National Library of Energy BETA

Sample records for nuclear chain reaction

  1. Enrico Fermi Achieves First Self Sustain Nuclear Chain Reaction...

    National Nuclear Security Administration (NNSA)

    Self Sustain Nuclear Chain Reaction Chicago, IL Metallurgical Laboratory scientists led by Enrico Fermi achieve the first self-sustained nuclear chain reaction in pile...

  2. OSTIblog Articles in the nuclear chain reaction Topic | OSTI...

    Office of Scientific and Technical Information (OSTI)

    amount of neutron reduction needed for a safe and controlled sustained nuclear reaction. ... Manhattan Project, nuclear chain reaction, plutonium, uranium, World War II Read more... ...

  3. Enrico Fermi Achieves First Self Sustain Nuclear Chain Reaction | National

    National Nuclear Security Administration (NNSA)

    Nuclear Security Administration | (NNSA) Enrico Fermi Achieves First Self Sustain Nuclear Chain Reaction Enrico Fermi Achieves First Self Sustain Nuclear Chain Reaction Chicago, IL Metallurgical Laboratory scientists led by Enrico Fermi achieve the first self-sustained nuclear chain reaction in pile constructed under the west grandstand at Stagg field in Chicago

  4. METHOD AND APPARATUS FOR CONDUCTING A NUCLEAR CHAIN REACTION

    DOE Patents [OSTI]

    Wigner, E.P.; Ohlinger, L.A.; Young, G.J.; Weinberg, A.M.

    1962-09-01

    A nuclear reactor is designed incorporating a slurry of uranium- containing particles in heavy water and including means for circulating the slurry and for cooling the slurry. (AEC)

  5. Enrico Fermi and the First Self-Sustaining Nuclear Chain Reaction

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Fermi and the First Self-Sustaining Nuclear Chain Reaction Resources with Additional Information * Fermi Honored * Atoms for Peace * Centennial of Birth * Stamp Patents * Audio/Video Clips * Selected by NSTA for SciLinks "The President of the United States of America ... for especially meritorious contributions to the development, use, or control of atomic energy, grant[s] an award of merit to Enrico Fermi for his contributions to basic neutron physics and the achievement of the controlled

  6. Polyneutron Chain Reactions

    SciTech Connect (OSTI)

    John C. Fisher

    2000-11-12

    Although helium atoms do not form molecules, a sufficiently large number will bind into a stable liquid droplet. A comparable situation is expected for neutrons, with a sufficiently large number binding into a stable droplet of neutron matter. Such polyneutron droplets can be viewed as isotopes of an element with nuclear charge Z=0, tentatively denoted neutrium, symbol Nt. Because of the relatively weak binding of neutrons compared with that of a mix of neutrons and protons, the minimum number of neutrons required for stability of a droplet is fairly large. Early estimates of {approx}60 may be reduced to a dozen or so by the BCS pairing interaction. The Nt entries with N{>=}12 are new to the table of isotopes. Because all of them are beta-unstable, none is expected to persist as a free particle. Yet, some may occasionally be produced by means to be described below, and it is of interest to examine their decay chains and their interactions with charged nuclei to ascertain how their presence might be revealed. Although these reactions are interesting, they cannot be taken seriously without identifying a source for the initial Nt isotope that begins the chain. Here, we consider possible interactions between {sup 16}O and {sup A}Nt. Although there is no strong interaction between them, we can expect a very weak residual attraction that can form a loosely bound {sup 16}O {sup A}Nt nuclear molecule. This is not a compound nucleus in the usual sense because, considered as fluids, the {sup 16}O and {sup A}Nt droplets are immiscible. For a droplet with fewer than about 60 neutrons, beta decay of {sup A}Nt is prevented by the buildup of Coulomb energy associated with transforming {sup A}Nt into {sup A}H in close proximity to {sup 16}O. Thus, it is possible that {sup 16}O {sup A}Nt molecules can persist indefinitely and that a few of them may be present in ordinary water as supermassive oxygen nuclei. Because the binding of these molecules is weak, the {sup A}Nt component can

