National Library of Energy BETA

Sample records for nuclear chain reaction

  1. Enrico Fermi Achieves First Self Sustain Nuclear Chain Reaction...

    National Nuclear Security Administration (NNSA)

    Self Sustain Nuclear Chain Reaction Chicago, IL Metallurgical Laboratory scientists led by Enrico Fermi achieve the first self-sustained nuclear chain reaction in pile...

  2. OSTIblog Articles in the nuclear chain reaction Topic | OSTI...

    Office of Scientific and Technical Information (OSTI)

    amount of neutron reduction needed for a safe and controlled sustained nuclear reaction. ... Manhattan Project, nuclear chain reaction, plutonium, uranium, World War II Read more... ...

  3. Enrico Fermi Achieves First Self Sustain Nuclear Chain Reaction | National

    National Nuclear Security Administration (NNSA)

    Nuclear Security Administration | (NNSA) Enrico Fermi Achieves First Self Sustain Nuclear Chain Reaction Enrico Fermi Achieves First Self Sustain Nuclear Chain Reaction Chicago, IL Metallurgical Laboratory scientists led by Enrico Fermi achieve the first self-sustained nuclear chain reaction in pile constructed under the west grandstand at Stagg field in Chicago

  4. METHOD AND APPARATUS FOR CONDUCTING A NUCLEAR CHAIN REACTION

    DOE Patents [OSTI]

    Wigner, E.P.; Ohlinger, L.A.; Young, G.J.; Weinberg, A.M.

    1962-09-01

    A nuclear reactor is designed incorporating a slurry of uranium- containing particles in heavy water and including means for circulating the slurry and for cooling the slurry. (AEC)

  5. Enrico Fermi and the First Self-Sustaining Nuclear Chain Reaction

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Fermi and the First Self-Sustaining Nuclear Chain Reaction Resources with Additional Information * Fermi Honored * Atoms for Peace * Centennial of Birth * Stamp Patents * Audio/Video Clips * Selected by NSTA for SciLinks "The President of the United States of America ... for especially meritorious contributions to the development, use, or control of atomic energy, grant[s] an award of merit to Enrico Fermi for his contributions to basic neutron physics and the achievement of the controlled

  6. Polyneutron Chain Reactions

    SciTech Connect (OSTI)

    John C. Fisher

    2000-11-12

    Although helium atoms do not form molecules, a sufficiently large number will bind into a stable liquid droplet. A comparable situation is expected for neutrons, with a sufficiently large number binding into a stable droplet of neutron matter. Such polyneutron droplets can be viewed as isotopes of an element with nuclear charge Z=0, tentatively denoted neutrium, symbol Nt. Because of the relatively weak binding of neutrons compared with that of a mix of neutrons and protons, the minimum number of neutrons required for stability of a droplet is fairly large. Early estimates of {approx}60 may be reduced to a dozen or so by the BCS pairing interaction. The Nt entries with N{>=}12 are new to the table of isotopes. Because all of them are beta-unstable, none is expected to persist as a free particle. Yet, some may occasionally be produced by means to be described below, and it is of interest to examine their decay chains and their interactions with charged nuclei to ascertain how their presence might be revealed. Although these reactions are interesting, they cannot be taken seriously without identifying a source for the initial Nt isotope that begins the chain. Here, we consider possible interactions between {sup 16}O and {sup A}Nt. Although there is no strong interaction between them, we can expect a very weak residual attraction that can form a loosely bound {sup 16}O {sup A}Nt nuclear molecule. This is not a compound nucleus in the usual sense because, considered as fluids, the {sup 16}O and {sup A}Nt droplets are immiscible. For a droplet with fewer than about 60 neutrons, beta decay of {sup A}Nt is prevented by the buildup of Coulomb energy associated with transforming {sup A}Nt into {sup A}H in close proximity to {sup 16}O. Thus, it is possible that {sup 16}O {sup A}Nt molecules can persist indefinitely and that a few of them may be present in ordinary water as supermassive oxygen nuclei. Because the binding of these molecules is weak, the {sup A}Nt component can

  7. Polymerase chain reaction system

    DOE Patents [OSTI]

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  8. OSTIblog Articles in the nuclear chain reaction Topic | OSTI, US Dept of

    Office of Scientific and Technical Information (OSTI)

    Energy Office of Scientific and Technical Information chain reaction Topic The Manhattan Project -- Its Operations by Mary Schorn 29 Nov, 2012 in Science Communications 4236 ManhattanProjectMap320.jpg The Manhattan Project -- Its Operations Read more about 4236 Major operations for the Manhattan Engineer District (Manhattan Project) took place in remote site locations in the states of Tennessee, New Mexico, and Washington, with additional research being conducted in university laboratories

  9. Theory of Neutron Chain Reactions. Volume II, Part I. Homogeneous Nuclear Chain Reactions. Chapter V. Neutron Chain Reactions. Chapter VI. Pile Equations. Chapter VII. Theory of Reflectors And The Method Of Groups

    DOE R&D Accomplishments [OSTI]

    Weinberg, Alvin M.; Noderer, L. C.

    1951-08-10

    The previous section of this book deals with the general problem of neutron diffusion. In this sequel we shall apply the results obtained already to the theory of slow neutron chain reacting systems.

  10. Lesson 5 - Fission and Chain Reactions | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    5 - Fission and Chain Reactions Lesson 5 - Fission and Chain Reactions Lesson Four showed how the nuclei of atoms store energy and how unstable atoms decay and release energy. How do nuclear engineers use this knowledge to help them harness energy to make electricity? The answer lies in being able to start a nuclear chain reaction in fuel inside a nuclear power plant and keep it going. This lesson examines nuclear reactions called fission as well as how uranium is processed from ore to fuel.

  11. Chain Reaction Innovations: Innovation Applicant Information | Argonne

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    National Laboratory Innovation Applicant Information Information for Innovation Applicants in the Chain Reaction Innovations program PDF icon CRI_innovation_applicant_info

  12. Supplement to Theory of Neutron Chain Reactions

    DOE R&D Accomplishments [OSTI]

    Weinberg, Alvin M.; Noderer, L. C.

    1952-05-26

    General discussions are given of the theory of neutron chain reactions. These include observations on exponential experiments, the general reactor with resonance fission, microscopic pile theory, and homogeneous slow neutron reactors. (B.J.H.)

  13. Nuclear structure and nuclear reactions | Argonne Leadership...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear structure and nuclear reactions PI Name: James Vary PI Email: jvary@iastate.edu Institution: Iowa State University Allocation Program: INCITE Allocation Hours at ALCF: 15 ...

  14. supply chain | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    supply chain

  15. maritime supply chain | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    maritime supply chain NNSA Co-Hosts Nuclear Security Summit Workshop on Maritime Security with UK WASHINGTON - This week, the Department of Energy's National Nuclear Security Administration (DOE/NNSA) and the U.K. Department of Energy and Climate Change concluded a workshop at Wilton Park, United Kingdom, on the growing challenge of securing the global maritime supply chain. In

  16. Dual phase multiplex polymerase chain reaction

    DOE Patents [OSTI]

    Pemov, Alexander; Bavykin, Sergei

    2008-10-07

    Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

  17. Integrated polymerase chain reaction/electrophoresis instrument

    DOE Patents [OSTI]

    Andresen, Brian D.

    2000-01-01

    A new approach and instrument for field identification of micro-organisms and DNA fragments using a small and disposable device containing integrated polymerase chain reaction (PCR) enzymatic reaction wells, attached capillary electrophoresis (CE) channels, detectors, and read-out all on/in a small hand-held package. The analysis instrument may be made inexpensively, for example, of plastic, and thus is disposable, which minimizes cross contamination and the potential for false positive identification between samples. In addition, it is designed for multiple users with individual applications. The integrated PCR/CE is manufactured by the PCR well and CE channels are "stamped" into plastic depressions where conductive coatings are made in the wells and ends of the CE microchannels to carry voltage and current to heat the PCR reaction mixtures and simultaneously draw DNA bands up the CE channels. Light is transmitted through the instrument at appropriate points and detects PCR bands and identifies DNA fragments by size (retention time) and quantifies each by the amount of light generated as each phototransistor positioned below each CE channel detects a passing band. The instrument is so compact that at least 100 PCR/CE reactions/analyses can be performed easily on one detection device.

  18. Chain Reaction Innovation is DOE's Newest Investment in the Clean...

    Office of Environmental Management (EM)

    in the Clean Energy Innovation Ecosystem Chain Reaction Innovation is DOE's Newest Investment in the Clean Energy Innovation Ecosystem June 1, 2016 - 4:00pm Addthis Ribbon ...

  19. NUCLEAR FISSION CHAIN REACTING SYSTEM

    DOE Patents [OSTI]

    Anderson, H.L.; Brown, H.S.

    1961-06-27

    The patent describes a reactor consisting of a plurality of tubes passing through a body of heavy water or graphite, a heat exchanger, means for flowing UF/sub 6/ through the tubes and the heat exchangar, and means for bleeding off some of the UF/sub 6/ and separating plutonium therefrom. A specific suggestion contained is that the amount of the UF/sub 6/ outside the reaction unit be a multiple of that within it.

  20. Nuclear reactions from lattice QCD

    SciTech Connect (OSTI)

    Briceño, Raúl A.; Davoudi, Zohreh; Luu, Thomas C.

    2015-01-13

    In this study, one of the overarching goals of nuclear physics is to rigorously compute properties of hadronic systems directly from the fundamental theory of strong interactions, Quantum Chromodynamics (QCD). In particular, the hope is to perform reliable calculations of nuclear reactions which will impact our understanding of environments that occur during big bang nucleosynthesis, the evolution of stars and supernovae, and within nuclear reactors and high energy/density facilities. Such calculations, being truly ab initio, would include all two-nucleon and three- nucleon (and higher) interactions in a consistent manner. Currently, lattice QCD provides the only reliable option for performing calculations of some of the low-energy hadronic observables. With the aim of bridging the gap between lattice QCD and nuclear many-body physics, the Institute for Nuclear Theory held a workshop on Nuclear Reactions from Lattice QCD on March 2013. In this review article, we report on the topics discussed in this workshop and the path planned to move forward in the upcoming years.

  1. Nuclear reactions from lattice QCD

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Briceño, Raúl A.; Davoudi, Zohreh; Luu, Thomas C.

    2015-01-13

    In this study, one of the overarching goals of nuclear physics is to rigorously compute properties of hadronic systems directly from the fundamental theory of strong interactions, Quantum Chromodynamics (QCD). In particular, the hope is to perform reliable calculations of nuclear reactions which will impact our understanding of environments that occur during big bang nucleosynthesis, the evolution of stars and supernovae, and within nuclear reactors and high energy/density facilities. Such calculations, being truly ab initio, would include all two-nucleon and three- nucleon (and higher) interactions in a consistent manner. Currently, lattice QCD provides the only reliable option for performing calculationsmore » of some of the low-energy hadronic observables. With the aim of bridging the gap between lattice QCD and nuclear many-body physics, the Institute for Nuclear Theory held a workshop on Nuclear Reactions from Lattice QCD on March 2013. In this review article, we report on the topics discussed in this workshop and the path planned to move forward in the upcoming years.« less

  2. On nuclear reactions in defects

    SciTech Connect (OSTI)

    Sienes, J.K. )

    1991-05-01

    The variability of results concerning cold fusion, together with the difficulty of explaining the observations, suggests that some nonstandard processes may be occurring. One such possibility is that nuclear reactions occur in defects of a deuterated lattice as a result of transient motions that momentarily bring deuterium atoms into close proximity. In this paper a mechanism involving shear of a one-dimensional lattice is described that illustrates this possibility. Order-of-magnitude estimates indicate that the expected fusion rate is not inconsistent with some experiments.

  3. Nuclear Structure and Nuclear Reactions | Argonne Leadership...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    x2 - triaxiality, and x3 - pairing correlations. Calculations were carried out using nuclear density functional theory. The collective action was minimized using the dynamical...

  4. EXFOR Library of Experimental Nuclear Reaction Data

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    The EXFOR library contains an extensive compilation of experimental nuclear reaction data up to 1 GeV. Neutron reactions have been compiled systematically since the discovery of the neutron, while charged particle(up to carbon) and photon reactions have been covered less extensively. Files contain nuclear reaction data such as cross sections, spectra, angular distributions, polarizations, etc, along with information on experimental technique, error analysis, and applied standards. Numerous search parameters include: target, beam, product, experimental method, and even author and publication names. The library contains data from more than 20,000 experiments. (Specialized Interface)

  5. Chain Reaction Innovations: A More Powerful Incubator for Energy and

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Science Technology | Argonne National Laboratory A More Powerful Incubator for Energy and Science Technology Chain Reaction Innovations (CRI) is a two-year program for innovators focusing on energy and science technologies. Through an annual application call, four to six teams will be selected to join CRI. Program participants will receive the financial and technical support needed to mature nascent technologies that face long development cycles to the proof-of-concept level, thus getting

  6. Ab Initio Calculations Of Nuclear Reactions And Exotic Nuclei...

    Office of Scientific and Technical Information (OSTI)

    Technical Report: Ab Initio Calculations Of Nuclear Reactions And Exotic Nuclei Citation Details In-Document Search Title: Ab Initio Calculations Of Nuclear Reactions And Exotic ...

  7. Calculation of nuclear reaction cross sections on excited nuclei...

    Office of Scientific and Technical Information (OSTI)

    Calculation of nuclear reaction cross sections on excited nuclei with the coupled-channels method Citation Details In-Document Search Title: Calculation of nuclear reaction cross ...

  8. Nuclear reaction and decay data evaluation capabilities at LANL...

    Office of Scientific and Technical Information (OSTI)

    Conference: Nuclear reaction and decay data evaluation capabilities at LANL Citation Details In-Document Search Title: Nuclear reaction and decay data evaluation capabilities at ...

  9. Nuclear reaction and decay data evaluation capabilities at LANL...

    Office of Scientific and Technical Information (OSTI)

    Nuclear reaction and decay data evaluation capabilities at LANL Citation Details In-Document Search Title: Nuclear reaction and decay data evaluation capabilities at LANL You ...

  10. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOE Patents [OSTI]

    Nasarabadi, Shanavaz

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.

  11. Experimental nuclear reaction data collection EXFOR

    SciTech Connect (OSTI)

    Semkova, V.; Otuka, N.; Simakov, S. P.; Zerkin, V.

    2011-07-01

    The International Network of Nuclear Reaction Data Centres (NRDC) constitutes a worldwide cooperation of 14 nuclear data centres. The main activity of the NRDC Network is collection and compilation of experimental nuclear reaction cross section data and the related bibliographic information in the EXFOR and CINDA databases as well as dissemination of nuclear reaction data and associated documentation to users. The database contains information and numerical data from more than about 19000 experiments consisting of more than 140000 datasets. EXFOR is kept up to date by constantly adding newly published experimental information. Tools developed for data dissemination utilise modern database technologies with fast online capabilities over the Internet. Users are provided with sophisticated search options, a user-friendly retrieval interface for downloading data in different formats, and additional output options such as improved data plotting capabilities. The present status of the EXFOR database will be presented together with the latest development for data access and retrieval. (authors)

  12. MEANS FOR TERMINATING NUCLEAR REACTIONS

    DOE Patents [OSTI]

    Cooper, C.M.

    1959-02-17

    An apparatus is presented for use in a reactor of the heterogeneous, fluid cooled type for the purpose of quickly terminating the reaction, the coolant being circulated through coolant tubes extending through the reactor core. Several of the tubes in the critical region are connected through valves to a tank containing a poisoning fluid having a high neutron capture crosssection and to a reservoir. When it is desired to quickly terminate the reaction, the valves are operated to permit the flow of the poisoning fluid through these particular tubes and into the reservoir while normal coolant is being circulated through the remaining tubes. The apparatus is designed to prevent contamination of the primary coolant by the poisoning fluid.

  13. Theory of Neutron Chain Reactions: Extracts from Volume I, Diffusion and Slowing Down of Neutrons: Chapter I. Elementary Theory of Neutron Diffusion. Chapter II. Second Order Diffusion Theory. Chapter III. Slowing Down of Neutrons

    DOE R&D Accomplishments [OSTI]

    Weinberg, Alvin M.; Noderer, L. C.

    1951-05-15

    The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.

  14. Chain Reaction Innovations Opens Call for First Startup Cohort of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Innovators | Department of Energy Chain Reaction Innovations Opens Call for First Startup Cohort of Energy Innovators Chain Reaction Innovations Opens Call for First Startup Cohort of Energy Innovators July 20, 2016 - 3:29pm Addthis Chain Reaction Innovations Opens Call for First Startup Cohort of Energy Innovators Earlier this year, we announced the launch of Chain Reaction Innovations (CRI), the newest addition to the Department of Energy's (DOE) Lab-Embedded Entrepreneurship Programs

  15. Supply Chain Management Center | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Supply Chain Management Center

  16. maritime supply chain | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    National Nuclear Security Administration (DOENNSA) and the U.K. Department of Energy and Climate Change concluded a workshop at Wilton Park, About This Site Budget IG Web Policy...

  17. On fusion/fission chain reactions in the Fleischmann-Pons cold fusion experiment

    SciTech Connect (OSTI)

    Anghaie, S.; Froelich, P.; Monkhorst, H.J. )

    1990-05-01

    In this paper the possibility of fusion/fission chain reactions following d-d source reactions in electrochemical cold fusion experiments have been investigated. The recycling factors for the charged particles in fusion reactions with consumable nuclei deuteron, {sup 6}Li nd {sup 7}Li, are estimated. It is concluded that, based on the established nuclear fusion cross sections and electronic stopping power, the recycling factor is four to five orders of magnitude less than required for close to critical conditions. It is argued that the cross generation of charged particles by neutrons does not play a significant role in this process, even if increased densities at the surface of electrodes do occur.

  18. Nested methylation-specific polymerase chain reaction cancer detection method

    DOE Patents [OSTI]

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  19. Nuclear reactions used for superheavy element research

    SciTech Connect (OSTI)

    Stoyer, M A

    2008-02-26

    Some of the most fascinating questions about the limits of nuclear stability are confronted in the heaviest nuclei. How many more new elements can be synthesized? What are the nuclear and chemical properties of these exotic nuclei? Does the 'Island of Stability' exist and can we ever explore the isotopes inhabiting that nuclear region? This paper will focus on the current experimental research on the synthesis and characterization of superheavy nuclei with Z > 112 from the Dubna/Livermore collaboration. Reactions using 48Ca projectiles from the U400 cyclotron and actinide targets ({sup 233,238}U, {sup 237}Np, {sup 242,244}Pu, {sup 243}Am, {sup 245,248}Cm, {sup 249}Cf) have been investigated using the Dubna Gas Filled Recoil Separator in Dubna over the last 8 years. In addition, several experiments have been performed to investigate the chemical properties of some of the observed longer-lived isotopes produced in these reactions. Some comments will be made on nuclear reactions used for the production of the heaviest elements. A summary of the current status of the upper end of the chart of nuclides will be presented.

  20. Nuclear Reactions Induced by a Pyroelectric Accelerator

    SciTech Connect (OSTI)

    Geuther, Jeffrey; Danon, Yaron; Saglime, Frank

    2006-02-10

    This work demonstrates the use of pyroelectric crystals to induce nuclear reactions. A system based on a pair of pyroelectric crystals is used to ionize gas and accelerate the ions to energies of up to 200 keV. The system operates above room temperature by simply heating or cooling the pyroelectric crystals. A D-D fusion reaction was achieved with this technique, and 2.5 MeV neutrons were detected. The measured neutron yield is in good agreement with the calculated yield. This work also verifies the results published by Naranjo, Gimzewski, and Putterman [Nature (London) 434, 1115 (2005)].

  1. Toward A Fundamental Understanding Of Nuclear Reactions And Exotic...

    Office of Scientific and Technical Information (OSTI)

    Conference: Toward A Fundamental Understanding Of Nuclear Reactions And Exotic Nuclei Citation Details In-Document Search Title: Toward A Fundamental Understanding Of Nuclear ...

  2. Hadron Cancer Therapy: Role of Nuclear Reactions

    DOE R&D Accomplishments [OSTI]

    Chadwick, M. B.

    2000-06-20

    Recently it has become feasible to calculate energy deposition and particle transport in the body by proton and neutron radiotherapy beams, using Monte Carlo transport methods. A number of advances have made this possible, including dramatic increases in computer speeds, a better understanding of the microscopic nuclear reaction cross sections, and the development of methods to model the characteristics of the radiation emerging from the accelerator treatment unit. This paper describes the nuclear reaction mechanisms involved, and how the cross sections have been evaluated from theory and experiment, for use in computer simulations of radiation therapy. The simulations will allow the dose delivered to a tumor to be optimized, whilst minimizing the dos given to nearby organs at risk.

  3. Chain Reaction Innovation is DOE's Newest Investment in the Clean Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Innovation Ecosystem | Department of Energy Chain Reaction Innovation is DOE's Newest Investment in the Clean Energy Innovation Ecosystem Chain Reaction Innovation is DOE's Newest Investment in the Clean Energy Innovation Ecosystem June 1, 2016 - 4:00pm Addthis Ribbon cutting ceremony for the Chain Reaction Innovations program launch. From left to right: Dr. David Danielson, Assistant Secretary for Energy Efficiency and Renewable Energy; Dr. Peter Littlewood, Director of Argonne National

  4. Chain Reaction Innovations Opens the Call for its First Startup Cohort |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Department of Energy Chain Reaction Innovations Opens the Call for its First Startup Cohort Chain Reaction Innovations Opens the Call for its First Startup Cohort July 12, 2016 - 11:52am Addthis Announcement from Argonne National Laboratory Argonne National Laboratory has opened a new innovation incubator called Chain Reaction Innovations (CRI), which wants to ensure that innovators who are pursuing transformational technologies thrive by giving them an unparalleled level of support that

  5. First-Hand Recollections of the First Self-Sustaining Chain Reaction

    Broader source: Energy.gov [DOE]

    Seventy years later, two of the men present at the first nuclear reaction recall the events of the memorable day.

  6. Numerical simulations for low energy nuclear reactions including...

    Office of Scientific and Technical Information (OSTI)

    Numerical simulations for low energy nuclear reactions including direct channels to validate statistical models Citation Details In-Document Search Title: Numerical simulations for ...

  7. Numerical simulations for low energy nuclear reactions including...

    Office of Scientific and Technical Information (OSTI)

    Numerical simulations for low energy nuclear reactions including direct channels to ... Visit OSTI to utilize additional information resources in energy science and technology. A ...

  8. Nuclear waste vitrification efficiency: cold cap reactions

    SciTech Connect (OSTI)

    Hrma, Pavel R.; Kruger, Albert A.; Pokorny, Richard

    2012-12-15

    The cost and schedule of nuclear waste treatment and immobilization are greatly affected by the rate of glass production. Various factors influence the performance of a waste-glass melter. One of the most significant, and also one of the least understood, is the process of batch melting. Studies are being conducted to gain fundamental understanding of the batch reactions, particularly those that influence the rate of melting, and models are being developed to link batch makeup and melter operation to the melting rate. Batch melting takes place within the cold cap, i.e., a batch layer floating on the surface of molten glass. The conversion of batch to glass consists of various chemical reactions, phase transitions, and diffusion-controlled processes. These include water evaporation (slurry feed contains as high as 60% water), gas evolution, the melting of salts, the formation of borate melt, reactions of borate melt with molten salts and with amorphous oxides (Fe2O3 and Al2O3), the formation of intermediate crystalline phases, the formation of a continuous glass-forming melt, the growth and collapse of primary foam, and the dissolution of residual solids. To this list we also need to add the formation of secondary foam that originates from molten glass but accumulates on the bottom of the cold cap. This study presents relevant data obtained for a high-level-waste melter feed and introduces a one-dimensional (1D) mathematical model of the cold cap as a step toward an advanced three-dimensional (3D) version for a complete model of the waste glass melter. The 1D model describes the batch-to-glass conversion within the cold cap as it progresses in a vertical direction. With constitutive equations and key parameters based on measured data, and simplified boundary conditions on the cold-cap interfaces with the glass melt and the plenum space of the melter, the model provides sensitivity analysis of the response of the cold cap to the batch makeup and melter conditions

  9. NUCLEAR WASTE VITRIFICATION EFFICIENCY COLD CAP REACTIONS

    SciTech Connect (OSTI)

    KRUGER AA; HRMA PR; POKORNY R

    2011-07-29

    The cost and schedule of nuclear waste treatment and immobilization are greatly affected by the rate of glass production. Various factors influence the performance of a waste-glass melter. One of the most significant, and also one of the least understood, is the process of batch melting. Studies are being conducted to gain fundamental understanding of the batch reactions, particularly those that influence the rate of melting, and models are being developed to link batch makeup and melter operation to the melting rate. Batch melting takes place within the cold cap, i.e., a batch layer floating on the surface of molten glass. The conversion of batch to glass consists of various chemical reactions, phase transitions, and diffusion-controlled processes. These include water evaporation (slurry feed contains as high as 60% water), gas evolution, the melting of salts, the formation of borate melt, reactions of borate melt with molten salts and with amorphous oxides (Fe{sub 2}O{sub 3} and Al{sub 2}O{sub 3}), the formation of intermediate crystalline phases, the formation of a continuous glass-forming melt, the growth and collapse of primary foam, and the dissolution of residual solids. To this list we also need to add the formation of secondary foam that originates from molten glass but accumulates on the bottom of the cold cap. This study presents relevant data obtained for a high-level-waste melter feed and introduces a one-dimensional (1D) mathematical model of the cold cap as a step toward an advanced three-dimensional (3D) version for a complete model of the waste glass melter. The 1D model describes the batch-to-glass conversion within the cold cap as it progresses in a vertical direction. With constitutive equations and key parameters based on measured data, and simplified boundary conditions on the cold-cap interfaces with the glass melt and the plenum space of the melter, the model provides sensitivity analysis of the response of the cold cap to the batch makeup

  10. EMPIRE: A Reaction Model Code for Nuclear Astrophysics

    SciTech Connect (OSTI)

    Palumbo, A.; Herman, M.; Capote, R.

    2014-06-15

    The correct modeling of abundances requires knowledge of nuclear cross sections for a variety of neutron, charged particle and γ induced reactions. These involve targets far from stability and are therefore difficult (or currently impossible) to measure. Nuclear reaction theory provides the only way to estimate values of such cross sections. In this paper we present application of the EMPIRE reaction code to nuclear astrophysics. Recent measurements are compared to the calculated cross sections showing consistent agreement for n-, p- and α-induced reactions of strophysical relevance.

  11. Nuclear reaction modeling, verification experiments, and applications

    SciTech Connect (OSTI)

    Dietrich, F.S.

    1995-10-01

    This presentation summarized the recent accomplishments and future promise of the neutron nuclear physics program at the Manuel Lujan Jr. Neutron Scatter Center (MLNSC) and the Weapons Neutron Research (WNR) facility. The unique capabilities of the spallation sources enable a broad range of experiments in weapons-related physics, basic science, nuclear technology, industrial applications, and medical physics.

  12. Method of carbon chain extension using novel aldol reaction

    DOE Patents [OSTI]

    Silks, Louis A; Gordon, John C; Wu, Ruilan; Hanson, Susan Kloek

    2013-07-30

    Method of producing C.sub.8-C.sub.15 hydrocarbons. comprising providing a ketone starting material; providing an aldol starting material comprising chloromethylfurfural; mixing the ketone starting material and the aldol starting material in a reaction in the presence of a proline-containing catalyst selected from the group consisting of Zn(Pro).sub.2, Yb(Pro).sub.3, and combinations thereof, or a catalyst having one of the structures (I), (II) or (III), and in the presence of a solvent, wherein the solvent comprises water and is substantially free of organic solvents, where (I), (II) and (III) respectively are: ##STR00001## where R.sub.1 is a C.sub.1-C.sub.6 alkyl moiety, X=(OH) and n=2. ##STR00002## In (III), X may be CH.sub.2, sulfur or selenium, M may be Zn, Mg, or a lanthanide, and R.sub.1 and R.sub.2 each independently may be a methyl, ethyl, phenyl moiety.

  13. Method of carbon chain extension using novel aldol reaction

    DOE Patents [OSTI]

    Silks, Louis A; Gordon, John C; Wu, Ruilan; Hangson, Susan Kloek

    2013-08-13

    Method of producing C.sub.8-C.sub.15 hydrocarbons comprising providing a ketone starting material; providing an aldol starting material comprising hydroxymethylfurfural; mixing the ketone starting material and the aldol starting material in a reaction in the presence of a proline-containing catalyst selected from the group consisting of Zn(Pro).sub.2, Yb(Pro).sub.2, and combinations thereof, or a catalyst having one of the structures (I), (II) or (III), and in the presence of a solvent, wherein the solvent comprises water and is substantially free of organic solvents, where (I), (II) and (III) respectively are: ##STR00001## where R.sub.1 is a C.sub.1-C.sub.6 alkyl moiety, X=(OH) and n=2. ##STR00002## In (III), X may be CH.sub.2, sulfur or selenium, M may be Zn, Mg, or a lanthanide, and R.sub.1 and R.sub.2 each independently may be a methyl, ethyl, phenyl moiety.

  14. Theoretical studies in nuclear reactions and nuclear structure. Progress report

    SciTech Connect (OSTI)

    Not Available

    1992-05-01

    Research in the Maryland Nuclear Theory Group focusses on problems in four basic areas of current relevance. Hadrons in nuclear matter; the structure of hadrons; relativistic nuclear physics and heavy ion dynamics and related processes. The section on hadrons in nuclear matter groups together research items which are aimed at exploring ways in which the properties of nucleons and the mesons which play a role in the nuclear force are modified in the nuclear medium. A very interesting result has been the finding that QCD sum rules supply a new insight into the decrease of the nucleon`s mass in the nuclear medium. The quark condensate, which characterizes spontaneous chiral symmetry breaking of the late QCD vacuum, decreases in nuclear matter and this is responsible for the decrease of the nucleon`s mass. The section on the structure of hadrons contains progress reports on our research aimed at understanding the structure of the nucleon. Widely different approaches are being studied, e.g., lattice gauge calculations, QCD sum rules, quark-meson models with confinement and other hedgehog models. A major goal of this type of research is to develop appropriate links between nuclear physics and QCD. The section on relativistic nuclear physics represents our continuing interest in developing an appropriate relativistic framework for nuclear dynamics. A Lorentz-invariant description of the nuclear force suggests a similar decrease of the nucleon`s mass in the nuclear medium as has been found from QCD sum rules. Work in progress extends previous successes in elastic scattering to inelastic scattering of protons by nuclei. The section on heavy ion dynamics and related processes reports on research into the e{sup +}e{sup {minus}} problem and heavy ion dynamics.

  15. Theoretical studies in nuclear reactions and nuclear structure

    SciTech Connect (OSTI)

    Not Available

    1992-05-01

    Research in the Maryland Nuclear Theory Group focusses on problems in four basic areas of current relevance. Hadrons in nuclear matter; the structure of hadrons; relativistic nuclear physics and heavy ion dynamics and related processes. The section on hadrons in nuclear matter groups together research items which are aimed at exploring ways in which the properties of nucleons and the mesons which play a role in the nuclear force are modified in the nuclear medium. A very interesting result has been the finding that QCD sum rules supply a new insight into the decrease of the nucleon's mass in the nuclear medium. The quark condensate, which characterizes spontaneous chiral symmetry breaking of the late QCD vacuum, decreases in nuclear matter and this is responsible for the decrease of the nucleon's mass. The section on the structure of hadrons contains progress reports on our research aimed at understanding the structure of the nucleon. Widely different approaches are being studied, e.g., lattice gauge calculations, QCD sum rules, quark-meson models with confinement and other hedgehog models. A major goal of this type of research is to develop appropriate links between nuclear physics and QCD. The section on relativistic nuclear physics represents our continuing interest in developing an appropriate relativistic framework for nuclear dynamics. A Lorentz-invariant description of the nuclear force suggests a similar decrease of the nucleon's mass in the nuclear medium as has been found from QCD sum rules. Work in progress extends previous successes in elastic scattering to inelastic scattering of protons by nuclei. The section on heavy ion dynamics and related processes reports on research into the e{sup +}e{sup {minus}} problem and heavy ion dynamics.

  16. Direct reactions for nuclear structure and nuclear astrophysics

    SciTech Connect (OSTI)

    Jones, Katherine Louise

    2014-12-18

    Direct reactions are powerful probes for studying the atomic nucleus. Modern direct reaction studies are illuminating both the fundamental nature of the nucleus and its role in nucleosynthetic processes occurring in the cosmos. This report covers experiments using knockout reactions on neutron-deficient fragmentation beams, transfer reactions on fission fragment beams, and theoretical sensitivity studies relating to the astrophysical r-process. Results from experiments on 108,106Sn at the NSCL, and on 131Sn at HRIBF are presented as well as the results from the nucleosynthesis study.

  17. The Role of the Nuclear Reaction Data Centres in Experimental Nuclear Data Knowledge Sharing

    SciTech Connect (OSTI)

    Otuka, N.; Schwerer, O.; Otuka,N.; Dunaeva,S.; Dupont,e.; Schwerer,O.; Blokhin,A.

    2011-08-01

    The International Network of Nuclear Reaction Data Centres (NRDC) consists of 14 data centers from 10 countries and 2 international organizations, and is collaborating for compilation, exchange and dissemination of various types of nuclear reaction data information. The nuclear data centers common data collection, the EXFOR library today contains experimental information and numerical data from more than 18,000 experiments consisting of more than 134,000 data sets mainly of nuclear reaction data for incident neutrons, charged-particles and photons with incident energy lower than 1 GeV. A brief history and the current status of NRDC collaboration are presented for EXFOR as well as CINDA and ENDF.

  18. Statistical methods of spin assignment in compound nuclear reactions

    SciTech Connect (OSTI)

    Mach, H.; Johns, M.W.

    1985-01-15

    Spin assignment to nuclear levels can be obtained from standard in-beam gamma-ray spectroscopy techniques and in the case of compound nuclear reactions can be complemented by statistical methods. These are based on a correlation pattern between level spin and gamma-ray intensities feeding low-lying levels. Three types of intensity and level spin correlations are found suitable for spin assignment: shapes of the excitation functions, ratio of intensity at two beam energies or populated in two different reactions, and feeding distributions. Various empirical attempts are examined and the range of applicability of these methods as well as the limitations associated with them are given.

  19. EXFOR SYSTEMS MANUAL NUCLEAR REACTION DATA EXCHANGE FORMAT.

    SciTech Connect (OSTI)

    MCLANE,V.; NUCLEAR DATA CENTER NETWORK

    2000-05-19

    EXFOR is an exchange format designed to allow transmission of nuclear reaction data between the members of the Nuclear Data Centers Network. This document has been written for use by the members of the Network and includes matters of procedure and protocol, as well as detailed rules for the compilation of data. Users may prefer to consult EXFOR Basics' for a brief description of the format.

  20. Nuclear Structure and Nuclear Reactions | Argonne Leadership Computing

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Facility path Projections of the 3D dynamic spontaneous fission path for 264Fm on the x1-x2 plane for x3 = 0 (a) and x1-x3 plane for x2= 0 (b), where x1 is the elongation of the nucleus, x2 - triaxiality, and x3 - pairing correlations. Calculations were carried out using nuclear density functional theory. The collective action was minimized using the dynamical programing method. The dash-dotted line shows for comparison the 2D path computed without pairing fluctuations. The static

  1. Towards a More Complete and Accurate Experimental Nuclear Reaction Data Library (EXFOR). International Collaboration Between Nuclear Reaction Data Centres (NRDC)

    SciTech Connect (OSTI)

    Otuka, N.; Pritychenko, B.; Otuka, N.; Dupont, E.; Semkova, V.; Pritychenko, B.; Blokhin, A. I.; Aikawa, M.; Babykina, S.; Bossant, M.; Chen, G.; Dunaeva, S.; Forrest, R. A.; Fukahori, T.; Furutachi, N.; Ganesan, S.; Ge, Z.; Gritzay, O. O.; Herman, M.; Hlavac, S.; Kato, K.; Lalremruata, B.; Lee, Y. O.; Makinaga, A.; Matsumoto, K.; Mikhaylyukova, M.; Pikulina, G.; Pronyaev, V. G.; Saxena, A.; Schwerer, O.; Simakov, S. P.; Soppera, N.; Suzuki, R.; Takacs, S.; Tao, X.; Taova, S.; Tarkanyi, F.; Varlamov, V. V.; Wang, J.; Yang, S. C.; Zerkin, V.; Zhuang, Y.

    2014-06-01

    The International Network of Nuclear Reaction Data Centres (NRDC) coordinated by the IAEA Nuclear Data Section (NDS) successfully collaborates in the maintenance and development of the EXFOR library. Likewise, as the scope of published data expands (e.g. to higher energy, to heavier projectile) to meet the needs of research and applications, it has become a challenging task to maintain both the completeness and accuracy of the EXFOR library. Evolution of the library highlighting recent developments is described.

  2. Towards a More Complete and Accurate Experimental Nuclear Reaction Data Library (EXFOR): International Collaboration Between Nuclear Reaction Data Centres (NRDC)

    SciTech Connect (OSTI)

    Otuka, N.; Dupont, E.; Semkova, V.; Pritychenko, B.; Blokhin, A.I.; Aikawa, M.; Babykina, S.; Bossant, M.; Chen, G.; Dunaeva, S.; Forrest, R.A.; Fukahori, T.; Furutachi, N.; Ganesan, S.; Ge, Z.; Gritzay, O.O.; Herman, M.; Hlavač, S.; and others

    2014-06-15

    The International Network of Nuclear Reaction Data Centres (NRDC) coordinated by the IAEA Nuclear Data Section (NDS) successfully collaborates in the maintenance and development of the EXFOR library. As the scope of published data expands (e.g. to higher energy, to heavier projectile) to meet the needs of research and applications, it has become a challenging task to maintain both the completeness and accuracy of the EXFOR library. Evolution of the library highlighting recent developments is described.

  3. Do nuclear reactions take place under chemical stimulation?

    SciTech Connect (OSTI)

    Bockris, J.O.; Lin, G.H.; Bush, R.T.

    1996-09-01

    Several examples of nuclear reactions occurring under the stimulation of chemical type energies are given. The production of tritium from deuterium in Pd has more than 100 published confirmations. Three models suggest circumstances such that barriers between nucleii may become transparent. 24 refs.

  4. Sigma: Web Retrieval Interface for Nuclear Reaction Data

    SciTech Connect (OSTI)

    Pritychenko,B.; Sonzogni, A.A.

    2008-06-24

    The authors present Sigma, a Web-rich application which provides user-friendly access in processing and plotting of the evaluated and experimental nuclear reaction data stored in the ENDF-6 and EXFOR formats. The main interface includes browsing using a periodic table and a directory tree, basic and advanced search capabilities, interactive plots of cross sections, angular distributions and spectra, comparisons between evaluated and experimental data, computations between different cross section sets. Interactive energy-angle, neutron cross section uncertainties plots and visualization of covariance matrices are under development. Sigma is publicly available at the National Nuclear Data Center website at www.nndc.bnl.gov/sigma.

