National Library of Energy BETA

Sample records for nuclear chain reaction

  1. Enrico Fermi Achieves First Self Sustain Nuclear Chain Reaction...

    National Nuclear Security Administration (NNSA)

    Self Sustain Nuclear Chain Reaction Chicago, IL Metallurgical Laboratory scientists led by Enrico Fermi achieve the first self-sustained nuclear chain reaction in pile...

  2. Enrico Fermi Achieves First Self Sustain Nuclear Chain Reaction | National

    National Nuclear Security Administration (NNSA)

    Nuclear Security Administration Enrico Fermi Achieves First Self Sustain Nuclear Chain Reaction | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets

  3. Enrico Fermi and the First Self-Sustaining Nuclear Chain Reaction

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Enrico Fermi and the First Self-Sustaining Nuclear Chain Reaction Resources with Additional Information * Fermi Honored * Atoms for Peace * Centennial of Birth * Stamp Patents * Audio/Video Clips * Selected by NSTA for SciLinks "The President of the United States of America ... for especially meritorious contributions to the development, use, or control of atomic energy, grant[s] an award of merit to Enrico Fermi for his contributions to basic neutron physics and the achievement of the

  4. Polymerase chain reaction system

    DOE Patents [OSTI]

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  5. Lesson 5 - Fission and Chain Reactions | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Lesson 5 - Fission and Chain Reactions Lesson Four showed how the nuclei of atoms store energy and how unstable atoms decay and release energy. How do nuclear engineers use this ...

  6. Dual phase multiplex polymerase chain reaction

    DOE Patents [OSTI]

    Pemov, Alexander (Charlottesville, VA); Bavykin, Sergei (Darien, IL)

    2008-10-07

    Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

  7. Integrated polymerase chain reaction/electrophoresis instrument

    DOE Patents [OSTI]

    Andresen, Brian D. (Livermore, CA)

    2000-01-01

    A new approach and instrument for field identification of micro-organisms and DNA fragments using a small and disposable device containing integrated polymerase chain reaction (PCR) enzymatic reaction wells, attached capillary electrophoresis (CE) channels, detectors, and read-out all on/in a small hand-held package. The analysis instrument may be made inexpensively, for example, of plastic, and thus is disposable, which minimizes cross contamination and the potential for false positive identification between samples. In addition, it is designed for multiple users with individual applications. The integrated PCR/CE is manufactured by the PCR well and CE channels are "stamped" into plastic depressions where conductive coatings are made in the wells and ends of the CE microchannels to carry voltage and current to heat the PCR reaction mixtures and simultaneously draw DNA bands up the CE channels. Light is transmitted through the instrument at appropriate points and detects PCR bands and identifies DNA fragments by size (retention time) and quantifies each by the amount of light generated as each phototransistor positioned below each CE channel detects a passing band. The instrument is so compact that at least 100 PCR/CE reactions/analyses can be performed easily on one detection device.

  8. supply chain | National Nuclear Security Administration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    supply chain | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog

  9. maritime supply chain | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    maritime supply chain | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at

  10. First-Hand Recollections of the First Self-Sustaining Chain Reaction |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Department of Energy First-Hand Recollections of the First Self-Sustaining Chain Reaction First-Hand Recollections of the First Self-Sustaining Chain Reaction August 3, 2012 - 4:53pm Addthis On December 2, 1942, 49 scientists, led by Enrico Fermi, made history when Chicago Pile 1 (CP-1) went critical and produced the world's first self-sustaining, controlled nuclear chain reaction. Seventy years later, two of the last surviving CP-1 pioneers, Harold Agnew and Warren Nyer, recall that

  11. Nuclear reactions from lattice QCD

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Briceño, Raúl A.; Davoudi, Zohreh; Luu, Thomas C.

    2015-01-13

    In this study, one of the overarching goals of nuclear physics is to rigorously compute properties of hadronic systems directly from the fundamental theory of strong interactions, Quantum Chromodynamics (QCD). In particular, the hope is to perform reliable calculations of nuclear reactions which will impact our understanding of environments that occur during big bang nucleosynthesis, the evolution of stars and supernovae, and within nuclear reactors and high energy/density facilities. Such calculations, being truly ab initio, would include all two-nucleon and three- nucleon (and higher) interactions in a consistent manner. Currently, lattice QCD provides the only reliable option for performing calculationsmore » of some of the low-energy hadronic observables. With the aim of bridging the gap between lattice QCD and nuclear many-body physics, the Institute for Nuclear Theory held a workshop on Nuclear Reactions from Lattice QCD on March 2013. In this review article, we report on the topics discussed in this workshop and the path planned to move forward in the upcoming years.« less

  12. Nuclear reactions from lattice QCD

    SciTech Connect (OSTI)

    Briceño, Raúl A.; Davoudi, Zohreh; Luu, Thomas C.

    2015-01-13

    In this study, one of the overarching goals of nuclear physics is to rigorously compute properties of hadronic systems directly from the fundamental theory of strong interactions, Quantum Chromodynamics (QCD). In particular, the hope is to perform reliable calculations of nuclear reactions which will impact our understanding of environments that occur during big bang nucleosynthesis, the evolution of stars and supernovae, and within nuclear reactors and high energy/density facilities. Such calculations, being truly ab initio, would include all two-nucleon and three- nucleon (and higher) interactions in a consistent manner. Currently, lattice QCD provides the only reliable option for performing calculations of some of the low-energy hadronic observables. With the aim of bridging the gap between lattice QCD and nuclear many-body physics, the Institute for Nuclear Theory held a workshop on Nuclear Reactions from Lattice QCD on March 2013. In this review article, we report on the topics discussed in this workshop and the path planned to move forward in the upcoming years.

  13. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices (Conference) |

    Office of Scientific and Technical Information (OSTI)

    SciTech Connect Conference: Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices Citation Details In-Document Search Title: Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices × You are accessing a document from the Department of Energy's (DOE) SciTech Connect. This site is a product of DOE's Office of Scientific and Technical Information (OSTI) and is provided as a public service. Visit OSTI to utilize additional information resources in energy science and technology. A paper copy

  14. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOE Patents [OSTI]

    Nasarabadi, Shanavaz (Livermore, CA)

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.

  15. Nuclear Structure and Nuclear Reactions | Argonne Leadership...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    x2 - triaxiality, and x3 - pairing correlations. Calculations were carried out using nuclear density functional theory. The collective action was minimized using the dynamical...

  16. Nuclear reaction and decay data evaluation capabilities at LANL...

    Office of Scientific and Technical Information (OSTI)

    Nuclear reaction and decay data evaluation capabilities at LANL Citation Details In-Document Search Title: Nuclear reaction and decay data evaluation capabilities at LANL You...

  17. Calculation of nuclear reaction cross sections on excited nuclei...

    Office of Scientific and Technical Information (OSTI)

    Calculation of nuclear reaction cross sections on excited nuclei with the coupled-channels method Citation Details In-Document Search Title: Calculation of nuclear reaction cross ...

  18. Experimental nuclear reaction data collection EXFOR

    SciTech Connect (OSTI)

    Semkova, V.; Otuka, N.; Simakov, S. P.; Zerkin, V.

    2011-07-01

    The International Network of Nuclear Reaction Data Centres (NRDC) constitutes a worldwide cooperation of 14 nuclear data centres. The main activity of the NRDC Network is collection and compilation of experimental nuclear reaction cross section data and the related bibliographic information in the EXFOR and CINDA databases as well as dissemination of nuclear reaction data and associated documentation to users. The database contains information and numerical data from more than about 19000 experiments consisting of more than 140000 datasets. EXFOR is kept up to date by constantly adding newly published experimental information. Tools developed for data dissemination utilise modern database technologies with fast online capabilities over the Internet. Users are provided with sophisticated search options, a user-friendly retrieval interface for downloading data in different formats, and additional output options such as improved data plotting capabilities. The present status of the EXFOR database will be presented together with the latest development for data access and retrieval. (authors)

  19. Nested methylation-specific polymerase chain reaction cancer detection method

    DOE Patents [OSTI]

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  20. maritime supply chain | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    National Nuclear Security Administration (DOENNSA) and the U.K. Department of Energy and Climate Change concluded a workshop at Wilton Park, About This Site Budget IG Web Policy...

  1. Random-matrix approach to the statistical compound nuclear reaction...

    Office of Scientific and Technical Information (OSTI)

    nuclear reaction at low energies using the Monte-Carlo technique Citation Details In-Document Search Title: Random-matrix approach to the statistical compound nuclear ...

  2. Hadron Cancer Therapy: Role of Nuclear Reactions

    DOE R&D Accomplishments [OSTI]

    Chadwick, M. B.

    2000-06-20

    Recently it has become feasible to calculate energy deposition and particle transport in the body by proton and neutron radiotherapy beams, using Monte Carlo transport methods. A number of advances have made this possible, including dramatic increases in computer speeds, a better understanding of the microscopic nuclear reaction cross sections, and the development of methods to model the characteristics of the radiation emerging from the accelerator treatment unit. This paper describes the nuclear reaction mechanisms involved, and how the cross sections have been evaluated from theory and experiment, for use in computer simulations of radiation therapy. The simulations will allow the dose delivered to a tumor to be optimized, whilst minimizing the dos given to nearby organs at risk.

  3. Numerical simulations for low energy nuclear reactions including...

    Office of Scientific and Technical Information (OSTI)

    Numerical simulations for low energy nuclear reactions including direct channels to validate statistical models Citation Details In-Document Search Title: Numerical simulations for...

  4. Nuclear waste vitrification efficiency: cold cap reactions

    SciTech Connect (OSTI)

    Hrma, Pavel R.; Kruger, Albert A.; Pokorny, Richard

    2012-12-15

    The cost and schedule of nuclear waste treatment and immobilization are greatly affected by the rate of glass production. Various factors influence the performance of a waste-glass melter. One of the most significant, and also one of the least understood, is the process of batch melting. Studies are being conducted to gain fundamental understanding of the batch reactions, particularly those that influence the rate of melting, and models are being developed to link batch makeup and melter operation to the melting rate. Batch melting takes place within the cold cap, i.e., a batch layer floating on the surface of molten glass. The conversion of batch to glass consists of various chemical reactions, phase transitions, and diffusion-controlled processes. These include water evaporation (slurry feed contains as high as 60% water), gas evolution, the melting of salts, the formation of borate melt, reactions of borate melt with molten salts and with amorphous oxides (Fe2O3 and Al2O3), the formation of intermediate crystalline phases, the formation of a continuous glass-forming melt, the growth and collapse of primary foam, and the dissolution of residual solids. To this list we also need to add the formation of secondary foam that originates from molten glass but accumulates on the bottom of the cold cap. This study presents relevant data obtained for a high-level-waste melter feed and introduces a one-dimensional (1D) mathematical model of the cold cap as a step toward an advanced three-dimensional (3D) version for a complete model of the waste glass melter. The 1D model describes the batch-to-glass conversion within the cold cap as it progresses in a vertical direction. With constitutive equations and key parameters based on measured data, and simplified boundary conditions on the cold-cap interfaces with the glass melt and the plenum space of the melter, the model provides sensitivity analysis of the response of the cold cap to the batch makeup and melter conditions. The model demonstrates that batch foaming has a decisive influence on the rate of melting. Understanding the dynamics of the foam layer at the bottom of the cold cap and the heat transfer through it appears crucial for a reliable prediction of the rate of melting as a function of the melter-feed makeup and melter operation parameters. Although the study is focused on a batch for waste vitrification, the authors expect that the outcome will also be relevant for commercial glass melting.

  5. NUCLEAR WASTE VITRIFICATION EFFICIENCY COLD CAP REACTIONS

    SciTech Connect (OSTI)

    KRUGER AA; HRMA PR; POKORNY R

    2011-07-29

    The cost and schedule of nuclear waste treatment and immobilization are greatly affected by the rate of glass production. Various factors influence the performance of a waste-glass melter. One of the most significant, and also one of the least understood, is the process of batch melting. Studies are being conducted to gain fundamental understanding of the batch reactions, particularly those that influence the rate of melting, and models are being developed to link batch makeup and melter operation to the melting rate. Batch melting takes place within the cold cap, i.e., a batch layer floating on the surface of molten glass. The conversion of batch to glass consists of various chemical reactions, phase transitions, and diffusion-controlled processes. These include water evaporation (slurry feed contains as high as 60% water), gas evolution, the melting of salts, the formation of borate melt, reactions of borate melt with molten salts and with amorphous oxides (Fe{sub 2}O{sub 3} and Al{sub 2}O{sub 3}), the formation of intermediate crystalline phases, the formation of a continuous glass-forming melt, the growth and collapse of primary foam, and the dissolution of residual solids. To this list we also need to add the formation of secondary foam that originates from molten glass but accumulates on the bottom of the cold cap. This study presents relevant data obtained for a high-level-waste melter feed and introduces a one-dimensional (1D) mathematical model of the cold cap as a step toward an advanced three-dimensional (3D) version for a complete model of the waste glass melter. The 1D model describes the batch-to-glass conversion within the cold cap as it progresses in a vertical direction. With constitutive equations and key parameters based on measured data, and simplified boundary conditions on the cold-cap interfaces with the glass melt and the plenum space of the melter, the model provides sensitivity analysis of the response of the cold cap to the batch makeup and melter conditions. The model demonstrates that batch foaming has a decisive influence on the rate of melting. Understanding the dynamics of the foam layer at the bottom of the cold cap and the heat transfer through it appears crucial for a reliable prediction of the rate of melting as a function of the melter-feed makeup and melter operation parameters. Although the study is focused on a batch for waste vitrification, the authors expect that the outcome will also be relevant for commercial glass melting.

  6. Method of carbon chain extension using novel aldol reaction

    DOE Patents [OSTI]

    Silks, Louis A; Gordon, John C; Wu, Ruilan; Hanson, Susan Kloek

    2013-07-30

    Method of producing C.sub.8-C.sub.15 hydrocarbons. comprising providing a ketone starting material; providing an aldol starting material comprising chloromethylfurfural; mixing the ketone starting material and the aldol starting material in a reaction in the presence of a proline-containing catalyst selected from the group consisting of Zn(Pro).sub.2, Yb(Pro).sub.3, and combinations thereof, or a catalyst having one of the structures (I), (II) or (III), and in the presence of a solvent, wherein the solvent comprises water and is substantially free of organic solvents, where (I), (II) and (III) respectively are: ##STR00001## where R.sub.1 is a C.sub.1-C.sub.6 alkyl moiety, X=(OH) and n=2. ##STR00002## In (III), X may be CH.sub.2, sulfur or selenium, M may be Zn, Mg, or a lanthanide, and R.sub.1 and R.sub.2 each independently may be a methyl, ethyl, phenyl moiety.

  7. Method of carbon chain extension using novel aldol reaction

    DOE Patents [OSTI]

    Silks, Louis A; Gordon, John C; Wu, Ruilan; Hangson, Susan Kloek

    2013-08-13

    Method of producing C.sub.8-C.sub.15 hydrocarbons comprising providing a ketone starting material; providing an aldol starting material comprising hydroxymethylfurfural; mixing the ketone starting material and the aldol starting material in a reaction in the presence of a proline-containing catalyst selected from the group consisting of Zn(Pro).sub.2, Yb(Pro).sub.2, and combinations thereof, or a catalyst having one of the structures (I), (II) or (III), and in the presence of a solvent, wherein the solvent comprises water and is substantially free of organic solvents, where (I), (II) and (III) respectively are: ##STR00001## where R.sub.1 is a C.sub.1-C.sub.6 alkyl moiety, X=(OH) and n=2. ##STR00002## In (III), X may be CH.sub.2, sulfur or selenium, M may be Zn, Mg, or a lanthanide, and R.sub.1 and R.sub.2 each independently may be a methyl, ethyl, phenyl moiety.

  8. Nuclear reaction and decay data evaluation capabilities at LANL

    Office of Scientific and Technical Information (OSTI)

    (Conference) | SciTech Connect Conference: Nuclear reaction and decay data evaluation capabilities at LANL Citation Details In-Document Search Title: Nuclear reaction and decay data evaluation capabilities at LANL Authors: Kawano, Toshihiko [1] + Show Author Affiliations Los Alamos National Laboratory [Los Alamos National Laboratory Publication Date: 2014-05-22 OSTI Identifier: 1132542 Report Number(s): LA-UR-14-23634 DOE Contract Number: AC52-06NA25396 Resource Type: Conference Resource

  9. Numerical simulations for low energy nuclear reactions including direct

    Office of Scientific and Technical Information (OSTI)

    channels to validate statistical models (Conference) | SciTech Connect Numerical simulations for low energy nuclear reactions including direct channels to validate statistical models Citation Details In-Document Search Title: Numerical simulations for low energy nuclear reactions including direct channels to validate statistical models Authors: Kawano, Toshihiko [1] + Show Author Affiliations Los Alamos National Laboratory [Los Alamos National Laboratory Publication Date: 2014-01-08 OSTI

  10. Toward A Fundamental Understanding Of Nuclear Reactions And Exotic Nuclei

    Office of Scientific and Technical Information (OSTI)

    (Conference) | SciTech Connect Toward A Fundamental Understanding Of Nuclear Reactions And Exotic Nuclei Citation Details In-Document Search Title: Toward A Fundamental Understanding Of Nuclear Reactions And Exotic Nuclei Authors: Quaglioni, S ; Hupin, G ; Langhammer, J ; Romero-Redondo, C ; Schuster, M D ; Johnson, C W ; Navratil, P ; Roth, R Publication Date: 2014-09-19 OSTI Identifier: 1165824 Report Number(s): LLNL-PROC-661058

  11. Toward A Fundamental Understanding Of Nuclear Reactions And Exotic Nuclei

    Office of Scientific and Technical Information (OSTI)

    (Conference) | SciTech Connect Toward A Fundamental Understanding Of Nuclear Reactions And Exotic Nuclei Citation Details In-Document Search Title: Toward A Fundamental Understanding Of Nuclear Reactions And Exotic Nuclei × You are accessing a document from the Department of Energy's (DOE) SciTech Connect. This site is a product of DOE's Office of Scientific and Technical Information (OSTI) and is provided as a public service. Visit OSTI to utilize additional information resources in energy

  12. Theoretical studies in nuclear reactions and nuclear structure. Progress report

    SciTech Connect (OSTI)

    Not Available

    1992-05-01

    Research in the Maryland Nuclear Theory Group focusses on problems in four basic areas of current relevance. Hadrons in nuclear matter; the structure of hadrons; relativistic nuclear physics and heavy ion dynamics and related processes. The section on hadrons in nuclear matter groups together research items which are aimed at exploring ways in which the properties of nucleons and the mesons which play a role in the nuclear force are modified in the nuclear medium. A very interesting result has been the finding that QCD sum rules supply a new insight into the decrease of the nucleon`s mass in the nuclear medium. The quark condensate, which characterizes spontaneous chiral symmetry breaking of the late QCD vacuum, decreases in nuclear matter and this is responsible for the decrease of the nucleon`s mass. The section on the structure of hadrons contains progress reports on our research aimed at understanding the structure of the nucleon. Widely different approaches are being studied, e.g., lattice gauge calculations, QCD sum rules, quark-meson models with confinement and other hedgehog models. A major goal of this type of research is to develop appropriate links between nuclear physics and QCD. The section on relativistic nuclear physics represents our continuing interest in developing an appropriate relativistic framework for nuclear dynamics. A Lorentz-invariant description of the nuclear force suggests a similar decrease of the nucleon`s mass in the nuclear medium as has been found from QCD sum rules. Work in progress extends previous successes in elastic scattering to inelastic scattering of protons by nuclei. The section on heavy ion dynamics and related processes reports on research into the e{sup +}e{sup {minus}} problem and heavy ion dynamics.

  13. Theoretical studies in nuclear reactions and nuclear structure

    SciTech Connect (OSTI)

    Not Available

    1992-05-01

    Research in the Maryland Nuclear Theory Group focusses on problems in four basic areas of current relevance. Hadrons in nuclear matter; the structure of hadrons; relativistic nuclear physics and heavy ion dynamics and related processes. The section on hadrons in nuclear matter groups together research items which are aimed at exploring ways in which the properties of nucleons and the mesons which play a role in the nuclear force are modified in the nuclear medium. A very interesting result has been the finding that QCD sum rules supply a new insight into the decrease of the nucleon's mass in the nuclear medium. The quark condensate, which characterizes spontaneous chiral symmetry breaking of the late QCD vacuum, decreases in nuclear matter and this is responsible for the decrease of the nucleon's mass. The section on the structure of hadrons contains progress reports on our research aimed at understanding the structure of the nucleon. Widely different approaches are being studied, e.g., lattice gauge calculations, QCD sum rules, quark-meson models with confinement and other hedgehog models. A major goal of this type of research is to develop appropriate links between nuclear physics and QCD. The section on relativistic nuclear physics represents our continuing interest in developing an appropriate relativistic framework for nuclear dynamics. A Lorentz-invariant description of the nuclear force suggests a similar decrease of the nucleon's mass in the nuclear medium as has been found from QCD sum rules. Work in progress extends previous successes in elastic scattering to inelastic scattering of protons by nuclei. The section on heavy ion dynamics and related processes reports on research into the e{sup +}e{sup {minus}} problem and heavy ion dynamics.

  14. Direct reactions for nuclear structure and nuclear astrophysics

    SciTech Connect (OSTI)

    Jones, Katherine Louise

    2014-12-18

    Direct reactions are powerful probes for studying the atomic nucleus. Modern direct reaction studies are illuminating both the fundamental nature of the nucleus and its role in nucleosynthetic processes occurring in the cosmos. This report covers experiments using knockout reactions on neutron-deficient fragmentation beams, transfer reactions on fission fragment beams, and theoretical sensitivity studies relating to the astrophysical r-process. Results from experiments on 108,106Sn at the NSCL, and on 131Sn at HRIBF are presented as well as the results from the nucleosynthesis study.

  15. EXFOR SYSTEMS MANUAL NUCLEAR REACTION DATA EXCHANGE FORMAT.

    SciTech Connect (OSTI)

    MCLANE,V.; NUCLEAR DATA CENTER NETWORK

    2000-05-19

    EXFOR is an exchange format designed to allow transmission of nuclear reaction data between the members of the Nuclear Data Centers Network. This document has been written for use by the members of the Network and includes matters of procedure and protocol, as well as detailed rules for the compilation of data. Users may prefer to consult EXFOR Basics' for a brief description of the format.

  16. Supply Chain Management Center | National Nuclear Security Administration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog Home / Supply

  17. Towards a More Complete and Accurate Experimental Nuclear Reaction Data Library (EXFOR): International Collaboration Between Nuclear Reaction Data Centres (NRDC)

    SciTech Connect (OSTI)

    Otuka, N.; Dupont, E.; Semkova, V.; Pritychenko, B.; Blokhin, A.I.; Aikawa, M.; Babykina, S.; Bossant, M.; Chen, G.; Dunaeva, S.; Forrest, R.A.; Fukahori, T.; Furutachi, N.; Ganesan, S.; Ge, Z.; Gritzay, O.O.; Herman, M.; Hlavač, S.; and others

    2014-06-15

    The International Network of Nuclear Reaction Data Centres (NRDC) coordinated by the IAEA Nuclear Data Section (NDS) successfully collaborates in the maintenance and development of the EXFOR library. As the scope of published data expands (e.g. to higher energy, to heavier projectile) to meet the needs of research and applications, it has become a challenging task to maintain both the completeness and accuracy of the EXFOR library. Evolution of the library highlighting recent developments is described.

  18. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOE Patents [OSTI]

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  19. Do nuclear reactions take place under chemical stimulation?

    SciTech Connect (OSTI)

    Bockris, J.O.; Lin, G.H.; Bush, R.T.

    1996-09-01

    Several examples of nuclear reactions occurring under the stimulation of chemical type energies are given. The production of tritium from deuterium in Pd has more than 100 published confirmations. Three models suggest circumstances such that barriers between nucleii may become transparent. 24 refs.

  20. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    SciTech Connect (OSTI)

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  1. Fusion reactions in nuclear astrophysics: The MUSIC approach

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    reactions in nuclear astrophysics: The MUSIC approach The MUSIC approach Sergio Almaraz-Calderon Sergio Almaraz-Calderon Physics Division Argonne National Laboratory 2014 ATLAS USER'S MEETING 05/15/2014 Carbon burning reactions in the stars Carbon burning in massive stars Ignition phase of Type Ia supernovae X-ray binaries NASA/CXC/PSU/L University of Chicago Flash Center S. Almaraz-Calderon ATLAS user's meeting 05/15/2014 H. Schatz X-Ray Bursts and Superbursts ● H and He burning (rp-process)

  2. Sigma: Web Retrieval Interface for Nuclear Reaction Data

    SciTech Connect (OSTI)

    Pritychenko,B.; Sonzogni, A.A.

    2008-06-24

    The authors present Sigma, a Web-rich application which provides user-friendly access in processing and plotting of the evaluated and experimental nuclear reaction data stored in the ENDF-6 and EXFOR formats. The main interface includes browsing using a periodic table and a directory tree, basic and advanced search capabilities, interactive plots of cross sections, angular distributions and spectra, comparisons between evaluated and experimental data, computations between different cross section sets. Interactive energy-angle, neutron cross section uncertainties plots and visualization of covariance matrices are under development. Sigma is publicly available at the National Nuclear Data Center website at www.nndc.bnl.gov/sigma.

  3. Nuclear Reaction Cross Sections Database at BNL | U.S. DOE Office...

    Office of Science (SC) Website

    Reaction Cross Sections Database at BNL Nuclear Physics (NP) NP Home About Research Facilities Science Highlights Benefits of NP Applications of Nuclear Science Applications of ...

  4. Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

    DOE Patents [OSTI]

    Chen, Xian (Los Alamos, NM); Gupta, Goutam (Santa Fe, NM); Bradbury, E. Morton (Santa Fe, NM)

    2001-01-01

    Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

  5. Solving The Long-Standing Problem Of Low-Energy Nuclear Reactions...

    Office of Scientific and Technical Information (OSTI)

    Energy Nuclear Reactions At The Highest Microscopic Level:Annual Continuation And Progress ... Title: Solving The Long-Standing Problem Of Low-Energy Nuclear Reactions At The Highest ...

  6. Experimental Observation of Nuclear Reactions in Palladium and Uranium

    SciTech Connect (OSTI)

    J. Dufour; D. Murat; X. Dufour; J. Foos

    2001-11-12

    By submitting various metals (Pd, U) containing hydrogen (from 2000 to 700 000 atoms of hydrogen for 1 000 000 atoms of the host metal) to the combined action of electrical currents and magnetic fields, we have observed a sizeable exothermal effect (from 0.1 to 8 W for 500 mg of metal used). This effect is beyond experimental errors, the energy output being typically 130 to 250{percent} of the energy input and not of chemical origin (exothermal effect in the range of 7000 MJ/mol of metal in the case of palladium and of 60 MJ/mol in the case of uranium). New chemical species also appear in the processes metals. It has been shown by a QED calculation that resonances of long lifetime (s), nuclear dimensions (fm), and low energy of formation (eV) could exist. This concept seems to look like the 'shrunken hydrogen atoms' proposed by various authors. It is indeed very different in two ways (a) being a metastable state, it needs energy to be formed (a few eV) and reverts to normal hydrogen after a few seconds, liberating back its energy of formation (it is thus not the source of the energy observed); (b) its formation can be described as the electron spin/proton nuclear spin interaction becoming first order in the lattice environment (whereas it is third order in a normal hydrogen atom). Moreover, we consider that the hydrex cannot yield a neutron because this reaction is strongly endothermic. To explain our results, we put forward the following working hypothesis: In a metal lattice and under proper conditions, the formation of such resonances (metastable state) could be favored. We propose to call them HYDREX, and we assume that they are actually formed in cold fusion (CF) and low-energy nuclear reaction (LENR) experiments. Once formed, a number of HYDREX could gather around a nucleus of the lattice to form a cluster of nuclear size and of very long life time compared to nuclear time (10{sup -22} s). In this cluster, nuclear rearrangements could take place, yielding mainly {sup 4}He, nuclei of atomic masses smaller than that of the host metal and small amounts of {sup 3}He and tritium. Because this nuclear rearrangement is a many-body reaction, the products formed should be stable products in their ground states, most of the reaction energy being carried away as kinetic energy by the alpha particles formed. The HYDREX hypothesis describes CF and LENR as fundamentally the same phenomenon, which we propose to call NUCLEAR CATALYSIS. Depending on the conditions of a CF or LENR experiment, the products formed may look very different, but the initial step is always the synthesis of HYDREX. When this synthesis is mastered, CF and LENR experiments should become fully reproducible.

  7. Calculation of nuclear reaction cross sections on excited nuclei with the

    Office of Scientific and Technical Information (OSTI)

    coupled-channels method (Journal Article) | SciTech Connect Calculation of nuclear reaction cross sections on excited nuclei with the coupled-channels method Citation Details In-Document Search Title: Calculation of nuclear reaction cross sections on excited nuclei with the coupled-channels method We calculate nuclear cross sections on excited nuclei in the fast neutron energy range. We partition the whole process into two contributions: the direct reaction part and the compound nuclear

  8. A comparative analysis of accident risks in fossil, hydro, and nuclear energy chains

    SciTech Connect (OSTI)

    Burgherr, P.; Hirschberg, S.

    2008-07-01

    This study presents a comparative assessment of severe accident risks in the energy sector, based on the historical experience of fossil (coal, oil, natural gas, and LPG (Liquefied Petroleum Gas)) and hydro chains contained in the comprehensive Energy-related Severe Accident Database (ENSAD), as well as Probabilistic Safety Assessment (PSA) for the nuclear chain. Full energy chains were considered because accidents can take place at every stage of the chain. Comparative analyses for the years 1969-2000 included a total of 1870 severe ({>=} 5 fatalities) accidents, amounting to 81,258 fatalities. Although 79.1% of all accidents and 88.9% of associated fatalities occurred in less developed, non-OECD countries, industrialized OECD countries dominated insured losses (78.0%), reflecting their substantially higher insurance density and stricter safety regulations. Aggregated indicators and frequency-consequence (F-N) curves showed that energy-related accident risks in non-OECD countries are distinctly higher than in OECD countries. Hydropower in non-OECD countries and upstream stages within fossil energy chains are most accident-prone. Expected fatality rates are lowest for Western hydropower and nuclear power plants; however, the maximum credible consequences can be very large. Total economic damages due to severe accidents are substantial, but small when compared with natural disasters. Similarly, external costs associated with severe accidents are generally much smaller than monetized damages caused by air pollution.

  9. Ab Initio Nuclear Structure and Reaction Calculations for Rare Isotopes

    SciTech Connect (OSTI)

    Draayer, Jerry P.

    2014-09-28

    We have developed a novel ab initio symmetry-adapted no-core shell model (SA-NCSM), which has opened the intermediate-mass region for ab initio investigations, thereby providing an opportunity for first-principle symmetry-guided applications to nuclear structure and reactions for nuclear isotopes from the lightest p-shell systems to intermediate-mass nuclei. This includes short-lived proton-rich nuclei on the path of X-ray burst nucleosynthesis and rare neutron-rich isotopes to be produced by the Facility for Rare Isotope Beams (FRIB). We have provided ab initio descriptions of high accuracy for low-lying (including collectivity-driven) states of isotopes of Li, He, Be, C, O, Ne, Mg, Al, and Si, and studied related strong- and weak-interaction driven reactions that are important, in astrophysics, for further understanding stellar evolution, X-ray bursts and triggering of s, p, and rp processes, and in applied physics, for electron and neutrino-nucleus scattering experiments as well as for fusion ignition at the National Ignition Facility (NIF).

  10. Probing Nuclear Reactions in Stars | U.S. DOE Office of Science (SC)

    Office of Science (SC) Website

    Probing Nuclear Reactions in Stars Nuclear Physics (NP) NP Home About Research Facilities Science Highlights Benefits of NP Funding Opportunities Nuclear Science Advisory Committee (NSAC) Community Resources Contact Information Nuclear Physics U.S. Department of Energy SC-26/Germantown Building 1000 Independence Ave., SW Washington, DC 20585 P: (301) 903-3613 F: (301) 903-3833 E: Email Us More Information » 11.01.15 Probing Nuclear Reactions in Stars Novel experiments measure unusual

  11. Resilience of nuclear matter in light ion induced reactions

    SciTech Connect (OSTI)

    Colonna, M.; Cugnon, J.; Pollacco, E.C.

    1997-03-01

    Cavitation and heating of the target nucleus in the first instances of {sup 3}He-induced collisions in the GeV/nucleon range are investigated in an intranuclear cascade model for the formation of this structure and a stochastic one-body dynamics calculation to study its evolution. The hard collisions having essentially ceased when the structure is fully developed, the latter model is particularly suited to study the possible breakup of the system. It is shown, however, that the target recovers a spherical shape rather rapidly, and has thus a good chance to decay by standard evaporation, justifying the use of a cascade + evaporation model to analyze the data. It is also shown that the system has to be much more modified to break up into pieces instead of recovering a compact shape: in these reactions, it is thus expected that nuclear matter is resilient to shape deformation and thermal excitation. Arguments are given to explain that expansion of the system, not important in these reactions, is required to overcome this resilience. {copyright} {ital 1997} {ital The American Physical Society}

  12. Solving The Long-Standing Problem Of Low-Eneregy Nuclear Reactions...

    Office of Scientific and Technical Information (OSTI)

    Eneregy Nuclear Reactions At The Highest Microscopic Level: Annual Continuation And Progress Report Citation Details In-Document Search Title: Solving The Long-Standing Problem Of...

  13. Solving The Long-Standing Problem Of Nuclear Reactions At The...

    Office of Scientific and Technical Information (OSTI)

    Technical Report: Solving The Long-Standing Problem Of Nuclear Reactions At The Highest Microscopic Level: Annual Continuation And Progress Report Citation Details In-Document...

  14. Solving The Long-Standing Problem Of Low-Energy Nuclear Reactions...

    Office of Scientific and Technical Information (OSTI)

    Energy Nuclear Reactions At The Highest Microscopic Level:Annual Continuation And Progress Report Citation Details In-Document Search Title: Solving The Long-Standing Problem Of...

  15. Establishing a value chain for human factors in nuclear power plantcontrol room modernization

    SciTech Connect (OSTI)

    Joe, Jeffrey Clark; Thomas, Kenneth David; Boring, Ronald Laurids

    2015-07-01

    Commercial nuclear power plants in the United States (U.S.) have operated reliably and efficiently for decades. With the life extensions of plants now being planned for operation beyond their original operating licenses, there are opportunities to achieve even greater efficiencies, while maintaining high operational reliabilities, with strategic, risk- and economically-informed, upgrades to plant systems and infrastructure. The U.S. Department of Energys Light Water Reactor Sustainability (LWRS) program supports the commercial nuclear industrys modernization efforts through research and development (R&D) activities across many areas to help establish the technical and economic bases for modernization activities. The Advanced Instrumentation, Information, and Control Systems Technologies pathway is one R&D focus area for the LWRS program, and has researchers at Idaho National Laboratory working with select utility partners to use human factors and instrumentation and controls R&D to help modernize the plants main control room. However, some in the nuclear industry have not been as enthusiastic about using human factors R&D to inform life extension decision making. Part of the reason for this may stem from uncertainty decision-makers have regarding how human factors fits into the value chain for nuclear power plant control room modernization. This paper reviews past work that has attempted to demonstrate the value of human factors, and then describes the value chain concept, how it applies to control room modernization, and then makes a case for how and why human factors is an essential link in the modernization value chain.

  16. Nuclear Reaction Cross Sections Database at BNL | U.S. DOE Office of

    Office of Science (SC) Website

    Science (SC) Reaction Cross Sections Database at BNL Nuclear Physics (NP) NP Home About Research Facilities Science Highlights Benefits of NP Applications of Nuclear Science Applications of Nuclear Science Archives Small Business Innovation / Technology Transfer Funding Opportunities Nuclear Science Advisory Committee (NSAC) Community Resources Contact Information Nuclear Physics U.S. Department of Energy SC-26/Germantown Building 1000 Independence Ave., SW Washington, DC 20585 P: (301)

  17. Modeled Neutron Induced Nuclear Reaction Cross Sections for Radiochemistry in the region of Iriduim and Gold

    SciTech Connect (OSTI)

    Hoffman, R D; Dietrich, F S; Kelley, K; Escher, J; Bauer, R; Mustafa, M

    2008-02-26

    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron induced nuclear reaction cross sections for targets ranging from osmium (Z = 76) to gold (Z = 79). Of particular interest are the cross sections on Ir and Au including reactions on isomeric targets.

  18. Random-matrix approach to the statistical compound nuclear reaction at low

    Office of Scientific and Technical Information (OSTI)

    energies using the Monte-Carlo technique (Conference) | SciTech Connect Conference: Random-matrix approach to the statistical compound nuclear reaction at low energies using the Monte-Carlo technique Citation Details In-Document Search Title: Random-matrix approach to the statistical compound nuclear reaction at low energies using the Monte-Carlo technique Authors: Kawano, Toshihiko [1] + Show Author Affiliations Los Alamos National Laboratory Publication Date: 2015-11-10 OSTI Identifier:

  19. Summary Report of the Workshop on The Experimental Nuclear Reaction Data Database

    SciTech Connect (OSTI)

    Semkova, V.; Pritychenko, B.

