Coramine) on Incorporation of Radioactive Phosphate into Rat Liver Deoxypentosenucleic Acid  

Science Journals Connector (OSTI)

...cornstarch, 15 per cent cottonseed oil, and 5 per cent Hawk-Oser...extract2 and 1 drop of Percomorph Oil on alternate days. For the...nucleic acids was accomplished by heating in 0.1 N NaOH at 80 C. for...15:240-^5, 1955. 15. PRICE, J. M., and LAIRD,A...

Willis R. Foster and Fred G. Brazda



Origin of the Difference in Structural Behavior of Poly(acrylic acid) and Poly(methacrylic acid) in Aqueous Solution Discerned by Explicit-Solvent Explicit-Ion MD Simulations  

Science Journals Connector (OSTI)

Origin of the Difference in Structural Behavior of Poly(acrylic acid) and Poly(methacrylic acid) in Aqueous Solution Discerned by Explicit-Solvent Explicit-Ion MD Simulations ... Polyelectrolytes such as sodium polyacrylate (Na-PAA) are widely used as adhesives, dispersants, wetting agents, and additives in coatings. ... Levitt, M.; Hirshberg, M.; Sharon, R.; Daggett, V.Potential energy function and parameters for simulations of the molecular dynamics of proteins and nucleic acids in solution Comput. ...

Muralidharan S. Sulatha; Upendra Natarajan



October 2001 NDB Newsletter  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

THE NUCLEIC ACID DATABASE NEWSLETTER THE NUCLEIC ACID DATABASE NEWSLETTER October 2001, Volume 5, Number 1 1. A Standard Reference Frame for the Description of Nucleic Acid Base-Pair Geometry Published 2. NDB Chapter in International Tables Published 1. Standard Reference Frame Published The paper "A Standard Reference Frame for the Description of Nucleic Acid Base-Pair Geometry" has been published in the Journal of Molecular Biology (2001; 313, pp. 229 - 237). This document is available from the NDB at http://ndbserver.rutgers.edu/NDB_news/ and from the Journal of Molecular Biology. The standardization of these parameters was the subject of the Tsukuba Workshop on Nucleic Acid Structure and Interactions that was organized by the NDB and the Structural Biology Centre and held at the Structural Biology Centre in Tsukuba, Japan on January 12-14, 1999. The meeting was funded by the COE program of the Science and Technology Agency, Japan and the CREST program of the Japan Science and Technology Corporation. The meeting was organized by Masashi Suzuki of the National Institute of Bioscience and Human-Technology and Helen M. Berman and Wilma K. Olson of the Nucleic Acid Database Project (supported by National Science Foundation (USA).


NDB Site Map  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Site map NDB Home Search Structures Search DNA Search RNA Advanced Search Nucleic acid tools RNA 3D motif atlas Non-redundant lists RNA base triples atlas WebFR3D R3D Align Contact NDB Mailing Address About NDB NDB Members Goal References Publications Site map Tools Software Standards Standard Reference Supplementary Information Ideal Geometries X-PLOR Parameters Valence Geometries RNA Ontology Consortium mmCIF Resources PDBML Resources Education Introduction to Nucleic Acids: DNA Definition of terms RNA Base Pair Families RNA Base-Phosphate Families Base Stacking Interactions Non Redundant list Equivalence classes RNA 3D Motifs Relative Frequency Introduction to Nucleic Acids: RNA Nucleic Acid Highlight (PDB): DNA DNA Polymerase Nucleosome Transfer RNA RNA Polymerase Self-splicing RNA


1998 Oxford University Press 7379Nucleic Acids Research, 1998, Vol. 26, No. 1 SGD: Saccharomyces Genome Database  

E-Print Network [OSTI]

, Erich T. Hester, Yankai Jia, Gail Juvik, TaiYun Roe, Mark Schroeder, Shuai Weng and David Botstein

Botstein, David


Evaluating the Flow-Cytometric Nucleic Acid Double-Staining Protocol in Realistic Situations of Planktonic Bacterial Death  

Science Journals Connector (OSTI)

...latter methodology has an advantage in that it uses a stain...protocols is based on energy transfer from an excited...is amplified by the energy transfer (FRET) from...This could be a disadvantage in working with commercial...lake water exposed to solar radiation. Aquat...

Tania Falcioni; Stefano Papa; Josep M. Gasol



Severe Acute Respiratory Syndrome Coronavirus Replication Inhibitor That Interferes with the Nucleic Acid Unwinding of the Viral Helicase  

Science Journals Connector (OSTI)

...public health threat, the likelihood of future occurrences of both SARS-CoV and related...520 nm) was measured immediately with a Quanta Master QM-1 T-format fluorescence...DMSO control. DISCUSSION Helicases are motor proteins that unwind double-stranded...

Adeyemi O. Adedeji; Kamalendra Singh; Nicholas E. Calcaterra; Marta L. DeDiego; Luis Enjuanes; Susan Weiss; Stefan G. Sarafianos



Antitumor Activity and Nucleic Acid Binding Properties of Dercitin, a New Acridine Alkaloid Isolated from a Marine Dercitus Species Sponge  

Science Journals Connector (OSTI)

...prior to treatment into male...with 5 ml water, and rinsed...equilibrium dialysis, and electrophoretic techniques...buffer. The dialysis cells were...dercitin to the dialysis membrane...39). DNA Electrophoresis. The ability...cyanole in water were added...

Neal S. Burres; Sharareh Sazesh; Geewananda P. Gunawardana; and Jacob J. Clement


Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Effects of 2-Acetylaminofluorene on Diurnal Oscillations in Nucleic Acid Metabolism in Two Classes of Nuclei Isolated from Rat Liver  

Science Journals Connector (OSTI)

...of Anatomy, Tulane Medical School, New Orleans...controlled feeding-lighting schedule, and the incorporation...controlled feeding-lighting schedule, and the incorporation...of Anatomy, Tulane Medical School, New Orleans...8 + 16" feeding-lighting schedule ("Materials...

Donald E. Bushnell and James R. Jeter, Jr.



Thermodynamics and Enzymatic Polymerization of Artificial Metallo-Nucleic Acids AND Investigation of Duplex Formation between GAN and RNA  

E-Print Network [OSTI]

C rt (92%). (c) DMTrCl, pyridine, rt (69%). (d) (iPr) 2 NP(Cl)OEtCN, (iPr) 2 NEt, CH 2 Cl 2 , rt (71%). Scheme 1. 7N,N-diisopropylehylamine ((iPr) 2 NEt) and 2-cyanoehtyl-N,N-

Kim, Eun Kyong



Nucleic Acids Research, 1993, Vol. 21, No. 9 2247-2248 The nucleosome repeat length of Kluyveromyces lactis is  

E-Print Network [OSTI]

Sorbitol, 20 mM Pipes, 0.1 mM CaCl2, pH = 6.3), and resuspended in the remaining liquid. The suspensions were each added to 25 ml of Ficoll-PMSF solution (9% Ficoll 4000, 20 mM Pipes, 0.5 mM CaCl2, pH = 6


Studies in 2-Acetylaminofluorene Carcinogenesis: I. The Intracellular Distribution of Nucleic Acids and Protein in Rat Liver  

Science Journals Connector (OSTI)

...Bone ash, 1.0 Linseed oil meal, 7.7 NaCl, 0...Alfalfa, 1.0 Cod-liver oil, 2.0 Casein, 8.0 Corn oil, 26.0 4We are deeply...with the aid of mild heating. Extensive tests conducted...according to the procedure of Price and Laird (9). Identical...

Robert J. Rutman; Abraham Cantarow; and Karl E. Paschkis



The Effect of Roentgen Radiation on the Incorporation of Radiophosphorus into Nucleic Acids and Other Constituents of Mouse Mammary Carcinoma  

Science Journals Connector (OSTI)

...total-body radiation administered by other workers. Furthermore, 4,500 r causes...Na,HPO4 on allocation from the Oak Ridge National Laboratory. Trial experiments...radiation ad ministered by other workers. Furthermore, 4,500 r causes...

Halvor Vermund; Cyrus P. Barnum; Robert A. Huseby; and Karl W. Stenstrom



Nucleic Acid Content and Nuclear Chromatin Structure of Human Bladder Cell Culture Lines as Studied by Flow Cytofluorometry  

Science Journals Connector (OSTI)

...characterizing tissue culture cell lines, as we have done home,and perhaps in distinguishing benign and malignant epithelial...Sharpless, T., and Darzynkiewicz, z. Urinary Cytology Automation. Preliminary Studies with Acridine Orange Stain and Flow-Through...

Myron R. Melamed; Zbigniew Darzynkiewicz; Frank Traganos; and Thomas K. Sharpless



1997 Oxford University Press49945002 Nucleic Acids Research, 1997, Vol. 25, No. 24 Information analysis of Fis binding sites  

E-Print Network [OSTI]

analysis of Fis binding sites Paul N. Hengen1, Stacy L. Bartram1,2,+, Lisa E. Stewart1 and Thomas D 30, 1997 ABSTRACT Originally discovered in the bacteriophage Mu DNA inversion system gin, Fis (Factor for Fis to locate its binding sites, we collected a set of 60 experimentally defined wild-type Fis DNA

Schneider, Thomas D.


Nucleic Acids Research, Vol. 19, No. 18 4949-4953 Direct introduction and transient expression of capped and  

E-Print Network [OSTI]

with lithium acetate (9) or by converting them to spheroplasts by enzyme treatment (10- 13). Recently

Kirkegaard, Karla


Notes: Nucleic Acid Amplification of the opa Gene for Detection of Neisseria gonorrhoeae: Experience from a Diagnostic Laboratory  

Science Journals Connector (OSTI)

...the Abbott m2000 is performed using Abbott multi-Collect specimen collection kits (MML Diagnostics Packaging, Inc., Troutdale, OR) according to the manufacturer's instructions. The porA pseudogene testing was performed by the method described...

M. J. Maze; Sheryl Young; Julie Creighton; Trevor Anderson; Anja Werno



1996 Oxford University Press 713720Nucleic Acids Research, 1996, Vol. 24, No. 4 Atomic force microscopy of long and short  

E-Print Network [OSTI]

of DNA can be reliably imaged and identified and also what substrates and methods of sample preparation technique for observing DNA. The AFM can image conformations of DNA molecules (3­5), nucleosome Corporation; Wood Dale, IL) and cleaved with tape immediately before use. Silicon. Oxidized silicon substrates

Hansma, Helen


Isotopic Studies on Structure-function Relationships of Nucleic Acids and Enzymes. Three Year Progress Report, May 1972 -- October 1975  

DOE R&D Accomplishments [OSTI]

The most important accomplishments and major contributions are tabulated with citations to published work. The more important unpublished contributions deal with the early events in ATP formation by chloroplasts, energy linkage in reaction steps of oxidative phosphorylation, molecular integrity of parental DNA, bound pyrophosphate and {sup 18}O-exchanges by inorganic pyrophosphatase, and glutamine synthetase exchanges and mechanisms. These are being prepared for publication. (JSR)

Boyer, P. D.



Electronic structure and spectroscopy of nucleic acid bases: Ionization energies, ionization-induced structural changes, and photoelectron spectra  

E-Print Network [OSTI]

FIG. 12: 7 Di?erentiated PIE curves and the PES. Solid linesphotoionization e?ciency (PIE) curves (8.200.05, 8.950.05,photoionization e?ciency (PIE) curves of the monomers. Being

Bravaya, Ksenia B.



November 2003 NDB Newsletter  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

November 2003, Volume 7, Number 2 November 2003, Volume 7, Number 2 Paper Describing RNA Visualization Programs Published NDB at the ACS Middle Atlantic Regional Meeting 2003 NDB at RNA 2003 Review of B- and A-DNA Structures Published Paper Nucleic Acid Visualization Program Published Using XML to Generate the NDB Atlas Paper Describing RNA Visualization Programs Published Programs developed to aid in the classification and visualization of RNA are available from the NDB site at ndbserver.rutgers.edu/services/. These programs are used to generate images of secondary structure for RNA structures in the NDB Atlas. The BPView program is used to display the three dimensional coordinates of base pairs and base pair collections. RNAview identifies and classifies base pair types formed in structures by various combinations of the three edges, Watson-Crick, Hoogsteen, and Sugar edge.


Abstract LB-4: Preclinical development of spherical nucleic acids, a novel RNAi-based nanomedicinal platform, as anti-glioma therapeutics  

Science Journals Connector (OSTI)

...of DNA damage in a single platform Sandra R. Woodgate 1 Clare...System is a high-throughput platform to simultaneously treat and...the addition of different chemicals to respective wells. Once...of DNA damage in a single platform. [abstract]. In: Proceedings...

Alexander H. Stegh



Abstract P1-01-11: The health economics of one step nucleic acid amplification for intraoperative sentinel lymph node analysis in breast cancer  

Science Journals Connector (OSTI)

...decisions about the test. Implications: Health literacy may affect womens...doing so, we consider its implications for health communication about this...decisions about the test. Implications: Health literacy may affect women's...

PM King; F Simmons; DJ Philip; BM Iain; EE Rachel; and A Sheikh



Published online 26 November 2007 Nucleic Acids Research, 2008, Vol. 36, No. 2 451461 doi:10.1093/nar/gkm1067  

E-Print Network [OSTI]

September 7, 2007; Revised November 11, 2007; Accepted November 12, 2007 ABSTRACT The Chlorella virus RNA poxviruses, reoviruses, alphaviruses, baculoviruses, West Nile virus and Chlorella virus PBCV-1 encode

Perreault, Jean-Pierre


This is a pre-print of a manuscript that will appear in: Nucleic Acids Research, 2005, Vol 33, Oxford University Press.  

E-Print Network [OSTI]

Function Prediction Brett Poulin*, Duane Szafron, Russell Greiner, Roman Eisner and Paul Lu *poulin@cs.ualberta.ca BIOINFORMATICS I We use Markov chains as a pre-processing filter for HMM software (HMMER)[2], removing the most

Alberta, University of


26722687 Nucleic Acids Research, 2009, Vol. 37, No. 8 Published online 9 March 2009 doi:10.1093/nar/gkp132  

E-Print Network [OSTI]

tendency depending on the types of protein complexes, indi- cating that this feature is not good energy (21,22). A database of alanine mutations is now accessible through the Internet for sys- tematic

Lee, Doheon


Use of DNA and Peptide Nucleic Acid Molecular Beacons for Detection and Quantification of rRNA in Solution and in Whole Cells  

Science Journals Connector (OSTI)

...Agbisit, K. Rausch, M. Tumbleson, and L. Raskin. 2002. Using biological processes to recover sulfur from corn wet milling industry waste streams. In WEFTEC 2002: Proceedings of the 75th Annual Water Environment Federation Technical Exhibition...

Chuanwu Xi; Michal Balberg; Stephen A. Boppart; Lutgarde Raskin



Published online 27 February 2008 Nucleic Acids Research, 2008, Vol. 36, No. 6 e36 doi:10.1093/nar/gkn033  

E-Print Network [OSTI]

/gkn033 Enzymatic signal amplification of molecular beacons for sensitive DNA detection Jianwei Jeffery Li, Yizhuo Chu, Benjamin Yi-Hung Lee and Xiaoliang Sunney Xie* Department of Chemistry and Chemical Biology

Xie, Xiaoliang Sunney

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Mechanism of Polyplex- and Lipoplex-Mediated Delivery of Nucleic Acids: Real-Time Visualization of Transient Membrane Destabilization without Endosomal Lysis  

Science Journals Connector (OSTI)

Department of Cell Biology, University Medical Center Groningen, University of Groningen, A. Deusinglaan 1, 9713 AV Groningen, The Netherlands ...

Zia ur Rehman; Dick Hoekstra; Inge S. Zuhorn



Multiple Nucleic Acid Binding Sites and Intrinsic Disorder of Severe Acute Respiratory Syndrome Coronavirus Nucleocapsid Protein: Implications for Ribonucleocapsid Protein Packaging  

Science Journals Connector (OSTI)

...resonances in the disordered region of...the whole protein. The flexible...conformational ensemble and does...putative disordered regions of coronavirus N proteins are positively...binding with N protein self-association in the disordered regions...

Chung-Ke Chang; Yen-Lan Hsu; Yuan-Hsiang Chang; Fa-An Chao; Ming-Chya Wu; Yu-Shan Huang; Chin-Kun Hu; Tai-Huang Huang



Published online 30 January 2007 Nucleic Acids Research, 2007, Vol. 35, No. 4 10751084 doi:10.1093/nar/gkl1140  

E-Print Network [OSTI]

understood. To follow the effects of (GAA)nÁ(TTC)n repeats on gene expres- sion, we have chosen E. coli of the full-sized mRNAs at (UUC)n runs by the E. coli degradosome. INTRODUCTION Friedreich's ataxia (FRDA.1093/nar/gkl1140 Effects of Friedreich's ataxia (GAA)nÁ(TTC)n repeats on RNA synthesis and stability Maria

Mirkin, Sergei


1996 Oxford University Press 11791186Nucleic Acids Research, 1996, Vol. 24, No. 7 A helicase assay based on the displacement of  

E-Print Network [OSTI]

includes the E.coliUvrAB and UvrD,Saccharomyces cerevisiaeRad3 and Rad25, and human ERCC-2, -3 and -6.g. the E.coli RecBCD and RecQ proteins) are implicated in recombination by genetic criteria.In vitro, RecBCD enzyme helicase activity generates the ssDNA substrate to which the RecA protein of E.coli can bind

Kowalczykowski, Stephen C.


N-Benzoyloxy-N-methyl-4-aminoazobenzene: Its Carcinogenic Activity in the Rat and Its Reactions with Proteins and Nucleic Acids and Their Constituents in Vitro  

Science Journals Connector (OSTI)

...ether, and 50 mg of finely powdered lithium aluminum hydride were added. The...acetate were added dropwise to destroy excess lithium aluminum hydride and 1 ml of water...atmosphere. After extraction of the excess dye 3 times with equal volumes of...

Lionel A. Poirier; James A. Miller; Elizabeth C. Miller; and Kei Sato



Detection of Escherichia coli O157 by Peptide Nucleic Acid Fluorescence In Situ Hybridization (PNA-FISH) and Comparison to a Standard Culture Method  

Science Journals Connector (OSTI)

...O157 growth. Actually, the ISO recommended for O157 detection in food samples (ISO 16654:2001) includes a preenrichment...ml) PNA-FISH result (PP/TP a ) for: Ground beef Unpasteurized...0/0) (0/0) a PP/TP, number of samples that tested...

C. Almeida; J. M. Sousa; R. Rocha; L. Cerqueira; S. Fanning; N. F. Azevedo; M. J. Vieira



Direct Blood PCR in Combination with Nucleic Acid Lateral Flow Immunoassay for Detection of Plasmodium Species in Settings Where Malaria Is Endemic  

Science Journals Connector (OSTI)

...Medani Teaching Hospital in Sudan. These blood samples were analyzed...and the operation of the PCR thermal cycler. This may limit the...parasitemia. The availability of thermal cyclers that operate on solar-powered...Wad Medani Teaching Hospital (Sudan) for kindly providing blood...

P. F. Mens; H. M. de Bes; P. Sondo; N. Laochan; L. Keereecharoen; A. van Amerongen; J. Flint; J. R. S. Sak; S. Proux; H. Tinto; H. D. F. H. Schallig



Quantitative Nucleic Acid Sequence-Based Assay as a New Molecular Tool for Detection and Quantification of Leishmania Parasites in Skin Biopsy Samples  

Science Journals Connector (OSTI)

...divided into Old World (southern Europe, Africa, the Middle East, and west and central...J., C. Canavate, B. Gutierrez-Solar, M. Jimenez, F. Laguna, R. Lopez-Velez...organisms by a fluorescence resonance energy transfer-based real-time PCR assay...

Wendy F. van der Meide; Gerard J. Schoone; William R. Faber; Jim E. Zeegelaar; Henry J. C. de Vries; Yusuf zbel; Rudy F. M. Lai A Fat; Lela I. A. R. C. Coelho; Masoom Kassi; Henk D. F. H. Schallig



Preprint copy of chapter from Functional Nucleic Acids for Sensing and Other Ana-lytical Applications, Y. Lu and Y. Li, eds.; Springer: New York, 2007.  

E-Print Network [OSTI]

interferon-induced protein kinase R (PKR) activity (O'Malley et al. 1986), and HIV encodes functionally relevant small RNA oligomers such as the TAR (trans-activation response) RNA that binds to the viral Tat occurring TAR aptamer was reported to inhibit HIV replication in vivo (Sullenger et al. 1990). The first

Silverman, Scott K.


930938 Nucleic Acids Research, 2007, Vol. 35, No. 3 Published online 23 January 2007 doi:10.1093/nar/gkl1145  

E-Print Network [OSTI]

.1093/nar/gkl1145 GEK1, a gene product of Arabidopsis thaliana involved in ethanol tolerance, is a D thaliana gene product, was recently identified through its involvement in ethanol tolerance. LaterRNATyr deacylase. Possible connections between exposure of plants to ethanol/acetaldehyde and misaminoacylation

Boyer, Edmond


Formation and Genotoxicity of Novel Oxidatively Generated Tandem DNA Lesions and N2-(1-carboxyethyl)-2'-deoxyguanosine  

E-Print Network [OSTI]

Nucleic Acids Res. 33, 1593-1603. von Sonntag, C. (1987) TheNucleic Acids Res. 33, 1593-1603. Liu, Z. J. , Gao, Y. , andNucleic Acids Res. 33, 1593-1603. Wang, Y. (2008) Bulky DNA

Jiang, Yong



PDT012 output  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

3DNA: Analysis & Rebuilding of 3-Dimensional Nucleic Acid Structures 3DNA: Analysis & Rebuilding of 3-Dimensional Nucleic Acid Structures by Xiang-Jun Lu @ Wilma K. Olson's Laboratory at Rutgers (olson@rutchem.rutgers.edu) **************************************************************************** 1. The list of the parameters given below are along the 5' to 3' direction of strand I and 3' to 5' direction of strand II 2. All angular parameters, except for the phase angle of sugar pseudo- rotation, are measured in degrees in the range of [-180, +180], and all displacements are measured in Angstrom **************************************************************************** File name: pdt012.pdb Date and time: Mon Mar 6 08:36:53 2000 Number of base-pairs: 12 Number of atoms: 486 ****************************************************************************


Fatty acid analogs  

DOE Patents [OSTI]

In one aspect, a radioactively labeled analog of a fatty acid which is capable of being taken up by mammalian tissue and which exhibits an in vivo beta-oxidation rate below that with a corresponding radioactively labeled fatty acid.

Elmaleh, David R. (Newton Center, MA); Livni, Eli (Brookline, MA)




E-Print Network [OSTI]

12.1 STANDARD OPERATING PROCEDURE for ACIDS CONTAINING PHOSPHOROUS Location(s): ___________________________________________________ Chemical(s): Hypophosphorous acid, methylphosphonic acid, phosphonic acid, phosphoric acid, phosphorous

Pawlowski, Wojtek


Microorganisms for producing organic acids  

DOE Patents [OSTI]

Organic acid-producing microorganisms and methods of using same. The organic acid-producing microorganisms comprise modifications that reduce or ablate AcsA activity or AcsA homolog activity. The modifications increase tolerance of the microorganisms to such organic acids as 3-hydroxypropionic acid, acrylic acid, propionic acid, lactic acid, and others. Further modifications to the microorganisms increase production of such organic acids as 3-hydroxypropionic acid, lactate, and others. Methods of producing such organic acids as 3-hydroxypropionic acid, lactate, and others with the modified microorganisms are provided. Methods of using acsA or homologs thereof as counter-selectable markers are also provided.