  5. Fusion reactions in nuclear astrophysics: The MUSIC approach

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    reactions in nuclear astrophysics: The MUSIC approach The MUSIC approach Sergio Almaraz-Calderon Sergio Almaraz-Calderon Physics Division Argonne National Laboratory 2014 ATLAS USER'S MEETING 05/15/2014 Carbon burning reactions in the stars Carbon burning in massive stars Ignition phase of Type Ia supernovae X-ray binaries NASA/CXC/PSU/L University of Chicago Flash Center S. Almaraz-Calderon ATLAS user's meeting 05/15/2014 H. Schatz X-Ray Bursts and Superbursts ● H and He burning (rp-process)

  6. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOE Patents [OSTI]

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  7. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    SciTech Connect (OSTI)

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  8. Experimental Observation of Nuclear Reactions in Palladium and Uranium

    SciTech Connect (OSTI)

    J. Dufour; D. Murat; X. Dufour; J. Foos

    2001-11-12

    By submitting various metals (Pd, U) containing hydrogen (from 2000 to 700 000 atoms of hydrogen for 1 000 000 atoms of the host metal) to the combined action of electrical currents and magnetic fields, we have observed a sizeable exothermal effect (from 0.1 to 8 W for 500 mg of metal used). This effect is beyond experimental errors, the energy output being typically 130 to 250{percent} of the energy input and not of chemical origin (exothermal effect in the range of 7000 MJ/mol of metal in the case of palladium and of 60 MJ/mol in the case of uranium). New chemical species also appear in the processes metals. It has been shown by a QED calculation that resonances of long lifetime (s), nuclear dimensions (fm), and low energy of formation (eV) could exist. This concept seems to look like the 'shrunken hydrogen atoms' proposed by various authors. It is indeed very different in two ways (a) being a metastable state, it needs energy to be formed (a few eV) and reverts to normal hydrogen after a few seconds, liberating back its energy of formation (it is thus not the source of the energy observed); (b) its formation can be described as the electron spin/proton nuclear spin interaction becoming first order in the lattice environment (whereas it is third order in a normal hydrogen atom). Moreover, we consider that the hydrex cannot yield a neutron because this reaction is strongly endothermic. To explain our results, we put forward the following working hypothesis: In a metal lattice and under proper conditions, the formation of such resonances (metastable state) could be favored. We propose to call them HYDREX, and we assume that they are actually formed in cold fusion (CF) and low-energy nuclear reaction (LENR) experiments. Once formed, a number of HYDREX could gather around a nucleus of the lattice to form a cluster of nuclear size and of very long life time compared to nuclear time (10{sup -22} s). In this cluster, nuclear rearrangements could take place, yielding

  9. Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

    DOE Patents [OSTI]

    Chen, Xian; Gupta, Goutam; Bradbury, E. Morton

    2001-01-01

    Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

  10. Ab Initio Nuclear Structure and Reaction Calculations for Rare Isotopes

    SciTech Connect (OSTI)

    Draayer, Jerry P.

    2014-09-28

    We have developed a novel ab initio symmetry-adapted no-core shell model (SA-NCSM), which has opened the intermediate-mass region for ab initio investigations, thereby providing an opportunity for first-principle symmetry-guided applications to nuclear structure and reactions for nuclear isotopes from the lightest p-shell systems to intermediate-mass nuclei. This includes short-lived proton-rich nuclei on the path of X-ray burst nucleosynthesis and rare neutron-rich isotopes to be produced by the Facility for Rare Isotope Beams (FRIB). We have provided ab initio descriptions of high accuracy for low-lying (including collectivity-driven) states of isotopes of Li, He, Be, C, O, Ne, Mg, Al, and Si, and studied related strong- and weak-interaction driven reactions that are important, in astrophysics, for further understanding stellar evolution, X-ray bursts and triggering of s, p, and rp processes, and in applied physics, for electron and neutrino-nucleus scattering experiments as well as for fusion ignition at the National Ignition Facility (NIF).

  11. Probing Nuclear Reactions in Stars | U.S. DOE Office of Science (SC)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Probing Nuclear Reactions in Stars Nuclear Physics (NP) NP Home About Research Facilities Science Highlights Benefits of NP Funding Opportunities Nuclear Science Advisory Committee (NSAC) Community Resources Contact Information Nuclear Physics U.S. Department of Energy SC-26/Germantown Building 1000 Independence Ave., SW Washington, DC 20585 P: (301) 903-3613 F: (301) 903-3833 E: Email Us More Information » 11.01.15 Probing Nuclear Reactions in Stars Novel experiments measure unusual

  12. A comparative analysis of accident risks in fossil, hydro, and nuclear energy chains

    SciTech Connect (OSTI)

    Burgherr, P.; Hirschberg, S.

    2008-07-01

    This study presents a comparative assessment of severe accident risks in the energy sector, based on the historical experience of fossil (coal, oil, natural gas, and LPG (Liquefied Petroleum Gas)) and hydro chains contained in the comprehensive Energy-related Severe Accident Database (ENSAD), as well as Probabilistic Safety Assessment (PSA) for the nuclear chain. Full energy chains were considered because accidents can take place at every stage of the chain. Comparative analyses for the years 1969-2000 included a total of 1870 severe ({>=} 5 fatalities) accidents, amounting to 81,258 fatalities. Although 79.1% of all accidents and 88.9% of associated fatalities occurred in less developed, non-OECD countries, industrialized OECD countries dominated insured losses (78.0%), reflecting their substantially higher insurance density and stricter safety regulations. Aggregated indicators and frequency-consequence (F-N) curves showed that energy-related accident risks in non-OECD countries are distinctly higher than in OECD countries. Hydropower in non-OECD countries and upstream stages within fossil energy chains are most accident-prone. Expected fatality rates are lowest for Western hydropower and nuclear power plants; however, the maximum credible consequences can be very large. Total economic damages due to severe accidents are substantial, but small when compared with natural disasters. Similarly, external costs associated with severe accidents are generally much smaller than monetized damages caused by air pollution.

  13. Resilience of nuclear matter in light ion induced reactions

    SciTech Connect (OSTI)

    Colonna, M.; Cugnon, J.; Pollacco, E.C.

    1997-03-01

    Cavitation and heating of the target nucleus in the first instances of {sup 3}He-induced collisions in the GeV/nucleon range are investigated in an intranuclear cascade model for the formation of this structure and a stochastic one-body dynamics calculation to study its evolution. The hard collisions having essentially ceased when the structure is fully developed, the latter model is particularly suited to study the possible breakup of the system. It is shown, however, that the target recovers a spherical shape rather rapidly, and has thus a good chance to decay by standard evaporation, justifying the use of a cascade + evaporation model to analyze the data. It is also shown that the system has to be much more modified to break up into pieces instead of recovering a compact shape: in these reactions, it is thus expected that nuclear matter is resilient to shape deformation and thermal excitation. Arguments are given to explain that expansion of the system, not important in these reactions, is required to overcome this resilience. {copyright} {ital 1997} {ital The American Physical Society}

  14. Solving The Long-Standing Problem Of Low-Eneregy Nuclear Reactions...

    Office of Scientific and Technical Information (OSTI)

    Eneregy Nuclear Reactions At The Highest Microscopic Level: Annual Continuation And Progress Report Citation Details In-Document Search Title: Solving The Long-Standing Problem Of ...

  15. Nuclear Reaction Cross Sections Database at BNL | U.S. DOE Office of

    Office of Science (SC) Website

    Science (SC) Reaction Cross Sections Database at BNL Nuclear Physics (NP) NP Home About Research Facilities Science Highlights Benefits of NP Applications of Nuclear Science Applications of Nuclear Science Archives Small Business Innovation Research / Small Business Technology Transfer Funding Opportunities Nuclear Science Advisory Committee (NSAC) Community Resources Contact Information Nuclear Physics U.S. Department of Energy SC-26/Germantown Building 1000 Independence Ave., SW

  16. Estimation of Nuclear Reaction Effects in Proton-Tissue-Dose Calculations.

    Energy Science and Technology Software Center (OSTI)

    1983-01-14

    Version 00 REPC reviews calculational methods for the estimation of dose from external proton exposure of arbitrary convex bodies and presents the necessary information for the estimation of dose in soft tissue. The effects of nuclear reactions, especially in relation to the dose equivalent, are retained. REPC subroutines can be used to convert existing computer programs which neglect nuclear reaction effects to include them.

  17. Establishing a value chain for human factors in nuclear power plantcontrol room modernization

    SciTech Connect (OSTI)

    Joe, Jeffrey Clark; Thomas, Kenneth David; Boring, Ronald Laurids

    2015-07-01

    Commercial nuclear power plants in the United States (U.S.) have operated reliably and efficiently for decades. With the life extensions of plants now being planned for operation beyond their original operating licenses, there are opportunities to achieve even greater efficiencies, while maintaining high operational reliabilities, with strategic, risk- and economically-informed, upgrades to plant systems and infrastructure. The U.S. Department of Energy’s Light Water Reactor Sustainability (LWRS) program supports the commercial nuclear industry’s modernization efforts through research and development (R&D) activities across many areas to help establish the technical and economic bases for modernization activities. The Advanced Instrumentation, Information, and Control Systems Technologies pathway is one R&D focus area for the LWRS program, and has researchers at Idaho National Laboratory working with select utility partners to use human factors and instrumentation and controls R&D to help modernize the plant’s main control room. However, some in the nuclear industry have not been as enthusiastic about using human factors R&D to inform life extension decision making. Part of the reason for this may stem from uncertainty decision-makers have regarding how human factors fits into the value chain for nuclear power plant control room modernization. This paper reviews past work that has attempted to demonstrate the value of human factors, and then describes the value chain concept, how it applies to control room modernization, and then makes a case for how and why human factors is an essential link in the modernization value chain.

  18. Modeled Neutron Induced Nuclear Reaction Cross Sections for Radiochemistry in the region of Iriduim and Gold

    SciTech Connect (OSTI)

    Hoffman, R D; Dietrich, F S; Kelley, K; Escher, J; Bauer, R; Mustafa, M

    2008-02-26

    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron induced nuclear reaction cross sections for targets ranging from osmium (Z = 76) to gold (Z = 79). Of particular interest are the cross sections on Ir and Au including reactions on isomeric targets.

  19. Uncovering Special Nuclear Materials by Low-energy Nuclear Reaction Imaging

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Rose, P. B.; Erickson, A. S.; Mayer, M.; Nattress, J.; Jovanovic, I.

    2016-04-18

    Weapons-grade uranium and plutonium could be used as nuclear explosives with extreme destructive potential. The problem of their detection, especially in standard cargo containers during transit, has been described as “searching for a needle in a haystack” because of the inherently low rate of spontaneous emission of characteristic penetrating radiation and the ease of its shielding. Currently, the only practical approach for uncovering well-shielded special nuclear materials is by use of active interrogation using an external radiation source. However, the similarity of these materials to shielding and the required radiation doses that may exceed regulatory limits prevent this method frommore » being widely used in practice. We introduce a low-dose active detection technique, referred to as low-energy nuclear reaction imaging, which exploits the physics of interactions of multi-MeV monoenergetic photons and neutrons to simultaneously measure the material’s areal density and effective atomic number, while confirming the presence of fissionable materials by observing the beta-delayed neutron emission. For the first time, we demonstrate identification and imaging of uranium with this novel technique using a simple yet robust source, setting the stage for its wide adoption in security applications.« less

  20. Equation of state of hot polarized nuclear matter and heavy-ion fusion reactions

    SciTech Connect (OSTI)

    Ghodsi, O. N.; Gharaei, R.

    2011-08-15

    We employ the equation of state of hot polarized nuclear matter to simulate the repulsive force caused by the incompressibility effects of nuclear matter in the fusion reactions of heavy colliding ions. The results of our studies reveal that temperature effects of compound nuclei have significant importance in simulating the repulsive force on the fusion reactions for which the temperature of the compound nucleus increases up to about 2 MeV. Since the equation of state of hot nuclear matter depends upon the density and temperature of the nuclear matter, it has been suggested that, by using this equation of state, one can simulate simultaneously both the effects of the precompound nucleons' emission and the incompressibility of nuclear matter to calculate the nuclear potential in fusion reactions within a static formalism such as the double-folding (DF) model.

  1. High temperature spin dynamics in linear magnetic chains, molecular rings, and segments by nuclear magnetic resonance

    SciTech Connect (OSTI)

    Adelnia, Fatemeh; Lascialfari, Alessandro; Mariani, Manuel; Ammannato, Luca; Caneschi, Andrea; Rovai, Donella; Winpenny, Richard; Timco, Grigore; Corti, Maurizio Borsa, Ferdinando

    2015-05-07

    We present the room temperature proton nuclear magnetic resonance (NMR) nuclear spin-lattice relaxation rate (NSLR) results in two 1D spin chains: the Heisenberg antiferromagnetic (AFM) Eu(hfac){sub 3}NITEt and the magnetically frustrated Gd(hfac){sub 3}NITEt. The NSLR as a function of external magnetic field can be interpreted very well in terms of high temperature spin dynamics dominated by a long time persistence of the decay of the two-spin correlation function due to the conservation of the total spin value for isotropic Heisenberg chains. The high temperature spin dynamics are also investigated in Heisenberg AFM molecular rings. In both Cr{sub 8} closed ring and in Cr{sub 7}Cd and Cr{sub 8}Zn open rings, i.e., model systems for a finite spin segment, an enhancement of the low frequency spectral density is found consistent with spin diffusion but the high cut-off frequency due to intermolecular anisotropic interactions prevents a detailed analysis of the spin diffusion regime.

  2. Proton Reaction Data Library for Nuclear Activation (Medium Energy Nuclear Data Library.)

    Energy Science and Technology Software Center (OSTI)

    2002-03-01

    Version 00 GROUPXS does file handling and processing of the double-differential continuum-emission cross sections stored in the new MF6 format of ENDF/VI. It treats the energy-angle data that are supposed to be represented by a Legendre-polynomial expansion in the center-of-mass system and can do the following: (1) Conversion of MF6 data from center-of-mass system to the laboratory system, with the possibility to continue the calculation with the options (2), (3), and (4). (2) Conversion ofmore » Legendre-polynomial representation into point-wise angular data, in MF6 format. (3) Conversion of data from MF6 into MF4 + MF5 (ENDF-V). (4) Calculation of group constants, scattering matrices and transfer matrices for arbitrary group structures with a fusion micro-flux weighting spectrum (PN-approximation). The code treats only continuum reaction types that are stored in the MF6 format with the restrictions as specified for the European Fusion File (EFF1). These restrictions are not inconvenient for the purpose of fusion neutronics calculations and they facilitate relatively simple processing . This neutron reaction data library can be used for nuclear activation and transmutation applications at energies up to 100 MeV.« less

  3. Solving The Long-Standing Problem Of Nuclear Reactions At The...

    Office of Scientific and Technical Information (OSTI)

    Long-Standing Problem Of Nuclear Reactions At The Highest Microscopic Level: Annual Continuation And Progress Report Citation Details In-Document Search Title: Solving The Long-Sta...

  4. Solving The Long-Standing Problem Of Low-Eneregy Nuclear Reactions...

    Office of Scientific and Technical Information (OSTI)

    Solving The Long-Standing Problem Of Low-Eneregy Nuclear Reactions At The Highest ... Citation Details In-Document Search Title: Solving The Long-Standing Problem Of ...

  5. Solving The Long-Standing Problem Of Low-Energy Nuclear Reactions...

    Office of Scientific and Technical Information (OSTI)

    Solving The Long-Standing Problem Of Low-Energy Nuclear Reactions At The Highest ... Citation Details In-Document Search Title: Solving The Long-Standing Problem Of Low-Energy ...

  6. Summary Report of the Workshop on The Experimental Nuclear Reaction Data Database

    SciTech Connect (OSTI)

    Semkova, V.; Pritychenko, B.

    2014-10-10

    The Workshop on the Experimental Nuclear Reaction Data Database (EXFOR) was held at IAEA Headquarters in Vienna from 6 to 10 October 2014. The workshop was organized to discuss various aspects of the EXFOR compilation process including compilation rules, different techniques for nuclear reaction data measurements, software developments, etc. A summary of the presentations and discussions that took place during the workshop is reported here.

  7. Study of components and statistical reaction mechanism in simulation of nuclear process for optimized production of {sup 64}Cu and {sup 67}Ga medical radioisotopes using TALYS, EMPIRE and LISE++ nuclear reaction and evaporation codes

    SciTech Connect (OSTI)

    Nasrabadi, M. N. Sepiani, M.

    2015-03-30

    Production of medical radioisotopes is one of the most important tasks in the field of nuclear technology. These radioactive isotopes are mainly produced through variety nuclear process. In this research, excitation functions and nuclear reaction mechanisms are studied for simulation of production of these radioisotopes in the TALYS, EMPIRE and LISE++ reaction codes, then parameters and different models of nuclear level density as one of the most important components in statistical reaction models are adjusted for optimum production of desired radioactive yields.

  8. LDRD Final Report: Surrogate Nuclear Reactions and the Origin of the Heavy Elements (04-ERD-057)

    SciTech Connect (OSTI)

    Escher, J E; Bernstein, L A; Bleuel, D; Burke, J; Church, J A; Dietrich, F S; Forssen, C; Gueorguiev, V; Hoffman, R D

    2007-02-23

    Research carried out in the framework of the LDRD project ''Surrogate Nuclear Reactions and the Origin of the Heavy Elements'' (04-ERD-057) is summarized. The project was designed to address the challenge of determining cross sections for nuclear reactions involving unstable targets, with a particular emphasis on reactions that play a key role in the production of the elements between Iron and Uranium. This report reviews the motivation for the research, introduces the approach employed to address the problem, and summarizes the resulting scientific insights, technical findings, and related accomplishments.

  9. EXTENSION OF THE NUCLEAR REACTION MODEL CODE EMPIRE TO ACTINIDES NUCLEAR DATA EVALUATION.

    SciTech Connect (OSTI)

    CAPOTE,R.; SIN, M.; TRKOV, A.; HERMAN, M.; CARLSON, B.V.; OBLOZINSKY, P.

    2007-04-22

    Recent extensions and improvements of the EMPIRE code system are outlined. They add new capabilities to the code, such as prompt fission neutron spectra calculations using Hauser-Feshbach plus pre-equilibrium pre-fission spectra, cross section covariance matrix calculations by Monte Carlo method, fitting of optical model parameters, extended set of optical model potentials including new dispersive coupled channel potentials, parity-dependent level densities and transmission through numerically defined fission barriers. These features, along with improved and validated ENDF formatting, exclusive/inclusive spectra, and recoils make the current EMPIRE release a complete and well validated tool for evaluation of nuclear data at incident energies above the resonance region. The current EMPIRE release has been used in evaluations of neutron induced reaction files for {sup 232}Th and {sup 231,233}Pa nuclei in the fast neutron region at IAEA. Triple-humped fission barriers and exclusive pre-fission neutron spectra were considered for the fission data evaluation. Total, fission, capture and neutron emission cross section, average resonance parameters and angular distributions of neutron scattering are in excellent agreement with the available experimental data.

  10. Dynamical dipole mode in fusion reactions with exotic nuclear beams

    SciTech Connect (OSTI)

    Baran, V.; Rizzo, C.; Colonna, M.; Toro, M. Di; Pierroutsakou, D.

    2009-02-15

    We report the properties of the prompt dipole radiation, produced via a collective bremsstrahlung mechanism, in fusion reactions with exotic beams. We show that the {gamma} yield is sensitive to the density dependence of the symmetry energy below/around saturation. Moreover, we find that the angular distribution of the emitted photons from such fast collective mode can represent a sensitive probe of its excitation mechanism and of fusion dynamics in the entrance channel.

  11. Experimental study of nuclear fusion reactions in muonic molecular systems

    SciTech Connect (OSTI)

    Bogdanova, L. N.

    2013-03-15

    Since the pioneering discovery of the muon catalysis by Alvarez [L. W. Alvarez, K. Brander, F. S. Crawford, et al., Phys. Rev. 105, 1127 (1957)], considerable efforts were aimed at observation of various fusion processes. Results of these studies facilitated understanding the properties of lightest nuclei and dynamics of low-energy fusion reactions. There still remain unsolved theoretical and experimental problems, especially in case of pt fusion.

  12. Coulomb reacceleration as a clock for nuclear reactions -- II

    SciTech Connect (OSTI)

    Bertulani, C.A.; Bertsch, G.F.

    1994-03-01

    Reacceleration effects in the Coulomb breakup of nuclei are modeled with the two-dimensional time-dependent Schroedinger equation, extending a previous one-dimensional study. The present model better describes the individual contributions of longitudinal and transverse forces to the breakup and reacceleration. Reacceleration effects are found to preserve a strong memory of the pre-breakup phase of the reaction, as was concluded with the one-dimensional model.

  13. Low-Energy Nuclear Reactions of Protons in Host Metals at Picometre Distance

    SciTech Connect (OSTI)

    Heinrich Hora; George H. Miley; Jak C. Kelly

    2000-11-12

    A review is given for the explanation of the measurements of Miley et al. of a fully reproducible generation of nuclei of the whole periodic table by protons in host metals during a several-weeks reaction. Similar low-energy nuclear reactions (LENR) were observed by other groups. The fact that the heavy nuclides are not due to pollution can be seen from the fact that such very rare elements as thulium and terbium were detected by unique K-shell X-ray spectra. The nuclear reaction energy goes into the heavy nuclei as measured from much bigger traces in CR39 than from alphas. The fact that any reaction of the protons results in stable daughter nuclei is confirmed by the fact that the highest energy gain is resulting with stable reaction products. This has been explained in Ref. 2, and the energy gain for the heavy element generation by a compound reaction was discussed. The explanation is based on the model of the authors from 1989 to assume free motion of the protons contrary to localized crystalline states. A relation of the reaction time U on distance d of the reacting nuclei by a power law with an exponent 34.8 was derived. Based on few reproducible D-D reactions, a reaction time near the range of megaseconds and a reaction distance of nanometers was concluded. A splendid confirmation of the picometre-megasecond reactions was achieved by Li et al. from his direct quantum mechanical calculations of the hot fusion D-T reactions based on a one-step selective resonance tunneling model. Li et al. were able for the first time to derive the cross sections of the hot fusion. Li's application to picometre distance showed megasecond reaction times with no neutron or gamma emission. Because of the imaginary part in the Schroedinger potential, the problem of the level width is reduced by damping.

  14. Examining Supply Chain Resilience for the Intermodal Shipment of Spent Nuclear Fuel and High Level Radioactive Materials

    SciTech Connect (OSTI)

    Peterson, Steven K

    2016-01-01

    The U.S. Department of Energy (DOE) has a significant programmatic interest in the safe and secure routing and transportation of Spent Nuclear Fuel (SNF) and High Level Waste (HLW) in the United States, including shipments entering the country from locations outside U.S borders. In any shipment of SNF/HLW, there are multiple chains; a jurisdictional chain as the material moves between jurisdictions (state, federal, tribal, administrative), a physical supply chain (which mode), as well as a custody chain (which stakeholder is in charge/possession) of the materials being transported. Given these interconnected networks, there lies vulnerabilities, whether in lack of communication between interested stakeholders or physical vulnerabilities such as interdiction. By identifying key links and nodes as well as administrative weaknesses, decisions can be made to harden the physical network and improve communication between stakeholders. This paper examines the parallel chains of oversight and custody as well as the chain of stakeholder interests for the shipments of SNF/HLW and the potential impacts on systemic resiliency. Using the Crystal River shutdown location as well as a hypothetical international shipment brought into the United States, this paper illustrates the parallel chains and maps them out visually.

  15. Tracking of Ions Produced at Near Barrier Energies in Nuclear Reactions

    SciTech Connect (OSTI)

    Shapira, Dan

    2010-01-01

    Examples of detectors, presently in use, for tracking products from nuclear reactions induced by radioactive ion beams are described. A new tracking detector is being designed to study the binary products from reactions induced by heavy neutron-rich radioactive ion beams on heavy neutron-rich target nuclei. The motivation for such studies and the features designed to accomplish this goal will be presented.

  16. Refined scenario of standard Big Bang nucleosynthesis allowing for nonthermal nuclear reactions in the primordial plasma

    SciTech Connect (OSTI)

    Voronchev, Victor T.; Nakao, Yasuyuki; Nakamura, Makoto; Tsukida, Kazuki [Institute of Nuclear Physics, Moscow State University, Moscow 119991 (Russian Federation); Department of Applied Quantum Physics and Nuclear Engineering, Kyushu University, Motooka, Fukuoka 819-0395 (Japan); Division of Advanced Plasma Research, Japan Atomic Energy Agency, 2-166 Oaza-Obuchi-Aza-Omotedate, Rokkasho, Kamikita, Aomori 039-3212 (Japan); Department of Applied Quantum Physics and Nuclear Engineering, Kyushu University, Motooka, Fukuoka 819-0395 (Japan)

    2012-11-12

    The standard scenario of big bang nucleosynthesis (BBN) is generalized to take into account nonthermal nuclear reactions in the primordial plasma. These reactions are naturally triggered in the BBN epoch by fast particles generated in various exoergic processes. It is found that, although such particles can appreciably enhance the rates of some individual reactions, their influence on the whole process of element production is not significant. The nonthermal corrections to element abundances are obtained to be 0.1% ({sup 3}H), -0.03% ({sup 7}Li), and 0.34 %-0.63% (CNO group).

  17. Cross-checking of Large Evaluated and Experimental Nuclear Reaction Databases

    SciTech Connect (OSTI)

    Zeydina, O.; Koning, A.J.; Soppera, N.; Raffanel, D.; Bossant, M.; Dupont, E.; Beauzamy, B.

    2014-06-15

    Automated methods are presented for the verification of large experimental and evaluated nuclear reaction databases (e.g. EXFOR, JEFF, TENDL). These methods allow an assessment of the overall consistency of the data and detect aberrant values in both evaluated and experimental databases.

  18. Enrico Fermi and the First Self-Sustaining Nuclear Chain Reaction

    Office of Scientific and Technical Information (OSTI)

    about Enrico Fermi and his work is available in full-text DOE reports and on the Web. ... FGST (Fermi Gamma-ray Space Telescope) Remembering Fermi (video) Top Additional Web Pages: ...

  19. Towards a nonequilibrium Green's function description of nuclear reactions: One-dimensional mean-field dynamics

    SciTech Connect (OSTI)

    Rios, Arnau; Barker, Brent; Buchler, Mark; Danielewicz, Pawel

    2011-05-15

    Research Highlights: > Dynamics of central nuclear reactions. > Nonequilibrium Green's functions and Kadanoff-Baym formalism. > Adiabatic switching on of interactions. > Mean-field time evolution of nuclear slabs. > Off-diagonal spatial structure of a collision density matrix. - Abstract: Nonequilibrium Green's function methods allow for an intrinsically consistent description of the evolution of quantal many-body body systems, with inclusion of different types of correlations. In this paper, we focus on the practical developments needed to build a Green's function methodology for nuclear reactions. We start out by considering symmetric collisions of slabs in one dimension within the mean-field approximation. We concentrate on two issues of importance for actual reaction simulations. First, the preparation of the initial state within the same methodology as for the reaction dynamics is demonstrated by an adiabatic switching on of the mean-field interaction, which leads to the mean-field ground state. Second, the importance of the Green's function matrix-elements far away from the spatial diagonal is analyzed by a suitable suppression process that does not significantly affect the evolution of the elements close to the diagonal. The relative lack of importance of the far-away elements is tied to system expansion. We also examine the evolution of the Wigner function and verify quantitatively that erasing of the off-diagonal elements corresponds to averaging out of the momentum-space details in the Wigner function.

  20. Experimental Observation of Nuclear Reactions in Palladium and Uranium - Possible Explanation by Hydrex Mode

    SciTech Connect (OSTI)

    Dufour, J.; Murat, D.; Dufour, X.; Foos, J

    2001-07-15

    Experiments with uranium are presented that show a highly exothermal reaction, which can only be of nuclear origin. One striking point of these results is that they clearly show that what is being observed is not some kind of fusion reaction of the deuterium present (only exceedingly small amounts of it are present). This is a strong indication that hydrogen can trigger nuclear reactions that seem to involve the nuclei of the lattice (which would yield a fission-like pattern of products). Confronted with a situation where some experiments in the field yield a fusion-like pattern of products (CF experiments) and others a fissionlike one (LENR experiments), one can reasonably wonder whether one is not observing two aspects of the same phenomenon. Thus, it is proposed to describe CF and LENR reactions as essentially the same phenomenon based on the possible existence of a still hypothetical proton/electron resonance, which would catalyze fissionlike reactions with a neutron sink. Finally, a series of experiments is proposed to assess this hypothesis.

  1. Level density inputs in nuclear reaction codes and the role of the spin cutoff parameter

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Voinov, A. V.; Grimes, S. M.; Brune, C. R.; Burger, A.; Gorgen, A.; Guttormsen, M.; Larsen, A. C.; Massey, T. N.; Siem, S.

    2014-09-03

    Here, the proton spectrum from the 57Fe(α,p) reaction has been measured and analyzed with the Hauser-Feshbach model of nuclear reactions. Different input level density models have been tested. It was found that the best description is achieved with either Fermi-gas or constant temperature model functions obtained by fitting them to neutron resonance spacing and to discrete levels and using the spin cutoff parameter with much weaker excitation energy dependence than it is predicted by the Fermi-gas model.

  2. Nuclear reaction products that would appear if substantial cold fusion occurred

    SciTech Connect (OSTI)

    Mueller, D.; Grisham, L.R. . Plasma Physics Lab.)

    1989-11-01

    This paper reports on recent claims of net energy production by cold fusion that have prompted an examination of all the positive Q value, two-body nuclear reactions that might result from the fusion of any of the isotopes in the apparatus used by Fleischmann and Pons. Any energy production that may result from cold fusion would be accompanied by copious production of nuclear reaction products (on the order of 10{sup 13}/s). Furthermore, the elementary properties of the alpha particle at the deuteron + deuteron threshold are discussed. An important property of the alpha at this high excitation is its nearly prompt (10{sup {minus}20} s) decay by particle emission to {sup 3}He + n or triton + proton.

  3. Using Nuclear Fusion Reactions to Peer Inside the Core of a Dense Hot

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Plasma | U.S. DOE Office of Science (SC) Using Nuclear Fusion Reactions to Peer Inside the Core of a Dense Hot Plasma Fusion Energy Sciences (FES) FES Home About Research Facilities Science Highlights Benefits of FES Funding Opportunities Fusion Energy Sciences Advisory Committee (FESAC) Community Resources Contact Information Fusion Energy Sciences U.S. Department of Energy SC-24/Germantown Building 1000 Independence Ave., SW Washington, DC 20585 P: (301) 903-4941 F: (301) 903-8584 E: Email

  4. Advancing the Theory of Nuclear Reactions with Rare Isotopes: From the Laboratory to the Cosmos

    SciTech Connect (OSTI)

    Elster, Charlotte

    2015-06-01

    The mission of the TORUS Topical Collaboration is to develop new methods that will advance nuclear reaction theory for unstable isotopes by using three-body techniques to improve direct-reaction calculations, and, by using a new partial-fusion theory, to integrate descriptions of direct and compound-nucleus reactions. Ohio University concentrates its efforts on the first part of the mission. Since direct measurements are often not feasible, indirect methods, e.g. (d,p) reactions, should be used. Those (d,p) reactions may be viewed as three-body reactions and described with Faddeev techniques. Faddeev equations in momentum space have a long tradition of utilizing separable interactions in order to arrive at sets of coupled integral equations in one variable. While there exist several separable representations for the nucleon-nucleon interaction, the optical potential between a neutron (proton) and a nucleus is not readily available in separable form. For this reason we first embarked in introducing a separable representation for complex phenomenological optical potentials of Woods-Saxon type.

  5. Coupled-Channels Density-Matrix Approach to Low-Energy Nuclear Reaction Dynamics

    SciTech Connect (OSTI)

    Diaz-Torres, Alexis

    2011-10-28

    Atomic nuclei are complex, quantum many-body systems whose structure manifests itself through intrinsic quantum states associated with different excitation modes or degrees of freedom. Collective modes (vibration and/or rotation) dominate at low energy (near the ground-state). The associated states are usually employed, within a truncated model space, as a basis in (coherent) coupled channels approaches to low-energy reaction dynamics. However, excluded states can be essential, and their effects on the open (nuclear) system dynamics are usually treated through complex potentials. Is this a complete description of open system dynamics? Does it include effects of quantum decoherence? Can decoherence be manifested in reaction observables? In this contribution, I discuss these issues and the main ideas of a coupled-channels density-matrix approach that makes it possible to quantify the role and importance of quantum decoherence in low-energy nuclear reaction dynamics. Topical applications, which refer to understanding the astrophysically important collision {sup 12}C+{sup 12}C and achieving a unified quantum dynamical description of relevant reaction processes of weakly-bound nuclei, are highlighted.

  6. Evaluated Nuclear (reaction) Data from the Evaluated Nuclear Data File (ENDF)

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    The ENDF libraries are a collection of documented data evaluations stored in a defined computer-readable format that can be used as the main input to nuclear data processing programs. An evaluation is the process of analyzing experimentally measured cross-section data, combining them with the predictions of nuclear model calculations, and attempting to extract the true value of a cross section. Parameterization and reduction of the data to tabular form produces an evaluated data set. If a written description of the preparation of a unique data set from the data sources is available, the data set is referred to as a documented evaluation. The data sets contained on the ENDF/B library are those chosen by CSEWG from evaluations submitted for review. The choice is made on the basis of requirements for applications, conformance of the evaluation to the formats and procedures, and performance in testing. The data set that represents a particular material may change when (1) new significant experimental results become available, (2) integral tests show that the data give erroneous results, or (3) user's requirements indicate a need for more accurate data and/or better representations of the data for a particular material. New or revised data sets are included in new releases of the ENDF/B library. ENDF/B data sets are revised or replaced only after extensive review and testing. This allows them to be used as standard reference data during the lifetime of the particular ENDF/B version. (This information is copied from the ENDF- 6 Formats Manual, Data Formats and Procedures for the Evaluated Nuclear Data File ENDF/B-VI and ENDF/B-VII, Document ENDF-102, Report BNL-NCS-44945-05-Rev.) The current version is ENDF/B VII.0, released in 2006. Users can search ENDF via specialized interfaces, browse sub-libraries or download them as zipped files. Data plots can be generated through the Sigma interface. The ENDF web page also provides access to covariance data processing and plots

  7. Low-energy RI beam technology and nuclear clusters in the explosive pp-chain breakout process

    SciTech Connect (OSTI)

    Kubono, S. [Institute of Modern Physics, Chinese Academy of Sciences, Nanchang Road 509, Lanzhou 73000 (China); RIKEN Nishina Center, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Center for Nuclear Study, University of Tokyo, 2-1 Hirosawa, Wako, Saitama 351-0 (Japan); Yamaguchi, H.; Kahl, D. M.; Ohshiro, Y.; Watanabe, S.; Yamazaki, N. [Center for Nuclear Study, University of Tokyo, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Teranishi, T. [Department of Physics, Kyushu University, 6-10-1 Hakozaki, Fukuoka 812-858 (Japan); Yanagisawa, Y.; Wakabayashi, Y.; Kase, M. [RIKEN Nishina Center, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Hayakawa, S. [Laboratori Nazionali del Sud, Istituto Nazionale di Fisica Nucleare, Via S. Sofia 62, 95125 Catania (Italy); Kwon, Y. K. [Institute for Basic Science, 70, Yuseong-daero 1689-gil, Yuseong-gu, Daejeon 305-81 (Korea, Republic of); Hashimoto, T.; Fukuda, Y. [Research Center for Nuclear Physics, Osaka University, 10-1 Mihogaoka, Ibaraki, Osaka 567-0047 (Japan); He, J. J. [Institute of Modern Physics, Chinese Academy of Sciences, Nanchang Road 509, Lanzhou 73000 (China); Goto, A. [Faculty of Medcine, Yamagata University, Yamagata 990-2331 (Japan); Muto, H. [Center of General Education, Tokyo University of Science at Suwa, Chino, Nagano 391-0292 (Japan)

    2014-05-09

    The lecture includes two parts: One is a discussion on the technology for developing RIB beam facility based on the in-flight method and relevant experimental technology. The second part is a discussion on experimental efforts for studying the breakout process from the pp-chain region based on recent works with low energy RI beams. The discussion of the second part specifically covers the problem of the vp-process in type II supernovae in terms of alpha cluster nature for the reactions.

  8. Advancing the Theory of Nuclear Reactions with Rare Isotopes. From the Laboratory to the Cosmos

    SciTech Connect (OSTI)

    Nunes, Filomena

    2015-06-01

    The mission of the Topical Collaboration on the Theory of Reactions for Unstable iSotopes (TORUS) was to develop new methods to advance nuclear reaction theory for unstable isotopes—particularly the (d,p) reaction in which a deuteron, composed of a proton and a neutron, transfers its neutron to an unstable nucleus. After benchmarking the state-of-the-art theories, the TORUS collaboration found that there were no exact methods to study (d,p) reactions involving heavy targets; the difficulty arising from the long-range nature of the well known, yet subtle, Coulomb force. To overcome this challenge, the TORUS collaboration developed a new theory where the complexity of treating the long-range Coulomb interaction is shifted to the calculation of so-called form-factors. An efficient implementation for the computation of these form factors was a major achievement of the TORUS collaboration. All the new machinery developed are essential ingredients to analyse (d,p) reactions involving heavy nuclei relevant for astrophysics, energy production, and stockpile stewardship.

  9. 3D reconstruction of nuclear reactions using GEM TPC with planar readout

    SciTech Connect (OSTI)

    Bihałowicz, Jan Stefan

    2015-02-24

    The research program of the Extreme Light Infrastructure – Nuclear Physics (ELI-NP) laboratory under construction in Magurele, Romania facilities the need of developing a gaseous active-target detector providing 3D reconstruction of charged products of nuclear reactions induced by gamma beam. The monoenergetic, high-energy (E{sub γ} > 19 MeV) gamma beam of intensity 10{sup 13}γ/s allows studying nuclear reactions in astrophysics. A Time Projection Chamber with crossed strip readout (eTPC) is proposed as one of the imaging detectors. The special feature of the readout electrode structure is a 2D reconstruction based on the information read out simultaneously from three arrays of strips that form virtual pixels. It is expected to reach similar spatial resolution as for pixel readout at largely reduced cost of electronics. The paper presents the current progress and first results of the small scale prototype TPC which is a one of implementation steps towards eTPC detector proposed in the Technical Design Report of Charged Particles Detection at ELI-NP.

  10. The Trojan Horse method for nuclear astrophysics: Recent results on resonance reactions

    SciTech Connect (OSTI)

    Cognata, M. La; Pizzone, R. G.; Spitaleri, C.; Cherubini, S.; Romano, S.; Gulino, M.; Tumino, A.; Lamia, L.

    2014-05-09

    Nuclear astrophysics aims to measure nuclear-reaction cross sections of astrophysical interest to be included into models to study stellar evolution and nucleosynthesis. Low energies, < 1 MeV or even < 10 keV, are requested for this is the window where these processes are more effective. Two effects have prevented to achieve a satisfactory knowledge of the relevant nuclear processes, namely, the Coulomb barrier exponentially suppressing the cross section and the presence of atomic electrons. These difficulties have triggered theoretical and experimental investigations to extend our knowledge down to astrophysical energies. For instance, indirect techniques such as the Trojan Horse Method have been devised yielding new cutting-edge results. In particular, I will focus on the application of this indirect method to resonance reactions. Resonances might dramatically enhance the astrophysical S(E)-factor so, when they occur right at astrophysical energies, their measurement is crucial to pin down the astrophysical scenario. Unknown or unpredicted resonances might introduce large systematic errors in nucleosynthesis models. These considerations apply to low-energy resonances and to sub-threshold resonances as well, as they may produce sizable modifications of the S-factor due to, for instance, destructive interference with another resonance.

  11. Nuclear Reactions X-Sections By Evaporation Model, Gamma-Cascades

    Energy Science and Technology Software Center (OSTI)

    2000-06-27

    Calculation of energy-averaged cross sections for nuclear reactions with emission of particles and gamma rays and fission. The models employed are the evaporation model with inclusion of pre-equilibrium decay and gamma ray cascade model. Angular momentum and parity conservation are accounted for. Major improvement to the 1976 STAPRE program (NEA 0461) relates to level density approach, implemwnted in subroutine ZSTDE. Generalized superfluid model is incorporated, Boltzman-gas modelling of intrinsic state density and semi-empirical modelling ofmore » a few quasiparticle effects in total level density in equilibrium and saddle deformations of actinide nuclei.« less

  12. COMMENTS ON "A NEW LOOK AT LOW-ENERGY NUCLEAR REACTION RESEARCH"

    SciTech Connect (OSTI)

    Shanahan, K.