    2014-10-10

    The Workshop on the Experimental Nuclear Reaction Data Database (EXFOR) was held at IAEA Headquarters in Vienna from 6 to 10 October 2014. The workshop was organized to discuss various aspects of the EXFOR compilation process including compilation rules, different techniques for nuclear reaction data measurements, software developments, etc. A summary of the presentations and discussions that took place during the workshop is reported here.

  20. Solving The Long-Standing Problem Of Low-Eneregy Nuclear Reactions At The

    Office of Scientific and Technical Information (OSTI)

    Highest Microscopic Level: Annual Continuation And Progress Report (Technical Report) | SciTech Connect Eneregy Nuclear Reactions At The Highest Microscopic Level: Annual Continuation And Progress Report Citation Details In-Document Search Title: Solving The Long-Standing Problem Of Low-Eneregy Nuclear Reactions At The Highest Microscopic Level: Annual Continuation And Progress Report Authors: Quaglioni, S Publication Date: 2012-08-28 OSTI Identifier: 1057712 Report Number(s): LLNL-TR-578293

  1. Solving The Long-Standing Problem Of Low-Energy Nuclear Reactions At The

    Office of Scientific and Technical Information (OSTI)

    Highest Microscopic Level:Annual Continuation And Progress Report (Technical Report) | SciTech Connect Energy Nuclear Reactions At The Highest Microscopic Level:Annual Continuation And Progress Report Citation Details In-Document Search Title: Solving The Long-Standing Problem Of Low-Energy Nuclear Reactions At The Highest Microscopic Level:Annual Continuation And Progress Report Authors: Quaglioni, S Publication Date: 2013-02-21 OSTI Identifier: 1069008 Report Number(s): LLNL-TR-622512 DOE

  2. Solving The Long-Standing Problem Of Nuclear Reactions At The Highest

    Office of Scientific and Technical Information (OSTI)

    Microscopic Level: Annual Continuation And Progress Report (Technical Report) | SciTech Connect Solving The Long-Standing Problem Of Nuclear Reactions At The Highest Microscopic Level: Annual Continuation And Progress Report Citation Details In-Document Search Title: Solving The Long-Standing Problem Of Nuclear Reactions At The Highest Microscopic Level: Annual Continuation And Progress Report Authors: Quaglioni, S Publication Date: 2014-03-05 OSTI Identifier: 1124871 Report Number(s):

  3. Study of components and statistical reaction mechanism in simulation of nuclear process for optimized production of {sup 64}Cu and {sup 67}Ga medical radioisotopes using TALYS, EMPIRE and LISE++ nuclear reaction and evaporation codes

    SciTech Connect (OSTI)

    Nasrabadi, M. N. Sepiani, M.

    2015-03-30

    Production of medical radioisotopes is one of the most important tasks in the field of nuclear technology. These radioactive isotopes are mainly produced through variety nuclear process. In this research, excitation functions and nuclear reaction mechanisms are studied for simulation of production of these radioisotopes in the TALYS, EMPIRE and LISE++ reaction codes, then parameters and different models of nuclear level density as one of the most important components in statistical reaction models are adjusted for optimum production of desired radioactive yields.

  4. EXTENSION OF THE NUCLEAR REACTION MODEL CODE EMPIRE TO ACTINIDES NUCLEAR DATA EVALUATION.

    SciTech Connect (OSTI)

    CAPOTE,R.; SIN, M.; TRKOV, A.; HERMAN, M.; CARLSON, B.V.; OBLOZINSKY, P.

    2007-04-22

    Recent extensions and improvements of the EMPIRE code system are outlined. They add new capabilities to the code, such as prompt fission neutron spectra calculations using Hauser-Feshbach plus pre-equilibrium pre-fission spectra, cross section covariance matrix calculations by Monte Carlo method, fitting of optical model parameters, extended set of optical model potentials including new dispersive coupled channel potentials, parity-dependent level densities and transmission through numerically defined fission barriers. These features, along with improved and validated ENDF formatting, exclusive/inclusive spectra, and recoils make the current EMPIRE release a complete and well validated tool for evaluation of nuclear data at incident energies above the resonance region. The current EMPIRE release has been used in evaluations of neutron induced reaction files for {sup 232}Th and {sup 231,233}Pa nuclei in the fast neutron region at IAEA. Triple-humped fission barriers and exclusive pre-fission neutron spectra were considered for the fission data evaluation. Total, fission, capture and neutron emission cross section, average resonance parameters and angular distributions of neutron scattering are in excellent agreement with the available experimental data.

  5. Experimental study of nuclear fusion reactions in muonic molecular systems

    SciTech Connect (OSTI)

    Bogdanova, L. N.

    2013-03-15

    Since the pioneering discovery of the muon catalysis by Alvarez [L. W. Alvarez, K. Brander, F. S. Crawford, et al., Phys. Rev. 105, 1127 (1957)], considerable efforts were aimed at observation of various fusion processes. Results of these studies facilitated understanding the properties of lightest nuclei and dynamics of low-energy fusion reactions. There still remain unsolved theoretical and experimental problems, especially in case of pt fusion.

  6. Dynamical dipole mode in fusion reactions with exotic nuclear beams

    SciTech Connect (OSTI)

    Baran, V.; Rizzo, C.; Colonna, M.; Toro, M. Di; Pierroutsakou, D.

    2009-02-15

    We report the properties of the prompt dipole radiation, produced via a collective bremsstrahlung mechanism, in fusion reactions with exotic beams. We show that the {gamma} yield is sensitive to the density dependence of the symmetry energy below/around saturation. Moreover, we find that the angular distribution of the emitted photons from such fast collective mode can represent a sensitive probe of its excitation mechanism and of fusion dynamics in the entrance channel.

  7. Low-Energy Nuclear Reactions of Protons in Host Metals at Picometre Distance

    SciTech Connect (OSTI)

    Heinrich Hora; George H. Miley; Jak C. Kelly

    2000-11-12

    A review is given for the explanation of the measurements of Miley et al. of a fully reproducible generation of nuclei of the whole periodic table by protons in host metals during a several-weeks reaction. Similar low-energy nuclear reactions (LENR) were observed by other groups. The fact that the heavy nuclides are not due to pollution can be seen from the fact that such very rare elements as thulium and terbium were detected by unique K-shell X-ray spectra. The nuclear reaction energy goes into the heavy nuclei as measured from much bigger traces in CR39 than from alphas. The fact that any reaction of the protons results in stable daughter nuclei is confirmed by the fact that the highest energy gain is resulting with stable reaction products. This has been explained in Ref. 2, and the energy gain for the heavy element generation by a compound reaction was discussed. The explanation is based on the model of the authors from 1989 to assume free motion of the protons contrary to localized crystalline states. A relation of the reaction time U on distance d of the reacting nuclei by a power law with an exponent 34.8 was derived. Based on few reproducible D-D reactions, a reaction time near the range of megaseconds and a reaction distance of nanometers was concluded. A splendid confirmation of the picometre-megasecond reactions was achieved by Li et al. from his direct quantum mechanical calculations of the hot fusion D-T reactions based on a one-step selective resonance tunneling model. Li et al. were able for the first time to derive the cross sections of the hot fusion. Li's application to picometre distance showed megasecond reaction times with no neutron or gamma emission. Because of the imaginary part in the Schroedinger potential, the problem of the level width is reduced by damping.

  8. Tracking of Ions Produced at Near Barrier Energies in Nuclear Reactions

    SciTech Connect (OSTI)

    Shapira, Dan

    2010-01-01

    Examples of detectors, presently in use, for tracking products from nuclear reactions induced by radioactive ion beams are described. A new tracking detector is being designed to study the binary products from reactions induced by heavy neutron-rich radioactive ion beams on heavy neutron-rich target nuclei. The motivation for such studies and the features designed to accomplish this goal will be presented.

  9. Refined scenario of standard Big Bang nucleosynthesis allowing for nonthermal nuclear reactions in the primordial plasma

    SciTech Connect (OSTI)

    Voronchev, Victor T.; Nakao, Yasuyuki; Nakamura, Makoto; Tsukida, Kazuki [Institute of Nuclear Physics, Moscow State University, Moscow 119991 (Russian Federation); Department of Applied Quantum Physics and Nuclear Engineering, Kyushu University, Motooka, Fukuoka 819-0395 (Japan); Division of Advanced Plasma Research, Japan Atomic Energy Agency, 2-166 Oaza-Obuchi-Aza-Omotedate, Rokkasho, Kamikita, Aomori 039-3212 (Japan); Department of Applied Quantum Physics and Nuclear Engineering, Kyushu University, Motooka, Fukuoka 819-0395 (Japan)

    2012-11-12

    The standard scenario of big bang nucleosynthesis (BBN) is generalized to take into account nonthermal nuclear reactions in the primordial plasma. These reactions are naturally triggered in the BBN epoch by fast particles generated in various exoergic processes. It is found that, although such particles can appreciably enhance the rates of some individual reactions, their influence on the whole process of element production is not significant. The nonthermal corrections to element abundances are obtained to be 0.1% ({sup 3}H), -0.03% ({sup 7}Li), and 0.34 %-0.63% (CNO group).

  10. Towards a nonequilibrium Green's function description of nuclear reactions: One-dimensional mean-field dynamics

    SciTech Connect (OSTI)

    Rios, Arnau; Barker, Brent; Buchler, Mark; Danielewicz, Pawel

    2011-05-15

    Research Highlights: > Dynamics of central nuclear reactions. > Nonequilibrium Green's functions and Kadanoff-Baym formalism. > Adiabatic switching on of interactions. > Mean-field time evolution of nuclear slabs. > Off-diagonal spatial structure of a collision density matrix. - Abstract: Nonequilibrium Green's function methods allow for an intrinsically consistent description of the evolution of quantal many-body body systems, with inclusion of different types of correlations. In this paper, we focus on the practical developments needed to build a Green's function methodology for nuclear reactions. We start out by considering symmetric collisions of slabs in one dimension within the mean-field approximation. We concentrate on two issues of importance for actual reaction simulations. First, the preparation of the initial state within the same methodology as for the reaction dynamics is demonstrated by an adiabatic switching on of the mean-field interaction, which leads to the mean-field ground state. Second, the importance of the Green's function matrix-elements far away from the spatial diagonal is analyzed by a suitable suppression process that does not significantly affect the evolution of the elements close to the diagonal. The relative lack of importance of the far-away elements is tied to system expansion. We also examine the evolution of the Wigner function and verify quantitatively that erasing of the off-diagonal elements corresponds to averaging out of the momentum-space details in the Wigner function.

  11. Experimental Observation of Nuclear Reactions in Palladium and Uranium - Possible Explanation by Hydrex Mode

    SciTech Connect (OSTI)

    Dufour, J.; Murat, D.; Dufour, X.; Foos, J

    2001-07-15

    Experiments with uranium are presented that show a highly exothermal reaction, which can only be of nuclear origin. One striking point of these results is that they clearly show that what is being observed is not some kind of fusion reaction of the deuterium present (only exceedingly small amounts of it are present). This is a strong indication that hydrogen can trigger nuclear reactions that seem to involve the nuclei of the lattice (which would yield a fission-like pattern of products). Confronted with a situation where some experiments in the field yield a fusion-like pattern of products (CF experiments) and others a fissionlike one (LENR experiments), one can reasonably wonder whether one is not observing two aspects of the same phenomenon. Thus, it is proposed to describe CF and LENR reactions as essentially the same phenomenon based on the possible existence of a still hypothetical proton/electron resonance, which would catalyze fissionlike reactions with a neutron sink. Finally, a series of experiments is proposed to assess this hypothesis.

  12. Low-energy RI beam technology and nuclear clusters in the explosive pp-chain breakout process

    SciTech Connect (OSTI)

    Kubono, S. [Institute of Modern Physics, Chinese Academy of Sciences, Nanchang Road 509, Lanzhou 73000 (China); RIKEN Nishina Center, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Center for Nuclear Study, University of Tokyo, 2-1 Hirosawa, Wako, Saitama 351-0 (Japan); Yamaguchi, H.; Kahl, D. M.; Ohshiro, Y.; Watanabe, S.; Yamazaki, N. [Center for Nuclear Study, University of Tokyo, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Teranishi, T. [Department of Physics, Kyushu University, 6-10-1 Hakozaki, Fukuoka 812-858 (Japan); Yanagisawa, Y.; Wakabayashi, Y.; Kase, M. [RIKEN Nishina Center, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Hayakawa, S. [Laboratori Nazionali del Sud, Istituto Nazionale di Fisica Nucleare, Via S. Sofia 62, 95125 Catania (Italy); Kwon, Y. K. [Institute for Basic Science, 70, Yuseong-daero 1689-gil, Yuseong-gu, Daejeon 305-81 (Korea, Republic of); Hashimoto, T.; Fukuda, Y. [Research Center for Nuclear Physics, Osaka University, 10-1 Mihogaoka, Ibaraki, Osaka 567-0047 (Japan); He, J. J. [Institute of Modern Physics, Chinese Academy of Sciences, Nanchang Road 509, Lanzhou 73000 (China); Goto, A. [Faculty of Medcine, Yamagata University, Yamagata 990-2331 (Japan); Muto, H. [Center of General Education, Tokyo University of Science at Suwa, Chino, Nagano 391-0292 (Japan)

    2014-05-09

    The lecture includes two parts: One is a discussion on the technology for developing RIB beam facility based on the in-flight method and relevant experimental technology. The second part is a discussion on experimental efforts for studying the breakout process from the pp-chain region based on recent works with low energy RI beams. The discussion of the second part specifically covers the problem of the vp-process in type II supernovae in terms of alpha cluster nature for the reactions.

  13. Using Nuclear Fusion Reactions to Peer Inside the Core of a Dense Hot

    Office of Science (SC) Website

    Plasma | U.S. DOE Office of Science (SC) Using Nuclear Fusion Reactions to Peer Inside the Core of a Dense Hot Plasma Fusion Energy Sciences (FES) FES Home About Research Facilities Science Highlights Benefits of FES Funding Opportunities Fusion Energy Sciences Advisory Committee (FESAC) Community Resources Contact Information Fusion Energy Sciences U.S. Department of Energy SC-24/Germantown Building 1000 Independence Ave., SW Washington, DC 20585 P: (301) 903-4941 F: (301) 903-8584 E: Email

  14. Nuclear Reactions X-Sections By Evaporation Model, Gamma-Cascades

    Energy Science and Technology Software Center (OSTI)

    2000-06-27

    Calculation of energy-averaged cross sections for nuclear reactions with emission of particles and gamma rays and fission. The models employed are the evaporation model with inclusion of pre-equilibrium decay and gamma ray cascade model. Angular momentum and parity conservation are accounted for. Major improvement to the 1976 STAPRE program (NEA 0461) relates to level density approach, implemwnted in subroutine ZSTDE. Generalized superfluid model is incorporated, Boltzman-gas modelling of intrinsic state density and semi-empirical modelling ofmore » a few quasiparticle effects in total level density in equilibrium and saddle deformations of actinide nuclei.« less

  15. COMMENTS ON "A NEW LOOK AT LOW-ENERGY NUCLEAR REACTION RESEARCH"

    SciTech Connect (OSTI)

    Shanahan, K.

    2009-12-30

    Cold fusion researchers have accumulated a large body of anomalous results over the last 20 years that they claim proves a new, mysterious nuclear reaction is active in systems they study. Krivit and Marwan give a brief and wholly positive view of this body of research. Unfortunately, cold fusion researchers routinely ignore conventional explanations of their observations, and claim much greater than real accuracy and precision for their techniques. This paper attempts to equally briefly address those aspects of the field with the intent of providing a balanced view of the field, and to establish some criteria for subsequent publications in this arena.

  16. Applications of nuclear reaction analysis to metal hydride film characterization at the GEND 200 KeV accelerator facility

    SciTech Connect (OSTI)

    Malbrough, D.J.; Becker, R.H.

    1985-01-01

    Nuclear reaction analysis (NRA) is a quantitative analytical technique that usually involves the use of MeV ion beams and resonant nuclear reactions to non-destructively probe materials for elemental content and depth profiles. Low energy, non-resonant nuclear reactions can also be exploited for NRA and procedures have been developed for using the GEND 200-KeV accelerator to characterize neutron generator components by that technique. The procedures involve the detection and analysis of fusion reaction products generated by the interactions of deuteron beams with light elements in metal hydride films. A description of the accelerator system is presented along with some of the unique NRA procedures that have recently been developed for its use. The system is used to measure neutron output efficiencies of metal deuterides and tritides by the associated particle technique (APT) and accurate neutron yield measurements have been made for a number of materials for which data was formerly not available.

  17. Compact Detection System for High Sensitivity Hydrogen Profiling of Materials by Nuclear Reaction Analysis

    SciTech Connect (OSTI)

    Marble, Daniel Keith; Urban, Ben; Pacheco, Jose

    2009-03-10

    Hydrogen is a ubiquitous contaminant that is known to have dramatic effects on the electrical, chemical, and mechanical properties of many types of materials in even minute quantities. Thus, the detection of hydrogen in materials is of major importance. Nuclear Reaction Analysis (NRA) is a powerful technique for nondestructive profiling hydrogen in materials. However, NRA has found only limited use in many applications because of poor sensitivity due to cosmic ray background (CSRB). Most attempts to eliminate CSRB to achieve ppm detection levels using higher energy nuclear reactions or tons of passive shielding are not compatible with commercial ion beam analysis space and equipment requirements Zimmerman, et al. have previously reported upon a coincidence detector that meets IBA space requirements and reduces the cosmic ray background, but the detector suffers from lower detection efficiency and small sample size. We have replaced the BGO well detector in the Zimmerman coincidence detection scheme with a larger Nal well detector and used faster timing electronics to produce a detector that can handle larger samples with higher detection efficiency, and still eliminate cosmic ray background.

  18. Supporting Technology for Chain of Custody of Nuclear Weapons and Materials throughout the Dismantlement and Disposition Processes

    SciTech Connect (OSTI)

    Bunch, Kyle J.; Jones, Anthony M.; Ramuhalli, Pradeep; Benz, Jacob M.; Denlinger, Laura Schmidt

    2014-05-04

    The ratification and ongoing implementation of the New START Treaty have been widely regarded as noteworthy global security achievements for both the Obama Administration and the Putin (formerly Medvedev) regime. But deeper cuts that move beyond the United States and Russia to engage the P-5 and other nuclear weapons possessor states are envisioned under future arms control regimes, and are indeed required for the P-5 in accordance with their Article VI disarmament obligations in the Nuclear Non-Proliferation Treaty. Future verification needs will include monitoring the cessation of production of new fissile material for weapons, monitoring storage of warhead components and fissile materials and verifying dismantlement of warheads, pits, secondary stages, and other materials. A fundamental challenge to implementing a nuclear disarmament regime is the ability to thwart unauthorized material diversion throughout the dismantlement and disposition process through strong chain of custody implementation. Verifying the declared presence, or absence, of nuclear materials and weapons components throughout the dismantlement and disposition lifecycle is a critical aspect of the disarmament process. From both the diplomatic and technical perspectives, verification under these future arms control regimes will require new solutions. Since any acceptable verification technology must protect sensitive design information and attributes to prevent the release of classified or other proliferation-sensitive information, non-nuclear non-sensitive modalities may provide significant new verification tools which do not require the use of additional information barriers. Alternative verification technologies based upon electromagnetic and acoustics could potentially play an important role in fulfilling the challenging requirements of future verification regimes. For example, researchers at the Pacific Northwest National Laboratory (PNNL) have demonstrated that low frequency electromagnetic signatures of sealed metallic containers can be used to rapidly confirm the presence of specific components on a yes/no basis without revealing classified information. PNNL researchers have also used ultrasonic measurements to obtain images of material microstructures which may be used as templates or unique identifiers of treaty-limited items. Such alternative technologies are suitable for application in various stages of weapons dismantlement and often include the advantage of an inherent information barrier due to the inability to extract classified weapon design information from the collected data. As a result, these types of technologies complement radiation-based verification methods for arms control. This article presents an overview of several alternative verification technologies that are suitable for supporting a future, broader and more intrusive arms control regime that spans the nuclear weapons disarmament lifecycle. The general capabilities and limitations of each verification modality are discussed and example technologies are presented. Potential applications are defined in the context of the nuclear material and weapons lifecycle. Example applications range from authentication (e.g., tracking and signatures within the chain of custody from downloading through weapons storage, unclassified templates and unique identification) to verification of absence and final material disposition.

  19. STARLIB: A NEXT-GENERATION REACTION-RATE LIBRARY FOR NUCLEAR ASTROPHYSICS

    SciTech Connect (OSTI)

    Sallaska, A. L.; Iliadis, C.; Champange, A. E.; Goriely, S.; Starrfield, S.; Timmes, F. X.

    2013-07-15

    STARLIB is a next-generation, all-purpose nuclear reaction-rate library. For the first time, this library provides the rate probability density at all temperature grid points for convenient implementation in models of stellar phenomena. The recommended rate and its associated uncertainties are also included. Currently, uncertainties are absent from all other rate libraries, and, although estimates have been attempted in previous evaluations and compilations, these are generally not based on rigorous statistical definitions. A common standard for deriving uncertainties is clearly warranted. STARLIB represents a first step in addressing this deficiency by providing a tabular, up-to-date database that supplies not only the rate and its uncertainty but also its distribution. Because a majority of rates are lognormally distributed, this allows the construction of rate probability densities from the columns of STARLIB. This structure is based on a recently suggested Monte Carlo method to calculate reaction rates, where uncertainties are rigorously defined. In STARLIB, experimental rates are supplemented with: (1) theoretical TALYS rates for reactions for which no experimental input is available, and (2) laboratory and theoretical weak rates. STARLIB includes all types of reactions of astrophysical interest to Z = 83, such as (p, {gamma}), (p, {alpha}), ({alpha}, n), and corresponding reverse rates. Strong rates account for thermal target excitations. Here, we summarize our Monte Carlo formalism, introduce the library, compare methods of correcting rates for stellar environments, and discuss how to implement our library in Monte Carlo nucleosynthesis studies. We also present a method for accessing STARLIB on the Internet and outline updated Monte Carlo-based rates.

  20. Advancing the Theory of Nuclear Reactions with Rare Isotopes: From the Laboratory to the Cosmos

    SciTech Connect (OSTI)

    Zhanov, Akram

    2015-08-30

    The Main goal of my research is to develop indirect methods, which allows one to connect the reactions measured in the labs with astrophysical reactions.

  1. Following the Transient Reactions in Lithium-Sulfur Batteries Using In an In Situ Nuclear Magnetic Resonance Technique

    SciTech Connect (OSTI)

    Xiao, Jie; Hu, Jian Z.; Chen, Honghao; Vijayakumar, M.; Zheng, Jianming; Pan, Huilin; Walter, Eric D.; Hu, Mary Y.; Deng, Xuchu; Feng, Ju; Liaw, Bor Yann; Gu, Meng; Deng, Zhiqun; Lu, Dongping; Xu, Suochang; Wang, Chong M.; Liu, Jun

    2015-05-13

    Li-S batteries hold great potential for next-generation, large-format power source applications; yet, the fundamental understanding of the electrochemical reaction pathways remains lacking to enable their functionality as promised. Here, in situ NMR technique employing a specially designed cylindrical micro battery was used to monitor the chemical environments around Li+ ions during repetitive charge-discharge process and track the transient electrochemical and chemical reactions occurring in the whole Li-S system. The in situ NMR provides real time, quantitative information related to the temporal concentration variations of the polysulfides with various chain lengths, providing important clues for the reaction pathways during both discharge and charge processes. The in-situ technique also reveals that redox reactions may involve transient species that are difficult to detect in ex-situ NMR study. Intermediate species such as charged free radicals may play an important role in the formation of the polysulfide products. Additionally, in situ NMR measurement simultaneously reveals vital information on the 7Li chemical environments in the electrochemical and parasitic reactions on the lithium anode that promotes the understanding of the failure mechanism in the Li-S system. These new insights could help design effective strategies to accelerate the development of Li-S battery technology.

  2. The effect of nuclear reaction rates and convective mixing on the evolution of a 6M{sub ?} star

    SciTech Connect (OSTI)

    Halabi, Ghina M.

    2014-05-09

    We present the evolution of a 6M{sub ?} star, of solar-like initial metallicity, and investigate the effects of key nuclear reaction rates, as well as the treatment of the convective mixing on its evolution along the Cepheid instability strip. In particular, we study the effect of recent estimates of the {sup 14}N(p,?){sup 15}O reaction on the formation and extension of the blue loop during core helium burning. We also investigate the effects induced on this blue loop by the adoption of non-standard convective mixing prescriptions, as well as the implications of modifying the Mixing Length Theory.

  3. Computer experiments concerning palladium-deuterium and titanium-deuterium lattices - implications to phenomenon of low-energy nuclear reaction

    SciTech Connect (OSTI)

    Rao, K.R.; Chaplot, S.L.

    1996-12-01

    Short-lived large energy fluctuations (SLEFs) in solids, proposed by Khait, are known to be responsible for several anomalous properties in a variety of materials. The study of SLEFs in palladium-deuterium and titanium-deuterium lattices via computer experiments is reported. The relevance of these large energy fluctuations in penetrating coulombic barriers in these systems is discussed. Such dynamical effects arising from the phonon bath in solids may enhance nuclear reaction probabilities leading to cold fusion. Expected cold fusion reaction rates are reported taking into account the effective charges of the deuterium atoms in the solid and SLEF frequencies. 25 refs., 7 figs., 1 tab.

  4. Fission-Fusion: A new reaction mechanism for nuclear astrophysics based on laser-ion acceleration

    SciTech Connect (OSTI)

    Thirolf, P. G.; Gross, M.; Allinger, K.; Bin, J.; Henig, A.; Kiefer, D.; Habs, D.; Ma, W.; Schreiber, J.

    2011-10-28

    We propose to produce neutron-rich nuclei in the range of the astrophysical r-process around the waiting point N = 126 by fissioning a dense laser-accelerated thorium ion bunch in a thorium target (covered by a CH{sub 2} layer), where the light fission fragments of the beam fuse with the light fission fragments of the target. Via the 'hole-boring' mode of laser Radiation Pressure Acceleration using a high-intensity, short pulse laser, very efficiently bunches of {sup 232}Th with solid-state density can be generated from a Th target and a deuterated CD{sub 2} foil, both forming the production target assembly. Laser-accelerated Th ions with about 7 MeV/u will pass through a thin CH{sub 2} layer placed in front of a thicker second Th foil (both forming the reaction target) closely behind the production target and disintegrate into light and heavy fission fragments. In addition, light ions (d,C) from the CD{sub 2} layer of the production target will be accelerated as well, inducing the fission process of {sup 232}Th also in the second Th layer. The laser-accelerated ion bunches with solid-state density, which are about 10{sup 14} times more dense than classically accelerated ion bunches, allow for a high probability that generated fission products can fuse again. The high ion beam density may lead to a strong collective modification of the stopping power, leading to significant range and thus yield enhancement. Using a high-intensity laser as envisaged for the ELI-Nuclear Physics project in Bucharest (ELI-NP), order-of-magnitude estimates promise a fusion yield of about 10{sup 3} ions per laser pulse in the mass range of A = 180-190, thus enabling to approach the r-process waiting point at N = 126.

  5. TORUS: Theory of Reactions for Unstable iSotopes - Topical Collaboration for Nuclear Theory Project. Period: June 1, 2010 - May 31, 2015

    SciTech Connect (OSTI)

    Arbanas, G; Elster, C; Escher, J; Nunes, F; Thompson, I

    2015-08-17

    The work of this collaboration during its existence is summarized. The mission of the TORUS Topical Collaboration was to develop new methods that advance nuclear reaction theory for unstable isotopes by using three-body techniques to improve direct reaction calculations. This multi-institution collaborative effort was and remains directly relevant to three areas of interest: the properties of nuclei far from stability, microscopic studies of nuclear input parameters for astrophysics, and microscopic nuclear reaction theory. The TORUS project focused on understanding the details of (d,p) reactions for neutron transfer to heavier nuclei. The bulk of the work fell into three areas: coupled channel theory, modeling (d,p) reactions with a Faddeev-AGS approach, and capture reactions.

  6. Flow cytometric detection of human immunodeficiency virus type 1 proviral DNA by the polymerase chain reaction incorporating digoxigenin- or fluorescein-labeled dUTP

    SciTech Connect (OSTI)

    Yang, Gang; Olson, J.C.; Pu, R.; Vyas, G.N.

    1995-10-01

    Serological assays are routinely used in the laboratory diagnosis of human immunodeficiency virus type-1 (HrV-1) infection, but the polymerase chain reaction (PCR) is ultimately the most sensitive and direct method for establishing definitive diagnosis. As an alternative to the conventional radioactive PCR procedure we have developed and evaluated a pair of rapid nonradioisotopic flow cytometric detection methods. Using heminested PCR we directly incorporated fluorescein-12-dUTP (fluo-dUTP) or digoxigenin-11-dUTP (dig-dUTP) into the PCR-amplicons. The labeled amplicons were hybridized with biotinylated antisense and sense probes, followed by capture of the hybrid DNA using streptavidin-coated beads which were finally analyzed in a flow cytometer by (1) direct detection of the fluorescence intensity of the amplicons incorporating fluo-dUTP and (2) immunodetection of the amplicons incorporating dig-dUTP by anti-digoxigenin IgG labeled with fluorescein isothiocyanate (FITC). Although both assays were functionally comparable with radiolabeled probe in reliably detecting as low as five copies of HIV-1 proviral DNA sequences, the immunodetection of dig-dUTP consistently yielded higher mean channel fluorescence and gave a stable signal over an extended period of 12-14 weeks. In testing a panel of 20 pedigreed PBMC specimens from blood donors with or without HIV-1 infection, the results of both flow cytometric assays were identical with those of the conventional radioactive procedure. Therefore, we conclude that the dig-dUTP incorporation in amplicons, hybridization with a pair of sense-antisense biotinylated probes and immunodetection of hybrids by flow cytometric analyses is the nonisotopic method of choice for PCR-diagnosis of HIV-1 infection. 21 refs., 2 figs., 4 tabs.

  7. Interacting-boson-approximation study on the nuclear structural factor in double-charge-exchange reactions

    SciTech Connect (OSTI)

    Wu, H.; Wang, R.; Liu, Y.; Zhao, E. , P.O. Box 8730, Beijing Physics Department, Suzhou University, Suzhou Institute of High Energy Physics, Academia Sinica, Beijing Institute of Theoretical Physics, Academia Sinica, Beijing )

    1992-04-01

    The double-charge-exchange (DCX) reaction with Ca isotopes as targets is studied by employing the interacting-boson approximation (IBA). A comparison between the IBA and the shell-model results shows that IBA is a good approximation of the shell model in describing the DCX reactions.

  8. Disassembly of hot nuclear matter formed in Au-induced reactions near the Fermi energy

    SciTech Connect (OSTI)

    Delis, D.N.

    1993-09-01

    Complex fragment emission has been studied in the 60 MeV/A {sup 197}Au + {sup 12}C, {sup 27}Al, {sup 51}V, {sup nat}Cu, and {sup 197}Au reactions. Velocity spectra, angular distributions and cross sections have been constructed for each target from the inclusive data. Coincidence data including 2-, 3-, 4-, and 5-fold events have also been examined. Furthermore neutron multiplicity distributions have been obtained for the above reactions by utilizing a novel neutron calorimetric approach.

  9. Manufacturing Supply Chain

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Supply Chain - Sandia Energy Energy Search Icon Sandia Home Locations Contact Us Employee Locator Energy & Climate Secure & Sustainable Energy Future Stationary Power Energy Conversion Efficiency Solar Energy Wind Energy Water Power Supercritical CO2 Geothermal Natural Gas Safety, Security & Resilience of the Energy Infrastructure Energy Storage Nuclear Power & Engineering Grid Modernization Battery Testing Nuclear Fuel Cycle Defense Waste Management Programs Advanced Nuclear

  10. Sensitivity of the blue loops of intermediate-mass stars to nuclear reactions

    SciTech Connect (OSTI)

    Halabi, Ghina M.; El Eid, Mounib

    2012-11-20

    We investigate the effects of a modification of the {sup 14}N(p,{gamma}){sup 15}O reaction rate, as suggested by recent evaluations, on the formation and extension of the blue loops encountered during the evolution of the stars in the mass range 5M{sub Circled-Dot-Operator} to 12M{sub Circled-Dot-Operator }. We show that the blue loops of stars in the mass range 5M{sub Circled-Dot-Operator} to 8M{sub Circled-Dot-Operator }, that is the range of super ABG stars, are severely affected by a modification of the important {sup 14}N(p,{gamma}){sup 15}O reaction rate. We also show that the blue loops can be restored if envelope overshooting is included, which is necessary to explain the observations of the Cepheid stars.

  11. The series of carbon-chain complexes {Ru(dppe)Cp*}?{?-(C?C)x} (x = 48, 11): Synthesis, structures, properties and some reactions

    SciTech Connect (OSTI)

    Bruce, Michael I.; Cole, Marcus L.; Ellis, Benjamin G.; Gaudio, Maryka; Nicholson, Brian K.; Parker, Christian R.; Skelton, Brian W.; White, Allan H.

    2015-01-28

    The construction of a series of compounds {Ru(dppe)Cp*}2(?-C2x) (Ru*-C2x-Ru*, x = 48, 11)) is described. A direct reaction between RuCl(dppe)Cp* and Me3Si(Ctriple bond; length of mdashC)4SiMe3 afforded Ru*-C8-Ru* in 89% yield. The Pd(0)/Cu(I)-catalysed coupling of Ru{Ctriple bond; length of mdashCCtriple bond; length of mdashCAu(PPh3)}(dppe)Cp*Ru*-C4-Au (2 equiv.) with diiodoethyne gave Ru*-C10-Ru* (64%), or of 1 equiv. with I(Ctriple bond; length of mdashC)3I gave Ru*-C14-Ru* (36%); similarly, Ru{(Ctriple bond; length of mdashC)4Au(PPh3)}(dppe)Cp*Ru*-C8-Au and I(Ctriple bond; length of mdashC)3I gave Ru*-C22-Ru* (12%). Desilylation (TBAF) of Ru{(Ctriple bond; length of mdashC)xSiMe3}(dppe)Cp*Ru*-C2x-Si (x = 3, 4) followed by oxidative coupling [Cu(OAc)2/py] gave Ru*-C12-Ru* (82%) and Ru*-C16-Ru* (58%), respectively. Similar oxidative coupling of Ru(Ctriple bond; length of mdashCCtriple bond; length of mdashCH)(dppe)Cp* was a second route to Ru*-C8-Ru* (82%). Appropriate precursors are already known, or obtained by coupling of Ru*-C2x-Si (x = 2, 4) with AuCl(PPh3)/NaOMe [Ru*-C4-Au, 95%; Ru*-C8-Au, 74%] or from Pd(0)/Cu(I) catalysed coupling of Ru*-C2x-Au (x = 2, 3) with I(Ctriple bond; length of mdashC)2SiMe3 (Ru*-C8-Si, 64%; Ru*-C10-Si, 2%). Reactions between Ru*-C2x-Ru* (x = 3, 4) and Fe2(CO)9 gave {Fe3(CO)9}{?3-CCtriple bond; length of mdashC[Ru(dppe)Cp*]}2Fe(C3-Ru*)2 and {Fe3(CO)9}{?3-CCtriple bond; length of mdashC[Ru(dppe)Cp*]}{?3-C(Ctriple bond; length of mdashC)2[Ru(dppe)Cp*]} Fe(C3-Ru*)(C5-Ru*), respectively. The redox properties of the series of complexes with 2x = 216 were measured and showed a diminution of the separation of the first two oxidation potentials, ?E = E2 - E1, with increasing carbon chain length. The X-ray-determined molecular structures of Ru*-C8-Si, Ru*-C8-Ru*, Ru*-C14-Ru* (two C6H6 solvates), {Ru(PPh3)2Cp}2{?-(Ctriple bond; length of mdashC)4}4CHCl3Ru-C8-Ru4CHCl3 and of Fe(C3-Ru*)2 and Fe(C3-Ru*)(C5-Ru*) are reported.

  12. U.S. Department of Energy Office of Nuclear Energy, Science and Technology

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    One the cover: Albert Einstein (1879-1955) U.S. Department of Energy Office of Nuclear Energy, Science and Technology Washington, D.C. 20585 The History of Nuclear Energy Table of Contents Preface ................................................................... 1 Introduction .......................................................... 3 The Discovery of Fission ...................................... 4 The First Self-Sustaining Chain Reaction ............ 5 The Development of Nuclear Energy for

  13. Localization of human elav-like neuronal protein 1 (Hel-N1) on chromosome 9p21 by chromosome microdissection polymerase chain reaction and fluorescence in situ hybridization

    SciTech Connect (OSTI)

    Han, Jian; Knops, J.F.; Longshore, J.W.; King, P.H.

    1996-08-15

    Hel-N1 is a member of the highly conserved elav family of neuronal genes. It shares considerable sequence homology with HuD, another human member, and both genes are expressed in brain. HuD was recently mapped to chromosome 1p34. Here, we have utilized chromosome microdissection polymerase chain reaction and fluorescence in situ hybridization to map Hel-N1 to chromosome 9p21. The different chromosomal locations of these homologous genes underscore their distinct identities. 10 refs., 2 figs.