Pfleger, Brian Frederick; Begemann, Matthew Brett



Separation Nanotechnology of Diethylenetriaminepentaacetic Acid...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Nanotechnology of Diethylenetriaminepentaacetic Acid Bonded Magnetic Nanoparticles for Spent Nuclear Fuel. Separation Nanotechnology of Diethylenetriaminepentaacetic Acid Bonded...


Reversible Acid Gas Capture  

SciTech Connect (OSTI)

Pacific Northwest National Laboratory scientist David Heldebrant demonstrates how a new process called reversible acid gas capture works to pull carbon dioxide out of power plant emissions.

Dave Heldebrant



Reversible Acid Gas Capture  

ScienceCinema (OSTI)

Pacific Northwest National Laboratory scientist David Heldebrant demonstrates how a new process called reversible acid gas capture works to pull carbon dioxide out of power plant emissions.

Dave Heldebrant



Controlling acid rain  

E-Print Network [OSTI]

High concentrations of sulfuric and nitric acid in raTn fn the northeastern USA are caused by the large scale combustion of fossil fuels within this region. Average precipitation acidity is pH 4.2, but spatial and temporal ...

Fay, James A.



Harvard Committee on Microbiological Safety January, 2013  

E-Print Network [OSTI]

recombinant nucleic acid molecules, or Synthetic nucleic acid molecules, or DNA or RNA derived from synthetic) Frequently Asked Questions Regarding Synthetic Nucleic Acid Research FAQ 1: What has changed with respect to the scope of the NIH Guidelines for Research Involving Recombinant or Synthetic Nucleic Acid Molecules (NIH

Goodrich, Lisa V.

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Chlorophyll and acid rain  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Chlorophyll and acid rain Chlorophyll and acid rain Name: beachbum Status: N/A Age: N/A Location: N/A Country: N/A Date: Around 1993 Question: A while ago I read an article that stated that after a plant received acid rain, there seemed to be less of chlorophyll a and b in the plant. I was wondering where does the chlorophyll go and what is the actual process (cell structure affected?). Replies: I think that less chlorophyll being present would be more likely a result of less being produced. Plant cell constantly turn over cell material, it will also constantly produce more. So if one compares a plant not exposed to acid rain (presumably producing a normal amount of chlorophyll and the exposed plant then one sees that the exposed plant has less chlorophyll than the unexposed plant. I do not think I can answer the rest of your question.


Reactivity of Acid Generators  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Reactivity of Acid Generators for Chemically Amplified Resists with Reactivity of Acid Generators for Chemically Amplified Resists with Low-Energy Electrons Atsuro Nakano, Takahiro Kozawa, Seiichi Tagawa, Tomasz Szreder, James F. Wishart, Toshiyuki Kai and Tsutomu Shimokawa Jpn. J. Appl. Phys., 45, L197-L200 (2006). [Find paper at the Japanese Journal of Applied Physics] Abstract: In chemically amplified resists for ionizing radiations such as electron beams and extreme ultraviolet (EUV), low-energy electrons play an important role in the pattern formation processes. The reactivity of acid generators with low-energy electrons was evaluated using solvated electrons in tetrahydrofuran, which were generated by a pulsed electron beam. The rate constants of acid generators with the solvated electrons ranged from 0.6 to 1.9 x 1011 M-1s-1


(Acid rain workshop)  

SciTech Connect (OSTI)

The traveler presented a paper entitled Susceptibility of Asian Ecosystems to Soil-Mediated Acid Rain Damage'' at the Second Workshop on Acid Rain in Asia. The workshop was organized by the Asian Institute of Technology (Bangkok, Thailand), Argonne National Laboratory (Argonne, Illinois), and Resource Management Associates (Madison, Wisconsin) and was sponsored by the US Department of Energy, the United Nations Environment Program, the United Nations Economic and Social Commission for Asia and the Pacific, and the World Bank. Papers presented on the first day discussed how the experience gained with acid rain in North America and Europe might be applied to the Asian situation. Papers describing energy use projections, sulfur emissions, and effects of acid rain in several Asian countries were presented on the second day. The remaining time was allotted to discussion, planning, and writing plans for a future research program.

Turner, R.S.



Fatty Acid Carcass Mapping  

E-Print Network [OSTI]

FATTY ACID CARCASS MAPPING A Thesis by STACEY NICOLE TURK Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE May 2008... Major Subject: Animal Science FATTY ACID CARCASS MAPPING A Thesis by STACEY NICOLE TURK Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE...

Turk, Stacey N.



The utilization of tricarboxylic acid cycle acids and the uptake of succinic acid by Neurospora crassa  

E-Print Network [OSTI]

THE UTILIZATION OF TRICARBOXYLIC ACID CYCLE ACIDS AND THE UPTAKE OF SUCCINIC ACID BY NEUROSPORA CRASSA A Thesis by PATTI LYNN GILLILAND Submitted to the Graduate College of Texas A&M University in partial fulfillment of the requirement... for the degree of MASTER OF SCIENCE August 1978 Ma) or Subject: Microbiology THE UTILIZATION OF TRICARBOXYLIC ACID CYCLE ACIDS AND THE UPTAKE OF SUCCINIC ACID BY NEUROSPORA CRASSA A Thesis by PATTI LYNN GILLILAND Approved as to style and content by...

Gilliland, Patti Lynn



Focus Sheet | Hydrofluoric Acid Health hazards of hydrofluoric acid  

E-Print Network [OSTI]

Focus Sheet | Hydrofluoric Acid Health hazards of hydrofluoric acid Hydrofluoric acid (HF characterized by weight loss, brittle bones, anemia, and general ill health. Safe use If possible, avoid working to exposures. #12;Focus Sheet | Hydrofluoric Acid Environmental Health and Safety Environmental Programs Office

Wilcock, William


Optical high acidity sensor  

DOE Patents [OSTI]

An apparatus and method for determining acid concentrations in solutions having acid concentrations of from about 0.1 Molar to about 16 Molar is disclosed. The apparatus includes a chamber for interrogation of the sample solution, a fiber optic light source for passing light transversely through the chamber, a fiber optic collector for receiving the collimated light after transmission through the chamber, a coating of an acid resistant polymeric composition upon at least one fiber end or lens, the polymeric composition in contact with the sample solution within the chamber and having a detectable response to acid concentrations within the range of from about 0.1 Molar to about 16 Molar, a measurer for the response of the polymeric composition in contact with the sample solution, and, a comparer of the measured response to predetermined standards whereby the acid molarity of the sample solution within the chamber can be determined. Preferably, a first lens is attached to the end of the fiber optic light source, the first lens adapted to collimate light from the fiber optic light source, and a second lens is attached to the end of the fiber optic collector for focusing the collimated light after transmission through the chamber.

Jorgensen, Betty S. (Jemez Springs, NM); Nekimken, Howard L. (Los Alamos, NM); Carey, W. Patrick (Lynnwood, WA); O'Rourke, Patrick E. (Martinez, GA)



A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid  

SciTech Connect (OSTI)

An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

Arceo, Elena; Ellman, Jonathan; Bergman, Robert



Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters  

DOE Patents [OSTI]

A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

Moens, Luc (Lakewood, CO)



Nucleotide and deduced amino acid sequence of the nonstructural phosphoprotein, NS2, of bluetongue virus serotype 17: comparison to two isolates of serotype 10  

Science Journals Connector (OSTI)

The nucleotide sequence of bluetongue virus (BTV) serotype 17 segment 8 from North America (NA) coding for the nonstructural phosphoprotein, NS2, was determined. This segment contains 1125 base pairs and codes for a protein of 40,581 daltons containing 354 amino acids with a net charge of ?8.5 at pH 7.0. The carboxyl terminal portion of the protein is very hydrophilic and has a high degree of potential ?-helix. Serine is the major, if not the exclusive, phosphorylated amino acid residue and ten of the twenty serine residues present in NS2 are found in consensus phosphorylation sites. Comparison of the nucleotide sequence of BTV-17NA segment 8 with the sequence of BTV-10NA and BTV-10 South Africa (SA) revealed a greater degree of homology between different serotypes within the same geographical area i.e., 17NA and 10NA, than between isolates of the same serotype located in different areas i.e., 10NA and 10SA. The same homology relationship as above was found at the amino acid level.

Marvin J. Grubman; Marla Zellner; Siba Samal



Acidizing of Sandstone Reservoirs Using HF and Organic Acids  

E-Print Network [OSTI]

Mud acid, which is composed of HCl and HF, is commonly used to remove the formation damage in sandstone reservoirs. However, many problems are associated with HCl, especially at high temperatures. Formic-HF acids have served as an alternative...

Yang, Fei



Acid Placement in Acid Jetting Treatments in Long Horizontal Wells  

E-Print Network [OSTI]

In the Middle East, extended reach horizontal wells (on the order of 25,000 feet of horizontal displacement) are commonly acid stimulated by jetting acid out of drill pipe. The acid is jetted onto the face of the openhole wellbore as the drill pipe...

Sasongko, Hari



Acid placement and coverage in the acid jetting process  

E-Print Network [OSTI]

Many open-hole acid treatments are being conducted by pumping acid through jetting ports placed at the end of coiled tubing or drill pipe. The filter-cake on the bore-hole is broken by the jet; the acid-soluble material is dissolved, creating...

Mikhailov, Miroslav I.



Pantothenic acid biosynthesis in zymomonas  

DOE Patents [OSTI]

Zymomonas is unable to synthesize pantothenic acid and requires this essential vitamin in growth medium. Zymomonas strains transformed with an operon for expression of 2-dehydropantoate reductase and aspartate 1-decarboxylase were able to grow in medium lacking pantothenic acid. These strains may be used for ethanol production without pantothenic acid supplementation in seed culture and fermentation media.

Tao, Luan; Tomb, Jean-Francois; Viitanen, Paul V.



Carboxylic acid sorption regeneration process  

DOE Patents [OSTI]

Carboxylic acids are sorbed from aqueous feedstocks into an organic liquid phase or onto a solid adsorbent. The acids are freed from the sorbent phase by treating it with aqueous alkylamine thus forming an alkylammonium carboxylate which is dewatered and decomposed to the desired carboxylic acid and the alkylamine.

King, C. Judson (Kensington, CA); Poole, Loree J. (Baton Rouge, LA)



Carboxylic acid sorption regeneration process  

DOE Patents [OSTI]

Carboxylic acids are sorbed from aqueous feedstocks into an organic liquid phase or onto a solid adsorbent. The acids are freed from the sorbent phase by treating it with aqueous alkylamine thus forming an alkylammonium carboxylate which is dewatered and decomposed to the desired carboxylic acid and the alkylamine. 10 figs.

King, C.J.; Poole, L.J.



Acidic gas capture by diamines  

DOE Patents [OSTI]

Compositions and methods related to the removal of acidic gas. In particular, the present disclosure relates to a composition and method for the removal of acidic gas from a gas mixture using a solvent comprising a diamine (e.g., piperazine) and carbon dioxide. One example of a method may involve a method for removing acidic gas comprising contacting a gas mixture having an acidic gas with a solvent, wherein the solvent comprises piperazine in an amount of from about 4 to about 20 moles/kg of water, and carbon dioxide in an amount of from about 0.3 to about 0.9 moles per mole of piperazine.

Rochelle, Gary (Austin, TX); Hilliard, Marcus (Missouri City, TX)



Developing Mixed Films of Immobilized Oligonucleotides and Quantum Dots for the Multiplexed Detection of Nucleic Acid Hybridization Using a Combination of Fluorescence Resonance Energy Transfer and Direct Excitation of Fluorescence  

Science Journals Connector (OSTI)

The probes were selected on the basis of having practical application: seq. 1 is complementary to a portion of the E. coli hemolysin coding gene (hly A);(38) seq. 2 is complementary to a portion of the L. monocytogenes listeriolysin O coding gene (hly A);(39) seq. 3 is complementary to a portion of the S. enterica invasion protein A coding gene (inv A);(40) seq. 4 is complementary to a portion of the E. coli beta-glucuronidase enzyme coding gene (uid A);(41) and seq. 5 is complementary to a portion of the H. sapiens survival of motor neuron protein coding gene (SMN 1). ... We also explore toxicity issues surrounding these materials and speculate about the future uses of quantum dots in a clin. ...

W. Russ Algar; Ulrich J. Krull



The effect of pi-stacking, h-bonding, and electrostatic interactions on the ionization energies of nucleic acid bases: adenine-adenine, thymine-thymine and adenine-thymine dimers  

E-Print Network [OSTI]

and di?erentiated (C,D) PIE curves for monomers and dimerswhich produces photoionization e?ciency (PIE) spectra.typical step size for the PIE scans is 50 meV, and a dwell

Bravaya, Ksenia B.


Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Separation of americium and europium from solutions of nitric and perchloric acid using dipicolinic acid diamides  

Science Journals Connector (OSTI)

Extraction of nitric acid, perchloric acid, americium, and europium with dialkyldiarylamides of 2,6-pyridinecarboxylic (dipicolinic) acid in polar fluorinated solvents (diluents) was analysed. Among the extrac...

M.Yu. Alyapyshev; V. A. Babain; I. V. Smirnov



Separation of americium and europium from solutions of nitric and perchloric acid using dipicolinic acid diamides  

Science Journals Connector (OSTI)

Extraction of nitric acid, perchloric acid, americium, and europium with dialkyldiarylamides of 2,6-pyridinecarboxylic (dipicolinic) acid in polar fluorinated solvents (diluents) was analysed. Among the extrac...

M. Yu. Alyapyshev; V. A. Babain; I. V. Smirnov



TABASCO: A single molecule, base-pair resolved gene expression simulator  

E-Print Network [OSTI]

Background Experimental studies of gene expression have identified some of the individual molecular components and elementary reactions that comprise and control cellular behavior. Given our current understanding of gene ...

Kosuri, Sriram


Ethylene Production from Linolenic Acid  

Science Journals Connector (OSTI)

... and Mapson1 have shown that linolenic 1 J acid may serve as a precursor of ethylene. The possi -bility that the ... . The possi -bility that the ethylene that is evolved from plants arises from linolenic acid was investigated by determining the relationship ...




Photochemical Studies on Xanthurenic Acid  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Photochemical Studies on Xanthurenic Acid Photochemical Studies on Xanthurenic Acid J. E. Roberts, J. F. Wishart, L. Martinez, C. F. Chignell Photochem.Photobiol. 72, 467-471 (2000) Abstract: The tryptophan metabolite xanthurenic acid has been isolated from aged human cataractous lenses. The photophysical properties of xanthurenic acid were examined to determine if it is a potential chromophore for age-related cataractogenesis. We found that xanthurenic acid produces singlet oxygen (F*= 0.17; CD3OD) with the same efficiency as the lenticular chromophore N-formyl kynurenine and quenches singlet oxygen at a rate similar to other tryptophan metabolites (2.1 x 107 M-1 s-1; CD3OD) found in the eye. As the mechanisms of induction of cataracts may also involve redox reactions, the interactions of hydrated electrons (e-aq), the azide radical


Treatment of acid mine wastewaters  

SciTech Connect (OSTI)

Acid mine drainage often results from the oxidation sulfide minerals to form sulfuric acid. As a consequence, high concentrations of metals in the both the suspended and dissolved state result from the low pH water. This paper discusses several of the more common treatment methods for acid mine drainage including the use of chemical precipitation agents, pH correction agents, filtration methods, and biodegradation methods. Advanced treatment technologies are also briefly described and include microfiltration, reverse osmosis, ion exchange, and electrodialysis.

Hayward, D.; Barnard, R.



Naphthenic acid corrosion literature survey  

SciTech Connect (OSTI)

Naphthenic acid corrosion is a growing concern for refineries processing crudes containing high levels of naphthenic acid. Due to this concern initiatives in place to better understand the mechanism of corrosion for mitigating the corrosion. During the 1996 Fall Corrosion Group, organized existing literature relevant to the literature search. Committee Week, NACE International many refineries have and evaluate methods T-8 Refining Industry a task group, T-8-22, to perform a review and compilation of naphthenic acid corrosion. This paper provides a summary of the literature research.

Babaian-Kibala, E. [Nalco/Exxon Energy Chemicals, Sugar Land, TX (United States); Nugent, M.J. [Tosco Refining Co., Linden, NJ (United States)



Asphaltene damage in matrix acidizing  

E-Print Network [OSTI]

This work addresses the problem of asphaltene deposition that occurs during acid treatments of oil reservoirs. Asphaltenes are present to some degree in most hydrocarbons. Due to the molecular weight of the components these asphaltenes are more...

Hinojosa, Roberto Antonio



Factors controlling naphthenic acid corrosion  

SciTech Connect (OSTI)

A laboratory study was conducted to elucidate the influence of chemical and physical parameters on corrosion of type 1018 carbon steel (CS, UNS G10180) and 5% Cr-0.5% Mo steel in oils containing naphthenic acids (NAs) for application to crude oil refinery systems. Effects of test duration, temperature, and acid concentration were assessed for a range of single acids of varying carbon numbers and for NA mixtures in mineral oil (MO) and in heavy vacuum gas oil (HGVO). In addition, a limited study of the effect of hydrogen sulfide (H{sub 2}S) addition to the acid-oil mixture was conducted. Use of the total acid number (TAN) as a measure of corrosiveness of a crude oil was discredited further. For the same TAN value, molecular size and structure of the acid were shown to have an important influence. Tests conducted in HGVO showed lower corrosion rates than in MO, suggesting inhibition caused by S species in the oil or the steric hindrance of naphtheno-aromatic acids. In oil containing the mixture of NAs, the corrosion rate of type 1018 CS was lower than that for 5% Cr-0.5% Mo steel. The 0.1% H{sub 2}S that passed through the acid-oil mixtures had an inhibiting effect on corrosion. Predicting corrosiveness of a crude oil from the measurement of TAN, distribution of NA composition, and S content and form was particularly challenging. The simple tests used were informative, but further work will be required to establish a standard test method that can provide an adequate ranking of crudes.

Turnbull, A. [National Physical Lab., Teddington (United Kingdom); Slavcheva, E. [Bulgarian Academy of Sciences, Sofia (Bulgaria); Shone, B. [Ty Isa, Nr Mold (United Kingdom)



Genetic and Biochemical Analysis of the GTPase Associated Center of the Ribosome  

E-Print Network [OSTI]

T7 RNA polymerase and synthetic DNA templates. Nucleic Acids1987) from a synthetic template made from the following DNA

Maklan, Eric Joshua



DNA Hybridization Catalysts and Catalyst Circuits  

E-Print Network [OSTI]

blocks for a synthetic DNA-based circuit. While ri- bozymes are the best known example of nucleic acids

Winfree, Erik


Teaching biotechnology  

Science Journals Connector (OSTI)

Teaching biotechnology ... HyperCard stack of the commonly used nucleic acid and protein techniques of biotechnology. ... Biotechnology ...

Helen B. Brooks; David W. Brooks; Sheldon M. Schuster; Dwane E. Wylie



Cost Effective Natural Antioxidants  

Science Journals Connector (OSTI)

Reactive oxygen species can damage nucleic acids, proteins, lipids and carbohydrates that consequently affect the immune functions causing degenerative dis...

Dhan Prakash; Neeraj Kumar



Multiplex automated genome engineering  

DOE Patents [OSTI]

The present invention relates to automated methods of introducing multiple nucleic acid sequences into one or more target cells.

Church, George M; Wang, Harris H; Isaacs, Farren J



Red-shifted fluorescent proteins mPlum and mRaspberry and polynucleotides encoding the same  

DOE Patents [OSTI]

Methods using somatic hypermutation (SHM) for producing polypeptide and nucleic acid variants, and nucleic acids encoding such polypeptide variants are disclosed. Such variants may have desired properties. Also disclosed are novel polypeptides, such as improved fluorescent proteins, produced by the novel methods, and nucleic acids, vectors, and host cells comprising such vectors.

Tsien, Roger Y. (La Jolla, CA); Wang, Lei (San Diego, CA)



Methods for making nucleotide probes for sequencing and synthesis  

DOE Patents [OSTI]

Compositions and methods for making a plurality of probes for analyzing a plurality of nucleic acid samples are provided. Compositions and methods for analyzing a plurality of nucleic acid samples to obtain sequence information in each nucleic acid sample are also provided.

Church, George M; Zhang, Kun; Chou, Joseph



Specific amino acid substitutions in bacterioopsin: replacement of a restriction fragment in the structural gene by synthetic DNA fragments containing altered codons  

SciTech Connect (OSTI)

To study the mechanism of light-dependent proton translocation by bacteriorhodopsin, we have introduced single-codon changes in the gene so as to produce the following specific amino acid substitutions in the protein: Tyr-185 to Phe, Pro-186 to Leu, Trp-189 to Phe, Ser-193 to Ala, and Glu-194 to Gln. The strategy involved replacement of a 62-base-pair restriction fragment by synthetic DNA duplexes containing the modified nucleotide sequences. This required a unique restriction site (Xho I) at Ile-203 which was created by oligonucleotide-directed point mutagenesis. The six DNA duplexes corresponding to the modified native and mutant restriction fragments were all prepared by DNA ligase-catalyzed joining of chemically synthesized deoxyribooligonucleotides. The bacterioopsin expression plasmids reconstructed by using the synthetic DNA fragments were characterized by restriction analysis and DNA sequence determination. An extremely rapid, efficient, and general method for purification of the synthetic oligonucleotides and of DNA fragments was developed. 32 references, 6 figures.

Lo, K.M.; Jones, S.S.; Hackett, N.R.; Khorana, H.G.



Method for production of petroselinic acid and OMEGA12 hexadecanoic acid in transgenic plants  

DOE Patents [OSTI]

The present invention relates to a process for producing lipids containing the fatty acid, petroselinic acid, in plants. The production of petroselinic acid is accomplished by genetically transforming plants which do not normally accumulate petroselinic acid with a gene for a {omega}12 desaturase from another species which does normally accumulate petroselinic acid. 19 figs.

Ohlrogge, J.B.; Cahoon, E.B.; Shanklin, J.; Somerville, C.R.



Method for production of petroselinic acid and OMEGA12 hexadecanoic acid in transgenic plants  

DOE Patents [OSTI]

The present invention relates to a process for producing lipids containing the fatty acid petroselinic acid in plants. The production of petroselinic acid is accomplished by genetically transforming plants which do not normally accumulate petroselinic acid with a gene for a .omega.12 desaturase from another species which does normally accumulate petroselinic acid.

Ohlrogge, John B. (Okemos, MI); Cahoon, Edgar B. (Lansing, MI); Shanklin, John (Upton, NY); Somerville, Christopher R. (Okemos, MI)



Sandstone Acidizing Using Chelating Agents and their Interaction with Clays  

E-Print Network [OSTI]

Sandstone acidizing has been carried out with mud acid which combines hydrochloric acid and hydrofluoric acid at various ratios. The application of mud acid in sandstone formations has presented quite a large number of difficulties like corrosion...