    2009-12-30

    Cold fusion researchers have accumulated a large body of anomalous results over the last 20 years that they claim proves a new, mysterious nuclear reaction is active in systems they study. Krivit and Marwan give a brief and wholly positive view of this body of research. Unfortunately, cold fusion researchers routinely ignore conventional explanations of their observations, and claim much greater than real accuracy and precision for their techniques. This paper attempts to equally briefly address those aspects of the field with the intent of providing a balanced view of the field, and to establish some criteria for subsequent publications in this arena.

  13. Applications of nuclear reaction analysis to metal hydride film characterization at the GEND 200 KeV accelerator facility

    SciTech Connect (OSTI)

    Malbrough, D.J.; Becker, R.H.

    1985-01-01

    Nuclear reaction analysis (NRA) is a quantitative analytical technique that usually involves the use of MeV ion beams and resonant nuclear reactions to non-destructively probe materials for elemental content and depth profiles. Low energy, non-resonant nuclear reactions can also be exploited for NRA and procedures have been developed for using the GEND 200-KeV accelerator to characterize neutron generator components by that technique. The procedures involve the detection and analysis of fusion reaction products generated by the interactions of deuteron beams with light elements in metal hydride films. A description of the accelerator system is presented along with some of the unique NRA procedures that have recently been developed for its use. The system is used to measure neutron output efficiencies of metal deuterides and tritides by the associated particle technique (APT) and accurate neutron yield measurements have been made for a number of materials for which data was formerly not available.

  14. Compact Detection System for High Sensitivity Hydrogen Profiling of Materials by Nuclear Reaction Analysis

    SciTech Connect (OSTI)

    Marble, Daniel Keith; Urban, Ben; Pacheco, Jose

    2009-03-10

    Hydrogen is a ubiquitous contaminant that is known to have dramatic effects on the electrical, chemical, and mechanical properties of many types of materials in even minute quantities. Thus, the detection of hydrogen in materials is of major importance. Nuclear Reaction Analysis (NRA) is a powerful technique for nondestructive profiling hydrogen in materials. However, NRA has found only limited use in many applications because of poor sensitivity due to cosmic ray background (CSRB). Most attempts to eliminate CSRB to achieve ppm detection levels using higher energy nuclear reactions or tons of passive shielding are not compatible with commercial ion beam analysis space and equipment requirements Zimmerman, et al. have previously reported upon a coincidence detector that meets IBA space requirements and reduces the cosmic ray background, but the detector suffers from lower detection efficiency and small sample size. We have replaced the BGO well detector in the Zimmerman coincidence detection scheme with a larger Nal well detector and used faster timing electronics to produce a detector that can handle larger samples with higher detection efficiency, and still eliminate cosmic ray background.

  15. Nucleus-nucleus total reaction cross sections, and the nuclear interaction radius

    SciTech Connect (OSTI)

    Abu-Ibrahim, Badawy

    2011-04-15

    We study the nucleus-nucleus total reaction cross sections for stable nuclei, in the energy region from 30A MeV to about 1A GeV, and find them to be in proportion to ({radical}({sigma}{sub pp}{sup tot}Z{sub 1}{sup 2/3}+{sigma}{sub pn}{sup tot}N{sub 1}{sup 2/3})+{radical}({sigma}{sub pp}{sup tot}Z{sub 2}{sup 2/3}+{sigma}{sub pn}{sup tot}N{sub 2}{sup 2/3})) {sup 2} in the mass range 8 to 100. Also, we find a parameter-free relation that enables us to predict a total reaction cross section for any nucleus-nucleus within 10% uncertainty at most, using the experimental value of the total reaction cross section of a given nucleus-nucleus. The power of the relation is demonstrated by several examples. The energy dependence of the nuclear interaction radius is deduced; it is found to be almost constant in the energy range from about 200A MeV to about 1A GeV; in this energy range and for nuclei with N=Z, R{sub I}(A)=(1.14{+-}0.02)A{sup 1/3} fm.

  16. STARLIB: A NEXT-GENERATION REACTION-RATE LIBRARY FOR NUCLEAR ASTROPHYSICS

    SciTech Connect (OSTI)

    Sallaska, A. L.; Iliadis, C.; Champange, A. E.; Goriely, S.; Starrfield, S.; Timmes, F. X.

    2013-07-15

    STARLIB is a next-generation, all-purpose nuclear reaction-rate library. For the first time, this library provides the rate probability density at all temperature grid points for convenient implementation in models of stellar phenomena. The recommended rate and its associated uncertainties are also included. Currently, uncertainties are absent from all other rate libraries, and, although estimates have been attempted in previous evaluations and compilations, these are generally not based on rigorous statistical definitions. A common standard for deriving uncertainties is clearly warranted. STARLIB represents a first step in addressing this deficiency by providing a tabular, up-to-date database that supplies not only the rate and its uncertainty but also its distribution. Because a majority of rates are lognormally distributed, this allows the construction of rate probability densities from the columns of STARLIB. This structure is based on a recently suggested Monte Carlo method to calculate reaction rates, where uncertainties are rigorously defined. In STARLIB, experimental rates are supplemented with: (1) theoretical TALYS rates for reactions for which no experimental input is available, and (2) laboratory and theoretical weak rates. STARLIB includes all types of reactions of astrophysical interest to Z = 83, such as (p, {gamma}), (p, {alpha}), ({alpha}, n), and corresponding reverse rates. Strong rates account for thermal target excitations. Here, we summarize our Monte Carlo formalism, introduce the library, compare methods of correcting rates for stellar environments, and discuss how to implement our library in Monte Carlo nucleosynthesis studies. We also present a method for accessing STARLIB on the Internet and outline updated Monte Carlo-based rates.

  17. Supporting Technology for Chain of Custody of Nuclear Weapons and Materials throughout the Dismantlement and Disposition Processes

    SciTech Connect (OSTI)

    Bunch, Kyle J.; Jones, Anthony M.; Ramuhalli, Pradeep; Benz, Jacob M.; Denlinger, Laura Schmidt

    2014-05-04

    The ratification and ongoing implementation of the New START Treaty have been widely regarded as noteworthy global security achievements for both the Obama Administration and the Putin (formerly Medvedev) regime. But deeper cuts that move beyond the United States and Russia to engage the P-5 and other nuclear weapons possessor states are envisioned under future arms control regimes, and are indeed required for the P-5 in accordance with their Article VI disarmament obligations in the Nuclear Non-Proliferation Treaty. Future verification needs will include monitoring the cessation of production of new fissile material for weapons, monitoring storage of warhead components and fissile materials and verifying dismantlement of warheads, pits, secondary stages, and other materials. A fundamental challenge to implementing a nuclear disarmament regime is the ability to thwart unauthorized material diversion throughout the dismantlement and disposition process through strong chain of custody implementation. Verifying the declared presence, or absence, of nuclear materials and weapons components throughout the dismantlement and disposition lifecycle is a critical aspect of the disarmament process. From both the diplomatic and technical perspectives, verification under these future arms control regimes will require new solutions. Since any acceptable verification technology must protect sensitive design information and attributes to prevent the release of classified or other proliferation-sensitive information, non-nuclear non-sensitive modalities may provide significant new verification tools which do not require the use of additional information barriers. Alternative verification technologies based upon electromagnetic and acoustics could potentially play an important role in fulfilling the challenging requirements of future verification regimes. For example, researchers at the Pacific Northwest National Laboratory (PNNL) have demonstrated that low frequency electromagnetic

  18. Nuclear Reaction Cross Sections Database at BNL | U.S. DOE Office...

    Office of Science (SC) Website

    by: DOE-NP, Nuclear Regulatory Commission, DOE-NNSA, Nuclear Industry Impactbenefit to spin-off field: Applications in nuclear energy, national security, radiation protection. ...

  19. Code System to Calculate Nuclear Reaction Cross Sections by Evaporation Model.

    Energy Science and Technology Software Center (OSTI)

    2000-11-27

    Version: 00 Both STAPRE and STAPREF are included in this package. STAPRE calculates energy-averaged cross sections for nuclear reactions with emission of particles and gamma rays and fission. The models employed are the evaporation model with inclusion of pre-equilibrium decay and a gamma-ray cascade model. Angular momentum and parity conservation are accounted for. Major improvement in the 1976 STAPRE program relates to level density approach, implemented in subroutine ZSTDE. Generalized superfluid model is incorporated, boltzman-gasmore » modeling of intrinsic state density and semi-empirical modeling of a few-quasiparticle effects in total level density at equilibrium and saddle deformations of actinide nuclei. In addition to the activation cross sections, particle and gamma-ray production spectra are calculated. Isomeric state populations and production cross sections for gamma rays from low excited levels are obtained, too. For fission a single or a double humped barrier may be chosen.« less

  20. Advancing the Theory of Nuclear Reactions with Rare Isotopes: From the Laboratory to the Cosmos

    SciTech Connect (OSTI)

    Zhanov, Akram

    2015-08-30

    The Main goal of my research is to develop indirect methods, which allows one to connect the reactions measured in the labs with astrophysical reactions.

  1. Application of evolved gas analysis to cold-cap reactions of melter feeds for nuclear waste vitrification

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Rodriguez, Carmen P.; Chun, Jaehun; Schweiger, Michael J.; Kruger, Albert A.; Hrma, Pavel

    2014-09-01

    In the vitrification of nuclear wastes, the melter feed (a mixture of nuclear waste and glass forming and modifying additives) experiences multiple gas-evolving reactions in an electrical glass-melting furnace. Foams from the residual gases can significantly alter the melting rate through mass and heat transfers. We employed the thermogravimetry-gas chromatography-mass spectrometry (TGA-GC-MS) combination to perform quantitative evolved gas analysis (EGA) and developed a simple calibration model which correlates the overall mass loss rate with the evolution rates for individual gases. The model parameters are obtained from the least squares analysis, assuming that the gas-evolving reactions are independent. Thus, the EGAmore » adds the ‘chemical identity’ to the reactions indicated by the ‘phenomenological’ kinetic model.« less

  2. Investigations of nuclear structure and nuclear reactions induced by complex projectiles. Progress report for the period September 1, 1992--August 31, 1993

    SciTech Connect (OSTI)

    Sarantites, D.G.

    1993-09-06

    This is a progress report on activities of the Washington University group in nuclear reaction studies for the period Sept 1, 1992 to Aug 31, 1993. This group has a research program which touches five areas of nuclear physics: nuclear structure studies at high spin; studies at the interface between structure and reactions; production and study of hot nuclei; reaction mechanism studies; development and use of novel techniques and instrumentation in the above areas of research. Specific activities of the group include in part: superdeformation in {sup 82}Sr; structure of and identical bands in {sup 182}Hg and {sup 178}Pt; a highly deformed band in {sup 136}Pm; particle decay of the {sup 164}Yb compound nucleus; fusion reactions; proton evaporation; two-proton decay of {sup 12}O; modeling and theoretical studies; excited {sup 16}O disassembly into four alpha particles; {sup 209}Bi + {sup 136}Xe collisions at 28.2 MeV/amu; and development work on 4{pi} solid angle gamma detectors, and x-ray detectors.

  3. Modeled Neutron and Charged-Particle Induced Nuclear Reaction Cross Sections for Radiochemistry in the Region of Yttrium, Zirconium, Niobium, and Molybdenum

    SciTech Connect (OSTI)

    Hoffman, R D; Kelley, K; Dietrich, F S; Bauer, R; Mustafa, M G

    2006-06-13

    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron, proton, and deuteron induced nuclear reaction cross sections for targets ranging from strontium (Z = 38) to rhodium (Z = 45).

  4. Melter Feed Reactions at T ≤ 700°C for Nuclear Waste Vitrification

    SciTech Connect (OSTI)

    Xu, Kai; Hrma, Pavel R.; Rice, Jarrett A.; Riley, Brian J.; Schweiger, Michael J.; Crum, Jarrod V.

    2015-07-23

    Batch reactions and phase transitions in a nuclear waste feed heated at 5 K min-1 up to 600°C were investigated by optical microscopy, scanning electron microscopy with energy dispersive X-ray spectrometer, and X-ray diffraction. Quenched samples were leached in deionized water at room temperature and 80°C to extract soluble salts and early glass-forming melt, respectively. To determine the content and composition of leachable phases, the leachates were analyzed by the inductively-coupled plasma spectroscopy. By ~400°C, gibbsite and borax lost water and converted to amorphous and intermediate crystalline phases. Between 400°C and 600°C, the sodium borate early glass-forming melt reacted with amorphous aluminum oxide and calcium oxide to form intermediate products containing Al and Ca. At ~600°C, half Na and B converted to the early glass-forming melt, and quartz began to dissolve in the melt.

  5. The effect of nuclear reaction rates and convective mixing on the evolution of a 6M{sub ?} star

    SciTech Connect (OSTI)

    Halabi, Ghina M.

    2014-05-09

    We present the evolution of a 6M{sub ?} star, of solar-like initial metallicity, and investigate the effects of key nuclear reaction rates, as well as the treatment of the convective mixing on its evolution along the Cepheid instability strip. In particular, we study the effect of recent estimates of the {sup 14}N(p,?){sup 15}O reaction on the formation and extension of the blue loop during core helium burning. We also investigate the effects induced on this blue loop by the adoption of non-standard convective mixing prescriptions, as well as the implications of modifying the Mixing Length Theory.

  6. Computer experiments concerning palladium-deuterium and titanium-deuterium lattices - implications to phenomenon of low-energy nuclear reaction

    SciTech Connect (OSTI)

    Rao, K.R.; Chaplot, S.L.

    1996-12-01

    Short-lived large energy fluctuations (SLEFs) in solids, proposed by Khait, are known to be responsible for several anomalous properties in a variety of materials. The study of SLEFs in palladium-deuterium and titanium-deuterium lattices via computer experiments is reported. The relevance of these large energy fluctuations in penetrating coulombic barriers in these systems is discussed. Such dynamical effects arising from the phonon bath in solids may enhance nuclear reaction probabilities leading to cold fusion. Expected cold fusion reaction rates are reported taking into account the effective charges of the deuterium atoms in the solid and SLEF frequencies. 25 refs., 7 figs., 1 tab.

  7. Fission-Fusion: A new reaction mechanism for nuclear astrophysics based on laser-ion acceleration

    SciTech Connect (OSTI)

    Thirolf, P. G.; Gross, M.; Allinger, K.; Bin, J.; Henig, A.; Kiefer, D.; Habs, D.; Ma, W.; Schreiber, J.

    2011-10-28

    We propose to produce neutron-rich nuclei in the range of the astrophysical r-process around the waiting point N = 126 by fissioning a dense laser-accelerated thorium ion bunch in a thorium target (covered by a CH{sub 2} layer), where the light fission fragments of the beam fuse with the light fission fragments of the target. Via the 'hole-boring' mode of laser Radiation Pressure Acceleration using a high-intensity, short pulse laser, very efficiently bunches of {sup 232}Th with solid-state density can be generated from a Th target and a deuterated CD{sub 2} foil, both forming the production target assembly. Laser-accelerated Th ions with about 7 MeV/u will pass through a thin CH{sub 2} layer placed in front of a thicker second Th foil (both forming the reaction target) closely behind the production target and disintegrate into light and heavy fission fragments. In addition, light ions (d,C) from the CD{sub 2} layer of the production target will be accelerated as well, inducing the fission process of {sup 232}Th also in the second Th layer. The laser-accelerated ion bunches with solid-state density, which are about 10{sup 14} times more dense than classically accelerated ion bunches, allow for a high probability that generated fission products can fuse again. The high ion beam density may lead to a strong collective modification of the stopping power, leading to significant range and thus yield enhancement. Using a high-intensity laser as envisaged for the ELI-Nuclear Physics project in Bucharest (ELI-NP), order-of-magnitude estimates promise a fusion yield of about 10{sup 3} ions per laser pulse in the mass range of A = 180-190, thus enabling to approach the r-process waiting point at N = 126.

  8. Following the Transient Reactions in Lithium-Sulfur Batteries Using In an In Situ Nuclear Magnetic Resonance Technique

    SciTech Connect (OSTI)

    Xiao, Jie; Hu, Jian Z.; Chen, Honghao; Vijayakumar, M.; Zheng, Jianming; Pan, Huilin; Walter, Eric D.; Hu, Mary Y.; Deng, Xuchu; Feng, Ju; Liaw, Bor Yann; Gu, Meng; Deng, Zhiqun; Lu, Dongping; Xu, Suochang; Wang, Chong M.; Liu, Jun

    2015-05-13

    Li-S batteries hold great potential for next-generation, large-format power source applications; yet, the fundamental understanding of the electrochemical reaction pathways remains lacking to enable their functionality as promised. Here, in situ NMR technique employing a specially designed cylindrical micro battery was used to monitor the chemical environments around Li+ ions during repetitive charge-discharge process and track the transient electrochemical and chemical reactions occurring in the whole Li-S system. The in situ NMR provides real time, quantitative information related to the temporal concentration variations of the polysulfides with various chain lengths, providing important clues for the reaction pathways during both discharge and charge processes. The in-situ technique also reveals that redox reactions may involve transient species that are difficult to detect in ex-situ NMR study. Intermediate species such as charged free radicals may play an important role in the formation of the polysulfide products. Additionally, in situ NMR measurement simultaneously reveals vital information on the 7Li chemical environments in the electrochemical and parasitic reactions on the lithium anode that promotes the understanding of the failure mechanism in the Li-S system. These new insights could help design effective strategies to accelerate the development of Li-S battery technology.

  9. TORUS: Theory of Reactions for Unstable iSotopes.Topical Collaboration for Nuclear Theory Project. Period: June 1, 2010 - May 31, 2015

    SciTech Connect (OSTI)

    Arbanas, Goran; Elster, Charlotte; Escher, Jutta; Nunes, Filomena; Thompson, Ian

    2015-08-28

    The work of this collaboration during its existence is summarized. The mission of the TORUS Topical Collaboration was to develop new methods that advance nuclear reaction theory for unstable isotopes by using three-body techniques to improve direct reaction calculations. This multi-institution collaborative effort was and remains directly relevant to three areas of interest: the properties of nuclei far from stability, microscopic studies of nuclear input parameters for astrophysics, and microscopic nuclear reaction theory. The TORUS project focused on understanding the details of (d,p) reactions for neutron transfer to heavier nuclei. The bulk of the work fell into three areas: coupled channel theory, modeling (d,p) reactions with a Faddeev-AGS approach, and capture reactions.

  10. Interacting-boson-approximation study on the nuclear structural factor in double-charge-exchange reactions

    SciTech Connect (OSTI)

    Wu, H.; Wang, R.; Liu, Y.; Zhao, E. , P.O. Box 8730, Beijing Physics Department, Suzhou University, Suzhou Institute of High Energy Physics, Academia Sinica, Beijing Institute of Theoretical Physics, Academia Sinica, Beijing )

    1992-04-01

    The double-charge-exchange (DCX) reaction with Ca isotopes as targets is studied by employing the interacting-boson approximation (IBA). A comparison between the IBA and the shell-model results shows that IBA is a good approximation of the shell model in describing the DCX reactions.

  11. Selected spectroscopic results on element 115 decay chains

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Rudolph, D.; Forsberg, U.; Golubev, P.; Sarmiento, L. G.; Yakushev, A.; Andersson, L. -L.; Di Nitto, A.; Düllmann, Ch. E.; Gates, J. M.; Gregorich, K. E.; et al

    2014-08-24

    We observed thirty correlated α-decay chains in an experiment studying the fusion-evaporation reaction 48Ca + 243Am at the GSI Helmholtzzentrum fur Schwerionenforschung. The decay characteristics of the majority of these 30 chains are consistent with previous observations and interpretations of such chains to originate from isotopes of element Z = 115. High-resolution α-photon coincidence spectroscopy in conjunction with comprehensive Monte-Carlo simulations allow to propose excitation schemes of atomic nuclei of the heaviest elements, thereby probing nuclear structure models near the 'Island of Stability' with unprecedented experimental precision.

  12. Selected spectroscopic results on element 115 decay chains

    SciTech Connect (OSTI)

    Rudolph, D.; Forsberg, U.; Golubev, P.; Sarmiento, L. G.; Yakushev, A.; Andersson, L. -L.; Di Nitto, A.; Düllmann, Ch. E.; Gates, J. M.; Gregorich, K. E.; Gross, C. J.; Herzberg, R. -D.; Heßberger, F. P.; Khuyagbaatar, J.; Kratz, J. V.; Rykaczewski, K.; Schädel, M.; Åberg, S.; Ackermann, D.; Block, M.; Brand, H.; Carlsson, B. G.; Cox, D.; Derkx, X.; Eberhardt, K.; Even, J.; Fahlander, C.; Gerl, J.; Jäger, E.; Kindler, B.; Krier, J.; Kojouharov, I.; Kurz, N.; Lommel, B.; Mistry, A.; Mokry, C.; Nitsche, H.; Omtvedt, J. P.; Papadakis, P.; Ragnarsson, I.; Runke, J.; Schaffner, H.; Schausten, B.; Thörle-Pospiech, P.; Torres, T.; Traut, T.; Trautmann, N.; Türler, A.; Ward, A.; Ward, D. E.; Wiehl, N.

    2014-08-24

    We observed thirty correlated α-decay chains in an experiment studying the fusion-evaporation reaction 48Ca + 243Am at the GSI Helmholtzzentrum fur Schwerionenforschung. The decay characteristics of the majority of these 30 chains are consistent with previous observations and interpretations of such chains to originate from isotopes of element Z = 115. High-resolution α-photon coincidence spectroscopy in conjunction with comprehensive Monte-Carlo simulations allow to propose excitation schemes of atomic nuclei of the heaviest elements, thereby probing nuclear structure models near the 'Island of Stability' with unprecedented experimental precision.

  13. CP-1 Anniversary: Nuclear Pioneers Remember the Dawn of the Nuclear Age |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Argonne National Laboratory Anniversary: Nuclear Pioneers Remember the Dawn of the Nuclear Age Share Topic Energy Energy sources Nuclear energy On December 2, 1942, 49 scientists, led by Enrico Fermi, made history when Chicago Pile 1 went critical and produced the world's first self-sustaining, controlled nuclear chain reaction. Seventy years later, two of the last surviving CP-1 pioneers, Harold Agnew and Warren Nyer, recall that historic day

  14. Mass chain evaluations for the evaluated nuclear structure data file (ENSDF) - an urgent appeal for European participation.

    SciTech Connect (OSTI)

    Kondev, F. G.; Nichols, A. L.; Tuli, J. K.; Nuclear Engineering Division; International Atomic Energy Agency; BNL

    2007-01-01

    Reliable nuclear structure and decay data represent the fundamental building blocks of nuclear physics and astrophysics research, and are also of vital importance in a significant number of applied nuclear fields such as power generation and associated fuel cycle operations (e.g., fuel manufacture, transport, reprocessing, and waste management), materials analysis, medical diagnosis, and radiotherapy. There is a continuous demand for good quality data formulated and recommended through the speedy assessment and incorporation of new and improved measurements.

  15. Disassembly of hot nuclear matter formed in Au-induced reactions near the Fermi energy

    SciTech Connect (OSTI)

    Delis, D.N.

    1993-09-01

    Complex fragment emission has been studied in the 60 MeV/A {sup 197}Au + {sup 12}C, {sup 27}Al, {sup 51}V, {sup nat}Cu, and {sup 197}Au reactions. Velocity spectra, angular distributions and cross sections have been constructed for each target from the inclusive data. Coincidence data including 2-, 3-, 4-, and 5-fold events have also been examined. Furthermore neutron multiplicity distributions have been obtained for the above reactions by utilizing a novel neutron calorimetric approach.

  16. Flow cytometric detection of human immunodeficiency virus type 1 proviral DNA by the polymerase chain reaction incorporating digoxigenin- or fluorescein-labeled dUTP

    SciTech Connect (OSTI)

    Yang, Gang; Olson, J.C.; Pu, R.; Vyas, G.N.

    1995-10-01

    Serological assays are routinely used in the laboratory diagnosis of human immunodeficiency virus type-1 (HrV-1) infection, but the polymerase chain reaction (PCR) is ultimately the most sensitive and direct method for establishing definitive diagnosis. As an alternative to the conventional radioactive PCR procedure we have developed and evaluated a pair of rapid nonradioisotopic flow cytometric detection methods. Using heminested PCR we directly incorporated fluorescein-12-dUTP (fluo-dUTP) or digoxigenin-11-dUTP (dig-dUTP) into the PCR-amplicons. The labeled amplicons were hybridized with biotinylated antisense and sense probes, followed by capture of the hybrid DNA using streptavidin-coated beads which were finally analyzed in a flow cytometer by (1) direct detection of the fluorescence intensity of the amplicons incorporating fluo-dUTP and (2) immunodetection of the amplicons incorporating dig-dUTP by anti-digoxigenin IgG labeled with fluorescein isothiocyanate (FITC). Although both assays were functionally comparable with radiolabeled probe in reliably detecting as low as five copies of HIV-1 proviral DNA sequences, the immunodetection of dig-dUTP consistently yielded higher mean channel fluorescence and gave a stable signal over an extended period of 12-14 weeks. In testing a panel of 20 pedigreed PBMC specimens from blood donors with or without HIV-1 infection, the results of both flow cytometric assays were identical with those of the conventional radioactive procedure. Therefore, we conclude that the dig-dUTP incorporation in amplicons, hybridization with a pair of sense-antisense biotinylated probes and immunodetection of hybrids by flow cytometric analyses is the nonisotopic method of choice for PCR-diagnosis of HIV-1 infection. 21 refs., 2 figs., 4 tabs.

  17. The Trojan Horse method for nuclear astrophysics: Recent results for direct reactions

    SciTech Connect (OSTI)

    Tumino, A.; Gulino, M.; Spitaleri, C.; Cherubini, S.; Romano, S.; Cognata, M. La; Pizzone, R. G.; Rapisarda, G. G.; Lamia, L.

    2014-05-09

    The Trojan Horse method is a powerful indirect technique to determine the astrophysical factor for binary rearrangement processes A+x→b+B at astrophysical energies by measuring the cross section for the Trojan Horse (TH) reaction A+a→B+b+s in quasi free kinematics. The Trojan Horse Method has been successfully applied to many reactions of astrophysical interest, both direct and resonant. In this paper, we will focus on direct sub-processes. The theory of the THM for direct binary reactions will be shortly presented based on a few-body approach that takes into account the off-energy-shell effects and initial and final state interactions. Examples of recent results will be presented to demonstrate how THM works experimentally.

  18. Positronium formation as a three-body reaction. II. The second-order nuclear amplitudes

    SciTech Connect (OSTI)

    Shojaei, F.; Bolorizadeh, M. A.; Ghanbari-Adivi, E.; Brunger, M. J.

    2009-01-15

    We derive an exact analytic form for the second-order nuclear amplitudes, under the Faddeev three-body approach, which is applicable to the nonrelativistic high energy impact interaction where positronium is formed in the collision of a positron with an atom.

  19. On the nonstationary quantum-mechanical origin of nuclear reactions in solids

    SciTech Connect (OSTI)

    Chechin, V.A.; Tsarev, V.A. )

    1994-07-01

    A model for deuteron reactions in solids is suggested in which an increase in the penetrability of the Coulomb barrier is attributed to a quantum-mechanical perturbation of the wave function caused by nonstationary deuterons in a crystalline lattice. 15 refs.

  20. Nuclear reactors and the nuclear fuel cycle

    SciTech Connect (OSTI)

    Pearlman, H

    1989-11-01

    According to the author, the first sustained nuclear fission chain reaction was not at the University of Chicago, but at the Oklo site in the African country of Gabon. Proof of this phenomenon is provided by mass spectrometric and analytical chemical measurements by French scientists. The U.S. experience in developing power-producing reactors and their related fuel and fuel cycles is discussed.

  1. Sensitivity of the blue loops of intermediate-mass stars to nuclear reactions

    SciTech Connect (OSTI)

    Halabi, Ghina M.; El Eid, Mounib

    2012-11-20

    We investigate the effects of a modification of the {sup 14}N(p,{gamma}){sup 15}O reaction rate, as suggested by recent evaluations, on the formation and extension of the blue loops encountered during the evolution of the stars in the mass range 5M{sub Circled-Dot-Operator} to 12M{sub Circled-Dot-Operator }. We show that the blue loops of stars in the mass range 5M{sub Circled-Dot-Operator} to 8M{sub Circled-Dot-Operator }, that is the range of super ABG stars, are severely affected by a modification of the important {sup 14}N(p,{gamma}){sup 15}O reaction rate. We also show that the blue loops can be restored if envelope overshooting is included, which is necessary to explain the observations of the Cepheid stars.

  2. Coulomb reacceleration as a clock for nuclear reactions: A two-dimensional model

    SciTech Connect (OSTI)

    Bertulani, C.A. ); Bertsch, G.F. )

    1994-05-01

    Reacceleration effects in the Coulomb breakup of nuclei are modeled with the two-dimensional time-dependent Schroedinger equation, extending a previous one-dimensional study. The present model better describes the individual contributions of longitudinal and transverse forces to the breakup and reacceleration. Reacceleration effects are found to preserve a strong memory of the pre-breakup phase of the reaction, as was concluded with the one-dimensional model.

  3. U.S. Department of Energy Office of Nuclear Energy, Science and Technology

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    One the cover: Albert Einstein (1879-1955) U.S. Department of Energy Office of Nuclear Energy, Science and Technology Washington, D.C. 20585 The History of Nuclear Energy Table of Contents Preface ................................................................... 1 Introduction .......................................................... 3 The Discovery of Fission ...................................... 4 The First Self-Sustaining Chain Reaction ............ 5 The Development of Nuclear Energy for

  4. Russian Military and Security Forces: A Postulated Reaction to a Nuclear Detonation

    SciTech Connect (OSTI)

    Ball, D

    2005-04-29

    In this paper, we will examine how Russia's military and security forces might react to the detonation of a 10-kiloton nuclear weapon placed next to the walls surrounding the Kremlin. At the time of this 'big bang,' Putin is situated outside Moscow and survives the explosion. No one claims responsibility for the detonation. No other information is known. Numerous variables will determine how events ultimately unfold and how the military and security forces will respond. Prior to examining these variables in greater detail, it is imperative to elucidate first what we mean by Russia's military and security forces.

  5. Theoretical nuclear reaction and structure studies using hyperons and photons. Final report

    SciTech Connect (OSTI)

    Cotanch, S.R.

    1998-12-31

    This report details research progress and results obtained during the ten period from June 1, 1988 through May 31, 1998. In compliance with grant requirements the Principal Investigator, Professor Stephen R. Cotanch, has conducted a research program addressing theoretical investigations of reactions involving hyperons and photons. The Principal Investigator has devoted to this program 50% of his time during the academic year and 100% of this time in the summer. Highlights of significant research results are briefly summarized in this report which respectively correspond to the three sub-programs of this project.

  6. Nuclear reaction analysis for H, Li, Be, B, C, N, O and F with an RBS check

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Lanford, W. A.; Parenti, M.; Nordell, B. J.; Paquette, M. M.; Caruso, A. N.; Mäntymäki, M.; Hämäläinen, J.; Ritala, M.; Klepper, K. B.; Miikkulainen, V.; et al

    2015-11-12

    In this paper, 15N nuclear reaction analysis (NRA) for H is combined with 1.2 MeV deuteron (D) NRA which provides a simultaneous analysis for Li, Be, B, C, N, O and F. The energy dependence of the D NRA has been measured and used to correct for the D energy loss in film being analyzed. A 2 MeV He RBS measurement is made. Film composition is determined by a self-consistent analysis of the light element NRA data combined with an RBS analysis for heavy elements. This composition is used to simulate, with no adjustable parameters, the complete RBS spectrum. Finally,more » comparison of this simulated RBS spectrum with the measured spectrum provides a powerful check of the analysis.« less

  7. The ({sup 18}O, {sup 16}O) reaction as a probe for nuclear spectroscopy

    SciTech Connect (OSTI)

    Cappuzzello, F.; Bond, M.; Nicolosi, D.; Tropea, S.; Agodi, A.; Carbone, D.; Cavallaro, M.; Cunsolo, A.; Borello-Lewin, T.; Rodrigues, M. R. D.; De Napoli, M.; Linares, R.

    2014-11-11

    The response of nuclei to the ({sup 18}O, {sup 16}O) two-neutron transfer reaction at 84 MeV incident energy has been systematically studied at the Catania INFN-LNS laboratory. The experiments were performed using several solid targets from light ({sup 9}Be, {sup 11}B, {sup 12,13}C, {sup 16}O, {sup 28}Si) to heavy ones ({sup 58,64}Ni, {sup 120}Sn, {sup 208}Pb). The {sup 16}O ejectiles were detected at forward angles by the MAGNEX magnetic spectrometer. Exploiting the large momentum acceptance (?10%, +14%) and solid angle (50 msr) of the spectrometer, energy spectra were obtained with a relevant yield up to about 20 MeV excitation energy. The application of the powerful trajectory reconstruction technique did allow to get energy spectra with energy resolution of about 150 keV and angular distributions with angular resolution better than 0.3. A common feature observed with light nuclei is the appearance of unknown resonant structures at high excitation energy. The strong population of these latter together with the measured width can reveal the excitation of a collective mode connected with the transfer of a pair.

  8. The series of carbon-chain complexes {Ru(dppe)Cp*}?{?-(C?C)x} (x = 48, 11): Synthesis, structures, properties and some reactions

    SciTech Connect (OSTI)

    Bruce, Michael I.; Cole, Marcus L.; Ellis, Benjamin G.; Gaudio, Maryka; Nicholson, Brian K.; Parker, Christian R.; Skelton, Brian W.; White, Allan H.

    2015-01-28

    The construction of a series of compounds {Ru(dppe)Cp*}2(?-C2x) (Ru*-C2x-Ru*, x = 48, 11)) is described. A direct reaction between RuCl(dppe)Cp* and Me3Si(Ctriple bond; length of mdashC)4SiMe3 afforded Ru*-C8-Ru* in 89% yield. The Pd(0)/Cu(I)-catalysed coupling of Ru{Ctriple bond; length of mdashCCtriple bond; length of mdashCAu(PPh3)}(dppe)Cp*Ru*-C4-Au (2 equiv.) with diiodoethyne gave Ru*-C10-Ru* (64%), or of 1 equiv. with I(Ctriple bond; length of mdashC)3I gave Ru*-C14-Ru* (36%); similarly, Ru{(Ctriple bond; length of mdashC)4Au(PPh3)}(dppe)Cp*Ru*-C8-Au and I(Ctriple bond; length of mdashC)3I gave Ru*-C22-Ru* (12%). Desilylation (TBAF) of Ru{(Ctriple bond; length of mdashC)xSiMe3}(dppe)Cp*Ru*-C2x-Si (x = 3, 4) followed by oxidative coupling [Cu(OAc)2/py] gave Ru*-C12-Ru* (82%) and Ru*-C16-Ru* (58%), respectively. Similar oxidative coupling of Ru(Ctriple bond; length of mdashCCtriple bond; length of mdashCH)(dppe)Cp* was a second route to Ru*-C8-Ru* (82%). Appropriate precursors are already known, or obtained by coupling of Ru*-C2x-Si (x = 2, 4) with AuCl(PPh3)/NaOMe [Ru*-C4-Au, 95%; Ru*-C8-Au, 74%] or from Pd(0)/Cu(I) catalysed coupling of Ru*-C2x-Au (x = 2, 3) with I(Ctriple bond; length of mdashC)2SiMe3 (Ru*-C8-Si, 64%; Ru*-C10-Si, 2%). Reactions between Ru*-C2x-Ru* (x = 3, 4) and Fe2(CO)9 gave {Fe3(CO)9}{?3-CCtriple bond; length of mdashC[Ru(dppe)Cp*]}2Fe(C3-Ru*)2 and {Fe3(CO)9}{?3-CCtriple bond; length of mdashC[Ru(dppe)Cp*]}{?3-C(Ctriple bond; length of mdashC)2[Ru(dppe)Cp*]} Fe(C3-Ru*)(C5-Ru*), respectively. The redox properties of the series of complexes with 2x = 216 were measured and showed a diminution of the separation of

  9. METHOD OF OPERATING NUCLEAR REACTORS

    DOE Patents [OSTI]

    Untermyer, S.

    1958-10-14

    A method is presented for obtaining enhanced utilization of natural uranium in heavy water moderated nuclear reactors by charging the reactor with an equal number of fuel elements formed of natural uranium and of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction. The reactor is operated until the rate of burnup of plutonium equals its rate of production, the fuel elements are processed to recover plutonium, the depleted uranium is discarded, and the remaining uranium is formed into fuel elements. These fuel elements are charged into a reactor along with an equal number of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction, and reuse of the uranium is continued as aforesaid until it wlll no longer support a chain reaction when combined with an equal quantity of natural uranium.

  10. Solving The Long-Standing Problem Of Low-Energy Nuclear Reactions At The Highest Microscopic Level. Annual Continuation And Progress Report, August 15, 2014 -- August 14, 2015

    SciTech Connect (OSTI)

    Quaglioni, Sofia

    2015-03-19

    The aim of this project is to develop a comprehensive framework that will lead to a fundamental description of both structural properties and reactions of light nuclei in terms of constituent protons and neutrons interacting through nucleon-nucleon (NN) and three-nucleon (3N) forces. This project will provide the research community with the theoretical and computational tools what will enable: an accurate prediction for fusion reactions that power stars and Earth-based fusion facilities; an improved description of the spectroscopy of exotic nuclei, including light Borromean systems; and, a fundamental understanding of the three-nucleon force in nuclear reaction and nuclei at the drip line.

  11. Localization of human elav-like neuronal protein 1 (Hel-N1) on chromosome 9p21 by chromosome microdissection polymerase chain reaction and fluorescence in situ hybridization

    SciTech Connect (OSTI)

    Han, Jian; Knops, J.F.; Longshore, J.W.; King, P.H.

    1996-08-15

    Hel-N1 is a member of the highly conserved elav family of neuronal genes. It shares considerable sequence homology with HuD, another human member, and both genes are expressed in brain. HuD was recently mapped to chromosome 1p34. Here, we have utilized chromosome microdissection polymerase chain reaction and fluorescence in situ hybridization to map Hel-N1 to chromosome 9p21. The different chromosomal locations of these homologous genes underscore their distinct identities. 10 refs., 2 figs.

  12. Argonne nuclear pioneers: Chicago Pile 1

    ScienceCinema (OSTI)

    Agnew, Harold; Nyer, Warren

    2013-04-19

    On December 2, 1942, 49 scientists, led by Enrico Fermi, made history when Chicago Pile 1 (CP-1) went critical and produced the world's first self-sustaining, controlled nuclear chain reaction. Seventy years later, two of the last surviving CP-1 pioneers, Harold Agnew and Warren Nyer, recall that historic day.

  13. Argonne nuclear pioneers: Chicago Pile 1

    SciTech Connect (OSTI)

    Agnew, Harold; Nyer, Warren

    2012-01-01

    On December 2, 1942, 49 scientists, led by Enrico Fermi, made history when Chicago Pile 1 (CP-1) went critical and produced the world's first self-sustaining, controlled nuclear chain reaction. Seventy years later, two of the last surviving CP-1 pioneers, Harold Agnew and Warren Nyer, recall that historic day.

  14. Tetramethyl-1-silacycloprop-2-ene: its characterization and reactions

    SciTech Connect (OSTI)

    Cornett, B.J.

    1980-05-01

    The object of this research is to fully characterize and study some of the reactions of tetramethyl-1-silacycloprop-2-ene. The final characterization of this compound was accomplished by obtaining both Si29 and 13C nuclear magnetic resonance spectra. The reactions studied included those with fluorenone, acetone, styrene, phenylacetylene, acetonitrile, t-butylcyanide, methyl isocyanate, phenyl azide, and azobenzene. Product analyses suggest that aside from addition reactions tetramethylsilacyclopropene can react either via a radical chain polymerization or an anionic chain polymerization mechanism with the latter being the more prevalent. Other reactions studied included the photolysis of tetramethylsilacyclopropene and its reactions in the presence of Pd(PPh/sub 3/)/sub 2/Cl/sub 2/. An appendix includes a study of trimethylsilyl radical disproportionation in the liquid phase to a sila olefin. Trimethylsilyl radicals in solution undergo disproportionation as well as recombination in a 1:5 ratio. The sila olefin formed by disproportionation was trapped by alcohols.