  14. The ({sup 18}O, {sup 16}O) reaction as a probe for nuclear spectroscopy

    SciTech Connect (OSTI)

    Cappuzzello, F.; Bond, M.; Nicolosi, D.; Tropea, S.; Agodi, A.; Carbone, D.; Cavallaro, M.; Cunsolo, A.; Borello-Lewin, T.; Rodrigues, M. R. D.; De Napoli, M.; Linares, R.

    2014-11-11

    The response of nuclei to the ({sup 18}O, {sup 16}O) two-neutron transfer reaction at 84 MeV incident energy has been systematically studied at the Catania INFN-LNS laboratory. The experiments were performed using several solid targets from light ({sup 9}Be, {sup 11}B, {sup 12,13}C, {sup 16}O, {sup 28}Si) to heavy ones ({sup 58,64}Ni, {sup 120}Sn, {sup 208}Pb). The {sup 16}O ejectiles were detected at forward angles by the MAGNEX magnetic spectrometer. Exploiting the large momentum acceptance (?10%, +14%) and solid angle (50 msr) of the spectrometer, energy spectra were obtained with a relevant yield up to about 20 MeV excitation energy. The application of the powerful trajectory reconstruction technique did allow to get energy spectra with energy resolution of about 150 keV and angular distributions with angular resolution better than 0.3. A common feature observed with light nuclei is the appearance of unknown resonant structures at high excitation energy. The strong population of these latter together with the measured width can reveal the excitation of a collective mode connected with the transfer of a pair.

  15. METHOD OF OPERATING NUCLEAR REACTORS

    DOE Patents [OSTI]

    Untermyer, S.

    1958-10-14

    A method is presented for obtaining enhanced utilization of natural uranium in heavy water moderated nuclear reactors by charging the reactor with an equal number of fuel elements formed of natural uranium and of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction. The reactor is operated until the rate of burnup of plutonium equals its rate of production, the fuel elements are processed to recover plutonium, the depleted uranium is discarded, and the remaining uranium is formed into fuel elements. These fuel elements are charged into a reactor along with an equal number of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction, and reuse of the uranium is continued as aforesaid until it wlll no longer support a chain reaction when combined with an equal quantity of natural uranium.

  16. Solving The Long-Standing Problem Of Low-Energy Nuclear Reactions At The Highest Microscopic Level. Annual Continuation And Progress Report, August 15, 2014 -- August 14, 2015

    SciTech Connect (OSTI)

    Quaglioni, Sofia

    2015-03-19

    The aim of this project is to develop a comprehensive framework that will lead to a fundamental description of both structural properties and reactions of light nuclei in terms of constituent protons and neutrons interacting through nucleon-nucleon (NN) and three-nucleon (3N) forces. This project will provide the research community with the theoretical and computational tools what will enable: an accurate prediction for fusion reactions that power stars and Earth-based fusion facilities; an improved description of the spectroscopy of exotic nuclei, including light Borromean systems; and, a fundamental understanding of the three-nucleon force in nuclear reaction and nuclei at the drip line.

  17. Argonne nuclear pioneers: Chicago Pile 1

    SciTech Connect (OSTI)

    Agnew, Harold; Nyer, Warren

    2012-01-01

    On December 2, 1942, 49 scientists, led by Enrico Fermi, made history when Chicago Pile 1 (CP-1) went critical and produced the world's first self-sustaining, controlled nuclear chain reaction. Seventy years later, two of the last surviving CP-1 pioneers, Harold Agnew and Warren Nyer, recall that historic day.

  18. Argonne nuclear pioneers: Chicago Pile 1

    ScienceCinema (OSTI)

    Agnew, Harold; Nyer, Warren

    2013-04-19

    On December 2, 1942, 49 scientists, led by Enrico Fermi, made history when Chicago Pile 1 (CP-1) went critical and produced the world's first self-sustaining, controlled nuclear chain reaction. Seventy years later, two of the last surviving CP-1 pioneers, Harold Agnew and Warren Nyer, recall that historic day.

  19. Argonne's Major Nuclear Energy Milestones | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Argonne's Major Nuclear Energy Milestones Argonne's reactor tree Argonne's reactor tree December 2, 1942: Enrico Fermi's team produces the world's first sustained nuclear chain reaction. March 20, 1943: Chicago Pile 2 achieves criticality. It was CP-1, Fermi's first reactor, dismantled and reassembled at the Argonne Forest site in the Cook Country Forest Preserve. May 15, 1944: Walter Zinn starts Chicago Pile 3, the world's first heavy-water-moderated nuclear reactor, at Site A. January 31,

  20. Development of a high-density gas-jet target for nuclear astrophysics and reaction studies with rare isotope beams. Final Report

    SciTech Connect (OSTI)

    Uwe, Greife

    2014-08-12

    The purpose of this project was to develop a high-density gas jet target that will enable a new program of transfer reaction studies with rare isotope beams and targets of hydrogen and helium that is not currently possible and will have an important impact on our understanding of stellar explosions and of the evolution of nuclear shell structure away from stability. This is the final closeout report for the project.

  1. Kinetics of Cold-Cap Reactions for Vitrification of Nuclear Waste Glass Based on Simultaneous Differential Scanning Calorimetry - Thermogravimetry (DSC-TGA) and Evolved Gas Analysis (EGA)

    SciTech Connect (OSTI)

    Rodriguez, Carmen P.; Pierce, David A.; Schweiger, Michael J.; Kruger, Albert A.; Chun, Jaehun; Hrma, Pavel R.

    2013-12-03

    For vitrifying nuclear waste glass, the feed, a mixture of waste with glass-forming and modifying additives, is charged onto the cold cap that covers 90-100% of the melt surface. The cold cap consists of a layer of reacting molten glass floating on the surface of the melt in an all-electric, continuous glass melter. As the feed moves through the cold cap, it undergoes chemical reactions and phase transitions through which it is converted to molten glass that moves from the cold cap into the melt pool. The process involves a series of reactions that generate multiple gases and subsequent mass loss and foaming significantly influence the mass and heat transfers. The rate of glass melting, which is greatly influenced by mass and heat transfers, affects the vitrification process and the efficiency of the immobilization of nuclear waste. We studied the cold-cap reactions of a representative waste glass feed using both the simultaneous differential scanning calorimetry thermogravimetry (DSC-TGA) and the thermogravimetry coupled with gas chromatography-mass spectrometer (TGA-GC-MS) as complementary tools to perform evolved gas analysis (EGA). Analyses from DSC-TGA and EGA on the cold-cap reactions provide a key element for the development of an advanced cold-cap model. It also helps to formulate melter feeds for higher production rate.

  2. SECTION II: HEAVY ION REACTIONS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    II: HEAVY ION REACTIONS Experimental Determination of the Symmetry Energy of a Low Density Nuclear Gas ...II-1 S....

  3. nuclear

    National Nuclear Security Administration (NNSA)

    2%2A en U.S-, Japan Exchange Best Practices on Nuclear Emergency Response http:nnsa.energy.govmediaroompressreleasesu.s-japan-exchange-best-practices-nuclear-emergency-respon...

  4. Resonant thermonuclear reaction rate

    SciTech Connect (OSTI)

    Haubold, H.J.; Mathai, A.M.

    1986-08-01

    Basic physical principles for the resonant and nonresonant thermonuclear reaction rates are applied to find their standard representations for nuclear astrophysics. Closed-form representations for the resonant reaction rate are derived in terms of Meijer's G-italic-function. Analytic representations of the resonant and nonresonant nuclear reaction rates are compared and the appearance of Meijer's G-italic-function is discussed in physical terms.

  5. NNSA TRITIUM SUPPLY CHAIN

    SciTech Connect (OSTI)

    Wyrick, Steven; Cordaro, Joseph; Founds, Nanette; Chambellan, Curtis

    2013-08-21

    Savannah River Site plays a critical role in the Tritium Production Supply Chain for the National Nuclear Security Administration (NNSA). The entire process includes: Production of Tritium Producing Burnable Absorber Rods (TPBARs) at the Westinghouse WesDyne Nuclear Fuels Plant in Columbia, South Carolina Production of unobligated Low Enriched Uranium (LEU) at the United States Enrichment Corporation (USEC) in Portsmouth, Ohio Irradiation of TPBARs with the LEU at the Tennessee Valley Authority (TVA) Watts Bar Reactor Extraction of tritium from the irradiated TPBARs at the Tritium Extraction Facility (TEF) at Savannah River Site Processing the tritium at the Savannah River Site, which includes removal of nonhydrogen species and separation of the hydrogen isotopes of protium, deuterium and tritium.

  6. Nuclear Physics from Lattice QCD

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Thursday, May 26, 2011 Exa-Scale Computational Resources Nuclear Astrophysics Accelerator Physics Cold QCD and Nuclear Forces Hot and Dense QCD Nuclear Structure and Reactions ...

  7. NNSA Contract Reform in Action: Supply Chain Management Center...

    National Nuclear Security Administration (NNSA)

    Contract Reform in Action: Supply Chain Management Center | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile...

  8. Nuclear Data Sheets for A = 88

    SciTech Connect (OSTI)

    McCutchan, E.A.; Sonzogni, A.A.

    2014-01-15

    The experimental results from the various reaction and radioactive decay studies leading to nuclides in the A=88 mass chain have been reviewed. Nuclides ranging from Ge (Z=32) to Ru (Z=44) are included. For these nuclei, level and decay schemes, as well as tables of nuclear properties, are given. This work supersedes the previous evaluation of the data on these nuclides (G. Mukherjee, A.A. Sonzogni Nucl.Data Sheets 105, 419 (2005))

  9. Nuclear Data Sheets for A=150

    SciTech Connect (OSTI)

    Basu, S.K.; Sonzogni, A.A.

    2013-04-15

    The experimental results from the various reaction and decay studies leading to nuclides in the A=150 mass chain have been reviewed. These data are summarized and presented, together with the adopted level schemes and properties, for the nuclides from Cs(Z=55) through Lu(Z=71). This evaluation replaces the previous evaluation by E. der Mateosian and J. K. Tuli (1995De28), which appeared in Nuclear Data Sheets 75, 827 (1995)

  10. Nuclear Data Sheets for A = 68

    SciTech Connect (OSTI)

    McCutchan, E. A.

    2012-07-01

    The experimental results from the various reaction and radioactive decay studies leading to nuclides in the A = 68 mass chain have been reviewed. Nuclides ranging from Cr (Z = 24) to Br (Z = 35) are included. For these nuclei, level and decay schemes, as well as tables of nuclear properties, are given. This work supersedes the previous evaluation of the data on these nuclides (2002Bu29).

  11. Method of controlling fusion reaction rates

    DOE Patents [OSTI]

    Kulsrud, R.M.; Furth, H.P.; Valeo, E.J.; Goldhaber, M.

    1983-05-09

    This invention relates to a method of controlling the reaction rates in a nuclear fusion reactor; and more particularly, to the use of polarized nuclear fuel.

  12. CHARACTERIZATION OF INDIVIDUAL CHEMICAL REACTIONS CONSUMING ACID DURING NUCLEAR WASTE PROCESSING AT THE SAVANNAH RIVER SITE - 136B

    SciTech Connect (OSTI)

    Koopman, D.; Pickenheim, B.; Lambert, D.; Newell, J.; Stone, M.

    2009-09-02

    Conversion of legacy radioactive high-level waste at the Savannah River Site into a stable glass waste form involves a chemical pretreatment process to prepare the waste for vitrification. Waste slurry is treated with nitric and formic acids to achieve certain goals. The total quantity of acid added to a batch of waste slurry is constrained by the catalytic activity of trace noble metal fission products in the waste that can convert formic acid into hydrogen gas at many hundreds of times the radiolytic hydrogen generation rate. A large block of experimental process simulations were performed to characterize the chemical reactions that consume acid prior to hydrogen generation. The analysis led to a new equation for predicting the quantity of acid required to process a given volume of waste slurry.

  13. Sleeve reaction chamber system

    DOE Patents [OSTI]

    Northrup, M. Allen (Berkeley, CA); Beeman, Barton V. (San Mateo, CA); Benett, William J. (Livermore, CA); Hadley, Dean R. (Manteca, CA); Landre, Phoebe (Livermore, CA); Lehew, Stacy L. (Livermore, CA); Krulevitch, Peter A. (Pleasanton, CA)

    2009-08-25

    A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

  14. Migration of Nuclear Shell Gaps Studied in the d({sup 24}Ne,p{gamma}){sup 25}Ne Reaction

    SciTech Connect (OSTI)

    Catford, W. N.; Timis, C. N.; Baldwin, T. D.; Gelletly, W.; Pain, S. D.; Lemmon, R. C.; Pucknell, V. P. E.; Warner, D. D.; Labiche, M.; Orr, N. A.; Achouri, N. L.; Chapman, R.; Amzal, N.; Burns, M.; Liang, X.; Spohr, K.; Freer, M.; Ashwood, N. I.

    2010-05-14

    The transfer of neutrons onto {sup 24}Ne has been measured using a reaccelerated radioactive beam of {sup 24}Ne to study the (d,p) reaction in inverse kinematics. The unusual raising of the first 3/2{sup +} level in {sup 25}Ne and its significance in terms of the migration of the neutron magic number from N=20 to N=16 is put on a firm footing by confirmation of this state's identity. The raised 3/2{sup +} level is observed simultaneously with the intruder negative parity 7/2{sup -} and 3/2{sup -} levels, providing evidence for the reduction in the N=20 gap. The coincident gamma-ray decays allowed the assignment of spins as well as the transferred orbital angular momentum. The excitation energy of the 3/2{sup +} state shows that the established USD shell model breaks down well within the sd model space and requires a revised treatment of the proton-neutron monopole interaction.

  15. Spallation process with simultaneous multi-particle emission in nuclear evaporation

    SciTech Connect (OSTI)

    Santos, B. M.

    2013-05-06

    High energy probes have been used currently to explore nuclear reaction mechanism and nuclear structure. The spallation process governs the reaction process around 1 GeV energy regime. A new aspect introduced here to describe the nuclear reaction is the in-medium nucleonnucleon collision framework. The nucleon-nucleon scattering is kinematically treated by using an effective mass to represent the nuclear binding. In respect to the evaporation phase of the reaction, we introduce the simultaneous particles emission decay. This process becomes important due to the rise of new channels at high excitation energy regime of the compound nucleus. As results, the particles yields in the rapid and evaporation phases are obtained and compared to experimental data. The effect and relevance of these simultaneous emission processes in the evaporation chain is also discussed.

  16. Laser amplifier chain

    DOE Patents [OSTI]

    Hackel, Richard P. (Livermore, CA)

    1992-01-01

    A laser amplifier chain has a plurality of laser amplifiers arranged in a chain to sequentially amplify a low-power signal beam to produce a significantly higher-power output beam. Overall efficiency of such a chain is improved if high-gain, low efficiency amplifiers are placed on the upstream side of the chain where only a very small fraction of the total pumped power is received by the chain and low-gain, high-efficiency amplifiers are placed on the downstream side where a majority of pumping energy is received by the chain.

  17. Laser amplifier chain

    DOE Patents [OSTI]

    Hackel, R.P.

    1992-10-20

    A laser amplifier chain has a plurality of laser amplifiers arranged in a chain to sequentially amplify a low-power signal beam to produce a significantly higher-power output beam. Overall efficiency of such a chain is improved if high-gain, low efficiency amplifiers are placed on the upstream side of the chain where only a very small fraction of the total pumped power is received by the chain and low-gain, high-efficiency amplifiers are placed on the downstream side where a majority of pumping energy is received by the chain. 6 figs.

  18. Nuclear Data Sheets for A = 222

    SciTech Connect (OSTI)

    Singh, S.; Tuli, J.; Jain,A.K.; Tuli,J.K.

    2011-11-01

    The ENSDF evaluation for A=222 mass chain (1996El01) has been updated on the basis of the experimental results, since September 1995 (literature cutoff date in 1996El01), from various reaction and decay studies for all nuclides in A=222 mass chain (Z=84 to 92). A new nuclide ({sup 222}Po) has since been observed. In addition, new measurements have been reported in Rn, Th and Ra nuclides. The results obtained from various theoretical studies are given as comments. The updated level and decay schemes, and experimental decay and reaction data on which they are based, are summarized and presented for all the nuclides with mass number A=222. The adopted values of level energies, level spins and parities are given, and {gamma}-ray energies, intensities, as well as other nuclear properties are presented.

  19. Nuclear Science/Nuclear Chemistry

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Science/Nuclear Chemistry Nuclear Physics The 10-MV tandem accelerator at CAMS provides a platform for conducting nuclear physics experiment both for basic science and lab mission-related programs. For example, we performed a new cross section measurement of the astrophysically important reaction 40Ca(a,g)44Ti in which high purity CaO targets were irradiated with helium ions at several different discrete energies. The reaction rate was measured on-line via prompt gamma ray spectroscopy

  20. Charge separation in photoredox reactions. Final report

    SciTech Connect (OSTI)

    Kevan, L.

    1993-07-15

    The structural aspects controlling charge separation in molecular photoionization reactions in organized molecular assemblies involving micelles, reverse micelles and vesicles are being studied by optical and electron magnetic resonance techniques including the time domain technique of deuterium electron spin echo modulation (ESEM) and matrix proton electron nuclear double resonance (ENDOR) to measure weak electron-nuclear dipolar interactions. ESEM and matrix ENDOR are particularly well adapted to the study of disordered systems as exemplified by micelles and vesicles. The photoionization yields of alkylphenothiazines in micelles and vesicles have been shown to depend on the alkyl chain length and to correlate with relative distances from the surfactant assembly interface measured by deuterium ESEM and matrix proton ENDOR. The photoionization of alkylmethylviologens versus alkyl chain length has also been studied in vesicles, micelles and reverse micelles. Nitroxide spin probes have been used to study the degree of water penetration into mixed ionic/nonionic poly(ethylene oxide) and cationic/anionic micelles by using ESEM methods and selectively deuterated surfactants. The effect of urea interaction at micellar interfaces on the interface hydration has also been evaluated by studying nitroxide probes with ESEM.

  1. SECTION II: HEAVY ION REACTIONS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    REACTIONS Temperature dependence of the isospin distillation in nuclear fragmentation ................................ II-1 D. V. Shetty for the NIMROD Collaboration Midrapidity emission in nuclear fragmentation .................................................................................. II-2 D. V. Shetty for the NIMROD Collaboration Isospin dependence of the <N/Z> in nuclear fragmentation .............................................................. II-3 D. V. Shetty, for the

  2. Absolute nuclear material assay

    DOE Patents [OSTI]

    Prasad, Manoj K.; Snyderman, Neal J.; Rowland, Mark S.

    2010-07-13

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  3. Absolute nuclear material assay

    DOE Patents [OSTI]

    Prasad, Manoj K.; Snyderman, Neal J.; Rowland, Mark S.

    2012-05-15

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  4. Microfabricated electrochemiluminescence cell for chemical reaction detection

    DOE Patents [OSTI]

    Northrup, M. Allen (Berkeley, CA); Hsueh, Yun-Tai (Davis, CA); Smith, Rosemary L. (Davis, CA)

    2003-01-01

    A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  5. Supply Chain | NISAC

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    model informs analyses of the availability of transportation fuel in the event the fuel supply chain is disrupted. The portion of the fuel supply system represented by the...

  6. Supply Chain Management Center event highlights how small businesses can

    National Nuclear Security Administration (NNSA)

    help NNSA carry out its missions | National Nuclear Security Administration Supply Chain Management Center event highlights how small businesses can help NNSA carry out its missions | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our

  7. Impacts to the ethylene supply chain from a hurricane disruption.

    SciTech Connect (OSTI)

    Sun, Amy Cha-Tien; Downes, Paula Sue; Heinen, Russell; Welk, Margaret Ellen

    2010-03-01

    Analysis of chemical supply chains is an inherently complex task, given the dependence of these supply chains on multiple infrastructure systems (e.g., the petroleum sector, transportation, etc.). This effort requires data and information at various levels of resolution, ranging from network-level distribution systems to individual chemical reactions. Sandia National Laboratories (Sandia) has integrated its existing simulation and infrastructure analysis capabilities with chemical data models to analyze the chemical supply chains of several nationally critical chemical commodities. This paper describes how Sandia models the ethylene supply chain; that is, the supply chain for the most widely used raw material for plastics production including a description of the types of data and modeling capabilities that are required to represent the ethylene supply chain. The paper concludes with a description of Sandia's use the model to project how the supply chain would be affected by and adapt to a disruptive scenario hurricane.

  8. Silicon-based sleeve devices for chemical reactions

    DOE Patents [OSTI]

    Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.

    1996-12-31

    A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.

  9. Silicon-based sleeve devices for chemical reactions

    DOE Patents [OSTI]

    Northrup, M. Allen (Berkeley, CA); Mariella, Jr., Raymond P. (Danville, CA); Carrano, Anthony V. (Livermore, CA); Balch, Joseph W. (Livermore, CA)

    1996-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  10. Influence of vertex coulomb effects on peripheral partial amplitudes for the consecutive transfer of two protons in A(X,Y)B peripheral nuclear reactions induced by light loosely bound (exotic) nuclei at low energies

    SciTech Connect (OSTI)

    Blokhintsev, L. D. [Moscow State University, Skobeltsyn Institute of Nuclear Physics (Russian Federation); Mukhamedzhanov, A. M. [Texas A and M University, MS 3366, Cyclotron Institute (United States); Tadzhibaeva, D. Kh.; Yarmukhamedov, R., E-mail: rakhim@inp.u [Uzbek Academy of Sciences, Institute of Nuclear Physics (Uzbekistan)

    2010-07-15

    The amplitude for the consecutive transfer of two protons in A(X, Y)B peripheral nuclear reactions induced by loosely bound light (exotic) nuclei and described by a nonrelativistic square Feynman diagram in which the first transferred proton is loosely bound while the second one in tightly bound is considered. It is shown that the inclusion of three-ray Coulomb vertex effects in the square diagram leads to the appearance of an additional 'Coulomb' singularity in the variable cos {theta} (here, {theta} is the c.m. scattering angle), this singularity being closer to the physical domain, -1 {<=} cos {theta} {<=} 1, than the well-known 'triangle' singularities corresponding to the amplitude of the square diagram in which the internal line is contracted. The asymptotic behavior of the partial-wave amplitudes for l >> 1 that are generated by the aforementioned singularities is found explicitly. A comparative analysis of the resulting partial-wave amplitudes for l >> 1 is performed for specific peripheral nuclear reactions induced by {sup 8}B and {sup 12}N ions at various energies.

  11. Enhancing the Security of the Maritime Supply Chain Gift Basket | National

    National Nuclear Security Administration (NNSA)

    Nuclear Security Administration Enhancing the Security of the Maritime Supply Chain Gift Basket | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets

  12. Microfabricated sleeve devices for chemical reactions

    DOE Patents [OSTI]

    Northrup, M. Allen (Berkeley, CA)

    2003-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  13. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices (Conference...

    Office of Scientific and Technical Information (OSTI)

    This paper analyzes a specific buoyancy PCR device in a micro-channel ''race-track'' ... simulation approach: (1) analytical expressions for the thermal entrance length are ...

  14. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    McInerney, Peter; Adams, Paul; Hadi, Masood Z.

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Errormore » rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less

  15. Office of Nuclear Energy Doe/ne-0143

    Energy Savers [EERE]

    Doe/ne-0143 Table of Contents Lesson 1 - Energy Basics Lesson 2 - Electricity Basics Lesson 3 - Atoms and Isotopes Lesson 4 - Ionizing Radiation Lesson 5 - Fission, Chain Reactions Lesson 6 - Atom to Electricity Lesson 7 - Waste from Nuclear Power Plants Lesson 8 - Concerns Lesson 9 - Energy and You 1 Lesson 1 Energy Basics ENERGY BASICS What is energy? Energy is the ability to do work. But what does that really mean? You might think of work as cleaning your room, cutting the grass, or studying

  16. Pulsed deuterium lithium nuclear reactor

    SciTech Connect (OSTI)

    Fischer, A.G.

    1980-01-08

    A nuclear reactor that burns hydrogen bomb material 6-lithium deuterotritide to helium in successive microexplosions which are ignited electrically and enclosed by this same molten material, and that permits the conversion of the reaction heat into useful electrical power. A specially-constructed high-current pulse machine is discharged via a thermally-preformed highly conducting path through a mass of the molten salt 6lid1-xtx (0nuclear fire is extinguished in the surrounding cold matter. The energy set free is insufficient to convert the blanket into a hot plasma in which chain reactions could propagate and escalate. The liquid blanket also serves as a neutron radiation shield. The shock wave is attenuated in it by a curtain of rising deuterium bubbles. The heat shock is buffered by partial melting of the external solid crust. The reaction heat is carried by the liquid metal of the external cooling jacket to the heat exchanger of the associated turbo-generator. Every few seconds, a new pulse can take place.

  17. Powering the Nuclear Navy | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    About Us / Our Programs / Powering the Nuclear Navy Powering the Nuclear Navy The Naval Nuclear Propulsion Program provides militarily effective nuclear propulsion plants and ensures their safe, reliable and long-lived operation. This mission requires the combination of fully trained U.S. Navy men and women with ships that excel in endurance, stealth, speed, and independence from supply chains. NNSA's Navy Reactors Program provides the design, development and operational support required to

  18. Monte Carlo without chains

    SciTech Connect (OSTI)

    Chorin, Alexandre J.

    2007-12-12

    A sampling method for spin systems is presented. The spin lattice is written as the union of a nested sequence of sublattices, all but the last with conditionally independent spins, which are sampled in succession using their marginals. The marginals are computed concurrently by a fast algorithm; errors in the evaluation of the marginals are offset by weights. There are no Markov chains and each sample is independent of the previous ones; the cost of a sample is proportional to the number of spins (but the number of samples needed for good statistics may grow with array size). The examples include the Edwards-Anderson spin glass in three dimensions.

  19. Application of evolved gas analysis to cold-cap reactions of...

    Office of Scientific and Technical Information (OSTI)

    feeds for nuclear waste vitrification Citation Details In-Document Search Title: Application of evolved gas analysis to cold-cap reactions of melter feeds for nuclear waste ...

  20. The Role of the Sellafield Ltd Centres of Expertise in Engaging with the Science, Environment and Technology Supply Chain and University Sector to Support Site Operations and Decommissioning in the UK Nuclear Industry - 13018

    SciTech Connect (OSTI)

    Butcher, Ed; Connor, Donna; Keighley, Debbie

    2013-07-01

    The development and maintenance of the broad range of the highly technical skills required for safe and successful management of nuclear sites is of vital importance during routine operations, decommissioning and waste treatment activities.. In order to maintain a core team of technical experts, across all of the disciplines required for these tasks, the approach which has been taken by the Sellafield Ltd has been the formation of twenty five Centres of Expertise (CoE), each covering key aspects of the technical skills required for nuclear site operations. Links with the Specialist University Departments: The CoE leads are also responsible for establishing formal links with university departments with specialist skills and facilities relevant to their CoE areas. The objective of these links is to allow these very specialist capabilities within the university sector to be more effectively utilized by the nuclear industry, which benefits both sectors. In addition to the utilization of specialist skills, the university links are providing an important introduction to the nuclear industry for students and researchers. This is designed to develop the pipeline of potential staff, who will be required in the future by both the academic and industrial sectors. (authors)

  1. Towards consistent nuclear models and comprehensive nuclear data

    Office of Scientific and Technical Information (OSTI)

    evaluations (Conference) | SciTech Connect Conference: Towards consistent nuclear models and comprehensive nuclear data evaluations Citation Details In-Document Search Title: Towards consistent nuclear models and comprehensive nuclear data evaluations The essence of this paper is to enlighten the consistency achieved nowadays in nuclear data and uncertainties assessments in terms of compound nucleus reaction theory from neutron separation energy to continuum. Making the continuity of

  2. Interplay between compound and fragments aspects of nuclear fission...

    Office of Scientific and Technical Information (OSTI)

    aspects of nuclear fission and heavy-ion reaction Citation Details In-Document Search Title: Interplay between compound and fragments aspects of nuclear fission and ...

  3. Application of evolved gas analysis to cold-cap reactions of melter feeds

    Office of Scientific and Technical Information (OSTI)

    for nuclear waste vitrification (Journal Article) | SciTech Connect Application of evolved gas analysis to cold-cap reactions of melter feeds for nuclear waste vitrification Citation Details In-Document Search Title: Application of evolved gas analysis to cold-cap reactions of melter feeds for nuclear waste vitrification In the vitrification of nuclear wastes, the melter feed (a mixture of nuclear waste and glass forming and modifying additives) experiences multiple gas-evolving reactions in

  4. Transport of triplet excitons along continuous 100 nm polyfluorene chains

    SciTech Connect (OSTI)

    Xi, Liang; Bird, Matthew; Mauro, Gina; Asaoka, Sadayuki; Cook, Andrew R.; Chen, Hung -Cheng; Miller, John R.

    2014-12-03

    Triplet excitons created in poly-2,7-(9,9-dihexyl)fluorene (pF) chains with end trap groups in solution are efficiently transported to and captured by the end groups. The triplets explore the entire lengths of the chains, even for ~100 nm long chains enabling determination of the completeness of end capping. The results show that the chains continuous: they may contain transient barriers or traps, such as those from fluctuations of dihedral angles, but are free of major defects that stop motion of the triplets. Quantitative determinations are aided by the addition of a strong electron donor, TMPD, which removes absorption bands of the end-trapped triplets. For chains having at least one end trap, triplet capture is quantitative on the 1 s timescale imposed by the use of the donor. Fractions of chains having no end traps were 0.15 for pF samples with anthraquinone (AQ) end traps and 0.063 with naphthylimide (NI) end traps. These determinations agreed with measurements by NMR for short (<40 polymer repeat units (PRU)) chains, where NMR determinations are accurate. The results find no evidence for traps or barriers to transport of triplets, and places limits on the possible presence of defects as impenetrable barriers to less than one per 300 PRU. The present results present a paradigm different from the current consensus, derived from observations of singlet excitons, that conjugated chains are divided into segments, perhaps by some kind of defects. For the present pF chains, the segmentation either does not apply to triplet excitons or is transient so that the defects are healed or surmounted in times much shorter than 1 s. Triplets on chains without end trap groups transfer to chains with end traps on a slower time scale. Rate constants for these bimolecular triplet transfer reactions were found to increase with the length of the accepting chain, as did rate constants for triplet transfer to the chains from small molecules like biphenyl. As a result, a second set of polyfluorenes with 2-butyloctyl side chains was found to have a much lower completeness of end capping.

  5. Transport of triplet excitons along continuous 100 nm polyfluorene chains

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Xi, Liang; Bird, Matthew; Mauro, Gina; Asaoka, Sadayuki; Cook, Andrew R.; Chen, Hung -Cheng; Miller, John R.

    2014-12-03

    Triplet excitons created in poly-2,7-(9,9-dihexyl)fluorene (pF) chains with end trap groups in solution are efficiently transported to and captured by the end groups. The triplets explore the entire lengths of the chains, even for ~100 nm long chains enabling determination of the completeness of end capping. The results show that the chains continuous: they may contain transient barriers or traps, such as those from fluctuations of dihedral angles, but are free of major defects that stop motion of the triplets. Quantitative determinations are aided by the addition of a strong electron donor, TMPD, which removes absorption bands of the end-trappedmore » triplets. For chains having at least one end trap, triplet capture is quantitative on the 1 µs timescale imposed by the use of the donor. Fractions of chains having no end traps were 0.15 for pF samples with anthraquinone (AQ) end traps and 0.063 with naphthylimide (NI) end traps. These determinations agreed with measurements by NMR for short (<40 polymer repeat units (PRU)) chains, where NMR determinations are accurate. The results find no evidence for traps or barriers to transport of triplets, and places limits on the possible presence of defects as impenetrable barriers to less than one per 300 PRU. The present results present a paradigm different from the current consensus, derived from observations of singlet excitons, that conjugated chains are divided into “segments,” perhaps by some kind of defects. For the present pF chains, the segmentation either does not apply to triplet excitons or is transient so that the defects are healed or surmounted in times much shorter than 1 µs. Triplets on chains without end trap groups transfer to chains with end traps on a slower time scale. Rate constants for these bimolecular triplet transfer reactions were found to increase with the length of the accepting chain, as did rate constants for triplet transfer to the chains from small molecules like biphenyl. As a result, a second set of polyfluorenes with 2-butyloctyl side chains was found to have a much lower completeness of end capping.« less

  6. Research in theoretical nuclear and neutrino physics. Final report

    Office of Scientific and Technical Information (OSTI)

    ANNIHILATION; FLAVOR MODEL; SUPERNOVAE; QUANTUM CHROMODYNAMICS; HEAVY ION REACTIONS; SUN; NUCLEAR THEORY; CONVERSION; CHARM PARTICLES; PROGRESS REPORT; NONLUMINOUS MATTER; STAR...

  7. TUNL Nuclear Data Project

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Energy Levels of Light Nuclei, A = 3 - 20 Nuclear Data Evaluation Project Triangular Universities Nuclear Laboratory TUNL Nuclear Data Evaluation Home Page Information on mass chains and nuclides 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Group Info Publications HTML General Tables Level Diagrams Tables of EL's NSR Key# Retrieval ENSDF Excitation Functions Thermal N Capt. G.S. Decays TUNL Dissertations NuDat at BNL Useful Links Citation Examples Home Sitemap Directory Email Us Search WWW

  8. Chemical Supply Chain Analysis | NISAC

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    NISACCapabilitiesChemical Supply Chain Analysis content top Chemical Supply Chain Analysis NISAC has developed a range of capabilities for analyzing the consequences of disruptions to the chemical manufacturing industry. Each capability provides a different but complementary perspective on the questions of interest-questions like Given an event, will the entire chemical sector be impacted or just parts? Which chemicals, plants, and complexes could be impacted? In which regions of the country?

  9. Building a Universal Nuclear Energy Density Functional

    SciTech Connect (OSTI)

    Bertulani, Carlos A.

    2014-09-10

    This grant had two components: Density functional theory and pairing and Nuclear reactions. This final report summarizes the activities for this SciDAC-2 project.

  10. Application of evolved gas analysis to cold-cap reactions of melter feeds

    Office of Scientific and Technical Information (OSTI)

    for nuclear waste vitrification (Technical Report) | SciTech Connect Technical Report: Application of evolved gas analysis to cold-cap reactions of melter feeds for nuclear waste vitrification Citation Details In-Document Search Title: Application of evolved gas analysis to cold-cap reactions of melter feeds for nuclear waste vitrification In the vitrification of nuclear wastes, the melter feed (a mixture of nuclear waste and glass-forming and modifying additives) experiences multiple

  11. Triangle Universities Nuclear Laboratory : 2011

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Based on these results we are now in the process of constructing a state-of-the-art nuclear-reaction-rate library for use in modern stellar models of massive stars, AGB...

  12. Heavy Ion Reactions - Research - Cyclotron Institute

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Heavy Ion Reactions Fast and slow components of CsI #4 are plotted. Hydrogen, Helium and Lithium isotopes are visible. The availability of energetic, light- and heavy-ion beams from the K500 Superconducting Cyclotron provides many possibilities for exploring new aspects of nuclear behavior. Using a wide variety of projectiles and bombarding energies, we achieve a more detailed understanding of the dynamics of nuclear collisions, casting new light onto the temporal evolution of quantal systems

  13. Novette chain design and performance

    SciTech Connect (OSTI)

    Hunt, J.T.; Speck, D.R.

    1980-12-11

    The design and performance of the Novette laser system, which is a two-beam, two-wavelength (1.05 ..mu.. and 0.53 ..mu..) target irradiation facility using phosphate glass laser chains, are discussed with information on the glass properties, controlling factors in the design selection, and projected performance with varying operating conditions. (LCL)

  14. Nuclear Science

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Science Nuclear Science Experimental and theoretical nuclear research carried out at NERSC is driven by the quest for improving our understanding of the building blocks of...

  15. Nuclear Theory and Applications progress report, January 1, 1989-- April 1, 1990

    SciTech Connect (OSTI)

    Strottman, D.D.; Mutschlecner, A.D. (comps.)

    1990-12-01

    This report contains brief papers on the following topics: data evaluation and libraries; data processing; nuclear applications; reactions; fission; and nuclear structure.

  16. Advanced Nuclear Reactors | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Advanced Nuclear Reactors Advanced Nuclear Reactors Turbulent Flow of Coolant in an Advanced Nuclear Reactor Visualizing Coolant Flow in Sodium Reactor Subassemblies Sodium-cooled Fast Reactor (SFR) Coolant Flow At the heart of a nuclear power plant is the reactor. The fuel assembly is placed inside a reactor vessel where all the nuclear reactions occur to produce the heat and steam used for power generation. Nonetheless, an entire power plant consists of many other support components and key

  17. Absolute nuclear material assay using count distribution (LAMBDA) space

    DOE Patents [OSTI]

    Prasad, Manoj K.; Snyderman, Neal J.; Rowland, Mark S.

    2012-06-05

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  18. Absolute nuclear material assay using count distribution (LAMBDA) space

    DOE Patents [OSTI]

    Prasad, Manoj K.; Snyderman, Neal J.; Rowland, Mark S.