George, Noble Thekkemelathethil 1987-


Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


New syntheses of aminoalkylphosphonic acids  

E-Print Network [OSTI]

NEW SYNTHESES OF AMINOALKYLPHOSPHON1C ACIDS A Thesis by John Frederick DeBardeleben, Jr. Su'bmitted to the Graduate School of the Agricultural and Mechanical College of Texas in partial fulfillment of the requirements for the degree of MASTER... OF SCIENCE August 196$ Major Subject: Chemistry NEW SYNTHESES OF AMINOALKYLPHOSPHONIC ACIDS A Thesis BY John Frederick DeBardeleben, Jr. Approved as to style and content hy: (Chairman of Committee) iJ C wc+'. A-c-~-' & (Head of Department...

DeBardeleben, John Frederick



Kinetic Study on the Acid-Catalyzed Hydrolysis of Cellulose to Levulinic Acid  

Science Journals Connector (OSTI)

A variety of interesting bulk chemicals is accessible by the acid-catalyzed hydrolysis of cellulose. An interesting example is levulinic acid, a versatile precursor for fuel additives, polymers, and resins. A detailed kinetic study on the acid-catalyzed ...

B. Girisuta; L. P. B. M. Janssen; H. J. Heeres



Acid Catalysis in Modern Organic  

E-Print Network [OSTI]

catalyst for organic synthesis". That is the starting sentence of this book by Yamamoto and Ishihara, which follows their earlier book "Lewis Acids in Organic Synthesis (2000)", and covers the new developments book that should be available in every well-equipped chemistry library. It will certainly be helpful

Snyder, Scott A.


E-Print Network 3.0 - acid linoleic acid Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

FAs (linolenic, linoleic) - - monounsaturated FAs (oleic acid) - olive, canola - hydrogenation... Biol 458 Lecture 6 & 7 Fatty Acids 1 A. Introduction to acyl lipids...


Nanoplasmonic molecular ruler for nuclease activity and DNA footprinting  

DOE Patents [OSTI]

This invention provides a nanoplasmonic molecular ruler, which can perform label-free and real-time monitoring of nucleic acid (e.g., DNA) length changes and perform nucleic acid footprinting. In various embodiments the ruler comprises a nucleic acid attached to a nanoparticle, such that changes in the nucleic acid length are detectable using surface plasmon resonance. The nanoplasmonic ruler provides a fast and convenient platform for mapping nucleic acid-protein interactions, for nuclease activity monitoring, and for other footprinting related methods.

Chen, Fanqing Frank; Liu, Gang L; Lee, Luke P



Recovery of mercury from acid waste residues  

DOE Patents [OSTI]

Mercury can be recovered from nitric acid-containing fluids by reacting the fluid with aluminum metal to produce mercury metal, and then quenching the reactivity of the nitric acid prior to nitration of the mercury metal.

Greenhalgh, Wilbur O. (Richland, WA)



Studies On Advanced Lead-Acid Batteries.  

E-Print Network [OSTI]

??Subsequent to the studies on precursor lead-acid systems by Daniel, Grove and Sindesten, practical lead-acid batteries began with the research and inventions of Raymond Gaston (more)

Martha, Surendra Kumar



Modeling of Acid Fracturing in Carbonate Reservoirs  

E-Print Network [OSTI]

The acid fracturing process is a thermal, hydraulic, mechanical, and geochemical (THMG)-coupled phenomena in which the behavior of these variables are interrelated. To model the flow behavior of an acid into a fracture, mass and momentum balance...

Al Jawad, Murtada s



Recovery of mercury from acid waste residues  

DOE Patents [OSTI]

Mercury can be recovered from nitric acid-containing fluids by reacting the fluid with aluminum metal to produce mercury metal, and thence quenching the reactivity of the nitric acid prior to nitration of the mercury metal. 1 fig.

Greenhalgh, W.O.



Synthesis of Biodiesel via Acid Catalysis  

Science Journals Connector (OSTI)

Synthesis of Biodiesel via Acid Catalysis ... Biodiesel is synthesized via the transesterification of lipid feedstocks with low molecular weight alcohols. ... Nonetheless, acid-catalyzed processes could produce biodiesel from low-cost feedstocks, lowering production costs. ...

Edgar Lotero; Yijun Liu; Dora E. Lopez; Kaewta Suwannakarn; David A. Bruce; James G. Goodwin, Jr.



Chemical Additive Selection in Matrix Acidizing  

E-Print Network [OSTI]

critical detail of weak acid chemistry. One concern when using any acid in oilfield operations is the corrosion of well tubulars. Thus operators often choose to pump corrosion inhibitor, a chemical additive electrostatically attracted... in oilfield operations, each of which protects well tubulars using the same mechanism: by impeding the acid?s ability to diffuse to the tubing surface. Because of the unique attraction of corrosion inhibitor to the metal surface, and the corrosion inhibitor...

Weidner, Jason 1981-



Reactions Between Water Soluble Organic Acids and Nitrates in...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Between Water Soluble Organic Acids and Nitrates in Atmospheric Aerosols: Recycling of Nitric Acid and Formation of Reactions Between Water Soluble Organic Acids and Nitrates in...


Sandia National Laboratories: Due Diligence on Lead Acid Battery...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Due Diligence on Lead Acid Battery Recycling March 23, 2011 Lead Acid Batteries on secondary containment pallet Lead Acid Batteries on secondary containment pallet In 2004, the US...


Hydrogen-Bond Acidic Polymers for Chemical Vapor Sensing. | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acidic Polymers for Chemical Vapor Sensing. Hydrogen-Bond Acidic Polymers for Chemical Vapor Sensing. Abstract: A review with 171 references. Hydrogen-bond acidic polymers for...


Unnatural reactive amino acid genetic code additions  

DOE Patents [OSTI]

This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, orthogonal pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

Deiters, Alexander; Cropp, T. Ashton; Chin, Jason W.; Anderson, J. Christopher; Schultz, Peter G.



Thermal Stability Of Formohydroxamic Acid  

SciTech Connect (OSTI)

The thermal stability of formohydroxamic acid (FHA) was evaluated to address the potential for exothermic decomposition during storage and its use in the uranium extraction process. Accelerating rate calorimetry showed rapid decomposition at a temperature above 65 {degree}?C; although, the rate of pressure rise was greater than two orders of magnitude less than the lower bound for materials which have no explosive properties with respect to transportation. FHA solutions in water and nitric acid did not reach runaway conditions until 150 {degree}?C. Analysis by differential scanning calorimetry showed that FHA melted at 67 {degree}?C and thermally decomposed at 90 {degree}?C with an enthalpy of -1924 J/g. The energics of the FHA thermal decomposition are comparable to those measured for aqueous solutions of hydroxylamine nitrate. Solid FHA should be stored in a location where the temperature does not exceed 20-25 {degree}?C. As a best practice, the solid material should be stored in a climate-controlled environment such as a refrigerator or freezer. FHA solutions in water are not susceptible to degradation by acid hydrolysis and are the preferred way to handle FHA prior to use.

Fondeur, F. F.; Rudisill, T. S.



Radioiodinated fatty acid analogs for myocardial imaging  

SciTech Connect (OSTI)

Fatty acids are the preferred substrate for the normoxic heart. About sixty percent of the energy required by the myocardium is provided by fatty acid [beta]-oxidation. Many scientists have focused on the alterations in fatty acid metabolism in the ischemic heart for the development of radiolabelled fatty acids for functional imaging of the heart. Three main categories of compounds were synthesized: tetrazoles (1 and 2), glycidic and [alpha]-methylene acids (3-5), and analogs of oleic acid (6,7 and 7A). The tetrazole group has a similar pKa and size to that of a carboxyl group; however, such fatty acid analogs cannot undergo normal fatty acid metabolism. Glycidic and [alpha]-methylene analogs are potential irreversible inhibitors of fatty acid metabolism. Oleic acid analogs were investigated to assess the affect of stereochemical consequences on biodistribution. The key intermediates in the synthesis of the target compounds were [omega]-nitrophenyl alkylcarboxylic acids and alcohols, which were made using a variety of cross-coupling reactions. The Wittig reaction, which was used in the synthesis of tetrazole 1 and glycidic acid 3, gave low yields of the cross-coupled products. The remaining target compounds were synthesized by condensation of appropriate RCu (CN) ZnI and substituted benzyl bromides or by Pd[sup II] catalyzed cross-coupling of substituted arylhalides with suitable alkynes. The latter two reactions produced much higher yields of the desired products. All of the target compounds were radiolabeled with [sup 125]I by various Cu(I) catalyzed radioiodine exchange procedures and were then subjected to tissue biodistribution (TD) studies in rats. Except for the 15-(4-iodophenyl)-2-methylene-pentadecanoic acid (5), all of the fatty acid analogs failed to surpass clinically-used 15-(4-iodophenyl)pentadecanoic acid (IPPA) in their ability to be taken up and retained by the rat myocardium.

Ruyan, M.K.



Acid Fracture and Fracture Conductivity Study of Field Rock Samples  

E-Print Network [OSTI]

Acid fracturing is a well stimulation strategy designed to increase the productivity of a producing well. The parameters of acid fracturing and the effects of acid interaction on specific rock samples can be studied experimentally. Acid injection...

Underwood, Jarrod



Micro-electro-mechanical systems phosphoric acid fuel cell  

DOE Patents [OSTI]

A phosphoric acid fuel cell system comprising a porous electrolyte support, a phosphoric acid electrolyte in the porous electrolyte support, a cathode electrode contacting the phosphoric acid electrolyte, and an anode electrode contacting the phosphoric acid electrolyte.

Sopchak, David A. (Livermore, CA); Morse, Jeffrey D. (Martinez, CA); Upadhye, Ravindra S. (Pleasanton, CA); Kotovsky, Jack (Oakland, CA); Graff, Robert T. (Modesto, CA)



Micro-electro-mechanical systems phosphoric acid fuel cell  

DOE Patents [OSTI]

A phosphoric acid fuel cell system comprising a porous electrolyte support, a phosphoric acid electrolyte in the porous electrolyte support, a cathode electrode contacting the phosphoric acid electrolyte, and an anode electrode contacting the phosphoric acid electrolyte.

Sopchak, David A. (Livermore, CA); Morse, Jeffrey D. (Martinez, CA); Upadhye, Ravindra S. (Pleasanton, CA); Kotovsky, Jack (Oakland, CA); Graff, Robert T. (Modesto, CA)


Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Common amino acid domain among endopolygalacturonases of ascomycete fungi.  

Science Journals Connector (OSTI)

...How- ever, amino acid compositions of homogeneous PGs appear...Mugnier (Rhone-Poulenc Agrochemical Co., France). C. lindemuthianum...Pharmacia). Amino acid composition. Amino acid analysis was...chromatography. amino acid compositions of the three purified materials...

J P Keon; G Waksman



Acid-catalytic decomposition of peracetic acid in the liquid phase  

SciTech Connect (OSTI)

This paper elucidates the kinetic relationships of peracetic acid (PAA) decomposition in the presence of mineral acids and their heterogeneous analogs, polystyrene-di-vinylbenzene cation-exchangers, differing in physicochemical and morphological parameters. It is shown that the thermal decomposition of PAA in acetic acid is an acid-catalyzed reaction. The controlling step of the reaction is protonation of the substrate with formation of an active intermediate form. Sulfonated cation-exchangers are twice as effective as sulfuric acid in this process. Polystyrene-divinylbenzene sulfonated cation-exchangers can be used with success as acid catalysts in oxidation processes involving PAA, because of their high effectiveness, stability, and availability.

Kharchuk, V.G.; Kolenko, I.P.; Petrov, L.A.



Testing of organic acids in engine coolants  

SciTech Connect (OSTI)

The effectiveness of 30 organic acids as inhibitors in engine coolants is reported. Tests include glassware corrosion of coupled and uncoupled metals. FORD galvanostatic and cyclic polarization electrochemistry for aluminum pitting, and reserve alkalinity (RA) measurements. Details of each test are discussed as well as some general conclusions. For example, benzoic acid inhibits coupled metals well but is ineffective on cast iron when uncoupled. In benzoic acid inhibits coupled metals well but is ineffective on cast iron when uncoupled. In general, the organic acids provide little RA when titrated to a pH of 5.5, titration to a pH of 4.5 can result in precipitation of the acid. Trends with respect to acid chain length are reported also.

Weir, T.W. [ARCO Chemical Co., Newtown Square, PA (United States)



Waste acid recycling via diffusion dialysis  

SciTech Connect (OSTI)

Inorganic acids are commonly used for surface cleaning and finishing of metals. The acids become unuseable due to contamination with metals or diluted and weakened. Diffusion dialysis has become a way to recover the useable acid and allow separation of the metals for recovery and sale to refineries. This technique is made possible by the use of membranes that are strong enough to withstand low ph and have long service life.

Steffani, C.



Organic Phosphoric Acid of the Soil.  

E-Print Network [OSTI]

TEXAS AGRICULTURAL EXPERIMENT STATIONS BULLETIN NO. +6CT /36 CHEMICAL SECTION, FEBRUARY, 191 1 I TECHNICAL BULLETIN Organic Phosphoric Acid of the Soil BY G. S. FRAPS, Chemist POSTOFFICE College Station, Brazos County, 'Texas. ,\\ustin... . ................................................ introduction 5 .............................. hmmonia-Soluble Phosphoric Acid 5 ................ Solubility of Phosphates in Ammonia 6 I Fixation of Phosphoric Acid from Ammonia .......... 7 Effect of Ratio of Soil to Solvent in Extraction of Phos- I I...

Fraps, G. S. (George Stronach)



Carboxylic acid accelerated formation of diesters  

DOE Patents [OSTI]

This invention pertains to accelerating the rate of formation of 1,1-dicarboxylic esters from the reaction of an aldehyde with a carboxylic acid anhydride or a ketene in the presence of a non-iodide containing a strong Bronsted acid catalyst by the addition of a carboxylic acid at about one bar pressure and between about 0 and 80 C in the substantial absence of a hydrogenation or carbonylation catalyst.

Tustin, G.C.; Dickson, T.J.



Acid Doped Membranes for High Temperature PEMFC  

Broader source: Energy.gov [DOE]

Presentation on Acid Doped Membranes for High Temperature PEMFC to the High Temperature Membrane Working Group, May 25, 2004 in Philadelphia, PA.


Biomedical Application of Hyaluronic Acid Nanoparticles  

E-Print Network [OSTI]

Hyaluronic acid (HA) is a naturally occurring biodegradable polymer with a variety of applications in medicine including tissue engineering, dermatological fillers, and viscosupplementation for osteoarthritis treatment. ...

Fakhari, Amir



E-Print Network 3.0 - acid eicosapentaenoic acid Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sample search results for: acid eicosapentaenoic acid Page: << < 1 2 3 4 5 > >> 1 Fish or Fish Oil in the Diet and Heart Attacks MAURICE E. STANSBY Summary: . Further...


E-Print Network 3.0 - acids eicosapentaenoic acid Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sample search results for: acids eicosapentaenoic acid Page: << < 1 2 3 4 5 > >> 1 Fish or Fish Oil in the Diet and Heart Attacks MAURICE E. STANSBY Summary: . Further...


Organic acid-tolerant microorganisms and uses thereof for producing organic acids  

DOE Patents [OSTI]

Organic acid-tolerant microorganisms and methods of using same. The organic acid-tolerant microorganisms comprise modifications that reduce or ablate AcsA activity or AcsA homolog activity. The modifications increase tolerance of the microorganisms to such organic acids as 3-hydroxypropionic acid (3HP), acrylic acid, and propionic acid. Further modifications to the microorganisms such as increasing expression of malonyl-CoA reductase and/or acetyl-CoA carboxylase provide or increase the ability of the microorganisms to produce 3HP. Methods of generating an organic acid with the modified microorganisms are provided. Methods of using acsA or homologs thereof as counter-selectable markers include replacing acsA or homologs thereof in cells with genes of interest and selecting for the cells comprising the genes of interest with amounts of organic acids effective to inhibit growth of cells harboring acsA or the homologs.

Pfleger, Brian Frederick; Begemann, Matthew Brett



Catalytic transformations of cellulose and its derived carbohydrates into 5-hydroxymethylfurfural, levulinic acid, and lactic acid  

Science Journals Connector (OSTI)

The catalytic transformation of cellulose into key building-block or platform chemicals such as 5-hydoxymethylfurfural (HMF), levulinic acid, and lactic acid under mild conditions, has attracted much attention...

Weiping Deng; Qinghong Zhang; Ye Wang



Yeast display evolution of a kinetically efficient 13-amino acid substrate for lipoic acid ligase  

E-Print Network [OSTI]

Escherichia coli lipoic acid ligase (LplA) catalyzes ATP-dependent covalent ligation of lipoic acid onto specific lysine side chains of three acceptor proteins involved in oxidative metabolism. Our lab has shown that LplA ...

Puthenveetil, Sujiet


2006 DOE Hydrogen Program Poly (p-phenylene Sulfonic Acid)s with...  

Broader source: Energy.gov (indexed) [DOE]

2006 DOE Hydrogen Program Poly (p-phenylene Sulfonic Acid)s with Frozen-in Free Volume for use in High Temperature Fuel Cells 2006 DOE Hydrogen Program Poly (p-phenylene Sulfonic...


The Arabidopsis hrl1 mutation reveals novel overlapping roles for salicylic acid, jasmonic acid and ethylene  

E-Print Network [OSTI]

and ethylene signalling in cell death and defence against pathogens Sendil K. Devadas1 , Alexander Enyedi2 molecules: salicylic acid (SA), jasmonic acid (JA) and ethylene (ET). The hrl1 (hypersensitive response

Raina, Ramesh


Effect of dietary cysteine, methionine, and sterculic acid on fatty acid distribution in rat adipose tissue  

E-Print Network [OSTI]


Brotze, Mary Frances



Further Investigation of Fluoboric Acid in Sandstone Acidizing Using ^(11)B and ^(19)F NMR  

E-Print Network [OSTI]

Although fluoboric acid (HBF_(4)) has long been known as one of the low-damaging acid treatments for clayey sandstone formations, little is known of its chemistry which could explain the mixed results of fluoboric acid in actual field application. A...

Pituckchon, Arpajit



Effect of defaunation and amino acid supplementation on growth and amino acid balance in growing sheep  

E-Print Network [OSTI]

, and the wool growth. The supplementation with protected amino acids may increase the growth rate and may lead and the addition of protected methionine and lysine on animal growth and amino acids digestibility in the body week for 9 weeks. Amino acids were determined in feed, blood, wool and feces in order to calculate

Paris-Sud XI, Université de


Nitrates and Prussic Acid in Forages  

E-Print Network [OSTI]

When nitrates and prussic acid accumulate in forage, the feed may not be safe for livestock consumption. Learn the symptoms of nitrate and prussic acid poisoning and which plants are most likely to pose a risk to livestock. Also learn sampling...

Provin, Tony; Pitt, John L.



Naphthenic acid corrosion by Venezuelan crudes  

SciTech Connect (OSTI)

Venezuelan crudes can contain levels of naphthenic acids that cause corrosion in distillation units designed for sweet crudes. This naphthenic acid corrosion can be mitigated in several ways, the most common of which is selective alloying. This paper will provide information from field experience on how various refineries worldwide have upgraded materials to run Venezuelan crudes in a cost effective way.

Hopkinson, B.E.; Penuela, L.E. [Lagoven, S.A., Judibana (Venezuela). Amuay Refinery


Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Naphthenic acid corrosion in crude distillation units  

SciTech Connect (OSTI)

This paper summarizes corrosion experience in crude distillation units processing highly naphthenic California crude oils. Correlations have been developed relating corrosion rates to temperature and total acid number. There is a threshold acid number in the range of 1.5 to 2 mg KOH/g below which corrosion is minimal. High concentrations of hydrogen sulfide may raise this threshold value.

Piehl, R.L.



Arginine and Conjugated Linoleic Acid Reduce Fat Mass in Rats  

E-Print Network [OSTI]

????????????????????.. 3 Nitric oxide (NO)????????????????????... 3 NOS synthesis by iNOS and obesity?????????????. 4 Stearoyl CoA desaturase?????????????????? 5 Conjugated linoleic acid?????????????????? 5 MATERIALS... on a liquid scintillation counter. 12 Fatty acid analysis Fatty acid composition in liver and plasma was determined using a fatty acid methylation procedure (FAME). Fatty acids were extracted using Folch et al (38) methods. Methylation...

Nall, Jennifer L.



A base pair between tRNA and 235 rRNA in the peptidyl transferase centre of the ribosome  

Science Journals Connector (OSTI)

... 235 rRNA in the peptidyl transferase centre of the ribosome Raymond R.SamahaR. R.RachelGreenR.Harry F.NollerH. F. Nature 377, 309-314(1995)

Raymond R. Samaha; Rachel Green; Harry F. Noller



NMR and molecular modeling evidence for a G.A mismatch base pair in a purine-rich DNA duplex  

Science Journals Connector (OSTI)

...group is critical. Nuclear Overhauser effect...ATGAGC)]. The energy-minimized duplex...group is critical. Nuclear Overhauser effect...ATGAGC)]. The energy-minimized duplex...recycle delay. 1D nuclear Overhauser effect...Still (24) and energy minimizations were...

Y Li; G Zon; W D Wilson



Combined Monte Carlo and quantum mechanics study of the hydration of the guanine-cytosine base pair  

Science Journals Connector (OSTI)

We present a computer simulation study of the hydration of the guanine-cytosine (GC) hydrogen-bonded complex. Using first principles density-functional theory, with gradient-corrected exchange-correlation and Monte Carlo simulation, we include thermal contribution, structural effects, solvent polarization, and the water-water and water-GC hydrogen bond interaction to show that the GC interaction in an aqueous environment is weakened to about 70% of the value obtained for an isolated complex. We also analyze in detail the preferred hydration sites of the GC pair and show that on the average it makes around five hydrogen bonds with water.

Kaline Coutinho; Valdemir Ludwig; Sylvio Canuto



Experimental Study of Acid Fracture Conductivity of Austin Chalk Formation  

E-Print Network [OSTI]

Acid fracture conductivity and the effect of key variables in the etching process during acid fracturing can be assessed at the laboratory scale. This is accomplished by using an experimental apparatus that simulates acid injection fluxes comparable...

Nino Penaloza, Andrea



Experimental High Velocity Acid Jetting in Limestone Carbonates  

E-Print Network [OSTI]

Acid jetting is a well stimulation technique that is used in carbonate reservoirs. It typically involves injecting acid down hole at high flow rates through small orifices which cause high velocities of acid to strike the borehole wall...

Holland, Christopher



Investigations of amino acid-based surfactants at liquid interfaces  

E-Print Network [OSTI]

Herein are presented collective studies of amino acid-based surfactants, also known as lipoamino acids, at liquid interfaces. Chapter III describes an investigation of domain morphology of N-Stearoylglutamic acid (N-SGA) Langmuir monolayers...