  15. Argonne's Major Nuclear Energy Milestones | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Argonne's Major Nuclear Energy Milestones Argonne's reactor tree Argonne's reactor tree December 2, 1942: Enrico Fermi's team produces the world's first sustained nuclear chain reaction. March 20, 1943: Chicago Pile 2 achieves criticality. It was CP-1, Fermi's first reactor, dismantled and reassembled at the Argonne Forest site in the Cook Country Forest Preserve. May 15, 1944: Walter Zinn starts Chicago Pile 3, the world's first heavy-water-moderated nuclear reactor, at Site A. January 31,

  16. Nuclear Science/Nuclear Chemistry

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    nuclear science nuclear chemistry Nuclear Science/Nuclear Chemistry Nuclear Physics The 10-MV tandem accelerator at CAMS provides a platform for conducting nuclear physics experiment both for basic science and lab mission-related programs. For example, we performed a new cross section measurement of the astrophysically important reaction 40Ca(a,g)44Ti in which high purity CaO targets were irradiated with helium ions at several different discrete energies. The reaction rate was measured on-line

  17. Coupled-channels density-matrix approach to low-energy nuclear collision dynamics: A technique for quantifying quantum decoherence effects on reaction observables

    SciTech Connect (OSTI)

    Diaz-Torres, Alexis

    2010-11-15

    The coupled-channels density-matrix technique for nuclear reaction dynamics, which is based on the Liouville-von Neumann equation with Lindblad dissipative terms, is developed with the inclusion of full angular momentum couplings. It allows a quantitative study of the role and importance of quantum decoherence in nuclear scattering. Formulas of asymptotic observables that can reveal effects of quantum decoherence are given. A method for extracting energy-resolved scattering information from the time-dependent density matrix is introduced. As an example, model calculations are carried out for the low-energy collision of the {sup 16}O projectile on the {sup 154}Sm target.

  18. nuclear

    National Nuclear Security Administration (NNSA)

    2%2A en U.S-, Japan Exchange Best Practices on Nuclear Emergency Response http:nnsa.energy.govmediaroompressreleasesu.s-japan-exchange-best-practices-nuclear-emergency-respon...

  19. Development of a high-density gas-jet target for nuclear astrophysics and reaction studies with rare isotope beams. Final Report

    SciTech Connect (OSTI)

    Uwe, Greife

    2014-08-12

    The purpose of this project was to develop a high-density gas jet target that will enable a new program of transfer reaction studies with rare isotope beams and targets of hydrogen and helium that is not currently possible and will have an important impact on our understanding of stellar explosions and of the evolution of nuclear shell structure away from stability. This is the final closeout report for the project.

  20. Kinetics of Cold-Cap Reactions for Vitrification of Nuclear Waste Glass Based on Simultaneous Differential Scanning Calorimetry - Thermogravimetry (DSC-TGA) and Evolved Gas Analysis (EGA)

    SciTech Connect (OSTI)

    Rodriguez, Carmen P.; Pierce, David A.; Schweiger, Michael J.; Kruger, Albert A.; Chun, Jaehun; Hrma, Pavel R.

    2013-12-03

    For vitrifying nuclear waste glass, the feed, a mixture of waste with glass-forming and modifying additives, is charged onto the cold cap that covers 90-100% of the melt surface. The cold cap consists of a layer of reacting molten glass floating on the surface of the melt in an all-electric, continuous glass melter. As the feed moves through the cold cap, it undergoes chemical reactions and phase transitions through which it is converted to molten glass that moves from the cold cap into the melt pool. The process involves a series of reactions that generate multiple gases and subsequent mass loss and foaming significantly influence the mass and heat transfers. The rate of glass melting, which is greatly influenced by mass and heat transfers, affects the vitrification process and the efficiency of the immobilization of nuclear waste. We studied the cold-cap reactions of a representative waste glass feed using both the simultaneous differential scanning calorimetry thermogravimetry (DSC-TGA) and the thermogravimetry coupled with gas chromatography-mass spectrometer (TGA-GC-MS) as complementary tools to perform evolved gas analysis (EGA). Analyses from DSC-TGA and EGA on the cold-cap reactions provide a key element for the development of an advanced cold-cap model. It also helps to formulate melter feeds for higher production rate.

  1. SECTION II: HEAVY ION REACTIONS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    II: HEAVY ION REACTIONS Experimental Determination of the Symmetry Energy of a Low Density Nuclear Gas ......II-1 S. ...

  2. Three-Dimensional Analysis of the Lattice Confinement Effect on Ion Dynamics in Condensed Matter and Lattice Effect on the D-D Nuclear Reaction Channel

    SciTech Connect (OSTI)

    Violante, Vittorio; Torre, Amalia; Selvaggi, Giovanna; Miley, George H.

    2001-03-15

    A three-dimensional analysis of the dynamics of hydrogen isotopes confined within a metal lattice, like palladium or nickel, is presented. It is assumed that the concentration of the hydrogen isotopes, as an atomic fraction, is close to unity and that coherent oscillations of the metal atom electrons near to the Fermi level take place. Coherent oscillations of the Fermi-level electrons in the metal lattice can produce an oscillating electric field within the cell and hence produce a radio-frequency oscillation of ions like protons or deuterons. The trajectories of the ions can be studied by means of the equations of motion. The results show that under proper initial conditions, the closest distance of approach between two ions or between an ion and the nucleus of an atom of the host metal lattice can be reduced below 0.1 Angst. An evaluation of the excess of heat production has been done for the D-D reaction within a Pd lattice by approximating the reaction both to an s-wave and a d-wave process, respectively. Last, the effect of the lattice field, which causes the collisions between ions, on the nuclear reaction channel for the D-D reaction is investigated by evaluating the transition probability for a stimulated decay.

  3. Nuclear Physics from Lattice QCD

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Thursday, May 26, 2011 Exa-Scale Computational Resources Nuclear Astrophysics Accelerator Physics Cold QCD and Nuclear Forces Hot and Dense QCD Nuclear Structure and Reactions ...

  4. Resonant thermonuclear reaction rate

    SciTech Connect (OSTI)

    Haubold, H.J.; Mathai, A.M.

    1986-08-01

    Basic physical principles for the resonant and nonresonant thermonuclear reaction rates are applied to find their standard representations for nuclear astrophysics. Closed-form representations for the resonant reaction rate are derived in terms of Meijer's G-italic-function. Analytic representations of the resonant and nonresonant nuclear reaction rates are compared and the appearance of Meijer's G-italic-function is discussed in physical terms.

  5. Nuclear structure studies with ([ital e],[ital e][prime]), ([pi],[pi][prime]), and ([gamma],[pi]) reactions: Applications to [sup 10]B

    SciTech Connect (OSTI)

    Sato, T.; Odagawa, N.; Ohtsubo, H. ); Lee, T.H. )

    1994-02-01

    Theoretical approaches for investigating nuclear structure with ([ital e],[ital e][prime]), ([pi],[pi][prime]), and ([gamma],[pi]) reactions are presented and applied to study the shell-model description of [sup 10]B. The distorted wave impulse approximation formulated in momentum space is used to calculate the cross sections of ([pi],[pi][prime]) and ([gamma],[pi]) reactions from the [pi][ital N][r arrow][pi][ital N] and [pi][ital N][r arrow][gamma][ital N] off-shell amplitudes which are generated from the model of Nozawa, Blankleider, and Lee[1]. It is found that the nonlocal effects due to [pi][ital N] off-shell dynamics and nucleon Fermi motion are important in predicting ([gamma],[pi]) cross sections. The one-pion-exchange two-body exchange currents are included in ([ital e],[ital e][prime]) calculations. It is shown that the core polarization effects, calculated in a perturbation approach including excitations up to 6[h bar][omega], are essential in obtaining quantitative agreements with the data with no adjustable parameters. The predictions based on the shell model of Cohen and Kurath [2] and Hague and Maripuu [3] are compared in order to illustrate the use of ([ital e],[ital e][prime]), ([pi],[pi][prime]), and ([gamma],[pi]) reactions in distinguishing nuclear structure theories which are almost equivalent in describing static properties in nuclei. Predictions for future ([ital e],[ital e][prime]) and ([gamma],[pi]) experiments are also presented.

  6. Chain Reaction Innovations | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Unparalleled access to an innovation ecosystem Advisory network of business mentors ... A Fertile Ecosystem to Seed Complex Science Innovators in CRI can leverage the unique ...

  7. Random-matrix approach to the statistical compound nuclear reaction at low energies using the Monte-Carlo technique

    SciTech Connect (OSTI)

    Kawano, Toshihiko

    2015-11-10

    This theoretical treatment of low-energy compound nucleus reactions begins with the Bohr hypothesis, with corrections, and various statistical theories. The author investigates the statistical properties of the scattering matrix containing a Gaussian Orthogonal Ensemble (GOE) Hamiltonian in the propagator. The following conclusions are reached: For all parameter values studied, the numerical average of MC-generated cross sections coincides with the result of the Verbaarschot, Weidenmueller, Zirnbauer triple-integral formula. Energy average and ensemble average agree reasonably well when the width I is one or two orders of magnitude larger than the average resonance spacing d. In the strong-absorption limit, the channel degree-of-freedom ν a is 2. The direct reaction increases the inelastic cross sections while the elastic cross section is reduced.

  8. Experimental differential cross sections, level densities, and spin cutoffs as a testing ground for nuclear reaction codes

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Voinov, Alexander V.; Grimes, Steven M.; Brune, Carl R.; Burger, Alexander; Gorgen, Andreas; Guttormsen, Magne; Larsen, Ann -Cecilie; Massey, Thomas N.; Siem, Sunniva

    2013-11-08

    Proton double-differential cross sections from 59Co(α,p)62Ni, 57Fe(α,p)60Co, 56Fe(7Li,p)62Ni, and 55Mn(6Li,p)60Co reactions have been measured with 21-MeV α and 15-MeV lithium beams. Cross sections have been compared against calculations with the empire reaction code. Different input level density models have been tested. It was found that the Gilbert and Cameron [A. Gilbert and A. G. W. Cameron, Can. J. Phys. 43, 1446 (1965)] level density model is best to reproduce experimental data. Level densities and spin cutoff parameters for 62Ni and 60Co above the excitation energy range of discrete levels (in continuum) have been obtained with a Monte Carlo technique. Furthermore,more » excitation energy dependencies were found to be inconsistent with the Fermi-gas model.« less

  9. Nuclear Data Sheets for A = 88

    SciTech Connect (OSTI)

    McCutchan, E.A.; Sonzogni, A.A.

    2014-01-15

    The experimental results from the various reaction and radioactive decay studies leading to nuclides in the A=88 mass chain have been reviewed. Nuclides ranging from Ge (Z=32) to Ru (Z=44) are included. For these nuclei, level and decay schemes, as well as tables of nuclear properties, are given. This work supersedes the previous evaluation of the data on these nuclides (G. Mukherjee, A.A. Sonzogni Nucl.Data Sheets 105, 419 (2005))

  10. Nuclear Data Sheets for A=150

    SciTech Connect (OSTI)

    Basu, S.K.; Sonzogni, A.A.

    2013-04-15

    The experimental results from the various reaction and decay studies leading to nuclides in the A=150 mass chain have been reviewed. These data are summarized and presented, together with the adopted level schemes and properties, for the nuclides from Cs(Z=55) through Lu(Z=71). This evaluation replaces the previous evaluation by E. der Mateosian and J. K. Tuli (1995De28), which appeared in Nuclear Data Sheets 75, 827 (1995)

  11. Nuclear Data Sheets for A = 68

    SciTech Connect (OSTI)

    McCutchan, E. A.

    2012-07-01

    The experimental results from the various reaction and radioactive decay studies leading to nuclides in the A = 68 mass chain have been reviewed. Nuclides ranging from Cr (Z = 24) to Br (Z = 35) are included. For these nuclei, level and decay schemes, as well as tables of nuclear properties, are given. This work supersedes the previous evaluation of the data on these nuclides (2002Bu29).

  12. NNSA TRITIUM SUPPLY CHAIN

    SciTech Connect (OSTI)

    Wyrick, Steven; Cordaro, Joseph; Founds, Nanette; Chambellan, Curtis

    2013-08-21

    Savannah River Site plays a critical role in the Tritium Production Supply Chain for the National Nuclear Security Administration (NNSA). The entire process includes: • Production of Tritium Producing Burnable Absorber Rods (TPBARs) at the Westinghouse WesDyne Nuclear Fuels Plant in Columbia, South Carolina • Production of unobligated Low Enriched Uranium (LEU) at the United States Enrichment Corporation (USEC) in Portsmouth, Ohio • Irradiation of TPBARs with the LEU at the Tennessee Valley Authority (TVA) Watts Bar Reactor • Extraction of tritium from the irradiated TPBARs at the Tritium Extraction Facility (TEF) at Savannah River Site • Processing the tritium at the Savannah River Site, which includes removal of nonhydrogen species and separation of the hydrogen isotopes of protium, deuterium and tritium.

  13. LUNA: Nuclear astrophysics underground

    SciTech Connect (OSTI)

    Best, A.

    2015-02-24

    Underground nuclear astrophysics with LUNA at the Laboratori Nazionali del Gran Sasso spans a history of 20 years. By using the rock overburden of the Gran Sasso mountain chain as a natural cosmic-ray shield very low signal rates compared to an experiment on the surface can be tolerated. The cross sectons of important astrophysical reactions directly in the stellar energy range have been successfully measured. In this proceeding we give an overview over the key accomplishments of the experiment and an outlook on its future with the expected addition of an additional accelerator to the underground facilities, enabling the coverage of a wider energy range and the measurement of previously inaccessible reactions.

  14. CHARACTERIZATION OF INDIVIDUAL CHEMICAL REACTIONS CONSUMING ACID DURING NUCLEAR WASTE PROCESSING AT THE SAVANNAH RIVER SITE - 136B

    SciTech Connect (OSTI)

    Koopman, D.; Pickenheim, B.; Lambert, D.; Newell, J.; Stone, M.

    2009-09-02

    Conversion of legacy radioactive high-level waste at the Savannah River Site into a stable glass waste form involves a chemical pretreatment process to prepare the waste for vitrification. Waste slurry is treated with nitric and formic acids to achieve certain goals. The total quantity of acid added to a batch of waste slurry is constrained by the catalytic activity of trace noble metal fission products in the waste that can convert formic acid into hydrogen gas at many hundreds of times the radiolytic hydrogen generation rate. A large block of experimental process simulations were performed to characterize the chemical reactions that consume acid prior to hydrogen generation. The analysis led to a new equation for predicting the quantity of acid required to process a given volume of waste slurry.

  15. Method of controlling fusion reaction rates

    DOE Patents [OSTI]

    Kulsrud, R.M.; Furth, H.P.; Valeo, E.J.; Goldhaber, M.

    1983-05-09

    This invention relates to a method of controlling the reaction rates in a nuclear fusion reactor; and more particularly, to the use of polarized nuclear fuel.

  16. Migration of Nuclear Shell Gaps Studied in the d({sup 24}Ne,p{gamma}){sup 25}Ne Reaction

    SciTech Connect (OSTI)

    Catford, W. N.; Timis, C. N.; Baldwin, T. D.; Gelletly, W.; Pain, S. D.; Lemmon, R. C.; Pucknell, V. P. E.; Warner, D. D.; Labiche, M.; Orr, N. A.; Achouri, N. L.; Chapman, R.; Amzal, N.; Burns, M.; Liang, X.; Spohr, K.; Freer, M.; Ashwood, N. I.

    2010-05-14

    The transfer of neutrons onto {sup 24}Ne has been measured using a reaccelerated radioactive beam of {sup 24}Ne to study the (d,p) reaction in inverse kinematics. The unusual raising of the first 3/2{sup +} level in {sup 25}Ne and its significance in terms of the migration of the neutron magic number from N=20 to N=16 is put on a firm footing by confirmation of this state's identity. The raised 3/2{sup +} level is observed simultaneously with the intruder negative parity 7/2{sup -} and 3/2{sup -} levels, providing evidence for the reduction in the N=20 gap. The coincident gamma-ray decays allowed the assignment of spins as well as the transferred orbital angular momentum. The excitation energy of the 3/2{sup +} state shows that the established USD shell model breaks down well within the sd model space and requires a revised treatment of the proton-neutron monopole interaction.

  17. Spallation process with simultaneous multi-particle emission in nuclear evaporation

    SciTech Connect (OSTI)

    Santos, B. M.

    2013-05-06

    High energy probes have been used currently to explore nuclear reaction mechanism and nuclear structure. The spallation process governs the reaction process around 1 GeV energy regime. A new aspect introduced here to describe the nuclear reaction is the in-medium nucleonnucleon collision framework. The nucleon-nucleon scattering is kinematically treated by using an effective mass to represent the nuclear binding. In respect to the evaporation phase of the reaction, we introduce the simultaneous particles emission decay. This process becomes important due to the rise of new channels at high excitation energy regime of the compound nucleus. As results, the particles yields in the rapid and evaporation phases are obtained and compared to experimental data. The effect and relevance of these simultaneous emission processes in the evaporation chain is also discussed.

  18. Sleeve reaction chamber system

    SciTech Connect (OSTI)

    Northrup, M. Allen; Beeman, Barton V.; Benett, William J.; Hadley, Dean R.; Landre, Phoebe; Lehew, Stacy L.; Krulevitch, Peter A.

    2009-08-25

    A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

  19. Argonne's Major Nuclear Energy Milestones | Argonne National...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Argonne's Major Nuclear Energy Milestones Argonne's reactor tree Argonne's reactor tree December 2, 1942: Enrico Fermi's team produces the world's first sustained nuclear chain ...

  20. Nuclear Data Sheets for A = 222

    SciTech Connect (OSTI)

    Singh, S.; Tuli, J.; Jain,A.K.; Tuli,J.K.

    2011-11-01

    The ENSDF evaluation for A=222 mass chain (1996El01) has been updated on the basis of the experimental results, since September 1995 (literature cutoff date in 1996El01), from various reaction and decay studies for all nuclides in A=222 mass chain (Z=84 to 92). A new nuclide ({sup 222}Po) has since been observed. In addition, new measurements have been reported in Rn, Th and Ra nuclides. The results obtained from various theoretical studies are given as comments. The updated level and decay schemes, and experimental decay and reaction data on which they are based, are summarized and presented for all the nuclides with mass number A=222. The adopted values of level energies, level spins and parities are given, and {gamma}-ray energies, intensities, as well as other nuclear properties are presented.

  1. Absolute nuclear material assay

    DOE Patents [OSTI]

    Prasad, Manoj K.; Snyderman, Neal J.; Rowland, Mark S.

    2010-07-13

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  2. Absolute nuclear material assay

    DOE Patents [OSTI]

    Prasad, Manoj K.; Snyderman, Neal J.; Rowland, Mark S.

    2012-05-15

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  3. Charge separation in photoredox reactions. Final report

    SciTech Connect (OSTI)

    Kevan, L.

    1993-07-15

    The structural aspects controlling charge separation in molecular photoionization reactions in organized molecular assemblies involving micelles, reverse micelles and vesicles are being studied by optical and electron magnetic resonance techniques including the time domain technique of deuterium electron spin echo modulation (ESEM) and matrix proton electron nuclear double resonance (ENDOR) to measure weak electron-nuclear dipolar interactions. ESEM and matrix ENDOR are particularly well adapted to the study of disordered systems as exemplified by micelles and vesicles. The photoionization yields of alkylphenothiazines in micelles and vesicles have been shown to depend on the alkyl chain length and to correlate with relative distances from the surfactant assembly interface measured by deuterium ESEM and matrix proton ENDOR. The photoionization of alkylmethylviologens versus alkyl chain length has also been studied in vesicles, micelles and reverse micelles. Nitroxide spin probes have been used to study the degree of water penetration into mixed ionic/nonionic poly(ethylene oxide) and cationic/anionic micelles by using ESEM methods and selectively deuterated surfactants. The effect of urea interaction at micellar interfaces on the interface hydration has also been evaluated by studying nitroxide probes with ESEM.

  4. Laser amplifier chain

    DOE Patents [OSTI]

    Hackel, R.P.

    1992-10-20

    A laser amplifier chain has a plurality of laser amplifiers arranged in a chain to sequentially amplify a low-power signal beam to produce a significantly higher-power output beam. Overall efficiency of such a chain is improved if high-gain, low efficiency amplifiers are placed on the upstream side of the chain where only a very small fraction of the total pumped power is received by the chain and low-gain, high-efficiency amplifiers are placed on the downstream side where a majority of pumping energy is received by the chain. 6 figs.

  5. Laser amplifier chain

    DOE Patents [OSTI]

    Hackel, Richard P.

    1992-01-01

    A laser amplifier chain has a plurality of laser amplifiers arranged in a chain to sequentially amplify a low-power signal beam to produce a significantly higher-power output beam. Overall efficiency of such a chain is improved if high-gain, low efficiency amplifiers are placed on the upstream side of the chain where only a very small fraction of the total pumped power is received by the chain and low-gain, high-efficiency amplifiers are placed on the downstream side where a majority of pumping energy is received by the chain.

  6. Office of Nuclear Energy Doe/ne-0143

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    energy Office of Nuclear Energy Doe/ne-0143 Table of Contents Lesson 1 - Energy Basics Lesson 2 - Electricity Basics Lesson 3 - Atoms and Isotopes Lesson 4 - Ionizing Radiation Lesson 5 - Fission, Chain Reactions Lesson 6 - Atom to Electricity Lesson 7 - Waste from Nuclear Power Plants Lesson 8 - Concerns Lesson 9 - Energy and You 1 Lesson 1 Energy Basics ENERGY BASICS What is energy? Energy is the ability to do work. But what does that really mean? You might think of work as cleaning your room,

  7. Nuclear Astrophysics - Research - Cyclotron Institute

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    REACTION. Nuclear astrophysics research measures reaction rates for proton-capture reactions such as 7Be(p,)8B, which is the sole source of high energy neutrinos from our sun. ...

  8. Probable new type of reaction mechanism: Double. cap alpha. direct...

    Office of Scientific and Technical Information (OSTI)

    Language: English Subject: 73 NUCLEAR PHYSICS AND RADIATION PHYSICS; BERYLLIUM 8; CLUSTER MODEL; BISMUTH 209 TARGET; CARBON 12 REACTIONS; MULTI-NUCLEON TRANSFER REACTIONS; ALPHA ...

  9. Following the Transient Reactions in Lithium-Sulfur Batteries...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Following the Transient Reactions in Lithium-Sulfur Batteries Using an In Situ Nuclear ... cell electrochemical reactions in Li-S batteries using a microbattery design Interphase ...

  10. Microfabricated electrochemiluminescence cell for chemical reaction detection

    DOE Patents [OSTI]

    Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.

    2003-01-01

    A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  11. Radiative capture reactions in astrophysics

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Brune, Carl R.; Davids, Barry

    2015-08-07

    Here, the radiative capture reactions of greatest importance in nuclear astrophysics are identified and placed in their stellar contexts. Recent experimental efforts to estimate their thermally averaged rates are surveyed.

  12. CHAIN REACTING SYSTEM

    DOE Patents [OSTI]

    Fermi, E.; Leverett, M.C.

    1958-06-01

    A nuclear reactor of the gas-cooled, graphitemoderated type is described. In this design, graphite blocks are arranged in a substantially cylindrical lattice having vertically orienied coolant channels in which uranium fuel elements having through passages are disposed. The active lattice is contained within a hollow body. such as a steel shell, which, in turn, is surrounded by water and concrete shields. Helium is used as the primary coolant and is circulated under pressure through the coolant channels and fuel elements. The helium is then conveyed to heat exchangers, where its heat is used to produce steam for driving a prime mover, thence to filtering means where radioactive impurities are removed. From the filtering means the helium passes to a compressor and an after cooler and is ultimately returned to the reactor for recirculation. Control and safety rods are provided to stabilize or stop the reaction. A space is provided between the graphite lattice and the internal walls of the shell to allow for thermal expansion of the lattice during operation. This space is filled with a resilient packing, such as asbestos, to prevent the passage of helium.

  13. Silicon-based sleeve devices for chemical reactions

    DOE Patents [OSTI]

    Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.

    1996-12-31

    A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.

  14. Silicon-based sleeve devices for chemical reactions

    DOE Patents [OSTI]

    Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.

    1996-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  15. Influence of vertex coulomb effects on peripheral partial amplitudes for the consecutive transfer of two protons in A(X,Y)B peripheral nuclear reactions induced by light loosely bound (exotic) nuclei at low energies

    SciTech Connect (OSTI)

    Blokhintsev, L. D. [Moscow State University, Skobeltsyn Institute of Nuclear Physics (Russian Federation); Mukhamedzhanov, A. M. [Texas A and M University, MS 3366, Cyclotron Institute (United States); Tadzhibaeva, D. Kh.; Yarmukhamedov, R., E-mail: rakhim@inp.u [Uzbek Academy of Sciences, Institute of Nuclear Physics (Uzbekistan)

    2010-07-15

    The amplitude for the consecutive transfer of two protons in A(X, Y)B peripheral nuclear reactions induced by loosely bound light (exotic) nuclei and described by a nonrelativistic square Feynman diagram in which the first transferred proton is loosely bound while the second one in tightly bound is considered. It is shown that the inclusion of three-ray Coulomb vertex effects in the square diagram leads to the appearance of an additional 'Coulomb' singularity in the variable cos {theta} (here, {theta} is the c.m. scattering angle), this singularity being closer to the physical domain, -1 {<=} cos {theta} {<=} 1, than the well-known 'triangle' singularities corresponding to the amplitude of the square diagram in which the internal line is contracted. The asymptotic behavior of the partial-wave amplitudes for l >> 1 that are generated by the aforementioned singularities is found explicitly. A comparative analysis of the resulting partial-wave amplitudes for l >> 1 is performed for specific peripheral nuclear reactions induced by {sup 8}B and {sup 12}N ions at various energies.

  16. Impacts to the ethylene supply chain from a hurricane disruption.

    SciTech Connect (OSTI)

    Sun, Amy Cha-Tien; Downes, Paula Sue; Heinen, Russell; Welk, Margaret Ellen

    2010-03-01

    Analysis of chemical supply chains is an inherently complex task, given the dependence of these supply chains on multiple infrastructure systems (e.g., the petroleum sector, transportation, etc.). This effort requires data and information at various levels of resolution, ranging from network-level distribution systems to individual chemical reactions. Sandia National Laboratories (Sandia) has integrated its existing simulation and infrastructure analysis capabilities with chemical data models to analyze the chemical supply chains of several nationally critical chemical commodities. This paper describes how Sandia models the ethylene supply chain; that is, the supply chain for the most widely used raw material for plastics production including a description of the types of data and modeling capabilities that are required to represent the ethylene supply chain. The paper concludes with a description of Sandia's use the model to project how the supply chain would be affected by and adapt to a disruptive scenario hurricane.

  17. Powering the Nuclear Navy | National Nuclear Security Administration |

    National Nuclear Security Administration (NNSA)

    (NNSA) Programs Powering the Nuclear Navy The Naval Nuclear Propulsion Program provides militarily effective nuclear propulsion plants and ensures their safe, reliable and long-lived operation. This mission requires the combination of fully trained U.S. Navy men and women with ships that excel in endurance, stealth, speed, and independence from supply chains. The Naval Nuclear Propulsion Program provides militarily effective nuclear propulsion plants and ensures their safe, reliable and

  18. Nuclear Transparency and Single Particle Spectral Functions from Quasielastic A(e,e'p) Reactions up to Q2=8.1 GeV2

    SciTech Connect (OSTI)

    David McKee

    2003-05-01

    High statistics elastic and quasielastic scattering measurements were performed on hydrogen, deuterium, carbon, and iron at squared momentum transfers up to 8.1 GeV2. Both the nuclear transparency and the single particle spectral functions were extracted by means of comparison with a Plane- Wave Impulse Approximation calculation. Our data provide no evidence of the onset of color transparency within our kinematic range.

  19. The U.S. Nuclear Data Network: Summary of the twenty-first meeting

    SciTech Connect (OSTI)

    1996-08-01

    The following progress reports and related documents from the members of the US Nuclear Data Network (USNDN) are included at attachments: INEL Decay Data and Mass-chain Evaluation Project; Decay-data Evaluation Project; Isotopes Project Report; Report on High-spin Data Evaluations; The NNDC Activity Report, Parts A and B; Nuclear Science References (NSR) Task Force Report; Status of Mass Chains A = 1 to 266; Nuclear Data Project Activity Report; and TUNL Nuclear Data Evaluation Project Report; The progress report of the Center for Nuclear Information Technology; An Overview of the USNDN; Evaluated Nuclear Structure Data File-Status; Report on High-spin Evaluations for ENSDF since November 1994; The High-spin Data and the Workshop on Data Analysis; Decay Data Evaluation Project; Compilation of High Energy Heavy-ion and Electron Interaction Data; Dissemination/code development update; 8th Edition of the Table of Isotopes/VuENSDF; Bits of Power-Issues in the Transborder Flow of Scientific and Technical Data; Data activities at the Center for Nuclear Information Technology (CNIT), San Jose State University; The Agenda and the Minutes of the Formats and Procedures Subcommittee of the NSDD; A status report on the US Nuclear Reaction Data Network (USNRDN); Coordination/Cooperation and Communication as applied to the USNDN; Nuclear Structure Data Evaluations: Issues/Concerns; Electronic Publishing of Nuclear Data; The status of the Nuclear Astrophysics Data Project; and Nuclear Astrophysics Data needs for A=3-20/Possible contributions by TUNL. The attendees formed the three Discussion Groups. The charge to these Discussion Groups was how to achieve the goal of the USNDN to make the ENSDF and the NSR the best nuclear structure and bibliographic databases available, while maintaining a proper balance between evaluations and data dissemination.

  20. Supply Chain | NISAC

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    NISACSupply Chain content top National Transportation Fuels Model Posted by tmanzan on Oct 3, 2012 in | Comments 0 comments National Transportation Fuels Model This model informs analyses of the availability of transportation fuel in the event the fuel supply chain is disrupted. The portion of the fuel supply system represented by the network model (see figure) spans from oil fields to fuel distribution terminals. Different components of this system (e.g., crude oil import terminals, refineries,

  1. Towards consistent nuclear models and comprehensive nuclear data...

    Office of Scientific and Technical Information (OSTI)

    in terms of compound nucleus reaction theory from neutron separation energy to continuum. ... Subject: 73; CROSS SECTIONS; ENERGY RANGE; FISSION; NEUTRON SEPARATION ENERGY; NUCLEAR ...

  2. Microfabricated sleeve devices for chemical reactions

    DOE Patents [OSTI]

    Northrup, M. Allen

    2003-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  3. Pulsed deuterium lithium nuclear reactor

    SciTech Connect (OSTI)

    Fischer, A.G.

    1980-01-08

    A nuclear reactor that burns hydrogen bomb material 6-lithium deuterotritide to helium in successive microexplosions which are ignited electrically and enclosed by this same molten material, and that permits the conversion of the reaction heat into useful electrical power. A specially-constructed high-current pulse machine is discharged via a thermally-preformed highly conducting path through a mass of the molten salt 6lid1-xtx (0nuclear fire is extinguished in the surrounding cold matter. The energy set free is insufficient to convert the blanket into a hot plasma in which chain reactions could propagate and escalate. The liquid blanket also serves as a neutron radiation shield. The shock wave is attenuated in it by a curtain of rising deuterium bubbles. The heat shock is buffered by partial melting of the external solid crust. The reaction heat is carried by the liquid metal of the external cooling jacket to the heat exchanger of the associated turbo-generator. Every few seconds, a new pulse can take place.

  4. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices (Conference...

    Office of Scientific and Technical Information (OSTI)

    Resource Relation: Conference: Presented at: Transport Phenomena in Micro and Nano Devices, Kona Coast, HI (US), 10172004--10212004; Other Information: PBD: 28 Sep 2004 ...

  5. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    McInerney, Peter; Adams, Paul; Hadi, Masood Z.

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Errormore » rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less

  6. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices (Conference...

    Office of Scientific and Technical Information (OSTI)

    compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum ...

  7. Electrochemical Branched-DNA Assay for Polymerase Chain Reaction...

    Office of Scientific and Technical Information (OSTI)

    square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct ...

  8. Chain Reaction Innovations Business Mentor Solicitation | Argonne National

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Laboratory Innovations Business Mentor Solicitation PDF icon 2016_05_24_CRI_Business_Mentor_Solicitation_JWW_5bd

  9. NNSA Contract Reform in Action: Supply Chain Management Center | National

    National Nuclear Security Administration (NNSA)

    Nuclear Security Administration | (NNSA) Contract Reform in Action: Supply Chain Management Center December 22, 2009 As part of NNSA's commitment to being a responsible steward of tax dollars, NNSA Administrator Thomas D'Agostino (then the head of Defense Programs) created the Supply Chain Management Center (SCMC) in 2006 and selected Honeywell, operator of the Kansas City Plant, as the lead contractor for managing the initiative. Since Management and Operating (M&O) contractors spend

  10. Supply Chain Management Center event highlights how small businesses can

    National Nuclear Security Administration (NNSA)

    help NNSA carry out its missions | National Nuclear Security Administration | (NNSA) Supply Chain Management Center event highlights how small businesses can help NNSA carry out its missions Thursday, February 18, 2016 - 11:06am NNSA Blog The Supply Chain Management Center (SCMC) has been an important tool for NNSA to save taxpayer dollars. At the event on Feb. 18, NNSA leadership and the New Mexico congressional delegation were well represented. From left, Scott Bissen, SCMC Director; Rep.

  11. The Role of the Sellafield Ltd Centres of Expertise in Engaging with the Science, Environment and Technology Supply Chain and University Sector to Support Site Operations and Decommissioning in the UK Nuclear Industry - 13018

    SciTech Connect (OSTI)

    Butcher, Ed; Connor, Donna; Keighley, Debbie

    2013-07-01

    The development and maintenance of the broad range of the highly technical skills required for safe and successful management of nuclear sites is of vital importance during routine operations, decommissioning and waste treatment activities.. In order to maintain a core team of technical experts, across all of the disciplines required for these tasks, the approach which has been taken by the Sellafield Ltd has been the formation of twenty five Centres of Expertise (CoE), each covering key aspects of the technical skills required for nuclear site operations. Links with the Specialist University Departments: The CoE leads are also responsible for establishing formal links with university departments with specialist skills and facilities relevant to their CoE areas. The objective of these links is to allow these very specialist capabilities within the university sector to be more effectively utilized by the nuclear industry, which benefits both sectors. In addition to the utilization of specialist skills, the university links are providing an important introduction to the nuclear industry for students and researchers. This is designed to develop the pipeline of potential staff, who will be required in the future by both the academic and industrial sectors. (authors)

  12. Interplay between compound and fragments aspects of nuclear fission...

    Office of Scientific and Technical Information (OSTI)

    aspects of nuclear fission and heavy-ion reaction Citation Details In-Document Search Title: Interplay between compound and fragments aspects of nuclear fission and ...

  13. METHOD OF SUSTAINING A NEUTRONIC CHAIN REACTING SYSTEM

    DOE Patents [OSTI]

    Fermi, E.; Leverett, M.C.

    1957-11-12

    This patent relates to neutronic reactors and a method of sustainlng a chain reaction. The reactor shown in the patent for carrying out the method is the gas-cooled type comprised of a solid moderator having a plurality of passages therethrough for receiving bodies of fissionable material. In carrying out the method, the reactor is loaded by inserting in the passages fuel elements and moderator material in a proportion to sustain a chain reaction As the reproduction ratio decreases below the desired fiiaire due to impurities formed during operation of the reactor, the moderator material is gradually replaced with additional fuel material to maintain the reproduction ratio above unity.

  14. containers | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    containers NNSA Co-Hosts Nuclear Security Summit Workshop on Maritime Security with UK WASHINGTON - This week, the Department of Energy's National Nuclear Security Administration (DOE/NNSA) and the U.K. Department of Energy and Climate Change concluded a workshop at Wilton Park, United Kingdom, on the growing challenge of securing the global maritime supply chain. In

  15. POWER GENERATION FROM LIQUID METAL NUCLEAR FUEL

    DOE Patents [OSTI]

    Dwyer, O.E.

    1958-12-23

    A nuclear reactor system is described wherein the reactor is the type using a liquid metal fuel, such as a dispersion of fissile material in bismuth. The reactor is designed ln the form of a closed loop having a core sectlon and heat exchanger sections. The liquid fuel is clrculated through the loop undergoing flssion in the core section to produce heat energy and transferrlng this heat energy to secondary fluids in the heat exchanger sections. The fission in the core may be produced by a separate neutron source or by a selfsustained chain reaction of the liquid fuel present in the core section. Additional auxiliary heat exchangers are used in the system to convert water into steam which drives a turbine.

  16. Monte Carlo without chains

    SciTech Connect (OSTI)

    Chorin, Alexandre J.

    2007-12-12

    A sampling method for spin systems is presented. The spin lattice is written as the union of a nested sequence of sublattices, all but the last with conditionally independent spins, which are sampled in succession using their marginals. The marginals are computed concurrently by a fast algorithm; errors in the evaluation of the marginals are offset by weights. There are no Markov chains and each sample is independent of the previous ones; the cost of a sample is proportional to the number of spins (but the number of samples needed for good statistics may grow with array size). The examples include the Edwards-Anderson spin glass in three dimensions.

  17. TUNL Nuclear Data Project

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Energy Levels of Light Nuclei, A = 3 - 20 Nuclear Data Evaluation Project Triangular Universities Nuclear Laboratory TUNL Nuclear Data Evaluation Home Page Information on mass chains and nuclides 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Group Info Publications HTML General Tables Level Diagrams Tables of EL's NSR Key# Retrieval ENSDF Excitation Functions Thermal N Capt. G.S. Decays TUNL Dissertations NuDat at BNL Useful Links Citation Examples Home Sitemap Directory Email Us Search WWW

  18. Research in theoretical nuclear and neutrino physics. Final report

    Office of Scientific and Technical Information (OSTI)

    ANNIHILATION; FLAVOR MODEL; SUPERNOVAE; QUANTUM CHROMODYNAMICS; HEAVY ION REACTIONS; SUN; NUCLEAR THEORY; CONVERSION; CHARM PARTICLES; PROGRESS REPORT; NONLUMINOUS MATTER; STAR...

  19. Multiple-Reheat Brayton Cycles for Nuclear Power Conversion with...

    Office of Scientific and Technical Information (OSTI)

    Volume: 144; Journal Issue: 3; Other Information: Copyright (c) 2006 American Nuclear Society (ANS), United States, ... CAPITALIZED COST; CHEMICAL REACTIONS; ...

  20. Nuclear Reactions and Stellar Evolution: Unified Dynamics

    SciTech Connect (OSTI)

    Bauer, W.; Strother, T.

    2007-10-26

    Motivated by the success of kinetic theory in the description of observables in intermediate and high energy heavy ion collisions, we use kinetic theory to model the dynamics of collapsing iron cores in type II supernova explosions. The algorithms employed to model the collapse, some preliminary results and predictions, and the future of the code are discussed.

  1. Nuclear Science Division: 1993 Annual report

    SciTech Connect (OSTI)

    Myers, W.D.

    1994-06-01

    This report describes the activities of the Nuclear Science Division for the 1993 calendar year. This was another significant year in the history of the Division with many interesting and important accomplishments. Activities for the following programs are covered here: (1) nuclear structure and reactions program; (2) the Institute for Nuclear and Particle Astrophysics; (3) relativistic nuclear collisions program; (4) nuclear theory program; (5) nuclear data evaluation program, isotope project; and (6) 88-inch cyclotron operations.