    2015-12-01

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  19. Nuclear Fabrication Consortium

    SciTech Connect (OSTI)

    Levesque, Stephen

    2013-04-05

    This report summarizes the activities undertaken by EWI while under contract from the Department of Energy (DOE) – Office of Nuclear Energy (NE) for the management and operation of the Nuclear Fabrication Consortium (NFC). The NFC was established by EWI to independently develop, evaluate, and deploy fabrication approaches and data that support the re-establishment of the U.S. nuclear industry: ensuring that the supply chain will be competitive on a global stage, enabling more cost-effective and reliable nuclear power in a carbon constrained environment. The NFC provided a forum for member original equipment manufactures (OEM), fabricators, manufacturers, and materials suppliers to effectively engage with each other and rebuild the capacity of this supply chain by : • Identifying and removing impediments to the implementation of new construction and fabrication techniques and approaches for nuclear equipment, including system components and nuclear plants. • Providing and facilitating detailed scientific-based studies on new approaches and technologies that will have positive impacts on the cost of building of nuclear plants. • Analyzing and disseminating information about future nuclear fabrication technologies and how they could impact the North American and the International Nuclear Marketplace. • Facilitating dialog and initiate alignment among fabricators, owners, trade associations, and government agencies. • Supporting industry in helping to create a larger qualified nuclear supplier network. • Acting as an unbiased technology resource to evaluate, develop, and demonstrate new manufacturing technologies. • Creating welder and inspector training programs to help enable the necessary workforce for the upcoming construction work. • Serving as a focal point for technology, policy, and politically interested parties to share ideas and concepts associated with fabrication across the nuclear industry. The report the objectives and summaries of the Nuclear Fabrication Consortium projects. Full technical reports for each of the projects have been submitted as well.

  20. Nuclear Physics

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Science Programs Office of Science Nuclear Physics science-innovationassetsimagesicon-science.jpg Nuclear Physics Enabling remarkable discoveries and tools that ...

  1. Nuclear fuel element

    DOE Patents [OSTI]

    Armijo, Joseph S.; Coffin, Jr., Louis F.

    1983-01-01

    A nuclear fuel element for use in the core of a nuclear reactor is disclosed and has a composite cladding having a substrate and a metal barrier metallurgically bonded on the inside surface of the substrate so that the metal barrier forms a shield between the substrate and the nuclear fuel material held within the cladding. The metal barrier forms about 1 to about 30 percent of the thickness of the cladding and is comprised of a low neutron absorption metal of substantially pure zirconium. The metal barrier serves as a preferential reaction site for gaseous impurities and fission products and protects the substrate from contact and reaction with such impurities and fission products. The substrate of the composite cladding is selected from conventional cladding materials and preferably is a zirconium alloy. Methods of manufacturing the composite cladding are also disclosed.

  2. Nuclear fuel element

    DOE Patents [OSTI]

    Armijo, Joseph S.; Coffin, Jr., Louis F.

    1980-04-29

    A nuclear fuel element for use in the core of a nuclear reactor is disclosed and has an improved composite cladding comprised of a moderate purity metal barrier of zirconium metallurgically bonded on the inside surface of a zirconium alloy tube. The metal barrier forms a shield between the alloy tube and a core of nuclear fuel material enclosed in the composite cladding. There is a gap between the cladding and the core. The metal barrier forms about 1 to about 30 percent of the thickness of the composite cladding and has low neutron absorption characteristics. The metal barrier serves as a preferential reaction site for gaseous impurities and fission products and protects the alloy tube from contact and reaction with such impurities and fission products. Methods of manufacturing the composite cladding are also disclosed.

  3. Neutron multiplicity distributions for 30 MeVu sup 14 N reactions with the indicated targets

    SciTech Connect (OSTI)

    Not Available

    1992-06-01

    This report contains short papers on the following topics: Heavy ion reactions; nuclear structure and fundamental interactions; nuclear theory; atomic molecular and materials science; and superconducting cyclotron and instrumentation. (LSP)

  4. Chemical Functionalization of Nanostructured Materials Using Supercritical Reaction Media

    SciTech Connect (OSTI)

    Zemanian, Thomas S.; Fryxell, Glen E.; Liu, Jun; Mattigod, Shas V.; Shin, Yongsoon; Franz, James A.; Ustyugov, Oleksiy A.; Nie, Zimin

    2001-12-15

    There exists a need for durable and thin functional coatings to utilize the afforded surface area of highly porous ceramic materials. Deposition of silane-based Self Assembled Monolayers (SAMs) has thus far been limited to maximum coverages of 4-5 molecules/nm2 and long processing times (up to 2 weeks), due to the restricted internal geometry of the substrates. Results are presented for SAMs deposited on high surface area silica from supercritical fluids (SCFs). The SAMs so produced display unprecedented coverages, high monolayer integrity, and extremely low surface defect density. Moreover, the depositions and subsequent removal of reaction byproducts are complete in a matter of minutes rather than days. Nuclear Magnetic Resonance (NMR) spectra of the surface modified silica are presented, demonstrating the SAM integrity and evolution over time. Sorption of aqueous metal ions is demonstrated, and results are given demonstrating the broad pH stability of the deposited SAMs. A chemical explanation for the enhanced deposition is posited, and the kinetics of mass transport into and out of the nanostructured spaces are discussed.Related experiments using zeolite substrates show deposition of thiol-terminated silanes to internal surfaces of 6? microporous material. After oxidation of the thiol functional group size selective chemistry was demonstrated using the produced catalyst, proving the efficacy of the supercritical reaction medium for installing functional coatings inside pores of similar diameters to the chain length of the deposited molecule[]. Comparisons are made between the response of the different substrates to the supercritical fluid-based processing, and remarks on the utility of SCF based processing of nanostructured materials are presented.

  5. Nuclear Forensics

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Forensics AMS is a Powerful Tool for Nuclear Forensics Nuclear forensics, which can be applied to both interdicted materials and debris from a nuclear explosion, is the application of laboratory analysis and interpretation to provide technical conclusions (provenance, design, etc.) about a nuclear device or interdicted nuclear material. Nuclear forensic analysts can build confidence in their conclusions by employing multiple signatures that collectively minimize the subset of possible

  6. Microfluidic chemical reaction circuits

    DOE Patents [OSTI]

    Lee, Chung-cheng (Irvine, CA); Sui, Guodong (Los Angeles, CA); Elizarov, Arkadij (Valley Village, CA); Kolb, Hartmuth C. (Playa del Rey, CA); Huang, Jiang (San Jose, CA); Heath, James R. (South Pasadena, CA); Phelps, Michael E. (Los Angeles, CA); Quake, Stephen R. (Stanford, CA); Tseng, Hsian-rong (Los Angeles, CA); Wyatt, Paul (Tipperary, IE); Daridon, Antoine (Mont-Sur-Rolle, CH)

    2012-06-26

    New microfluidic devices, useful for carrying out chemical reactions, are provided. The devices are adapted for on-chip solvent exchange, chemical processes requiring multiple chemical reactions, and rapid concentration of reagents.

  7. Reaction coordinates for electron transfer reactions

    SciTech Connect (OSTI)

    Rasaiah, Jayendran C.; Zhu Jianjun

    2008-12-07

    The polarization fluctuation and energy gap formulations of the reaction coordinate for outer sphere electron transfer are linearly related to the constant energy constraint Lagrangian multiplier m in Marcus' theory of electron transfer. The quadratic dependence of the free energies of the reactant and product intermediates on m and m+1, respectively, leads to similar dependence of the free energies on the reaction coordinates and to the same dependence of the activation energy on the reorganization energy and the standard reaction free energy. Within the approximations of a continuum model of the solvent and linear response of the longitudinal polarization to the electric field in Marcus' theory, both formulations of the reaction coordinate are expected to lead to the same results.

  8. nuclear security

    National Nuclear Security Administration (NNSA)

    3%2A en Shaping the future of nuclear detection http:nnsa.energy.govblogshaping-future-nuclear-detection

    Learning techniques to combat nuclear trafficking, touring the...

  9. Nuclear Science

    Energy Savers [EERE]

    and Engineering Education Sourcebook 2013 American Nuclear Society US Department of Energy Nuclear Science & Engineering Education Sourcebook 2013 North American Edition American Nuclear Society Education, Training, and Workforce Division US Department of Energy Office of Nuclear Energy Editor and Founder John Gilligan Professor of Nuclear Engineering North Carolina State University Version 5.13 Welcome to the 2013 Edition of the Nuclear Science and Engineering Education (NS&EE)

  10. Continuous chain bit with downhole cycling capability

    DOE Patents [OSTI]

    Ritter, Don F. (Albuquerque, NM); St. Clair, Jack A. (Albuquerque, NM); Togami, Henry K. (Albuquerque, NM)

    1983-01-01

    A continuous chain bit for hard rock drilling is capable of downhole cycling. A drill head assembly moves axially relative to a support body while the chain on the head assembly is held in position so that the bodily movement of the chain cycles the chain to present new composite links for drilling. A pair of spring fingers on opposite sides of the chain hold the chain against movement. The chain is held in tension by a spring-biased tensioning bar. A head at the working end of the chain supports the working links. The chain is centered by a reversing pawl and piston actuated by the pressure of the drilling mud. Detent pins lock the head assembly with respect to the support body and are also operated by the drilling mud pressure. A restricted nozzle with a divergent outlet sprays drilling mud into the cavity to remove debris. Indication of the centered position of the chain is provided by noting a low pressure reading indicating proper alignment of drilling mud slots on the links with the corresponding feed branches.

  11. Cyclotron-based nuclear science. Progress report, April 1, 1979-March 31, 1980

    SciTech Connect (OSTI)

    Not Available

    1980-06-01

    Research at the cyclotron institute is summarized. These major areas are covered: nuclear structure; nuclear reactions and scattering; polarization studies; interdisciplinary nuclear science; instrumentation and systems development; and publications. (GHT)

  12. A,B,C`s of nuclear science

    SciTech Connect (OSTI)

    Noto, V.A.; Norman, E.B.; Chan, Yuen-Dat; Dairiki, J.; Matis, H.S.; McMahan, M.A.; Otto, R.

    1995-08-07

    This introductory level presentation contains information on nuclear structure, radioactivity, alpha decay, beta decay, gamma decay, half-life, nuclear reactions, fusion, fission, cosmic rays, and radiation protection. Nine experiments with procedures and test questions are included.

  13. Nuclear Materials Research and Technology/Los Alamos National...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    In the early 1990s, a Russian team at the Joint Institute of Nuclear Re- search at Dubna ... In this experimental setup, nuclear reaction products re- coil out of the thin 233 U ...

  14. nuclear enterprise

    National Nuclear Security Administration (NNSA)

    Outlines Accomplishments in Stockpile Stewardship, Nuclear Nonproliferation, Naval Reactors and Managing the Nuclear Enterprise

    The...

  15. Nuclear Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Safety, Security & Resilience of the Energy Infrastructure Energy Storage Nuclear Power & Engineering Grid Modernization Battery Testing Nuclear Fuel Cycle Defense Waste Management ...

  16. Interplay between compound and fragments aspects of nuclear fission...

    Office of Scientific and Technical Information (OSTI)

    Interplay between compound and fragments aspects of nuclear fission and heavy-ion reaction Citation Details In-Document Search Title: Interplay between compound and fragments...

  17. Microscopic Theory of Fission Younes, W; Gogny, D 73 NUCLEAR...

    Office of Scientific and Technical Information (OSTI)

    Conference Conference: Presented at: Compound Nuclear Reactions and Related Topics, Fish Camp, CA, United States, Oct 22 - Oct 26, 2007 Medium: ED; Size: PDF-file: 6 pages;...

  18. Evaluated Nuclear Data

    SciTech Connect (OSTI)

    Oblozinsky, P.; Oblozinsky,P.; Herman,M.; Mughabghab,S.F.

    2010-10-01

    This chapter describes the current status of evaluated nuclear data for nuclear technology applications. We start with evaluation procedures for neutron-induced reactions focusing on incident energies from the thermal energy up to 20 MeV, though higher energies are also mentioned. This is followed by examining the status of evaluated neutron data for actinides that play dominant role in most of the applications, followed by coolants/moderators, structural materials and fission products. We then discuss neutron covariance data that characterize uncertainties and correlations. We explain how modern nuclear evaluated data libraries are validated against an extensive set of integral benchmark experiments. Afterwards, we briefly examine other data of importance for nuclear technology, including fission yields, thermal neutron scattering and decay data. A description of three major evaluated nuclear data libraries is provided, including the latest version of the US library ENDF/B-VII.0, European JEFF-3.1 and Japanese JENDL-3.3. A brief introduction is made to current web retrieval systems that allow easy access to a vast amount of up-to-date evaluated nuclear data for nuclear technology applications.

  19. Better Plants Supply Chain Pilot Overview

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    SUPPLY CHAIN PILOT Learn more at energy.gov/eere/amo/better-plants The Department of Energy (DOE) is working with Better Plants Partners to improve energy efficiency throughout their supply chains. Around 40 to 60 percent of a manufacturing company's energy and carbon footprint can reside upstream in its supply chain-from raw materials, transport, and packaging to the energy consumed in manufacturing processes-but this number can be as high as 80 percent. 1 Coordinating energy management

  20. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets,...

  1. TRIMOLECULAR REACTIONS OF URANIUM HEXAFLUORIDE WITH WATER

    SciTech Connect (OSTI)

    Westbrook, M.; Becnel, J.; Garrison, S.

    2010-02-25

    The hydrolysis reaction of uranium hexafluoride (UF{sub 6}) is a key step in the synthesis of uranium dioxide (UO{sub 2}) powder for nuclear fuels. Mechanisms for the hydrolysis reactions are studied here with density functional theory and the Stuttgart small-core scalar relativistic pseudopotential and associated basis set for uranium. The reaction of a single UF{sub 6} molecule with a water molecule in the gas phase has been previously predicted to proceed over a relatively sizeable barrier of 78.2 kJ {center_dot} mol{sup -1}, indicating this reaction is only feasible at elevated temperatures. Given the observed formation of a second morphology for the UO{sub 2} product coupled with the observations of rapid, spontaneous hydrolysis at ambient conditions, an alternate reaction pathway must exist. In the present work, two trimolecular hydrolysis mechanisms are studied with density functional theory: (1) the reaction between two UF{sub 6} molecules and one water molecule, and (2) the reaction of two water molecules with a single UF{sub 6} molecule. The predicted reaction of two UF{sub 6} molecules with one water molecule displays an interesting 'fluorine-shuttle' mechanism, a significant energy barrier of 69.0 kJ {center_dot} mol{sup -1} to the formation of UF{sub 5}OH, and an enthalpy of reaction ({Delta}H{sub 298}) of +17.9 kJ {center_dot} mol{sup -1}. The reaction of a single UF{sub 6} molecule with two water molecules displays a 'proton-shuttle' mechanism, and is more favorable, having a slightly lower computed energy barrier of 58.9 kJ {center_dot} mol{sup -1} and an exothermic enthalpy of reaction ({Delta}H{sub 298}) of -13.9 kJ {center_dot} mol{sup -1}. The exothermic nature of the overall UF{sub 6} + 2 {center_dot} H{sub 2}O trimolecular reaction and the lowering of the barrier height with respect to the bimolecular reaction are encouraging; however, the sizable energy barrier indicates further study of the UF{sub 6} hydrolysis reaction mechanism is warranted to resolve the remaining discrepancies between the predicted mechanisms and experimental observations.

  2. Modeling Proton- and Light Ion-Induced Reactions at Low Energies in the MARS15 Code

    SciTech Connect (OSTI)

    Rakhno, I. L.; Mokhov, N. V.; Gudima, K. K.

    2015-04-25

    An implementation of both ALICE code and TENDL evaluated nuclear data library in order to describe nuclear reactions induced by low-energy projectiles in the Monte Carlo code MARS15 is presented. Comparisons between results of modeling and experimental data on reaction cross sections and secondary particle distributions are shown.

  3. Cold nuclear fusion

    SciTech Connect (OSTI)

    Tsyganov, E. N.

    2012-02-15

    Recent accelerator experiments on fusion of various elements have clearly demonstrated that the effective cross-sections of these reactions depend on what material the target particle is placed in. In these experiments, there was a significant increase in the probability of interaction when target nuclei are imbedded in a conducting crystal or are a part of it. These experiments open a new perspective on the problem of so-called cold nuclear fusion.

  4. Nuclear Data Sheets for A = 239

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Browne, E.; Tuli, J. K.

    2014-11-18

    Spectroscopic data and level schemes from radioactive decay and nuclear reaction studies are presented here for all nuclei with mass number A=239. In general, a relatively small amount of new data on this mass chain has been reported since the previous evaluation in 2003. However, special evaluations, such as ''Database of prompt gamma rays from slow neutron–capture from elemental analysis'' (2007ChZX), have provided additional precise data for levels in 29U. Also, new Coulomb excitation measurements in 239Pu have extended the knowledge of the 1/2[631] rotational band up to Jπ=(55/2+)Jπ=(55/2+), and that of the octupole vibrational band up to Jπ=(53/2-)Jπ=(53/2-). Formore » historical knowledge it is worth mentioning the report on the “Discovery of isotopes of the transuranium elements with 93 <= Z <= 98'' (2013Fr02), where the information for elements Np, Pu, Am, and Cf with mass number A=239 is presented. The alpha hindrance factors (HF) presented in this evaluation were calculated using values of the radius parameter (r0) interpolated from those for even–even adjacent nuclei given by 1998Ak04.« less

  5. Nuclear Data Sheets for A = 239

    SciTech Connect (OSTI)

    Browne, E.; Tuli, J. K.

    2014-11-18

    Spectroscopic data and level schemes from radioactive decay and nuclear reaction studies are presented here for all nuclei with mass number A=239. In general, a relatively small amount of new data on this mass chain has been reported since the previous evaluation in 2003. However, special evaluations, such as ''Database of prompt gamma rays from slow neutroncapture from elemental analysis'' (2007ChZX), have provided additional precise data for levels in 29U. Also, new Coulomb excitation measurements in 239Pu have extended the knowledge of the 1/2[631] rotational band up to J?=(55/2+)J?=(55/2+), and that of the octupole vibrational band up to J?=(53/2-)J?=(53/2-). For historical knowledge it is worth mentioning the report on the Discovery of isotopes of the transuranium elements with 93 <= Z <= 98'' (2013Fr02), where the information for elements Np, Pu, Am, and Cf with mass number A=239 is presented. The alpha hindrance factors (HF) presented in this evaluation were calculated using values of the radius parameter (r0) interpolated from those for eveneven adjacent nuclei given by 1998Ak04.

  6. Single-Chain Antibody Library

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Baird, Cheryl

    Researchers at Pacific Northwest National Laboratory (PNNL) have constructed a nonimmune library consisting of 109 human antibody scFv fragments, which have been cloned and expressed on the surface of yeast. Nanomolar-affinity scFvs are routinely obtained by magnetic bead screening and flow cytometric sorting. The yeast library can be amplified 1010 fold without measurable loss of clonal diversity. This allows for indefinite expansion of the library. All scFv clones can be assessed directly on the yeast cell surface by immunofluorescent labeling and flow cytometry, obviating separate subcloning, expression, and purification steps. The ability to use multiplex library screening demonstrates the utility of this approach for high-throughput antibody isolation for proteomic applications. The yeast library may be used for research projects or teaching performed for U.S. Government purposes only. If you would like to request an aliquot of the single-chain antibody library for your research, please print and fill out the Materials Transfer Agreement (MTA) [PDF, 20K]. The website provides the contact information for mailing the MTA. [copied from http://www.sysbio.org/dataresources/singlechain.stm

  7. Shutdown system for a nuclear reactor

    DOE Patents [OSTI]

    Groh, Edward F. (Naperville, IL); Olson, Arne P. (Western Springs, IL); Wade, David C. (Naperville, IL); Robinson, Bryan W. (Oak Lawn, IL)

    1984-01-01

    An ultimate shutdown system is provided for termination of neutronic activity in a nuclear reactor. The shutdown system includes bead chains comprising spherical containers suspended on a flexible cable. The containers are comprised of mating hemispherical shells which provide a ruggedized enclosure for reactor poison material. The bead chains, normally suspended above the reactor core on storage spools, are released for downward travel upon command from an external reactor monitor. The chains are capable of horizontal movement, so as to flow around obstructions in the reactor during their downward motion.

  8. Shutdown system for a nuclear reactor

    DOE Patents [OSTI]

    Groh, E.F.; Olson, A.P.; Wade, D.C.; Robinson, B.W.

    1984-06-05

    An ultimate shutdown system is provided for termination of neutronic activity in a nuclear reactor. The shutdown system includes bead chains comprising spherical containers suspended on a flexible cable. The containers are comprised of mating hemispherical shells which provide a ruggedized enclosure for reactor poison material. The bead chains, normally suspended above the reactor core on storage spools, are released for downward travel upon command from an external reactor monitor. The chains are capable of horizontal movement, so as to flow around obstructions in the reactor during their downward motion. 8 figs.

  9. Method for polymer synthesis in a reaction well

    DOE Patents [OSTI]

    Brennan, Thomas M.

    1998-01-01

    A method of synthesis for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: A) depositing a liquid reagent in a reaction well (26) in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well (26) includes at least one orifice (74) extending into the well (26), and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well (26) to enable polymer chain growth on the solid support. The method further includes the step of B) expelling the reagent solution from the well (26), while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit (80) of the orifice (74) exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well (26) through the orifice exit (80).

  10. Method for polymer synthesis in a reaction well

    DOE Patents [OSTI]

    Brennan, T.M.

    1998-09-29

    A method of synthesis is described for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: (A) depositing a liquid reagent in a reaction well in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well includes at least one orifice extending into the well, and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well to enable polymer chain growth on the solid support. The method further includes the step of (B) expelling the reagent solution from the well, while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit of the orifice exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well through the orifice exit. 9 figs.

  11. Theoretical nuclear physics at Yale University

    SciTech Connect (OSTI)

    Not Available

    1992-12-31

    Brief summaries of past and planned activities in the following areas are given: models of nuclear structure; models of hadronic structure; hot nuclei; chaos in nuclei; reactions and structure; dissipation, diffusion, and collective motion; and modeling equilibrium and nonequilibrium systems.

  12. Nuclear Data Sheets for A = 148

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Nica, N.

    2014-04-02

    The experimental nuclear structure data available through October 2013 have been reviewed. A summary of information obtained in various reaction and decay experiments is presented, together with adopted level schemes.

  13. Triangle Universities Nuclear Laboratory : 2011

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    at LENA| Reaction Rates| UNC Astrophysics| Laboratory for Experimental Nuclear Astrophysics (LENA) The LENA is among only a few accelerator facilities in the world dedicated entirely to nuclear astrophysics experiments. It has two low-energy electrostatic accelerators that are capable of delivering high-current charged-particle beams to a common target. One is an ECR source on a 200-kV platform and the other one is a 1-MV JN Van de Graaff accelerator. Both accelerators are fully

  14. The Packing of Granular Polymer Chains

    SciTech Connect (OSTI)

    Zou, Ling-Nan; Cheng, Xiang; Rivers, Mark L.; Jaeger, Heinrich M.; Nagel, Sidney R.; UC

    2009-12-01

    Rigid particles pack into structures, such as sand dunes on the beach, whose overall stability is determined by the average number of contacts between particles. However, when packing spatially extended objects with flexible shapes, additional concepts must be invoked to understand the stability of the resulting structure. Here, we examine the disordered packing of chains constructed out of flexibly connected hard spheres. Using x-ray tomography, we find that long chains pack into a low-density structure whose mechanical rigidity is mainly provided by the backbone. On compaction, randomly oriented, semi-rigid loops form along the chain, and the packing of chains can be understood as the jamming of these elements. Finally, we uncover close similarities between the packing of chains and the glass transition in polymers.

  15. Studying Nuclear Astrophysics at NIF

    SciTech Connect (OSTI)

    Boyd, R; Bernstein, L; Brune, C

    2009-07-01

    The National Ignition Facility's primary goal is to generate fusion energy. But the starlike conditions that it creates will also enable NIF scientists to study astrophysically important nuclear reactions. When scientists at the stadium-sized National Ignition Facility attempt to initiate fusion next year, 192 powerful lasers will direct 1.2 MJ of light energy toward a two-mm-diameter pellet of deuterium ({sup 2}H, or D) and tritium ({sup 3}H, or T). Some of that material will be gaseous, but most will be in a frozen shell. The idea is to initiate 'inertial confinement fusion', in which the two hydrogen isotopes fuse to produce helium-4, a neutron, and 17.6 MeV of energy. The light energy will be delivered to the inside walls of a hohlraum, a heavy-metal, centimeter-sized cylinder that houses the pellet. The container's heated walls will produce x rays that impinge on the pellet and ablate its outer surface. The exiting particles push inward on the pellet and compresses the DT fuel. Ultimately a hot spot develops at the pellet's center, where fusion produces {sup 4}He nuclei that have sufficient energy to propagate outward, trigger successive reactions, and finally react the frozen shell. Ignition should last several tens of picoseconds and generate more than 10 MJ of energy and roughly 10{sup 19} neutrons. The temperature will exceed 10{sup 8} K and fuel will be compressed to a density of several hundred g/cm{sup 3}, both considerably greater than at the center of the Sun. The figure shows a cutaway view of NIF. The extreme conditions that will be produced there simulate those in nuclear weapons and inside stars. For that reason, the facility is an important part of the US stockpile stewardship program, designed to assess the nation's aging nuclear stockpile without doing nuclear tests. In this Quick Study we consider a third application of NIF - using the extraordinary conditions it will produce to perform experiments in basic science. We will focus on measurements of some of the nuclear reaction probabilities that are important to nuclear astrophysics, the field that relates energy production and nucleosynthesis from nuclear reactions in stars and in the Big Bang to the environments in which those nuclear reactions occur. NIF, unlike previous nuclear-physics facilities, will enable measurements of nuclear reactions at the temperatures, densities, and ionization states similar to those that occur in stars.

  16. Ab initio calculations of light-ion fusion reactions (Journal Article) |

    Office of Scientific and Technical Information (OSTI)

    SciTech Connect Journal Article: Ab initio calculations of light-ion fusion reactions Citation Details In-Document Search Title: Ab initio calculations of light-ion fusion reactions The exact treatment of nuclei starting from the constituent nucleons and the fundamental interactions among them has been a long-standing goal in nuclear physics. Above all nuclear scattering and reactions, which require the solution of the many-body quantum-mechanical problem in the continuum, represent an

  17. Nuclear Data Sheets for A = 215

    SciTech Connect (OSTI)

    Singh, Balraj; Mukherjee, Gopal; Abriola, Daniel; Basu, Swapan Kumar; Demetriou, Paraskevi; Jain, Ashok; Kumar, Suresh; Singh, Sukhjeet; Tuli, Jagdish

    2013-12-15

    The evaluated spectroscopic data are presented for 12 known nuclides of mass 215 (Hg, Tl, Pb, Bi, Po, At, Rn, Fr, Ra, Ac, Th, Pa). For {sup 215}Hg, {sup 215}Tl, {sup 215}Pb, and {sup 215}Pa nuclei, no excited states are known. The decay characteristics of {sup 215}Hg and {sup 215}Tl are unknown. The decay scheme of {sup 215}Pb is considered as incomplete. Ordering of ? cascades in the decay of 36.9s isomer of {sup 215}Bi and for highspin states above 2251 keV in {sup 215}Fr are not established. Highspin excitations, including several isomeric states, are well known in {sup 215}Bi, {sup 215}Po, {sup 215}Rn, {sup 215}Fr, {sup 215}Ra, and {sup 215}Ac. No particletransfer reaction data are available for any of the A=215 nuclei. The rms charge radii for {sup 215}Pb, {sup 215}Bi, {sup 215}Po, {sup 215}Rn, {sup 215}Fr and {sup 215}Ra have been evaluated by Daniel Abriola, from extrapolation or interpolation of available evaluated data in 2013An02 for radii of respective Z chains using formula 9 in 2004An14. This evaluation was carried out as part of ENSDDworkshop at VECC, Kolkata for Nuclear Structure and Decay Data, organized and hosted by VECC and Board of Research in Nuclear Sciences (BRNS) in Kolkata, India, November 2629, 2012. This work supersedes the previous A = 215 evaluation (2001Br31) published by E. Browne which covered literature prior to May 2001.

  18. Reactor for exothermic reactions

    DOE Patents [OSTI]

    Smith, Jr., Lawrence A. (Bellaire, TX); Hearn, Dennis (Houston, TX); Jones, Jr., Edward M. (Friendswood, TX)

    1993-01-01

    A liquid phase process for oligomerization of C.sub.4 and C.sub.5 isoolefins or the etherification thereof with C.sub.1 to C.sub.6 alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120.degree. to 300.degree. F. Wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  19. Reactor for exothermic reactions

    DOE Patents [OSTI]

    Smith, L.A. Jr.; Hearn, D.; Jones, E.M. Jr.

    1993-03-02

    A liquid phase process is described for oligomerization of C[sub 4] and C[sub 5] isoolefins or the etherification thereof with C[sub 1] to C[sub 6] alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120 to 300 F. Wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  20. Nuclear Navy

    SciTech Connect (OSTI)

    1994-12-31

    This video tells the story of the Navy`s development of nuclear power and its application in long-range submarines and the growing nuclear surface force. Narrated by Frank Blair.

  1. Nuclear Energy!

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    more about Nuclear Energy When: Saturday, October 19 | 1:00 p.m. - 3:00 p.m. Where: Aiken ... an IndyCar driver, see the Nuclear Clean Air Energy race car and receive a special ...

  2. Nuclear astrophysics and electron beams

    SciTech Connect (OSTI)

    Schwenk, A.

    2013-11-07

    Electron beams provide important probes and constraints for nuclear astrophysics. This is especially exciting at energies within the regime of chiral effective field theory (EFT), which provides a systematic expansion for nuclear forces and electroweak operators based on quantum chromodynamics. This talk discusses some recent highlights and future directions based on chiral EFT, including nuclear structure and reactions for astrophysics, the neutron skin and constraints for the properties of neutron-rich matter in neutron stars and core-collapse supernovae, and the dark matter response of nuclei.

  3. Nuclear Physics Laboratory 1980 annual report

    SciTech Connect (OSTI)

    Adelberger, E.G.

    1980-09-01

    Research progress is reported in the following areas: astrophysics and cosmology, fundamental symmetries, nuclear structure and reactions, radiative capture, medium energy physics, heavy ion reactions, research by outside users, accelerators and ion sources, instrumentation and experimental techniques, and computers and computing. Publications are listed. (WHK)

  4. Interplay between compound and fragments aspects of nuclear fission and

    Office of Scientific and Technical Information (OSTI)

    heavy-ion reaction (Conference) | SciTech Connect Interplay between compound and fragments aspects of nuclear fission and heavy-ion reaction Citation Details In-Document Search Title: Interplay between compound and fragments aspects of nuclear fission and heavy-ion reaction The scission point in nuclear fission plays a special role where one-body system changes to two-body system. Inverse of this situation is realized in heavy-ion fusion reaction where two-body system changes to one body

  5. Nuclear structure studies with intermediate energy probes

    SciTech Connect (OSTI)

    Lee, T.S.H.

    1993-10-01

    Nuclear structure studies with pions are reviewed. Results from a recent study of 1 p-shell nuclei using (e,e{prime}), ({pi}, {pi}{prime}), and ({gamma},{pi}) reactions are reported. Future nuclear structure studies with GeV electrons at CEBAF are also briefly discussed.

  6. Nuclear Data Sheets for A=247

    SciTech Connect (OSTI)

    Nesaraja, Caroline D

    2015-01-01

    Available information pertaining to the nuclear structure of all nuclei with mass number A=247 is presented. Various decay and reaction data are evaluated and compared. Adopted data, levels, spin, parity and configuration assignments are given. When there are insufficient data, expected values from systematics of nuclear properties or/and theoretical calculations are quoted. Unexpected or discrepant experimental resultsare also noted.

  7. Nudat: Nuclear Structure and Decay Data from the National Nuclear Data Center (NNDC)

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    NuDat allows users to search and plot nuclear structure and decay data interactively. NuDat was developed by the National Nuclear Data Center (NNDC)but utilizes contributions from physicists around the world. It provides an interface between web users and several databases containing nuclear structure, nuclear decay and some neutron-induced nuclear reaction information. Users can search for nuclear level properties (energy, half-life, spinparity), gamma-ray information (energy, intensity, multipolarity, coincidences), radiation information following nuclear decay (energy, intensity, dose), and neutron-induced reaction data from the BNL-325 book (thermal cross section and resonance integral). The information provided by NuDat 2 can be viewed in tables, level schemes and an interactive chart of nuclides.

  8. Nuclear Data Sheets for A=159

    SciTech Connect (OSTI)

    Reich C. W.; Reich,C.W.

    2012-01-01

    The experimental results from the various reaction and radioactive decay studies leading to nuclides in the A = 159 mass chain have been reviewed. Nuclides ranging from Pm (Z = 61) through Os (Z = 74) are included. These data are summarized and presented, together with adopted level schemes and properties. This work supersedes the previous evaluation of the data on these nuclides (2003He11).

  9. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Signal Speed in Nanomagnetic Logic Chains Print Wednesday, 30 September 2015 00:00 The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated

  10. [Experimental nuclear physics]. Annual report 1988

    SciTech Connect (OSTI)

    1988-05-01

    This is the May 1988 annual report of the Nuclear Physics Laboratory of the University of Washington. It contains chapters on astrophysics, giant resonances, heavy ion induced reactions, fundamental symmetries, polarization in nuclear reactions, medium energy reactions, accelerator mass spectrometry (AMS), research by outside users, Van de Graaff and ion sources, the Laboratory`s booster linac project work, instrumentation, and computer systems. An appendix lists Laboratory personnel, Ph.D. degrees granted in the 1987-88 academic year, and publications. Refs., 27 figs., 4 tabs.

  11. [Experimental nuclear physics]. Annual report 1989

    SciTech Connect (OSTI)

    1989-04-01

    This is the April 1989 annual report of the Nuclear Physics Labortaory of the University of Washington. It contains chapters on astrophysics, giant resonances, heavy ion induced reactions, fundamental symmetries, polarization in nuclear reactions, medium energy reactions, accelerator mass spectrometry (AMS), research by outside users, Van de Graaff and ion sources, computer systems, instrumentation, and the Laboratory`s booster linac work. An appendix lists Laboratory personnel, Ph.D. degrees granted in the 1988-1989 academic year, and publications. Refs., 23 figs., 3 tabs.

  12. Civilian nuclear power on the drawing board: the development of Experimental Breeder Reactor-II.

    SciTech Connect (OSTI)

    Westfall, C.

    2003-02-20

    On September 28, 2001 a symposium was held at Argonne National Laboratory as part of the festivities to mark the 100th birthday of Enrico Fermi. The symposium celebrated Fermi's ''contribution to the development of nuclear power'' and focused on one particular ''line of development'' resulting from Fermi's interest in power reactors: Argonne's fast reactor program. Symposium participants made many references to the ways in which the program was linked to Fermi, who led the team which created the world's first self-sustaining nuclear chain reaction. For example, one presentation featured an April, 1944 memo that described a meeting attended by Fermi and others. The memo came from the time when research on plutonium and the nuclear chain reaction at Chicago's WWII Metallurgical Laboratory was nearing its end. Even as other parts of the Manhattan Engineering Project were building on this effort to create the bombs that would end the war, Fermi and his colleagues were taking the first steps to plan the use of nuclear energy in the postwar era. After noting that Fermi ''viewed the use of [nuclear] power for the heating of cities with sympathy,'' the group outlined several power reactor designs. In the course of discussion, Fermi and his colleagues took the first steps in conjuring the vision that would later be brought to life with Experimental Breeder Reactor I (EBR-I) and Experimental Breeder Reactor II (EBR-II), the celebrated achievements of the Argonne fast reactor program. Group members considered various schemes for a breeder reactor in which the relatively abundant U-238 would be placed near a core of fissionable material. The reactor would be a fast reactor; that is, neutrons would not be moderated, as were most wartime reactors. Thus, the large number of neutrons emitted in fast neutron fission would hit the U-238 and create ''extra'' fissionable material, that is, more than ''invested,'' and at the same time produce power. The group identified the problem of removing heat in such a reactor and presaged the eventual solution by suggesting the use of sodium coolant, which has minimal interaction with neutrons.

  13. Reaction of hydrogen sulfide with oxygen in the presence of sulfite

    SciTech Connect (OSTI)

    Weres, O.; Tsao, L.

    1983-01-14

    Commonly, abatement of hydrogen sulfide emission from a geothermal powerplant requires that hydrogen sulfide dissolved in the cooling water be eliminated by chemical reaction. Oxidation by atmospheric oxygen is the preferred reaction, but requires a suitable catalyst. Nickel is the most potent and thereby cheapest catalyst for this purpose. One mg/L nickel in the cooling water would allow 99% removal of hydrogen sulfide to be attained. A major drawback of catalytic air oxidation is that colloidal sulfur is a major reaction product; this causes rapid sludge accumulation and deposition of sulfur scale. We studied the kinetics and product distribution of the reaction of hydrogen sulfide with oxygen, catalyzed by nickel. Adding sodium sulfite to the solution completely suppresses formation of colloidal sulfur by converting it to thiosulfate. The oxidation reaction is an autocatalytic, free radical chain reaction. A rate expression for this reaction and a detailed reaction mechanism were developed. Nickel catalyzes the chain initiation step, and polysulfidoradical ions propagate the chains. Several complexes of iron and cobalt were also studied. Iron citrate and iron N-hydroxyEDTA are the most effective iron based catalysts. Uncomplexed cobalt is as effective as nickel, but forms a precipitate of cobalt oxysulfide and is too expensive for practical use. 33 figures, 9 tables.