Yang, Dengliang



Naphthenic acid corrosion in refinery settings  

SciTech Connect (OSTI)

Naphthenic acid corrosion has been a problem in the refining industry for many years. Recently interest in this problem has grown because crudes that contain naphthenic acid are being recovered from areas which were not known to produce this type of crude, such as china, India, and Africa. New techniques for identifying naphthenic acid corrosion and chemical treatments for preventing this attack are presented. Refinery case studies include stream analysis, failure analysis, and inhibitor use. Laboratory tests to show the effect of hydrogen sulfide and phosphorus-based inhibitors are discussed.

Babaian-Kibala, E. (Nalco Chemical Co., Sugar Land, TX (United States)); Craig, H.L. Jr. (Mobil Research and Development Corp., Paulsboro, NJ (United States)); Rusk, G.L. (Mobil Oil Co., Torrance, CA (United States)); Blanchard, K.V.; Rose, T.J.; Uehlein, B.L. (Nalco Chemical Co., Paulsboro, NJ (United States)); Quinter, R.C. (Sun Co., Newtown Square, PA (United States)); Summers, M.A. (Sun Co., Marcus Hook, PA (United States))



Experimental Investigation for the Effects of the Core Geometry on the Optimum Acid Flux in Carbonate Acidizing  

E-Print Network [OSTI]

Previous matrix acidizing experimental research showed that there exists an optimum acid interstitial velocity (Vi-opt) that results in the minimum volume of acid used while providing the best stimulation results. There are already several...

Jin, Xiao



Aerobic Heterotrophic Bacteria Indigenous to pH 2.8 Acid Mine Water: Microscopic Examination of Acid Streamers  

Science Journals Connector (OSTI)

...streamers" found in acid coal mine drainage consist of bacteria...than one species. Acidic coal mine drainage is characterized...of 11 states that comprise Appalachia and includes numerous other coal mining areas ofthe world. The acidic...

Patrick R. Dugan; Carol B. MacMillan; Robert M. Pfister



Studying Cellulose Fiber Structure by SEM, XRD, NMR and Acid...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Studying Cellulose Fiber Structure by SEM, XRD, NMR and Acid Hydrolysis. Abstract: Cotton linters were partially hydrolyzed in dilute acid and the morphology of remaining...


adenylic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

preservation A Rauramaa A Tommila J Ltd, Espoo Reseach Centre, PO Box 44, 02271 Espoo, Finland Formic acid is known to improve silage hygienic quality. Formic acid based...


acid rain program: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

preservation A Rauramaa A Tommila J Ltd, Espoo Reseach Centre, PO Box 44, 02271 Espoo, Finland Formic acid is known to improve silage hygienic quality. Formic acid based...


Formation of iron complexs from trifluoroacetic acid based liquid...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of iron complexs from trifluoroacetic acid based liquid chromatography mobile phases as interference ions in liquid Formation of iron complexs from trifluoroacetic acid based...


Copper isotope fractionation in acid mine drainage. | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Copper isotope fractionation in acid mine drainage. Copper isotope fractionation in acid mine drainage. Abstract: We surveyed the Cu isotopic composition of primary minerals and...


Hydrogen-bond acidic functionalized carbon nanotubes (CNTs) with...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Hydrogen-bond acidic functionalized carbon nanotubes (CNTs) with covalently-bound hexafluoroisopropanol groups. Hydrogen-bond acidic functionalized carbon nanotubes (CNTs) with...


AVTA: 2010 Honda Civic HEV with Experimental Ultra Lead Acid...  

Broader source: Energy.gov (indexed) [DOE]

2010 Honda Civic HEV with Experimental Ultra Lead Acid Battery Testing Results AVTA: 2010 Honda Civic HEV with Experimental Ultra Lead Acid Battery Testing Results The Vehicle...


Effects of Continuous Triiodothyronine Infusion on Citric Acid...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Continuous Triiodothyronine Infusion on Citric Acid Cycle in the Normal Immature Swine Heart under Extracorporeal Effects of Continuous Triiodothyronine Infusion on Citric Acid...


Acid Initiation of Ammonia-Borane Dehydrogenation for Hydrogen...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acid Initiation of Ammonia-Borane Dehydrogenation for Hydrogen Storage. Acid Initiation of Ammonia-Borane Dehydrogenation for Hydrogen Storage. Abstract: An abstract for this...

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Fraud in the acid rain debate  

SciTech Connect (OSTI)

Electric utility executives, according to the author, and millions of other Americans are the victims of a gigantic fraud being carried on in the name of controlling acid rain. This fraud, states the author, involves the distorted, dire image of acidity in nature being created by environmental groups, politicians and others - to gain public sympathy for their legislative goals. The alleged fraud involves the very nature of the legislation being promoted as a low-cost cure for acid rain. On the basis of scientific evidence to date there is no assurance it will reduce acidity by any appreciable amount, but on the other hand it most certainly will cost users of electricity hundreds of billions of dollars in new costs. What has already happened to the nuclear industry is also meant for coal.

Bagge, C.



Ascorbic Acid and Cancer: A Review  

Science Journals Connector (OSTI)

...groups, together with the formation of hydrogen bonds, offer a probable explanation...and Landeau, B. R. Ascorbic acid economy in surgical patients. Ann. N. Y...Culver, P. L. Horseradish peroxidase/ hydrogen peroxide-catalyzed oxidation of the...

Ewan Cameron; Linus Pauling; and Brian Leibovitz



Lactic acid fermentation of crude sorghum extract  

SciTech Connect (OSTI)

Crude extract from sweet sorghum supplemented with vetch juice was utilized as the carbohydrate source for fermentative production of lactic acid. Fermentation of media containing 7% (w/v) total sugar was completed in 60-80 hours by Lactobacillus plantarum, product yield averaging 85%. Maximum acid production rates were dependent on pH, initial substrate distribution, and concentration, the rates varying from 2 to 5 g/liter per hour. Under limited medium supplementation the lactic acid yield was lowered to 67%. The fermented ammoniated product contained over eight times as much equivalent crude protein (N x 6.25) as the original medium. Unstructured kinetic models were developed for cell growth, lactic acid formation, and substrate consumption in batch fermentation. With the provision of experimentally determined kinetic parameters, the proposed models accurately described the fermentation process. 15 references.

Samuel, W.A.; Lee, Y.Y.; Anthony, W.B.



A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid  

E-Print Network [OSTI]

R.G.B and J.A.E. ). Keywords: biomass carboxylic acids 10.1002/cssc.201000111 A Direct, Biomass-Based Synthesis ofaro- matic compounds from biomass resources could provide a



Heterogeneous Reactions of Epoxides in Acidic Media  

E-Print Network [OSTI]

on sulfuric acid using Ion drift-Chemical Ionization Mass Spectrometry (ID-CIMS) showed an irreversible uptake of epoxides at room temperature resulting in the formation of less volatile products like diols, organosulfates and acetals. However, at lower...

Lal, Vinita



Ascorbic Acid and Cancer: A Review  

Science Journals Connector (OSTI)

...skinned individuals resident in areas of high solar intensity, such as the southern United States, South Africa, and Australia. Experimentally, the...Effects of Ascorbic Acid Ascorbate and Energy Production. Cytochromes P-450 and b5are...

Ewan Cameron; Linus Pauling; and Brian Leibovitz




E-Print Network [OSTI]

PREDICTING TEMPERATURE BEHAVIOR IN CARBONATE ACIDIZING TREATMENTS A Thesis by XUEHAO TAN Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree... of MASTER OF SCIENCE May 2009 Major Subject: Petroleum Engineering PREDICTING TEMPERATURE BEHAVIOR IN CARBONATE ACIDIZING TREATMENTS A Thesis by XUEHAO TAN Submitted to the Office of Graduate Studies of Texas A&M University...

Tan, Xuehao



Primer on lead-acid storage batteries  

SciTech Connect (OSTI)

This handbook was developed to help DOE facility contractors prevent accidents caused during operation and maintenance of lead-acid storage batteries. Major types of lead-acid storage batteries are discussed as well as their operation, application, selection, maintenance, and disposal (storage, transportation, as well). Safety hazards and precautions are discussed in the section on battery maintenance. References to industry standards are included for selection, maintenance, and disposal.




Biologically produced acid precipitable polymeric lignin  

DOE Patents [OSTI]

A water soluble, acid precipitable polymeric degraded lignin (APPL), having a molecular weight of at least 12,000 daltons, and comprising, by percentage of total weight, at least three times the number of phenolic hydroxyl groups and carboxylic acid groups present in native lignin. The APPL may be modified by chemical oxidation and reduction to increase its phenolic hydroxyl content and reduce the number of its antioxidant inhibitory side chains, thereby improving antioxidant properties.

Crawford, Don L. (Moscow, ID); Pometto, III, Anthony L. (Moscow, ID)



Catalytic oxidative conversion of cellulosic biomass to formic acid and acetic acid with exceptionally high yields  

Science Journals Connector (OSTI)

Abstract Direct conversion of raw biomass materials to fine chemicals is of great significance from both economic and ecological perspectives. In this paper, we report that a Keggin-type vanadium-substituted phosphomolybdic acid catalyst, namely H4PVMo11O40, is capable of converting various biomass-derived substrates to formic acid and acetic acid with high selectivity in a water medium and oxygen atmosphere. Under optimized reaction conditions, \\{H4PVMo11O40\\} gave an exceptionally high yield of formic acid (67.8%) from cellulose, far exceeding the values achieved in previous catalytic systems. Our study demonstrates that heteropoly acids are generally effective catalysts for biomass conversion due to their strong acidities, whereas the composition of metal addenda atoms in the catalysts has crucial influence on the reaction pathway and the product selectivity.

Jizhe Zhang; Miao Sun; Xin Liu; Yu Han



The inability of rats to synthesize linoleic acid from cis-2-octenoic acid  

E-Print Network [OSTI]

THE INABILITY OF RATS TO SYNTHESI2E LINOLEIC ACID FROM CIS-2-OCTENOIC ACID A Thesis Robert Eugene Anderson Submitted to the Graduate College of the Texas A g: M University in partia1 fulfillment of the requirerents for the degree of MASTER... OF SCIENCE January 1965 Major Subjeot: Bioohemistry THE INABILITY OF RATS TQ SYNTHESIEE LINOLEIC ACID FROM CIS-2E)CTENOIC ACID A Thesis Robert, Eugene Anderson Approved as to style and content by: Chair n of Committee)~ (Head of Depart~ant, Member...

Anderson, Robert Eugene



E-Print Network 3.0 - acid docosahexaenoic acid Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

SAGE-Hindawi Access to Research International Journal of Alzheimer's Disease Summary: APP secretion 19. 2.2. Fatty Acids on Membrane Physical Properties and APP Processing. Fatty...


E-Print Network 3.0 - acid-amino acid conjugates Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

amino acids is reported with the incorporation of one example into a ... Source: Beal, Peter A. - Department of Chemistry, University of Utah Collection: Chemistry 13 An...


Correlation between Fibroin Amino Acid Sequence and Physical Silk Properties*  

E-Print Network [OSTI]

moth (Ephe- stia kuehniella), and Indian meal moth (Plodia inter- punctella). The amino acid repeats

?urovec, Michal


Transcription factor-based biosensors for detecting dicarboxylic acids  

DOE Patents [OSTI]

The invention provides methods and compositions for detecting dicarboxylic acids using a transcription factor biosensor.

Dietrich, Jeffrey; Keasling, Jay



Purification Or Organic Acids Using Anion Exchange Chromatography.  

DOE Patents [OSTI]

Disclosed is a cost-effective method for purifying and acidifying carboxylic acids, including organic acids and amino acids. The method involves removing impurities by allowing the anionic form of the carboxylic acid to bind to an anion exchange column and washing the column. The carboxylic anion is displaced as carboxylic acid by washing the resin with a strong inorganic anion. This method is effective in removing organic carboxylic acids and amino acids from a variety of industrial sources, including fermentation broths, hydrolysates, and waste streams.

Ponnampalam; Elankovan (Okemos, MI)



Synergy of Lewis and Brnsted Acids on Catalytic Hydrothermal Decomposition of Hexose to Levulinic Acid  

Science Journals Connector (OSTI)

Levulinic acid (LA), an important platform chemical, is regarded as one of top 12 block chemicals. ... Phosphate standard concentrate (85%), glucose (99%), and levulinic acid (99%) were purchased from Aladdin Chemistry Co., Ltd. ... Fructose, chromium(III) chloride hexahydrate, and 5-HMF (purities of these chemicals ? 98%) were purchased from J&K Chemica, Ltd. ...

Fan Yang; Jie Fu; Jing Mo; Xiuyang Lu



Acid Diversion in Carbonate Reservoirs Using Polymer-Based In-Situ Gelled Acids  

E-Print Network [OSTI]

Diversion in carbonates is more difficult than in sandstones because of the ability of acid to significantly increase the permeability in carbonates as it reacts in the pore spaces and flow channels of matrix. In-situ gelled acids that are based...

Gomaa, Ahmed Mohamed Mohamed



Computer-aided visualization and analysis system for sequence evaluation  

DOE Patents [OSTI]

A computer system for analyzing nucleic acid sequences is provided. The computer system is used to perform multiple methods for determining unknown bases by analyzing the fluorescence intensities of hybridized nucleic acid probes. The results of individual experiments are improved by processing nucleic acid sequences together. Comparative analysis of multiple experiments is also provided by displaying reference sequences in one area and sample sequences in another area on a display device. 27 figs.

Chee, M.S.



Water and UV degradable lactic acid polymers  

DOE Patents [OSTI]

A water and UV light degradable copolymer of monomers of lactic acid and a modifying monomer were selected from the class consisting of ethylene and polyethylene glycols, propylene and polypropylene glycols, P-dioxanone, 1,5 dioxepan-2-one, 1,4 -oxathialan-2-one, 1,4-dioxide and mixtures. These copolymers are useful for waste disposal and agricultural purposes. Also disclosed is a water degradable blend of polylactic acid or modified polylactic acid and high molecular weight polyethylene oxide where the high molecular weight polyethylene oxide is present in the range of from about 2% by weight to about 50% by weight, suitable for films. A method of applying an active material selected from the class of seeds, seedlings, pesticides, herbicides, fertilizers and mixtures to an agricultural site is also disclosed.

Bonsignore, P.V.; Coleman, R.D.


Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Water and UV degradable lactic acid polymers  

DOE Patents [OSTI]

A water and UV light degradable copolymer of monomers of lactic acid and a modifying monomer selected from the class consisting of ethylene and polyethylene glycols, propylene and polypropylene glycols, P-dioxanone, 1,5 dioxepan-2-one, 1,4 -oxathialan-2-one, 1,4-dioxide and mixtures thereof. These copolymers are useful for waste disposal and agricultural purposes. Also disclosed is a water degradable blend of polylactic acid or modified polylactic acid and high molecular weight polyethylene oxide wherein the high molecular weight polyethylene oxide is present in the range of from about 2% by weight to about 50% by weight, suitable for films. A method of applying an active material selected from the class of seeds, seedlings, pesticides, herbicides, fertilizers and mixtures thereof to an agricultural site is also disclosed.

Bonsignore, Patrick V. (Joliet, IL); Coleman, Robert D. (Wheaton, IL)



Water and UV degradable lactic acid polymers  

DOE Patents [OSTI]

A water and UV light degradable copolymer is described made from monomers of lactic acid and a modifying monomer selected from the class consisting of ethylene glycol, propylene glycol, P-dioxanone, 1,5 dioxepan-2-one, 1,4-oxathialan-2-one, 1,4-dioxide and mixtures thereof. These copolymers are useful for waste disposal and agricultural purposes. Also disclosed is a water degradable blend of polylactic acid or modified polylactic acid and high molecular weight polyethylene oxide wherein the high molecular weight polyethylene oxide is present in the range of from about 2 by weight to about 50% by weight, suitable for films. A method of applying an active material selected from the class of seeds, seedlings, pesticides, herbicides, fertilizers and mixtures thereof to an agricultural site is also disclosed.

Bonsignore, P.V.; Coleman, R.D.



Water and UV degradable lactic acid polymers  

DOE Patents [OSTI]

A water and UV light degradable copolymer of monomers of lactic acid and a modifying monomer selected from the class consisting of ethylene glycol, propylene glycol, P-dioxanone, 1,5 dioxepan-2-one, 1,4-oxathialan-2-one, 1,4-dioxide and mixtures thereof. These copolymers are useful for waste disposal and agricultural purposes. Also disclosed is a water degradable blend of polylactic acid or modified polylactic acid and high molecular weight polyethylene oxide wherein the high molecular weight polyethylene oxide is present in the range of from about 2 by weight to about 50% by weight, suitable for films. A method of applying an active material selected from the class of seeds, seedlings, pesticides, herbicides, fertilizers and mixtures thereof to an agricultural site is also disclosed.

Bonsignore, Patrick V. (Joliet, IL); Coleman, Robert D. (Wheaton, IL)



Photoenhanced anaerobic digestion of organic acids  

DOE Patents [OSTI]

A process is described for rapid conversion of organic acids and alcohols anaerobic digesters into hydrogen and carbon dioxide, the optimal precursor substrates for production of methane. The process includes addition of photosynthetic bacteria to the digester and exposure of the bacteria to radiant energy (e.g., solar energy). The process also increases the pH stability of the digester to prevent failure of the digester. Preferred substrates for photosynthetic bacteria are the organic acid and alcohol waste products of fermentative bacteria. In mixed culture with methanogenic bacteria or in defined co-culture with non-aceticlastic methanogenic bacteria, photosynthetic bacteria are capable of facilitating the conversion or organic acids and alcohols into methane with low levels of light energy input.

Weaver, Paul F. (Golden, CO)



E-Print Network 3.0 - acid analysis including Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

predict the relative acid strength of a set... section. Findings Our analysis led to the identification of four distinct mental models of acid and acid... models of acid and acid...


Relative reactivities of solid benzoic acids  

E-Print Network [OSTI]

was always the acid salt, (RBZA) HK. For the reaction, RBZAH + Z R'BZAK, where R g R', the products were those predicted from Hammett o-constants for R and R'. Observations on the mode of reaction and free energy changes are given. The desirability... reaction series chosen was that. one most directly related to the Hammett substituent constants; namely, the reactions of various m- or p- monosubstituted benzoic acids with m- or p-monosubstituted potas- sium benzoate salts. CHAPTER Il RES ULTS...

Warwas, Edwin James



Acid mine water aeration and treatment system  

DOE Patents [OSTI]

An in-line system is provided for treating acid mine drainage which basically comprises the combination of a jet pump (or pumps) and a static mixer. The jet pump entrains air into the acid waste water using a Venturi effect so as to provide aeration of the waste water while further aeration is provided by the helical vanes of the static mixer. A neutralizing agent is injected into the suction chamber of the jet pump and the static mixer is formed by plural sections offset by 90 degrees.

Ackman, Terry E. (Finleyville, PA); Place, John M. (Bethel Park, PA)



Effect of Conjugated Linoleic Acid or Oleic Acid Addition on Fatty Acid Composition Profiles of Poultry Meat  

E-Print Network [OSTI]

on the omega-6 fatty acid accumulation in broiler chicken breast and thigh meat. Eight broilers from each treatment were processed at 4 and 6 weeks of age, respectively. Regarding the diets containing five different fat sources, broiler chickens fed CLA...

Shin, Dae Keun



E-Print Network 3.0 - advanced uracil-excision dna Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

MA... 31, 2005; Accepted September 18, 2005 ABSTRACT Peptide nucleic acid (PNA) is a synthetic DNA mimic Source: Boston University, Center for Advanced Biotechnology...


Affinity capture of specific DNA fragments with short synthetic sequences  

Science Journals Connector (OSTI)

The ability of short peptide nucleic acid (PNA) oligomers and oligonucleotides containing modified residues of 5-methylcitidine, 2-aminoadenosine, and 5-propynyl-2?-deoxyuridine (strong binding oligonucleotide...

V. S. Mikhailov; V. K. Potapov; R. N. Amirkhanov



E-Print Network 3.0 - ainulaadne dna anals Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

31, 2005; Accepted September 18, 2005 ABSTRACT Peptide nucleic acid (PNA) is a synthetic DNA mimic... is capable of sequence-specific targeting of complementary dsDNA...

332 Small angle X-ray and neutron scattering  

Science Journals Connector (OSTI)

This document is part of Subvolume C Spectroscopic and Kinetic Data. Physical Data I of Volume 1 Nucleic Acids of Landolt-Brnstein - Group VII Biophysics.

H. Eisenberg



Justin Flory | Center for Bio-Inspired Solar Fuel Production  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Justin Flory Graduate student Subtask 2 project: "Nucleic Acid (PNA-DNA) Driven Peptide Assembly for Building an Artificial Oxygen Evolving Complex...


aging premature: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

human RecQ helicases in the maintenance of genomic stability through their catalytic activities and protein interactions in various pathways of cellular nucleic acid metabolism...


Evolutionary Genomics of Prokaryotic Viruses.  

E-Print Network [OSTI]

??Evolutionary history of biological entities is recorded within their nucleic acid sequences and can (sometimes) be deciphered by thorough genomic analysis. In this study we (more)

Krupovic, Mart



E-Print Network 3.0 - analyse protein-protein interactions Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

use only. Not for reproduction, distribution or commercial use. Summary: on four interrelated aspects of protein-protein and protein-nucleic acid interactions. Section 2...


Lateral flow devices  

DOE Patents [OSTI]

An analytical test for an analyte comprises (a) a base, having a reaction area and a visualization area, (b) a capture species, on the base in the visualization area, comprising nucleic acid, and (c) analysis chemistry reagents, on the base in the reaction area. The analysis chemistry reagents comprise (i) a substrate comprising nucleic acid and a first label, and (ii) a reactor comprising nucleic acid. The analysis chemistry reagents can react with a sample comprising the analyte and water, to produce a visualization species comprising nucleic acid and the first label, and the capture species can bind the visualization species.

Mazumdar, Debapriya (Urbana, IL); Liu, Juewen (Urbana, IL); Lu, Yi (Champaign, IL)



A method to attenuate U(VI) mobility in acidic waste plumes using humic acids  

SciTech Connect (OSTI)

Acidic uranium (U) contaminated plumes have resulted from acid-extraction of plutonium during the Cold War and from U mining and milling operations. A sustainable method for in-situ immobilization of U under acidic conditions is not yet available. Here, we propose to use humic acids (HAs) for in-situ U immobilization in acidic waste plumes. Our laboratory batch experiments show that HA can adsorb onto aquifer sediments rapidly, strongly and practically irreversibly. Adding HA greatly enhanced U adsorption capacity to sediments at pH below 5.0. Our column experiments using historically contaminated sediments from the Savannah River Site under slow flow rates (120 and 12 m/y) show that desorption of U and HA were non-detectable over 100 pore-volumes of leaching with simulated acidic groundwaters. Upon HA-treatment, 99% of the contaminant [U] was immobilized at pH < 4.5, compared to 5% and 58% immobilized in the control columns at pH 3.5 and 4.5, respectively. These results demonstrated that HA-treatment is a promising in-situ remediation method for acidic U waste plumes. As a remediation reagent, HAs are resistant to biodegradation, cost effective, nontoxic, and easily introducible to the subsurface.

Wan, J.; Dong, W.; Tokunaga, T.K.