  2. Building a Universal Nuclear Energy Density Functional

    SciTech Connect (OSTI)

    Bertulani, Carlos A.

    2014-09-10

    This grant had two components: Density functional theory and pairing and Nuclear reactions. This final report summarizes the activities for this SciDAC-2 project.

  3. Nuclear Data Sheets for A = 99

    SciTech Connect (OSTI)

    Browne, E.; Tuli,J.K.

    2011-02-01

    The evaluators present in this publication spectroscopic data and level schemes from radioactive decay and nuclear reactions studies for all isobars with mass number A = 99.

  4. Nuclear Data Sheets for A=246

    SciTech Connect (OSTI)

    Browne, E. .; Tuli, J.; Browne,E.; Tuli,J.K.

    2011-07-01

    The evaluators present in this publication spectroscopic data and level schemes from radioactive decay and nuclear reaction studies for all nuclei with mass number A = 246.

  5. Microsoft Word - Nuclear_Astrophysics_Summary

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and ATLAS S. Almaraz-Calderon (ANL): Fusion Reactions in Nuclear Astrophysics: The MUSIC Approach P. Collon (Notre Dame): AMS for astrophysics, p-process work and other...

  6. Nuclear Structure and Nuclear Reactions | Argonne Leadership Computing

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Facility ADLB (Asynchronous Dynamic Load-Balancing) version of GFMC The ADLB (Asynchronous Dynamic Load-Balancing) version of GFMC was used to make calculations of 12C with a complete Hamiltonian (two- and three-nucleon potential AV18+IL7) on 32,000 processors of Intrepid. These are believed to be the best converged ab initio calculations of 12^C ever made. The computed binding energy is 93.5(6) MeV compared to the experimental value of 92.16 MeV and the point rms radius is 2.35 fm vs 2.33

  7. Nuclear Structure and Nuclear Reactions | Argonne Leadership Computing

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Facility Slice of the translationally-invariant proton hexadecapole density of the ground state of 8Li, Slice of the translationally-invariant proton hexadecapole density of the ground state of 8Li, a nucleus with 3 protons and 5 neutrons. The results were calculated in the ab initio no core shell model with a realistic two-nucleon interaction. C. Cockrell, J.P. Vary and P. Maris, "Lithium isotopes within the ab initio no-core full configuration approach," Phys. Rev. C 86, 034325

  8. Evaluated Nuclear (reaction) Data from the Evaluated Nuclear...

    Office of Scientific and Technical Information (OSTI)

    The current version is ENDFB VII.0, released in 2006. Users can search ENDF via specialized interfaces, browse sub-libraries or download them as zipped files. ...

  9. Transport of triplet excitons along continuous 100 nm polyfluorene chains

    SciTech Connect (OSTI)

    Xi, Liang; Bird, Matthew; Mauro, Gina; Asaoka, Sadayuki; Cook, Andrew R.; Chen, Hung -Cheng; Miller, John R.

    2014-12-03

    Triplet excitons created in poly-2,7-(9,9-dihexyl)fluorene (pF) chains with end trap groups in solution are efficiently transported to and captured by the end groups. The triplets explore the entire lengths of the chains, even for ~100 nm long chains enabling determination of the completeness of end capping. The results show that the chains continuous: they may contain transient barriers or traps, such as those from fluctuations of dihedral angles, but are free of major defects that stop motion of the triplets. Quantitative determinations are aided by the addition of a strong electron donor, TMPD, which removes absorption bands of the end-trapped triplets. For chains having at least one end trap, triplet capture is quantitative on the 1 s timescale imposed by the use of the donor. Fractions of chains having no end traps were 0.15 for pF samples with anthraquinone (AQ) end traps and 0.063 with naphthylimide (NI) end traps. These determinations agreed with measurements by NMR for short (<40 polymer repeat units (PRU)) chains, where NMR determinations are accurate. The results find no evidence for traps or barriers to transport of triplets, and places limits on the possible presence of defects as impenetrable barriers to less than one per 300 PRU. The present results present a paradigm different from the current consensus, derived from observations of singlet excitons, that conjugated chains are divided into segments, perhaps by some kind of defects. For the present pF chains, the segmentation either does not apply to triplet excitons or is transient so that the defects are healed or surmounted in times much shorter than 1 s. Triplets on chains without end trap groups transfer to chains with end traps on a slower time scale. Rate constants for these bimolecular triplet transfer reactions were found to increase with the length of the accepting chain, as did rate constants for triplet transfer to the chains from small molecules like biphenyl. As a result, a second

  10. Transport of triplet excitons along continuous 100 nm polyfluorene chains

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Xi, Liang; Bird, Matthew; Mauro, Gina; Asaoka, Sadayuki; Cook, Andrew R.; Chen, Hung -Cheng; Miller, John R.

    2014-12-03

    Triplet excitons created in poly-2,7-(9,9-dihexyl)fluorene (pF) chains with end trap groups in solution are efficiently transported to and captured by the end groups. The triplets explore the entire lengths of the chains, even for ~100 nm long chains enabling determination of the completeness of end capping. The results show that the chains continuous: they may contain transient barriers or traps, such as those from fluctuations of dihedral angles, but are free of major defects that stop motion of the triplets. Quantitative determinations are aided by the addition of a strong electron donor, TMPD, which removes absorption bands of the end-trappedmore » triplets. For chains having at least one end trap, triplet capture is quantitative on the 1 µs timescale imposed by the use of the donor. Fractions of chains having no end traps were 0.15 for pF samples with anthraquinone (AQ) end traps and 0.063 with naphthylimide (NI) end traps. These determinations agreed with measurements by NMR for short (<40 polymer repeat units (PRU)) chains, where NMR determinations are accurate. The results find no evidence for traps or barriers to transport of triplets, and places limits on the possible presence of defects as impenetrable barriers to less than one per 300 PRU. The present results present a paradigm different from the current consensus, derived from observations of singlet excitons, that conjugated chains are divided into “segments,” perhaps by some kind of defects. For the present pF chains, the segmentation either does not apply to triplet excitons or is transient so that the defects are healed or surmounted in times much shorter than 1 µs. Triplets on chains without end trap groups transfer to chains with end traps on a slower time scale. Rate constants for these bimolecular triplet transfer reactions were found to increase with the length of the accepting chain, as did rate constants for triplet transfer to the chains from small molecules like biphenyl. As a

  11. Nuclear Science References Database

    SciTech Connect (OSTI)

    Pritychenko, B.; Běták, E.; Singh, B.; Totans, J.

    2014-06-15

    The Nuclear Science References (NSR) database together with its associated Web interface, is the world's only comprehensive source of easily accessible low- and intermediate-energy nuclear physics bibliographic information for more than 210,000 articles since the beginning of nuclear science. The weekly-updated NSR database provides essential support for nuclear data evaluation, compilation and research activities. The principles of the database and Web application development and maintenance are described. Examples of nuclear structure, reaction and decay applications are specifically included. The complete NSR database is freely available at the websites of the National Nuclear Data Center (http://www.nndc.bnl.gov/nsr) and the International Atomic Energy Agency (http://www-nds.iaea.org/nsr)

  12. Public Affairs | National Nuclear Security Administration | (NNSA)

    National Nuclear Security Administration (NNSA)

    Public Affairs The Naval Nuclear Propulsion Program provides militarily effective nuclear propulsion plants and ensures their safe, reliable and long-lived operation. This mission requires the combination of fully trained U.S. Navy men and women with ships that excel in endurance, stealth, speed, and independence from supply chains. The Naval Nuclear Propulsion Program provides militarily effective nuclear propulsion plants and ensures their safe, reliable and long-lived operation. This mission

  13. Public Affairs | National Nuclear Security Administration | (NNSA)

    National Nuclear Security Administration (NNSA)

    Public Affairs The Naval Nuclear Propulsion Program provides militarily effective nuclear propulsion plants and ensures their safe, reliable and long-lived operation. This mission requires the combination of fully trained U.S. Navy men and women with ships that excel in endurance, stealth, speed, and independence from supply chains. The Naval Nuclear Propulsion Program provides militarily effective nuclear propulsion plants and ensures their safe, reliable and long-lived operation. This mission

  14. Nuclear Science

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Science Nuclear Science Experimental and theoretical nuclear research carried out at NERSC is driven by the quest for improving our understanding of the building blocks of...

  15. Nuclear Astrophysics

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear & Uranium Glossary › FAQS › Overview Data Status of U.S. nuclear outages (interactive) Nuclear power plants Uranium & nuclear fuel Spent nuclear fuel All nuclear data reports Analysis & Projections Major Topics Most popular Nuclear plants and reactors Projections Recurring Uranium All reports Browse by Tag Alphabetical Frequency Tag Cloud Current Issues & Trends See more › U.S. nuclear outages this summer were higher than in summer 2015

  16. Nuclear Forensics

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    nuclear forensics Nuclear Forensics AMS is a Powerful Tool for Nuclear Forensics Nuclear forensics, which can be applied to both interdicted materials and debris from a nuclear explosion, is the application of laboratory analysis and interpretation to provide technical conclusions (provenance, design, etc.) about a nuclear device or interdicted nuclear material. Nuclear forensic analysts can build confidence in their conclusions by employing multiple signatures that collectively minimize the

  17. Advanced Nuclear Reactors | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Advanced Nuclear Reactors Advanced Nuclear Reactors Turbulent Flow of Coolant in an Advanced Nuclear Reactor Visualizing Coolant Flow in Sodium Reactor Subassemblies Sodium-cooled Fast Reactor (SFR) Coolant Flow At the heart of a nuclear power plant is the reactor. The fuel assembly is placed inside a reactor vessel where all the nuclear reactions occur to produce the heat and steam used for power generation. Nonetheless, an entire power plant consists of many other support components and key

  18. Nuclear Facilities

    Broader source: Energy.gov [DOE]

    The nuclear sites list and map shows how DOE nuclear operations are mostly divided between nuclear weapons stockpile maintenance, research and environmental cleanup. The operations are performed within several different facilities supporting nuclear reactor operations, nuclear research, weapons disassembly, maintenance and testing, hot cell operations, nuclear material storage and processing and waste disposal.

  19. Chemical Supply Chain Analysis | NISAC

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    NISACCapabilitiesChemical Supply Chain Analysis content top Chemical Supply Chain Analysis NISAC has developed a range of capabilities for analyzing the consequences of disruptions to the chemical manufacturing industry. Each capability provides a different but complementary perspective on the questions of interest-questions like Given an event, will the entire chemical sector be impacted or just parts? Which chemicals, plants, and complexes could be impacted? In which regions of the country?

  20. Nuclear Theory and Applications progress report, January 1, 1989-- April 1, 1990

    SciTech Connect (OSTI)

    Strottman, D.D.; Mutschlecner, A.D.

    1990-12-01

    This report contains brief papers on the following topics: data evaluation and libraries; data processing; nuclear applications; reactions; fission; and nuclear structure.

  1. gms | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    gms NNSA Co-Hosts Nuclear Security Summit Workshop on Maritime Security with UK WASHINGTON - This week, the Department of Energy's National Nuclear Security Administration (DOE/NNSA) and the U.K. Department of Energy and Climate Change concluded a workshop at Wilton Park, United Kingdom, on the growing challenge of securing the global maritime supply chain. In... NNSA Provides Tajikistan Specialized Vehicles to Transport Radiological Materials NNSA Program Manager Nick Cavellero, right, and NRSA

  2. Nuclear Fabrication Consortium

    SciTech Connect (OSTI)

    Levesque, Stephen

    2013-04-05

    This report summarizes the activities undertaken by EWI while under contract from the Department of Energy (DOE) – Office of Nuclear Energy (NE) for the management and operation of the Nuclear Fabrication Consortium (NFC). The NFC was established by EWI to independently develop, evaluate, and deploy fabrication approaches and data that support the re-establishment of the U.S. nuclear industry: ensuring that the supply chain will be competitive on a global stage, enabling more cost-effective and reliable nuclear power in a carbon constrained environment. The NFC provided a forum for member original equipment manufactures (OEM), fabricators, manufacturers, and materials suppliers to effectively engage with each other and rebuild the capacity of this supply chain by : • Identifying and removing impediments to the implementation of new construction and fabrication techniques and approaches for nuclear equipment, including system components and nuclear plants. • Providing and facilitating detailed scientific-based studies on new approaches and technologies that will have positive impacts on the cost of building of nuclear plants. • Analyzing and disseminating information about future nuclear fabrication technologies and how they could impact the North American and the International Nuclear Marketplace. • Facilitating dialog and initiate alignment among fabricators, owners, trade associations, and government agencies. • Supporting industry in helping to create a larger qualified nuclear supplier network. • Acting as an unbiased technology resource to evaluate, develop, and demonstrate new manufacturing technologies. • Creating welder and inspector training programs to help enable the necessary workforce for the upcoming construction work. • Serving as a focal point for technology, policy, and politically interested parties to share ideas and concepts associated with

  3. Psychological aspects of nuclear war

    SciTech Connect (OSTI)

    Thompson, J.

    1985-01-01

    Exploring the nature of nuclear war, this treatise examines human reaction to nuclear disaster and accidental explosions. The discussion is based on evidence of human fallibility that has emerged from the psychology of accidents and from research into decision-making in military and political contexts. The book draws on the psychology of negotiation and conflict resolution to suggest ways in which the threat of nuclear war might be reduced.

  4. Absolute nuclear material assay using count distribution (LAMBDA) space

    DOE Patents [OSTI]

    Prasad, Mano K.; Snyderman, Neal J.; Rowland, Mark S.

    2015-12-01

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  5. Absolute nuclear material assay using count distribution (LAMBDA) space

    DOE Patents [OSTI]

    Prasad, Manoj K.; Snyderman, Neal J.; Rowland, Mark S.

    2012-06-05

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  6. Nuclear fuel element

    DOE Patents [OSTI]

    Armijo, Joseph S.; Coffin, Jr., Louis F.

    1980-04-29

    A nuclear fuel element for use in the core of a nuclear reactor is disclosed and has an improved composite cladding comprised of a moderate purity metal barrier of zirconium metallurgically bonded on the inside surface of a zirconium alloy tube. The metal barrier forms a shield between the alloy tube and a core of nuclear fuel material enclosed in the composite cladding. There is a gap between the cladding and the core. The metal barrier forms about 1 to about 30 percent of the thickness of the composite cladding and has low neutron absorption characteristics. The metal barrier serves as a preferential reaction site for gaseous impurities and fission products and protects the alloy tube from contact and reaction with such impurities and fission products. Methods of manufacturing the composite cladding are also disclosed.

  7. Nuclear fuel element

    DOE Patents [OSTI]

    Armijo, Joseph S.; Coffin, Jr., Louis F.

    1983-01-01

    A nuclear fuel element for use in the core of a nuclear reactor is disclosed and has a composite cladding having a substrate and a metal barrier metallurgically bonded on the inside surface of the substrate so that the metal barrier forms a shield between the substrate and the nuclear fuel material held within the cladding. The metal barrier forms about 1 to about 30 percent of the thickness of the cladding and is comprised of a low neutron absorption metal of substantially pure zirconium. The metal barrier serves as a preferential reaction site for gaseous impurities and fission products and protects the substrate from contact and reaction with such impurities and fission products. The substrate of the composite cladding is selected from conventional cladding materials and preferably is a zirconium alloy. Methods of manufacturing the composite cladding are also disclosed.

  8. [Experimental nuclear physics]. Final report

    SciTech Connect (OSTI)

    1991-04-01

    This is the final report of the Nuclear Physics Laboratory of the University of Washington on work supported in part by US Department of Energy contract DE-AC06-81ER40048. It contains chapters on giant dipole resonances in excited nuclei, nucleus-nucleus reactions, astrophysics, polarization in nuclear reactions, fundamental symmetries and interactions, accelerator mass spectrometry (AMS), ultra-relativistic heavy ions, medium energy reactions, work by external users, instrumentation, accelerators and ion sources, and computer systems. An appendix lists Laboratory personnel, a Ph. D. degree granted in the 1990-1991 academic year, and publications. Refs., 41 figs., 7 tabs.

  9. nuclear security

    National Nuclear Security Administration (NNSA)

    3%2A en Shaping the future of nuclear detection http:nnsa.energy.govblogshaping-future-nuclear-detection

    Learning techniques to combat nuclear trafficking, touring the...

  10. Nuclear Science

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    and Engineering Education Sourcebook 2013 American Nuclear Society US Department of Energy Nuclear Science & Engineering Education Sourcebook 2013 North American Edition American Nuclear Society Education, Training, and Workforce Division US Department of Energy Office of Nuclear Energy Editor and Founder John Gilligan Professor of Nuclear Engineering North Carolina State University Version 5.13 Welcome to the 2013 Edition of the Nuclear Science and Engineering Education (NS&EE)

  11. Neutron multiplicity distributions for 30 MeVu sup 14 N reactions with the indicated targets

    SciTech Connect (OSTI)

    Not Available

    1992-06-01

    This report contains short papers on the following topics: Heavy ion reactions; nuclear structure and fundamental interactions; nuclear theory; atomic molecular and materials science; and superconducting cyclotron and instrumentation. (LSP)

  12. Nuclear Physics

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Physics Nuclear Physics Enabling remarkable discoveries and tools that transform our understanding of energy and matter and advance national, economic, and energy security. ...

  13. nuclear enterprise

    National Nuclear Security Administration (NNSA)

    Outlines Accomplishments in Stockpile Stewardship, Nuclear Nonproliferation, Naval Reactors and Managing the Nuclear Enterprise

    The...

  14. Novette chain design and performance

    SciTech Connect (OSTI)

    Hunt, J.T.; Speck, D.R.

    1980-12-11

    The design and performance of the Novette laser system, which is a two-beam, two-wavelength (1.05 ..mu.. and 0.53 ..mu..) target irradiation facility using phosphate glass laser chains, are discussed with information on the glass properties, controlling factors in the design selection, and projected performance with varying operating conditions. (LCL)

  15. Spent Nuclear Fuel

    U.S. Energy Information Administration (EIA) Indexed Site

    Nuclear & Uranium Glossary FAQS Overview Data Status of U.S. nuclear outages (interactive) Nuclear power plants Uranium & nuclear fuel Spent nuclear fuel All nuclear data ...

  16. Chemical Functionalization of Nanostructured Materials Using Supercritical Reaction Media

    SciTech Connect (OSTI)

    Zemanian, Thomas S.; Fryxell, Glen E.; Liu, Jun; Mattigod, Shas V.; Shin, Yongsoon; Franz, James A.; Ustyugov, Oleksiy A.; Nie, Zimin

    2001-12-15

    There exists a need for durable and thin functional coatings to utilize the afforded surface area of highly porous ceramic materials. Deposition of silane-based Self Assembled Monolayers (SAMs) has thus far been limited to maximum coverages of 4-5 molecules/nm2 and long processing times (up to 2 weeks), due to the restricted internal geometry of the substrates. Results are presented for SAMs deposited on high surface area silica from supercritical fluids (SCFs). The SAMs so produced display unprecedented coverages, high monolayer integrity, and extremely low surface defect density. Moreover, the depositions and subsequent removal of reaction byproducts are complete in a matter of minutes rather than days. Nuclear Magnetic Resonance (NMR) spectra of the surface modified silica are presented, demonstrating the SAM integrity and evolution over time. Sorption of aqueous metal ions is demonstrated, and results are given demonstrating the broad pH stability of the deposited SAMs. A chemical explanation for the enhanced deposition is posited, and the kinetics of mass transport into and out of the nanostructured spaces are discussed.Related experiments using zeolite substrates show deposition of thiol-terminated silanes to internal surfaces of 6? microporous material. After oxidation of the thiol functional group size selective chemistry was demonstrated using the produced catalyst, proving the efficacy of the supercritical reaction medium for installing functional coatings inside pores of similar diameters to the chain length of the deposited molecule[]. Comparisons are made between the response of the different substrates to the supercritical fluid-based processing, and remarks on the utility of SCF based processing of nanostructured materials are presented.

  17. Compilation of requests for nuclear data

    SciTech Connect (OSTI)

    Not Available

    1981-03-01

    A request list for nuclear data which was produced from a computerized data file by the National Nuclear Data Center is presented. The request list is given by target nucleus (isotope) and then reaction type. The purpose of the compilation is to summarize the current needs of US Nuclear Energy programs and other applied technologies for nuclear data. Requesters are identified by laboratory, last name, and sponsoring US government agency. (WHK)

  18. Evaluated Nuclear Data

    SciTech Connect (OSTI)

    Oblozinsky, P.; Oblozinsky,P.; Herman,M.; Mughabghab,S.F.

    2010-10-01

    This chapter describes the current status of evaluated nuclear data for nuclear technology applications. We start with evaluation procedures for neutron-induced reactions focusing on incident energies from the thermal energy up to 20 MeV, though higher energies are also mentioned. This is followed by examining the status of evaluated neutron data for actinides that play dominant role in most of the applications, followed by coolants/moderators, structural materials and fission products. We then discuss neutron covariance data that characterize uncertainties and correlations. We explain how modern nuclear evaluated data libraries are validated against an extensive set of integral benchmark experiments. Afterwards, we briefly examine other data of importance for nuclear technology, including fission yields, thermal neutron scattering and decay data. A description of three major evaluated nuclear data libraries is provided, including the latest version of the US library ENDF/B-VII.0, European JEFF-3.1 and Japanese JENDL-3.3. A brief introduction is made to current web retrieval systems that allow easy access to a vast amount of up-to-date evaluated nuclear data for nuclear technology applications.

  19. A,B,C`s of nuclear science

    SciTech Connect (OSTI)

    Noto, V.A.; Norman, E.B.; Chan, Yuen-Dat; Dairiki, J.; Matis, H.S.; McMahan, M.A.; Otto, R.

    1995-08-07

    This introductory level presentation contains information on nuclear structure, radioactivity, alpha decay, beta decay, gamma decay, half-life, nuclear reactions, fusion, fission, cosmic rays, and radiation protection. Nine experiments with procedures and test questions are included.

  20. Cyclotron-based nuclear science. Progress report, April 1, 1979-March 31, 1980

    SciTech Connect (OSTI)

    Not Available

    1980-06-01

    Research at the cyclotron institute is summarized. These major areas are covered: nuclear structure; nuclear reactions and scattering; polarization studies; interdisciplinary nuclear science; instrumentation and systems development; and publications. (GHT)

  1. Microscopic Theory of Fission Younes, W; Gogny, D 73 NUCLEAR...

    Office of Scientific and Technical Information (OSTI)

    Conference Conference: Presented at: Compound Nuclear Reactions and Related Topics, Fish Camp, CA, United States, Oct 22 - Oct 26, 2007 Medium: ED; Size: PDF-file: 6 pages;...

  2. Management of the National Nuclear Security Administrations...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    SUBJECT: INFORMATION: Audit Report on "Management of the National Nuclear Security ... MANAGEMENT REACTION Management generally concurred with our recommendations and identified ...

  3. Microfluidic chemical reaction circuits

    DOE Patents [OSTI]

    Lee, Chung-cheng; Sui, Guodong; Elizarov, Arkadij; Kolb, Hartmuth C.; Huang, Jiang; Heath, James R.; Phelps, Michael E.; Quake, Stephen R.; Tseng, Hsian-rong; Wyatt, Paul; Daridon, Antoine

    2012-06-26

    New microfluidic devices, useful for carrying out chemical reactions, are provided. The devices are adapted for on-chip solvent exchange, chemical processes requiring multiple chemical reactions, and rapid concentration of reagents.

  4. Nuclear Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Stationary Power/Nuclear Energy Nuclear Energy Tara Camacho-Lopez 2016-06-29T14:02:38+00:00 Contributing to the Next Generation of Nuclear Power Generation Our nuclear energy and fuel cycle technologies supports the safe, secure, reliable, and sustainable use of nuclear power worldwide through strengths in repository science, nonproliferation, safety and security, transportation, modeling, and system demonstrations. Areas of Expertise Defense Waste Management Sandia advises the U.S. Department

  5. Nuclear Energy!

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Energy Technical Assistance Nuclear Energy Technical Assistance "The United States will continue to promote the safe and secure use of nuclear power worldwide through a variety of bilateral and multilateral engagements. For example, the U.S. Nuclear Regulatory Commission advises international partners on safety and regulatory best practices, and the Department of Energy works with international partners on research and development, nuclear waste and storage, training, regulations,

  6. Reaction coordinates for electron transfer reactions

    SciTech Connect (OSTI)

    Rasaiah, Jayendran C.; Zhu Jianjun

    2008-12-07

    The polarization fluctuation and energy gap formulations of the reaction coordinate for outer sphere electron transfer are linearly related to the constant energy constraint Lagrangian multiplier m in Marcus' theory of electron transfer. The quadratic dependence of the free energies of the reactant and product intermediates on m and m+1, respectively, leads to similar dependence of the free energies on the reaction coordinates and to the same dependence of the activation energy on the reorganization energy and the standard reaction free energy. Within the approximations of a continuum model of the solvent and linear response of the longitudinal polarization to the electric field in Marcus' theory, both formulations of the reaction coordinate are expected to lead to the same results.

  7. Spin Observables in Reactions with Radioactive Ion Beams

    SciTech Connect (OSTI)

    Galindo-Uribarri, Alfredo {nmn}; Urrego Blanco, Juan Pablo

    2007-01-01

    Polarization observables in nuclear reactions with exotic nuclei will provide important information concerning structural properties of nuclei and reaction mechanisms. We are currently engaged in exploring the use of polarization observables with radioactive ion beams and in the development of a polarized cryogenic target.

  8. On reaction mechanisms involved in the deuteron–induced surrogate reactions

    SciTech Connect (OSTI)

    Avrigeanu, M.; Avrigeanu, V.; Mănăilescu, C.

    2015-02-24

    An extended analysis of the nuclear reaction mechanisms involved within deuteron interaction with nuclei, namely the breakup, stripping, pick-up, pre-equilibrium emission, and evaporation from fully equilibrated compound nucleus, is presented in order to highlight the importance of the direct mechanisms still neglected in the analysis of deuteron-induced surrogate reactions. Particularly, the dominance of the breakup mechanism at low energies around the Coulomb barrier should be considered in the case of (d,x) surrogate reactions on actinide target nuclei.

  9. Cold nuclear fusion

    SciTech Connect (OSTI)

    Tsyganov, E. N.

    2012-02-15

    Recent accelerator experiments on fusion of various elements have clearly demonstrated that the effective cross-sections of these reactions depend on what material the target particle is placed in. In these experiments, there was a significant increase in the probability of interaction when target nuclei are imbedded in a conducting crystal or are a part of it. These experiments open a new perspective on the problem of so-called cold nuclear fusion.

  10. small business | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    small business Supply Chain Management Center event highlights how small businesses can help NNSA carry out its missions The Supply Chain Management Center (SCMC) has been an important tool for NNSA to save taxpayer dollars. At the event on Feb. 18, NNSA leadership and the New Mexico congressional delegation were well represented. From left, Scott Bissen, SCMC Director; Rep. Steve Pearce (R-NM); NNSA Administrator... NNSA Demonstrates its Commitment to Small Business The National Nuclear

  11. Lieutenant General Frank G. Klotz, USAF (Ret.) | National Nuclear...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and then led a brand new 23,000-person organization that merged responsibility for all U.S. nuclear-capable bombers and land-based missiles under a single chain of command. ...

  12. More About NNSA's Naval Reactors Office | National Nuclear Security

    National Nuclear Security Administration (NNSA)

    Administration | (NNSA) More About NNSA's Naval Reactors Office The Naval Nuclear Propulsion Program provides militarily effective nuclear propulsion plants and ensures their safe, reliable and long-lived operation. This mission requires the combination of fully trained U.S. Navy men and women with ships that excel in endurance, stealth, speed, and independence from supply chains. The Naval Nuclear Propulsion Program provides militarily effective nuclear propulsion plants and ensures their

  13. Triangle Universities Nuclear Laboratory : 2011

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    LENA| Research at LENA| Reaction Rates| UNC Astrophysics| Collaborators Mohammad Ahmed Art Champagne Tom Clegg Christian Iliadis John Kelley Henry Weller Publications Recent Review INSPIRES List Useful Links LENA HIGS Nuclei: From Structure to Exploding Stars Nuclear processes generate the energy that makes stars shine and are responsible for the synthesis of the elements. When stars eject part of their matter through various means, they enrich the interstellar medium with the nuclear ashes and

  14. Triangle Universities Nuclear Laboratory : 2011

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    at LENA| Reaction Rates| UNC Astrophysics| Laboratory for Experimental Nuclear Astrophysics (LENA) The LENA is among only a few accelerator facilities in the world dedicated entirely to nuclear astrophysics experiments. It has two low-energy electrostatic accelerators that are capable of delivering high-current charged-particle beams to a common target. One is an ECR source on a 200-kV platform and the other one is a 1-MV JN Van de Graaff accelerator. Both accelerators are fully

  15. Nuclear Data Sheets for A = 239

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Browne, E.; Tuli, J. K.

    2014-11-18

    Spectroscopic data and level schemes from radioactive decay and nuclear reaction studies are presented here for all nuclei with mass number A=239. In general, a relatively small amount of new data on this mass chain has been reported since the previous evaluation in 2003. However, special evaluations, such as ''Database of prompt gamma rays from slow neutron–capture from elemental analysis'' (2007ChZX), have provided additional precise data for levels in 29U. Also, new Coulomb excitation measurements in 239Pu have extended the knowledge of the 1/2[631] rotational band up to Jπ=(55/2+)Jπ=(55/2+), and that of the octupole vibrational band up to Jπ=(53/2-)Jπ=(53/2-). Formore » historical knowledge it is worth mentioning the report on the “Discovery of isotopes of the transuranium elements with 93 <= Z <= 98'' (2013Fr02), where the information for elements Np, Pu, Am, and Cf with mass number A=239 is presented. The alpha hindrance factors (HF) presented in this evaluation were calculated using values of the radius parameter (r0) interpolated from those for even–even adjacent nuclei given by 1998Ak04.« less

  16. Nuclear Data Sheets for A = 239

    SciTech Connect (OSTI)

    Browne, E.; Tuli, J. K.

    2014-11-18

    Spectroscopic data and level schemes from radioactive decay and nuclear reaction studies are presented here for all nuclei with mass number A=239. In general, a relatively small amount of new data on this mass chain has been reported since the previous evaluation in 2003. However, special evaluations, such as ''Database of prompt gamma rays from slow neutron–capture from elemental analysis'' (2007ChZX), have provided additional precise data for levels in 29U. Also, new Coulomb excitation measurements in 239Pu have extended the knowledge of the 1/2[631] rotational band up to Jπ=(55/2+)Jπ=(55/2+), and that of the octupole vibrational band up to Jπ=(53/2-)Jπ=(53/2-). For historical knowledge it is worth mentioning the report on the “Discovery of isotopes of the transuranium elements with 93 <= Z <= 98'' (2013Fr02), where the information for elements Np, Pu, Am, and Cf with mass number A=239 is presented. The alpha hindrance factors (HF) presented in this evaluation were calculated using values of the radius parameter (r0) interpolated from those for even–even adjacent nuclei given by 1998Ak04.

  17. Nuclear Data Sheets for A = 239

    SciTech Connect (OSTI)

    Browne, E.; Tuli, J. K.

    2014-11-18

    Spectroscopic data and level schemes from radioactive decay and nuclear reaction studies are presented here for all nuclei with mass number A=239. In general, a relatively small amount of new data on this mass chain has been reported since the previous evaluation in 2003. However, special evaluations, such as ''Database of prompt gamma rays from slow neutroncapture from elemental analysis'' (2007ChZX), have provided additional precise data for levels in 29U. Also, new Coulomb excitation measurements in 239Pu have extended the knowledge of the 1/2[631] rotational band up to J?=(55/2+)J?=(55/2+), and that of the octupole vibrational band up to J?=(53/2-)J?=(53/2-). For historical knowledge it is worth mentioning the report on the Discovery of isotopes of the transuranium elements with 93 <= Z <= 98'' (2013Fr02), where the information for elements Np, Pu, Am, and Cf with mass number A=239 is presented. The alpha hindrance factors (HF) presented in this evaluation were calculated using values of the radius parameter (r0) interpolated from those for eveneven adjacent nuclei given by 1998Ak04.

  18. Studying Nuclear Astrophysics at NIF

    SciTech Connect (OSTI)

    Boyd, R; Bernstein, L; Brune, C

    2009-07-01

    The National Ignition Facility's primary goal is to generate fusion energy. But the starlike conditions that it creates will also enable NIF scientists to study astrophysically important nuclear reactions. When scientists at the stadium-sized National Ignition Facility attempt to initiate fusion next year, 192 powerful lasers will direct 1.2 MJ of light energy toward a two-mm-diameter pellet of deuterium ({sup 2}H, or D) and tritium ({sup 3}H, or T). Some of that material will be gaseous, but most will be in a frozen shell. The idea is to initiate 'inertial confinement fusion', in which the two hydrogen isotopes fuse to produce helium-4, a neutron, and 17.6 MeV of energy. The light energy will be delivered to the inside walls of a hohlraum, a heavy-metal, centimeter-sized cylinder that houses the pellet. The container's heated walls will produce x rays that impinge on the pellet and ablate its outer surface. The exiting particles push inward on the pellet and compresses the DT fuel. Ultimately a hot spot develops at the pellet's center, where fusion produces {sup 4}He nuclei that have sufficient energy to propagate outward, trigger successive reactions, and finally react the frozen shell. Ignition should last several tens of picoseconds and generate more than 10 MJ of energy and roughly 10{sup 19} neutrons. The temperature will exceed 10{sup 8} K and fuel will be compressed to a density of several hundred g/cm{sup 3}, both considerably greater than at the center of the Sun. The figure shows a cutaway view of NIF. The extreme conditions that will be produced there simulate those in nuclear weapons and inside stars. For that reason, the facility is an important part of the US stockpile stewardship program, designed to assess the nation's aging nuclear stockpile without doing nuclear tests. In this Quick Study we consider a third application of NIF - using the extraordinary conditions it will produce to perform experiments in basic science. We will focus on

  19. Nuclear Materials Management & Safeguards System | National Nuclear...

    National Nuclear Security Administration (NNSA)

    About Our Programs Nuclear Security Nuclear Materials Management & Safeguards System NMMSS U.S. Department of Energy U.S. Nuclear Regulatory Commission Nuclear Materials ...

  20. Nuclear Data Sheets for A = 148

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Nica, N.

    2014-04-02

    The experimental nuclear structure data available through October 2013 have been reviewed. A summary of information obtained in various reaction and decay experiments is presented, together with adopted level schemes.

  1. Theoretical nuclear physics at Yale University

    SciTech Connect (OSTI)

    Not Available

    1992-12-31

    Brief summaries of past and planned activities in the following areas are given: models of nuclear structure; models of hadronic structure; hot nuclei; chaos in nuclei; reactions and structure; dissipation, diffusion, and collective motion; and modeling equilibrium and nonequilibrium systems.

  2. Shutdown system for a nuclear reactor

    DOE Patents [OSTI]

    Groh, Edward F.; Olson, Arne P.; Wade, David C.; Robinson, Bryan W.

    1984-01-01

    An ultimate shutdown system is provided for termination of neutronic activity in a nuclear reactor. The shutdown system includes bead chains comprising spherical containers suspended on a flexible cable. The containers are comprised of mating hemispherical shells which provide a ruggedized enclosure for reactor poison material. The bead chains, normally suspended above the reactor core on storage spools, are released for downward travel upon command from an external reactor monitor. The chains are capable of horizontal movement, so as to flow around obstructions in the reactor during their downward motion.

  3. Shutdown system for a nuclear reactor

    DOE Patents [OSTI]

    Groh, E.F.; Olson, A.P.; Wade, D.C.; Robinson, B.W.

    1984-06-05

    An ultimate shutdown system is provided for termination of neutronic activity in a nuclear reactor. The shutdown system includes bead chains comprising spherical containers suspended on a flexible cable. The containers are comprised of mating hemispherical shells which provide a ruggedized enclosure for reactor poison material. The bead chains, normally suspended above the reactor core on storage spools, are released for downward travel upon command from an external reactor monitor. The chains are capable of horizontal movement, so as to flow around obstructions in the reactor during their downward motion. 8 figs.

  4. Nuclear Navy

    SciTech Connect (OSTI)

    1994-12-31

    This video tells the story of the Navy`s development of nuclear power and its application in long-range submarines and the growing nuclear surface force. Narrated by Frank Blair.

  5. Modeling Proton- and Light Ion-Induced Reactions at Low Energies in the MARS15 Code

    SciTech Connect (OSTI)

    Rakhno, I. L.; Mokhov, N. V.; Gudima, K. K.

    2015-04-25

    An implementation of both ALICE code and TENDL evaluated nuclear data library in order to describe nuclear reactions induced by low-energy projectiles in the Monte Carlo code MARS15 is presented. Comparisons between results of modeling and experimental data on reaction cross sections and secondary particle distributions are shown.

  6. Nuclear Data Sheets for A = 215

    SciTech Connect (OSTI)

    Singh, Balraj; Mukherjee, Gopal; Abriola, Daniel; Basu, Swapan Kumar; Demetriou, Paraskevi; Jain, Ashok; Kumar, Suresh; Singh, Sukhjeet; Tuli, Jagdish

    2013-12-15

    The evaluated spectroscopic data are presented for 12 known nuclides of mass 215 (Hg, Tl, Pb, Bi, Po, At, Rn, Fr, Ra, Ac, Th, Pa). For {sup 215}Hg, {sup 215}Tl, {sup 215}Pb, and {sup 215}Pa nuclei, no excited states are known. The decay characteristics of {sup 215}Hg and {sup 215}Tl are unknown. The decay scheme of {sup 215}Pb is considered as incomplete. Ordering of ? cascades in the decay of 36.9s isomer of {sup 215}Bi and for highspin states above 2251 keV in {sup 215}Fr are not established. Highspin excitations, including several isomeric states, are well known in {sup 215}Bi, {sup 215}Po, {sup 215}Rn, {sup 215}Fr, {sup 215}Ra, and {sup 215}Ac. No particletransfer reaction data are available for any of the A=215 nuclei. The rms charge radii for {sup 215}Pb, {sup 215}Bi, {sup 215}Po, {sup 215}Rn, {sup 215}Fr and {sup 215}Ra have been evaluated by Daniel Abriola, from extrapolation or interpolation of available evaluated data in 2013An02 for radii of respective Z chains using formula 9 in 2004An14. This evaluation was carried out as part of ENSDDworkshop at VECC, Kolkata for Nuclear Structure and Decay Data, organized and hosted by VECC and Board of Research in Nuclear Sciences (BRNS) in Kolkata, India, November 2629, 2012. This work supersedes the previous A = 215 evaluation (2001Br31) published by E. Browne which covered literature prior to May 2001.

  7. TRIMOLECULAR REACTIONS OF URANIUM HEXAFLUORIDE WITH WATER

    SciTech Connect (OSTI)

    Westbrook, M.; Becnel, J.; Garrison, S.