  14. Reaction of Hydrogen Sulfide with Oxygen in the Presence ofSulfite

    SciTech Connect (OSTI)

    Weres, Oleh; Tsao, Leon

    1983-01-01

    Commonly, abatement of hydrogen sulfide emissions from a geothermal powerplant requires that hydrogen sulfide dissolved in the cooling water be eliminated by chemical reaction. Oxidation by atmospheric oxygen is the preferred reaction, but requires a suitable catalyst. Nickel is the most potent and thereby cheapest catalyst for this purpose. One Mg/L nickel in the cooling water would allow 99% removal of hydrogen sulfide to be attained. A major drawback of catalytic air oxidation is that colloidal sulfur is a major reaction product; this causes rapid sludge accumulation and deposition of sulfur scale. The authors studied the kinetics and product distribution of the reaction of hydrogen sulfide with oxygen, catalyzed by nickel. Adding sodium sulfite to the solution completely suppresses formation of colloidal sulfur by converting it to thiosulfate. The oxidation reaction is an autocatalytic, free radical chain reaction. A rate expression for this reaction and a detailed reaction mechanism were developed. Nickel catalyzes the chain initiation step, and polysulfidoradical ions propagate the chains. Several complexes of iron and cobalt were also studied. Iron citrate and iron N-hydroxyEDT are the most effective iron based catalysts. Uncomplexed cobalt is as effective as nickel, but forms a precipitate of cobalt oxysulfide and is too expensive for practical use.

  15. Velocity pump reaction turbine

    DOE Patents [OSTI]

    House, Palmer A. (Walnut Creek, CA)

    1984-01-01

    An expanding hydraulic/two-phase velocity pump reaction turbine including a dual concentric rotor configuration with an inter-rotor annular flow channel in which the inner rotor is mechanically driven by the outer rotor. In another embodiment, the inner rotor is immobilized and provided with gas recovery ports on its outer surface by means of which gas in solution may be recovered. This velocity pump reaction turbine configuration is capable of potential energy conversion efficiencies of up to 70%, and is particularly suited for geothermal applications.

  16. Velocity pump reaction turbine

    DOE Patents [OSTI]

    House, Palmer A. (Walnut Creek, CA)

    1982-01-01

    An expanding hydraulic/two-phase velocity pump reaction turbine including a dual concentric rotor configuration with an inter-rotor annular flow channel in which the inner rotor is mechanically driven by the outer rotor. In another embodiment, the inner rotor is immobilized and provided with gas recovery ports on its outer surface by means of which gas in solution may be recovered. This velocity pump reaction turbine configuration is capable of potential energy conversion efficiencies of up to 70%, and is particularly suited for geothermal applications.

  17. Supply Chain Sustainability Analysis of Fast Pyrolysis and Hydrotreati...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Supply Chain Sustainability Analysis of Fast Pyrolysis and Hydrotreating Bio-Oil to Produce Hydrocarbon Fuels Title Supply Chain Sustainability Analysis of Fast Pyrolysis and...

  18. Addressing Biomass Supply Chain Challenges With AFEX(tm) Technology...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Addressing Biomass Supply Chain Challenges With AFEX(tm) Technology Addressing Biomass Supply Chain Challenges With AFEX(tm) Technology Plenary IV: Advances in Bioenergy ...

  19. On-chip real-time single-copy polymerase chain reaction in picoliter droplets

    SciTech Connect (OSTI)

    Beer, N R; Hindson, B; Wheeler, E; Hall, S B; Rose, K A; Kennedy, I; Colston, B

    2007-04-20

    The first lab-on-chip system for picoliter droplet generation and PCR amplification with real-time fluorescence detection has performed PCR in isolated droplets at volumes 10{sup 6} smaller than commercial real-time PCR systems. The system utilized a shearing T-junction in a silicon device to generate a stream of monodisperse picoliter droplets that were isolated from the microfluidic channel walls and each other by the oil phase carrier. An off-chip valving system stopped the droplets on-chip, allowing them to be thermal cycled through the PCR protocol without droplet motion. With this system a 10-pL droplet, encapsulating less than one copy of viral genomic DNA through Poisson statistics, showed real-time PCR amplification curves with a cycle threshold of {approx}18, twenty cycles earlier than commercial instruments. This combination of the established real-time PCR assay with digital microfluidics is ideal for isolating single-copy nucleic acids in a complex environment.

  20. Nuclear Physics

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Science Programs » Office of Science » Nuclear Physics /science-innovation/_assets/images/icon-science.jpg Nuclear Physics Enabling remarkable discoveries and tools that transform our understanding of energy and matter and advance national, economic, and energy security. Isotopes» A roadmap of matter that will help unlock the secrets of how the universe is put together The DOE Office of Science's Nuclear Physics (NP) program supports the experimental and theoretical research needed to create

  1. Nuclear Counterterrorism

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2013-08-26

    The Order defines requirements for the protection of sensitive improvised nuclear device information and provides a framework to support DOE activities related to nuclear counterterrorism. (A supplemental DOE Manual, Control of and Access to Improvised Nuclear Device Information, provides requirements and procedures for protecting Sigma 20 information.) Appendices A and B are Official Use Only. Point of contact is Adam Boyd (NA-82), 202-586-0010. Supersedes DOE O 457.1 and DOE M 457.1-1.

  2. nuclear smuggling

    National Nuclear Security Administration (NNSA)

    13, 2015

    SHANGHAI, CHINA - Today, the Nuclear Security Administration's (NNSA) Principal Assistant Deputy Administrator for Defense...

  3. nuclear material

    National Nuclear Security Administration (NNSA)

    width"300" >WASHINGTON, D.C. - The Department of Energy's (DOE) National Nuclear Security Administration (NNSA), in partnership with the Defense Threat Reduction...

  4. nuclear weapons

    National Nuclear Security Administration (NNSA)

    09, 2015

    WASHINGTON, D.C. - The National Nuclear Security Administration (NNSA) and United States Air Force completed eight successful...

  5. nuclear controls

    National Nuclear Security Administration (NNSA)

    which "international safeguards are fully integrated into the design process of a new nuclear facility from the initial planning through design, construction, operation, and...

  6. nuclear forensics

    National Nuclear Security Administration (NNSA)

    serves as the premier technical leader in responding to and successfully resolving nuclear and radiological threats worldwide. When the need arises, NNSA is prepared to...

  7. NUCLEAR ENERGY

    Office of Environmental Management (EM)

    NUCLEAR ENERGY RESEARCH AND DEVELOPMENT ROADMAP Table of Contents List of Acronyms ................................................................................................... iii Executive Summary ............................................................................................... v 1. Introduction ...................................................................................................... 1 2. Background

  8. 2011-2012 SECTION II: HEAVY ION REACTIONS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Factors influencing residue cross section in 48Ca-induced reactions D. A. Mayorov, T. A. Werke, M. C. Alfonso, M. E. Bennett, and C. M. Folden III Characterization of a gas stopper for heavy element chemistry studies M. C. Alfonso, D. A. Mayorov, T. A. Werke, and C. M. Folden III Fabrication of lanthanide targets for nuclear reaction studies D. A. Mayorov, T. A. Werke, M. E. Bennett, and C. M. Folden III Excitation functions of 45Sc-induced reactions: towards future superheavy element synthesis

  9. More About NNSA's Naval Reactors Office | National Nuclear Security

    National Nuclear Security Administration (NNSA)

    Administration About Us / Our Programs / Powering the Nuclear Navy / More About NNSA's Naval Reactors Office More About NNSA's Naval Reactors Office The Naval Nuclear Propulsion Program provides militarily effective nuclear propulsion plants and ensures their safe, reliable and long-lived operation. This mission requires the combination of fully trained U.S. Navy men and women with ships that excel in endurance, stealth, speed, and independence from supply chains. Leadership Budget PDF

  10. More About NNSA's Naval Reactors Office | National Nuclear Security

    National Nuclear Security Administration (NNSA)

    Administration Our Mission / Powering the Nuclear Navy / More About NNSA's Naval Reactors Office More About NNSA's Naval Reactors Office The Naval Nuclear Propulsion Program provides militarily effective nuclear propulsion plants and ensures their safe, reliable and long-lived operation. This mission requires the combination of fully trained U.S. Navy men and women with ships that excel in endurance, stealth, speed, and independence from supply chains. Leadership Budget Executive Order 12344

  11. TORUS: Theory of Reactions for Unstable iSotopes - Year 1 Continuation and Progress Report

    SciTech Connect (OSTI)

    Arbanas, G; Elster, C; Escher, J; Mukhamedzhanov, A; Nunes, F; Thompson, I J

    2011-02-24

    The TORUS collaboration derives its name from the research it focuses on, namely the Theory of Reactions for Unstable iSotopes. It is a Topical Collaboration in Nuclear Theory, and funded by the Nuclear Theory Division of the Office of Nuclear Physics in the Office of Science of the Department of Energy. The funding started on June 1, 2010, it will have been running for nine months by the date of submission of this Annual Continuation and Progress Report on March 1, 2011. The extent of funding was reduced from the original application, and now supports one postdoctoral researcher for the years 1 through 3. The collaboration brings together as Principal Investigators a large fraction of the nuclear reaction theorists currently active within the USA. The mission of the TORUS Topical Collaboration is to develop new methods that will advance nuclear reaction theory for unstable isotopes by using three-body techniques to improve direct-reaction calculations, and, by using a new partial-fusion theory, to integrate descriptions of direct and compound-nucleus reactions. This multi-institution collaborative effort is directly relevant to three areas of interest: the properties of nuclei far from stability; microscopic studies of nuclear input parameters for astrophysics, and microscopic nuclear reaction theory.

  12. nuclear | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog Home /

  13. Reports to the DOE Nuclear Data Committee

    SciTech Connect (OSTI)

    Not Available

    1988-05-01

    The report in this document were submitted to the Department of Energy, Nuclear Data Committee (DOE-NDC) in April 1988. The reporting laboratories are those with a substantial program for the measurement of neutron and nuclear cross sections of relevance to the US applied nuclear energy program. Appropriate subjects are microscopic neutron cross sections relevant to the nuclear energy program, including shielding. Inverse reactions where pertinent are included; charged-particle cross sections where relevant to developing and testing nuclear models; gamma ray production, radioactive decay, and theoretical developments in nuclear structure which are applicable to nuclear energy programs; and proton and alpha-particle cross sections, at energies of up to 1 GeV, which are of interest to the space program.

  14. Nuclear Weapons Journal

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Weapons Journal Nuclear Weapons Journal The Nuclear Weapons Journal ceased publication after Issue 2, 2009. Below are Nuclear Weapons Journal archived issues. Issue 2, 2009 ...

  15. Peppytides: Interactive Models of Polypeptide Chains

    ScienceCinema (OSTI)

    Zuckermann, Ron; Chakraborty, Promita; Derisi, Joe

    2014-10-28

    Peppytides are scaled, 3D-printed models of polypeptide chains that can be folded into accurate protein structures. Designed and created by Berkeley Lab Researcher, Promita Chakraborty, and Berkeley Lab Senior Scientist, Dr. Ron Zuckermann, Peppytides are accurate physical models of polypeptide chains that anyone can interact with and fold intro various protein structures - proving to be a great educational tool, resulting in a deeper understanding of these fascinating structures and how they function. Build your own Peppytide model and learn about how nature's machines fold into their intricate architectures!

  16. Catalysts for synthesizing various short chain hydrocarbons

    DOE Patents [OSTI]

    Colmenares, Carlos (Alamo, CA)

    1991-01-01

    Method and apparatus (10), including novel photocatalysts, are disclosed for the synthesis of various short chain hydrocarbons. Light-transparent SiO.sub.2 aerogels doped with photochemically active uranyl ions (18) are fluidized in a fluidized-bed reactor (12) having a transparent window (16), by hydrogen and CO, C.sub.2 H.sub.4 or C.sub.2 H.sub.6 gas mixtures (20), and exposed to radiation (34) from a light source (32) external to the reactor (12), to produce the short chain hydrocarbons (36).

  17. Peppytides: Interactive Models of Polypeptide Chains

    SciTech Connect (OSTI)

    Zuckermann, Ron; Chakraborty, Promita; Derisi, Joe

    2014-01-21

    Peppytides are scaled, 3D-printed models of polypeptide chains that can be folded into accurate protein structures. Designed and created by Berkeley Lab Researcher, Promita Chakraborty, and Berkeley Lab Senior Scientist, Dr. Ron Zuckermann, Peppytides are accurate physical models of polypeptide chains that anyone can interact with and fold intro various protein structures - proving to be a great educational tool, resulting in a deeper understanding of these fascinating structures and how they function. Build your own Peppytide model and learn about how nature's machines fold into their intricate architectures!

  18. Reaction chemistry of cerium

    SciTech Connect (OSTI)

    1997-01-01

    It is truly ironic that a synthetic organic chemist likely has far greater knowledge of the reaction chemistry of cerium(IV) than an inorganic colleague. Cerium(IV) reagents have long since been employed as oxidants in effecting a wide variety of organic transformations. Conversely, prior to the late 1980s, the number of well characterized cerium(IV) complexes did not extend past a handful of known species. Though in many other areas, interest in the molecular chemistry of the 4f-elements has undergone an explosive growth over the last twenty years, the chemistry of cerium(IV) has for the most part been overlooked. This report describes reactions of cerium complexes and structure.

  19. Notice of Intent to Revise DOE O 452.4B, Security and Control of Nuclear Explosives and Nuclear Weapons, dated 1-11-2010

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2014-09-18

    Recent events have revealed that there are organizations that are seeking to insert malicious software and/or components into the nuclear weapon supply chain that can alter the functionality of the weapon and possible cause DAU.

  20. Nuclear Nonproliferation Treaty | National Nuclear Security Administra...

    National Nuclear Security Administration (NNSA)

    People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy ... Nuclear Nonproliferation Treaty The Treaty on the Non-Proliferation of Nuclear Weapons off ...

  1. Chart of Nuclides from the National Nuclear Data Center (NNDC)

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    The Chart of Nuclides is a software product that allows users to search and plot nuclear structure and nuclear decay data interactively. The Chart of Nuclides was developed by the National Nuclear Data Center (NNDC). It provides an interface between web users and several databases containing nuclear structure, nuclear decay and some neutron-induced nuclear reaction information. Using the Chart of Nuclides, it is possible to search for nuclear level properties (energy, half-life, spin-parity), gamma-ray information (energy, intensity, multipolarity, coincidences),radiation information following nuclear decay (energy, intensity, dose), and neutron-induced reaction data from the BNL-325 book (thermal cross section and resonance integral). The information provided by the Chart of Nuclides can be seen in tables, level schemes and an interactive chart of nuclides. (From the Chart of Nuclides Description at http://www.nndc.bnl.gov/chart/help/index.jsp?product=chart)

  2. The reaction of hydroperoxy-propyl radicals with molecular oxygen

    SciTech Connect (OSTI)

    Bozzelli, J.W.; Pitz, W.J.

    1993-12-03

    Addition of hydroperoxy-alkyl radicals to molecular oxygen leads to chain branching in autoignition and engine knock, and in low temperature oxidation of paraffins. Rate constants and product channels for reaction of hydroperoxy-propyl radicals with O{sub 2} are estimated using thermodynamic properties, bimolecular quantum Kassel analysis and transition state theory. Thermochemistry of relevant molecules and radicals is estimated using group additivity and bond dissociation groups for radicals. Results show that rates of the hydroperoxy-propyl radical addition to O{sub 2} are near their high pressure limits at {ge} 1 atm. Main products at 1--15 atm are stabilization, reverse reaction to hydroperoxy-propyl + O{sub 2} and alkyl carbonyl + OH. Reactions of the stabilized adducts, dissociation rates and product channels are estimated using unimolecular quantum Kassel analysis, because stabilization is the most important hydroperoxy-propyl radical + O{sub 2} product channel. Below 700 K, the stabilized peroxy adducts react primarily to hydroperoxy-carbonyl + OH, products which lead to chain branching. Above 700K, the stabilized peroxy adducts react primarily to hydroperoxy-propyl radical + O{sub 2}, initial reactants, which inhibits the overall oxidation. This switchover in channels correlates well observed negative temperature coefficient behavior for propane oxidation. Rate expressions for reaction of each of the three hydroperoxy-alkyl isomers with O{sub 2} and for dissociation of the associated stabilized adducts are calculated for a series of pressures at 300--2100K.

  3. Building a More Efficient Industrial Supply Chain

    Broader source: Energy.gov [DOE]

    This infographic highlights some of the ways businesses can save money at each step of the energy supply chain. Many companies can identify low-cost ways to reduce energy costs in electricity generation, electricity transmission, industrial processes, product delivery, and retail sales.

  4. Neutron multiplicity distributions for 30 MeVu {sup 14}N reactions with the indicated targets. Progress in research, April 1, 1991--March 31, 1992

    SciTech Connect (OSTI)

    Not Available

    1992-06-01

    This report contains short papers on the following topics: Heavy ion reactions; nuclear structure and fundamental interactions; nuclear theory; atomic molecular and materials science; and superconducting cyclotron and instrumentation. (LSP)

  5. Numerical simulations for low energy nuclear reactions including...

    Office of Scientific and Technical Information (OSTI)

    Resource Relation: Conference: Consultants Meeting on Recommended Input Parameters for Fission Cross-Section Calculation ; 2013-12-17 - 2013-12-18 ; Vienna, Austria Research Org: ...

  6. Random-matrix approach to the statistical compound nuclear reaction...

    Office of Scientific and Technical Information (OSTI)

    AC52-06NA25396 Resource Type: Conference Resource Relation: Conference: Random Matrix Theory, Integrable Systems, and Topology in Physics ; 2015-11-02 - 2015-11-02 ; Stony...

  7. Toward A Fundamental Understanding Of Nuclear Reactions And Exotic...

    Office of Scientific and Technical Information (OSTI)

    Authors: Quaglioni, S ; Hupin, G ; Langhammer, J ; Romero-Redondo, C ; Schuster, M D ; Johnson, C W ; Navratil, P ; Roth, R Publication Date: 2014-09-19 OSTI Identifier: 1165824 ...

  8. Nuclear Counterterrorism

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2006-02-07

    The Order defines requirements for the protection of sensitive improvised nuclear device information and provides a framework to support DOE activities related to nuclear counterterrorism. (A supplemental DOE Manual, Control of and Access to Improvised Nuclear Device Information, provides requirements and procedures for protecting Sigma 20 information. The Manual is Official Use Only, and is not available on the Directives Portal. The point of contact for the Manual is Randall Weidman, NA-121.2, 202-586-4582.) Canceled by DOE O 457.1A

  9. Nuclear spectroscopic studies. Progress report

    SciTech Connect (OSTI)

    Bingham, C.R.; Guidry, M.W.; Riedinger, L.L.; Sorensen, S.P.

    1994-02-18

    The Nuclear Physics group at UTK is involved in heavy-ion physics including both nuclear structure and reaction mechanisms. During the last year experimental work has been in 3 broad areas: structure of nuclei at high angular momentum, structure of nuclei far from stability, and ultra-relativistic heavy-ion physics. Results in these areas are described in this document under: properties of high-spin states, study of low-energy levels of nuclei far from stability, and high-energy heavy-ion physics (PHENIX, etc.). Another important component of the work is theoretical interpretation of experimental results (Joint Institute for Heavy Ion Research).

  10. National Nuclear Security Administration | National Nuclear Security...

    National Nuclear Security Administration (NNSA)

    National Nuclear Security Administration | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing...

  11. RADIOCHEMISTRY, AND NUCLEAR CHEMISTRY; NUCLEAR MEDICINE; HISTORICAL

    Office of Scientific and Technical Information (OSTI)

    The early days Richards, P. 38 RADIATION CHEMISTRY, RADIOCHEMISTRY, AND NUCLEAR CHEMISTRY; NUCLEAR MEDICINE; HISTORICAL ASPECTS; TECHNETIUM 99; COLLOIDS; MOLYBDENUM...

  12. nuclear navy

    National Nuclear Security Administration (NNSA)

    7%2A en Powering the Nuclear Navy http:nnsa.energy.govourmissionpoweringnavy

    Page...

  13. nuclear navy

    National Nuclear Security Administration (NNSA)

    7%2A en Powering the Nuclear Navy http:www.nnsa.energy.govourmissionpoweringnavy

    Page...

  14. Nuclear Diagnostics of ICF

    SciTech Connect (OSTI)

    Izumi, N; Ierche, R A; Moran, M J; Phillips, T W; Sangster, T C; Schmid, G J; Stoyer, M A; Disdier, L; Bourgade, J L; Rouyer, A; Fisher, R K; Gerggren, R R; Caldwen, S E; Faulkner, J R; Mack, J M; Oertel, J A; Young, C S; Glebov, V Y; Jaanimagi, P A; Meyerhofer, D D; Soures, J M; Stockel, C; Frenje, J A; Li, C K; Petrasso, R D

    2001-10-18

    In inertial confinement fusion (ICF), a high temperature and high density plasma is produced by the spherical implosion of a small capsule. A spherical target capsule is irradiated uniformly by a laser beam (direct irradiation) or x-rays from a high Z enclosure (hohlraum) that is irradiated by laser or ion beams (indirect irradiation). Then high-pressure ablation of the surface causes the fuel to be accelerated inward. Thermonuclear fusion reactions begin in the center region of the capsule as it is heated to sufficient temperature (10 keV) by the converging shocks (hot spot formation). During the stagnation of the imploded shell, the fuel in the shell region is compressed to high density ({approx} 10{sup 3} times solid density in fuel region). When these conditions are established, energy released by the initial nuclear reactions in center ''hot-spot'' region can heat up the cold ''fuel'' region and cause ignition. They are developing advanced nuclear diagnostics for imploding plasmas of the ignition campaign on the National Ignition Facility (NIF). The NIF is a 1.8MJ, 192-beam glass laser system that is under construction at Lawrence Livermore National Laboratory. One objective of the NIF is to demonstrate ignition and gain in an inertial confinement fusion plasma. Extreme physical conditions characterize the imploded plasmas on the NIF. First, the thickness of the plasma, expressed by areal density (plasma density times radius), is large, up to {approx} 1 g/cm{sup 2}. Highly penetrating probes such as energetic neutrons, hard x-rays, or {gamma} rays are required to see deep inside the plasma. Second, the implosion time is quite short. The implosion process takes {approx} 20 ns and the duration of the fusion reaction is on the order of 100 picoseconds. To observe the time history of the nuclear reactions, time resolution better than 10 ps is required. Third, the size of the imploded plasma is quite small ({approx} 100 {micro}m). To see the shape of burning region, a spatial resolution of {approx} 5 {micro}m is required for imaging systems. Fourth, the diagnostics operate in a harsh background. In implosion experiments, strong bursts of electromagnetic pulses, x-rays, neutrons, and neutron-induced radioactivity are produced. Therefore the diagnostics have to be designed to survive in these backgrounds. In addition, to prevent materials ablated from diagnostic components close to the target from being deposited on the laser optics, these components are excluded from a zone around the target with a radius in the range of 0.5 m to 5 m. This exclusion zone has a large impact on diagnostic design.

  15. Nuclear Nonproliferation

    SciTech Connect (OSTI)

    Atkins-Duffin, C E

    2008-12-10

    With an explosion equivalent of about 20kT of TNT, the Trinity test was the first demonstration of a nuclear weapon. Conducted on July 16, 1945 in Alamogordo, NM this site is now a Registered National Historic Landmark. The concept and applicability of nuclear power was demonstrated on December 20, 1951 with the Experimental Breeder Reactor Number One (EBR-1) lit four light bulbs. This reactor is now a Registered National Historic Landmark, located near Arco, ID. From that moment forward it had been clearly demonstrated that nuclear energy has both peaceful and military applications and that the civilian and military fuel cycles can overlap. For the more than fifty years since the Atoms for Peace program, a key objective of nuclear policy has been to enable the wider peaceful use of nuclear energy while preventing the spread of nuclear weapons. Volumes have been written on the impact of these two actions on the world by advocates and critics; pundits and practioners; politicians and technologists. The nations of the world have woven together a delicate balance of treaties, agreements, frameworks and handshakes that are representative of the timeframe in which they were constructed and how they have evolved in time. Collectively these vehicles attempt to keep political will, nuclear materials and technology in check. This paper captures only the briefest abstract of the more significant aspects on the Nonproliferation Regime. Of particular relevance to this discussion is the special nonproliferation sensitivity associated with the uranium isotope separation and spent fuel reprocessing aspects of the nuclear fuel cycle.

  16. Nuclear Astrophysics

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Astrophysics One of the great scientific challenges is understanding how elements form. This process, called nucleosynthesis, occurs at extreme stellar temperatures and pressures, making it difficult to simulate in the laboratory. The conditions produced by NIF experiments, however, are well matched to the conditions that exist in stars in several phases of their evolution. As a result, NIF is a powerful tool for exploring nuclear physics. Elements heavier than iron are formed either

  17. Nuclear Data

    SciTech Connect (OSTI)

    White, Morgan C.

    2014-01-23

    PowerPoint presentation targeted for educational use. Nuclear data comes from a variety of sources and in many flavors. Understanding where the data you use comes from and what flavor it is can be essential to understand and interpret your results. This talk will discuss the nuclear data pipeline with particular emphasis on providing links to additional resources that can be used to explore the issues you will encounter.

  18. Interlaboratory reaction rate program. 12th progress report, November 1976-October 1979

    SciTech Connect (OSTI)

    Lippincott, E.P.; McElroy, W.N.; Preston, C.C.

    1980-09-01

    The Interlaboratory Reaction Rate UILRR) program is establishing the capability to accurately measure neutron-induced reactions and reaction rates for reactor fuels and materials development programs. The goal for the principal fission reactions, /sup 235/U, /sup 238/U and /sup 239/Pu, is an accuracy to within +- 5% at the 95% confidence level. Accurate measurement of other fission and nonfission reactions is also required, but to a lesser accuracy, between +- 5% and 10% at the 95% confidence level. A secondary program objective is improvement in knowledge of the nuclear parameters involved in the standarization of fuels and materials dosimetry measurements of neutron flux, spectra, fluence and burnup.

  19. Microscopic Description of the Exotic Nuclei Reactions by Using Folding model Potentials

    SciTech Connect (OSTI)

    Ibraheem, Awad A.; Hassanain, M. A.; Mokhtar, S. R.; El-Azab Farid, M.; Zaki, M. A.; Mahmoud, Zakaria M. M.

    2011-10-27

    A microscopic folding approach based upon the effective M3Y nucleon-nucleon interaction and the nuclear matter densities of the interacting nuclei has been carried out to explain recently measured experimental data of the {sup 6}He+{sup 120}Sn elastic scattering reaction at four different laboratory energies near the Coulomb barrier. The corresponding reaction cross sections are also considered.

  20. Development of odd-Z-projectile reactions for transactinide element synthesis

    SciTech Connect (OSTI)

    Folden III, Charles Marvin

    2004-11-04

    The development of new odd-Z-projectile reactions leading to the production of transactinide elements is described. The cross section of the even-Z-projectile 208Pb(64Ni, n)271Ds reaction was measured at two new energies using the Berkeley Gas-filled Separator at the Lawrence Berkeley National Laboratory 88-Inch Cyclotron. In total, seven decay chains attributable to 271Ds were observed. These data, combined with previous results, establish an excitation function for the production of 271Ds. The maximum cross section was 20 +15 -11 pb at a center-of-target energy of 311.5 MeV in the laboratory frame.The data from the 271Ds experiments were used to estimate the optimum beam energy for the new odd-Z-projectile 208Pb(65Cu, n)272-111 reaction using the Fusion by Diffusion theory proposed by Swiatecki, Siwek-Wilczynska, and Wilczynski. A cross section for this reaction was measured for the first time, at a center-of-target energy of 321.1 MeV in the laboratory frame. The excitation energy f or compound nuclei formed at the target center was 13.2 MeV. One decay chain was observed, resulting in a measured cross section of 1.7 +3.9 -1.4 pb. This decay chain is in good agreement with previously published data on the decay of 272-111.The new odd-Z-projectile 208Pb(55Mn, n)262Bh reaction was studied at three different projectile energies, and 33 decay chains of 262Bh were observed. The existence of a previously reported alpha-decaying isomeric state in this nuclide was confirmed. Production of the ground state was preferred at all three beam energies. The maximum cross section was 540 +180 -150 pb at a projectile center-of-target energy of 264.0 MeV. This cross section is much larger than that previously reported for the even-Z-projectile 209Bi(54Cr, n)262Bh reaction, which may be because the 54Cr projectile energies in the latter reaction were too high for optimum production of the 1n product. At the highest projectile energy of 268.0 MeV in the target center, two decay chains from 261Bh were observed as a result of the 208Pb(55Mn, 2n) reaction. In summary, this work shows that odd-Z-projectile reactions can have cross sections comparable to analogous even-Z-projectile reactions, and that the energy of the maximum cross section for 1n reactions can be estimated simply.

  1. Method for preparation of single chain antibodies

    DOE Patents [OSTI]

    Cheung, Nai-Kong V. (New York, NY); Guo, Hong-fen (New York, NY)

    2012-04-03

    This invention provides a method for identifying cells expressing a target single chain antibody (scFv) directed against a target antigen from a collection of cells that includes cells that do not express the target scFv, comprising the step of combining the collection of cells with an anti-idiotype directed to an antibody specific for the target antigen and detecting interaction, if any, of the anti-idiotype with the cells, wherein the occurrence of an interaction identifies the cell as one which expresses the target scFv. This invention also provides a method for making a single chain antibody (scFv) directed against an antigen, wherein the selection of clones is made based upon interaction of those clones with an appropriate anti-idiotype, and heretofore inaccessible scFv so made. This invention provides the above methods or any combination thereof. Finally, this invention provides various uses of these methods.

  2. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated to minimizing the energy required to perform computational operations and to

  3. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated to minimizing the energy required to perform computational operations and to

  4. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated to minimizing the energy required to perform computational operations and to

  5. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated to minimizing the energy required to perform computational operations and to

  6. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated to minimizing the energy required to perform computational operations and to

  7. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated to minimizing the energy required to perform computational operations and to

  8. Adsorption of polymer chains at penetrable interfaces

    SciTech Connect (OSTI)

    Gerasimchuk, I. V.; Sommer, J.-U.; Gerasimchuk, V. S.

    2011-03-15

    We investigate the problem of adsorption (localization) of polymer chains in the system of two penetrable interfaces within the mean-field approximation. The saturation of the polymer system in the limit case of zero bulk concentration is studied. We find the exact solution of this mean-field polymer adsorption problem that opens the possibility to treat various localization problems for polymer chains in such environments using appropriate boundary conditions. The exact solution is controlled by a single scaling variable that describes the coupling between the interfaces due to the polymer chains. We obtain a nonmonotonic behavior of the amount of adsorbed polymers as a function of the distance between the interfaces. This leads to a high-energy and a low-energy phase for the double layer with respect to the amount of polymers localized. At the saturation point, we find the total energy of the system and determine the force acting between the interfaces to be strictly attractive and to monotonically decay to zero when the interface distance increases.

  9. Kinetic simulations of plasmoid chain dynamics

    SciTech Connect (OSTI)

    Markidis, S. [High Performance Computing and Visualization (HPCViz) Department, KTH Royal Institute of Technology, Stockholm (Sweden)] [High Performance Computing and Visualization (HPCViz) Department, KTH Royal Institute of Technology, Stockholm (Sweden); Henri, P. [Universit de Nice Sophia Antipolis, CNRS, Observatoire de la Cte d'Azur, Nice (France)] [Universit de Nice Sophia Antipolis, CNRS, Observatoire de la Cte d'Azur, Nice (France); Lapenta, G. [Centrum voor Plasma-Astrofysica, Department Wiskunde, Katholieke Universiteit Leuven, Leuven (Belgium)] [Centrum voor Plasma-Astrofysica, Department Wiskunde, Katholieke Universiteit Leuven, Leuven (Belgium); Divin, A. [Swedish Institute of Space Physics, Uppsala (Sweden)] [Swedish Institute of Space Physics, Uppsala (Sweden); Goldman, M.; Newman, D. [Department of Physics and CIPS, University of Colorado, Boulder 80309-0390 (United States)] [Department of Physics and CIPS, University of Colorado, Boulder 80309-0390 (United States); Laure, E. [PDC and High Performance Computing and Visualization (HPCViz) Department, KTH Royal Institute of Technology, Stockholm (Sweden)] [PDC and High Performance Computing and Visualization (HPCViz) Department, KTH Royal Institute of Technology, Stockholm (Sweden)

    2013-08-15

    The dynamics of a plasmoid chain is studied with three dimensional Particle-in-Cell simulations. The evolution of the system with and without a uniform guide field, whose strength is 1/3 the asymptotic magnetic field, is investigated. The plasmoid chain forms by spontaneous magnetic reconnection: the tearing instability rapidly disrupts the initial current sheet generating several small-scale plasmoids that rapidly grow in size coalescing and kinking. The plasmoid kink is mainly driven by the coalescence process. It is found that the presence of guide field strongly influences the evolution of the plasmoid chain. Without a guide field, a main reconnection site dominates and smaller reconnection regions are included in larger ones, leading to an hierarchical structure of the plasmoid-dominated current sheet. On the contrary in presence of a guide field, plasmoids have approximately the same size and the hierarchical structure does not emerge, a strong core magnetic field develops in the center of the plasmoid in the direction of the existing guide field, and bump-on-tail instability, leading to the formation of electron holes, is detected in proximity of the plasmoids.

  10. Duplex quantum communication through a spin chain

    SciTech Connect (OSTI)

    Wang Zhaoming; Gu Yongjian [Department of Physics, Ocean University of China, Qingdao 266100 (China); Bishop, C. Allen [Department of Physics, Southern Illinois University, Carbondale, Illinois 62901-4401 (United States); Shao Bin [Department of Physics, Beijing Institute of Technology, Beijing 100081 (China)

    2011-08-15

    Data multiplexing within a quantum computer can allow for the simultaneous transfer of multiple streams of information over a shared medium thereby minimizing the number of channels needed for requisite data transmission. Here, we investigate a two-way quantum communication protocol using a spin chain placed in an external magnetic field. In our scheme, Alice and Bob each play the role of a sender and a receiver as two states, cos(({theta}{sub 1}/2))0+sin(({theta}{sub 1}/2))e{sup i{phi}{sub 1}}1 and cos(({theta}{sub 2}/2))0+sin(({theta}{sub 2}/2))e{sup i{phi}{sub 2}}1, are transferred through one channel simultaneously. We find that the transmission fidelity at each end of a spin chain can usually be enhanced by the presence of a second party. This is an important result for establishing the viability of duplex quantum communication through spin chain networks.

  11. Reich-Moore Parameterization of ({alpha},n) Reactions on Light Nuclei:

    Office of Scientific and Technical Information (OSTI)

    Impact on a Neutron Source Calculation in an Oxide Fuel (Journal Article) | SciTech Connect Reich-Moore Parameterization of ({alpha},n) Reactions on Light Nuclei: Impact on a Neutron Source Calculation in an Oxide Fuel Citation Details In-Document Search Title: Reich-Moore Parameterization of ({alpha},n) Reactions on Light Nuclei: Impact on a Neutron Source Calculation in an Oxide Fuel Evaluated data are adjusted on experimental measurements using nuclear reaction models. Among these data,

  12. Investigation of reports of fusion reactions occurring at the cathode in glow discharges

    SciTech Connect (OSTI)

    Ellison, C.H.; Mahaffey, J.A.

    1996-01-01

    Recent reports of deuteron-deuteron (d-d) neutrons resulting from nuclear reactions in or at the palladium cathode of a deuterium glow discharge were investigated. The equipment, techniques, and experimental procedures are discussed in detail, as well as various possible mechanisms to produce such reactions. The results of this investigation do not confirm the presence of d-d reactions. 15 refs., 9 figs.

  13. Microsoft Word - Nuclear_Astrophysics_Summary

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Astrophysics Working Group Report Convenors: J. A. Clark (ANL) and C. M. Deibel (LSU) The nuclear astrophysics session consisted of six invited talks and one contributed talk, which spanned a fairly large range of astrophysical processes from those involving nuclei close to or at stability to those far from stability over a variety of masses:  A. A. Chen (McMaster University): Classical Novae, Type I X-ray Bursts and ATLAS  S. Almaraz-Calderon (ANL): Fusion Reactions in Nuclear

  14. Nuclear Data Sheets for A=243

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Nesaraja, Caroline D; McCutchan, Elizabeth A.

    2014-01-01

    Available information pertaining to the nuclear structure o f all nuclei with mass numbers A=243 i s presented. Various decay and reaction data are evaluated and compared. Adopted data, levels, spin, parity and configuration assignments are given. When there are insufficient data, expected values from systematics of nuclear properties or/and theoretical calculations are quoted. Unexpected or discrepant experimental results are also noted.

  15. Ion-induced nuclear radiotherapy

    DOE Patents [OSTI]

    Horn, K.M.; Doyle, B.L.