The Crystal Structure of Non-Modified and Bipyridine-Modified PNA Duplexes  

SciTech Connect (OSTI)

Peptide nucleic acid (PNA) is a synthetic analogue of DNA that commonly has an N-aminoethyl glycine backbone. The crystal structures of two PNA duplexes, one containing eight standard nucleobase pairs (GGCATGCC)2, and the other containing the same nucleobase pairs and a central pair of bipyridine ligands, have been solved with a resolution of 1.22 and 1.10 {angstrom}, respectively. The non-modified PNA duplex adopts a P-type helical structure similar to that of previously characterized PNAs. The atomic-level resolution of the structures allowed us to observe for the first time specific modes of interaction between the terminal lysines of the PNA and the backbone and the nucleobases situated in the vicinity of the lysines, which are considered an important factor in the induction of a preferred handedness in PNA duplexes. Our results support the notion that whereas PNA typically adopts a P-type helical structure, its flexibility is relatively high. For example, the base-pair rise in the bipyridine-containing PNA is the largest measured to date in a PNA homoduplex. The two bipyridines bulge out of the duplex and are aligned parallel to the major groove of the PNA. In addition, two bipyridines from adjacent PNA duplexes form a p-stacked pair that relates the duplexes within the crystal. The bulging out of the bipyridines causes bending of the PNA duplex, which is in contrast to the structure previously reported for biphenyl-modified DNA duplexes in solution, where the biphenyls are p stacked with adjacent nucleobase pairs and adopt an intrahelical geometry. This difference shows that relatively small perturbations can significantly impact the relative position of nucleobase analogues in nucleic acid duplexes.

Yeh, Joanne I.; Pohl, Ehmke; Truan, Daphne; He, Wei; Sheldrick, George M.; Du, Shoucheng; Achim, Catalina (Pitt); (PSI); (Goettingen); (Durham); (CM)



Preparation of Some Substituted Terephthalic Acids  

E-Print Network [OSTI]

, with the dilithiation of 2,5-dibromotoluene with t-BuLi at ­78 8C, followed by reaction with dry ice and subsequent acid (3) is esterified,[9] then side-chain brominated with NBS, to produce dimethyl 2

Benin, Vladimir

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Acid dyes removal using low cost adsorbents  

Science Journals Connector (OSTI)

Dyestuff production units and dyeing units have always had pressing need techniques that allow economical pre-treatment for colour in the effluent. The effectiveness of adsorption for dye removal from wastewaters has made it an ideal alternative to other expensive treatment options. Removal of acid green

A.H. Aydin; Y. Bulut; O. Yavuz



Heterogeneous organic acid uptake on soot surfaces  

E-Print Network [OSTI]

observed the interaction between a number of carboxylic acids and soot from different fuel sources and formation mechanisms. A low pressure fast flow reactor was used to control the contact between the solid phase soot and gas phase organics, while chemical...

Levitt, Nicholas Paul



Peer review plan muddies acid rain talks  

Science Journals Connector (OSTI)

Bilateral U.S./Canadian talks on an acid rain treaty are being buffeted by bitter winds of national politics and uncertain science. The latest ill wind to blow north, as far as the Canadians are concerned, is the U.S. plan to have peer reviewed all ...



MFR PAPER 1339 Phosphonoacetic Acid Inhibition of  

E-Print Network [OSTI]

phosphonoace- tic acid (PAA), functions specifically by inhibiting the herpesvirus coded DNA dependent DNA polymerase in its process of replicating virus DNA (Mao and Robishaw, [975). In tissue culture systems, PAA and Overby, 1975). In all cases, the effec- tive tissue culture dose of PAA which inhibited herpesvirus


Corrosion free phosphoric acid fuel cell  

DOE Patents [OSTI]

A phosphoric acid fuel cell with an electrolyte fuel system which supplies electrolyte via a wick disposed adjacent a cathode to an absorbent matrix which transports the electrolyte to portions of the cathode and an anode which overlaps the cathode on all sides to prevent corrosion within the cell.

Wright, Maynard K. (Bethel Park, PA)



Producing a trimethylpentanoic acid using hybrid polyketide synthases  

DOE Patents [OSTI]

The present invention provides for a polyketide synthase (PKS) capable of synthesizing trimethylpentanoic acid. The present invention also provides for a host cell comprising the PKS and when cultured produces the trimethylpentanoic acid. The present invention also provides for a method of producing the trimethylpentanoic acid, comprising: providing a host cell of the present invention, and culturing said host cell in a suitable culture medium such that the trimethylpentanoic acid is produced, optionally isolating the trimethylpentanoic acid, and optionally, reducing the isolated trimethylpentanoic acid into a trimethylpentanol or an iso-octane.

Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D



Investigating the Effect of Oil Saturation on Acid Propagation during Matrix Acidization of Carbonate Rocks  

E-Print Network [OSTI]

The existence of an optimum injection rate for wormhole propagation, and face dissolution at low injection rates during matrix acidizing are well established. However, little has been documented that describes how the presence of residual oil...

Kumar, Rahul Pradeep



Effects of Acid Additives on Spent Acid Flowback through Carbonate Cores  

E-Print Network [OSTI]

Matrix acidizing is a well stimulation technique used to remove formation damage in the near wellbore region. But it comes with an associated set of challenges such as corrosion of the tubulars and iron precipitation in the formation. To counter...

Nasir, Ehsaan Ahmad



Modeling Acid Transport and Non-Uniform Etching in a Stochastic Domain in Acid Fracturing  

E-Print Network [OSTI]

Success of acid fracturing depends on uneven etching along the fracture surfaces caused by heterogeneities such as variations in local mineralogy and variations in leakoff behavior. The heterogeneities tend to create channeling characteristics...

Mou, Jianye



A study of the distribution of fatty acids in the system: cottonseed oil-oleic acid-isopropanol-water  

E-Print Network [OSTI]


Lamb, Frank E



A First Look at Yeast Fatty Acid Synthase  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

A First Look at Yeast Fatty Acid Synthase Print A First Look at Yeast Fatty Acid Synthase Print Fatty acids are the major constituents of eukaryotic and bacterial cellular membranes. They are used for functionally important post-translational protein modifications, and chains of fatty acids are the main storage compartments of an organism's chemical energy. Fatty acid synthesis is carried out by fatty acid sythase (FAS), which catalyzes cycles of multistep chemical reactions that are essentially the same in all organisms. FAS uses one acetyl-coenzyme A (CoA) and seven malonyl-CoA molecules to synthesize the 16-carbon palmitic acid, the most abundant fatty acid in eukaryotes. Now, for the first time, a group of researchers has determined the atomic structure of yeast Saccharomyces cerevisiae FAS derived from two crystals of the enzyme, using data collected at ALS Beamlines 8.2.1 and 8.2.2, as well as other synchrotron facilities.


Acid-catalyzed dehydrogenation of amine-boranes  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acid-catalyzed dehydrogenation of amine-boranes Acid-catalyzed dehydrogenation of amine-boranes Acid-catalyzed dehydrogenation of amine-boranes A method of dehydrogenating an amine-borane using an acid-catalyzed reaction. June 25, 2013 Acid-catalyzed dehydrogenation of amine-boranes A method of dehydrogenating an amine-borane using an acid-catalyzed reaction. Available for thumbnail of Feynman Center (505) 665-9090 Email Acid-catalyzed dehydrogenation of amine-boranes A method of dehydrogenating an amine-borane using an acid-catalyzed reaction. The method generates hydrogen and produces a solid polymeric product. The method of dehydrogenating amine-boranes may be used to generate hydrogen for power generation sources such as fuel cells. U.S. Patent No.: 7,645,902 (DOE S-104,909) Patent Application Filing Date: June 22, 2006


A First Look at Yeast Fatty Acid Synthase  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

A First Look at Yeast Fatty Acid Synthase Print A First Look at Yeast Fatty Acid Synthase Print Fatty acids are the major constituents of eukaryotic and bacterial cellular membranes. They are used for functionally important post-translational protein modifications, and chains of fatty acids are the main storage compartments of an organism's chemical energy. Fatty acid synthesis is carried out by fatty acid sythase (FAS), which catalyzes cycles of multistep chemical reactions that are essentially the same in all organisms. FAS uses one acetyl-coenzyme A (CoA) and seven malonyl-CoA molecules to synthesize the 16-carbon palmitic acid, the most abundant fatty acid in eukaryotes. Now, for the first time, a group of researchers has determined the atomic structure of yeast Saccharomyces cerevisiae FAS derived from two crystals of the enzyme, using data collected at ALS Beamlines 8.2.1 and 8.2.2, as well as other synchrotron facilities.


Mid-ultraviolet Light-Emitting Diode Detects Dipicolinic Acid  

Science Journals Connector (OSTI)

Dipicolinic acid (DPA, 2,6-pyridinedicarboxylic acid) is a substance uniquely present in bacterial spores such as that from anthrax (B. anthracis). It is known that DPA can be...

Li, Qingyang; Dasgupta, Purnendu K; Temkin, Henryk; Crawford, M H; Fischer, A J; Allerman, A A; Bogart, K H A; Lee, S R



TRL Acid and Solvent Wet Processing Rules and Guidelines  

E-Print Network [OSTI]

: General rules and guidelines for wet chemical processing in TRL. Author: KFlo hood and when transporting or handling chemicals. An acid-proof apron, sleeveTRL Acid and Solvent Wet Processing Rules and Guidelines Purpose

Reif, Rafael


Development and testing of an advanced acid fracture conductivity apparatus  

E-Print Network [OSTI]

wells. Acid fracturing is a standard practice to increase the production rate and to improve ultimate recovery in carbonate reservoirs. There have been successful cases in most carbonate reservoirs around the world. However acid fracture performance...

Zou, ChunLei



Choline for neutralizing naphthenic acid in fuel and lubricating oils  

SciTech Connect (OSTI)

A method is described of neutralizing at least a portion of the naphthenic acids present in fuel and lubricating oils which contain naphthenic acids which comprises treating these oils with a neutralizing amount of choline.

Ries, D.G.; Roof, G.L.



Identification of petroleum acids in Liaohe super-heavy oil  

Science Journals Connector (OSTI)

In this study, petroleum acids were extracted from the super-heavy oil of Liaohe oilfield, North-east China, by using acetic acid, and their structural components and properties were investigated by using FT-I...

Bencheng Wu; Jianhua Zhu



Integrated 3D Acid Fracturing Model for Carbonate Reservoir Stimulation  

E-Print Network [OSTI]

in integrating fracture propagation, acid transport and dissolution, and well performance models in a seamless fashion for acid fracturing design. In this new approach, the fracture geometry data of a hydraulic fracture is first obtained from commercial models...

Wu, Xi



High Temperature Fuel Cell (Phosphoric Acid) Manufacturing R...  

Broader source: Energy.gov (indexed) [DOE]

Fuel Cell (Phosphoric Acid) Manufacturing R&D High Temperature Fuel Cell (Phosphoric Acid) Manufacturing R&D Presented at the NREL Hydrogen and Fuel Cell Manufacturing R&D Workshop...

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Conversion of carboxylate salts to carboxylic acids via reactive distillation.  

E-Print Network [OSTI]

??The purpose of this study is to convert carboxylate salts (e.g. calcium acetate, propionate, and butyrate) into carboxylic acids (e.g., acetic, propionic, and butyric acids). (more)

Williamson, Shelly Ann



Influence of boric acid additive size on green lubricant performance  

Science Journals Connector (OSTI)

...towards green manufacturing processes, there...boric acid powder additives with canola oil...change present manufacturing process lines...powder-based lubricant additives As conceptually...of boric acid additive size on green...towards green manufacturing processes, there...



The Effect of Heterogeneity on Matrix Acidizing of Carbonate Rocks  

E-Print Network [OSTI]

In matrix acidizing, the goal is to dissolve minerals in the rock to increase well productivity. This is accomplished by injecting an application-specific solution of acid into the formation at a pressure between the pore pressure and fracture...

Keys, Ryan S.



Kinetic evaluation of the esterification of fatty acids to biodiesel  

Science Journals Connector (OSTI)

The free fatty acids of cotton seed oil were processed with methanol and ethanol into the corresponding alkyl fatty esters in the presence of diluted sulfuric acid. The products characterized as biodiesels pre...

Frederico A. D. Arajo; Sonia V. Pereira



The determination of potential acidity in overburden sediments  

E-Print Network [OSTI]

Weathered Overburden Samples. Determination of Total Sulfur by LECO. Determination of Non-Sulfate Sulfur by LECO. Pyritic Iron Using the ASTM Method Potential Acidity Using a Rapid Oxidation Technique - Original Method. Potential Acidity Using a Rapid... the Sample. The Addition of Excess H 02. Catalysing the Decomposition of Excess H202. Leaching the Oxidized Sample with CaC12. Comparison of Potential Acidity Methods. F and T Tests. Potential Acidity of Weathered vs. Unweathered Samples. Total S...

O'Shay, Tracey Ann



The biodegradation of organic acids by a heterogeneous bacterial culture  

E-Print Network [OSTI]

- tion of fatty acids results in multiple cleavage of the molecules to form shorter chain acids. It has been found (1I) that ethanoic and butanoic are the principle volatile acids present during digestion of sewage sludge while propanoic and pentanoic... was developed from a heterogeneous culture found in a sewage plant effluent. The culture was developed in a bench scale continuous flow activated. sludge reactor, and individual studies were made in a bench scale aerated batch reactor. The acids used were...

Tyer, Bobby Ray



Improved Processes to Remove Naphthenic Acids  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Improved Processes to Remove Naphthenic Acids Improved Processes to Remove Naphthenic Acids Final Technical Report (From October 1, 2002 to September 30, 2005) Principle Authors Aihua Zhang, Qisheng Ma, Kangshi Wang, Yongchun Tang (co-PI), William A. Goddard (PI), Date Report was issued: December 9, 2005 DOE Award number: DE-FC26-02NT15383 Name and Address of Submitting Organization California Institute of Technology 1200 East California Blvd., Pasadena, CA91125 Disclaimer This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any


Critical review of naphthenic acid corrosion  

SciTech Connect (OSTI)

Naphthenic acid corrosion continues to be a reliability issue in refinery distillation units. A review of the subject is presented herein with special focus on field and laboratory data and on areas where research is needed. The review shows that several parameters are known to affect the corrosion process and their individual effect on crude corrosivity are somewhat understood. However, their combined effect is still subject to much controversy. The determination of a critical factor--naphthenic acid content--is still not standardized. It is shown herein that, by arranging the literature findings into three groups (1) furnace tubes and transfer lines, (2) vacuum column and (3) side cut piping, a better agreement of the literature data is achieved.

Tebbal, S. [SET Labs., Inc., Stafford, TX (United States)



Sulfate and acid resistant concrete and mortar  

DOE Patents [OSTI]

The present invention relates to concrete, mortar and other hardenable mixtures comprising cement and fly ash for use in construction and other applications, which hardenable mixtures demonstrate significant levels of acid and sulfate resistance while maintaining acceptable compressive strength properties. The acid and sulfate hardenable mixtures of the invention containing fly ash comprise cementitious materials and a fine aggregate. The cementitous materials may comprise fly ash as well as cement. The fine aggregate may comprise fly ash as well as sand. The total amount of fly ash in the hardenable mixture ranges from about 60% to about 120% of the total amount of cement, by weight, whether the fly ash is included as a cementious material, fine aggregate, or an additive, or any combination of the foregoing. In specific examples, mortar containing 50% fly ash and 50% cement in cementitious materials demonstrated superior properties of corrosion resistance. 6 figs.

Liskowitz, J.W.; Wecharatana, M.; Jaturapitakkul, C.; Cerkanowicz, A.E.



Sulfate and acid resistant concrete and mortar  

DOE Patents [OSTI]

The present invention relates to concrete, mortar and other hardenable mixtures comprising cement and fly ash for use in construction and other applications, which hardenable mixtures demonstrate significant levels of acid and sulfate resistance while maintaining acceptable compressive strength properties. The acid and sulfate hardenable mixtures of the invention containing fly ash comprise cementitious materials and a fine aggregate. The cementitous materials may comprise fly ash as well as cement. The fine aggregate may comprise fly ash as well as sand. The total amount of fly ash in the hardenable mixture ranges from about 60% to about 120% of the total amount of cement, by weight, whether the fly ash is included as a cementious material, fine aggregate, or an additive, or any combination of the foregoing. In specific examples, mortar containing 50% fly ash and 50% cement in cementitious materials demonstrated superior properties of corrosion resistance.

Liskowitz, John W. (Belle Mead, NJ); Wecharatana, Methi (Parsippany, NJ); Jaturapitakkul, Chai (Bangkok, TH); Cerkanowicz, deceased, Anthony E. (late of Livingston, NJ)



Reference electrode for strong oxidizing acid solutions  

DOE Patents [OSTI]

A reference electrode for the measurement of the oxidation-reduction potentials of solutions is especially suitable for oxidizing solutions such as highly concentrated and fuming nitric acids, the solutions of nitrogen oxides, N.sub.2 O.sub.4 and N.sub.2 O.sub.5, in nitric acids. The reference electrode is fabricated of entirely inert materials, has a half cell of Pt/Ce(IV)/Ce(III)/70 wt. % HNO.sub.3, and includes a double-junction design with an intermediate solution of 70 wt. % HNO.sub.3. The liquid junctions are made from Corning No. 7930 glass for low resistance and negligible solution leakage.

Rigdon, Lester P. (Livermore, CA); Harrar, Jackson E. (Castro Valley, CA); Bullock, Sr., Jack C. (Pleasanton, CA); McGuire, Raymond R. (Brentwood, CA)



Lightweight, durable lead-acid batteries  

DOE Patents [OSTI]

A lightweight, durable lead-acid battery is disclosed. Alternative electrode materials and configurations are used to reduce weight, to increase material utilization and to extend service life. The electrode can include a current collector having a buffer layer in contact with the current collector and an electrochemically active material in contact with the buffer layer. In one form, the buffer layer includes a carbide, and the current collector includes carbon fibers having the buffer layer. The buffer layer can include a carbide and/or a noble metal selected from of gold, silver, tantalum, platinum, palladium and rhodium. When the electrode is to be used in a lead-acid battery, the electrochemically active material is selected from metallic lead (for a negative electrode) or lead peroxide (for a positive electrode).

Lara-Curzio, Edgar (Lenoir City, TN); An, Ke (Knoxville, TX); Kiggans, Jr., James O. (Oak Ridge, TN); Dudney, Nancy J. (Knoxville, TN); Contescu, Cristian I. (Knoxville, TN); Baker, Frederick S. (Oak Ridge, TN); Armstrong, Beth L. (Clinton, TN)



Lightweight, durable lead-acid batteries  

SciTech Connect (OSTI)

A lightweight, durable lead-acid battery is disclosed. Alternative electrode materials and configurations are used to reduce weight, to increase material utilization and to extend service life. The electrode can include a current collector having a buffer layer in contact with the current collector and an electrochemically active material in contact with the buffer layer. In one form, the buffer layer includes a carbide, and the current collector includes carbon fibers having the buffer layer. The buffer layer can include a carbide and/or a noble metal selected from of gold, silver, tantalum, platinum, palladium and rhodium. When the electrode is to be used in a lead-acid battery, the electrochemically active material is selected from metallic lead (for a negative electrode) or lead peroxide (for a positive electrode).

Lara-Curzio, Edgar; An, Ke; Kiggans, Jr., James O; Dudney, Nancy J; Contescu, Cristian I; Baker, Frederick S; Armstrong, Beth L



E-Print Network 3.0 - acid alkyl esters Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Nitric Acid 34. Sulfuric acid... .5 will not be accepted through this program. Heavy metal, toxic, acidic (without solvents) and basic wastes should... . Mercaptans 4. ......


E-Print Network 3.0 - acid improves hypertriglyceridemia Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

contain unusual fatty acids that are valuable... p. 1 Lipid signals: jasmonic acid & green leaf volatiles i. Jasmonic acid and jasmonates... agronomic species i) diffent...


E-Print Network 3.0 - acid promotes detoxification Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Bile acid Detoxification, Synthesis... acid transport, synthesis and detoxification. The LCA-induced altered enzymes and transporter... ;Regulation of bile acid detoxification and...


E-Print Network 3.0 - acid operational experiences Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

acetic acid, propionic acid, butyric acid, valeric ... Source: Manning, Sturt - Cornell Tree-Ring Laboratory, Cornell University Collection: Environmental Sciences and Ecology 34...


E-Print Network 3.0 - acid requirements based Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

(Eichhornia crassipes) to levulinic acid (LA) through an acid-catalysed hydrolysis reaction. LA has been... OHOH OH Diphenolic acid O CH3 Methyltetrahydrofuran O O OHNH2 ......


E-Print Network 3.0 - aminocyclopropane carboxylic acid Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

acid, which primarily loses the ele... -methylaziridinecarboxylic acid via an internal SN2 pathway, rather than protonated vinylglycine. Protonated amino acids... readily expel...


E-Print Network 3.0 - ammonia acetic acid Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

fluminic acid, or hydrogen. NITRIC ACID with: acetic... with: water, carbon dioxide, carbon tetrachloride, and other chlorinated hydrocarbons. ACETIC ACID with......

Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


E-Print Network 3.0 - aromatic sulfonic acids Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

examples: Methane sulfonic... acid Ethane sulfonic acid 1-Propane sulfonic acid 1-Butane ... Source: Wikswo, John - Department of Physics and Astronomy, Vanderbilt University...


Naphthenic acid corrosion in the refinery  

SciTech Connect (OSTI)

Field tests and laboratory studies of refinery process streams are presented. The effects of temperature, velocity and physical state were studied with respect to alloy selection for corrosion resistant service. The amount of molybdenum in the austenitic stainless steel alloys is the dominant factor in conferring corrosion resistance. The Naphthenic Acid Corrosion Index (NACI) is useful in assessing the severity of corrosion under a variety of circumstances.

Craig, H.L. Jr. [Mobil Research and Development Corp., Paulsboro, NJ (United States)



Alkaline earth cation extraction from acid solution  

DOE Patents [OSTI]

An extractant medium for extracting alkaline earth cations from an aqueous acidic sample solution is described as are a method and apparatus for using the same. The separation medium is free of diluent, free-flowing and particulate, and comprises a Crown ether that is a 4,4'(5')[C.sub.4 -C.sub.8 -alkylcyclohexano]18-Crown-6 dispersed on an inert substrate material.

Dietz, Mark (Elmhurst, IL); Horwitz, E. Philip (Naperville, IL)



The Effect of Supercritical Fluids on Solid Acid Catalyst Alkylation  

Science Journals Connector (OSTI)

Box 1625, Idaho Falls, Idaho 83415-2208, and Marathon-Ashland Petroleum LLC, P.O. ... The liquid acid processes present serious safety and environmental concerns in both the transport and storage of concentrated liquid acids and the disposal of acid?oil sludges. ...

Daniel M. Ginosar; David N. Thompson; Kyle Coates; David J. Zalewski



The Fixation of Phosphoric Acid by the Soil  

E-Print Network [OSTI]

KAS AtiRICULTURAL EXPERIMENT STATION AGRICULTURAL AND MECHANICAL COLLEGE OF TEXAS W. B. BII BULLETIN NO. 304 eddent CEMBER, 1922 'ION OF PHOSPI ACID BY THE SOIL B. YOUNGBLOOD, DIRECTOR, COLLEGE STATION, BRAZOS COUNTY, TEXA STATION STAFF... ............................................... '7 ............................................... ;t of Acid 7' ........................................... of Ignition 8 ........................................ on by Minerals 10 ...................... on of Phosphoric Acid of Fertilizers 11...