    2010-02-25

    The hydrolysis reaction of uranium hexafluoride (UF{sub 6}) is a key step in the synthesis of uranium dioxide (UO{sub 2}) powder for nuclear fuels. Mechanisms for the hydrolysis reactions are studied here with density functional theory and the Stuttgart small-core scalar relativistic pseudopotential and associated basis set for uranium. The reaction of a single UF{sub 6} molecule with a water molecule in the gas phase has been previously predicted to proceed over a relatively sizeable barrier of 78.2 kJ {center_dot} mol{sup -1}, indicating this reaction is only feasible at elevated temperatures. Given the observed formation of a second morphology for the UO{sub 2} product coupled with the observations of rapid, spontaneous hydrolysis at ambient conditions, an alternate reaction pathway must exist. In the present work, two trimolecular hydrolysis mechanisms are studied with density functional theory: (1) the reaction between two UF{sub 6} molecules and one water molecule, and (2) the reaction of two water molecules with a single UF{sub 6} molecule. The predicted reaction of two UF{sub 6} molecules with one water molecule displays an interesting 'fluorine-shuttle' mechanism, a significant energy barrier of 69.0 kJ {center_dot} mol{sup -1} to the formation of UF{sub 5}OH, and an enthalpy of reaction ({Delta}H{sub 298}) of +17.9 kJ {center_dot} mol{sup -1}. The reaction of a single UF{sub 6} molecule with two water molecules displays a 'proton-shuttle' mechanism, and is more favorable, having a slightly lower computed energy barrier of 58.9 kJ {center_dot} mol{sup -1} and an exothermic enthalpy of reaction ({Delta}H{sub 298}) of -13.9 kJ {center_dot} mol{sup -1}. The exothermic nature of the overall UF{sub 6} + 2 {center_dot} H{sub 2}O trimolecular reaction and the lowering of the barrier height with respect to the bimolecular reaction are encouraging; however, the sizable energy barrier indicates further study of the UF{sub 6} hydrolysis reaction mechanism is

  8. Correlation effects in nuclear transparency

    SciTech Connect (OSTI)

    Frankfurt, L. L.; Moniz, Ernest J.; Sargsyan, M. M.; Strikman, M. I.

    1995-06-01

    The Glauber approximation is used to calculate the contribution of nucleon correlations in high-energy A(e,e'N) reactions. When the excitation energy of the residual nucleus is small, the increase of the nuclear transparency due to correlations between the struck nucleon and the other nucleons is mostly compensated by a decrease of the transparency due to the correlations between nondetected nucleons. We derive Glauber model predictions for nuclear transparency for the differential cross section when nuclear shell level excitations are measured. The role of correlations in color transparency is briefly discussed.

  9. Nuclear astrophysics and electron beams

    SciTech Connect (OSTI)

    Schwenk, A.

    2013-11-07

    Electron beams provide important probes and constraints for nuclear astrophysics. This is especially exciting at energies within the regime of chiral effective field theory (EFT), which provides a systematic expansion for nuclear forces and electroweak operators based on quantum chromodynamics. This talk discusses some recent highlights and future directions based on chiral EFT, including nuclear structure and reactions for astrophysics, the neutron skin and constraints for the properties of neutron-rich matter in neutron stars and core-collapse supernovae, and the dark matter response of nuclei.

  10. Continuous chain bit with downhole cycling capability

    DOE Patents [OSTI]

    Ritter, Don F.; St. Clair, Jack A.; Togami, Henry K.

    1983-01-01

    A continuous chain bit for hard rock drilling is capable of downhole cycling. A drill head assembly moves axially relative to a support body while the chain on the head assembly is held in position so that the bodily movement of the chain cycles the chain to present new composite links for drilling. A pair of spring fingers on opposite sides of the chain hold the chain against movement. The chain is held in tension by a spring-biased tensioning bar. A head at the working end of the chain supports the working links. The chain is centered by a reversing pawl and piston actuated by the pressure of the drilling mud. Detent pins lock the head assembly with respect to the support body and are also operated by the drilling mud pressure. A restricted nozzle with a divergent outlet sprays drilling mud into the cavity to remove debris. Indication of the centered position of the chain is provided by noting a low pressure reading indicating proper alignment of drilling mud slots on the links with the corresponding feed branches.

  11. Nuclear Data Sheets for A = 247

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Nesaraja, C. D.

    2015-03-01

    Here, we present available information pertaining to the nuclear structure of all nuclei with mass number A=247. Various decay and reaction data are evaluated and compared. Adopted data, levels, spin, parity and configuration assignments are given. Moreover, when there are insufficient data, expected values from systematics of nuclear properties or/and theoretical calculations are quoted. Unexpected or discrepant experimental resultsare also noted.

  12. Nuclear Data Sheets for A=143

    SciTech Connect (OSTI)

    Browne E.; Tuli J.; Browne,E.; Tuli.J.K.

    2012-03-01

    The evaluators present in this publication spectroscopic data and level schemes from radioactive decay and nuclear reaction studies for all nuclei with mass number A = 143. The evaluation, which includes all data received by May 2011, supersedes the 2001 evaluation by J.K. Tuli, published in Nuclear Data Sheets94, 605 (2001).

  13. Nuclear structure studies with intermediate energy probes

    SciTech Connect (OSTI)

    Lee, T.S.H.

    1993-10-01

    Nuclear structure studies with pions are reviewed. Results from a recent study of 1 p-shell nuclei using (e,e{prime}), ({pi}, {pi}{prime}), and ({gamma},{pi}) reactions are reported. Future nuclear structure studies with GeV electrons at CEBAF are also briefly discussed.

  14. Nuclear Data Sheets for A=247

    SciTech Connect (OSTI)

    Nesaraja, Caroline D

    2015-01-01

    Available information pertaining to the nuclear structure of all nuclei with mass number A=247 is presented. Various decay and reaction data are evaluated and compared. Adopted data, levels, spin, parity and configuration assignments are given. When there are insufficient data, expected values from systematics of nuclear properties or/and theoretical calculations are quoted. Unexpected or discrepant experimental resultsare also noted.

  15. Hydrogen evolution reaction catalyst

    DOE Patents [OSTI]

    Subbaraman, Ram; Stamenkovic, Vojislav; Markovic, Nenad; Tripkovic, Dusan

    2016-02-09

    Systems and methods for a hydrogen evolution reaction catalyst are provided. Electrode material includes a plurality of clusters. The electrode exhibits bifunctionality with respect to the hydrogen evolution reaction. The electrode with clusters exhibits improved performance with respect to the intrinsic material of the electrode absent the clusters.

  16. Nuclear Physics Laboratory 1980 annual report

    SciTech Connect (OSTI)

    Adelberger, E.G.

    1980-09-01

    Research progress is reported in the following areas: astrophysics and cosmology, fundamental symmetries, nuclear structure and reactions, radiative capture, medium energy physics, heavy ion reactions, research by outside users, accelerators and ion sources, instrumentation and experimental techniques, and computers and computing. Publications are listed. (WHK)

  17. Nudat: Nuclear Structure and Decay Data from the National Nuclear Data Center (NNDC)

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    NuDat allows users to search and plot nuclear structure and decay data interactively. NuDat was developed by the National Nuclear Data Center (NNDC)but utilizes contributions from physicists around the world. It provides an interface between web users and several databases containing nuclear structure, nuclear decay and some neutron-induced nuclear reaction information. Users can search for nuclear level properties (energy, half-life, spinparity), gamma-ray information (energy, intensity, multipolarity, coincidences), radiation information following nuclear decay (energy, intensity, dose), and neutron-induced reaction data from the BNL-325 book (thermal cross section and resonance integral). The information provided by NuDat 2 can be viewed in tables, level schemes and an interactive chart of nuclides.

  18. Interplay between compound and fragments aspects of nuclear fission and

    Office of Scientific and Technical Information (OSTI)

    heavy-ion reaction (Conference) | SciTech Connect Conference: Interplay between compound and fragments aspects of nuclear fission and heavy-ion reaction Citation Details In-Document Search Title: Interplay between compound and fragments aspects of nuclear fission and heavy-ion reaction The scission point in nuclear fission plays a special role where one-body system changes to two-body system. Inverse of this situation is realized in heavy-ion fusion reaction where two-body system changes to

  19. Method for polymer synthesis in a reaction well

    DOE Patents [OSTI]

    Brennan, Thomas M.

    1998-01-01

    A method of synthesis for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: A) depositing a liquid reagent in a reaction well (26) in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well (26) includes at least one orifice (74) extending into the well (26), and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well (26) to enable polymer chain growth on the solid support. The method further includes the step of B) expelling the reagent solution from the well (26), while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit (80) of the orifice (74) exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well (26) through the orifice exit (80).

  20. Method for polymer synthesis in a reaction well

    DOE Patents [OSTI]

    Brennan, T.M.

    1998-09-29

    A method of synthesis is described for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: (A) depositing a liquid reagent in a reaction well in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well includes at least one orifice extending into the well, and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well to enable polymer chain growth on the solid support. The method further includes the step of (B) expelling the reagent solution from the well, while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit of the orifice exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well through the orifice exit. 9 figs.

  1. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets,...

  2. Better Plants Supply Chain Pilot Overview

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    SUPPLY CHAIN PILOT Learn more at energy.goveereamobetter-plants The Department of ... Partners will receive aggregated year-end metrics that demonstrate the energy performance ...

  3. Manufacturing Competitiveness and Supply Chain Analysis | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    chain of the heating and cooling (e.g., magnetocaloric or thermoelectric solid state heat pump) technologies, but also gain understanding of manufacturing location decisions. ...

  4. Enhancing chemical reactions

    DOE Patents [OSTI]

    Morrey, John R.

    1978-01-01

    Methods of enhancing selected chemical reactions. The population of a selected high vibrational energy state of a reactant molecule is increased substantially above its population at thermal equilibrium by directing onto the molecule a beam of radiant energy from a laser having a combination of frequency and intensity selected to pump the selected energy state, and the reaction is carried out with the temperature, pressure, and concentrations of reactants maintained at a combination of values selected to optimize the reaction in preference to thermal degradation by transforming the absorbed energy into translational motion. The reaction temperature is selected to optimize the reaction. Typically a laser and a frequency doubler emit radiant energy at frequencies of .nu. and 2.nu. into an optical dye within an optical cavity capable of being tuned to a wanted frequency .delta. or a parametric oscillator comprising a non-centrosymmetric crystal having two indices of refraction, to emit radiant energy at the frequencies of .nu., 2.nu., and .delta. (and, with a parametric oscillator, also at 2.nu.-.delta.). Each unwanted frequency is filtered out, and each desired frequency is focused to the desired radiation flux within a reaction chamber and is reflected repeatedly through the chamber while reactants are fed into the chamber and reaction products are removed therefrom.

  5. Office of Global Material Security | National Nuclear Security

    National Nuclear Security Administration (NNSA)

    Administration Global Material Security NNSA Co-Hosts Nuclear Security Summit Workshop on Maritime Security with UK WASHINGTON - This week, the Department of Energy's National Nuclear Security Administration (DOE/NNSA) and the U.K. Department of Energy and Climate Change concluded a workshop at Wilton Park, United Kingdom, on the growing challenge of securing the global maritime supply chain. In

  6. Nuclear Physics

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Physics Nuclear Physics Enabling remarkable discoveries and tools that transform our understanding of energy and matter and advance national, economic, and energy security. Isotopes» A roadmap of matter that will help unlock the secrets of how the universe is put together The DOE Office of Science's Nuclear Physics (NP) program supports the experimental and theoretical research needed to create this roadmap. This quest requires a broad approach to different, but related, scientific

  7. Nuclear Structure

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Security Administration | (NNSA) Nuclear Security Centers of Excellence: Fact Sheet March 23, 2012 "We [the Participating States]... Acknowledge the need for capacity building for nuclear security and cooperation at bilateral, regional and multilateral levels for the promotion of nuclear security culture through technology development, human resource development, education, and training; and stress the importance of optimizing international cooperation and coordination of

  8. Nuclear Counterterrorism

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2013-08-26

    The Order defines requirements for the protection of sensitive improvised nuclear device information and provides a framework to support DOE activities related to nuclear counterterrorism. (A supplemental DOE Manual, Control of and Access to Improvised Nuclear Device Information, provides requirements and procedures for protecting Sigma 20 information.) Appendices A and B are Official Use Only. Point of contact is Adam Boyd (NA-82), 202-586-0010. Supersedes DOE O 457.1 and DOE M 457.1-1.

  9. [Experimental nuclear physics]. Annual report 1988

    SciTech Connect (OSTI)

    1988-05-01

    This is the May 1988 annual report of the Nuclear Physics Laboratory of the University of Washington. It contains chapters on astrophysics, giant resonances, heavy ion induced reactions, fundamental symmetries, polarization in nuclear reactions, medium energy reactions, accelerator mass spectrometry (AMS), research by outside users, Van de Graaff and ion sources, the Laboratory`s booster linac project work, instrumentation, and computer systems. An appendix lists Laboratory personnel, Ph.D. degrees granted in the 1987-88 academic year, and publications. Refs., 27 figs., 4 tabs.

  10. [Experimental nuclear physics]. Annual report 1989

    SciTech Connect (OSTI)

    1989-04-01

    This is the April 1989 annual report of the Nuclear Physics Labortaory of the University of Washington. It contains chapters on astrophysics, giant resonances, heavy ion induced reactions, fundamental symmetries, polarization in nuclear reactions, medium energy reactions, accelerator mass spectrometry (AMS), research by outside users, Van de Graaff and ion sources, computer systems, instrumentation, and the Laboratory`s booster linac work. An appendix lists Laboratory personnel, Ph.D. degrees granted in the 1988-1989 academic year, and publications. Refs., 23 figs., 3 tabs.

  11. NUCLEAR ENERGY

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    NUCLEAR ENERGY RESEARCH AND DEVELOPMENT ROADMAP Table of Contents List of Acronyms ................................................................................................... iii Executive Summary ............................................................................................... v 1. Introduction ...................................................................................................... 1 2. Background

  12. nuclear smuggling

    National Nuclear Security Administration (NNSA)

    13, 2015

    SHANGHAI, CHINA - Today, the Nuclear Security Administration's (NNSA) Principal Assistant Deputy Administrator for Defense...

  13. nuclear material

    National Nuclear Security Administration (NNSA)

    width"300" >WASHINGTON, D.C. - The Department of Energy's (DOE) National Nuclear Security Administration (NNSA), in partnership with the Defense Threat Reduction...

  14. nuclear weapons

    National Nuclear Security Administration (NNSA)

    09, 2015

    WASHINGTON, D.C. - The National Nuclear Security Administration (NNSA) and United States Air Force completed eight successful...

  15. nuclear controls

    National Nuclear Security Administration (NNSA)

    which "international safeguards are fully integrated into the design process of a new nuclear facility from the initial planning through design, construction, operation, and...

  16. nuclear forensics

    National Nuclear Security Administration (NNSA)

    serves as the premier technical leader in responding to and successfully resolving nuclear and radiological threats worldwide. When the need arises, NNSA is prepared to...

  17. Additional chain-branching pathways in the low-temperature oxidation of branched alkanes

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Wang, Zhandong; Zhang, Lidong; Moshammer, Kai; Popolan-Vaida, Denisia M.; Shankar, Vijai Shankar Bhavani; Lucassen, Arnas; Hemken, Christian; Taatjes, Craig A.; Leone, Stephen R.; Kohse-Hoinghaus, Katharina; et al

    2015-12-31

    Chain-branching reactions represent a general motif in chemistry, encountered in atmospheric chemistry, combustion, polymerization, and photochemistry; the nature and amount of radicals generated by chain-branching are decisive for the reaction progress, its energy signature, and the time towards its completion. In this study, experimental evidence for two new types of chain-branching reactions is presented, based upon detection of highly oxidized multifunctional molecules (HOM) formed during the gas-phase low-temperature oxidation of a branched alkane under conditions relevant to combustion. The oxidation of 2,5-dimethylhexane (DMH) in a jet-stirred reactor (JSR) was studied using synchrotron vacuum ultra-violet photoionization molecular beam mass spectrometry (SVUV-PI-MBMS).more » Specifically, species with four and five oxygen atoms were probed, having molecular formulas of C8H14O4 (e.g., diketo-hydroperoxide/keto-hydroperoxy cyclic ether) and C8H16O5 (e.g., keto-dihydroperoxide/dihydroperoxy cyclic ether), respectively. The formation of C8H16O5 species involves alternative isomerization of OOQOOH radicals via intramolecular H-atom migration, followed by third O2 addition, intramolecular isomerization, and OH release; C8H14O4 species are proposed to result from subsequent reactions of C8H16O5 species. The mechanistic pathways involving these species are related to those proposed as a source of low-volatility highly oxygenated species in Earth's troposphere. At the higher temperatures relevant to auto-ignition, they can result in a net increase of hydroxyl radical production, so these are additional radical chain-branching pathways for ignition. Furthermore, the results presented herein extend the conceptual basis of reaction mechanisms used to predict the reaction behavior of ignition, and have implications on atmospheric gas-phase chemistry and the oxidative stability of organic substances.« less

  18. Nuclear Data Sheets for A=159

    SciTech Connect (OSTI)

    Reich C. W.; Reich,C.W.

    2012-01-01

    The experimental results from the various reaction and radioactive decay studies leading to nuclides in the A = 159 mass chain have been reviewed. Nuclides ranging from Pm (Z = 61) through Os (Z = 74) are included. These data are summarized and presented, together with adopted level schemes and properties. This work supersedes the previous evaluation of the data on these nuclides (2003He11).

  19. Reactor for exothermic reactions

    DOE Patents [OSTI]

    Smith, L.A. Jr.; Hearn, D.; Jones, E.M. Jr.

    1993-03-02

    A liquid phase process is described for oligomerization of C[sub 4] and C[sub 5] isoolefins or the etherification thereof with C[sub 1] to C[sub 6] alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120 to 300 F. Wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  20. Reactor for exothermic reactions

    DOE Patents [OSTI]

    Smith, Jr., Lawrence A. (Bellaire, TX); Hearn, Dennis (Houston, TX); Jones, Jr., Edward M. (Friendswood, TX)

    1993-01-01

    A liquid phase process for oligomerization of C.sub.4 and C.sub.5 isoolefins or the etherification thereof with C.sub.1 to C.sub.6 alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120.degree. to 300.degree. F. Wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  1. Single-Chain Antibody Library

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Baird, Cheryl

    Researchers at Pacific Northwest National Laboratory (PNNL) have constructed a nonimmune library consisting of 109 human antibody scFv fragments, which have been cloned and expressed on the surface of yeast. Nanomolar-affinity scFvs are routinely obtained by magnetic bead screening and flow cytometric sorting. The yeast library can be amplified 1010 fold without measurable loss of clonal diversity. This allows for indefinite expansion of the library. All scFv clones can be assessed directly on the yeast cell surface by immunofluorescent labeling and flow cytometry, obviating separate subcloning, expression, and purification steps. The ability to use multiplex library screening demonstrates the utility of this approach for high-throughput antibody isolation for proteomic applications. The yeast library may be used for research projects or teaching performed for U.S. Government purposes only. If you would like to request an aliquot of the single-chain antibody library for your research, please print and fill out the Materials Transfer Agreement (MTA) [PDF, 20K]. The website provides the contact information for mailing the MTA. [copied from http://www.sysbio.org/dataresources/singlechain.stm

  2. Civilian nuclear power on the drawing board: the development of Experimental Breeder Reactor-II.

    SciTech Connect (OSTI)

    Westfall, C.

    2003-02-20

    On September 28, 2001 a symposium was held at Argonne National Laboratory as part of the festivities to mark the 100th birthday of Enrico Fermi. The symposium celebrated Fermi's ''contribution to the development of nuclear power'' and focused on one particular ''line of development'' resulting from Fermi's interest in power reactors: Argonne's fast reactor program. Symposium participants made many references to the ways in which the program was linked to Fermi, who led the team which created the world's first self-sustaining nuclear chain reaction. For example, one presentation featured an April, 1944 memo that described a meeting attended by Fermi and others. The memo came from the time when research on plutonium and the nuclear chain reaction at Chicago's WWII Metallurgical Laboratory was nearing its end. Even as other parts of the Manhattan Engineering Project were building on this effort to create the bombs that would end the war, Fermi and his colleagues were taking the first steps to plan the use of nuclear energy in the postwar era. After noting that Fermi ''viewed the use of [nuclear] power for the heating of cities with sympathy,'' the group outlined several power reactor designs. In the course of discussion, Fermi and his colleagues took the first steps in conjuring the vision that would later be brought to life with Experimental Breeder Reactor I (EBR-I) and Experimental Breeder Reactor II (EBR-II), the celebrated achievements of the Argonne fast reactor program. Group members considered various schemes for a breeder reactor in which the relatively abundant U-238 would be placed near a core of fissionable material. The reactor would be a fast reactor; that is, neutrons would not be moderated, as were most wartime reactors. Thus, the large number of neutrons emitted in fast neutron fission would hit the U-238 and create ''extra'' fissionable material, that is, more than ''invested,'' and at the same time produce power. The group identified the problem of

  3. Nuclear Weapons Journal

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Weapons Journal Nuclear Weapons Journal The Nuclear Weapons Journal ceased publication after Issue 2, 2009. Below are Nuclear Weapons Journal archived issues. Issue 2, 2009 ...

  4. 2013 Nuclear Workforce Development ...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Myths Topics: Can a Nuclear Reactor Explode Like a Bomb? Will Nuclear Waste Be Around for Millions of Years? Is Nuclear Energy Dangerous? Moderator: Suzy Hobbs ...

  5. The Packing of Granular Polymer Chains

    SciTech Connect (OSTI)

    Zou, Ling-Nan; Cheng, Xiang; Rivers, Mark L.; Jaeger, Heinrich M.; Nagel, Sidney R.; UC

    2009-12-01

    Rigid particles pack into structures, such as sand dunes on the beach, whose overall stability is determined by the average number of contacts between particles. However, when packing spatially extended objects with flexible shapes, additional concepts must be invoked to understand the stability of the resulting structure. Here, we examine the disordered packing of chains constructed out of flexibly connected hard spheres. Using x-ray tomography, we find that long chains pack into a low-density structure whose mechanical rigidity is mainly provided by the backbone. On compaction, randomly oriented, semi-rigid loops form along the chain, and the packing of chains can be understood as the jamming of these elements. Finally, we uncover close similarities between the packing of chains and the glass transition in polymers.

  6. Nuclear Nonproliferation Treaty | National Nuclear Security Administra...

    National Nuclear Security Administration (NNSA)

    People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy ... Nuclear Nonproliferation Treaty The Treaty on the Non-Proliferation of Nuclear Weapons off ...

  7. Nuclear Nonproliferation, International Safeguards and Nuclear...

    Office of Scientific and Technical Information (OSTI)

    Conference: Nuclear Nonproliferation, International Safeguards and Nuclear Security in the Middle East Citation Details In-Document Search Title: Nuclear Nonproliferation, ...

  8. Nuclear Nonproliferation, International Safeguards and Nuclear...

    Office of Scientific and Technical Information (OSTI)

    Nuclear Nonproliferation, International Safeguards and Nuclear Security in the Middle East Citation Details In-Document Search Title: Nuclear Nonproliferation, International ...

  9. nuclear | National Nuclear Security Administration (NNSA)

    National Nuclear Security Administration (NNSA)

    nuclear Nuclear Science Week releases 2015 Impact Report and 2016 Request for Proposal Last week the Nuclear Science Week (NSW) National Steering Committee released its impact ...

  10. Chernobyl Nuclear Accident | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Chernobyl Nuclear Accident Chernobyl Nuclear Accident Chernobyl, Ukraine A catastrophic nuclear accident occurs at Chernobyl Reactor 4 in the then Soviet Republic of Ukraine

  11. Nuclear Nonproliferation Program Offices | National Nuclear Security...

    National Nuclear Security Administration (NNSA)

    People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy ... and monitor nuclear weapons production, proliferation, and nuclear explosions worldwide. ...

  12. OSTIblog Articles in the uranium Topic | OSTI, US Dept of Energy...

    Office of Scientific and Technical Information (OSTI)

    amount of neutron reduction needed for a safe and controlled sustained nuclear reaction. ... Manhattan Project, nuclear chain reaction, plutonium, uranium, World War II Read more... ...

  13. OSTIblog Articles in the 70th Anniversary Topic | OSTI, US Dept...

    Office of Scientific and Technical Information (OSTI)

    amount of neutron reduction needed for a safe and controlled sustained nuclear reaction. ... Manhattan Project, nuclear chain reaction, plutonium, uranium, World War II Read more... ...

  14. OSTIblog Articles in the World War II Topic | OSTI, US Dept of...

    Office of Scientific and Technical Information (OSTI)

    amount of neutron reduction needed for a safe and controlled sustained nuclear reaction. ... Manhattan Project, nuclear chain reaction, plutonium, uranium, World War II Read more... ...

  15. OSTIblog Articles in the plutonium Topic | OSTI, US Dept of Energy...

    Office of Scientific and Technical Information (OSTI)

    amount of neutron reduction needed for a safe and controlled sustained nuclear reaction. ... Manhattan Project, nuclear chain reaction, plutonium, uranium, World War II Read more... ...

  16. Reports to the DOE Nuclear Data Committee

    SciTech Connect (OSTI)

    Not Available

    1988-05-01

    The report in this document were submitted to the Department of Energy, Nuclear Data Committee (DOE-NDC) in April 1988. The reporting laboratories are those with a substantial program for the measurement of neutron and nuclear cross sections of relevance to the US applied nuclear energy program. Appropriate subjects are microscopic neutron cross sections relevant to the nuclear energy program, including shielding. Inverse reactions where pertinent are included; charged-particle cross sections where relevant to developing and testing nuclear models; gamma ray production, radioactive decay, and theoretical developments in nuclear structure which are applicable to nuclear energy programs; and proton and alpha-particle cross sections, at energies of up to 1 GeV, which are of interest to the space program.

  17. Chart of Nuclides from the National Nuclear Data Center (NNDC)

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    The Chart of Nuclides is a software product that allows users to search and plot nuclear structure and nuclear decay data interactively. The Chart of Nuclides was developed by the National Nuclear Data Center (NNDC). It provides an interface between web users and several databases containing nuclear structure, nuclear decay and some neutron-induced nuclear reaction information. Using the Chart of Nuclides, it is possible to search for nuclear level properties (energy, half-life, spin-parity), gamma-ray information (energy, intensity, multipolarity, coincidences),radiation information following nuclear decay (energy, intensity, dose), and neutron-induced reaction data from the BNL-325 book (thermal cross section and resonance integral). The information provided by the Chart of Nuclides can be seen in tables, level schemes and an interactive chart of nuclides. (From the Chart of Nuclides Description at http://www.nndc.bnl.gov/chart/help/index.jsp?product=chart)

  18. Structure of Human Ferritin L Chain

    SciTech Connect (OSTI)

    Wang,Z.; Li, C.; Ellenburg, M.; Soistman, E.; Ruble, J.; Wright, B.; Ho, J.; Carter, D.

    2006-01-01

    Ferritin is the major iron-storage protein present in all cells. It generally contains 24 subunits, with different ratios of heavy chain (H) to light chain (L), in the shape of a hollow sphere hosting up to 4500 ferric Fe atoms inside. H-rich ferritins catalyze the oxidation of iron(II), while L-rich ferritins promote the nucleation and storage of iron(III). Several X-ray structures have been determined, including those of L-chain ferritins from horse spleen (HoSF), recombinant L-chain ferritins from horse (HoLF), mouse (MoLF) and bullfrog (BfLF) as well as recombinant human H-chain ferritin (HuHF). Here, structures have been determined of two crystal forms of recombinant human L-chain ferritin (HuLF) obtained from native and perdeuterated proteins. The structures show a cluster of acidic residues at the ferrihydrite nucleation site and at the iron channel along the threefold axis. An ordered Cd{sup 2+} structure is observed within the iron channel, offering further insight into the route and mechanism of iron transport into the capsid. The loop between helices D and E, which is disordered in many other L-chain structures, is clearly visible in these two structures. The crystals generated from perdeuterated HuLF will be used for neutron diffraction studies.

  19. Nuclear Counterterrorism

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2006-02-07

    The Order defines requirements for the protection of sensitive improvised nuclear device information and provides a framework to support DOE activities related to nuclear counterterrorism. (A supplemental DOE Manual, Control of and Access to Improvised Nuclear Device Information, provides requirements and procedures for protecting Sigma 20 information. The Manual is Official Use Only, and is not available on the Directives Portal. The point of contact for the Manual is Randall Weidman, NA-121.2, 202-586-4582.) Canceled by DOE O 457.1A

  20. Velocity pump reaction turbine

    DOE Patents [OSTI]

    House, P.A.

    An expanding hydraulic/two-phase velocity pump reaction turbine including a dual concentric rotor configuration with an inter-rotor annular flow channel in which the inner rotor is mechanically driven by the outer rotor. In another embodiment, the inner rotor is immobilized and provided with gas recovery ports on its outer surface by means of which gas in solution may be recovered. This velocity pump reaction turbine configuration is capable of potential energy conversion efficiencies of up to 70%, and is particularly suited for geothermal applications.

  1. Velocity pump reaction turbine

    DOE Patents [OSTI]

    House, Palmer A.

    1982-01-01

    An expanding hydraulic/two-phase velocity pump reaction turbine including a dual concentric rotor configuration with an inter-rotor annular flow channel in which the inner rotor is mechanically driven by the outer rotor. In another embodiment, the inner rotor is immobilized and provided with gas recovery ports on its outer surface by means of which gas in solution may be recovered. This velocity pump reaction turbine configuration is capable of potential energy conversion efficiencies of up to 70%, and is particularly suited for geothermal applications.

  2. Velocity pump reaction turbine

    DOE Patents [OSTI]

    House, Palmer A.

    1984-01-01

    An expanding hydraulic/two-phase velocity pump reaction turbine including a dual concentric rotor configuration with an inter-rotor annular flow channel in which the inner rotor is mechanically driven by the outer rotor. In another embodiment, the inner rotor is immobilized and provided with gas recovery ports on its outer surface by means of which gas in solution may be recovered. This velocity pump reaction turbine configuration is capable of potential energy conversion efficiencies of up to 70%, and is particularly suited for geothermal applications.

  3. National Nuclear Security Administration | National Nuclear Security...

    National Nuclear Security Administration (NNSA)

    National Nuclear Security Administration | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing...

  4. RADIOCHEMISTRY, AND NUCLEAR CHEMISTRY; NUCLEAR MEDICINE; HISTORICAL

    Office of Scientific and Technical Information (OSTI)

    The early days Richards, P. 38 RADIATION CHEMISTRY, RADIOCHEMISTRY, AND NUCLEAR CHEMISTRY; NUCLEAR MEDICINE; HISTORICAL ASPECTS; TECHNETIUM 99; COLLOIDS; MOLYBDENUM...

  5. Notice of Intent to Revise DOE O 452.4B, Security and Control of Nuclear Explosives and Nuclear Weapons, dated 1-11-2010

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2014-09-18

    Recent events have revealed that there are organizations that are seeking to insert malicious software and/or components into the nuclear weapon supply chain that can alter the functionality of the weapon and possible cause DAU.

  6. nuclear navy

    National Nuclear Security Administration (NNSA)

    7%2A en Powering the Nuclear Navy http:www.nnsa.energy.govourmissionpoweringnavy

    Page...

  7. nuclear navy

    National Nuclear Security Administration (NNSA)

    7%2A en Powering the Nuclear Navy http:nnsa.energy.govourmissionpoweringnavy

    Page...

  8. Nuclear option

    SciTech Connect (OSTI)

    Olson, P.S.

    1983-03-01

    The energy demand complexion of this country is always changing and promises to change in the future. The nuclear industry is responding to changing energy demands through standards writing activities. Since the oil embargo of 1973, there has been a change in the mix of fuels contributing to energy growth in this country; virtually all of the energy growth has come from coal and nuclear power. The predicted expansion of coal use by 1985, over 1977 level, is 37%, while the use of oil is expected to decline by 17%. Use of nuclear power is expected to increase 62% from the 1977 level. The feasibility of using nuclear energy to meet the needs of the USA for electric power is discussed.

  9. Reaction of Hydrogen Sulfide with Oxygen in the Presence ofSulfite

    SciTech Connect (OSTI)

    Weres, Oleh; Tsao, Leon

    1983-01-01

    Commonly, abatement of hydrogen sulfide emissions from a geothermal powerplant requires that hydrogen sulfide dissolved in the cooling water be eliminated by chemical reaction. Oxidation by atmospheric oxygen is the preferred reaction, but requires a suitable catalyst. Nickel is the most potent and thereby cheapest catalyst for this purpose. One Mg/L nickel in the cooling water would allow 99% removal of hydrogen sulfide to be attained. A major drawback of catalytic air oxidation is that colloidal sulfur is a major reaction product; this causes rapid sludge accumulation and deposition of sulfur scale. The authors studied the kinetics and product distribution of the reaction of hydrogen sulfide with oxygen, catalyzed by nickel. Adding sodium sulfite to the solution completely suppresses formation of colloidal sulfur by converting it to thiosulfate. The oxidation reaction is an autocatalytic, free radical chain reaction. A rate expression for this reaction and a detailed reaction mechanism were developed. Nickel catalyzes the chain initiation step, and polysulfidoradical ions propagate the chains. Several complexes of iron and cobalt were also studied. Iron citrate and iron N-hydroxyEDT are the most effective iron based catalysts. Uncomplexed cobalt is as effective as nickel, but forms a precipitate of cobalt oxysulfide and is too expensive for practical use.

  10. Reaction of hydrogen sulfide with oxygen in the presence of sulfite

    SciTech Connect (OSTI)

    Weres, O.; Tsao, L.

    1983-01-14

    Commonly, abatement of hydrogen sulfide emission from a geothermal powerplant requires that hydrogen sulfide dissolved in the cooling water be eliminated by chemical reaction. Oxidation by atmospheric oxygen is the preferred reaction, but requires a suitable catalyst. Nickel is the most potent and thereby cheapest catalyst for this purpose. One mg/L nickel in the cooling water would allow 99% removal of hydrogen sulfide to be attained. A major drawback of catalytic air oxidation is that colloidal sulfur is a major reaction product; this causes rapid sludge accumulation and deposition of sulfur scale. We studied the kinetics and product distribution of the reaction of hydrogen sulfide with oxygen, catalyzed by nickel. Adding sodium sulfite to the solution completely suppresses formation of colloidal sulfur by converting it to thiosulfate. The oxidation reaction is an autocatalytic, free radical chain reaction. A rate expression for this reaction and a detailed reaction mechanism were developed. Nickel catalyzes the chain initiation step, and polysulfidoradical ions propagate the chains. Several complexes of iron and cobalt were also studied. Iron citrate and iron N-hydroxyEDTA are the most effective iron based catalysts. Uncomplexed cobalt is as effective as nickel, but forms a precipitate of cobalt oxysulfide and is too expensive for practical use. 33 figures, 9 tables.

  11. Nuclear Data

    SciTech Connect (OSTI)

    White, Morgan C.

    2014-01-23

    PowerPoint presentation targeted for educational use. Nuclear data comes from a variety of sources and in many flavors. Understanding where the data you use comes from and what flavor it is can be essential to understand and interpret your results. This talk will discuss the nuclear data pipeline with particular emphasis on providing links to additional resources that can be used to explore the issues you will encounter.

  12. Nuclear Nonproliferation

    SciTech Connect (OSTI)

    Atkins-Duffin, C E

    2008-12-10

    With an explosion equivalent of about 20kT of TNT, the Trinity test was the first demonstration of a nuclear weapon. Conducted on July 16, 1945 in Alamogordo, NM this site is now a Registered National Historic Landmark. The concept and applicability of nuclear power was demonstrated on December 20, 1951 with the Experimental Breeder Reactor Number One (EBR-1) lit four light bulbs. This reactor is now a Registered National Historic Landmark, located near Arco, ID. From that moment forward it had been clearly demonstrated that nuclear energy has both peaceful and military applications and that the civilian and military fuel cycles can overlap. For the more than fifty years since the Atoms for Peace program, a key objective of nuclear policy has been to enable the wider peaceful use of nuclear energy while preventing the spread of nuclear weapons. Volumes have been written on the impact of these two actions on the world by advocates and critics; pundits and practioners; politicians and technologists. The nations of the world have woven together a delicate balance of treaties, agreements, frameworks and handshakes that are representative of the timeframe in which they were constructed and how they have evolved in time. Collectively these vehicles attempt to keep political will, nuclear materials and technology in check. This paper captures only the briefest abstract of the more significant aspects on the Nonproliferation Regime. Of particular relevance to this discussion is the special nonproliferation sensitivity associated with the uranium isotope separation and spent fuel reprocessing aspects of the nuclear fuel cycle.

  13. 2011-2012 SECTION II: HEAVY ION REACTIONS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Factors influencing residue cross section in 48Ca-induced reactions D. A. Mayorov, T. A. Werke, M. C. Alfonso, M. E. Bennett, and C. M. Folden III Characterization of a gas stopper for heavy element chemistry studies M. C. Alfonso, D. A. Mayorov, T. A. Werke, and C. M. Folden III Fabrication of lanthanide targets for nuclear reaction studies D. A. Mayorov, T. A. Werke, M. E. Bennett, and C. M. Folden III Excitation functions of 45Sc-induced reactions: towards future superheavy element synthesis

  14. Nuclear spectroscopic studies. Progress report

    SciTech Connect (OSTI)

    Bingham, C.R.; Guidry, M.W.; Riedinger, L.L.; Sorensen, S.P.

    1994-02-18

    The Nuclear Physics group at UTK is involved in heavy-ion physics including both nuclear structure and reaction mechanisms. During the last year experimental work has been in 3 broad areas: structure of nuclei at high angular momentum, structure of nuclei far from stability, and ultra-relativistic heavy-ion physics. Results in these areas are described in this document under: properties of high-spin states, study of low-energy levels of nuclei far from stability, and high-energy heavy-ion physics (PHENIX, etc.). Another important component of the work is theoretical interpretation of experimental results (Joint Institute for Heavy Ion Research).

  15. Reaction product imaging

    SciTech Connect (OSTI)

    Chandler, D.W.

    1993-12-01

    Over the past few years the author has investigated the photochemistry of small molecules using the photofragment imaging technique. Bond energies, spectroscopy of radicals, dissociation dynamics and branching ratios are examples of information obtained by this technique. Along with extending the technique to the study of bimolecular reactions, efforts to make the technique as quantitative as possible have been the focus of the research effort. To this end, the author has measured the bond energy of the C-H bond in acetylene, branching ratios in the dissociation of HI, the energetics of CH{sub 3}Br, CD{sub 3}Br, C{sub 2}H{sub 5}Br and C{sub 2}H{sub 5}OBr dissociation, and the alignment of the CD{sub 3} fragment from CD{sub 3}I photolysis. In an effort to extend the technique to bimolecular reactions the author has studied the reaction of H with HI and the isotopic exchange reaction between H and D{sub 2}.

  16. TORUS: Theory of Reactions for Unstable iSotopes - Year 1 Continuation and Progress Report

    SciTech Connect (OSTI)

    Arbanas, G; Elster, C; Escher, J; Mukhamedzhanov, A; Nunes, F; Thompson, I J

    2011-02-24

    The TORUS collaboration derives its name from the research it focuses on, namely the Theory of Reactions for Unstable iSotopes. It is a Topical Collaboration in Nuclear Theory, and funded by the Nuclear Theory Division of the Office of Nuclear Physics in the Office of Science of the Department of Energy. The funding started on June 1, 2010, it will have been running for nine months by the date of submission of this Annual Continuation and Progress Report on March 1, 2011. The extent of funding was reduced from the original application, and now supports one postdoctoral researcher for the years 1 through 3. The collaboration brings together as Principal Investigators a large fraction of the nuclear reaction theorists currently active within the USA. The mission of the TORUS Topical Collaboration is to develop new methods that will advance nuclear reaction theory for unstable isotopes by using three-body techniques to improve direct-reaction calculations, and, by using a new partial-fusion theory, to integrate descriptions of direct and compound-nucleus reactions. This multi-institution collaborative effort is directly relevant to three areas of interest: the properties of nuclei far from stability; microscopic studies of nuclear input parameters for astrophysics, and microscopic nuclear reaction theory.