    1996-08-20

    Ion-induced Nuclear Radiotherapy (INRT) is a technique for conducting radiosurgery and radiotherapy with a very high degree of control over the spatial extent of the irradiated volume and the delivered dose. Based upon the concept that low energy, ion induced atomic and nuclear reactions can be used to produce highly energetic reaction products at the site of a tumor, the INRT technique is implemented through the use of a conduit-needle or tube which conducts a low energy ion beam to a position above or within the intended treatment area. At the end of the conduit-needle or tube is a specially fabricated target which, only when struck by the ion beam, acts as a source of energetic radiation products. The inherent limitations in the energy, and therefore range, of the resulting reaction products limits the spatial extent of irradiation to a pre-defined volume about the point of reaction. Furthermore, since no damage is done to tissue outside this irradiated volume, the delivered dose may be made arbitrarily large. INRT may be used both as a point-source of radiation at the site of a small tumor, or as a topical bath of radiation to broad areas of diseased tissue. 25 figs.

  16. Ion-induced nuclear radiotherapy

    DOE Patents [OSTI]

    Horn, Kevin M.; Doyle, Barney L.

    1996-01-01

    Ion-induced Nuclear Radiotherapy (INRT) is a technique for conducting radiosurgery and radiotherapy with a very high degree of control over the spatial extent of the irradiated volume and the delivered dose. Based upon the concept that low energy, ion induced atomic and nuclear reactions can be used to produce highly energetic reaction products at the site of a tumor, the INRT technique is implemented through the use of a conduit-needle or tube which conducts a low energy ion beam to a position above or within the intended treatment area. At the end of the conduit-needle or tube is a specially fabricated target which, only when struck by the ion beam, acts as a source of energetic radiation products. The inherent limitations in the energy, and therefore range, of the resulting reaction products limits the spatial extent of irradiation to a pre-defined volume about the point of reaction. Furthermore, since no damage is done to tissue outside this irradiated volume, the delivered dose may be made arbitrarily large. INRT may be used both as a point-source of radiation at the site of a small tumor, or as a topical bath of radiation to broad areas of diseased tissue.

  17. Green Energy Supply Chain Franchise and Excise Tax Credit

    Broader source: Energy.gov [DOE]

    A certified green energy supply chain manufacturer and campus affiliate, integrated customer or integrated supplier of a green energy supply chain manufacturer is allowed a tax credit against their...

  18. Nuclear Models

    SciTech Connect (OSTI)

    Fossion, Ruben [Instituto de Ciencias Nucleares, Universidad Nacional Autonoma de Mexico, Apartado Postal 70-543, Mexico D. F., C.P. 04510 (Mexico)

    2010-09-10

    The atomic nucleus is a typical example of a many-body problem. On the one hand, the number of nucleons (protons and neutrons) that constitute the nucleus is too large to allow for exact calculations. On the other hand, the number of constituent particles is too small for the individual nuclear excitation states to be explained by statistical methods. Another problem, particular for the atomic nucleus, is that the nucleon-nucleon (n-n) interaction is not one of the fundamental forces of Nature, and is hard to put in a single closed equation. The nucleon-nucleon interaction also behaves differently between two free nucleons (bare interaction) and between two nucleons in the nuclear medium (dressed interaction).Because of the above reasons, specific nuclear many-body models have been devised of which each one sheds light on some selected aspects of nuclear structure. Only combining the viewpoints of different models, a global insight of the atomic nucleus can be gained. In this chapter, we revise the the Nuclear Shell Model as an example of the microscopic approach, and the Collective Model as an example of the geometric approach. Finally, we study the statistical properties of nuclear spectra, basing on symmetry principles, to find out whether there is quantum chaos in the atomic nucleus. All three major approaches have been rewarded with the Nobel Prize of Physics. In the text, we will stress how each approach introduces its own series of approximations to reduce the prohibitingly large number of degrees of freedom of the full many-body problem to a smaller manageable number of effective degrees of freedom.

  19. Solid State NMR Investigations of Chain Dynamics and Network...

    Office of Scientific and Technical Information (OSTI)

    Resource Relation: Conference: Presented at: Silicon containing polymers and composites ... AND ANALYTICAL CHEMISTRY; CHAINS; ELASTOMERS; POLYMERS; PROBES; SILICON; SILOXANES

  20. U.S. Offshore Wind Manufacturing and Supply Chain Development...

    Broader source: Energy.gov (indexed) [DOE]

    an organized, analytical approach to identifying and bounding uncertainties around offshore wind manufacturing and supply chain capabilities; projecting potential...

  1. Photovoltaic Supply Chain and Cross-Cutting Technologies Round 2 |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Department of Energy Technology to Market » Photovoltaic Supply Chain and Cross-Cutting Technologies Round 2 Photovoltaic Supply Chain and Cross-Cutting Technologies Round 2 Four projects are working to accelerate the development of revolutionary products or processes for the photovoltaic (PV) industry through the High Impact Supply Chain R&D for PV Technologies/Systems program, which represents the second round of PV Supply Chain and Cross-Cutting Technologies funding. These projects

  2. Tuesday Webcasts for Industry: Engaging Supply Chains in Energy Management

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Engaging Supply Chains in Energy Management April 10, 2012 2 | Advanced Manufacturing Office eere.energy.gov * Overview and Welcome * Engaging Supply Chains in Energy Management - Ron Reising, EUISSCA * 2012 Supplier Sustainability Outreach Program - Eric Battino, PepsiCo * Questions and Answers * Accessing Slides Agenda April 10, 2012 Engaging Supply Chains in Energy Management 4 Current members include 16 of the largest electric utilities in the U.S. Electric Utility Sustainable Supply Chain

  3. Supply Chain Risk Management (SCRM) Awareness Toolkit | Department of

    Energy Savers [EERE]

    Energy Supply Chain Risk Management (SCRM) Awareness Toolkit Supply Chain Risk Management (SCRM) Awareness Toolkit The Office of the Chief Information Officer (OCIO) Supply Chain Risk Management (SCRM) Resource Center developed the SCRM Awareness Toolkit to introduce DOE employees to the basic terms and concepts of the technology supply chain and associated threats. For additional information on the DOE Enterprise SCRM Resource Center and program initiatives, please contact Sue Farrand at

  4. Nuclear Data Sheets for A = 161

    SciTech Connect (OSTI)

    Reich C. W.; Reich C.W.

    2011-10-01

    The experimental results from the various reaction and radioactive decay studies leading to nuclides in the A = 161 mass chain have been reviewed. Nuclides ranging from Sm (Z = 62) through Os (Z = 76) are included, with Os being a new entry based on a recently reported study. These data are summarized and presented, together with adopted level schemes and properties. This work supersedes the previous evaluation (2000Re14) of the data on these nuclides.

  5. Optical probe for the cytochrome P-450 cholesterol side chain cleavage enzyme

    DOE Patents [OSTI]

    Marrone, Babetta L. (Los Alamos, NM); Simpson, Daniel J. (Los Alamos, NM); Unkefer, Clifford J. (Los Alamos, NM); Whaley, Thomas W. (Santa Fe, NM)

    1992-01-01

    An optical probe enables the study of enzyme activity by absorbance spectroscopy or by sensitive fluorescence methods. In particular, the probe provides the ability to monitor the activity of cytochrome P-450.sub.scc enzyme, the rate limiting enzyme for steroid biosynthesis. Located on the inner mitochondrial membrane, P-450.sub.scc catalyzes the conversion of cholesterol to pregnenolone and isocapraldehyde by sequential oxidations of the cholesterol side chain. The fluorogenic probe includes a cholesterol-like steroid linked to a chromophore through a linking group. The chromophore is selected to have little optical response when linked to the steroid substrate and an enhanced optical response when cleaved from the substrate and linking group. Thus, a fluorescent anion that can be optically detected is generated by the side-chain cleavage reaction during steroidogenesis.

  6. Optical probe for the cytochrome P-450 cholesterol side chain cleavage enzyme

    DOE Patents [OSTI]

    Marrone, Babetta L. (Los Alamos, NM); Simpson, Daniel J. (Los Alamos, NM); Unkefer, Clifford J. (Los Alamos, NM); Whaley, Thomas W. (Santa Fe, NM)

    1993-01-01

    An optical probe enables the study of enzyme activity by absorbance spectroscopy or by sensitive fluorescence methods. In particular, the probe provides the ability to monitor the activity of cytochrome P-450.sub.scc enzyme, the rate limiting enzyme for steroid biosynthesis. Located on the inner mitochondrial membrane, P-450.sub.scc catalyzes the conversion of cholesterol to pregnenolone and isocapraldehyde by sequential oxidations of the cholesterol side chain. The fluorogenic probe includes a cholesterol-like steroid linked to a chromophore through a linking group. The chromophore is selected to have little optical response when linked to the steroid substrate and an enhanced optical response when cleaved from the substrate and linking group. Thus, a fluorescent anion that can be optically detected is generated by the side-chain cleavage reaction during steroidogenesis.

  7. Solid state laser media driven by remote nuclear powered fluorescence

    DOE Patents [OSTI]

    Prelas, Mark A.

    1992-01-01

    An apparatus is provided for driving a solid state laser by a nuclear powered fluorescence source which is located remote from the fluorescence source. A nuclear reaction produced in a reaction chamber generates fluorescence or photons. The photons are collected from the chamber into a waveguide, such as a fiber optic waveguide. The waveguide transports the photons to the remote laser for exciting the laser.

  8. Nuclear Data Sheets for A = 92

    SciTech Connect (OSTI)

    Baglin, Coral M.

    2012-10-15

    Nuclear structure and decay data pertaining to all nuclides with mass number A = 92 (As, Se, Br, Kr, Rb, Sr, Y, Zr, Nb, Mo, Tc, Ru, Rh, Pd) have been compiled and evaluated, and incorporated into the ENSDF data file. All literature available by 15 September 2012 has been considered. This evaluation supersedes the previous publication for this mass chain (Coral M. Baglin, Nuclear Data Sheets 91, 423 (2000) (November 2000 cutoff date)), and subsequent unpublished reevaluations by C.M. Baglin for {sup 92}Kr (January 2004 literature cut-off) and {sup 92}Sr (August 2003 literature cut-off).

  9. U.S. Offshore Wind Manufacturing and Supply Chain Development

    SciTech Connect (OSTI)

    Hamilton, Bruce

    2013-02-22

    This report seeks to provide an organized, analytical approach to identifying and bounding uncertainties around offshore wind manufacturing and supply chain capabilities; projecting potential component-level supply chain needs under three demand scenarios; and identifying key supply chain challenges and opportunities facing the future U.S. market and current suppliers of the nation’s landbased wind market.

  10. Attempt to confirm superheavy element production in the 48Ca +238U reaction

    SciTech Connect (OSTI)

    Gregorich, K.E.; Loveland, W.; Peterson, D.; Zielinski, P.M.; Nelson, S.L.; Chung, Y.H.; Dullmann, Ch.E.; Folden III, C.M.; Aleklett,K.; Eichler, R.; Hoffman D.C.; Omtvedt, J.P.; Pang, G.K.; Schwantes,J.M.; Soverna, S.; Sprunger, P.; Sudowe, R.; Wilson, R.E.; Nitsche, H.

    2005-03-24

    An attempt to confirm production of superheavy elements in the reaction of 48Ca beams with actinide targets has been performed using the 238U(48Ca,3n)283112 reaction. Two 48Ca projectile energies were used, that spanned the energy range where the largest cross sections have been reported for this reaction. No spontaneous fission events were observed. No alpha decay chains consistent with either reported or theoretically predicted element 112 decay properties were observed. The cross section limits reached are significantly smaller than the recently reported cross sections.

  11. Attempt to confirm superheavy element production in the {sup 48}Ca+{sup 238}U reaction

    SciTech Connect (OSTI)

    Gregorich, K.E.; Sudowe, R.; Loveland, W.; Sprunger, P.; Peterson, D.; Zielinski, P.M.; Nelson, S.L.; Duellmann, Ch.E.; Folden III, C.M.; Hoffman, D.C.; Wilson, R.E.; Nitsche, H.; Chung, Y.H.; Aleklett, K.; Eichler, R.; Soverna, S.; Omtvedt, J.P.; Pang, G.K.; Schwantes, J.M.

    2005-07-01

    An attempt to confirm production of superheavy elements in the reaction of {sup 48}Ca beams with actinide targets has been performed using the {sup 238}U({sup 48}Ca,3n){sup 283}112 reaction. Two {sup 48}Ca projectile energies were used that spanned the energy range where the largest cross sections have been reported for this reaction. No spontaneous fission events were observed. No {alpha} decay chains consistent with either reported or theoretically predicted element 112 decay properties were observed. The cross-section limits reached are significantly smaller than the recently reported cross sections.

  12. Two chamber reaction furnace

    DOE Patents [OSTI]

    Blaugher, R.D.

    1998-05-05

    A vertical two chamber reaction furnace is described. The furnace comprises a lower chamber having an independently operable first heating means for heating the lower chamber and a gas inlet means for admitting a gas to create an ambient atmosphere, and an upper chamber disposed above the lower chamber and having an independently operable second heating means for heating the upper chamber. Disposed between the lower chamber and the upper chamber is a vapor permeable diffusion partition. The upper chamber has a conveyor means for conveying a reactant there through. Of particular importance is the thallinating of long-length thallium-barium-calcium-copper oxide (TBCCO) or barium-calcium-copper oxide (BCCO) precursor tapes or wires conveyed through the upper chamber to thereby effectuate the deposition of vaporized thallium (being so vaporized as the first reactant in the lower chamber at a temperature between about 700 C and 800 C) on TBCCO or BCCO tape or wire (the second reactant) at its simultaneous annealing temperature in the upper chamber of about 800 to 950 C to thereby replace thallium oxide lost from TBCCO tape or wire because of the high annealing temperature or to deposit thallium on BCCO tape or wire. Continuously moving the tape or wire provides a single-step process that effectuates production of long-length TBCCO superconducting product. 2 figs.

  13. 2013-2014 SECTION II: HEAVY ION REACTIONS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Recent results of 45Sc-induced fusion evaporation reactions on 158,160Gd T. A. Werke, D. A. Mayorov, M. C. Alfonso, M. M. Frey, and C. M. Folden III Production cross sections of residues in 50Ti-induced reactions D. A. Mayorov, T. A. Werke, M. C. Alfonso, M. M. Frey, E. E. Tereshatov, and C. M. Folden III Development of nuclear forensics program at Texas A&M University T. K. Bhardwaj, J. R. Allred, K. F. Jones, P. M. Mendoza, R. L. Du, C. M. Folden III, and S. S. Chirayath Exploring the

  14. 2013 Nuclear Workforce Development ...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Energy Impact Topics: Today's & Tomorrow's New Nuclear Energy Construction & the Workforce Outlook Current New Nuclear Energy Construction Projects Small Modular...

  15. Nuclear Science & Technology

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Science & Technology Nuclear Science & Technology1354608000000Nuclear Science & TechnologySome of these resources are LANL-only and will require Remote Access. No...

  16. Metal-Ion-Mediated Reactions

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Researchers from Patras (Greece), Nicosia (Cyprus), Karlsruhe (Germany), Zaragoza (Spain), and the ALS at Berkeley Lab have studied metal-ion-mediated reactions of...

  17. Nuclear reactor shutdown system

    DOE Patents [OSTI]

    Bhate, Suresh K. (Niskayuna, NY); Cooper, Martin H. (Monroeville, PA); Riffe, Delmar R. (Murrysville, PA); Kinney, Calvin L. (Penn Hills, PA)

    1981-01-01

    An inherent shutdown system for a nuclear reactor having neutron absorbing rods affixed to an armature which is held in an upper position by a magnetic flux flowing through a Curie temperature material. The Curie temperature material is fixedly positioned about the exterior of an inner duct in an annular region through which reactor coolant flows. Elongated fuel rods extending from within the core upwardly toward the Curie temperature material are preferably disposed within the annular region. Upon abnormal conditions which result in high neutron flux and coolant temperature, the Curie material loses its magnetic permeability, breaking the magnetic flux path and allowing the armature and absorber rods to drop into the core, thus shutting down the fissioning reaction. The armature and absorber rods are retrieved by lowering the housing for the electromagnet forming coils which create a magnetic flux path which includes the inner duct wall. The coil housing then is raised, resetting the armature.

  18. About the Neutron and Nuclear Science Research (WNR) facility at LANSCE

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    About the Neutron and Nuclear Science (WNR) Facility The Neutron and Nuclear Science (WNR) Facility provides neutron and proton beams and detector arrays for basic, applied, industrial, and defense-related research. Neutron and Nuclear Science The Neutron and Nuclear Science (WNR) Facility consists of a high-energy "white" neutron source (Target 4) with 6 flight paths, three low-energy nuclear science flight paths at the Lujan Center (Target-1), and a proton reaction area (Target-2).

  19. Application of nuclear models to neutron nuclear cross section calculations

    SciTech Connect (OSTI)

    Young, P.G.

    1982-01-01

    Nuclear theory is used increasingly to supplement and extend the nuclear data base that is available for applied studies. Areas where theoretical calculations are most important include the determination of neutron cross sections for unstable fission products and transactinide nuclei in fission reactor or nuclear waste calculations and for meeting the extensive dosimetry, activation, and neutronic data needs associated with fusion reactor development, especially for neutron energies above 14 MeV. Considerable progress has been made in the use of nuclear models for data evaluation and, particularly, in the methods used to derive physically meaningful parameters for model calculations. Theoretical studies frequently involve use of spherical and deformed optical models, Hauser-Feshbach statistical theory, preequilibrium theory, direct-reaction theory, and often make use of gamma-ray strength function models and phenomenological (or microscopic) level density prescriptions. The development, application, and limitations of nuclear models for data evaluation are discussed, with emphasis on the 0.1 to 50 MeV energy range. (91 references).

  20. Surface-micromachined chain for use in microelectromechanical structures

    DOE Patents [OSTI]

    Vernon, Sr., George E. (Rio Rancho, NM)

    2001-01-01

    A surface-micromachined chain and a microelectromechanical (MEM) structure incorporating such a chain are disclosed. The surface-micromachined chain can be fabricated in place on a substrate (e.g. a silicon substrate) by depositing and patterning a plurality of alternating layers of a chain-forming material (e.g. polycrystalline silicon) and a sacrificial material (e.g. silicon dioxide or a silicate glass). The sacrificial material is then removed by etching to release the chain for movement. The chain has applications for forming various types of MEM devices which include a microengine (e.g. an electrostatic motor) connected to rotate a drive sprocket, with the surface-micromachined chain being connected between the drive sprocket and one or more driven sprockets.

  1. Nuclear and Radiological Material Security | National Nuclear...

    National Nuclear Security Administration (NNSA)

    This includes NNSA's work to advance physical protection standards for nuclear facilities and to strengthen nuclear safeguards, which are criteria for the physical security and the ...

  2. nuclear safeguards | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Home nuclear safeguards nuclear safeguards Working With PNNL Mentors, Engineering Students Deliver Prototype Safeguards Fixtures Earlier this month, Washington State University...

  3. Nuclear Suppliers Group & Regimes | National Nuclear Security...

    National Nuclear Security Administration (NNSA)

    | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency ...

  4. Nuclear Energy Systems Laboratory (NESL) / Transient Nuclear...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Transient Nuclear Fuels Testing - Sandia Energy Energy Search Icon Sandia Home Locations ... Safety, Security & Resilience of the Energy Infrastructure Energy Storage Nuclear Power & ...

  5. Nuclear / Radiological Advisory Team | National Nuclear Security...

    National Nuclear Security Administration (NNSA)

    | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency ...

  6. nuclear material | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response ...

  7. Nuclear Forensics | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Forensics | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy ...

  8. Nuclear Incident Team | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Incident Team | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear ...

  9. nuclear weapons | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    weapons | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy ...

  10. Audit Report National Nuclear Security Administration Nuclear...

    Office of Environmental Management (EM)

    National Nuclear Security Administration Nuclear Weapons Systems Configuration Management DOEIG-0902 March 2014 U.S. Department of Energy Office of Inspector General Office of ...

  11. Ab initio calculations of light-ion fusion reactions

    SciTech Connect (OSTI)

    Hupin, G.; Quaglioni, S.; Navratil, P.

    2012-10-20

    The exact treatment of nuclei starting from the constituent nucleons and the fundamental interactions among them has been a long-standing goal in nuclear physics. Above all nuclear scattering and reactions, which require the solution of the many-body quantum-mechanical problem in the continuum, represent an extraordinary theoretical as well as computational challenge for ab initio approaches. The ab initio No-Core Shell Model/Resonating-Group Method (NCSM/RGM) complements a microscopic cluster technique with the use of realistic interactions, and a microscopic and consistent description of the nucleon clusters. This approach is capable of describing simultaneously both bound and scattering states in light nuclei. Recent applications to light nuclei scattering and fusion reactions relevant to energy production in stars and Earth based fusion facilities, such as the deuterium-{sup 3}He fusion, are presented. Progress toward the inclusion of the three nucleon force into the formalism is outlined.

  12. Uranium in the Near-shore Aquatic Food Chain: Studies on Periphyton and Asian Clams

    SciTech Connect (OSTI)

    Bunn, Amoret L.; Miley, Terri B.; Eslinger, Paul W.; Brandt, Charles A.; Napier, Bruce A.

    2007-12-31

    The benthic aquatic organisms in the near-shore environment of the Columbia River are the first biological receptors that can be exposed to groundwater contaminants coming from the U.S. Department of Energy's Hanford Site. The primary contaminant of concern in the former nuclear fuels processing area at the Site, known as the 300 Area, is uranium. Currently, there are no national clean up criteria for uranium and ecological receptors. This report summarizes efforts to characterize biological uptake of uranium in the food chain of the benthic aquatic organisms and provide information to be used in future assessments of uranium and the ecosystem.

  13. Computational studies of polysiloxanes : oxidation potentials and decomposition reactions.

    SciTech Connect (OSTI)

    Assary, R. S.; Curtiss, L. A.; Redfern, P. C.; Zhang, Z.; Amine, K.

    2011-06-23

    Silicon-containing solvents have tremendous potential for application as electrolytes for electrical energy storage devices such as lithium-ion (air) batteries and supercapacitors. Quantum chemical methods were employed to investigate trends in oxidation potentials and decomposition reactions of a series of polysiloxanes. Various electron-donating and -withdrawing substituents can be used to tune the oxidation potential in shorter chain siloxanes but not in longer ones. Decomposition reactions of siloxanes in their oxidized states were investigated and compared against their carbon analogues. These studies suggest that the Si-O group provides added stability for siloxanes over their carbon analogues. Computational studies have also been performed for various disiloxanes and siloxanes with spacer groups to understand their thermochemical stability and oxidation potentials.

  14. Spent Nuclear Fuel

    Gasoline and Diesel Fuel Update (EIA)

    Nuclear & Uranium Glossary › FAQS › Overview Data Status of U.S. Nuclear Outages (interactive) Summary Uranium & nuclear fuel Nuclear power plants Spent nuclear fuel International All nuclear data reports Analysis & Projections Major Topics Most popular Nuclear plants and reactors Projections Recurring Uranium All reports Browse by Tag Alphabetical Frequency Tag Cloud Previous releases 2002 1998 Spent Nuclear Fuel Release date: December 7, 2015 Next release date: Late 2018 Spent

  15. Nuclear | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Nuclear Nuclear Radioisotope Power Systems, a strong partnership between the Energy Department's Office of Nuclear Energy and NASA, has been providing the energy for deep space exploration. Nuclear power is the use of sustained nuclear fission to generate heat and electricity. Nuclear power plants provide about 6 percent of the world's energy and 13-14 percent of the world's electricity. Featured Moving Forward to Address Nuclear Waste Storage and Disposal Three trucks transport nuclear waste

  16. Nuclear Forensics

    National Nuclear Security Administration (NNSA)

    Forensics Role, State of the Art, and Program Needs Joint Working Group of the American Physical Society and the American Association for the Advancement of Science Nuclear Forensics Role, State of the Art, and Program Needs Joint Working Group of the American Physical Society and the American Association for the Advancement of Science Acknowledgments Many thanks to Linton Brooks, Raymond Jeanloz, and Robin Pitman for their thoughtful comments on this paper. The authors also thank William

  17. Studies in Low-Energy Nuclear Science

    SciTech Connect (OSTI)

    Carl R. Brune; Steven M. Grimes

    2010-01-13

    This report presents a summary of research projects in the area of low energy nuclear reactions and structure, carried out between March 1, 2006 and October 31, 2009 which were supported by U.S. DOE grant number DE-FG52-06NA26187.

  18. Building a Universal Nuclear Energy Density Functional

    SciTech Connect (OSTI)

    Carlson, Joe A.; Furnstahl, Dick; Horoi, Mihai; Lust, Rusty; Nazaewicc, Witek; Ng, Esmond; Thompson, Ian; Vary, James

    2012-12-30

    During the period of Dec. 1 2006 Jun. 30, 2012, the UNEDF collaboration carried out a comprehensive study of all nuclei, based on the most accurate knowledge of the strong nuclear interaction, the most reliable theoretical approaches, the most advanced algorithms, and extensive computational resources, with a view towards scaling to the petaflop platforms and beyond. The long-term vision initiated with UNEDF is to arrive at a comprehensive, quantitative, and unified description of nuclei and their reactions, grounded in the fundamental interactions between the constituent nucleons. We seek to replace current phenomenological models of nuclear structure and reactions with a well-founded microscopic theory that delivers maximum predictive power with well-quantified uncertainties. Specifically, the mission of this project has been three-fold: ? First, to find an optimal energy density functional (EDF) using all our knowledge of the nucleonic Hamiltonian and basic nuclear properties; ? Second, to apply the EDF theory and its extensions to validate the functional using all the available relevant nuclear structure and reaction data; ? Third, to apply the validated theory to properties of interest that cannot be measured, in particular the properties needed for reaction theory.

  19. NUCLEAR REACTOR

    DOE Patents [OSTI]

    Grebe, J.J.

    1959-07-14

    High temperature reactors which are uniquely adapted to serve as the heat source for nuclear pcwered rockets are described. The reactor is comprised essentially of an outer tubular heat resistant casing which provides the main coolant passageway to and away from the reactor core within the casing and in which the working fluid is preferably hydrogen or helium gas which is permitted to vaporize from a liquid storage tank. The reactor core has a generally spherical shape formed entirely of an active material comprised of fissile material and a moderator material which serves as a diluent. The active material is fabricated as a gas permeable porous material and is interlaced in a random manner with very small inter-connecting bores or capillary tubes through which the coolant gas may flow. The entire reactor is divided into successive sections along the direction of the temperature gradient or coolant flow, each section utilizing materials of construction which are most advantageous from a nuclear standpoint and which at the same time can withstand the operating temperature of that particular zone. This design results in a nuclear reactor characterized simultaneously by a minimum critiral size and mass and by the ability to heat a working fluid to an extremely high temperature.

  20. BUILDING A UNIVERSAL NUCLEAR ENERGY DENSITY FUNCTIONAL (UNEDF) (Technical

    Office of Scientific and Technical Information (OSTI)

    Report) | SciTech Connect BUILDING A UNIVERSAL NUCLEAR ENERGY DENSITY FUNCTIONAL (UNEDF) Citation Details In-Document Search Title: BUILDING A UNIVERSAL NUCLEAR ENERGY DENSITY FUNCTIONAL (UNEDF) The long-term vision initiated with UNEDF is to arrive at a comprehensive, quantitative, and unified description of nuclei and their reactions, grounded in the fundamental interactions between the constituent nucleons. We seek to replace current phenomenological models of nuclear structure and

  1. Imperfect World of beta beta-decay Nuclear Data Sets

    SciTech Connect (OSTI)

    Pritychenko, B.

    2015-01-03

    The precision of double-beta ??-decay experimental half lives and their uncertainties is reanalyzed. The method of Benford's distributions has been applied to nuclear reaction, structure and decay data sets. First-digit distribution trend for ??-decay T2v1/2 is consistent with large nuclear reaction and structure data sets and provides validation of experimental half-lives. A complementary analysis of the decay uncertainties indicates deficiencies due to small size of statistical samples, and incomplete collection of experimental information. Further experimental and theoretical efforts would lead toward more precise values of-decay half-lives and nuclear matrix elements.

  2. National Nuclear Security Administration | National Nuclear Security

    National Nuclear Security Administration (NNSA)

    Administration National Nuclear Security Administration | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs

  3. Integrated Solar Thermochemical Reaction System

    Broader source: Energy.gov [DOE]

    This fact sheet describes an integrated solar thermochemical reaction system project awarded under the DOE's 2012 SunShot Concentrating Solar Power R&D award program. The team, led by the Pacific Northwest National Laboratory, is working to develop and demonstrate a high-performance solar thermochemical reaction system in an end-to-end demonstration that produces electricity. A highly efficient solar thermochemical reaction system would allow for 24-hour operation without the need for storage technology, and reductions in total system costs while providing a relatively low-risk deployment option for CSP systems.

  4. EXFOR BASICS A SHORT GUIDE TO THE NEUTRON REACTION DATA EXCHANGE FORMAT.

    SciTech Connect (OSTI)

    MCLANE,V.; NUCLEAR DATA CENTER NETWORK

    2000-05-19

    This manual is intended as a guide to users of nuclear reaction data compiled in the EXFOR format, and is not intended as a complete guide to the EXFOR System. EXFOR is the exchange format designed to allow transmission of nuclear reaction data between the Nuclear Reaction Data Centers. In addition to storing the data and its' bibliographic information, experimental information is also compiled. The status (e.g., the source of the data) and history (e.g., date of last update) of the data set is also included. EXFOR is designed for flexibility in order to meet the diverse needs of the nuclear reaction data centers. It was originally conceived for the exchange of neutron data and was developed through discussions among personnel from centers situated in Saclay, Vienna, Livermore and Brookhaven. It was accepted as the official exchange format of the neutron data centers at Saclay, Vienna, Brookhaven and Obninsk, at a meeting held in November 1969.3 As a result of two meetings held in 1975 and 1976 and attended by several charged-particle data centers, the format was further developed and adapted to cover all nuclear reaction data. The exchange format should not be confused with a center-to-user format. Although users may obtain data from the centers in the EXFOR format, other center-to-user formats have been developed to meet the needs of the users within each center's own sphere of responsibility. The EXFOR format, as outlined, allows a large variety of numerical data tables with explanatory and bibliographic information to be transmitted in a format: l that is machine-readable (for checking and indicating possible errors); l that can be read by personnel (for passing judgment on and correcting errors). The data presently included in the EXFOR exchange file include: a complete compilation of experimental neutron-induced reaction data, a selected compilation of charged-particle-induced reaction data, a selected compilation of photon-induced reaction data.

  5. EXFOR BASICS A SHORT GUIDE TO THE NEUTRON REACTION DATA EXCHANGE FORMAT.

    SciTech Connect (OSTI)

    MCLANE,V.; NUCLEAR DATA CENTER NETWORK

    2000-05-19

    This manual is intended as a guide to users of nuclear reaction data compiled in the EXFOR format, and is not intended as a complete guide to the EXFOR System. EXFOR is the exchange format designed to allow transmission of nuclear reaction data between the Nuclear Reaction Data Centers. In addition to storing the data and its' bibliographic information, experimental information is also compiled. The status (e.g., the source of the data) and history (e.g., date of last update) of the data set is also included. EXFOR is designed for flexibility in order to meet the diverse needs of the nuclear reaction data centers. It was originally conceived for the exchange of neutron data and was developed through discussions among personnel from centers situated in Saclay, Vienna, Livermore and Brookhaven. It was accepted as the official exchange format of the neutron data centers at Saclay, Vienna, Brookhaven and Obninsk, at a meeting held in November 1969. As a result of two meetings held in 1975 and 1976 and attended by several charged-particle data centers, the format was further developed and adapted to cover all nuclear reaction data. The exchange format should not be confused with a center-to-user format. Although users may obtain data from the centers in the EXFOR format, other center-to-user formats have been developed to meet the needs of the users within each center's own sphere of responsibility. The EXFOR format, as outlined, allows a large variety of numerical data tables with explanatory and bibliographic information to be transmitted in a format: that is machine-readable (for checking and indicating possible errors); that can be read by personnel (for passing judgment on and correcting errors). The data presently included in the EXFOR exchange file include: a complete compilation of experimental neutron-induced reaction data, a selected compilation of charged-particle-induced reaction data, a selected compilation of photon-induced reaction data.

  6. Evaluated Nuclear (reaction) Data from the Evaluated Nuclear Data File (ENDF)

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    The current version is ENDF/B VII.0, released in 2006. Users can search ENDF via specialized interfaces, browse sub-libraries or download them as zipped files. Data plots can be generated through the Sigma interface. The ENDF web page also provides access to covariance data processing and plots. (Specialized Interface)

  7. Addressing Biomass Supply Chain Challenges With AFEX(tm) Technology |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Department of Energy Addressing Biomass Supply Chain Challenges With AFEX(tm) Technology Addressing Biomass Supply Chain Challenges With AFEX(tm) Technology Plenary IV: Advances in Bioenergy Feedstocks-From Field to Fuel Addressing Biomass Supply Chain Challenges With AFEX(tm) Technology Allen Julian, Chief Business Officer, MBI PDF icon julian_biomass_2014.pdf More Documents & Publications 2015 Peer Review Presentations-Biochemical Conversion Process Design and Economics for Biochemical

  8. Engaging Supply Chains in Energy Management | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Engaging Supply Chains in Energy Management Engaging Supply Chains in Energy Management Featuring presenters from PepsiCo and EUISSICA, this presentation covers ways of engaging industrial suppliers involved in energy management. PDF icon Engaging Supply Chains in Energy Management (April 10, 2012) PDF icon Questions & Answers More Documents & Publications Energy Management and Financing From Shop Floor to Top Floor: Best Business Practices in Energy Efficiency CHP SYSTEM AT FOOD

  9. Photovoltaic Supply Chain and Cross-Cutting Technologies Round 1 |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Department of Energy Technology to Market » Photovoltaic Supply Chain and Cross-Cutting Technologies Round 1 Photovoltaic Supply Chain and Cross-Cutting Technologies Round 1 On June 11, 2009, DOE announced the first round of Photovoltaic (PV) Supply Chain and Cross-Cutting Technologies awardees. The funded projects target manufacturing and product cost reduction with the potential to have a near-term impact on a substantial segment of the PV industry. General Electric Global Research

  10. Better Plants Supply Chain Pilot - Overview | Department of Energy

    Office of Environmental Management (EM)

    Supply Chain Pilot - Overview Better Plants Supply Chain Pilot - Overview An Industrial Assessment Center (IAC) student examines pumps at an industrial facility. Photo courtesy of the San Francisco State University IAC. Around 40% to 60% of a manufacturing company's energy and carbon footprint can reside upstream in its supply chain-from raw materials, transport, and packaging to manufacturing processes-but this number can be as high as 80% for some sectors.[1] Manufacturing companies that

  11. Energy Department Announces $2 Million to Develop Supply Chain,

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Manufacturing Competitiveness Analysis for Hydrogen and Fuel Cell Technologies | Department of Energy $2 Million to Develop Supply Chain, Manufacturing Competitiveness Analysis for Hydrogen and Fuel Cell Technologies Energy Department Announces $2 Million to Develop Supply Chain, Manufacturing Competitiveness Analysis for Hydrogen and Fuel Cell Technologies May 21, 2014 - 3:05pm Addthis The Energy Department today announced up to $2 million to develop the domestic supply chain for hydrogen

  12. Method for conducting exothermic reactions

    DOE Patents [OSTI]

    Smith, Jr., Lawrence (Bellaire, TX); Hearn, Dennis (Houston, TX); Jones, Jr., Edward M. (Friendswood, TX)

    1993-01-01

    A liquid phase process for oligomerization of C.sub.4 and C.sub.5 isoolefins or the etherification thereof with C.sub.1 to C.sub.6 alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120.degree. to 300.degree. F. wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  13. Method for conducting exothermic reactions

    DOE Patents [OSTI]

    Smith, L. Jr.; Hearn, D.; Jones, E.M. Jr.

    1993-01-05

    A liquid phase process for oligomerization of C[sub 4] and C[sub 5] isoolefins or the etherification thereof with C[sub 1] to C[sub 6] alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120 to 300 F. wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  14. Solar-thermal reaction processing

    DOE Patents [OSTI]

    Weimer, Alan W; Dahl, Jaimee K; Lewandowski, Allan A; Bingham, Carl; Raska Buechler, Karen J; Grothe, Willy

    2014-03-18

    In an embodiment, a method of conducting a high temperature chemical reaction that produces hydrogen or synthesis gas is described. The high temperature chemical reaction is conducted in a reactor having at least two reactor shells, including an inner shell and an outer shell. Heat absorbing particles are included in a gas stream flowing in the inner shell. The reactor is heated at least in part by a source of concentrated sunlight. The inner shell is heated by the concentrated sunlight. The inner shell re-radiates from the inner wall and heats the heat absorbing particles in the gas stream flowing through the inner shell, and heat transfers from the heat absorbing particles to the first gas stream, thereby heating the reactants in the gas stream to a sufficiently high temperature so that the first gas stream undergoes the desired reaction(s), thereby producing hydrogen or synthesis gas in the gas stream.