Fraps, G. S. (George Stronach)



How is ferulic acid transported into the Golgi apparatus? Lignin  

E-Print Network [OSTI]

How is ferulic acid transported into the Golgi apparatus? Lignin polymerization is also influenced]. These ferulic acid residues are thought to initiate lignin polymerization. It is not known how ferulic acid in the cell wall field, but also creates novel opportunities for the manipulation of lignin in crop plants


Process for the extraction of strontium from acidic solutions  

DOE Patents [OSTI]

The invention is a process for selectively extracting strontium values from aqueous nitric acid waste solutions containing these and other fission product values. The extractant solution is a macrocyclic polyether in an aliphatic hydrocarbon diluent containing a phase modifier. The process will selectively extract strontium values from nitric acid solutions which are up to 6 molar in nitric acid. 4 figs.

Horwitz, E.P.; Dietz, M.L.



Production of carboxylic acid and salt co-products  

DOE Patents [OSTI]

This invention provide processes for producing carboxylic acid product, along with useful salts. The carboxylic acid product that is produced according to this invention is preferably a C.sub.2-C.sub.12 carboxylic acid. Among the salts produced in the process of the invention are ammonium salts.

Hanchar, Robert J.; Kleff, Susanne; Guettler, Michael V.



Process for the extraction of strontium from acidic solutions  

DOE Patents [OSTI]

The invention is a process for selectively extracting strontium values from aqueous nitric acid waste solutions containing these and other fission product values. The extractant solution is a macrocyclic polyether in an aliphatic hydrocarbon diluent containing a phase modifier. The process will selectively extract strontium values from nitric acid solutions which are up to 6 molar in nitric acid.

Horwitz, E.P.; Dietz, M.L.



The Effects of Initial Condition of Fracture Surfaces, Acid Spending, and Type on Conductivity of Acid Fracture  

E-Print Network [OSTI]

. Another area of interest is the variation of conductivity along the fracture due to acid spending. We also investigated the contact time, acid system type, and treatment temperature effects on conductivity using San Andres dolomite cores. The results...

Almomen, Ali Mansour



Naphthenic acid corrosion in synthetic fuels production  

SciTech Connect (OSTI)

Serious corrosion damage to carbon steel piping in a fractionation unit associated with synthetic fuels production has been ascribed to the presence of naphthenic acids. Investigation of the problem revealed total acids numbers (TAN) ranging from 8--12mg KOH/g in the feed to the unit. Damage typically occurred in the temperature range 180--240 C and manifested as localized pitting, preferential weld corrosion, general wall thinning and end-grain attack. Filming amine corrosion inhibitors designed for refinery overhead systems have been proven ineffective and high temperature phosphate-based inhibitors could not be used due to potential catalyst poisoning in downstream refinery units. Coupon exposures indicated corrosion rates in the order of 2 mm/y on carbon steel in a reboiler line as well as pitting to austenitic stainless steel type UNS S30403. Line replacement in austenitic stainless steel UNS S31603 has been proven effective. The performance of this alloy is mainly ascribed to its molybdenum content. The absence of sulfur in the feed to the unit is also contributing to the alloy performance despite the extremely high total acid numbers.

Bruyn, H.I. de [Mossgas Ltd., Mossel Bay (South Africa)



The effects of solvent mixtures on the gel permeation chromatography of alkanes, fatty acids, and fatty acid esters  

E-Print Network [OSTI]


Bolton, Patrick Lee



Influences of cooperative hydrogen bonding economy on protein-nucleic acid complexation: Structure of unidecahydrated Inosine C5?-monophosphate and L-glutamine (2C10H13N4O8P??C5H10N2O3??11H2O) cocrystal at atomic resolution  

Science Journals Connector (OSTI)

The crystal structure of a unidecahydrated co-complex between two Inosine 5?-monophosphate (IMP) and one L-glutamine has been determined at atomic resolution by X-ray crystallographic methods. The crystal belo...

Asim K. Bera; Bishnu P. Mukhopadhyay; S. Ghosh



Type II Diacylglycerol Acyltransferase from Claviceps purpurea with Ricinoleic Acid, a Hydroxyl Fatty Acid of Industrial Importance, as Preferred Substrate  

Science Journals Connector (OSTI)

...total fatty acids in sclerotium oil (2). Ricinoleic acid, a...CpDGAT2 cDNA were obtained using a Marathon cDNA amplification kit (BD...purified from Ricinus communis oil according to Donaldson (11...fatty acids in the sclerotium oil of this fungus (2). DGAT2...

Ioannis Mavraganis; Dauenpen Meesapyodsuk; Patricia Vrinten; Mark Smith; Xiao Qiu



Dosage de la lignine insoluble en milieu acide : influence du prtraitement par hydrolyse acide sur la lignine Kla-  

E-Print Network [OSTI]

Dosage de la lignine insoluble en milieu acide : influence du prétraitement par hydrolyse acide sur la lignine Kla- son de bois et de paille Bernard MONTIES LN.R.A., Laboratoire de Chimie biologique et la lignine insoluble dans l'acide sulfurique concentré, lignine Klason, est décrit : il comporte une

Paris-Sud XI, Université de


Rate dependent finite deformation stressstrain behavior of an ethylene methacrylic acid copolymer and an ethylene methacrylic acid butyl  

E-Print Network [OSTI]

Rate dependent finite deformation stress­strain behavior of an ethylene methacrylic acid copolymer and an ethylene methacrylic acid butyl acrylate copolymer S. Deschanel a,*, B.P. Greviskes a , K. Bertoldi a , S dependence a b s t r a c t The large strain deformation behaviors of an ethylene methacrylic acid (EMAA


Acetic Acid Production by Clostridium thermoaceticum in pH-Controlled Batch Fermentations at Acidic pH  

Science Journals Connector (OSTI)

...and the conversion efficiencies to acetic acid and...neutral pH. The highest acetic acid concentrations...acetic acid, and efficiency of converting glucose...the CO2 was of the highest purity attainable...valve completely and venting for 90 s, closing...ii) A glass furnace tube was packed...

Robert D. Schwartz; Frederick A. Keller Jr.



Phosphatidic acid: an emerging plant lipid second messenger  

Science Journals Connector (OSTI)

Evidence is accumulating that phosphatidic acid is a second messenger. Its level increases within minutes of a wide variety of stress treatments including ethylene, wounding, pathogen elicitors, osmotic and oxidative stress, and abscisic acid. Enhanced signal levels are rapidly attenuated by phosphorylating phosphatidic acid to diacylglycerol pyrophosphate. Phosphatidic acid is the product of two signalling pathways, those of phospholipases C and D, the former in combination with diacylglycerol kinase. Families of these genes are now being cloned from plants. Several downstream targets of phosphatidic acid have been identified, including protein kinases and ion channels.

Teun Munnik



Continuous-flow free acid monitoring method and system  

DOE Patents [OSTI]

A free acid monitoring method and apparatus is provided for continuously measuring the excess acid present in a process stream. The disclosed monitoring system and method is based on the relationship of the partial pressure ratio of water and acid in equilibrium with an acid solution at constant temperature. A portion of the process stream is pumped into and flows through the monitor under the influence of gravity and back to the process stream. A continuous flowing sample is vaporized at a constant temperature and the vapor is subsequently condensed. Conductivity measurements of the condensate produces a nonlinear response function from which the free acid molarity of the sample process stream is determined.

Strain, J.E.; Ross, H.H.



Naphthenic acids as antiwear additives for jet fuels  

SciTech Connect (OSTI)

One of the ways in which the antiwear properties of jet fuels can be improved is the use of lubricity agents, otherwise known as antiwear additives. Among the various compounds that have antiwear properties in these fuels, naphthenic, acids merit special attention. These are alicyclic carboxylic acids, in most cases monobasic, with five- and six-membered carbon rings; they have the general formula R(CH{sub 2}){sub n}COOH, where R is a naphthene radical. Natural naphthenic acids consist mainly of acids of the cyclopentane series, beginning with the simplest, in particular cyclopentylacetic acid. The lower naphthenic acids are monocyclic; the higher acids, beginning with C{sub 13}, are bicyclic and polycyclic. Naphthenic acids of the cyclohexane series are encountered less frequently; they may be found, for example, in Baku, California, and Sakhalin crudes. The most widely used method for obtaining naphthenic acids is the treatment of light distillates, lube distillates, and diesel fuels. The standard GOST 13302-77 establishes several grades of naphthenic acids, depending on the raw material and the production technology. This work was aimed at the utilization of wastes containing naphthenic acids, with subsequent use as jet fuel additives.

Deineko, P.S.; Vasil`eva, E.N.; Popova, O.V.; Bashkatova, S.T.


Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Interaction of Uranium(VI) with Phthalic Acid  

SciTech Connect (OSTI)

Phthalic acid, a ubiquitous organic compound found in soil, water, and in domestic and nuclear wastes can affect the mobility and bioavailability of metals and radionuclides. We examined the complexation of uranium with phthalic acid by potentiometric titration, electrospray ionization-mass spectroscopy (ESI-MS), and extended X-ray absorption fine structure (EXAFS) analysis. Potentiometric titration of a 1:1 U/phthalic acid indicated uranyl ion bonding with both carboxylate groups of phthalic acid; above pH 5 the uranyl ion underwent hydrolysis with one hydroxyl group coordinated to the inner-sphere of uranium. In the presence of excess phthalic acid, ESI-MS analysis revealed the formation of both 1:1 and 1:2 U/phthalic acid complexes. EXAFS studies confirmed the mononuclear biligand 1:2 U/phthalic acid complex as the predominant form. These results show that phthalates can form soluble stable complexes with uranium and may affect its mobility.

Vazquez, G.; Dodge, C; Francis, A



Processes to remove acid forming gases from exhaust gases  

DOE Patents [OSTI]

The present invention relates to a process for reducing the concentration of NO in a gas, which process comprises: (A) contacting a gas sample containing NO with a gaseous oxidizing agent to oxidize the NO to NO[sub 2]; (B) contacting the gas sample of step (A) comprising NO[sub 2] with an aqueous reagent of bisulfite/sulfite and a compound selected from urea, sulfamic acid, hydrazinium ion, hydrazoic acid, nitroaniline, sulfanilamide, sulfanilic acid, mercaptopropanoic acid, mercaptosuccinic acid, cysteine or combinations thereof at between about 0 and 100 C at a pH of between about 1 and 7 for between about 0.01 and 60 sec; and (C) optionally contacting the reaction product of step (A) with conventional chemical reagents to reduce the concentrations of the organic products of the reaction in step (B) to environmentally acceptable levels. Urea or sulfamic acid are preferred, especially sulfamic acid, and step (C) is not necessary or performed. 16 figs.

Chang, S.G.



Effect of Hydrolysis on the Properties of a New Viscoelastic Surfactant-Based Acid  

E-Print Network [OSTI]

Viscoelastic surfactants (VES) have been widely used in acidizing and acid fracturing. They are used as diversion agents during matrix acid treatments and leakoff control agents during acid fracturing. At high temperatures, viscoelastic surfactants...

He, Zhenhua



E-Print Network 3.0 - acid-base equilibrium Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Principles of Environmental Engineering Date Topic Reading Summary: Acid-Base Chemistry 86-195 28 Acid-Base Chemistry 31 Acid Base Chemistry Sept. 2 Acid-Base Chemistry...


Constructing and engineering fatty acid metabolic pathways for the production of fuels and chemicals  

E-Print Network [OSTI]

0 fatty acids in transgenic canola by overexpression of Ch0 fatty acids in transgenic canola by overexpression of Ch

Steen, Eric James



Investigating fatty acid biosynthesis within the algal chloroplast using Chlamydomonas reinhardtii as a model  

E-Print Network [OSTI]

0 fatty acids in transgenic canola by overexpression of Ch0 fatty acids in transgenic canola by overexpression of Ch

Blatti, Jillian L.



E-Print Network 3.0 - active lewis acid Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

levulinic acid. Proceeding... chemicals: kinetic study on the decomposition of 5-hydroxymethylfurfural into levulinic acid. ... Source: Groningen, Rijksuniversiteit - Centre for...


Phosphoric acid impurities in phosphoric acid fuel cell electrolytes. 2: Effects on the oxygen reduction reaction at platinum electrodes  

SciTech Connect (OSTI)

The effects of phosphorus acid additions on the oxygen reduction reaction at platinum electrodes in concentrated phosphoric acid were studied. The oxygen reduction currents decreased, and the Tafel slopes became more negative upon the addition of small concentrations of phosphorus acid. In addition,the phosphorus acid oxidation current tended to complete with the oxygen reduction current. These effects became more pronounced at higher phosphorus acid concentrations and at higher temperatures. Upon the addition of phosphorus acid the number of electrons involved in the oxygen reduction reaction decreased from a value close to four to a value approaching two, suggesting promotion of a two-electron reduction to peroxide. Therefore, in studies of the electrochemical reduction of oxygen in hot concentrated phosphoric acid or in fuel cell systems using hot concentrated phosphoric acid as electrolyte, it is recommended that precautions be taken against the inadvertent formation of the phosphorus acid. The removal of phosphorus acid from concentrated phosphoric acid by repeated potential cycling at 100 mV/s between + 0.5 and +1.50 V (vs. dynamic hydrogen electrode) was demonstrated.

Sugishima, Noboru; Hinatsu, J.T.; Foulkes, F.R. (Univ. of Toronto, Ontario (Canada). Dept. of Chemical Engineering and Applied Chemistry)



Solvent extraction of rare-earth metals by carboxylic acids  

SciTech Connect (OSTI)

The solvent extraction of the trivalent lanthanides and yttrium from nitrate media by solutions of carboxylic acids in xylene has been studied. Commercially available carboxylic acids such as Versatic 10 and naphthenic acids were used, as well as model compounds of known structure, such as 2-ethylhexanoic and 3-cyclohexylpropanoic acids. In a few cases, extraction of the metals from sulphate and chloride solutions was also investigated. The dependence of the extraction properties of the carboxylic acids on the atomic number of the lanthanide shows a definite relationship to the steric bulk of the carboxylic acid molecule quantified by means of the steric parameter, E{sub s}{prime} of the substituent alkyl group. The stoichiometries of the extracted complexes for representative light (La), middle (Gd) and heavy (Lu) rare-earth metals were investigated by the slope-analysis technique for a sterically hindered acid (Versatic 10 acid; -E{prime}{sub s} = 3.83) and an acid with low steric hindrance (3-cyclohexylpropanoic acid; -E{prime}{sub s} = 0.28). 14 refs., 13 figs., 3 tabs.

Preez, A.C. du; Preston, J.S. [Mintek, Randburg (South Africa)



in amino-acid concentration enhanced amino-acid and glucose utilization for lipogenesis, with no  

E-Print Network [OSTI]

. In contrast, insulin decreased lipid secretion measured by glycerol (-35%) and glucose incor- poration increased glycerol incorporation (+35%) into cellular lipids and consequently lipogenesis. Insulin increased more strongly amino-acid and glucose incorporation into cellular lipids, the glu- cose incorporation

Boyer, Edmond


Evalutaion of Multi-Stage Sandstone Acidizing Uging an Organic Mud Acid and a Clay Stabalizer  

E-Print Network [OSTI]

and clay particles. The purpose of this study is to present and evaluate multi-stage acid injection into the Bandera sandstone cores to remove formation damage. In this study, coreflood experiments were conducted on Bandera sandstone cores (1.5 in. x 6 in...

Sakipour, Armin



(Created 1/09; Revised 10/09, 3/11, 7/11) UNL Environmental Health and Safety (402) 472-4925 http://ehs.unl.edu  

E-Print Network [OSTI]

from a single nonchromosomal or viral DNA source, though one or more of the segments may be a synthetic-4925 · http://ehs.unl.edu Safe Operating Procedure (Revised 11/13) RECOMBINANT OR SYNTHETIC NUCLEIC ACIDS://ehs.unl.edu/) All recombinant or synthetic nucleic acid molecule (r/sNA) projects at the University of Nebraska

Farritor, Shane


Type II restriction-modification system methylation subunit of Alicyclobacillus acidocaldarius  

DOE Patents [OSTI]

Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius are provided. Further provided are methods for modulating or altering recombination inside or outside of a cell using isolated and/or purified polypeptides and/or nucleic acid sequences from Alicyclobacillus acidocaldarius.

Lee, Brady D; Newby, Deborah T; Lacey, Jeffrey A; Thompson, David N; Thompson, Vicki S; Apel, William A; Roberto, Francisco F; Reed, David W



Thermophilic and thermoacidophilic sugar transporter genes and enzymes from Alicyclobacillus acidocaldarius and related organisms, methods  

DOE Patents [OSTI]

Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius are provided. Further provided are methods for transporting sugars across cell membranes using isolated and/or purified polypeptides and nucleic acid sequences from Alicyclobacillus acidocaldarius.

Thompson, David N; Apel, William A; Thompson, Vicki S; Reed, David W; Lacey, Jeffrey A



Thermophilic and thermoacidophilic sugar transporter genes and enzymes from alicyclobacillus acidocaldarius and related organisms, methods  

DOE Patents [OSTI]

Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius are provided. Further provided are methods for transporting sugars across cell membranes using isolated and/or purified polypeptides and nucleic acid sequences from Alicyclobacillus acidocaldarius.

Thompson, David N. (Idaho Falls, ID); Apel, William A. (Jackson, WY); Thompson, Vicki S. (Idaho Falls, ID); Reed, David W. (Idaho Falls, ID); Lacey, Jeffrey A. (Idaho Falls, ID)



Modulating lignin in plants  

SciTech Connect (OSTI)

Materials and methods for modulating (e.g., increasing or decreasing) lignin content in plants are disclosed. For example, nucleic acids encoding lignin-modulating polypeptides are disclosed as well as methods for using such nucleic acids to generate transgenic plants having a modulated lignin content.

Apuya, Nestor; Bobzin, Steven Craig; Okamuro, Jack; Zhang, Ke



Transcriptional control in Alicyclobacillus acidocaldarius and associated genes, proteins, and methods  

DOE Patents [OSTI]

Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius are provided. Further provided are methods of modulating transcription or transcription or transcriptional control using isolated and/or purified polypeptides and nucleic acid sequences from Alicyclobacillus acidocaldarius.

Lee, Brady Deneys; Thompson, David N; Apel, William A.; Thompson, Vicki Slavchev; Reed, David W; Lacey, Jeffrey A



Thermophilic and thermoacidophilic metabolism genes and enzymes from Alicyclobacillus acidocaldarius and related organisms, methods  

DOE Patents [OSTI]

Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius are provided. Further provided are methods for modulating or altering metabolism in a cell using isolated and/or purified polypeptides and nucleic acid sequences from Alicyclobacillus acidocaldarius.

Thompson, Vicki S; Apel, William A; Reed, David W; Lee, Brady D; Thompson, David N; Roberto, Francisco F; Lacey, Jeffrey A



Recombination initiation maps of individual human genomes  

Science Journals Connector (OSTI)

...and searching . Nucleic Acids Res. 37 ( Web Server ), W202 W208 ( 2009 ). 10.1093/nar...80 Mahony S. Benos P. V. , STAMP: A web tool for exploring DNA-binding motif similarities . Nucleic Acids Res. 35 ( Web Server ), W253 W258 ( 2007 ). 10...

Florencia Pratto; Kevin Brick; Pavel Khil; Fatima Smagulova; Galina V. Petukhova; R. Daniel Camerini-Otero



Phylogenomics resolves the timing and pattern of insect evolution  

Science Journals Connector (OSTI)

...the corresponding codon alignments . Nucleic Acids Res. 34 ( Web Server ), W609 W612 ( 2006 ). 10.1093/nar/gkl315 16845082...Eddy S. R. Sonnhammer E. L. Bateman A. , Pfam: Clans, web tools and services . Nucleic Acids Res. 34 , D247 D251...

Bernhard Misof; Shanlin Liu; Karen Meusemann; Ralph S. Peters; Alexander Donath; Christoph Mayer; Paul B. Frandsen; Jessica Ware; Tom Flouri; Rolf G. Beutel; Oliver Niehuis; Malte Petersen; Fernando Izquierdo-Carrasco; Torsten Wappler; Jes Rust; Andre J. Aberer; Ulrike Aspck; Horst Aspck; Daniela Bartel; Alexander Blanke; Simon Berger; Alexander Bhm; Thomas R. Buckley; Brett Calcott; Junqing Chen; Frank Friedrich; Makiko Fukui; Mari Fujita; Carola Greve; Peter Grobe; Shengchang Gu; Ying Huang; Lars S. Jermiin; Akito Y. Kawahara; Lars Krogmann; Martin Kubiak; Robert Lanfear; Harald Letsch; Yiyuan Li; Zhenyu Li; Jiguang Li; Haorong Lu; Ryuichiro Machida; Yuta Mashimo; Pashalia Kapli; Duane D. McKenna; Guanliang Meng; Yasutaka Nakagaki; Jos Luis Navarrete-Heredia; Michael Ott; Yanxiang Ou; Gnther Pass; Lars Podsiadlowski; Hans Pohl; Bjrn M. von Reumont; Kai Schtte; Kaoru Sekiya; Shota Shimizu; Adam Slipinski; Alexandros Stamatakis; Wenhui Song; Xu Su; Nikolaus U. Szucsich; Meihua Tan; Xuemei Tan; Min Tang; Jingbo Tang; Gerald Timelthaler; Shigekazu Tomizuka; Michelle Trautwein; Xiaoli Tong; Toshiki Uchifune; Manfred G. Walzl; Brian M. Wiegmann; Jeanne Wilbrandt; Benjamin Wipfler; Thomas K. F. Wong; Qiong Wu; Gengxiong Wu; Yinlong Xie; Shenzhou Yang; Qing Yang; David K. Yeates; Kazunori Yoshizawa; Qing Zhang; Rui Zhang; Wenwei Zhang; Yunhui Zhang; Jing Zhao; Chengran Zhou; Lili Zhou; Tanja Ziesmann; Shijie Zou; Yingrui Li; Xun Xu; Yong Zhang; Huanming Yang; Jian Wang; Jun Wang; Karl M. Kjer; Xin Zhou


Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Regulating the ethylene response of a plant by modulation of F-box proteins  

SciTech Connect (OSTI)

The invention relates to transgenic plants having reduced sensitivity to ethylene as a result of having a recombinant nucleic acid encoding a F-box protein, and a method of producing a transgenic plant with reduced ethylene sensitivity by transforming the plant with a nucleic acid sequence encoding a F-box protein.

Guo, Hongwei (La Jolla, CA); Ecker, Joseph R. (Carlsbad, CA)



Recombinant constructs of Borrelia burgdorferi  

DOE Patents [OSTI]

Novel chimeric nucleic acids, encoding chimeric Borrelia proteins comprising OspC or an antigenic fragment thereof and OspA or an antigenic fragment thereof, are disclosed. Chimeric proteins encoded by the nucleic acid sequences are also disclosed. The chimeric proteins are useful as vaccine immunogens against Lyme borreliosis, as well as for immunodiagnostic reagents.