  17. Nuclear Diagnostics of ICF

    SciTech Connect (OSTI)

    Izumi, N; Ierche, R A; Moran, M J; Phillips, T W; Sangster, T C; Schmid, G J; Stoyer, M A; Disdier, L; Bourgade, J L; Rouyer, A; Fisher, R K; Gerggren, R R; Caldwen, S E; Faulkner, J R; Mack, J M; Oertel, J A; Young, C S; Glebov, V Y; Jaanimagi, P A; Meyerhofer, D D; Soures, J M; Stockel, C; Frenje, J A; Li, C K; Petrasso, R D

    2001-10-18

    In inertial confinement fusion (ICF), a high temperature and high density plasma is produced by the spherical implosion of a small capsule. A spherical target capsule is irradiated uniformly by a laser beam (direct irradiation) or x-rays from a high Z enclosure (hohlraum) that is irradiated by laser or ion beams (indirect irradiation). Then high-pressure ablation of the surface causes the fuel to be accelerated inward. Thermonuclear fusion reactions begin in the center region of the capsule as it is heated to sufficient temperature (10 keV) by the converging shocks (hot spot formation). During the stagnation of the imploded shell, the fuel in the shell region is compressed to high density ({approx} 10{sup 3} times solid density in fuel region). When these conditions are established, energy released by the initial nuclear reactions in center ''hot-spot'' region can heat up the cold ''fuel'' region and cause ignition. They are developing advanced nuclear diagnostics for imploding plasmas of the ignition campaign on the National Ignition Facility (NIF). The NIF is a 1.8MJ, 192-beam glass laser system that is under construction at Lawrence Livermore National Laboratory. One objective of the NIF is to demonstrate ignition and gain in an inertial confinement fusion plasma. Extreme physical conditions characterize the imploded plasmas on the NIF. First, the thickness of the plasma, expressed by areal density (plasma density times radius), is large, up to {approx} 1 g/cm{sup 2}. Highly penetrating probes such as energetic neutrons, hard x-rays, or {gamma} rays are required to see deep inside the plasma. Second, the implosion time is quite short. The implosion process takes {approx} 20 ns and the duration of the fusion reaction is on the order of 100 picoseconds. To observe the time history of the nuclear reactions, time resolution better than 10 ps is required. Third, the size of the imploded plasma is quite small ({approx} 100 {micro}m). To see the shape of burning region

  18. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Signal Speed in Nanomagnetic Logic Chains Print Wednesday, 30 September 2015 00:00 The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated

  19. Ab Initio Calculations Of Nuclear Reactions And Exotic Nuclei...

    Office of Scientific and Technical Information (OSTI)

    Furthermore, these theoretical developments will support plasma diagnostic efforts at facilities dedicated to the development of terrestrial fusion energy. Authors: Quaglioni, S. ...

  20. Random-matrix approach to the statistical compound nuclear reaction...

    Office of Scientific and Technical Information (OSTI)

    Resource Type: Conference Resource Relation: Conference: Random Matrix Theory, Integrable Systems, and Topology in Physics ; 2015-11-02 - 2015-11-02 ; Stony Brook, New York, United ...

  1. Toward A Fundamental Understanding Of Nuclear Reactions And Exotic...

    Office of Scientific and Technical Information (OSTI)

    Authors: Quaglioni, S ; Hupin, G ; Langhammer, J ; Romero-Redondo, C ; Schuster, M D ; Johnson, C W ; Navratil, P ; Roth, R Publication Date: 2014-09-19 OSTI Identifier: 1165824 ...

  2. Prevention of nuclear war

    SciTech Connect (OSTI)

    Lifton, R.J.

    1980-10-01

    Physicians are exercising their responsibility as healers in their efforts to prevent nuclear war. Death for Hiroshima survivors was experienced in four stages: the immediate impact of destruction, the acute impact of radiation, delayed radiation effects, and later identification as an atomic bomb survivor. Each phase had its physical and psychological impacts and negates Hiroshima as a model for rational behavior despite those who claim survival is possible for those who are prepared. The psychic effects of modern nuclear, chemical, and germ warfare need to be challenged with a symbolization of life and immortality. Studies of psychological reactions to the terror children felt during practice air-raid drills indicate that the fears can be surpressed and re-emerge in adult life as a linking of death with collective annihilation. Other themes which emerge are feelings of impermanence, craziness, identification with the bomb, and a double existence. Psychic numbing and the religion of nuclearism cause dangerous conflicts with the anxieties caused by increasing awareness of death. (DCK)

  3. On-chip real-time single-copy polymerase chain reaction in picoliter droplets

    SciTech Connect (OSTI)

    Beer, N R; Hindson, B; Wheeler, E; Hall, S B; Rose, K A; Kennedy, I; Colston, B

    2007-04-20

    The first lab-on-chip system for picoliter droplet generation and PCR amplification with real-time fluorescence detection has performed PCR in isolated droplets at volumes 10{sup 6} smaller than commercial real-time PCR systems. The system utilized a shearing T-junction in a silicon device to generate a stream of monodisperse picoliter droplets that were isolated from the microfluidic channel walls and each other by the oil phase carrier. An off-chip valving system stopped the droplets on-chip, allowing them to be thermal cycled through the PCR protocol without droplet motion. With this system a 10-pL droplet, encapsulating less than one copy of viral genomic DNA through Poisson statistics, showed real-time PCR amplification curves with a cycle threshold of {approx}18, twenty cycles earlier than commercial instruments. This combination of the established real-time PCR assay with digital microfluidics is ideal for isolating single-copy nucleic acids in a complex environment.

  4. Optimized nested Markov chain Monte Carlo sampling: theory (Conference...

    Office of Scientific and Technical Information (OSTI)

    Optimized nested Markov chain Monte Carlo sampling: theory Citation Details In-Document Search Title: Optimized nested Markov chain Monte Carlo sampling: theory Metropolis Monte ...

  5. Supply Chain Sustainability Analysis of Three Biofuel Pathways...

    Office of Scientific and Technical Information (OSTI)

    Supply Chain Sustainability Analysis of Three Biofuel Pathways Citation Details In-Document Search Title: Supply Chain Sustainability Analysis of Three Biofuel Pathways The ...

  6. Supply Chain Sustainability Analysis of Fast Pyrolysis and Hydrotreati...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Supply Chain Sustainability Analysis of Fast Pyrolysis and Hydrotreating Bio-Oil to Produce Hydrocarbon Fuels Title Supply Chain Sustainability Analysis of Fast Pyrolysis and...

  7. Neutron multiplicity distributions for 30 MeVu {sup 14}N reactions with the indicated targets. Progress in research, April 1, 1991--March 31, 1992

    SciTech Connect (OSTI)

    Not Available

    1992-06-01

    This report contains short papers on the following topics: Heavy ion reactions; nuclear structure and fundamental interactions; nuclear theory; atomic molecular and materials science; and superconducting cyclotron and instrumentation. (LSP)

  8. Reaction chemistry of cerium

    SciTech Connect (OSTI)

    1997-01-01

    It is truly ironic that a synthetic organic chemist likely has far greater knowledge of the reaction chemistry of cerium(IV) than an inorganic colleague. Cerium(IV) reagents have long since been employed as oxidants in effecting a wide variety of organic transformations. Conversely, prior to the late 1980s, the number of well characterized cerium(IV) complexes did not extend past a handful of known species. Though in many other areas, interest in the molecular chemistry of the 4f-elements has undergone an explosive growth over the last twenty years, the chemistry of cerium(IV) has for the most part been overlooked. This report describes reactions of cerium complexes and structure.

  9. Photochemical reaction dynamics

    SciTech Connect (OSTI)

    Moore, B.C.

    1993-12-01

    The purpose of the program is to develop a fundamental understanding of unimolecular and bimolecular reaction dynamics with application in combustion and energy systems. The energy dependence in ketene isomerization, ketene dissociation dynamics, and carbonyl substitution on organometallic rhodium complexes in liquid xenon have been studied. Future studies concerning unimolecular processes in ketene as well as energy transfer and kinetic studies of methylene radicals are discussed.

  10. NNSA Contributions to the IAEA | National Nuclear Security Administration |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Security Administration | (NNSA) NNSA Contract Reform in Action: Supply Chain Management Center December 22, 2009 As part of NNSA's commitment to being a responsible steward of tax dollars, NNSA Administrator Thomas D'Agostino (then the head of Defense Programs) created the Supply Chain Management Center (SCMC) in 2006 and selected Honeywell, operator of the Kansas City Plant, as the lead contractor for managing the initiative. Since Management and Operating (M&O) contractors

  11. Nuclear Models

    SciTech Connect (OSTI)

    Fossion, Ruben [Instituto de Ciencias Nucleares, Universidad Nacional Autonoma de Mexico, Apartado Postal 70-543, Mexico D. F., C.P. 04510 (Mexico)

    2010-09-10

    The atomic nucleus is a typical example of a many-body problem. On the one hand, the number of nucleons (protons and neutrons) that constitute the nucleus is too large to allow for exact calculations. On the other hand, the number of constituent particles is too small for the individual nuclear excitation states to be explained by statistical methods. Another problem, particular for the atomic nucleus, is that the nucleon-nucleon (n-n) interaction is not one of the fundamental forces of Nature, and is hard to put in a single closed equation. The nucleon-nucleon interaction also behaves differently between two free nucleons (bare interaction) and between two nucleons in the nuclear medium (dressed interaction).Because of the above reasons, specific nuclear many-body models have been devised of which each one sheds light on some selected aspects of nuclear structure. Only combining the viewpoints of different models, a global insight of the atomic nucleus can be gained. In this chapter, we revise the the Nuclear Shell Model as an example of the microscopic approach, and the Collective Model as an example of the geometric approach. Finally, we study the statistical properties of nuclear spectra, basing on symmetry principles, to find out whether there is quantum chaos in the atomic nucleus. All three major approaches have been rewarded with the Nobel Prize of Physics. In the text, we will stress how each approach introduces its own series of approximations to reduce the prohibitingly large number of degrees of freedom of the full many-body problem to a smaller manageable number of effective degrees of freedom.

  12. Nuclear pursuits

    SciTech Connect (OSTI)

    Not Available

    1993-05-01

    This table lists quantities of warheads (in stockpile, peak number per year, total number built, number of known test explosions), weapon development milestones (developers of the atomic bomb and hydrogen bomb, date of first operational ICBM, first nuclear-powered naval SSN in service, first MIRVed missile deployed), and testing milestones (first fission test, type of boosted fission weapon, multistage thermonuclear test, number of months from fission bomb to multistage thermonuclear bomb, etc.), and nuclear infrastructure (assembly plants, plutonium production reactors, uranium enrichment plants, etc.). Countries included in the tally are the United States, Soviet Union, Britain, France, and China.

  13. Nuclear Controls | National Nuclear Security Administration | (NNSA)

    National Nuclear Security Administration (NNSA)

    Control Nuclear Controls Challenge: Detect/deter illicit transfers of nuclear/dual-use materials, technology, and commodities. Solution: Build domestic and international capacity to implement and meet export control obligations. Related Topics international security international security policy NIS nuclear controls safeguards safeguards and security verification Related News Nuclear Verification International Nuclear Safeguards Nonproliferation Policy Nonproliferation and Arms Control NIS

  14. Nuclear Verification | National Nuclear Security Administration | (NNSA)

    National Nuclear Security Administration (NNSA)

    Control Nuclear Verification Challenge: Maintain the U.S. ability to monitor and verify nuclear reduction agreements and detect violations of treaties and other nuclear nonproliferation commitments. Solution: Develop and deploy measures to ensure verifiable compliance with treaties and other international agreements, implement regimes to reduce nuclear weapons, and detect and dismantle undeclared nuclear programs. Specific subprogram activities include: Implementing current and developing future

  15. nuclear controls | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    controls Nuclear Verification Challenge: Maintain the U.S. ability to monitor and verify nuclear reduction agreements and detect violations of treaties and other nuclear nonproliferation commitments. Solution: Develop and deploy measures to ensure verifiable compliance with treaties and other international agreements,... International Nuclear Safeguards Challenge: Detect/deter undeclared nuclear materials and activities. Solution: Build capacity of the International Atomic Energy Agency and

  16. Defense Nuclear Facility | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Defense Nuclear Facility NNSA's safety office accredited and recognized for leadership in safe operation of defense nuclear facilities Part of NNSA's commitment to maintaining the nation's safe, secure, and effective nuclear deterrent are relentlessly high standards for technically capable nuclear enterprise personnel qualifications for all aspects of Defense Nuclear Facility operations. In December 2015, the Department of Energy

  17. Using Gagne`s Chain in OJT

    SciTech Connect (OSTI)

    Fetters, F.E.

    1993-11-01

    This report discusses Gagne`s Chain which is a taxonomy which can used as a tool to identify trainee deficiencies encountered during On-the-Job Training. It also assists in the development of effective training strategies for the training of deficient behaviors and knowledges. Gagne`s Chain presupposes three phases of acquisition for knowledges and skills identified as deficiencies: precondition, qualified acquisition, and unassisted demonstration. The hierarchy of the taxonomy identifies both the psychomotor and cognitive branches. At the ``Principles`` level, verbal and psychomotor activities are combined. Gagne`s Chain identifies the hierarchy as follows: Problem Solving [higher psychomotor and verbal combined level], Principles (lower psychomotor and verbal combined level), Association [highest verbal level], Discrimination [second highest verbal level], Signal Recognition [lowest verbal level], Operant Chain [higher psychomotor level], and Single Operant [lower psychomotor level]. A ``rule of thumb`` associated with the use of Gagne`s Chain is, if behavior or knowledge are not acquired at a higher level, the trainee should be trained at the next lower step. Then the knowledge or behavior acquired at this step becomes the precondition for the acquisition of the actual knowledge or skill identified at the original level.

  18. The reaction of hydroperoxy-propyl radicals with molecular oxygen

    SciTech Connect (OSTI)

    Bozzelli, J.W.; Pitz, W.J.

    1993-12-03

    Addition of hydroperoxy-alkyl radicals to molecular oxygen leads to chain branching in autoignition and engine knock, and in low temperature oxidation of paraffins. Rate constants and product channels for reaction of hydroperoxy-propyl radicals with O{sub 2} are estimated using thermodynamic properties, bimolecular quantum Kassel analysis and transition state theory. Thermochemistry of relevant molecules and radicals is estimated using group additivity and bond dissociation groups for radicals. Results show that rates of the hydroperoxy-propyl radical addition to O{sub 2} are near their high pressure limits at {ge} 1 atm. Main products at 1--15 atm are stabilization, reverse reaction to hydroperoxy-propyl + O{sub 2} and alkyl carbonyl + OH. Reactions of the stabilized adducts, dissociation rates and product channels are estimated using unimolecular quantum Kassel analysis, because stabilization is the most important hydroperoxy-propyl radical + O{sub 2} product channel. Below 700 K, the stabilized peroxy adducts react primarily to hydroperoxy-carbonyl + OH, products which lead to chain branching. Above 700K, the stabilized peroxy adducts react primarily to hydroperoxy-propyl radical + O{sub 2}, initial reactants, which inhibits the overall oxidation. This switchover in channels correlates well observed negative temperature coefficient behavior for propane oxidation. Rate expressions for reaction of each of the three hydroperoxy-alkyl isomers with O{sub 2} and for dissociation of the associated stabilized adducts are calculated for a series of pressures at 300--2100K.

  19. Nuclear Data Sheets for A = 230

    SciTech Connect (OSTI)

    Browne, E.; Tuli, J. K.

    2012-09-01

    The evaluators present in this publication spectroscopic data and level schemes from radioactive decay and nuclear reactions for all isobars with mass number A=230. This evaluation includes the first experimental evidence of 230Am, produced through the 197Au(40Ar,3n)234Bk (α decay to 230Am) reaction, E(40Ar)=188.4 MeV (2003MoZX).

  20. Nuclear Science & Technology

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Science & Technology Nuclear Science & Technology1354608000000Nuclear Science & TechnologySome of these resources are LANL-only and will require Remote Access. No...

  1. 2013 Nuclear Workforce Development ...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Energy Impact Topics: Today's & Tomorrow's New Nuclear Energy Construction & the Workforce Outlook Current New Nuclear Energy Construction Projects Small Modular...

  2. Ion-induced nuclear radiotherapy

    DOE Patents [OSTI]

    Horn, K.M.; Doyle, B.L.

    1996-08-20

    Ion-induced Nuclear Radiotherapy (INRT) is a technique for conducting radiosurgery and radiotherapy with a very high degree of control over the spatial extent of the irradiated volume and the delivered dose. Based upon the concept that low energy, ion induced atomic and nuclear reactions can be used to produce highly energetic reaction products at the site of a tumor, the INRT technique is implemented through the use of a conduit-needle or tube which conducts a low energy ion beam to a position above or within the intended treatment area. At the end of the conduit-needle or tube is a specially fabricated target which, only when struck by the ion beam, acts as a source of energetic radiation products. The inherent limitations in the energy, and therefore range, of the resulting reaction products limits the spatial extent of irradiation to a pre-defined volume about the point of reaction. Furthermore, since no damage is done to tissue outside this irradiated volume, the delivered dose may be made arbitrarily large. INRT may be used both as a point-source of radiation at the site of a small tumor, or as a topical bath of radiation to broad areas of diseased tissue. 25 figs.

  3. Ion-induced nuclear radiotherapy

    DOE Patents [OSTI]

    Horn, Kevin M.; Doyle, Barney L.

    1996-01-01

    Ion-induced Nuclear Radiotherapy (INRT) is a technique for conducting radiosurgery and radiotherapy with a very high degree of control over the spatial extent of the irradiated volume and the delivered dose. Based upon the concept that low energy, ion induced atomic and nuclear reactions can be used to produce highly energetic reaction products at the site of a tumor, the INRT technique is implemented through the use of a conduit-needle or tube which conducts a low energy ion beam to a position above or within the intended treatment area. At the end of the conduit-needle or tube is a specially fabricated target which, only when struck by the ion beam, acts as a source of energetic radiation products. The inherent limitations in the energy, and therefore range, of the resulting reaction products limits the spatial extent of irradiation to a pre-defined volume about the point of reaction. Furthermore, since no damage is done to tissue outside this irradiated volume, the delivered dose may be made arbitrarily large. INRT may be used both as a point-source of radiation at the site of a small tumor, or as a topical bath of radiation to broad areas of diseased tissue.

  4. NUCLEAR REACTOR

    DOE Patents [OSTI]

    Starr, C.

    1963-01-01

    This patent relates to a combination useful in a nuclear reactor and is comprised of a casing, a mass of graphite irapregnated with U compounds in the casing, and at least one coolant tube extending through the casing. The coolant tube is spaced from the mass, and He is irtroduced irto the space between the mass and the coolant tube. (AEC)

  5. About the Neutron and Nuclear Science Research (WNR) facility...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    "white" neutron source (Target 4) with 6 flight paths, three low-energy nuclear science flight paths at the Lujan Center (Target-1), and a proton reaction area (Target-2). ...

  6. Interplay between compound and fragments aspects of nuclear fission...

    Office of Scientific and Technical Information (OSTI)

    The scission point in nuclear fission plays a special role where one-body system changes to two-body system. Inverse of this situation is realized in heavy-ion fusion reaction ...

  7. A program in medium-energy nuclear physics

    SciTech Connect (OSTI)

    Berman, B.L.; Dhuga, K.S.

    1990-01-01

    This report discusses the following topics: electron-scattering nuclear-structure studies; coincidence electrodisintegration studies of light nuclei; pion scattering and reactions on the three-body nuclei; and pion scattering from shell-model nuclei.

  8. Better Plants Supply Chain Pilot – Overview

    Office of Energy Efficiency and Renewable Energy (EERE)

    The Department of Energy (DOE) is working with Better Plants Partners to improve energy efficiency throughout their supply chains. Around 40 to 60 percent of a manufacturing company’s energy and carbon footprint can reside upstream in its supply chain—from raw materials, transport, and packaging to the energy consumed in manufacturing processes—but this number can be as high as 80 percent. Coordinating energy management practices between companies and their supply chains has the potential to significantly improve industrial energy productivity and reduce the amount of energy embedded in manufactured products. Through this Supply Chain Pilot, DOE will work with a select group of Better Plants Partners to extend the benefits of energy efficiency to their suppliers. Partners will leverage existing Better Plants Program resources and encourage suppliers to collectively set, track, and meet energy savings goals.

  9. Peppytides: Interactive Models of Polypeptide Chains

    ScienceCinema (OSTI)

    Zuckermann, Ron; Chakraborty, Promita; Derisi, Joe

    2014-10-28

    Peppytides are scaled, 3D-printed models of polypeptide chains that can be folded into accurate protein structures. Designed and created by Berkeley Lab Researcher, Promita Chakraborty, and Berkeley Lab Senior Scientist, Dr. Ron Zuckermann, Peppytides are accurate physical models of polypeptide chains that anyone can interact with and fold intro various protein structures - proving to be a great educational tool, resulting in a deeper understanding of these fascinating structures and how they function. Build your own Peppytide model and learn about how nature's machines fold into their intricate architectures!

  10. Peppytides: Interactive Models of Polypeptide Chains

    SciTech Connect (OSTI)

    Zuckermann, Ron; Chakraborty, Promita; Derisi, Joe

    2014-01-21

    Peppytides are scaled, 3D-printed models of polypeptide chains that can be folded into accurate protein structures. Designed and created by Berkeley Lab Researcher, Promita Chakraborty, and Berkeley Lab Senior Scientist, Dr. Ron Zuckermann, Peppytides are accurate physical models of polypeptide chains that anyone can interact with and fold intro various protein structures - proving to be a great educational tool, resulting in a deeper understanding of these fascinating structures and how they function. Build your own Peppytide model and learn about how nature's machines fold into their intricate architectures!

  11. Catalysts for synthesizing various short chain hydrocarbons

    DOE Patents [OSTI]

    Colmenares, Carlos (Alamo, CA)

    1991-01-01

    Method and apparatus (10), including novel photocatalysts, are disclosed for the synthesis of various short chain hydrocarbons. Light-transparent SiO.sub.2 aerogels doped with photochemically active uranyl ions (18) are fluidized in a fluidized-bed reactor (12) having a transparent window (16), by hydrogen and CO, C.sub.2 H.sub.4 or C.sub.2 H.sub.6 gas mixtures (20), and exposed to radiation (34) from a light source (32) external to the reactor (12), to produce the short chain hydrocarbons (36).

  12. Interlaboratory reaction rate program. 12th progress report, November 1976-October 1979

    SciTech Connect (OSTI)

    Lippincott, E.P.; McElroy, W.N.; Preston, C.C.

    1980-09-01

    The Interlaboratory Reaction Rate UILRR) program is establishing the capability to accurately measure neutron-induced reactions and reaction rates for reactor fuels and materials development programs. The goal for the principal fission reactions, /sup 235/U, /sup 238/U and /sup 239/Pu, is an accuracy to within +- 5% at the 95% confidence level. Accurate measurement of other fission and nonfission reactions is also required, but to a lesser accuracy, between +- 5% and 10% at the 95% confidence level. A secondary program objective is improvement in knowledge of the nuclear parameters involved in the standarization of fuels and materials dosimetry measurements of neutron flux, spectra, fluence and burnup.

  13. Solid state laser media driven by remote nuclear powered fluorescence

    DOE Patents [OSTI]

    Prelas, Mark A.

    1992-01-01

    An apparatus is provided for driving a solid state laser by a nuclear powered fluorescence source which is located remote from the fluorescence source. A nuclear reaction produced in a reaction chamber generates fluorescence or photons. The photons are collected from the chamber into a waveguide, such as a fiber optic waveguide. The waveguide transports the photons to the remote laser for exciting the laser.

  14. Nuclear Data Sheets for A = 92

    SciTech Connect (OSTI)

    Baglin, Coral M.

    2012-10-15

    Nuclear structure and decay data pertaining to all nuclides with mass number A = 92 (As, Se, Br, Kr, Rb, Sr, Y, Zr, Nb, Mo, Tc, Ru, Rh, Pd) have been compiled and evaluated, and incorporated into the ENSDF data file. All literature available by 15 September 2012 has been considered. This evaluation supersedes the previous publication for this mass chain (Coral M. Baglin, Nuclear Data Sheets 91, 423 (2000) (November 2000 cutoff date)), and subsequent unpublished reevaluations by C.M. Baglin for {sup 92}Kr (January 2004 literature cut-off) and {sup 92}Sr (August 2003 literature cut-off).

  15. Defense Nuclear Nonproliferation | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Defense Nuclear Nonproliferation NNSA Announces Elimination of Highly Enriched Uranium (HEU) from Indonesia All of Southeast Asia Now HEU-Free (WASHINGTON, D.C.) - The U.S. Department of Energy's National Nuclear Security Administration (DOE/NNSA), Indonesian Nuclear Industry, LLC (PT INUKI), the National Nuclear Energy Agency (BATAN), and the Nuclear Energy Regulatory Agency (BAPETEN) of the... NNSA program strengthens national security from afar The Nuclear Smuggling Detection and Deterrence

  16. Microscopic Description of the Exotic Nuclei Reactions by Using Folding model Potentials

    SciTech Connect (OSTI)

    Ibraheem, Awad A.; Hassanain, M. A.; Mokhtar, S. R.; El-Azab Farid, M.; Zaki, M. A.; Mahmoud, Zakaria M. M.

    2011-10-27

    A microscopic folding approach based upon the effective M3Y nucleon-nucleon interaction and the nuclear matter densities of the interacting nuclei has been carried out to explain recently measured experimental data of the {sup 6}He+{sup 120}Sn elastic scattering reaction at four different laboratory energies near the Coulomb barrier. The corresponding reaction cross sections are also considered.

  17. Nuclear Forensics | National Nuclear Security Administration...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Forensics Forensics Operations The National Technical Nuclear Forensics (NTNF) program is a Homeland Security Council and National Security Council-sponsored policy ...

  18. Nuclear Security Enterprise | National Nuclear Security Administration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    About Our Programs Defense Programs Nuclear Security Enterprise The Nuclear Security Enterprise (NSE) mission is to ensure the Nation sustains a safe, secure, and effective ...

  19. Nuclear Verification | National Nuclear Security Administration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Challenge: Maintain the U.S. ability to monitor and verify nuclear reduction agreements and detect violations of treaties and other nuclear nonproliferation commitments. Solution: ...

  20. Nuclear Suppliers Group & Regimes | National Nuclear Security...

    National Nuclear Security Administration (NNSA)

    | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency ...

  1. Nuclear Controls | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Controls | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy ...

  2. Nuclear and Radiological Material Security | National Nuclear...

    National Nuclear Security Administration (NNSA)

    This includes NNSA's work to advance physical protection standards for nuclear facilities and to strengthen nuclear safeguards, which are criteria for the physical security and the ...

  3. nuclear emergency | National Nuclear Security Administration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Apply for Our Jobs Our Jobs Working at NNSA Blog Home nuclear emergency nuclear emergency Fukushima: Five Years Later After the March 11, 2011, Japan earthquake, tsunami, and ...

  4. Nuclear / Radiological Advisory Team | National Nuclear Security...

    National Nuclear Security Administration (NNSA)

    Nuclear Radiological Advisory Team (NRAT) provides an emergency response capability for on-scene scientific and technical advice for both domestic and international nuclear or ...

  5. Nuclear Incident Team | National Nuclear Security Administration...

    National Nuclear Security Administration (NNSA)

    Incident Team NNSA houses the Nuclear Incident Team (NIT), which is responsible for deploying assets at the request of coordinating agencies in response to a nuclear or ...

  6. Nuclear Energy Systems Laboratory (NESL) / Transient Nuclear...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Transient Nuclear Fuels Testing - Sandia Energy Energy Search Icon Sandia Home Locations ... Safety, Security & Resilience of the Energy Infrastructure Energy Storage Nuclear Power & ...

  7. nuclear science week | National Nuclear Security Administration...

    National Nuclear Security Administration (NNSA)

    science week Nuclear Science Week releases 2015 Impact Report and 2016 Request for Proposal Last week the Nuclear Science Week (NSW) National Steering Committee released its impact ...

  8. Nuclear Security Enterprise | National Nuclear Security Administration...

    National Nuclear Security Administration (NNSA)

    Nuclear Security Enterprise The Nuclear Security Enterprise ... efficient 21stcentury NSE with less environmental impact. ... is referred to as Stockpile Stewardship and Management. ...

  9. Status of nuclear data for actinides

    SciTech Connect (OSTI)

    Guzhovskii, B.Y.; Gorelov, V.P.; Grebennikov, A.N.

    1995-10-01

    Nuclear data required for transmutation problem include many actinide nuclei. In present paper the analysis of neutron fission, capture, (n,2n) and (n,3n) reaction cross sections at energy region from thermal point to 14 MeV was carried out for Th, Pa, U, Np, Pu, Am and Cm isotops using modern evaluated nuclear data libraries and handbooks of recommended nuclear data. Comparison of these data indicates on substantial discrepancies in different versions of files, that connect with quality and completeness of original experimental data.

  10. Nuclear reactor shutdown system

    DOE Patents [OSTI]

    Bhate, Suresh K.; Cooper, Martin H.; Riffe, Delmar R.; Kinney, Calvin L.

    1981-01-01

    An inherent shutdown system for a nuclear reactor having neutron absorbing rods affixed to an armature which is held in an upper position by a magnetic flux flowing through a Curie temperature material. The Curie temperature material is fixedly positioned about the exterior of an inner duct in an annular region through which reactor coolant flows. Elongated fuel rods extending from within the core upwardly toward the Curie temperature material are preferably disposed within the annular region. Upon abnormal conditions which result in high neutron flux and coolant temperature, the Curie material loses its magnetic permeability, breaking the magnetic flux path and allowing the armature and absorber rods to drop into the core, thus shutting down the fissioning reaction. The armature and absorber rods are retrieved by lowering the housing for the electromagnet forming coils which create a magnetic flux path which includes the inner duct wall. The coil housing then is raised, resetting the armature.

  11. Application of nuclear models to neutron nuclear cross section calculations

    SciTech Connect (OSTI)

    Young, P.G.

    1982-01-01

    Nuclear theory is used increasingly to supplement and extend the nuclear data base that is available for applied studies. Areas where theoretical calculations are most important include the determination of neutron cross sections for unstable fission products and transactinide nuclei in fission reactor or nuclear waste calculations and for meeting the extensive dosimetry, activation, and neutronic data needs associated with fusion reactor development, especially for neutron energies above 14 MeV. Considerable progress has been made in the use of nuclear models for data evaluation and, particularly, in the methods used to derive physically meaningful parameters for model calculations. Theoretical studies frequently involve use of spherical and deformed optical models, Hauser-Feshbach statistical theory, preequilibrium theory, direct-reaction theory, and often make use of gamma-ray strength function models and phenomenological (or microscopic) level density prescriptions. The development, application, and limitations of nuclear models for data evaluation are discussed, with emphasis on the 0.1 to 50 MeV energy range. (91 references).

  12. Nuclear Data Sheets for A = 161

    SciTech Connect (OSTI)

    Reich C. W.; Reich C.W.

    2011-10-01

    The experimental results from the various reaction and radioactive decay studies leading to nuclides in the A = 161 mass chain have been reviewed. Nuclides ranging from Sm (Z = 62) through Os (Z = 76) are included, with Os being a new entry based on a recently reported study. These data are summarized and presented, together with adopted level schemes and properties. This work supersedes the previous evaluation (2000Re14) of the data on these nuclides.

  13. Nuclear | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Nuclear Nuclear Radioisotope Power Systems, a strong partnership between the Energy Department's Office of Nuclear Energy and NASA, has been providing the energy for deep space exploration. Nuclear power is the use of sustained nuclear fission to generate heat and electricity. Nuclear power plants provide about 6 percent of the world's energy and 13-14 percent of the world's electricity. Featured Moving Forward to Address Nuclear Waste Storage and Disposal Three trucks transport nuclear waste

  14. Investigation of reports of fusion reactions occurring at the cathode in glow discharges

    SciTech Connect (OSTI)

    Ellison, C.H.; Mahaffey, J.A.

    1996-01-01

    Recent reports of deuteron-deuteron (d-d) neutrons resulting from nuclear reactions in or at the palladium cathode of a deuterium glow discharge were investigated. The equipment, techniques, and experimental procedures are discussed in detail, as well as various possible mechanisms to produce such reactions. The results of this investigation do not confirm the presence of d-d reactions. 15 refs., 9 figs.

  15. NUCLEAR REACTORS

    DOE Patents [OSTI]

    Long, E.; Ashby, J.W.

    1958-09-16

    ABS>A graphite moderator structure is presented for a nuclear reactor compriscd of an assembly of similarly orientated prismatic graphite blocks arranged on spaced longitudinal axes lying in common planes wherein the planes of the walls of the blocks are positioned so as to be twisted reintive to the planes of said axes so thatthe unlmpeded dtrect paths in direction wholly across the walls of the blocks are limited to the width of the blocks plus spacing between the blocks.

  16. NUCLEAR REACTOR

    DOE Patents [OSTI]

    Anderson, C.R.

    1962-07-24

    A fluidized bed nuclear reactor and a method of operating such a reactor are described. In the design means are provided for flowing a liquid moderator upwardly through the center of a bed of pellets of a nentron-fissionable material at such a rate as to obtain particulate fluidization while constraining the lower pontion of the bed into a conical shape. A smooth circulation of particles rising in the center and falling at the outside of the bed is thereby established. (AEC)

  17. Building a More Efficient Industrial Supply Chain

    Broader source: Energy.gov [DOE]

    This infographic highlights some of the ways businesses can save money at each step of the energy supply chain. Many companies can identify low-cost ways to reduce energy costs in electricity generation, electricity transmission, industrial processes, product delivery, and retail sales.

  18. Supersolitons: Solitonic Excitations in Atomic Soliton Chains

    SciTech Connect (OSTI)

    Novoa, David; Michinel, Humberto; Perez-Garcia, Victor M.

    2008-10-03

    We show that, by tuning interactions in nonintegrable vector nonlinear Schroedinger equations modeling Bose-Einstein condensates and other relevant physical systems, it is possible to achieve a regime of elastic particlelike collisions between solitons. This would allow one to construct a Newton's cradle with solitons and supersolitons: localized collective excitations in solitary-wave chains.

  19. NUCLEAR REACTOR

    DOE Patents [OSTI]

    Grebe, J.J.

    1959-07-14

    High temperature reactors which are uniquely adapted to serve as the heat source for nuclear pcwered rockets are described. The reactor is comprised essentially of an outer tubular heat resistant casing which provides the main coolant passageway to and away from the reactor core within the casing and in which the working fluid is preferably hydrogen or helium gas which is permitted to vaporize from a liquid storage tank. The reactor core has a generally spherical shape formed entirely of an active material comprised of fissile material and a moderator material which serves as a diluent. The active material is fabricated as a gas permeable porous material and is interlaced in a random manner with very small inter-connecting bores or capillary tubes through which the coolant gas may flow. The entire reactor is divided into successive sections along the direction of the temperature gradient or coolant flow, each section utilizing materials of construction which are most advantageous from a nuclear standpoint and which at the same time can withstand the operating temperature of that particular zone. This design results in a nuclear reactor characterized simultaneously by a minimum critiral size and mass and by the ability to heat a working fluid to an extremely high temperature.

  20. Development of odd-Z-projectile reactions for transactinide element synthesis

    SciTech Connect (OSTI)

    Folden III, Charles Marvin

    2004-11-04

    The development of new odd-Z-projectile reactions leading to the production of transactinide elements is described. The cross section of the even-Z-projectile 208Pb(64Ni, n)271Ds reaction was measured at two new energies using the Berkeley Gas-filled Separator at the Lawrence Berkeley National Laboratory 88-Inch Cyclotron. In total, seven decay chains attributable to 271Ds were observed. These data, combined with previous results, establish an excitation function for the production of 271Ds. The maximum cross section was 20 +15 -11 pb at a center-of-target energy of 311.5 MeV in the laboratory frame.The data from the 271Ds experiments were used to estimate the optimum beam energy for the new odd-Z-projectile 208Pb(65Cu, n)272-111 reaction using the Fusion by Diffusion theory proposed by Swiatecki, Siwek-Wilczynska, and Wilczynski. A cross section for this reaction was measured for the first time, at a center-of-target energy of 321.1 MeV in the laboratory frame. The excitation energy f or compound nuclei formed at the target center was 13.2 MeV. One decay chain was observed, resulting in a measured cross section of 1.7 +3.9 -1.4 pb. This decay chain is in good agreement with previously published data on the decay of 272-111.The new odd-Z-projectile 208Pb(55Mn, n)262Bh reaction was studied at three different projectile energies, and 33 decay chains of 262Bh were observed. The existence of a previously reported alpha-decaying isomeric state in this nuclide was confirmed. Production of the ground state was preferred at all three beam energies. The maximum cross section was 540 +180 -150 pb at a projectile center-of-target energy of 264.0 MeV. This cross section is much larger than that previously reported for the even-Z-projectile 209Bi(54Cr, n)262Bh reaction, which may be because the 54Cr projectile energies in the latter reaction were too high for optimum production of the 1n product. At the highest projectile energy of 268.0 MeV in the target center, two decay

  1. National Nuclear Security Administration - Lisa Copeland | Department of

    Energy Savers [EERE]

    Energy Lisa Copeland National Nuclear Security Administration - Lisa Copeland Presented at the 15th Annual DOE Small Business Forum & Expo by: Lisa Copeland, Small Business Program Manager, Y-12 National Security Complex National Nuclear Security Administration - Lisa Copeland (4.17 MB) More Documents & Publications December 12, 2013 Business Opportunity Session Presentations Small Business Program Manager Directory DOE's Supply Chain Management

  2. Building a Universal Nuclear Energy Density Functional

    SciTech Connect (OSTI)

    Carlson, Joe A.; Furnstahl, Dick; Horoi, Mihai; Lust, Rusty; Nazaewicc, Witek; Ng, Esmond; Thompson, Ian; Vary, James

    2012-12-30

    During the period of Dec. 1 2006 – Jun. 30, 2012, the UNEDF collaboration carried out a comprehensive study of all nuclei, based on the most accurate knowledge of the strong nuclear interaction, the most reliable theoretical approaches, the most advanced algorithms, and extensive computational resources, with a view towards scaling to the petaflop platforms and beyond. The long-term vision initiated with UNEDF is to arrive at a comprehensive, quantitative, and unified description of nuclei and their reactions, grounded in the fundamental interactions between the constituent nucleons. We seek to replace current phenomenological models of nuclear structure and reactions with a well-founded microscopic theory that delivers maximum predictive power with well-quantified uncertainties. Specifically, the mission of this project has been three-fold:  First, to find an optimal energy density functional (EDF) using all our knowledge of the nucleonic Hamiltonian and basic nuclear properties;  Second, to apply the EDF theory and its extensions to validate the functional using all the available relevant nuclear structure and reaction data;  Third, to apply the validated theory to properties of interest that cannot be measured, in particular the properties needed for reaction theory.

  3. Studies in Low-Energy Nuclear Science

    SciTech Connect (OSTI)

    Carl R. Brune; Steven M. Grimes

    2010-01-13

    This report presents a summary of research projects in the area of low energy nuclear reactions and structure, carried out between March 1, 2006 and October 31, 2009 which were supported by U.S. DOE grant number DE-FG52-06NA26187.

  4. Modeling nuclear fusion in dense plasmas using a cryogenic non-neutral plasma

    SciTech Connect (OSTI)

    Dubin, Daniel H. E.

    2008-05-15

    An analogy between the nuclear reaction rate in a dense neutral plasma and the energy equipartition rate in a strongly magnetized non-neutral plasma is discussed. This analogy allows the first detailed measurements of plasma screening enhancements in the strong screening and pycnonuclear regimes. In strong magnetic fields and at low temperatures, cyclotron energy, like nuclear energy, is released only through rare close collisions between charges. The probability of such collisions is enhanced by plasma screening, just as for nuclear reactions. Rate enhancements of up to 10{sup 10} are measured in simulations of equipartition, and are compared to theories of screened nuclear reactions.