  15. Nuclear Workforce Initiative - SRSCRO

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    nuclear Nuclear Workforce Initiative The SRSCRO region of Georgia and South Carolina has the most unique nuclear industry capabilities in the nation. This region is at the forefront of new nuclear power production, environmental stewardship, innovative technology and national security. Long-term nuclear workforce demand is growing in the region as new nuclear reactors are under construction at the V.C Summer Nuclear Station in Fairfield County, SC and at Plant Vogtle in Waynesboro, GA. New

  16. Rouse mode analysis of chain relaxation in homopolymer melts

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Kalathi, Jagannathan T.; Kumar, Sanat K.; Rubinstein, Michael; Grest, Gary S.

    2014-09-15

    We use molecular dynamics simulations of the Kremer–Grest (KG) bead–spring model of polymer chains of length between 10 and 500, and a closely related analogue that allows for chain crossing, to clearly delineate the effects of entanglements on the length-scale-dependent chain relaxation in polymer melts. We analyze the resulting trajectories using the Rouse modes of the chains and find that entanglements strongly affect these modes. The relaxation rates of the chains show two limiting effective monomeric frictions, with the local modes experiencing much lower effective friction than the longer modes. The monomeric relaxation rates of longer modes vary approximately inverselymore » with chain length due to kinetic confinement effects. The time-dependent relaxation of Rouse modes has a stretched exponential character with a minimum of stretching exponent in the vicinity of the entanglement chain length. None of these trends are found in models that allow for chain crossing. As a result, these facts, in combination, argue for the confined motion of chains for time scales between the entanglement time and their ultimate free diffusion.« less

  17. Sr. Business Analyst - Supply Chain Mgmt. (Term Position) | Princeton...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Supply Chain Mgmt. (Term Position) Department: Business Operations Supervisor(s): Jaclyn Pursell Staff: AM 5 Requisition Number: 1500993 Princeton Plasma Physics Lab (PPPL) is...

  18. Microsoft Word - BP supply chain overview - draft v2.docx

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    http:energy.goveereamobetter-plant Supply Chain Initiative Overview BETTER BUILDINGS, ... by DOE, which track the energy performance improvements and cost savings ...

  19. Remarkable Effect of Molecular Architecture on Chain Exchange...

    Office of Scientific and Technical Information (OSTI)

    Remarkable Effect of Molecular Architecture on Chain Exchange in Triblock Copolymer Micelles Citation Details In-Document Search Title: Remarkable Effect of Molecular Architecture...

  20. Gold Nanoparticles Self-Similar Chain Structure Organized by...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Gold Nanoparticles Self-Similar Chain Structure Organized by DNA Origami Authors: Ding, B., Deng, Z., Yan, H., Cabrini, S., Zukerman, R., and Boker, J. Title: Gold Nanoparticles...

  1. Tank Closure and Waste Management Environmental Impact Statement...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ... Prevent nuclear criticality (an unplanned nuclear chain reaction that may occur as a result of concentrating too much fissile material in one place). Provide physical protection ...

  2. The Power of Integrators, Financiers, and Insurers to Reduce Proliferation Risks: Nuclear Dual-Use Goods

    SciTech Connect (OSTI)

    Weise, Rachel A.; Hund, Gretchen

    2015-05-01

    Globalization of manufacturing supply chains has changed the nature of nuclear proliferation. Before 1991, nonproliferation efforts focused almost exclusively on limiting the spread of materials and equipment specifically designed for nuclear use -- reactors, centrifuges, and fissile material. Dual-use items, those items with both nuclear and non-nuclear applications, were not closely scrutinized or controlled. However, in 1991 the international community discovered that Iraq had developed a fairly sophisticated nuclear weapons program by importing dual-use items; this discovery spurred the international community to increase controls on dual-use technologies. Despite these international efforts, dual-use items are still a challenge for those seeking to limit proliferation.

  3. The spectral irradiance traceability chain at PTB

    SciTech Connect (OSTI)

    Sperfeld, P.; Pape, S.; Nevas, S.

    2013-05-10

    Spectral irradiance is a fundamental radiometric unit. Its application to measurement results requires qualified traceability to basic units of the international system of units (Systeme international d'unites, SI). The Physikalisch-Technische Bundesanstalt (PTB) is amongst other national metrological institutes (NMIs) responsible for the realization, maintenance and dissemination of various radiometric and photometric units based on and traceable to national standards. The unit of spectral irradiance is realized and represented by a blackbody-radiator as the national primary standard of the PTB. Based on Planck's radiation law, the irradiance is calculated and realized for any wavelength taking into account the exact knowledge of the radiation temperature and the geometrical parameters. Using a double-monochromator-based spectroradiometer system, secondary standard lamps can be calibrated by direct comparison to the blackbody-radiator (substitution method). These secondary standard lamps are then used at the PTB to calibrate standard lamps of customers. The customers themselves use these so-called transfer standards to calibrate their working standard lamps. These working standards are then used to calibrate own spectroradiometers or sources. This rather complex calibration chain is a common procedural method that for the customers generally leads to satisfying measurement results on site. Nevertheless, the standard lamps in use have to fulfill highest requirements concerning stability and reproducibility. Only this allows achieving comparably low transfer measurement uncertainties, which occur at each calibration step. Thus, the PTB is constantly investigating the improvement and further development of transfer standards and measurement methods for various spectral regions. The realization and dissemination of the spectral irradiance using the blackbody-radiator at the PTB is accomplished with worldwide approved minimized measurement uncertainties confirmed by international intercomparisons among NMIs. Ultimately, the spectral irradiance can be realized with expanded measurement uncertainties of far less than 1 % over a wide spectral range. Thus, for customers with high demands on low measurement uncertainties, it is possible to calibrate their working standards directly against the blackbody-radiator, taking into account the higher necessary effort. In special cases it is possible to calibrate the customer's spectroradiometric facilities directly in front of the blackbody-radiator. In the context of the European Metrology Research Project Traceability for surface spectral solar ultraviolet radiation, the traceability chain will be improved and adapted.

  4. Closing the circle on the splitting of the atom: The environmental legacy of nuclear weapons production in the United States and what the Department of Energy is doing about it

    SciTech Connect (OSTI)

    1996-01-01

    In the grand scheme of things we are a little more than halfway through the cycle of splitting the atom for weapons purposes. If we visualize this historic cycle as the full sweep of a clockface, at zero hour we would find the first nuclear chain reaction by Enrico Fermi, followed immediately by the Manhattan Project and the explosion of the first atomic bombs. From two o`clock until five, the United States built and ran a massive industrial complex that produced tens of thousands of nuclear weapons. At half past, the Cold War ended, and the United States shut down most of its nuclear weapons factories. The second half of this cycle involves dealing with the waste and contamination from nuclear weapons production - a task that had, for the most part, been postponed into the indefinite future. That future is now upon us. Dealing with the environmental legacy of the Cold War is in many ways as big a challenge for us today as the building of the atomic bomb was for the Manhattan Project pioneers in the 1940s. Our challenges are political and social as well as technical, and we are meeting those challenges. We are reducing risks, treating wastes, developing new technologies, and building democratic institutions for a constructive debate on our future course.

  5. Nuclear Data Sheets for A = 163

    SciTech Connect (OSTI)

    Reich, C.W.; Singh, Balraj

    2010-05-15

    The available data from the various reaction and decay studies leading to nuclides having mass number A=163 have been reviewed. These data are summarized and presented, together with adopted level schemes and properties, for nuclides from Eu (Z=63) through Os (Z=76). {sup 163}Eu represents a new addition to these nuclides. Level structures are now known for {sup 163}Ta and {sup 163}W through high-spin studies and recoil-decay tagging techniques. Several radioactive decays in this mass chain are not known at all or poorly established. No {beta} or {gamma}-ray data are available for {sup 163}Re-{sup 163}W-{sup 163}Ta-{sup 163}Hf {epsilon} decay chain. Those for {sup 163}Hf-{sup 163}Lu-{sup 163}Yb {epsilon} decay chain and {sup 163}Eu-{sup 163}Gd-{sup 163}Tb {beta}{sup -} decay chain are very sketchy. This evaluation is an update and revision of the previous one (2000Si01)

  6. NUCLEAR REACTOR

    DOE Patents [OSTI]

    Miller, H.I.; Smith, R.C.

    1958-01-21

    This patent relates to nuclear reactors of the type which use a liquid fuel, such as a solution of uranyl sulfate in ordinary water which acts as the moderator. The reactor is comprised of a spherical vessel having a diameter of about 12 inches substantially surrounded by a reflector of beryllium oxide. Conventionnl control rods and safety rods are operated in slots in the reflector outside the vessel to control the operation of the reactor. An additional means for increasing the safety factor of the reactor by raising the ratio of delayed neutrons to prompt neutrons, is provided and consists of a soluble sulfate salt of beryllium dissolved in the liquid fuel in the proper proportion to obtain the result desired.

  7. Nuclear Engineering | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Engineering Advancing the safe and secure use of nuclear energy Argonne's Nuclear Engineering (NE) division works to advance nuclear energy as a proven, abundant and ...

  8. TUNL Nuclear Data Evaluation Group

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    TUNL Nuclear Data Evaluation Group As a part of the United States Nuclear Data Network and the international Nuclear Structure and Decay Data Evaluators' Network, the Nuclear Data...

  9. Combustion kinetics and reaction pathways

    SciTech Connect (OSTI)

    Klemm, R.B.; Sutherland, J.W.

    1993-12-01

    This project is focused on the fundamental chemistry of combustion. The overall objectives are to determine rate constants for elementary reactions and to elucidate the pathways of multichannel reactions. A multitechnique approach that features three independent experiments provides unique capabilities in performing reliable kinetic measurements over an exceptionally wide range in temperature, 300 to 2500 K. Recent kinetic work has focused on experimental studies and theoretical calculations of the methane dissociation system (CH{sub 4} + Ar {yields} CH{sub 3} + H + Ar and H + CH{sub 4} {yields} CH{sub 3} + H{sub 2}). Additionally, a discharge flow-photoionization mass spectrometer (DF-PIMS) experiment is used to determine branching fractions for multichannel reactions and to measure ionization thresholds of free radicals. Thus, these photoionization experiments generate data that are relevant to both reaction pathways studies (reaction dynamics) and fundamental thermochemical research. Two distinct advantages of performing PIMS with high intensity, tunable vacuum ultraviolet light at the National Synchrotron Light Source are high detection sensitivity and exceptional selectivity in monitoring radical species.

  10. Radiolabeled dimethyl branched long chain fatty acid for heart imaging

    DOE Patents [OSTI]

    Knapp, Jr., Furn F. (Oak Ridge, TN); Goodman, Mark M. (Knoxville, TN); Kirsch, Gilbert (Woippy, FR)

    1988-08-16

    A radiolabeled long chain fatty acid for heart imaging that has dimethyl branching at one of the carbons of the chain which inhibits the extent to which oxidation can occur. The closer to the carboxyl the branching is positioned, the more limited the oxidation, thereby resulting in prolonged retention of the radiolabeled compound in the heart.

  11. Comment on a discrepancy between proton- and alpha-induced cluster knockout reactions on /sup 16/O

    SciTech Connect (OSTI)

    Rotter, I.

    1984-03-01

    The possibility is discussed that the enhanced clustering in the nuclear surface of some nuclei observed by Samanta et al. (Phys. Rev. C 26, 1379 (1982)) is due to the modification of the wave function of a discrete nuclear state at the nuclear surface by unbound states. The modification is formulated in a model with unified description of bound and unbound states. Experimental data from knockout reactions on odd nuclei are necessary in order to test the theoretical statements.

  12. Office of Nuclear Safety

    Broader source: Energy.gov [DOE]

    The Office of Nuclear Safety establishes nuclear safety requirements and expectations for the Department to ensure protection of workers and the public from the hazards associated with nuclear operations with all Department operations.

  13. Nuclear Data Links

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Links to Other Useful Sites Online Journals Institutions and Programs Related to Nuclear Physics U.S. Nuclear Data Program: All evaluated nuclear data supported by the U.S. ...

  14. Nuclear Explosive Safety

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2014-07-10

    The Order establishes requirements to implement the nuclear explosive safety (NES) elements of DOE O 452.1E, Nuclear Explosive and Weapon Surety Program, for routine and planned nuclear explosive operations (NEOs).

  15. Nuclear Materials Disposition

    Broader source: Energy.gov [DOE]

    In fulfilling its mission, EM frequently manages and completes disposition of surplus nuclear materials and spent nuclear fuel.  These are not waste. They are nuclear materials no longer needed for...

  16. Computational nuclear quantum many-body problem: The UNEDF project

    SciTech Connect (OSTI)

    Fann, George I [ORNL

    2013-01-01

    The UNEDF project was a large-scale collaborative effort that applied high-performance computing to the nuclear quantum many-body problem. The primary focus of the project was on constructing, validating, and applying an optimized nuclear energy density functional, which entailed a wide range of pioneering developments in microscopic nuclear structure and reactions, algorithms, high-performance computing, and uncertainty quantification. UNEDF demonstrated that close associations among nuclear physicists, mathematicians, and computer scientists can lead to novel physics outcomes built on algorithmic innovations and computational developments. This review showcases a wide range of UNEDF science results to illustrate this interplay.

  17. Platinum Monolayer Electrocatalysts for Oxygen Reduction Reaction...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Platinum Monolayer Electrocatalysts for Oxygen Reduction Reaction Platinum Monolayer Electrocatalysts for Oxygen Reduction Reaction Download presentation slides from the June 19,...

  18. Nuclear Quadrupole Moments and Nuclear Shell Structure

    DOE R&D Accomplishments [OSTI]

    Townes, C. H.; Foley, H. M.; Low, W.

    1950-06-23

    Describes a simple model, based on nuclear shell considerations, which leads to the proper behavior of known nuclear quadrupole moments, although predictions of the magnitudes of some quadrupole moments are seriously in error.

  19. Safer nuclear power

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Safer nuclear power 1663 Los Alamos science and technology magazine Latest Issue:October 2015 past issues All Issues » submit Safer nuclear power Experiments at Los Alamos reveal that alternative fuel rod cladding materials can make nuclear power plants dramatically less likely to suffer a Fukushima-type explosion in the event of a nuclear accident March 25, 2013 Safer nuclear power Nuclear generating station Los Alamos scientists, in collaboration with scientists from the Idaho and Oak Ridge

  20. Nuclear Energy Programs

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Energy Programs Solving Nuclear Energy Technical Challenges Our science and technology are making way for new nuclear fuels and reactor materials. Get Expertise David Teter Email Generating breakthroughs in nuclear energy materials Safe and sustainable nuclear energy is a focus of the Laboratory's energy security mission, and our expertise in materials science plays an important role. With collaborators worldwide, Los Alamos is developing technologies for future nuclear reactor designs

  1. Nuclear Fuel Cycle & Vulnerabilities

    SciTech Connect (OSTI)

    Boyer, Brian D.

    2012-06-18

    The objective of safeguards is the timely detection of diversion of significant quantities of nuclear material from peaceful nuclear activities to the manufacture of nuclear weapons or of other nuclear explosive devices or for purposes unknown, and deterrence of such diversion by the risk of early detection. The safeguards system should be designed to provide credible assurances that there has been no diversion of declared nuclear material and no undeclared nuclear material and activities.

  2. Nuclear Materials Information Program | National Nuclear Security...

    National Nuclear Security Administration (NNSA)

    Information Program | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the...

  3. Nuclear Security Summit | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure...

  4. Nuclear & Radiological Material Removal | National Nuclear Security...

    National Nuclear Security Administration (NNSA)

    & Radiological Material Removal | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation...

  5. Chernobyl Nuclear Accident | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Chernobyl Nuclear Accident | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working

  6. defense nuclear security | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    nuclear security | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA

  7. Vision 2020. Reaction Engineering Roadmap

    SciTech Connect (OSTI)

    Klipstein, David H.; Robinson, Sharon

    2001-01-01

    The Reaction Engineering Roadmap is a part of an industry- wide effort to create a blueprint of the research and technology milestones that are necessary to achieve longterm industry goals. This report documents the results of a workshop focused on the research needs, technology barriers, and priorities of the chemical industry as they relate to reaction engineering viewed first by industrial use (basic chemicals; specialty chemicals; pharmaceuticals; and polymers) and then by technology segment (reactor system selection, design, and scale-up; chemical mechanism development and property estimation; dealing with catalysis; and new, nonstandard reactor types).

  8. Advancing Global Nuclear Security

    Office of Energy Efficiency and Renewable Energy (EERE)

    Today world leaders gathered at The Hague for the Nuclear Security Summit, a meeting to measure progress and take action to secure sensitive nuclear materials.

  9. Sandia Energy - Nuclear Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Sandia's Brayton-Cycle Turbine Boosts Small Nuclear Reactor Efficiency Energy, Energy Efficiency, News, News & Events, Nuclear Energy Sandia's Brayton-Cycle Turbine Boosts Small...

  10. Nuclear Energy Advisory Committee

    Broader source: Energy.gov [DOE]

    The Nuclear Energy Advisory Committee (NEAC), formerly the Nuclear Energy Research Advisory Committee (NERAC), was established on October 1, 1998, to provide independent advice to the Office of...

  11. Nuclear | Open Energy Information

    Open Energy Info (EERE)

    High construction costs for nuclear plants, especially relative to natural-gas-fired plants, make other options for new nuclear capacity uneconomical even in the alternative...

  12. Nuclear Security Summit

    National Nuclear Security Administration (NNSA)

    Joint Research Centre and the United States Department of Energy's National Nuclear Security Administration regarding the reduction of excess nuclear material http:...

  13. Sandia Energy Nuclear Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    afety-expert-elected-to-national-academy-of-engineeringfeed 0 Sandia Teaches Nuclear Safety Course http:energy.sandia.govsandia-teaches-nuclear-safety-course http:...

  14. 2013 Nuclear Workforce Development ...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Practice in Nuclear Medicine Radiopharmacy Patient Care Medical Imaging & Computers Moderator: Deborah M. Gibbs, MEd, PET, CNMT Lead Nuclear Medicine PET Facility...

  15. Nuclear Data Links

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Links to Useful Online Nuclear Physics Journals Important Online Resources Science Direct ... Elsevier Physics Online: Nuclear Physics A, B, Physics Repots, Physics Letters B and more. ...

  16. Nuclear Controls Checklist

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Controls Yes No 1) Is your Facility involved in the research on or development, design, manufacture, construction, testing or maintenance of any nuclear explosive ...

  17. Nuclear and Particle Futures

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear and Particle Futures Nuclear and Particle Futures The Lab's four Science Pillars harness our scientific capabilities for national security solutions. Contacts Pillar ...

  18. Nuclear Energy Workshops

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Safety, Security & Resilience of the Energy Infrastructure Energy Storage Nuclear Power & Engineering Grid Modernization Battery Testing Nuclear Fuel Cycle Defense Waste Management ...

  19. Nuclear Safety Regulatory Framework

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Department of Energy Nuclear Safety Regulatory Framework DOE's Nuclear Safety Enabling Legislation Regulatory Enforcement & Oversight Regulatory Governance Atomic Energy Act 1946 ...

  20. Nuclear Energy Systems Lab

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Safety, Security & Resilience of the Energy Infrastructure Energy Storage Nuclear Power & Engineering Grid Modernization Battery Testing Nuclear Fuel Cycle Defense Waste Management ...

  1. National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    15 National Nuclear Security Administration FY 2013 PER Babcock & Wilcox Technical ... The National Nuclear Security Administration (NNSA) Production Office (NPO) took into ...

  2. Nuclear Science Series: Radiochemistry

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Radiochemistry Nuclear Science Series: Radiochemistry These volumes are publicly ... working under the Committee on Nuclear Science within the National Academy of ...

  3. National Nuclear Security Administration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Security Administration DOENV--325-Rev. lOa February 2015 Nevada National Security Site Waste Acceptance Criteria Prepared by U.S. Department of Energy National Nuclear ...

  4. Nuclear Physics: Campaigns

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Free-Electron Laser (FEL) Medical Imaging Physics Topics Campaigns The Structure of the Nuclear Building Blocks The Structure of Nuclei Symmetry Tests in Nuclear Physics Meetings ...

  5. Nuclear weapons modernizations

    SciTech Connect (OSTI)

    Kristensen, Hans M.

    2014-05-09

    This article reviews the nuclear weapons modernization programs underway in the world's nine nuclear weapons states. It concludes that despite significant reductions in overall weapons inventories since the end of the Cold War, the pace of reductions is slowing - four of the nuclear weapons states are even increasing their arsenals, and all the nuclear weapons states are busy modernizing their remaining arsenals in what appears to be a dynamic and counterproductive nuclear competition. The author questions whether perpetual modernization combined with no specific plan for the elimination of nuclear weapons is consistent with the nuclear Non-Proliferation Treaty and concludes that new limits on nuclear modernizations are needed.

  6. Sandia's Nuclear Weapons Mission

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Weapons Mission Ensuring that the nation's stockpile is safe, secure and effective, and that it meets military requirements America's Nuclear Weapons Systems Engineering ...

  7. The Effects of Neutron Transfer on Nuclear Fusion at Low Energies

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Effects of Neutron Transfer on Nuclear Fusion at Low Energies Nuclear fusion produces heavier nuclei in stars and in laboratories. At energies so low that a classical particle could not penetrate the Coulomb repulsion of the nucleus, the Coulomb barrier, fusion takes place by quantum tunneling. At these energies, fusion rates can be sensitive to the interplay between nuclear structure and nuclear reactions. This talk presents experimental studies of the influence of neutron transfer on

  8. Nuclear / Radiological Advisory Team | National Nuclear Security

    National Nuclear Security Administration (NNSA)

    Administration / Radiological Advisory Team | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our

  9. Nuclear Science References (NSR) from the National Nuclear Data Center (NNDC)

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    The Nuclear Science References (NSR) database is an indexed bibiliography of primary and secondary references in nuclear physics research. About 80 journals are regularly scanned for articles. Recent references are added on a weekly basis. Approximately 4300 entries are added to the database annually. In general, articles are included in NSR if they include measured, calculated, or deduced quantitative nuclear structure or reaction data. Papers that apply previously known data are generally not included. Examples of this include neutron activation analysis using known cross sections or radiological dating using known half-lives. The database can be searched like a normal bibliographic database but can also be searched by the data that distinguishes it, data such as the nuclide, target/parent/daughter, reaction, incident particles, and outgoing particles. (Specialized Interface) [Taken from the NSR Help pages at http://www.nndc.bnl.gov/nsr/nsr_help.jsp

  10. Nuclear reactor

    DOE Patents [OSTI]

    Thomson, Wallace B. (Severna Park, MD)

    2004-03-16

    A nuclear reactor comprising a cylindrical pressure vessel, an elongated annular core centrally disposed within and spaced from the pressure vessel, and a plurality of ducts disposed longitudinally of the pressure vessel about the periphery thereof, said core comprising an annular active portion, an annular reflector just inside the active portion, and an annular reflector just outside the active a portion, said annular active portion comprising rectangular slab, porous fuel elements radially disposed around the inner reflector and extending the length of the active portion, wedge-shaped, porous moderator elements disposed adjacent one face of each fuel element and extending the length of the fuel element, the fuel and moderator elements being oriented so that the fuel elements face each other and the moderator elements do likewise, adjacent moderator elements being spaced to provide air inlet channels, and adjacent fuel elements being spaced to provide air outlet channels which communicate with the interior of the peripheral ducts, and means for introducing air into the air inlet channels which passes through the porous moderator elements and porous fuel elements to the outlet channel.

  11. The Joys of Nuclear Engineering

    ScienceCinema (OSTI)

    Jon Carmack

    2010-01-08

    Nuclear fuels researcher Jon Carmack talks about the satisfactions of a career in nuclear engineering.

  12. Bomb tests attack the food chain

    SciTech Connect (OSTI)

    Ruff, T. )

    1990-03-01

    Ciguatera poisoning, the most common type of fish poisoning in the world, has become a major public health problem in some parts of the South Pacific. This area has always been the site of periodic outbreaks, especially after severe storms or natural disasters that damage core reefs. But since World War II it has become evident that military activities and major construction projects that wreak havoc on corals also lead to ciguatera outbreaks. Extraordinarily high rates of ciguatera poisoning have occurred on the small Pacific islands that have been used for nuclear tests and on the islands that host the military infrastructures and activities that accompany the tests. This is true for both the Marshall Islands near Bikini and Eniwetok, where U.S. tests took place, and in French Polynesia, in the area around Moruroa Atoll where the French government continues to test. Ciguatera poisoning has a disastrous effect on people who depend on fishing as a way of life and on fish as the major source of protein. 10 refs.

  13. Probabilistic accident consequence uncertainty analysis: Food chain uncertainty assessment. Volume 1: Main report

    SciTech Connect (OSTI)

    Brown, J.; Goossens, L.H.J.; Kraan, B.C.P.

    1997-06-01

    This volume is the first of a two-volume document that summarizes a joint project conducted by the US Nuclear Regulatory Commission and the European Commission to assess uncertainties in the MACCS and COSYMA probabilistic accident consequence codes. These codes were developed primarily for estimating the risks presented by nuclear reactors based on postulated frequencies and magnitudes of potential accidents. This document reports on an ongoing project to assess uncertainty in the MACCS and COSYMA calculations for the offsite consequences of radionuclide releases by hypothetical nuclear power plant accidents. A panel of sixteen experts was formed to compile credible and traceable uncertainty distributions for food chain variables that affect calculations of offsite consequences. The expert judgment elicitation procedure and its outcomes are described in these volumes. Other panels were formed to consider uncertainty in other aspects of the codes. Their results are described in companion reports. Volume 1 contains background information and a complete description of the joint consequence uncertainty study. Volume 2 contains appendices that include (1) a summary of the MACCS and COSYMA consequence codes, (2) the elicitation questionnaires and case structures for both panels, (3) the rationales and results for the panels on soil and plant transfer and animal transfer, (4) short biographies of the experts, and (5) the aggregated results of their responses.

  14. Advanced nuclear fuel

    SciTech Connect (OSTI)

    Terrani, Kurt

    2014-07-14

    Kurt Terrani uses his expertise in materials science to develop safer fuel for nuclear power plants.

  15. Advanced nuclear fuel

    ScienceCinema (OSTI)

    Terrani, Kurt

    2014-07-15

    Kurt Terrani uses his expertise in materials science to develop safer fuel for nuclear power plants.

  16. Uranium metal reactions with hydrogen and water vapour and the reactivity of the uranium hydride produced

    SciTech Connect (OSTI)

    Godfrey, H.; Broan, C.; Goddard, D.; Hodge, N.; Woodhouse, G.; Diggle, A.; Orr, R.

    2013-07-01

    Within the nuclear industry, metallic uranium has been used as a fuel. If this metal is stored in a hydrogen rich environment then the uranium metal can react with the hydrogen to form uranium hydride which can be pyrophoric when exposed to air. The UK National Nuclear Laboratory has been carrying out a programme of research for Sellafield Limited to investigate the conditions required for the formation and persistence of uranium hydride and the reactivity of the material formed. The experimental results presented here have described new results characterising uranium hydride formed from bulk uranium at 50 and 160 C. degrees and measurements of the hydrolysis kinetics of these materials in liquid water. It has been shown that there is an increase in the proportion of alpha-uranium hydride in material formed at lower temperatures and that there is an increase in the rate of reaction with water of uranium hydride formed at lower temperatures. This may at least in part be attributable to a difference in the reaction rate between alpha and beta-uranium hydride. A striking observation is the strong dependence of the hydrolysis reaction rate on the temperature of preparation of the uranium hydride. For example, the reaction rate of uranium hydride prepared at 50 C. degrees was over ten times higher than that prepared at 160 C. degrees at 20% extent of reaction. The decrease in reaction rate with the extent of reaction also depended on the temperature of uranium hydride preparation.

  17. The effects of lithium hydroxide solution on alkali silica reaction gels created with opal

    SciTech Connect (OSTI)

    Mitchell, Lyndon D.; Beaudoin, James J.; Grattan-Bellew, Patrick

    2004-04-01

    The reaction of Nevada opal with calcium hydroxide, potassium hydroxide and lithium hydroxide solutions was investigated. In addition, opal was exposed to a combined solution of these three hydroxides. The progress of the three reactions was followed using X-ray diffraction (XRD), {sup 29}Si nuclear magnetic resonance (NMR) and scanning electron microscopy (SEM). The XRD results indicated the presence of a low-angle peak exclusive to the lithium-based reactions. The NMR results suggested a change in the silicate structure in the presence of lithium. These techniques indicated that the reaction of the alkali with the opal starting material is inhibited and perhaps stopped in the presence of lithium hydroxide. SEM revealed that the morphology of the reaction products on the surface of the reacted opal grains is markedly different invariably. It was concluded that evidence to support the theory of a protective layer exists and that the nature of the layer varies with ion type.

  18. Spontaneous Fission Modes and Lifetimes of Superheavy Elements in the Nuclear Density Functional Theory

    SciTech Connect (OSTI)

    Staszczak, A,

    2013-01-01

    Background: The reactions with the neutron-rich 48Ca beam and actinide targets resulted in the detection of new superheavy (SH) nuclides with Z=104 118. The unambiguous identification of the new isotopes, however, still poses a problem because their -decay chains terminate by spontaneous fission (SF) before reaching the known region of the nuclear chart. The understanding of the competition between -decay and SF channels in SH nuclei is, therefore, of crucial importance for our ability to map the SH region and to assess its extent.

    Purpose: We perform self-consistent calculations of the competing decay modes of even-even SH isotopes with 108 Z 126 and 148 N 188.

    Methods: We use the state-of-the-art computational framework based on self-consistent symmetry-unrestricted nuclear density functional theory capable of describing the competition between nuclear attraction and electrostatic repulsion. We apply the SkM* Skyrme energy density functional. The collective mass tensor of the fissioning superfluid nucleus is computed by means of the cranking approximation to the adiabatic time-dependent Hartree-Fock-Bogoliubov (HFB) approach. This paper constitutes a systematic self-consistent study of spontaneous fission in the SH region, carried out at a full HFB level, that simultaneously takes into account both triaxiality and reflection asymmetry.

    Results: Breaking axial symmetry and parity turns out to be crucial for a realistic estimate of collective action; it results in lowering SF lifetimes by more than 7 orders of magnitude in some cases. We predict two competing SF modes: reflection symmetric modes and reflection asymmetric modes.

    Conclusions: The shortest-lived SH isotopes decay by SF; they are expected to lie in a narrow corridor formed by 280Hs, 284Fl, and 118284Uuo that separates the regions of SH nuclei synthesized in cold-fusion and hot-fusion reactions. The region of long-lived SH nuclei is expected to be centered on 294Ds with a total half-life of 1.5 days. Our survey provides a solid benchmark for the future improvements of self-consistent SF calculations in the region of SH nuclei.

  19. Nuclear Data Verification and Standardization

    SciTech Connect (OSTI)

    Karam, Lisa R.; Arif, Muhammad; Thompson, Alan K.

    2011-10-01

    The objective of this interagency program is to provide accurate neutron interaction verification and standardization data for the U.S. Department of Energy Division of Nuclear Physics programs which include astrophysics, radioactive beam studies, and heavy-ion reactions. The measurements made in this program are also useful to other programs that indirectly use the unique properties of the neutron for diagnostic and analytical purposes. These include homeland security, personnel health and safety, nuclear waste disposal, treaty verification, national defense, and nuclear based energy production. The work includes the verification of reference standard cross sections and related neutron data employing the unique facilities and capabilities at NIST and other laboratories as required; leadership and participation in international intercomparisons and collaborations; and the preservation of standard reference deposits. An essential element of the program is critical evaluation of neutron interaction data standards including international coordinations. Data testing of critical data for important applications is included. The program is jointly supported by the Department of Energy and the National Institute of Standards and Technology.

  20. ICENES '91:Sixth international conference on emerging nuclear energy systems

    SciTech Connect (OSTI)

    Not Available

    1991-01-01

    This document contains the program and abstracts of the sessions at the Sixth International Conference on Emerging Nuclear Energy Systems held June 16--21, 1991 at Monterey, California. These sessions included: The plenary session, fission session, fission and nonelectric session, poster session 1P; (space propulsion, space nuclear power, electrostatic confined fusion, fusion miscellaneous, inertial confinement fusion, [mu]-catalyzed fusion, and cold fusion); Advanced fusion session, space nuclear session, poster session 2P, (nuclear reactions/data, isotope separation, direct energy conversion and exotic concepts, fusion-fission hybrids, nuclear desalting, accelerator waste-transmutation, and fusion-based chemical recycling); energy policy session, poster session 3P (energy policy, magnetic fusion reactors, fission reactors, magnetically insulated inertial fusion, and nuclear explosives for power generation); exotic energy storage and conversion session; and exotic energy storage and conversion; review and closing session.

  1. Civilian Nuclear Programs

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    The Civilian Nuclear Programs Office is the focal point for nuclear energy research and development and next-generation repository science at Los Alamos National Laboratory. Civilian Nuclear Programs Los Alamos is committed to using its advanced nuclear expertise and unique facilities to meet the civilian nuclear national security demands of the future. CONTACT US Program Director Venkateswara Rao Dasari (Rao) (505) 667-5098 Email Los Alamos partners extensively with other laboratories,

  2. Data requirements for intermediate energy nuclear applications

    SciTech Connect (OSTI)

    Pearlstein, S.

    1990-01-01

    Several applications that include spallation neutron sources, space radiation effects, biomedical isotope production, accelerator shielding and radiation therapy make use of intermediate energy nuclear data extending to several GeV. The overlapping data needs of these applications are discussed in terms of what projectiles, targets and reactions are of interest. Included is a discussion of what is generally known about these data and what is needed to facilitate their use in intermediate energy applications. 40 refs., 2 figs., 2 tabs.

  3. A porous metal-organic framework with helical chain building...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    porous metal-organic framework with helical chain building units exhibiting facile transition from micro- to meso-porosity Previous Next List Jinhee Park , Jian-Rong Li , E....

  4. Energy Department Announces $2 Million to Develop Supply Chain...

    Broader source: Energy.gov (indexed) [DOE]

    develop the domestic supply chain for hydrogen and fuel cell technologies and study the competitiveness of U.S. hydrogen and fuel cell system and component manufacturing. As a part...

  5. Structural and optical properties of self-assembled chains of...

    Office of Scientific and Technical Information (OSTI)

    characteristics. Predominant face-to-face assembly of large NCs coated with short polymer ligands led to a larger volume of hot spots in the chains, a nearly uniform E-field...

  6. U.S. Offshore Wind Manufacturing and Supply Chain Development

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    U.S. Offshore Wind Manufacturing and Supply Chain Development Prepared for: U.S. Department of Energy Navigant Consulting, Inc. 77 Bedford Street Suite 400 Burlington, MA 01803-5154 781.270.8314 www.navigant.com February 22, 2013 U.S. Offshore Wind Manufacturing and Supply Chain Development Document Number DE-EE0005364 Prepared for: U.S. Department of Energy Michael Hahn Cash Fitzpatrick Gary Norton Prepared by: Navigant Consulting, Inc. Bruce Hamilton, Principal Investigator Lindsay Battenberg

  7. Supply Chain Sustainability Analysis of Three Biofuel Pathways (Technical

    Office of Scientific and Technical Information (OSTI)

    Report) | SciTech Connect Supply Chain Sustainability Analysis of Three Biofuel Pathways Citation Details In-Document Search Title: Supply Chain Sustainability Analysis of Three Biofuel Pathways The Department of Energy's (DOE) Bioenergy Technologies Office (BETO) collaborates with industrial, agricultural, and non-profit partners to develop and deploy biofuels and other biologically-derived products. As part of this effort, BETO and its national laboratory teams conduct in-depth

  8. Supply Chain Sustainability Analysis of Three Biofuel Pathways (Technical

    Office of Scientific and Technical Information (OSTI)

    Report) | SciTech Connect Supply Chain Sustainability Analysis of Three Biofuel Pathways Citation Details In-Document Search Title: Supply Chain Sustainability Analysis of Three Biofuel Pathways × You are accessing a document from the Department of Energy's (DOE) SciTech Connect. This site is a product of DOE's Office of Scientific and Technical Information (OSTI) and is provided as a public service. Visit OSTI to utilize additional information resources in energy science and technology. A

  9. Wind Manufacturing and Supply Chain | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    You are here Home » Research & Development » Wind Manufacturing and Supply Chain Wind Manufacturing and Supply Chain The U.S. Department of Energy (DOE) works with wind technology suppliers to promote advanced manufacturing capabilities. Its goals are to increase reliability while lowering production costs, and to promote an industry that can meet all demands domestically while competing in the global market. The Wind Program supports industry partnerships and targeted R&D investments

  10. Reaction Selectivity in Heterogeneous Catalysis

    SciTech Connect (OSTI)

    Somorjai, Gabor A.; Kliewer, Christopher J.

    2009-02-02

    The understanding of selectivity in heterogeneous catalysis is of paramount importance to our society today. In this review we outline the current state of the art in research on selectivity in heterogeneous catalysis. Current in-situ surface science techniques have revealed several important features of catalytic selectivity. Sum frequency generation vibrational spectroscopy has shown us the importance of understanding the reaction intermediates and mechanism of a heterogeneous reaction, and can readily yield information as to the effect of temperature, pressure, catalyst geometry, surface promoters, and catalyst composition on the reaction mechanism. DFT calculations are quickly approaching the ability to assist in the interpretation of observed surface spectra, thereby making surface spectroscopy an even more powerful tool. HP-STM has revealed three vitally important parameters in heterogeneous selectivity: adsorbate mobility, catalyst mobility, and selective site-blocking. The development of size controlled nanoparticles from 0.8 to 10 nm, of controlled shape, and of controlled bimetallic composition has revealed several important variables for catalytic selectivity. Lastly, DFT calculations may be paving the way to guiding the composition choice for multi-metallic heterogeneous catalysis for the intelligent design of catalysts incorporating the many factors of selectivity we have learned.