Dattwyler, Raymond J. (Setauket, NY); Gomes-Solecki, Maria J. C. (New York, NY); Luft, Benjamin J. (East Setauket, NY); Dunn, John J. (Bellport, NY)



Thermophilic and thermoacidophilic sugar transporter genes and enzymes from Alicyclobacillus acidocaldarius and related organisms, methods  

DOE Patents [OSTI]

Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius are provided. Further provided are methods for transporting sugars across cell membranes using isolated and/or purified polypeptides and nucleic acid sequences from Alicyclobacillus acidocaldarius.

Thompson, David N.; Apel, William A.; Thompson, Vicki S.; Reed, David W.; Lacey, Jeffrey A.



Thermophilic and thermoacidophilic sugar transporter genes and enzymes from Alicyclobacillus acidocaldarius and related organisms, methods  

DOE Patents [OSTI]

Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius are provided. Further provided are methods for transporting sugars across cell membranes using isolated and/or purified polypeptides and nucleic acid sequences from Alicyclobacillus acidocaldarius.

Thompson, David N.; Apel, William A.; Thompson, Vicki S.; Reed, David W.; Lacey, Jeffrey A.



Phosphorylation of the Cyclin B1 Cytoplasmic Retention Sequence by Mitogen-Activated Protein Kinase and Plx 1 NIH RO1 GM60500 to S.K. S.K. is a Scholar of the Leukemia and Lymphoma Society.  

Science Journals Connector (OSTI)

...Effects of phosphate bond energy on nucleic acid stability in...experimental Effects of Phosphate Bond Energy on Nucleic Acid Stability in...triphosphate) in the reaction mix tures (3). This should make...synthetic reactions which re quire energy. As a preliminary to these...

Susan Walsh; Seth S. Margolis; and Sally Kornbluth



DOE - Office of Legacy Management -- Acid Pueblo Canyon - NM 03  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acid Pueblo Canyon - NM 03 Acid Pueblo Canyon - NM 03 FUSRAP Considered Sites Acid/Pueblo Canyon, NM Alternate Name(s): Radioactive Liquid Waste Treatment Plant (TA-45) Acid/Pueblo and Los Alamos Canyon NM.03-3 Location: Canyons in the Pajarito Plateau Region in Los Alamos County, Los Alamos, NM NM.03-3 Historical Operations: Late 1943 or early 1944, head of the south fork of Acid Canyon received untreated liquid waste containing tritium and isotopes of strontium, cesium, uranium, plutonium, and americium discharged from main acid sewer lines and subsequently from the TA-3 plutonium treatment plant. NM.03-3 Eligibility Determination: Radiological Survey(s): Verification Surveys NM.03-5 NM.03-6 Site Status: Certified- Certification Basis and Federal Register Notice NM.03-2


Newer method for analyzing naphthenic acids in petroleum  

SciTech Connect (OSTI)

The naphthenic acids in petroleum are considered a class of biological markers. Their potential use in source correlation and as indicator of biodegradation have been reported in the past. Their presence in waste water at refineries may also cause corrosion problems and fish toxicity. Due to their highly complicated nature, detailed characterization of the acids has been difficult and time consuming. This talk will describe a relatively simple approach in characterizing the acids based on their group types. The acids were first separated from petroleum followed by mass spectrometric determinations. Two newer methods were developed to analyze the acid components, namely Chemical Ionization with NF{sub 3} as reagent gas and negative ion Fast Atom Bombardment. The geochemical interpretation based on acid distribution will be demonstrated with a set of well understood crude oil samples.

Fan, T.P. (Shell Development Co., Houston, TX (United States))



The iron powder test for naphthenic acid corrosion studies  

SciTech Connect (OSTI)

In the course of an ongoing investigation into the phenomenon of naphthenic acid corrosion, a new test method has evolved and is currently being further developed to substitute the total acid number (TAN or neutralization number) as an indicator for naphthenic acid corrosion potential. It can also be used to complement conventional autoclave corrosion tests in high temperature environments, which are based on weight loss of steel coupons. In this new method an oil sample reacts with pure iron powder within an autoclave heated to the testing temperature. The result is based on the amount of dissolved iron found in the oil sample. The oil sample can dissolve an amount of iron for a given time at a given temperature, depending on the naphthenic acid corrosion, since these acids react with iron to produce oil soluble iron naphthenates. This paper describes the method, compares it with conventional crude corrosiveness testing, and proposes it as a new way of measuring naphthenic acid corrosion potential.

Hau, J.L.; Yepez, O.; Specht, M.I.; Lorenzo, R. [PDVSA-Intevep, Caracas (Venezuela)



Investigating the Effects of Core Length on Pore Volume to Breakthrough (PVBT) Behavior in Carbonate Core Samples during Matrix Acidizing with Hydrochloric Acid  

E-Print Network [OSTI]

Most literature contains Hydrochloric acid (HCl) carbonate acidizing experiments performed on short (2 - 6 inch) cores. These cores do not accurately represent reservoir conditions, as spent acid is not propagated for any appreciable distance along...

Nour, Mohamed



An Improved Model for Sandstone Acidizing and Study of the Effect of Mineralogy and Temperature on Sandstone Acidizing Treatments and Simulation  

E-Print Network [OSTI]

Sandstone acidizing is a complex operation because the acidizing fluid reacts with a variety of minerals present in the formation that results in a wide range of reaction products. The hydrofluoric acid (HF) reaction rate differs widely from mineral...

Agarwal, Amit Kumar



Study of Acid Response of Qatar Carbonate Rocks  

E-Print Network [OSTI]

STUDY OF ACID RESPONSE OF QATAR CARBONATE ROCKS A Thesis by ZHAOHONG WANG Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE... December 2011 Major Subject: Petroleum Engineering Study of Acid Response of Qatar Carbonate Rocks Copyright 2011 Zhaohong Wang STUDY OF ACID RESPONSE OF QATAR CARBONATE ROCKS A Thesis...

Wang, Zhaohong



Phosphate ester inhibitors solve naphthenic acid corrosion problems  

SciTech Connect (OSTI)

Crude oils containing naphthenic acids can cause a variety of corrosion problems in any of several process areas. But because of the complexity of naphthenic acid corrosion, no routine technique is available for predicting corrosion from this source. Certain high-temperature corrosion inhibitors with a general phosphate ester structure have shown good mitigation of naphthenic acid corrosion in commercial applications. A description of two such cases will help refiners know what to look for to prevent similar occurrences in their plants.

Babaian-Kibala, E. (Nalco Chemical Co., Sugar Land, TX (United States))



Process for the recovery of strontium from acid solutions  

DOE Patents [OSTI]

The invention is a process for selectively extracting strontium and technetium values from aqueous nitric acid waste solutions containing these and other fission product values. The extractant is a macrocyclic polyether in a diluent which is insoluble in water, but which will itself dissolve a small amount of water. The process will extract strontium and technetium values from nitric acid solutions which are up to 6 molar in nitric acid. 5 figs.

Horwitz, E.P.; Dietz, M.L.



The reaction of cesium hydroxide with 4-phenylvaleric acid  

E-Print Network [OSTI]

Alkali Metal Hycroxide Solutions Used in Potentio- metric and Spectrophotometric Titrations with 4-Phenylvaleric Acid 17 Samples for Nuclear Magnetic Resonance Spectra 18 Concentration of 4-Phenylvaleric Acid in Carbon Tetrachloride for Infrared.... Similarly, nuclear magnetic resonance techniques may be used to determine whether any TT-bonding involving the phenyl ring of 4- phenylvaleric acid occurs during its reaction with cesium hydroxide. If any such bonding to the n-electrons of the ring occurs...

Caughfield, Arvie Jeane



A First Look at Yeast Fatty Acid Synthase  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

A First Look at Yeast Fatty Acid A First Look at Yeast Fatty Acid Synthase A First Look at Yeast Fatty Acid Synthase Print Wednesday, 28 November 2007 00:00 Fatty acids are the major constituents of eukaryotic and bacterial cellular membranes. They are used for functionally important post-translational protein modifications, and chains of fatty acids are the main storage compartments of an organism's chemical energy. Fatty acid synthesis is carried out by fatty acid sythase (FAS), which catalyzes cycles of multistep chemical reactions that are essentially the same in all organisms. FAS uses one acetyl-coenzyme A (CoA) and seven malonyl-CoA molecules to synthesize the 16-carbon palmitic acid, the most abundant fatty acid in eukaryotes. Now, for the first time, a group of researchers has determined the atomic structure of yeast Saccharomyces cerevisiae FAS derived from two crystals of the enzyme, using data collected at ALS Beamlines 8.2.1 and 8.2.2, as well as other synchrotron facilities.


Production of Biofuels from High-Acid-Value Waste Oils  

Science Journals Connector (OSTI)

Production of Biofuels from High-Acid-Value Waste Oils ... (1) Biofuel is derived from a renewable, domestic resource, thereby relieving reliance on petroleum fuel imports. ...

Junming Xu; Guomin Xiao; Yonghong Zhou; Jianchun Jiang



Regulating for the long term: SMCRA and acid mine drainage  

SciTech Connect (OSTI)

With the passage of the Surface Mining Control and Reclamation Act of 1977 (SMCRA), regulators and industry representatives expected to solve the problem of pollution of the Nation`s waterways caused by acidic discharges from coal mines. Eighteen years after the passage of SMCRA, hard issues of predicting, regulating and treating acid mine drainage remain. Acid mine drainage is most common in the coal seams of the Midwest and Appalachia: Pennsylvania, West Virginia, Maryland, Ohio, Illinois, and Tennessee. This article discusses regulation of coal mines and acid mine drainage for the long term.

Shea, C.W.



E-Print Network 3.0 - acid glycosaminoglycan mucopolysaccharide...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

used: HA, hyaluronic acid; hexosa- minidase, 3-IV-acetyl ... Source: Geiger, Benjamin - Department of Molecular Cell Biology, Weizmann Institute of Science Collection:...


Recombinant microorganisms for increased production of organic acids  

DOE Patents [OSTI]

Disclosed are recombinant microorganisms for producing organic acids. The recombinant microorganisms express a polypeptide that has the enzymatic activity of an enzyme that is utilized in the pentose phosphate cycle. The recombinant microorganism may include recombinant Actinobacillus succinogenes that has been transformed to express a Zwischenferment (Zwf) gene. The recombinant microorganisms may be useful in fermentation processes for producing organic acids such as succinic acid and lactic acid. Also disclosed are novel plasmids that are useful for transforming microorganisms to produce recombinant microorganisms that express enzymes such as Zwf.

Yi, Jian; Kleff, Susanne; Guettler, Michael V



Recombinant microorganisms for increased production of organic acids  

DOE Patents [OSTI]

Disclosed are recombinant microorganisms for producing organic acids. The recombinant microorganisms express a polypeptide that has the enzymatic activity of an enzyme that is utilized in the pentose phosphate cycle. The recombinant microorganism may include recombinant Actinobacillus succinogenes that has been transformed to express a Zwischenferment (Zwf) gene. The recombinant microorganisms may be useful in fermentation processes for producing organic acids such as succinic acid and lactic acid. Also disclosed are novel plasmids that are useful for transforming microorganisms to produce recombinant microorganisms that express enzymes such as Zwf.

Yi, Jian (East Lansing, MI); Kleff, Susanne (East Lansing, MI); Guettler, Michael V. (Holt, MI)


Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Amino acid treatment enhances protein recovery from sediment...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

treatment enhances protein recovery from sediment and soils for metaproteomic studies . Amino acid treatment enhances protein recovery from sediment and soils for metaproteomic...


Dissociative Binding of Carboxylic Acid Ligand on Nanoceria Surface...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Abstract: Carboxylic acid is a common ligand anchoring group to functionalize nanoparticle surfaces. Its binding structures and mechanisms as a function of the oxidation...


Membrane Stresses Induced by Overproduction of Free Fatty Acids...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

coli. Abstract: Microbially produced fatty acids are potential precursors to high energy density biofuels, including alkanes and alkyl ethyl esters by either catalytic...


amino acid conjugates: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

the measured distributions. Guang Wu; Shaomin Yan 71 Amino acid classes and the protein folding problem Condensed Matter (arXiv) Summary: We present and implement a...


The corrosion of aluminum in boric acid solutions  

E-Print Network [OSTI]

vs. Time of at 40oC . vs. Time of 40 C . 34 ~ ~ ~ 35 3S Aluminum in Boric ~ ~ ~ 24S Aluminum in Boric Corrosion Rate Acid Solutions vs. Time of at 50oC . 2S Aluminum in Boric 36 Corrosion Rate Acid Solutions vs. Time of at 50oC 3S... Solutions vs. Time of 3S Aluminum in Boric at 70oC 40 Corrosion Rate Acid Solutions vs. Time of at 70oC 24S Aluminum in Boric ~ ~ ~ . a ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ /+1 14. Corrosion Rate Acid Solutions vs. Time of at 90cC 2S Aluminum in Boric 42 15...

Bass, Henry Kinsolving



A novel recycling process using the treated citric acid wastewater as ingredients water for citric acid production  

Science Journals Connector (OSTI)

Abstract In this study, an integrated process coupling citric acid and methane fermentations was proposed to solve severe wastewater pollution problem in cassava-based citric acid production. The accumulation patterns of the potential and major inhibitors in this process, including organic compounds, volatile fatty acids (VFAs), total ions and pigments were investigated. Both simulation and experimental results indicated that these inhibitors could reach their equilibrium levels after 37 fermentation runs when reutilizing the treated citric acid wastewater. As a result, the proposed citric acid fermentation process by recycling the wastewater treated in methane fermentation could be stably operated for more than 15 runs, which could save a large amount of fresh water and relieve the severe wastewater pollution in citric acid production potentially.

Hong-Jian Zhang; Jian-Hua Zhang; Jian Xu; Lei Tang; Zhong-Gui Mao



Interaction of divalent cations with triethylenetetraminehexaacetic acid  

Science Journals Connector (OSTI)

Further studies of the interactions of divalent metal ions with triethylenetetraminehexaacetic acid (TTHA) have revealed that mononuclear, binuclear, and protonated mononuclear complexes are formed in solution with Zn(II), Cd(II), Hg(II) and Pb(II) iions. Equilibrium constants are reported for the various complex species formed, and possible structures for the mononuclear are reported for the various complex species formed, and possible structures for the mononuclear species are suggested. Other reports describing the nature of the complexes formed by this ligand with divalent metal ions are confirmed in that the binuclear complexes are resistant to hydrolysis in alkaline solution, and that the symmetrical binuclear complex is considered the most likely structure.

Austin Yingst; Arthur E. Martell



Naphthenic acid corrosion and its control  

SciTech Connect (OSTI)

This paper first presents a brief description of naphthenic acid corrosion and the main factors which influence its onset and severity. After a brief discussion of traditional control methods, it proceeds to a discussion of chemical inhibition, which is a relatively new control technique. Chemical inhibitors can be divided into two broad classifications: phosphorus-based and non-phosphorus-based. Three types of phosphorus-based inhibitors have been reported: amine-neutralized phosphate esters, alkaline earth phosphonate phenate sulfide plus trialkyl phosphate, and thiazolines plus di and tri-alkyl phosphates. Non-phosphorus based inhibitors include: thiazolines, organic polysulfides, and sulfonated alkyl phenols. A description of each inhibitor and its effectiveness in the laboratory and field is presented.

Zetlmeisl, M.J. [Petrolite Corp., St. Louis, MO (United States)



Corrosion of carbons in acid electrolytes  

SciTech Connect (OSTI)

The stability of the electrode materials used in hot phosphoric acid fuel cells, in particular the conductive carbon electrocatalyst support, is a continuing concern. The Tafel slope of the carbon corrosion reaction appears to be indicative of the degree of disorder on the carbon surface--the larger the Tafel slope, the greater the degree of disorder. The effect of heat-treatment was found to depend on the structure of the parent carbon. Differences in the electrochemical behavior of samples of heattreated Vulcan XC-72R were correlated with the structural properties of the carbon produced, as reflected by lattice parameters. Changes in BET surface areas and lattice parameters as well as in electrochemical behavior showed evidence that the addition of boron resulted in ''graphitization'' that was not achieved by heat-treatment alone.

Stonehart, P.; MacDonald, J.



Promoters and proteins from Clostridium thermocellum and uses thereof  

DOE Patents [OSTI]

The present invention relates to an inducible and a high expression nucleic acid promoter isolated from Clostridium thermocellum. These promoters are useful for directing expression of a protein or polypeptide encoded by a nucleic acid molecule operably associated with the nucleic acid promoters. The present invention also relates to nucleic acid constructs including the C. thermocellum promoters, and expression vectors and hosts containing such nucleic acid constructs. The present invention also relates to protein isolated from Clostridium thermocellum, including a repressor protein. The present invention also provides methods of using the isolated promoters and proteins from Clostridium thermocellum, including methods for directing inducible in vitro and in vivo expression of a protein or polypeptide in a host, and methods of producing ethanol from a cellulosic biomass.

Wu, J. H. David; Newcomb, Michael



Active Phosphoric Acid and Its Relation to the Needs of the Soil for Phosphoric Acid in Pot Experiments.  

E-Print Network [OSTI]

. K/5 nitric acid, measured with a flask. Place in ter bath previously heated to 40" C. Digest five hours, shak- ?very half hour. Filter on a large'double folded filter. When cola, take 1800 c.c. for the estimation of phosphoric acid and potael... and silica. The filtrate was measured ancl its vol- ume recorded. The soil on the filter paper was washed back into the bottle with 2000 c.c. N,'5 nitric acid, and again digested. Fonr treatments in all were made with the acid, The quantity of phosphorjc...

Fraps, G. S. (George Stronach)




SciTech Connect (OSTI)

As nitric acid molarity is increased, there are two competing phenomena affecting the reactivity of the system. First, there is interaction between each of the 10 wells in the basket-like insert. As the molarity of the nitric acid solution is increased (it moves from 100% water to 100% HNO{sub 3}), the hydrogen atom density decreases by about 80%. However, it remains a relatively efficient moderator. The moderating ratio of nitric acid is about 90% that of water. As the media between the wells is changed from 100% water to 100% nitric acid, the density of the media increases by 50%. A higher density typically leads to a better reflector. However, when the macroscopic scattering cross sections are considered, nitric acid is a much worse reflector than water. The effectiveness of nitric acid as a reflector is about 40% that of water. Since the media between the wells become a worse reflector and still remains an effective moderator, interaction between the wells increases. This phenomenon will cause reactivity to increase as nitric acid molarity increases. The seond phenomenon is due to the moderating ratio changing in the high concentration fissile-nitric acid solution in the 10 wells. Since the wells contain relatively small volumes of high concentration solutions, a small decrease in moderating power has a large effect on reactivity. This is due to the fact that neutrons are more likely to escape the high concentration fissile solution before causing another fission event. The result of this phenomenon is that as nitric acid molarity increases, reactivity decreases. Recent studies have shown that the second phenomenon is indeed the dominating force in determining reactivity changes in relation to nitric acid molarity changes. When considering the system as a whole, as nitric acid molarity increases, reactivity decreases.

Williamson, B.



Production of levulinic acid from glucosamine by dilute-acid catalyzed hydrothermal process  

Science Journals Connector (OSTI)

Abstract Glucosamine is a basic unit of the chitin/chitosan structure, which is derived from crustacean (e.g. crab, shrimp) and insect shells. In this study, the production of levulinic acid (LA) from glucosamine via dilute-acid-catalyzed hydrothermal hydrolysis was investigated. Among the reaction conditions, reaction temperature, reaction time, and substrate concentration were more effective than catalyst concentration. The optimal conditions for LA production, as determined by the response-surface methodology (RSM), were as follows: 188C reaction temperature, 4wt% catalyst concentration, 49min reaction time, 120g/L substrate concentration. Under these conditions, the LA yield was 30.3g/L (25.3wt%), while the 5-HMF concentration was zero. These results might provide basic knowledge essential to the production of valuable chemicals derivable from renewable marine resources and utilizable as fuel additives and polymer building blocks.

Gwi-Taek Jeong



Behavior of copper in acidic sulfate solution: Comparison with acidic chloride  

SciTech Connect (OSTI)

The anodic polarization behavior of copper in a 0.1 M sulfuric acid (H{sub 2}SO{sub 4}) + 1 M sodium sulfate (Na{sub 2}SO{sub 4}) solution (pH = 2.0) was studied at room temperature under quiescent and stirred conditions. The behavior was compared with aqueous equilibria via construction of a potential-vs-pH (E-pH) diagram for the copper-sulfate-water (Cu-SO{sub 4}{sup 2}-H{sub 2}O) system. Interpretation of the behavior was aided by comparison with aqueous equilibria and polarization studies of copper in a 0.2 M hydrochloric acid (HCl) + 1 M sodium chloride (NaCl) solution(pH = 0.8). The initial anodic dissolution region in the acidic sulfate solution exhibited Tafel behavior with a slope consistent with formation of cupric ions (Cu{sup 2+}) whose rate of formation was charge-transfer controlled. At higher potentials, limiting current density (i{sub L}) behavior was observed under E-pH conditions that were consistent with formation of a film of copper sulfate pentahydrate (CuSO{sub 4} {degree} 5H{sub 2}O). Comparison of experimental i{sub L} values with those predicted by mass transport-controlled processes, using estimates of the diffusion layer thickness obtained from the mass transfer-influenced region of apparent Tafel behavior in the acidic chloride solution, were in sufficient agreement to indicate i{sub L} was controlled by the rate of dissolution of the CuSO{sub 4} {degree} 5H{sub 2}O film via transport of Cu{sup 2+} from the film-electrolyte interface into the bulk solution.

Tromans, D.; Silva, J.C. [Univ. of British Columbia, Vancouver, British Columbia (Canada). Dept. of Metals and Materials Engineering



Abc Amino Acids: Design, Synthesis, and Properties of New Photoelastic Amino Acids  

SciTech Connect (OSTI)

Photoisomerizable amino acids provide a direct avenue to the experimental manipulation of bioactive polypeptides, potentially allowing real-time, remote control of biological systems and enabling useful applications in nanobiotechnology. Herein, we report a new class of photoisomerizable amino acids intended to cause pronounced expansion and contraction in the polypeptide backbone, i.e., to be photoelastic. These compounds, termed Abc amino acids, employ a photoisomerizable azobiphenyl chromophore to control the relative disposition of aminomethyl and carboxyl substituents. Molecular modeling of nine Abc isomers led to the identification of one with particularly attractive properties, including the ability to induce contractions up to 13A in the backbone upon transa?cis photoisomerization. This isomer, designated mpAbc, has substituents at meta and para positions on the inner (azo-linked) and outer rings, respectively. An efficient synthesis of Fmoc-protected mpAbc was executed in which the biaryl components were formed via Suzuki couplings and the azo linkage was formed via amine/nitroso condensation; protected forms of three other Abc isomers were prepared similarly. A decapeptide incorporating mpAbc was synthesized by conventional solid-phase methods and displayed characteristic azobenzene photochemical behavior with optimal conversion to the cis isomer at 360 nm and a thermal cisa?trans half life of 100 min. at 80 AoC.