  5. 2013-2014 SECTION II: HEAVY ION REACTIONS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Recent results of 45Sc-induced fusion evaporation reactions on 158,160Gd T. A. Werke, D. A. Mayorov, M. C. Alfonso, M. M. Frey, and C. M. Folden III Production cross sections of residues in 50Ti-induced reactions D. A. Mayorov, T. A. Werke, M. C. Alfonso, M. M. Frey, E. E. Tereshatov, and C. M. Folden III Development of nuclear forensics program at Texas A&M University T. K. Bhardwaj, J. R. Allred, K. F. Jones, P. M. Mendoza, R. L. Du, C. M. Folden III, and S. S. Chirayath Exploring the

  6. Nuclear Detonation Detection | National Nuclear Security Administration |

    National Nuclear Security Administration (NNSA)

    (NNSA) Research and Development Nuclear Detonation Detection The Office of Nuclear Detonation Detection (NDD) develops and provide continuous, global capabilities to detect foreign nuclear weapon detonations, including for test ban treaty monitoring needs and military requirements. These efforts are aligned along three functional areas: Space-based Detection of Nuclear Detonations: Develops and builds space sensors for the nation's operational nuclear test treaty monitoring and Integrated

  7. nuclear threat science | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    threat science Counterterrorism Counterterrorism Policy and Cooperation Nuclear Threat Science Office of Nuclear Threat Science The Office of Nuclear Threat Science is responsible for overseeing the Nuclear Counterterrorism Program, an NNSA program that sustains specialized expertise and integrates and executes key activities to advise and enable technical aspects of U.S. Government nuclear counterterrorism and... Office of Counterterrorism Policy and Cooperation The 2011 National Strategy for

  8. nuclear science | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    science Nuclear Science Week releases 2015 Impact Report and 2016 Request for Proposal Last week the Nuclear Science Week (NSW) National Steering Committee released its impact report from the 2015 event, detailing the many ways people were educated about all things nuclear as a result of the event. Nuclear Science Week is an international weeklong celebration to focus interest on... Consortium Led by University of California, Berkeley Awarded $25M NNSA Grant for Nuclear Science and Security

  9. NUCLEAR REACTORS

    DOE Patents [OSTI]

    Long, E.; Ashley, J.W.

    1958-12-16

    A graphite moderator structure is described for a gas-cooled nuclear reactor having a vertical orlentation wherein the structure is physically stable with regard to dlmensional changes due to Wigner growth properties of the graphite, and leakage of coolant gas along spaces in the structure is reduced. The structure is comprised of stacks of unlform right prismatic graphite blocks positioned in layers extending in the direction of the lengths of the blocks, the adjacent end faces of the blocks being separated by pairs of tiles. The blocks and tiles have central bores which are in alignment when assembled and are provided with cooperatlng keys and keyways for physical stability.

  10. NUCLEAR REACTOR

    DOE Patents [OSTI]

    Young, G.

    1963-01-01

    This patent covers a power-producing nuclear reactor in which fuel rods of slightly enriched U are moderated by heavy water and cooled by liquid metal. The fuel rods arranged parallel to one another in a circle are contained in a large outer closed-end conduit that extends into a tank containing the heavy water. Liquid metal is introduced into the large conduit by a small inner conduit that extends within the circle of fuel rods to a point near the lower closed end of the outer conduit. (AEC) Production Reactors

  11. {alpha}-particle optical potentials for nuclear astrophysics (NA) and nuclear technology (NT)

    SciTech Connect (OSTI)

    Avrigeanu, V.; Avrigeanu, M.

    2012-11-20

    The high precision of recent measurements for low-energy {alpha}-particle elastic-scattering as well as induced-reaction data makes possible the understanding of actual limits and possible improvement of the global optical model potentials parameters. Involvement of recent optical potentials for reliable description of both the elastic scattering and emission of {alpha}-particles, of equal interest for nuclear astrophysics (NA) and nuclear technology (NT) for fusion devices, is discussed in the present work.

  12. The electron screening puzzle and nuclear clustering

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Spitaleri, C.; Bertulani, C. A.; Fortunato, L.; Vitturi, A.

    2016-02-12

    Accurate measurements of nuclear reactions of astrophysical interest within, or close to, the Gamow peak show evidence of an unexpected effect attributed to the presence of atomic electrons in the target. The experiments need to include an effective "screening" potential to explain the enhancement of the cross sections at the lowest measurable energies. Despite various theoretical studies conducted over the past 20 years and numerous experimental measurements, a theory has not yet been found that can explain the cause of the exceedingly high values of the screening potential needed to explain the data. Furthermore, in this letter we show thatmore » instead of an atomic physics solution of the "electron screening puzzle", the reason for the large screening potential values is in fact due to clusterization effects in nuclear reactions, in particular for reaction involving light nuclei.« less

  13. Nuclear Data Links

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Links to Other Useful Sites Online Journals Institutions and Programs Related to Nuclear Physics U.S. Nuclear Data Program: All evaluated nuclear data supported by the U.S. Department of Energy. National Nuclear Data Center: Brookhaven National Laboratory; Evaluated Nuclear Structure Data Files (ENSDF), Nuclear Science References (NSR) and other databases. Isotopes Project: (E.O.L. Berkeley National Laboratory) Table of Isotopes, Isotope Explorer, XUNDL, Nuclear Data Dissemination Homepage, and

  14. Two chamber reaction furnace

    DOE Patents [OSTI]

    Blaugher, Richard D.

    1998-05-05

    A vertical two chamber reaction furnace. The furnace comprises a lower chamber having an independently operable first heating means for heating the lower chamber and a gas inlet means for admitting a gas to create an ambient atmosphere, and an upper chamber disposed above the lower chamber and having an independently operable second heating means for heating the upper chamber. Disposed between the lower chamber and the upper chamber is a vapor permeable diffusion partition. The upper chamber has a conveyor means for conveying a reactant there through. Of particular importance is the thallinating of long-length thallium-barium-calcium-copper oxide (TBCCO) or barium-calcium-copper oxide (BCCO) precursor tapes or wires conveyed through the upper chamber to thereby effectuate the deposition of vaporized thallium (being so vaporized as the first reactant in the lower chamber at a temperature between about 700.degree. and 800.degree. C.) on TBCCO or BCCO tape or wire (the second reactant) at its simultaneous annealing temperature in the upper chamber of about 800.degree. to 950.degree. C. to thereby replace thallium oxide lost from TBCCO tape or wire because of the high annealing temperature or to deposit thallium on BCCO tape or wire. Continuously moving the tape or wire provides a single-step process that effectuates production of long-length TBCCO superconducting product.

  15. Two chamber reaction furnace

    DOE Patents [OSTI]

    Blaugher, R.D.

    1998-05-05

    A vertical two chamber reaction furnace is described. The furnace comprises a lower chamber having an independently operable first heating means for heating the lower chamber and a gas inlet means for admitting a gas to create an ambient atmosphere, and an upper chamber disposed above the lower chamber and having an independently operable second heating means for heating the upper chamber. Disposed between the lower chamber and the upper chamber is a vapor permeable diffusion partition. The upper chamber has a conveyor means for conveying a reactant there through. Of particular importance is the thallinating of long-length thallium-barium-calcium-copper oxide (TBCCO) or barium-calcium-copper oxide (BCCO) precursor tapes or wires conveyed through the upper chamber to thereby effectuate the deposition of vaporized thallium (being so vaporized as the first reactant in the lower chamber at a temperature between about 700 C and 800 C) on TBCCO or BCCO tape or wire (the second reactant) at its simultaneous annealing temperature in the upper chamber of about 800 to 950 C to thereby replace thallium oxide lost from TBCCO tape or wire because of the high annealing temperature or to deposit thallium on BCCO tape or wire. Continuously moving the tape or wire provides a single-step process that effectuates production of long-length TBCCO superconducting product. 2 figs.

  16. Radionuclide chain transport through heterogeneous media

    SciTech Connect (OSTI)

    Hadermann, J.; Patry, J.

    1982-04-01

    A one-dimensional radionuclide chain transport model is developed, taking into account sorption, longitudinal dispersion, and arbitrary repository concentrations. For piecewise constant geologic parameters, a semianalytic solution can be written down, when, at the layer boundaries, mass conservation is considered rigorously and flux conservation to a good approximation. The solution consists of a superposition of terms that are easily interpreted and is invariant under layer permutation and parameter scaling. A corresponding computer code RANCH has been developed. The /sup 245/Cm chain has been investigated for a broad variation of parameters of a three-layer geology. For very small retention factors only, /sup 245/Cm and /sup 241/Am can survive migration in the geologic medium, while /sup 237/Np is reduced by at most three orders of magnitude.

  17. Method for preparation of single chain antibodies

    DOE Patents [OSTI]

    Cheung, Nai-Kong V.; Guo, Hong-fen

    2012-04-03

    This invention provides a method for identifying cells expressing a target single chain antibody (scFv) directed against a target antigen from a collection of cells that includes cells that do not express the target scFv, comprising the step of combining the collection of cells with an anti-idiotype directed to an antibody specific for the target antigen and detecting interaction, if any, of the anti-idiotype with the cells, wherein the occurrence of an interaction identifies the cell as one which expresses the target scFv. This invention also provides a method for making a single chain antibody (scFv) directed against an antigen, wherein the selection of clones is made based upon interaction of those clones with an appropriate anti-idiotype, and heretofore inaccessible scFv so made. This invention provides the above methods or any combination thereof. Finally, this invention provides various uses of these methods.

  18. Attempt to confirm superheavy element production in the 48Ca +238U reaction

    SciTech Connect (OSTI)

    Gregorich, K.E.; Loveland, W.; Peterson, D.; Zielinski, P.M.; Nelson, S.L.; Chung, Y.H.; Dullmann, Ch.E.; Folden III, C.M.; Aleklett,K.; Eichler, R.; Hoffman D.C.; Omtvedt, J.P.; Pang, G.K.; Schwantes,J.M.; Soverna, S.; Sprunger, P.; Sudowe, R.; Wilson, R.E.; Nitsche, H.

    2005-03-24

    An attempt to confirm production of superheavy elements in the reaction of 48Ca beams with actinide targets has been performed using the 238U(48Ca,3n)283112 reaction. Two 48Ca projectile energies were used, that spanned the energy range where the largest cross sections have been reported for this reaction. No spontaneous fission events were observed. No alpha decay chains consistent with either reported or theoretically predicted element 112 decay properties were observed. The cross section limits reached are significantly smaller than the recently reported cross sections.

  19. Attempt to confirm superheavy element production in the {sup 48}Ca+{sup 238}U reaction

    SciTech Connect (OSTI)

    Gregorich, K.E.; Sudowe, R.; Loveland, W.; Sprunger, P.; Peterson, D.; Zielinski, P.M.; Nelson, S.L.; Duellmann, Ch.E.; Folden III, C.M.; Hoffman, D.C.; Wilson, R.E.; Nitsche, H.; Chung, Y.H.; Aleklett, K.; Eichler, R.; Soverna, S.; Omtvedt, J.P.; Pang, G.K.; Schwantes, J.M.

    2005-07-01

    An attempt to confirm production of superheavy elements in the reaction of {sup 48}Ca beams with actinide targets has been performed using the {sup 238}U({sup 48}Ca,3n){sup 283}112 reaction. Two {sup 48}Ca projectile energies were used that spanned the energy range where the largest cross sections have been reported for this reaction. No spontaneous fission events were observed. No {alpha} decay chains consistent with either reported or theoretically predicted element 112 decay properties were observed. The cross-section limits reached are significantly smaller than the recently reported cross sections.

  20. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated to minimizing the energy required to perform computational operations and to

  1. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated to minimizing the energy required to perform computational operations and to

  2. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated to minimizing the energy required to perform computational operations and to

  3. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated to minimizing the energy required to perform computational operations and to

  4. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated to minimizing the energy required to perform computational operations and to

  5. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated to minimizing the energy required to perform computational operations and to

  6. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated to minimizing the energy required to perform computational operations and to

  7. Kinetic simulations of plasmoid chain dynamics

    SciTech Connect (OSTI)

    Markidis, S. [High Performance Computing and Visualization (HPCViz) Department, KTH Royal Institute of Technology, Stockholm (Sweden)] [High Performance Computing and Visualization (HPCViz) Department, KTH Royal Institute of Technology, Stockholm (Sweden); Henri, P. [Universit de Nice Sophia Antipolis, CNRS, Observatoire de la Cte d'Azur, Nice (France)] [Universit de Nice Sophia Antipolis, CNRS, Observatoire de la Cte d'Azur, Nice (France); Lapenta, G. [Centrum voor Plasma-Astrofysica, Department Wiskunde, Katholieke Universiteit Leuven, Leuven (Belgium)] [Centrum voor Plasma-Astrofysica, Department Wiskunde, Katholieke Universiteit Leuven, Leuven (Belgium); Divin, A. [Swedish Institute of Space Physics, Uppsala (Sweden)] [Swedish Institute of Space Physics, Uppsala (Sweden); Goldman, M.; Newman, D. [Department of Physics and CIPS, University of Colorado, Boulder 80309-0390 (United States)] [Department of Physics and CIPS, University of Colorado, Boulder 80309-0390 (United States); Laure, E. [PDC and High Performance Computing and Visualization (HPCViz) Department, KTH Royal Institute of Technology, Stockholm (Sweden)] [PDC and High Performance Computing and Visualization (HPCViz) Department, KTH Royal Institute of Technology, Stockholm (Sweden)

    2013-08-15

    The dynamics of a plasmoid chain is studied with three dimensional Particle-in-Cell simulations. The evolution of the system with and without a uniform guide field, whose strength is 1/3 the asymptotic magnetic field, is investigated. The plasmoid chain forms by spontaneous magnetic reconnection: the tearing instability rapidly disrupts the initial current sheet generating several small-scale plasmoids that rapidly grow in size coalescing and kinking. The plasmoid kink is mainly driven by the coalescence process. It is found that the presence of guide field strongly influences the evolution of the plasmoid chain. Without a guide field, a main reconnection site dominates and smaller reconnection regions are included in larger ones, leading to an hierarchical structure of the plasmoid-dominated current sheet. On the contrary in presence of a guide field, plasmoids have approximately the same size and the hierarchical structure does not emerge, a strong core magnetic field develops in the center of the plasmoid in the direction of the existing guide field, and bump-on-tail instability, leading to the formation of electron holes, is detected in proximity of the plasmoids.

  8. Duplex quantum communication through a spin chain

    SciTech Connect (OSTI)

    Wang Zhaoming; Gu Yongjian [Department of Physics, Ocean University of China, Qingdao 266100 (China); Bishop, C. Allen [Department of Physics, Southern Illinois University, Carbondale, Illinois 62901-4401 (United States); Shao Bin [Department of Physics, Beijing Institute of Technology, Beijing 100081 (China)

    2011-08-15

    Data multiplexing within a quantum computer can allow for the simultaneous transfer of multiple streams of information over a shared medium thereby minimizing the number of channels needed for requisite data transmission. Here, we investigate a two-way quantum communication protocol using a spin chain placed in an external magnetic field. In our scheme, Alice and Bob each play the role of a sender and a receiver as two states, cos(({theta}{sub 1}/2))0+sin(({theta}{sub 1}/2))e{sup i{phi}{sub 1}}1 and cos(({theta}{sub 2}/2))0+sin(({theta}{sub 2}/2))e{sup i{phi}{sub 2}}1, are transferred through one channel simultaneously. We find that the transmission fidelity at each end of a spin chain can usually be enhanced by the presence of a second party. This is an important result for establishing the viability of duplex quantum communication through spin chain networks.

  9. Adsorption of polymer chains at penetrable interfaces

    SciTech Connect (OSTI)

    Gerasimchuk, I. V.; Sommer, J.-U.; Gerasimchuk, V. S.

    2011-03-15

    We investigate the problem of adsorption (localization) of polymer chains in the system of two penetrable interfaces within the mean-field approximation. The saturation of the polymer system in the limit case of zero bulk concentration is studied. We find the exact solution of this mean-field polymer adsorption problem that opens the possibility to treat various localization problems for polymer chains in such environments using appropriate boundary conditions. The exact solution is controlled by a single scaling variable that describes the coupling between the interfaces due to the polymer chains. We obtain a nonmonotonic behavior of the amount of adsorbed polymers as a function of the distance between the interfaces. This leads to a high-energy and a low-energy phase for the double layer with respect to the amount of polymers localized. At the saturation point, we find the total energy of the system and determine the force acting between the interfaces to be strictly attractive and to monotonically decay to zero when the interface distance increases.

  10. Metal-Ion-Mediated Reactions

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Researchers from Patras (Greece), Nicosia (Cyprus), Karlsruhe (Germany), Zaragoza (Spain), and the ALS at Berkeley Lab have studied metal-ion-mediated reactions of...

  11. Ab initio calculations of light-ion fusion reactions

    SciTech Connect (OSTI)

    Hupin, G.; Quaglioni, S.; Navratil, P.

    2012-10-20

    The exact treatment of nuclei starting from the constituent nucleons and the fundamental interactions among them has been a long-standing goal in nuclear physics. Above all nuclear scattering and reactions, which require the solution of the many-body quantum-mechanical problem in the continuum, represent an extraordinary theoretical as well as computational challenge for ab initio approaches. The ab initio No-Core Shell Model/Resonating-Group Method (NCSM/RGM) complements a microscopic cluster technique with the use of realistic interactions, and a microscopic and consistent description of the nucleon clusters. This approach is capable of describing simultaneously both bound and scattering states in light nuclei. Recent applications to light nuclei scattering and fusion reactions relevant to energy production in stars and Earth based fusion facilities, such as the deuterium-{sup 3}He fusion, are presented. Progress toward the inclusion of the three nucleon force into the formalism is outlined.

  12. Fifty years of nuclear fission: Nuclear data and measurements...

    Office of Scientific and Technical Information (OSTI)

    Technical Report: Fifty years of nuclear fission: Nuclear data and measurements series Citation Details In-Document Search Title: Fifty years of nuclear fission: Nuclear data and ...

  13. Fifty years of nuclear fission: Nuclear data and measurements...

    Office of Scientific and Technical Information (OSTI)

    Fifty years of nuclear fission: Nuclear data and measurements series Citation Details In-Document Search Title: Fifty years of nuclear fission: Nuclear data and measurements series ...

  14. Green Energy Supply Chain Franchise and Excise Tax Credit

    Office of Energy Efficiency and Renewable Energy (EERE)

    A certified green energy supply chain manufacturer and campus affiliate, integrated customer or integrated supplier of a green energy supply chain manufacturer is allowed a tax credit against their...

  15. New DOE Reports Assess Offshore Wind Market and Supply Chain...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Reports Assess Offshore Wind Market and Supply Chain New DOE Reports Assess Offshore Wind Market and Supply Chain April 1, 2013 - 12:58pm Addthis This is an excerpt from the First ...

  16. Supply Chain Management Center event highlights how small businesses...

    National Nuclear Security Administration (NNSA)

    Supply Chain Management Center event highlights how small businesses can help NNSA carry out its missions Thursday, February 18, 2016 - 11:06am NNSA Blog The Supply Chain ...

  17. Optical probe for the cytochrome P-450 cholesterol side chain cleavage enzyme

    DOE Patents [OSTI]

    Marrone, Babetta L.; Simpson, Daniel J.; Unkefer, Clifford J.; Whaley, Thomas W.

    1993-01-01

    An optical probe enables the study of enzyme activity by absorbance spectroscopy or by sensitive fluorescence methods. In particular, the probe provides the ability to monitor the activity of cytochrome P-450.sub.scc enzyme, the rate limiting enzyme for steroid biosynthesis. Located on the inner mitochondrial membrane, P-450.sub.scc catalyzes the conversion of cholesterol to pregnenolone and isocapraldehyde by sequential oxidations of the cholesterol side chain. The fluorogenic probe includes a cholesterol-like steroid linked to a chromophore through a linking group. The chromophore is selected to have little optical response when linked to the steroid substrate and an enhanced optical response when cleaved from the substrate and linking group. Thus, a fluorescent anion that can be optically detected is generated by the side-chain cleavage reaction during steroidogenesis.

  18. Optical probe for the cytochrome P-450 cholesterol side chain cleavage enzyme

    DOE Patents [OSTI]

    Marrone, Babetta L.; Simpson, Daniel J.; Unkefer, Clifford J.; Whaley, Thomas W.

    1992-01-01

    An optical probe enables the study of enzyme activity by absorbance spectroscopy or by sensitive fluorescence methods. In particular, the probe provides the ability to monitor the activity of cytochrome P-450.sub.scc enzyme, the rate limiting enzyme for steroid biosynthesis. Located on the inner mitochondrial membrane, P-450.sub.scc catalyzes the conversion of cholesterol to pregnenolone and isocapraldehyde by sequential oxidations of the cholesterol side chain. The fluorogenic probe includes a cholesterol-like steroid linked to a chromophore through a linking group. The chromophore is selected to have little optical response when linked to the steroid substrate and an enhanced optical response when cleaved from the substrate and linking group. Thus, a fluorescent anion that can be optically detected is generated by the side-chain cleavage reaction during steroidogenesis.

  19. Evaluated Nuclear (reaction) Data from the Evaluated Nuclear Data File (ENDF)

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    The current version is ENDF/B VII.0, released in 2006. Users can search ENDF via specialized interfaces, browse sub-libraries or download them as zipped files. Data plots can be generated through the Sigma interface. The ENDF web page also provides access to covariance data processing and plots. (Specialized Interface)

  20. Nuclear reactor

    DOE Patents [OSTI]

    Wade, Elman E.

    1979-01-01

    A nuclear reactor including two rotatable plugs and a positive top core holddown structure. The top core holddown structure is divided into two parts: a small core cover, and a large core cover. The small core cover, and the upper internals associated therewith, are attached to the small rotating plug, and the large core cover, with its associated upper internals, is attached to the large rotating plug. By so splitting the core holddown structures, under-the-plug refueling is accomplished without the necessity of enlarging the reactor pressure vessel to provide a storage space for the core holddown structure during refueling. Additionally, the small and large rotating plugs, and their associated core covers, are arranged such that the separation of the two core covers to permit rotation is accomplished without the installation of complex lifting mechanisms.

  1. NUCLEAR REACTOR

    DOE Patents [OSTI]

    Grebe, J.J.

    1959-12-15

    A reactor which is particularly adapted tu serve as a heat source for a nuclear powered alrcraft or rocket is described. The core of this reactor consists of a porous refractory modera;or body which is impregnated with fissionable nuclei. The core is designed so that its surface forms tapered inlet and outlet ducts which are separated by the porous moderator body. In operation a gaseous working fluid is circulated through the inlet ducts to the surface of the moderator, enters and passes through the porous body, and is heated therein. The hot gas emerges into the outlet ducts and is available to provide thrust. The principle advantage is that tremendous quantities of gas can be quickly heated without suffering an excessive pressure drop.

  2. NUCLEAR REACTOR

    DOE Patents [OSTI]

    Miller, H.I.; Smith, R.C.

    1958-01-21

    This patent relates to nuclear reactors of the type which use a liquid fuel, such as a solution of uranyl sulfate in ordinary water which acts as the moderator. The reactor is comprised of a spherical vessel having a diameter of about 12 inches substantially surrounded by a reflector of beryllium oxide. Conventionnl control rods and safety rods are operated in slots in the reflector outside the vessel to control the operation of the reactor. An additional means for increasing the safety factor of the reactor by raising the ratio of delayed neutrons to prompt neutrons, is provided and consists of a soluble sulfate salt of beryllium dissolved in the liquid fuel in the proper proportion to obtain the result desired.

  3. Solid State NMR Investigations of Chain Dynamics and Network...

    Office of Scientific and Technical Information (OSTI)

    Resource Relation: Conference: Presented at: Silicon containing polymers and composites ... AND ANALYTICAL CHEMISTRY; CHAINS; ELASTOMERS; POLYMERS; PROBES; SILICON; SILOXANES

  4. U.S. Offshore Wind Manufacturing and Supply Chain Development...

    Broader source: Energy.gov (indexed) [DOE]

    an organized, analytical approach to identifying and bounding uncertainties around offshore wind manufacturing and supply chain capabilities; projecting potential...

  5. Photovoltaic Supply Chain and Cross-Cutting Technologies Round 2 |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Department of Energy Technology to Market » Photovoltaic Supply Chain and Cross-Cutting Technologies Round 2 Photovoltaic Supply Chain and Cross-Cutting Technologies Round 2 Four projects are working to accelerate the development of revolutionary products or processes for the photovoltaic (PV) industry through the High Impact Supply Chain R&D for PV Technologies/Systems program, which represents the second round of PV Supply Chain and Cross-Cutting Technologies funding. These projects

  6. Supply Chain Risk Management (SCRM) Awareness Toolkit | Department of

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Energy Supply Chain Risk Management (SCRM) Awareness Toolkit Supply Chain Risk Management (SCRM) Awareness Toolkit The Office of the Chief Information Officer (OCIO) Supply Chain Risk Management (SCRM) Resource Center developed the SCRM Awareness Toolkit to introduce DOE employees to the basic terms and concepts of the technology supply chain and associated threats. For additional information on the DOE Enterprise SCRM Resource Center and program initiatives, please contact Sue Farrand at

  7. TUNL Nuclear Data Evaluation Group

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    TUNL Nuclear Data Evaluation Group As a part of the United States Nuclear Data Network and the international Nuclear Structure and Decay Data Evaluators' Network, the Nuclear Data...

  8. U.S. Offshore Wind Manufacturing and Supply Chain Development

    SciTech Connect (OSTI)

    Hamilton, Bruce

    2013-02-22

    This report seeks to provide an organized, analytical approach to identifying and bounding uncertainties around offshore wind manufacturing and supply chain capabilities; projecting potential component-level supply chain needs under three demand scenarios; and identifying key supply chain challenges and opportunities facing the future U.S. market and current suppliers of the nation’s landbased wind market.

  9. Kinetic and mechanistic studies of free-radical reactions in combustion

    SciTech Connect (OSTI)

    Tully, F.P.

    1993-12-01

    Combustion is driven by energy-releasing chemical reactions. Free radicals that participate in chain reactions carry the combustion process from reactants to products. Research in chemical kinetics enables us to understand the microscopic mechanisms involved in individual chemical reactions as well as to determine the rates at which they proceed. Both types of information are required for an understanding of how flames burn, why engines knock, how to minimize the production of pollutants, and many other important questions in combustion. In this program the authors emphasize accurate measurements over wide temperature ranges of the rates at which ubiquitous free radicals react with stable molecules. The authors investigate a variety of OH, CN, and CH + stable molecule reactions important to fuel conversion, emphasizing application of the extraordinarily precise technique of laser photolysis/continuous-wave laser-induced fluorescence (LP/cwLIF). This precision enables kinetic measurements to serve as mechanistic probes. Since considerable effort is required to study each individual reaction, prudent selection is critical. Two factors encourage selection of a specific reaction: (1) the rates and mechanisms of the subject reaction are required input to a combustion model; and (2) the reaction is a chemical prototype which, upon characterization, will provide fundamental insight into chemical reactivity, facilitate estimation of kinetic parameters for similar reactions, and constrain and test the computational limits of reaction-rate theory. Most studies performed in this project satisfy both conditions.

  10. NNSA Co-Hosts Nuclear Security Summit Workshop on Maritime Security with UK

    National Nuclear Security Administration (NNSA)

    | National Nuclear Security Administration | (NNSA) Co-Hosts Nuclear Security Summit Workshop on Maritime Security with UK November 19, 2015 WASHINGTON - This week, the Department of Energy's National Nuclear Security Administration (DOE/NNSA) and the U.K. Department of Energy and Climate Change concluded a workshop at Wilton Park, United Kingdom, on the growing challenge of securing the global maritime supply chain. In total, 55 participants from 15 countries and 9 international

  11. The Power of Integrators, Financiers, and Insurers to Reduce Proliferation Risks: Nuclear Dual-Use Goods

    SciTech Connect (OSTI)

    Weise, Rachel A.; Hund, Gretchen

    2015-05-01

    Globalization of manufacturing supply chains has changed the nature of nuclear proliferation. Before 1991, nonproliferation efforts focused almost exclusively on limiting the spread of materials and equipment specifically designed for nuclear use -- reactors, centrifuges, and fissile material. Dual-use items, those items with both nuclear and non-nuclear applications, were not closely scrutinized or controlled. However, in 1991 the international community discovered that Iraq had developed a fairly sophisticated nuclear weapons program by importing dual-use items; this discovery spurred the international community to increase controls on dual-use technologies. Despite these international efforts, dual-use items are still a challenge for those seeking to limit proliferation.

  12. Nuclear Explosive Safety

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2014-07-10

    The Order establishes requirements to implement the nuclear explosive safety (NES) elements of DOE O 452.1E, Nuclear Explosive and Weapon Surety Program, for routine and planned nuclear explosive operations (NEOs).

  13. Office of Nuclear Safety

    Office of Energy Efficiency and Renewable Energy (EERE)

    The Office of Nuclear Safety establishes nuclear safety requirements and expectations for the Department to ensure protection of workers and the public from the hazards associated with nuclear operations with all Department operations.

  14. Nuclear Materials Disposition

    Broader source: Energy.gov [DOE]

    In fulfilling its mission, EM frequently manages and completes disposition of surplus nuclear materials and spent nuclear fuel.  These are not waste. They are nuclear materials no longer needed for...

  15. Computational studies of polysiloxanes : oxidation potentials and decomposition reactions.

    SciTech Connect (OSTI)

    Assary, R. S.; Curtiss, L. A.; Redfern, P. C.; Zhang, Z.; Amine, K.

    2011-06-23

    Silicon-containing solvents have tremendous potential for application as electrolytes for electrical energy storage devices such as lithium-ion (air) batteries and supercapacitors. Quantum chemical methods were employed to investigate trends in oxidation potentials and decomposition reactions of a series of polysiloxanes. Various electron-donating and -withdrawing substituents can be used to tune the oxidation potential in shorter chain siloxanes but not in longer ones. Decomposition reactions of siloxanes in their oxidized states were investigated and compared against their carbon analogues. These studies suggest that the Si-O group provides added stability for siloxanes over their carbon analogues. Computational studies have also been performed for various disiloxanes and siloxanes with spacer groups to understand their thermochemical stability and oxidation potentials.

  16. Nuclear Incident Team | National Nuclear Security Administration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Apply for Our Jobs Our Jobs Working at NNSA Blog Home Nuclear Incident Team Nuclear Incident Team Fukushima: Five Years Later After the March 11, 2011, Japan earthquake, tsunami, ...

  17. Nuclear Quadrupole Moments and Nuclear Shell Structure

    DOE R&D Accomplishments [OSTI]

    Townes, C. H.; Foley, H. M.; Low, W.

    1950-06-23

    Describes a simple model, based on nuclear shell considerations, which leads to the proper behavior of known nuclear quadrupole moments, although predictions of the magnitudes of some quadrupole moments are seriously in error.

  18. Civilian Nuclear Program

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Civilian Nuclear Program Civilian Nuclear Program Los Alamos is committed to using its advanced nuclear expertise and unique facilities to meet the civilian nuclear national security demands of the future. CONTACT US Program Director Venkateswara Rao Dasari (Rao) (505) 667-5098 Email Los Alamos partners extensively with other laboratories, universities, industry, and the international nuclear community to address real-world technical challenges The Civilian Nuclear Program is the focal point for

  19. Nuclear Energy Programs

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Services » Nuclear Energy Advisory Committee Nuclear Energy Advisory Committee The Nuclear Energy Advisory Committee (NEAC), formerly the Nuclear Energy Research Advisory Committee (NERAC), was established on October 1, 1998, to provide independent advice to the Office of Nuclear Energy (NE) on complex science and technical issues that arise in the planning, managing, and implementation of DOE's nuclear energy program. NEAC periodically reviews the elements of the NE program and based on these

  20. Nuclear Security Summit | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure...

  1. Nuclear Forensics | National Nuclear Security Administration | (NNSA)

    National Nuclear Security Administration (NNSA)

    Nuclear Forensics Forensics Operations The National Technical Nuclear Forensics (NTNF) program is a Homeland Security Council and National Security Council-sponsored policy initiative that establishes federal agency missions and institutionalizes roles and responsibilities to enable operational support for materials, pre-detonation device, and post-detonation nuclear or radiological forensics programs with the broader goal of attribution. Technical nuclear forensics utilizes the data from

  2. International Nuclear Security | National Nuclear Security Administration |

    National Nuclear Security Administration (NNSA)

    (NNSA) International Nuclear Security The International Nuclear Security program collaborates with partners world-wide to improve the security of proliferation-sensitive materials, particularly weapons-usable nuclear material in both civilian and non-civilian use in key countries. As part of these efforts, INS works with partner countries to: Upgrade and sustain physical security and material control and accounting systems; Develop national-level nuclear security infrastructure in areas such

  3. Nuclear Materials Information Program | National Nuclear Security...

    National Nuclear Security Administration (NNSA)

    Information Program | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the...

  4. Nuclear & Radiological Material Removal | National Nuclear Security...

    National Nuclear Security Administration (NNSA)

    & Radiological Material Removal | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation...

  5. Uranium in the Near-shore Aquatic Food Chain: Studies on Periphyton and Asian Clams

    SciTech Connect (OSTI)

    Bunn, Amoret L.; Miley, Terri B.; Eslinger, Paul W.; Brandt, Charles A.; Napier, Bruce A.

    2007-12-31

    The benthic aquatic organisms in the near-shore environment of the Columbia River are the first biological receptors that can be exposed to groundwater contaminants coming from the U.S. Department of Energy's Hanford Site. The primary contaminant of concern in the former nuclear fuels processing area at the Site, known as the 300 Area, is uranium. Currently, there are no national clean up criteria for uranium and ecological receptors. This report summarizes efforts to characterize biological uptake of uranium in the food chain of the benthic aquatic organisms and provide information to be used in future assessments of uranium and the ecosystem.

  6. EXFOR BASICS A SHORT GUIDE TO THE NEUTRON REACTION DATA EXCHANGE FORMAT.

    SciTech Connect (OSTI)

    MCLANE,V.; NUCLEAR DATA CENTER NETWORK

    2000-05-19

    This manual is intended as a guide to users of nuclear reaction data compiled in the EXFOR format, and is not intended as a complete guide to the EXFOR System. EXFOR is the exchange format designed to allow transmission of nuclear reaction data between the Nuclear Reaction Data Centers. In addition to storing the data and its' bibliographic information, experimental information is also compiled. The status (e.g., the source of the data) and history (e.g., date of last update) of the data set is also included. EXFOR is designed for flexibility in order to meet the diverse needs of the nuclear reaction data centers. It was originally conceived for the exchange of neutron data and was developed through discussions among personnel from centers situated in Saclay, Vienna, Livermore and Brookhaven. It was accepted as the official exchange format of the neutron data centers at Saclay, Vienna, Brookhaven and Obninsk, at a meeting held in November 1969.3 As a result of two meetings held in 1975 and 1976 and attended by several charged-particle data centers, the format was further developed and adapted to cover all nuclear reaction data. The exchange format should not be confused with a center-to-user format. Although users may obtain data from the centers in the EXFOR format, other center-to-user formats have been developed to meet the needs of the users within each center's own sphere of responsibility. The EXFOR format, as outlined, allows a large variety of numerical data tables with explanatory and bibliographic information to be transmitted in a format: l that is machine-readable (for checking and indicating possible errors); l that can be read by personnel (for passing judgment on and correcting errors). The data presently included in the EXFOR exchange file include: a complete compilation of experimental neutron-induced reaction data, a selected compilation of charged-particle-induced reaction data, a selected compilation of photon-induced reaction data.

  7. EXFOR BASICS A SHORT GUIDE TO THE NEUTRON REACTION DATA EXCHANGE FORMAT.

    SciTech Connect (OSTI)

    MCLANE,V.; NUCLEAR DATA CENTER NETWORK

    2000-05-19

    This manual is intended as a guide to users of nuclear reaction data compiled in the EXFOR format, and is not intended as a complete guide to the EXFOR System. EXFOR is the exchange format designed to allow transmission of nuclear reaction data between the Nuclear Reaction Data Centers. In addition to storing the data and its' bibliographic information, experimental information is also compiled. The status (e.g., the source of the data) and history (e.g., date of last update) of the data set is also included. EXFOR is designed for flexibility in order to meet the diverse needs of the nuclear reaction data centers. It was originally conceived for the exchange of neutron data and was developed through discussions among personnel from centers situated in Saclay, Vienna, Livermore and Brookhaven. It was accepted as the official exchange format of the neutron data centers at Saclay, Vienna, Brookhaven and Obninsk, at a meeting held in November 1969. As a result of two meetings held in 1975 and 1976 and attended by several charged-particle data centers, the format was further developed and adapted to cover all nuclear reaction data. The exchange format should not be confused with a center-to-user format. Although users may obtain data from the centers in the EXFOR format, other center-to-user formats have been developed to meet the needs of the users within each center's own sphere of responsibility. The EXFOR format, as outlined, allows a large variety of numerical data tables with explanatory and bibliographic information to be transmitted in a format: that is machine-readable (for checking and indicating possible errors); that can be read by personnel (for passing judgment on and correcting errors). The data presently included in the EXFOR exchange file include: a complete compilation of experimental neutron-induced reaction data, a selected compilation of charged-particle-induced reaction data, a selected compilation of photon-induced reaction data.

  8. Nuclear War Against Cancer

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear War Against Cancer 1663 Los Alamos science and technology magazine Latest Issue:March 2016 past issues All Issues submit Nuclear War Against Cancer Los Alamos, in ...

  9. Nuclear weapons modernizations

    SciTech Connect (OSTI)

    Kristensen, Hans M.

    2014-05-09

    This article reviews the nuclear weapons modernization programs underway in the world's nine nuclear weapons states. It concludes that despite significant reductions in overall weapons inventories since the end of the Cold War, the pace of reductions is slowing - four of the nuclear weapons states are even increasing their arsenals, and all the nuclear weapons states are busy modernizing their remaining arsenals in what appears to be a dynamic and counterproductive nuclear competition. The author questions whether perpetual modernization combined with no specific plan for the elimination of nuclear weapons is consistent with the nuclear Non-Proliferation Treaty and concludes that new limits on nuclear modernizations are needed.

  10. Advancing Global Nuclear Security

    Broader source: Energy.gov [DOE]

    Today world leaders gathered at The Hague for the Nuclear Security Summit, a meeting to measure progress and take action to secure sensitive nuclear materials.

  11. Nuclear Energy Systems Lab

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Safety, Security & Resilience of the Energy Infrastructure Energy Storage Nuclear Power & Engineering Grid Modernization Battery Testing Nuclear Fuel Cycle Defense Waste Management ...

  12. NUCLEAR REGULATORY COMMISSION

    Office of Environmental Management (EM)

    NUCLEAR REGULATORY COMMISSION 10 CFR Parts 71 and 73 RIN 3150-AG41 Advance Notification to Native American Tribes of Transportation of Certain Types of Nuclear Waste AGENCY: ...

  13. Nuclear Safety Regulatory Framework

    Energy Savers [EERE]

    Authority and responsibility to regulate nuclear safety at DOE facilities 10 CFR 830 10 CFR 835 10 CFR 820 Regulatory Implementation Nuclear Safety Radiological Safety Procedural ...

  14. National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    U.S. Department of Energy National Nuclear Security Administration Federal Equal ... A. Name and Address of Agency National Nuclear Security Administration Office of ...

  15. National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Nuclear Security Administration FY 2013 PER Babcock & Wilcox Technical Services Y-12, LLC Performance Evaluation Report NNSA Production Office Y-12 Nuclear Security Complex ...

  16. Nuclear Materials Science

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Materials Science Our multidisciplinary expertise comprises the core actinide materials science and metallurgical capability within the nuclear weapons production and ...

  17. National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    U.S. Department of Energy National Nuclear Security Administration Federal Equal ... A. Name and Address of Agency National Nuclear Security Administration 1000 Independence ...

  18. National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    15 National Nuclear Security Administration FY 2013 PER Babcock & Wilcox Technical ... The National Nuclear Security Administration (NNSA) Production Office (NPO) took into ...

  19. Nuclear | Open Energy Information

    Open Energy Info (EERE)

    High construction costs for nuclear plants, especially relative to natural-gas-fired plants, make other options for new nuclear capacity uneconomical even in the alternative...

  20. Nuclear Security Summit

    National Nuclear Security Administration (NNSA)

    Joint Research Centre and the United States Department of Energy's National Nuclear Security Administration regarding the reduction of excess nuclear material http:...