  11. JETS OF NUCLEAR MATTER FROM HIGH ENERGY HEAVY ION COLLISIONS

    SciTech Connect (OSTI)

    Stocker, H.; Csernai, L.P.; Graebner, G.; Buchwald, G.; Kruse, H.; Cusson, R.Y.; Maruhn, J.A.; Greiner, W.

    1980-11-01

    The nuclear fluid dynamical model with final thermal breakup is used to study the reactions {sup 20}Ne + {sup 238}U and {sup 40} Ar + {sup 40}Ca at E{sub LAB}=390 MeV/n. Calculated double differential cross sections d{sup 2}{sigma}/d{Omega}dE are in agreement with recent experimental data. It is shown that azimuthally dependent triple differential cross sections d{sup 3}{sigma}/dEd cos{theta}d{phi} yield considerably deeper insight into the collision process and allow for snapshots of the reactions. Strongly correlated jets of nuclear matter are predicted.

  12. Building A Universal Nuclear Energy Density Functional (UNEDF)

    SciTech Connect (OSTI)

    Carlson, Joe, Los Alamos National Laboratory, Los Alamos, NM; Furnstahl, Dick, Ohio State University, Columbus, OH; Horoi, Mihai, Central Michigan University, Mount Pleasant, MI; Lusk, Rusty, Argonne National Laboratory, Argonne, IL; Nazarewicz, Witek, University of Tennessee, Knoxville, TN; Ng, Esmond, Berkeley National Laboratory, Berkeley, CA; Thompson, Ian, Lawrence Livermore National Laboratory, Livermore, CA; Vary, James, Iowa State University, Ames, Iowa

    2012-09-30

    During the period of Dec. 1 2006 ?? Jun. 30, 2012, the UNEDF collaboration carried out a comprehensive study of all nuclei, based on the most accurate knowledge of the strong nuclear interaction, the most reliable theoretical approaches, the most advanced algorithms, and extensive computational resources, with a view towards scaling to the petaflop platforms and beyond. The long-term vision initiated with UNEDF is to arrive at a comprehensive, quantitative, and unified description of nuclei and their reactions, grounded in the fundamental interactions between the constituent nucleons. We seek to replace current phenomenological models of nuclear structure and reactions with a well-founded microscopic theory that delivers maximum predictive power with well-quantified uncertainties. Specifically, the mission of this project has been three-fold: first, to find an optimal energy density functional (EDF) using all our knowledge of the nucleonic Hamiltonian and basic nuclear properties; second, to apply the EDF theory and its extensions to validate the functional using all the available relevant nuclear structure and reaction data; third, to apply the validated theory to properties of interest that cannot be measured, in particular the properties needed for reaction theory. The main physics areas of UNEDF, defined at the beginning of the project, were: ab initio structure; ab initio functionals; DFT applications; DFT extensions; reactions.

  13. Ab initio nuclear structure from lattice effective field theory

    SciTech Connect (OSTI)

    Lee, Dean

    2014-11-11

    This proceedings article reviews recent results by the Nuclear Lattice EFT Collaboration on an excited state of the {sup 12}C nucleus known as the Hoyle state. The Hoyle state plays a key role in the production of carbon via the triple-alpha reaction in red giant stars. We discuss the structure of low-lying states of {sup 12}C as well as the dependence of the triple-alpha reaction on the masses of the light quarks.

  14. Defense Nuclear Security | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Security | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog Home

  15. International Nuclear Safeguards | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Safeguards | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog

  16. International Nuclear Security | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Security | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog Home

  17. Nuclear Controls | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Controls | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog Home

  18. Nuclear Detonation Detection | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Detonation Detection | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at

  19. Nuclear Forensics | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Forensics | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog

  20. Nuclear Incident Team | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog Home / About

  1. Nuclear Incident Team | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog Home /

  2. Nuclear Material Removal | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Material Removal | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA

  3. Nuclear Security 101 | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    101 | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog Home /

  4. Nuclear Security Enterprise | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Enterprise | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog

  5. Nuclear Verification | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Verification | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog

  6. nuclear emergency | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    emergency | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog

  7. Defense Nuclear Nonproliferation | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Nonproliferation | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA

  8. Naval Nuclear Propulsion | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog Home / Naval

  9. Nuclear Operations | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Operations | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog

  10. Nuclear Security Summit | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Summit | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog Home /

  11. nuclear bombs | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    bombs | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog Home /

  12. nuclear controls | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    controls | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog Home

  13. nuclear enterprise | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    enterprise | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog

  14. nuclear forensics | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    forensics | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog

  15. nuclear navy | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    navy | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog Home /

  16. nuclear safety | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    safety | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog Home /

  17. nuclear security | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    security | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog Home

  18. nuclear technology | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    technology | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog

  19. nuclear threat science | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    threat science | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA

  20. Defense Nuclear Facility | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Facility | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog Home

  1. nuclear fusion | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    fusion | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog Home /

  2. nuclear science week | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    week | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog Home /

  3. nuclear science | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog Home /

  4. nuclear smuggling | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    smuggling | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog

  5. Nuclear Nonproliferation Program Offices | National Nuclear Security

    National Nuclear Security Administration (NNSA)

    Administration Program Offices | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs

  6. Nuclear Nonproliferation Treaty | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Treaty | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog Home /

  7. The role of cellular structure on increasing the detonability limits of three-step chain-branching detonations

    SciTech Connect (OSTI)

    Short, Mark; Kiyanda, Charles B; Quirk, James J; Sharpe, Gary J

    2011-01-27

    In [1], the dynamics of a pulsating three-step chain-branching detonation were studied. The reaction model consists of, sequentially, chain-initiation, chain-branching and chain-termination steps. The chain-initiation and chain-branching steps are taken to be thermally neutral, with chemical energy release occuring in the chain-termination stage. The purpose of the present study is to examine whether cellular detonation structure can increase the value of the chain-branching cross-over temperature T{sub b} at which fully coupled detonation solutions are observed over those in 1 D. The basic concept is straightforward and has been discussed in [1] and [3]; if T{sub s} drops below T{sub b} at the lead shock, the passage of a transverse shock can increase both the lead shock temperature and the temperature behind the transverse wave back above T{sub b}, thus sustaining an unstable cellular detonation for values of T{sub b} for which a one-dimensional pulsating detonation will fail. Experiments potentially supporting this hypothesis with irregular detonations have been shown in [3] in a shock tube with acoustically absorbing walls. Removal of the transverse waves results in detonation failure, giving way to a decoupled shock-flame complex. A number of questions remain to be addressed regarding the possibility of such a mechanism, and, if so, about the precise mechanisms driving the cellular structure for large T{sub b}. For instance, one might ask what sets the cell size in a chain-branching detonation, particularly could the characteristic cell size be set by the chain-branching cross-over temperature T{sub b}: after a transverse wave shock collision, the strength of the transverse wave weakens as it propagates along the front. If the spacing between shock collisions is too large (cell size), then the transverse shocks may weaken to the extent that the lead shock temperature or that behind the transverse waves is not raised above T{sub b}, losing chemical energy to drive the front in those regions. Failure may result if less than sufficient of the lead shock be driven above n to sustain reaction. Our starting point for generating cellular solutions is as in [I], consisting of an initial ZND wave in the channel, but perturbed here by a density non-uniformity to generate a cellular structure. Exactly how far the detonability limits (value of T{sub b}) can be extended is not addressed here, as such issues relate in part to the way the cellular structure is generated [6]. Our concern here is to investigate the mechanisms of self-sustained cellular detonation for values of T{sub b} above those that lead to 1D pulsating wave failure that can be generated from the initial ZND wave. Finally, we do not consider cellular propagation driven by a process of apparent thermal ignition of hot-spots downstream that tends to appear close to the 20 detonability limit. Such events are subject to the lack of correct thermal diffusive physics in the model and thus to the form of numerical dissipation in the underlying flow algorithm.

  8. Photoinduced electron transfer double fragmentation. An oxygen-mediated radical chain process in the cofragmentation of aminopinacol donors with organic halides

    SciTech Connect (OSTI)

    Chen, L.; Farahat, M.S.; Gan, H.; Whitten, D.G.; Farid, S. |

    1995-06-14

    We reprot an investigation in which excited states of amino pinacols 1-3 are reacted with the halides CCl{sub 4}, benzyl bromide, and p-cyanobenzyl bromide. Interesting results from this study include the finding that low-to-moderate quantum efficiencies for reaction are observed when the reactions are carried out under degassed conditions, indicating that the halide radical anions must survive long enough within the initial ion pair formed in the quenching step to undergo considerable return electron transfer. More strikingly we find that for certain pinacol-halide combinations reaction in aerared solutions leads to much higher efficiencies, which can be attributed to a chain reaction involving oxygen capture of a primary radical product. 25 refs., 1 fig., 1 tab.

  9. Global Nuclear Energy Partnership Fact Sheet - Minimize Nuclear Waste |

    Office of Environmental Management (EM)

    Department of Energy Minimize Nuclear Waste Global Nuclear Energy Partnership Fact Sheet - Minimize Nuclear Waste GNEP will increase the efficiency in the management of used nuclear fuel, also known as spent fuel, and defer the need for additional geologic nuclear waste repositories until the next century. PDF icon Global Nuclear Energy Partnership Fact Sheet - Minimize Nuclear Waste More Documents & Publications GNEP Element:Develop Enhanced Nuclear Safeguards Global Nuclear Energy

  10. Nuclear Detonation Detection | National Nuclear Security Administratio...

    National Nuclear Security Administration (NNSA)

    NNSA builds the nation's operational sensors that monitor the entire planet from space to detect and report surface, atmospheric, or space nuclear detonations; produces and updates...

  11. Nuclear Safeguards | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy ... site link , and the emergence of new proliferation threats from both state and non-state ...

  12. Nuclear Detonation Detection | National Nuclear Security Administratio...

    National Nuclear Security Administration (NNSA)

    the entire planet from space to detect and report surface, atmospheric, or space nuclear detonations; produces and updates the regional geophysical datasets enabling...

  13. Soil-to-Plant Concentration Ratios for Assessing Food Chain Pathways in Biosphere Models

    SciTech Connect (OSTI)

    Napier, Bruce A.; Fellows, Robert J.; Krupka, Kenneth M.

    2007-10-01

    This report describes work performed for the U.S. Nuclear Regulatory Commissions project Assessment of Food Chain Pathway Parameters in Biosphere Models, which was established to assess and evaluate a number of key parameters used in the food-chain models used in performance assessments of radioactive waste disposal facilities. Section 2 of this report summarizes characteristics of samples of soils and groundwater from three geographical regions of the United States, the Southeast, Northwest, and Southwest, and analyses performed to characterize their physical and chemical properties. Because the uptake and behavior of radionuclides in plant roots, plant leaves, and animal products depends on the chemistry of the water and soil coming in contact with plants and animals, water and soil samples collected from these regions of the United States were used in experiments at Pacific Northwest National Laboratory to determine radionuclide soil-to-plant concentration ratios. Crops and forage used in the experiments were grown in the soils, and long-lived radionuclides introduced into the groundwater provide the contaminated water used to water the grown plants. The radionuclides evaluated include 99Tc, 238Pu, and 241Am. Plant varieties include alfalfa, corn, onion, and potato. The radionuclide uptake results from this research study show how regional variations in water quality and soil chemistry affect radionuclide uptake. Section 3 summarizes the procedures and results of the uptake experiments, and relates the soil-to-plant uptake factors derived. In Section 4, the results found in this study are compared with similar values found in the biosphere modeling literature; the studys results are generally in line with current literature, but soil- and plant-specific differences are noticeable. This food-chain pathway data may be used by the NRC staff to assess dose to persons in the reference biosphere (e.g., persons who live and work in an area potentially affected by radionuclide releases) of waste disposal facilities and decommissioning sites.

  14. Assessment of Food Chain Pathway Parameters in Biosphere Models: Annual Progress Report for Fiscal Year 2004

    SciTech Connect (OSTI)

    Napier, Bruce A.; Krupka, Kenneth M.; Fellows, Robert J.; Cataldo, Dominic A.; Valenta, Michelle M.; Gilmore, Tyler J.

    2004-12-02

    This Annual Progress Report describes the work performed and summarizes some of the key observations to date on the U.S. Nuclear Regulatory Commissions project Assessment of Food Chain Pathway Parameters in Biosphere Models, which was established to assess and evaluate a number of key parameters used in the food-chain models used in performance assessments of radioactive waste disposal facilities. Section 2 of this report describes activities undertaken to collect samples of soils from three regions of the United States, the Southeast, Northwest, and Southwest, and perform analyses to characterize their physical and chemical properties. Section 3 summarizes information gathered regarding agricultural practices and common and unusual crops grown in each of these three areas. Section 4 describes progress in studying radionuclide uptake in several representative crops from the three soil types in controlled laboratory conditions. Section 5 describes a range of international coordination activities undertaken by Project staff in order to support the underlying data needs of the Project. Section 6 provides a very brief summary of the status of the GENII Version 2 computer program, which is a client of the types of data being generated by the Project, and for which the Project will be providing training to the US NRC staff in the coming Fiscal Year. Several appendices provide additional supporting information.

  15. Comprehensive Nuclear Test-Ban Treaty | National Nuclear Security...

    National Nuclear Security Administration (NNSA)

    Nuclear Test-Ban Treaty | National Nuclear Security Administration Facebook Twitter ... Apply for Our Jobs Our Jobs Working at NNSA Blog Home Comprehensive Nuclear Test-Ban ...

  16. NNSA Nuclear/Radiological Incident Response | National Nuclear...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Jan 1, 2009 The National Nuclear Security Administration (NNSA) has more than 60 years of nuclear weapons experience in responding to nuclear and radiological accidents and...

  17. NNSA Nuclear/Radiological Incident Response | National Nuclear...

    National Nuclear Security Administration (NNSA)

    Dec 1, 2008 The National Nuclear Security Administration (NNSA) has over 60 years of nuclear weapons experience in responding to nuclear and radiological accidents and incidents....

  18. Towards consistent nuclear models and comprehensive nuclear data...

    Office of Scientific and Technical Information (OSTI)

    Conference: Towards consistent nuclear models and comprehensive nuclear data evaluations Citation Details In-Document Search Title: Towards consistent nuclear models and ...

  19. Nuclear Weapons Life Cycle | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Apply for Our Jobs Our Jobs Working at NNSA Blog Home Our Mission Maintaining the Stockpile Nuclear Weapons Life Cycle Nuclear Weapons Life Cycle Nuclear weapons are ...

  20. NUCLEAR POWER REACTORS AND ASSOCIATED PLANTS; 05 NUCLEAR FUELS...

    Office of Scientific and Technical Information (OSTI)

    Title list of documents made publicly available, January 1-31, 1998 NONE 21 NUCLEAR POWER REACTORS AND ASSOCIATED PLANTS; 05 NUCLEAR FUELS; BIBLIOGRAPHIES; NUCLEAR POWER PLANTS;...

  1. Generalized Nuclear Data: A New Structure (with Supporting Infrastructure) for Handling Nuclear Data

    SciTech Connect (OSTI)

    Mattoon, C.M.; Beck, B.R.; Patel, N.R.; Summers, N.C.; Hedstrom, G.W.; Brown, D.A.

    2012-12-15

    The Evaluated Nuclear Data File (ENDF) format was designed in the 1960s to accommodate neutron reaction data to support nuclear engineering applications in power, national security and criticality safety. Over the years, the scope of the format has been extended to handle many other kinds of data including charged particle, decay, atomic, photo-nuclear and thermal neutron scattering. Although ENDF has wide acceptance and support for many data types, its limited support for correlated particle emission, limited numeric precision, and general lack of extensibility mean that the nuclear data community cannot take advantage of many emerging opportunities. More generally, the ENDF format provides an unfriendly environment that makes it difficult for new data evaluators and users to create and access nuclear data. The Cross Section Evaluation Working Group (CSEWG) has begun the design of a new Generalized Nuclear Data (or 'GND') structure, meant to replace older formats with a hierarchy that mirrors the underlying physics, and is aligned with modern coding and database practices. In support of this new structure, Lawrence Livermore National Laboratory (LLNL) has updated its nuclear data/reactions management package Fudge to handle GND structured nuclear data. Fudge provides tools for converting both the latest ENDF format (ENDF-6) and the LLNL Evaluated Nuclear Data Library (ENDL) format to and from GND, as well as for visualizing, modifying and processing (i.e., converting evaluated nuclear data into a form more suitable to transport codes) GND structured nuclear data. GND defines the structure needed for storing nuclear data evaluations and the type of data that needs to be stored. But unlike ENDF and ENDL, GND does not define how the data are to be stored in a file. Currently, Fudge writes the structured GND data to a file using the eXtensible Markup Language (XML), as it is ASCII based and can be viewed with any text editor. XML is a meta-language, meaning that it has a primitive set of definitions for representing hierarchical data/text in a file. Other meta-languages, like HDF5 which stores the data in binary form, can also be used to store GND in a file. In this paper, we will present an overview of the new GND data structures along with associated tools in Fudge.

  2. budget | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Reflects Commitment to Maintain a Safe, Secure, and Effective Nuclear Deterrent; Prevent, Counter, and Respond to Global Nuclear Dangers; and Effectively Power the Nuclear Navy(...

  3. Nuclear Energy | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Energy Argonne has contributed to the development of civilian nuclear power for over 50 years. Our scientists and engineers conduct research in advanced nuclear energy ...

  4. Nuclear Facilities | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Nuclear Facilities Locator Map Numerical map data points indicate two or more nuclear facilities in the same geographic location. Nuclear Facilities List: Argonne National ...

  5. Nuclear Security for Floating Nuclear Power Plants

    SciTech Connect (OSTI)

    Skiba, James M.; Scherer, Carolynn P.

    2015-10-13

    Recently there has been a lot of interest in small modular reactors. A specific type of these small modular reactors (SMR,) are marine based power plants called floating nuclear power plants (FNPP). These FNPPs are typically built by countries with extensive knowledge of nuclear energy, such as Russia, France, China and the US. These FNPPs are built in one country and then sent to countries in need of power and/or seawater desalination. Fifteen countries have expressed interest in acquiring such power stations. Some designs for such power stations are briefly summarized. Several different avenues for cooperation in FNPP technology are proposed, including IAEA nuclear security (i.e. safeguards), multilateral or bilateral agreements, and working with Russian design that incorporates nuclear safeguards for IAEA inspections in non-nuclear weapons states

  6. Comprehensive Nuclear Model Code, Nucleons, Ions, Induced Cross-Sections

    Energy Science and Technology Software Center (OSTI)

    2002-09-27

    EMPIRE-II is a flexible code for calculation of nuclear reactions in the frame of combined op0tical, Multistep Direct (TUL), Multistep Compound (NVWY) and statistical (Hauser-Feshbach) models. Incident particle can be a nucleon or any nucleus (Heavy Ion). Isomer ratios, residue production cross sections and emission spectra for neutrons, protons, alpha- particles, gamma-rays, and one type of Light Ion can be calculated. The energy range starts just above the resonance region for neutron induced reactions andmore »extends up to several hundreds of MeV for the Heavy Ion induced reactions.« less

  7. Comprehensive Nuclear Model Code, Nucleons, Ions, Induced Cross-Sections

    Energy Science and Technology Software Center (OSTI)

    2002-09-27

    EMPIRE-II is a flexible code for calculation of nuclear reactions in the frame of combined op0tical, Multistep Direct (TUL), Multistep Compound (NVWY) and statistical (Hauser-Feshbach) models. Incident particle can be a nucleon or any nucleus (Heavy Ion). Isomer ratios, residue production cross sections and emission spectra for neutrons, protons, alpha- particles, gamma-rays, and one type of Light Ion can be calculated. The energy range starts just above the resonance region for neutron induced reactions andmore » extends up to several hundreds of MeV for the Heavy Ion induced reactions.« less

  8. Dudley Herschbach: Chemical Reactions and Molecular Beams

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Dudley Herschbach: Chemical Reactions and Molecular Beams Resources with Additional Information Dudley Herschbach Courtesy of Texas A&M University As a co-recipient of the 1986 Nobel Prize in Chemistry, 'Dudley Herschbach was cited for "providing a much more detailed understanding of how chemical reactions take place". Using molecular beams, he studied elementary reactions such as K + CH3I and K + Br2, where it became possible to correlate reaction dynamics with the electronic

  9. Nuclear radiation actuated valve

    DOE Patents [OSTI]

    Christiansen, David W.; Schively, Dixon P.

    1985-01-01

    A nuclear radiation actuated valve for a nuclear reactor. The valve has a valve first part (such as a valve rod with piston) and a valve second part (such as a valve tube surrounding the valve rod, with the valve tube having side slots surrounding the piston). Both valve parts have known nuclear radiation swelling characteristics. The valve's first part is positioned to receive nuclear radiation from the nuclear reactor's fuel region. The valve's second part is positioned so that its nuclear radiation induced swelling is different from that of the valve's first part. The valve's second part also is positioned so that the valve's first and second parts create a valve orifice which changes in size due to the different nuclear radiation caused swelling of the valve's first part compared to the valve's second part. The valve may be used in a nuclear reactor's core coolant system.

  10. Nuclear Energy Institute

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Hub Douglas B. Kothe Oak Ridge National Laboratory Director, CASL 9 th Nuclear Energy R&D Summit Nuclear Energy Institute Washington, D.C. February 26, 2014 CASL-U-2014-0355-000 ...

  11. Promulgating Nuclear Safety Requirements

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1996-05-15

    Applies to all Nuclear Safety Requirements Adopted by the Department to Govern the Conduct of its Nuclear Activities. Cancels DOE P 410.1. Canceled by DOE N 251.85.

  12. American Nuclear Society Awards

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Society Awards Established in 1999 by the Fusion Energy Division of the American Nuclear Society (ANS) and named after LLNL's co-founder, the Edward Teller Medal recognizes...

  13. EIA - State Nuclear Profiles

    U.S. Energy Information Administration (EIA) Indexed Site

    FirstEnergy Nuclear Operating Company Perry Unit 1 1,240 10,620 67.2 FirstEnergy ... Perry Nuclear Power Plant Unit Summer capacity (mw) Net generation (thousand mwh) Summer ...

  14. Working Group Report on - Space Nuclear Power Systems and Nuclear...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Working Group Report on - Space Nuclear Power Systems and Nuclear Waste Technology R&D Working Group Report on - Space Nuclear Power Systems and Nuclear Waste Technology R&D "Even ...

  15. Security and Use Control of Nuclear Explosives and Nuclear Weapons...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    O 452.4C, Security and Use Control of Nuclear Explosives and Nuclear Weapons by LtCol Karl Basham Functional areas: Nuclear Explosives, Nuclear Weapons, Security, Safety, Weapon...

  16. Method of controlling fusion reaction rates

    DOE Patents [OSTI]

    Kulsrud, Russell M. (Princeton, NJ); Furth, Harold P. (Princeton, NJ); Valeo, Ernest J. (Princeton Junction, NJ); Goldhaber, Maurice (Bayport, NY)

    1988-01-01

    A method of controlling the reaction rates of the fuel atoms in a fusion reactor comprises the step of polarizing the nuclei of the fuel atoms in a particular direction relative to the plasma confining magnetic field. Fusion reaction rates can be increased or decreased, and the direction of emission of the reaction products can be controlled, depending on the choice of polarization direction.

  17. Sandia Energy - Nuclear Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Over Five Years Computational Modeling & Simulation, Energy, News, News & Events, Nuclear Energy, Partnership, Systems Analysis Consortium for Advanced Simulation of...

  18. Nuclear Materials Science

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    16 Nuclear Materials Science Our multidisciplinary expertise comprises the core actinide materials science and metallurgical capability within the nuclear weapons production and surveillance communities. Contact Us Group Leader David Pugmire (acting) Email Group Office (505) 667-4665 The evaluations performed by our group are essential for the nuclear weapons program as well as nuclear materials storage, forensics, and actinide fundamental science. The evaluations performed by our group are

  19. Nuclear Fuel Cycle

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    - Sandia Energy Energy Search Icon Sandia Home Locations Contact Us Employee Locator Energy & Climate Secure & Sustainable Energy Future Stationary Power Energy Conversion Efficiency Solar Energy Wind Energy Water Power Supercritical CO2 Geothermal Natural Gas Safety, Security & Resilience of the Energy Infrastructure Energy Storage Nuclear Power & Engineering Grid Modernization Battery Testing Nuclear Fuel Cycle Defense Waste Management Programs Advanced Nuclear Energy Nuclear

  20. 3D NUCLEAR SEGMENTAT

    Energy Science and Technology Software Center (OSTI)

    003029WKSTN00 Delineation of nuclear structures in 3D multicellular systems https://vision.lbl.gov/Software/3DMorphometry/

  1. Advanced Nuclear Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Energy - Sandia Energy Energy Search Icon Sandia Home Locations Contact Us Employee Locator Energy & Climate Secure & Sustainable Energy Future Stationary Power Energy Conversion Efficiency Solar Energy Wind Energy Water Power Supercritical CO2 Geothermal Natural Gas Safety, Security & Resilience of the Energy Infrastructure Energy Storage Nuclear Power & Engineering Grid Modernization Battery Testing Nuclear Fuel Cycle Defense Waste Management Programs Advanced Nuclear

  2. Nuclear Explosive Safety Manual

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2009-04-14

    This Manual provides supplemental details to support the requirements of DOE O 452.2D, Nuclear Explosive Safety.

  3. Nuclear Safety Regulatory Framework

    Energy Savers [EERE]

    Department of Energy Nuclear Safety Regulatory Framework DOE's Nuclear Safety Enabling Legislation Regulatory Enforcement & Oversight Regulatory Governance Atomic Energy Act 1946 Atomic Energy Act 1954 Energy Reorganization Act 1974 DOE Act 1977 Authority and responsibility to regulate nuclear safety at DOE facilities 10 CFR 830 10 CFR 835 10 CFR 820 Regulatory Implementation Nuclear Safety Radiological Safety Procedural Rules ISMS-QA; Operating Experience; Metrics and Analysis Cross Cutting

  4. Eisenhower Halts Nuclear Weapons Testing | National Nuclear Security...

    National Nuclear Security Administration (NNSA)

    Eisenhower Halts Nuclear Weapons Testing | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing ...

  5. Nuclear Explosive Safety

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2009-04-14

    This Department of Energy (DOE) Order establishes requirements to implement the nuclear explosive safety (NES) elements of DOE O 452.1D, Nuclear Explosive and Weapon Surety Program, for routine and planned nuclear explosive operations (NEOs). Cancels DOE O 452.2C. Admin Chg 1, dated 7-10-13, cancels DOE O 452.2D.

  6. Nuclear Explosive Safety

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2009-04-14

    This Order establishes requirements to implement the nuclear explosive safety elements of DOE O 452.1D, Nuclear Explosive and Weapon Surety Program, for routine and planned nuclear explosive operations. Cancels DOE O 452.2C. Admin Chg 1, 7-10-13

  7. NUCLEAR REACTOR CONTROL SYSTEM

    DOE Patents [OSTI]

    Epler, E.P.; Hanauer, S.H.; Oakes, L.C.

    1959-11-01

    A control system is described for a nuclear reactor using enriched uranium fuel of the type of the swimming pool and other heterogeneous nuclear reactors. Circuits are included for automatically removing and inserting the control rods during the course of normal operation. Appropriate safety circuits close down the nuclear reactor in the event of emergency.

  8. Nuclear Explosive Safety

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2015-01-26

    This Department of Energy (DOE) Order establishes requirements to implement the nuclear explosive safety (NES) elements of DOE O 452.1E, Nuclear Explosive and Weapon Surety Program, or successor directive, for routine and planned nuclear explosive operations (NEOs). Supersedes DOE O 452.2D and DOE M 452.2-1A.

  9. Small nickel nanoparticle arrays from long chain imidazolium ionic liquids

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Yang, Mei; Campbell, Paul S.; Santini, Catherine C.; Mudring, Anja -Verena

    2013-11-08

    A series of six long chain alkyl mono- and bi-cationic imidazolium based salts with bis(trifluoromethylsulfonyl)imide (NTf2–) as the anion were synthesized and characterized. Single crystal structure of 1-methyl-3-octadecylimidazolium bis(trifluoromethylsulfonyl)imide could be obtained by X-ray analysis. All these long chain alkyl imidazolium based ILs were applied in the synthesis of nickel nanoparticles via chemical decomposition of an organometallic precursor of nickel. In these media, spontaneous decomposition of Ni(COD)2 (COD = 1,5-cyclooctadiene) in the absence of H2 occurred giving small NPs (≤4 nm) with narrow size distributions. Interestingly, formation of regularly interspaced NP arrays was also observed in long chain ILs. Lastly,more » such array formation could be interesting for potential applications such as carbon nanotube growth.« less

  10. Chemistry-Nuclear Chemistry Division. Progress report, October 1980-September 1981

    SciTech Connect (OSTI)

    Ryan, R.R.

    1982-05-01

    This report describes major progress in the research and development programs pursued by the Chemistry-Nuclear Chemistry Division of the Los Alamos National Laboratory during FY 1981. Topics covered include advanced analytical methods, atmospheric chemistry and transport, biochemistry, biomedical research, medical radioisotopes research, element migration and fixation, nuclear waste isolation research, inorganic and structural chemistry, isotope separation, analysis and applications, the newly established Nuclear Magnetic Resonance Center, atomic and molecular collisions, molecular spectroscopy, nuclear cosmochemistry, nuclear structure and reactions, pion charge exchange, radiochemical separations, theoretical chemistry, and unclassified weapons research.

  11. Incidents of chemical reactions in cell equipment

    SciTech Connect (OSTI)

    Baldwin, N.M.; Barlow, C.R.

    1991-12-31

    Strongly exothermic reactions can occur between equipment structural components and process gases under certain accident conditions in the diffusion enrichment cascades. This paper describes the conditions required for initiation of these reactions, and describes the range of such reactions experienced over nearly 50 years of equipment operation in the US uranium enrichment program. Factors are cited which can promote or limit the destructive extent of these reactions, and process operations are described which are designed to control the reactions to minimize equipment damage, downtime, and the possibility of material releases.

  12. Dual chain synthetic heparin-binding growth factor analogs

    DOE Patents [OSTI]

    Zamora, Paul O.; Pena, Louis A.; Lin, Xinhua

    2009-10-06

    The invention provides synthetic heparin-binding growth factor analogs having two peptide chains each branched from a branch moiety, such as trifunctional amino acid residues, the branch moieties separated by a first linker of from 3 to about 20 backbone atoms, which peptide chains bind a heparin-binding growth factor receptor and are covalently bound to a non-signaling peptide that includes a heparin-binding domain, preferably by a second linker, which may be a hydrophobic second linker. The synthetic heparin-binding growth factor analogs are useful as pharmaceutical agents, soluble biologics or as surface coatings for medical devices.

  13. Dual chain synthetic heparin-binding growth factor analogs

    DOE Patents [OSTI]

    Zamora, Paul O.; Pena, Louis A.; Lin, Xinhua

    2012-04-24

    The invention provides synthetic heparin-binding growth factor analogs having two peptide chains each branched from a branch moiety, such as trifunctional amino acid residues, the branch moieties separated by a first linker of from 3 to about 20 backbone atoms, which peptide chains bind a heparin-binding growth factor receptor and are covalently bound to a non-signaling peptide that includes a heparin-binding domain, preferably by a second linker, which may be a hydrophobic second linker. The synthetic heparin-binding growth factor analogs are useful as pharmaceutical agents, soluble biologics or as surface coatings for medical devices.

  14. Triangle Universities Nuclear Laboratory : 2013

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    nuclear data evaluation group at TUNL continue their work as part of the United States Nuclear Data Program

  15. 2013 Nuclear Workforce Development Day

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Myths Topics:  Can a Nuclear Reactor Explode Like a Bomb?  Will Nuclear Waste Be Around for Millions of Years?  Is Nuclear Energy Dangerous? Moderator: Suzy Hobbs Baker Founder, PopAtomic Studios & Director of Nuclear Literacy Project Panel Members: TJ Corder - Nuclear Engineer, Vogtle 3 & 4 Southern Company Jana Thames - Communications Specialist Southern Company Brian Dyke - Nuclear Auxiliary Operator Duke Energy Nathan Zohner North American Young Generation in Nuclear

  16. Nuclear & Particle Physics, Astrophysics, Cosmology

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear & Particle Physics science-innovationassetsimagesicon-science.jpg Nuclear & Particle Physics, Astrophysics, Cosmology National security depends on science and ...

  17. transportation | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    transportation | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear...

  18. A new copper borophosphate with novel polymeric chains and its structural correlation with raw materials in molten hydrated flux synthesis

    SciTech Connect (OSTI)

    Duan, Ruijing; Liu, Wei Cao, Lixin; Su, Ge; Xu, Hongmei; Zhao, Chenggong

    2014-02-15

    A novel copper borophosphate, Cu{sub 3}[B{sub 2}P{sub 3}O{sub 12}(OH){sub 3}] has been prepared by the molten hydrated flux method. Its crystal structure was determined by the single-crystal X-ray diffraction (monoclinic, Cc, a=6.1895 , b=13.6209 , c=11.9373 , ?=97.62, V=997.5 {sup 3}, Z=4). The three-dimensional framework of the titled compound, is composed by two kinds of polymeric chains and isolated PO{sub 4} tetrahedral. One novel 4-membered tetrahedral rings has been observed in borophosphates. Magnetic measurements indicate that the title compound exits antiferromagnetic interactions. Due to the special reaction medium created by the molten hydrated flux method, a possible structural correlation between the final solids and the raw materials has been noted. - Graphical abstract: The 3D structure consists of a framework composed of CuO{sub x} polyhedra, BO{sub 4} and PO{sub 4} tetrahedra. A intersection angle between the metal chains and borophosphate chains can be noted. Display Omitted - Highlights: A novel copper borophosphate has been prepared by the molten hydrated flux method. One novel 4-membered tetrahedral ring has been observed firstly in borophosphates. A possible structural correlation between the final solids and the raw materials has been noted.

  19. Ring Walking/Oxidative Addition Reactions for the Controlled Synthesis of Conjugated Polymers

    SciTech Connect (OSTI)

    Bazan, Guillermo C

    2012-04-03

    Power conversion efficiencies of plastic solar cells depend strongly on the molecular weight characteristics of the semiconducting polymers used for their fabrication. The synthesis of these materials typically relies on transition metal mediated catalytic reactions. In many instances, the ideal structures cannot be attained because of deficiencies in these reactions, particularly when it comes to being able to achieve high number average molecular weights and narrow molecular weight distributions. Another important conjugated polymer structure of interest is one in which a single functional group is attached at the end group of the chain. Such systems would be ideal for modifying surface properties at interfaces and for labeling biomolecular probes used in fluorescent biosensors. To respond to the challenges above, our efforts have centered on the design of homogenous transition metal complexes that are easy to prepare and effective in carrying out living, or quasi-living, condensative chain polymerization reactions. The key mechanistic challenge for the success of this reaction is to force the insertion of one monomer unit at a time via a process that involves migration of the transition metal-containing fragment to one terminus of the polymer chain. Chain growth characteristics are therefore favored when the metal does not dissociate from the newly formed reductive elimination product. We have proposed that dissociation is disfavored by the formation of a ?-complex, in which the metal can sample various locations of the electronically delocalized framework, a process that we term ??ring-walking?, and find the functionality where oxidative addition takes place. Success has been achieved in the nickel-mediated cross coupling reaction of Grignard reagents with aromatic halides by using bromo[1,2-bis(diphenylphosphino)ethane]phenylnickel. This reagent can yield poly(thiophene)s (one of the most widely used type of polymer in plastic solar cells) with excellent stereoregularity and molecular weight distributions with polydispersities that are consistent with a living polymerization sequence. Another important objective of this program concerned the use of these new catalysts and improved mechanistic insight for the synthesis of specific polymeric materials with prespecified properties.

  20. Quantum Monte Carlo methods for nuclear physics

    SciTech Connect (OSTI)

    Carlson, J.; Gandolfi, S.; Pederiva, F.; Pieper, Steven C.; Schiavilla, R.; Schmidt, K. E.; Wiringa, R. B.

    2015-09-09

    Quantum Monte Carlo methods have proved valuable to study the structure and reactions of light nuclei and nucleonic matter starting from realistic nuclear interactions and currents. These ab-initio calculations reproduce many low-lying states, moments, and transitions in light nuclei, and simultaneously predict many properties of light nuclei and neutron matter over a rather wide range of energy and momenta. The nuclear interactions and currents are reviewed along with a description of the continuum quantum Monte Carlo methods used in nuclear physics. These methods are similar to those used in condensed matter and electronic structure but naturally include spin-isospin, tensor, spin-orbit, and three-body interactions. A variety of results are presented, including the low-lying spectra of light nuclei, nuclear form factors, and transition matrix elements. Low-energy scattering techniques, studies of the electroweak response of nuclei relevant in electron and neutrino scattering, and the properties of dense nucleonic matter as found in neutron stars are also described. Furthermore, a coherent picture of nuclear structure and dynamics emerges based upon rather simple but realistic interactions and currents.