Standaert, Robert F [ORNL; Park, Dr Seung Bum [Seoul National University



Original article Ethanol and acetic-acid tolerance  

E-Print Network [OSTI]

Original article Ethanol and acetic-acid tolerance in Indian geographical populations of Drosophila clines of ethanol toler- ance (1.5-4.2%) and acetic-acid tolerance (2.9-4.9%) were observed in adult individuals of 4 geographical populations of Drosophila immigrans. Thus, both ethanol and acetic

Paris-Sud XI, Université de


Original article Ethanol and acetic-acid tolerances  

E-Print Network [OSTI]

Original article Ethanol and acetic-acid tolerances in Drosophila melanogaster: similar maternal) Summary - Ethanol and acetic-acid tolerances were studied in a cross between 2 geo- graphic races disappeared in the F2. Further investigations demonstrated that for ethanol tolerance, the large difference

Paris-Sud XI, Université de


Stimulation of Carbonate Reservoirs Using a New Emulsified Acid System  

E-Print Network [OSTI]

The scope of work can be divided into; the measurement of the rheological properties of a new emulsified acid system that can be suitable for high temperature applications, a study of the performance of the new emulsified acid in stimulating both...

Sayed, Mohammed Ali Ibrahim



Ancient insights into uric acid metabolism in primates  

E-Print Network [OSTI]

such as gout and hypertension have plagued us for centu- ries. The prevalence of gout in the United States has, a key enzyme that metabolizes uric acid, leaving us vulnerable to diseases such as gout rise to the well-known joint pain associated with gout. Elevated uric acid levels have also been

Chang, Belinda


Solvent extraction studies of holmium with acidic extractants  

SciTech Connect (OSTI)

Liquid-liquid extraction studies of holmium with 2-ethylhexyl phosphoric acid mono-2-ethylhexyl ester, naphthenic, and Versatic 10 acids have been carried out. The nature of the extracted species and the extraction equilibrium constants of these systems have been determined from aqueous nitrate solution. The extraction mechanism and complexation models have been proposed. 11 refs., 8 figs.

Gaikwad, A.G.; Damodaran, A.D. (CSIR, Trivandrum (India))


Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Evaporative Hydrochloric Acid Recovery: Something Old, Something New...  

E-Print Network [OSTI]

. If zinc is present from the pickling of galvanizing racks or stripping of parts, the zinc concentration will range from as low as zinc chloride solution remains. In the evaporative process of the Hydrochloric Acid Recovery System, the waste acid is pumped through a pre-filter into the evaporator section oftI1e recovery system. This solution is heated by means...

Cullivan, B.


Boron-containing amino carboxylic acid compounds and uses thereof  

DOE Patents [OSTI]

Novel compounds which are useful for boron neutron capture therapy (BNCT) are disclosed. The compounds comprise a stable boron-containing group and an aminocycloalkane carboxylic acid group or a boronated acyclic hydrocarbon-linked amino carboxylic acid. Methods for synthesis of the compounds and for use of the compounds in BNCT are disclosed.

Kabalka, George W. (Knoxville, TN); Srivastava, Rajiv R. (Knoxville, TN)



AcidBase Regulation in Fishes: Cellular and Molecular Mechanisms  

E-Print Network [OSTI]

, and functional studies that have begun to define the protein transporters involved in the acid­base relevant ion gill membrane transport processes in acid­base balance. J. Exp. Zool. 293:302­319, 2002. r 2002 Wiley on recent advances in our understand- ing of membrane transport systems which are responsible for the net

Claiborne, James Berkeley


Effects of the Biologically Produced Polymer Alginic Acid on  

E-Print Network [OSTI]

. Using a combined atomic force microscopy (AFM)/flow- through reactor apparatus, we investigated. In alginic acid, the acute step retreat rate is nearly unchanged in comparison to water, whereas the obtuse but propagate faster in the obtuse direction. To explain these observations, we propose that alginic acid


Production of amino acids using auxotrophic mutants of methylotrophic bacillus  

SciTech Connect (OSTI)

A method of producing amino acids by culturing an amino acid auxotroph of a biologically pure strain of a type I methylotrophic bacterium of the genus Bacillus which exhibits sustained growth at 50.degree. C. using methanol as a carbon and energy source and requiring vitamin B.sub.12 and biotin is provided.

Hanson, Richard S. (Wayzata, MN); Flickinger, Michael C. (St. Paul, MN); Schendel, Frederick J. (Falcon Heights, MN); Guettler, Michael V. (Waconia, MN)



Propionic-Acid-Terminated Silicon Nanoparticles: Synthesis and Optical Characterization  

E-Print Network [OSTI]

producing water-dispersible, propionic-acid-terminated particles. From transmission electron microscope (TEM oxidation of the nanocrystals. The silicon nanocrystals could be transferred into water or methanol in acrylic acid, water, and methanol and showed essentially the same optical properties in all three solvents

Swihart, Mark T.


Inhibition of Aluminum Oxyhydroxide Precipitation with Citric Acid  

E-Print Network [OSTI]

Inhibition of Aluminum Oxyhydroxide Precipitation with Citric Acid Daniel M. Dabbs, Usha as an agent for increasing the solubility of aluminum oxyhydroxides in aqueous solutions of high (>2.47 mol/mol) hydroxide-to-aluminum ratios. Conversely, citric acid also colloidally stabilizes particles in aqueous

Aksay, Ilhan A.


Preparation of {alpha},{beta}-unsaturated carboxylic acids and esters  

DOE Patents [OSTI]

Disclosed is a process for the preparation of {alpha},{beta}-unsaturated carboxylic acids and esters thereof which comprises contacting formaldehyde or a source of formaldehyde with a carboxylic acid, ester or anhydride in the presence of a catalyst comprising an oxide of niobium.

Gogate, M.R.; Spivey, J.J.; Zoeller, J.R.



E-Print Network 3.0 - amino-terminal dna binding Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Nucleic Acid Copying using 2-amino-2, 3- Summary: -labeled-2-amino-terminated DNA primer, 0.5M template (5- GGGUp Up Up -3-primer binding site), 100mM MES... Figure S1. Acid...


A family of regulatory genes associated with type II restriction-modification systems.  

Science Journals Connector (OSTI)

...restriction-modification system. Nucleic Acids Res. 17...deoxyribonucleic acid restriction systems of their hosts. Microbiol...A. Lechevalier (ed.), Handbook of microbiology, vol. 2...restriction-modification systems, p. 39-71. In A. Razin...

T Tao; J C Bourne; R M Blumenthal



Mercury-free dissolution of aluminum-clad fuel in nitric acid  

DOE Patents [OSTI]

A mercury-free dissolution process for aluminum involves placing the aluminum in a dissolver vessel in contact with nitric acid-fluoboric acid mixture at an elevated temperature. By maintaining a continuous flow of the acid mixture through the dissolver vessel, an effluent containing aluminum nitrate, nitric acid, fluoboric acid and other dissolved components are removed.

Christian, Jerry D. (Idaho Falls, ID); Anderson, Philip A. (Pocatello, ID)



Membrane Bound: C2-Domain Abscisic Acid-Related Proteins Help Abscisic Acid Receptors Get Where They Need to Go  

Science Journals Connector (OSTI)

...Membrane Bound: C2-Domain Abscisic Acid-Related Proteins Help Abscisic Acid Receptors Get Where They Need to Go Jennifer Lockhart jlockhart@aspb.org Science Editor www.plantcell.org/cgi/doi/10.1105/tpc.114.134411

Jennifer Lockhart




SciTech Connect (OSTI)

The carotenoid cleavage dioxygenases (CCD) catalyze synthesis of a variety of apo-carotenoid secondary metabolites in plants, animals and bacteria. In plants, the reaction catalyzed by the 11, 12, 9-cis-epoxy carotenoid dioxygenase (NCED) is the first committed and key regulated step in synthesis of the plant hormone, abscisic acid (ABA). ABA is a key regulator of plant stress responses and has critical functions in normal root and seed development. The molecular mechanisms responsible for developmental control of ABA synthesis in plant tissues are poorly understood. Five of the nine CCD genes present in the Arabidopsis genome encode NCED's involved in control of ABA synthesis in the plant. This project is focused on functional analysis of these five AtNCED genes as a key to understanding developmental regulation of ABA synthesis and dissecting the role of ABA in plant development. For this purpose, the project developed a comprehensive set of gene knockouts in the AtNCED genes that facilitate genetic dissection of ABA synthesis. These mutants were used in combination with key molecular tools to address the following specific objectives: (1) the role of ABA synthesis in root development; (2) developmental control of ABA synthesis in seeds; (3) analysis of ATNCED over-expressers; (4) preliminary crystallography of the maize VP14 protein.




Fate of the naphthenic acid, U-{sup 14}C-palmitic acid, in constructed wetlands; A microcosm study  

SciTech Connect (OSTI)

This study represents part of an overall initiative to assess the ecological viability of constructed wetlands for the treatment of oil sands wastewater. To determine the fate of naphthenic acids (C{sub n}H{sub 2n+z}O{sub 2}), the most toxic component of oil sands wastewater, in constructed wetlands, a representative naphthenic acid (NA), U-{sup 14}C-palmitic acid was added to microcosms placed within three control and three treatment wetlands. Treatment wetlands receive wastewater typical of effluent resulting from the oil sands extraction process. In each of the 6 microcosms, biotic compartments measured for {sup 14}C at t = 0, 1, 3, 5, 7, 14 and 21 days were: mineralized palmitic acid (evolved {sup 14}C-CO{sub 2}), water, suspended sediments, bottom sediments, cattail, chironomid larvae, and sticklebacks (liver, muscle and skin). The fate of the {sup 14}C-palmitic acid was similar between the control versus treatment microcosms. Exceptions were greater amounts of {sup 14}C-palmitic acid detected in water and suspended sediments of treatment versus control microcosms. Of the biotic compartments, at t = 21 days, the majority of the {sup 14}C-palmitic acid was found in chironomids and fish tissues. Mineralization and partitioning of {sup 14}C-palmitic acid onto sediments also represented important fates. From the initial addition of the labelled compound, with the exception of bottom sediments, by t = 1 day {sup 14}C was detected in ail biotic compartments. {sup 14}C was detected in bottom sediments by t = 7 days. These results indicate that in addition to mineralization being an important process influencing the fate palmitic acid within the wetlands, partitioning into biotic compartments such as chironomids and fish are also important fates. Hence, when considering the use of constructed wetlands for the treatment of oil sands effluent, the adverse effects of naphthenic acids on the biota needs to be fully addressed.

Wood, A.; Barjaktarovic, L.; Moore, M.; Kennedy, C.; Farrell, A.P.; Bendell-Young, L.I. [Simon Fraser Univ., Burnaby, British Columbia (Canada). Dept. of Biological Sciences



NDB Download  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Download Data from FTP Server Download Data from FTP Server Dowload NDB ID to PDB ID mapping (tsv format) Coordinate Files na-biol. Coordinate files (PDB format) for one biological assembly of nucleic acid-containing structures determined by x-ray crystallography. na-deposited. Coordinate files (PDB format) for the asymmetric unit of nucleic acid-containing structures determined by x-ray crystallography. The chirality has been corrected for these structures. na-mmcif. Coordinate files (mmCIF format) for the asymmetric unit of nucleic acid-containing structures determined by x-ray crystallography in mmCIF format. na-nmr. Copies of the coordinate files released by the PDB for nucleic acid-containing structures determined by NMR. na-nmr-mmcif. Coordinate files (mmCIF format) for nucleic


Fatty acyl-CoA reductase  

SciTech Connect (OSTI)

The present invention relates to bacterial enzymes, in particular to an acyl-CoA reductase and a gene encoding an acyl-CoA reductase, the amino acid and nucleic acid sequences corresponding to the reductase polypeptide and gene, respectively, and to methods of obtaining such enzymes, amino acid sequences and nucleic acid sequences. The invention also relates to the use of such sequences to provide transgenic host cells capable of producing fatty alcohols and fatty aldehydes.

Reiser, Steven E.; Somerville, Chris R.



Process for removing naphthenic acids from petroleum distillates  

SciTech Connect (OSTI)

A liquid extraction process is described for removing naphthenic acids from naphthenic acid containing petroleum distillates boiling within the range of about 180/sup 0/-600/sup 0/C. and having an acid number of at least about 0.2 which process comprises the steps of: (a) intimately contacting the petroleum distillates with a solvent consisting essentially of methanol, water, and about from 2-20 wt. % ammonia and having a methanol: water ratio in the range of about from 0.2 to 3 parts by weight of methanol per part by weight of water and using an ammonia to petroleum distillate ratio of about 0.1-1 part by weight of ammonia per 100 parts by weight of the petroleum distillate. This selectively extracts the naphthenic acids into the solvent and yielding an immiscible two-phase liquid mixture, one of which is naphthenic acid-rich solvent phase and the other of which is a substantially napthenic acid-free petroleum distillate phase; and (b) separating and respectively recovering the naphtenic acid-rich solvent phase and petroleum distillate phase.

Danzik, M.



Ursolic acid improves domoic acid-induced cognitive deficits in mice  

SciTech Connect (OSTI)

Our previous findings suggest that mitochondrial dysfunction is the mechanism underlying cognitive deficits induced by domoic acid (DA). Ursolic acid (UA), a natural triterpenoid compound, possesses many important biological functions. Evidence shows that UA can activate PI3K/Akt signaling and suppress Forkhead box protein O1 (FoxO1) activity. FoxO1 is an important regulator of mitochondrial function. Here we investigate whether FoxO1 is involved in the oxidative stress-induced mitochondrial dysfunction in DA-treated mice and whether UA inhibits DA-induced mitochondrial dysfunction and cognitive deficits through regulating the PI3K/Akt and FoxO1 signaling pathways. Our results showed that FoxO1 knockdown reversed the mitochondrial abnormalities and cognitive deficits induced by DA in mice through decreasing HO-1 expression. Mechanistically, FoxO1 activation was associated with oxidative stress-induced JNK activation and decrease of Akt phosphorylation. Moreover, UA attenuated the mitochondrial dysfunction and cognitive deficits through promoting Akt phosphorylation and FoxO1 nuclear exclusion in the hippocampus of DA-treated mice. LY294002, an inhibitor of PI3K/Akt signaling, significantly decreased Akt phosphorylation in the hippocampus of DA/UA mice, which weakened UA actions. These results suggest that UA could be recommended as a possible candidate for the prevention and therapy of cognitive deficits in excitotoxic brain disorders. - Highlights: Ursolic acid (UA) is a naturally triterpenoid compound. UA attenuated the mitochondrial dysfunction and cognitive deficits. Mechanistically, UA activates PI3K/Akt signaling and suppresses FoxO1 activity. UA could be recommended as a possible candidate for anti-excitotoxic brain disorders.

Wu, Dong-mei [School of Environment and Spatial Informatics, China University of Mining and Technology, Xuzhou 221008, Jiangsu Province (China); Key Laboratory for Biotechnology on Medicinal Plants of Jiangsu Province, School of Life Science, Xuzhou Normal University, Xuzhou 221116, Jiangsu Province (China); Lu, Jun, E-mail: lu-jun75@163.com [Key Laboratory for Biotechnology on Medicinal Plants of Jiangsu Province, School of Life Science, Xuzhou Normal University, Xuzhou 221116, Jiangsu Province (China); Zhang, Yan-qiu [School of Environment and Spatial Informatics, China University of Mining and Technology, Xuzhou 221008, Jiangsu Province (China); Zheng, Yuan-lin, E-mail: ylzheng@xznu.edu.cn [Key Laboratory for Biotechnology on Medicinal Plants of Jiangsu Province, School of Life Science, Xuzhou Normal University, Xuzhou 221116, Jiangsu Province (China); Hu, Bin [Key Laboratory for Biotechnology on Medicinal Plants of Jiangsu Province, School of Life Science, Xuzhou Normal University, Xuzhou 221116, Jiangsu Province (China); Cheng, Wei [School of Environment and Spatial Informatics, China University of Mining and Technology, Xuzhou 221008, Jiangsu Province (China); Zhang, Zi-feng; Li, Meng-qiu [Key Laboratory for Biotechnology on Medicinal Plants of Jiangsu Province, School of Life Science, Xuzhou Normal University, Xuzhou 221116, Jiangsu Province (China)



An In-depth Investigation of an Aluminum Chloride Retarded Mud Acid System on Sandstone Reservoirs  

E-Print Network [OSTI]

Sandstone acidizing using mud acid is a quick and complex process where dissolution and precipitation occur simultaneously. Retarded mud acids are less reactive with the rock reducing the reaction rate hence increased penetration into the formation...

Aneto, Nnenna



The Effect Of Viscoelastic Surfactants Used In Carbonate Matrix Acidizing On Wettability  

E-Print Network [OSTI]

Carbonate reservoirs are heterogeneous; therefore, proper acid placement/diversion is required to make matrix acid treatments effective. Viscoelastic surfactants (VES) are used as diverting agents in carbonate matrix acidizing. However...

Adejare, Oladapo


Note: This page contains sample records for the topic "nucleic acid base-pair" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


E-Print Network 3.0 - acid-induced bile duct Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Lithocholic Acid in the Regulation of Bile acid Detoxification, Synthesis... acid (LCA), a common ligand of VDR, FXR and PXR, on the regulation of proteins involved in bile...


E-Print Network 3.0 - acid sensor fxr Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Role of Lithocholic Acid in the Regulation of Bile acid Detoxification, Summary: acid (LCA), a common ligand of VDR, FXR and PXR, on the regulation of proteins involved in bile...


E-Print Network 3.0 - acid base regulation Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

12 Bio390 ACID-BASE thanks to Dr. J.F. Anderson, Summary: Bio390 ACID-BASE thanks to Dr. J.F. Anderson, Dept Zoology Univ of Florida, Gainesville... , there is more acid than base...


E-Print Network 3.0 - acids reduce body Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

that is causing thialkalosis. Thus, the Pa... Bio390 ACID-BASE thanks to Dr. J.F. Anderson, Dept Zoology Univ of Florida, Gainesville... " "acid" ) log( "salt" "acid"...


E-Print Network 3.0 - acid sequence analysis Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acid Analysis Page 77 An Introduction to Amino Acid Analysis Summary: as a whole, and ISO 17025:2005 Technical competence in amino acid analysis and protein sequencing... An...


A novel method for the purification of prephenic acid  

E-Print Network [OSTI]

in the K ? of components eluting av with prephenate from G-10/NH4HC03 column. . III Elemental analysis of barium prephenate. . Page 22 28 30 is P rfi ti of p phe ic acid f ~oos o c essa. . . 35 LIST OF FIGURES Figure Prephenic acid Page... of the degree of cross-linking, type of gel and eluting solvent polarity on the separation of cis and trans-cin- namic acids. They found that the degree of cross-linking influences the degree of adsorption, as defined by K . The K for Sephadex 1 av av G-10...

Harding, Tammy Tiner



Extraction of nitric acid, uranyl nitrate, and bismuth nitrate from aqueous nitric acid solutions with CMPO  

SciTech Connect (OSTI)

DOE sponsored development of the transuranium extraction (TRUEX) process for removing actinides from radioactive wastes. The solvent is a mixture of CMPO and TBP. Since the extraction characteristics of CMPO are not as well understood as those of TBP, the extraction of nitric acid, uranyl nitrate, and bismuth nitrate with CMPO (dissolved in n-dodecane) were studied. Results indicate that CMPO extracts nitric acid with a 1:1 stoichiometry; equilibrium constant is 2. 660{plus_minus}0.092 at 25 C, and extraction enthalpy is -5. 46{plus_minus}0.46 kcal/mol. Slope analysis indicates that uranyl nitrate extracts with a mixed equilibria of 1:1 and 2:1 stoichiometries in nearly equal proportion. Equil. constant of the 2: 1 extraction was 1.213 {times} 10{sup 6}{plus_minus}3.56 {times} 10{sup 4} at 25 C; reaction enthalpy was -9.610{plus_minus}0.594 kcal/mol. Nitration complexation constant is 8.412{plus_minus}0.579, with an enthalpy of -10.72{plus_minus}1.87 kcal/mol. Bismuth nitrate also extracts with a mixed equilibria of (perhaps) 1:1 and 2:1 stoichiometries. A 2:1 extraction equilibrium and a nitrate complexation adequately model the data. Kinetics and enthalpies were also measured.

Spencer, B.B.



E-Print Network 3.0 - amino acid restriction Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of amino acid encoding to present amino acid sequences in the most beneficial way for machine learning... are calculated from position specific ... Source: Bodn, Mikael - School...


E-Print Network 3.0 - acid-metabolizing enzyme cytochrome Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

on metabolic enzyme activities in the freshwater Summary: elegans. These include enzymes of carbohydrate, fatty acid, adenylate, and amino acid metabolism. Anoxia... recovery...


E-Print Network 3.0 - acid desaturase gene Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

fatty acids. Mutagenesis and selection in E. coli yielded variants... . Cahoon EB, Shanklin J: Substrate-dependent mutant complementation to select fatty acid desaturase......


E-Print Network 3.0 - acid suppresses uv-b-induced Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

are discussed in relation to the Summary: in Chapter 3, carboxylic acids are the actual additives responsible for the suppression of catalase... excess of carboxylic acid in...


acid overcomes bcl-2-mediated: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

preservation A Rauramaa A Tommila J Ltd, Espoo Reseach Centre, PO Box 44, 02271 Espoo, Finland Formic acid is known to improve silage hygienic quality. Formic acid based...


E-Print Network 3.0 - acids electronic resource Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Dicarboxylic Acid Clusters with Water Molecules Summary: Cluster Phase Chemistry: Gas-Phase Reactions of Anionic Sodium Salts of Dicarboxylic Acid Clusters... -phase...


E-Print Network 3.0 - acid electronic resource Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Dicarboxylic Acid Clusters with Water Molecules Summary: Cluster Phase Chemistry: Gas-Phase Reactions of Anionic Sodium Salts of Dicarboxylic Acid Clusters... -phase...


E-Print Network 3.0 - acid derivative entrapped Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2003 ) Biodegradable hydrophilic polymers poly-lactic-co-glycolic acid (PLGA) and polyethylene oxide... -co-lactic acid (PELA) were used to encapsulate a small hydrophilic...


E-Print Network 3.0 - acid protects human Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Introduction: Scope of the Thesis Ansar A. Khan Summary: , 155). The major products of LCA metabolism in human and rat liver microsomes are hyodeoxycholic acid... bile acids such...


E-Print Network 3.0 - acid dicamba dicloran Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

weed control. Acetic acid (vinegar) WeedGrass Killer, Natural... weed control. Ammoniated soap of fatty acid Garden Safe Weed & Grass ... Source: Liskiewicz, Maciej -...


E-Print Network 3.0 - acid sequence determination Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by Scatchard analysis of 3 H nicotinic acid binding saturation isotherms. Relative cell surface... sequences from GPR109B. B, nicotinic acid- and ... Source: Hall, Randy A -...


E-Print Network 3.0 - amino acid-linked dialkyl Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Amino acid may raise risk... tested blood for homocysteine, an amino acid known to mark heart ... Source: Portland State University, Center for Lakes and Reservoirs...


E-Print Network 3.0 - acid suppression predict Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

the situation... the cloud condensation nucleus activity of organic acids on the basis of surface tension and osmolality... in the solutions of organic acids. The surface tension...