  7. Polymerase chain reaction system

    DOE Patents [OSTI]

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  8. OSTIblog Articles in the nuclear chain reaction Topic | OSTI, US Dept of

    Office of Scientific and Technical Information (OSTI)

    Energy Office of Scientific and Technical Information chain reaction Topic The Manhattan Project -- Its Operations by Mary Schorn 29 Nov, 2012 in Science Communications 4236 ManhattanProjectMap320.jpg The Manhattan Project -- Its Operations Read more about 4236 Major operations for the Manhattan Engineer District (Manhattan Project) took place in remote site locations in the states of Tennessee, New Mexico, and Washington, with additional research being conducted in university laboratories

  9. Theory of Neutron Chain Reactions. Volume II, Part I. Homogeneous Nuclear Chain Reactions. Chapter V. Neutron Chain Reactions. Chapter VI. Pile Equations. Chapter VII. Theory of Reflectors And The Method Of Groups

    DOE R&D Accomplishments [OSTI]

    Weinberg, Alvin M.; Noderer, L. C.

    1951-08-10

    The previous section of this book deals with the general problem of neutron diffusion. In this sequel we shall apply the results obtained already to the theory of slow neutron chain reacting systems.

  10. Lesson 5 - Fission and Chain Reactions | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    5 - Fission and Chain Reactions Lesson 5 - Fission and Chain Reactions Lesson Four showed how the nuclei of atoms store energy and how unstable atoms decay and release energy. How do nuclear engineers use this knowledge to help them harness energy to make electricity? The answer lies in being able to start a nuclear chain reaction in fuel inside a nuclear power plant and keep it going. This lesson examines nuclear reactions called fission as well as how uranium is processed from ore to fuel.

  11. Chain Reaction Innovations: Innovation Applicant Information | Argonne

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    National Laboratory Innovation Applicant Information Information for Innovation Applicants in the Chain Reaction Innovations program PDF icon CRI_innovation_applicant_info

  12. Supplement to Theory of Neutron Chain Reactions

    DOE R&D Accomplishments [OSTI]

    Weinberg, Alvin M.; Noderer, L. C.

    1952-05-26

    General discussions are given of the theory of neutron chain reactions. These include observations on exponential experiments, the general reactor with resonance fission, microscopic pile theory, and homogeneous slow neutron reactors. (B.J.H.)

  13. Nuclear structure and nuclear reactions | Argonne Leadership...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear structure and nuclear reactions PI Name: James Vary PI Email: jvary@iastate.edu Institution: Iowa State University Allocation Program: INCITE Allocation Hours at ALCF: 15 ...

  14. supply chain | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    supply chain

  15. maritime supply chain | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    maritime supply chain NNSA Co-Hosts Nuclear Security Summit Workshop on Maritime Security with UK WASHINGTON - This week, the Department of Energy's National Nuclear Security Administration (DOE/NNSA) and the U.K. Department of Energy and Climate Change concluded a workshop at Wilton Park, United Kingdom, on the growing challenge of securing the global maritime supply chain. In

  16. Dual phase multiplex polymerase chain reaction

    DOE Patents [OSTI]

    Pemov, Alexander; Bavykin, Sergei

    2008-10-07

    Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

  17. Integrated polymerase chain reaction/electrophoresis instrument

    DOE Patents [OSTI]

    Andresen, Brian D.

    2000-01-01

    A new approach and instrument for field identification of micro-organisms and DNA fragments using a small and disposable device containing integrated polymerase chain reaction (PCR) enzymatic reaction wells, attached capillary electrophoresis (CE) channels, detectors, and read-out all on/in a small hand-held package. The analysis instrument may be made inexpensively, for example, of plastic, and thus is disposable, which minimizes cross contamination and the potential for false positive identification between samples. In addition, it is designed for multiple users with individual applications. The integrated PCR/CE is manufactured by the PCR well and CE channels are "stamped" into plastic depressions where conductive coatings are made in the wells and ends of the CE microchannels to carry voltage and current to heat the PCR reaction mixtures and simultaneously draw DNA bands up the CE channels. Light is transmitted through the instrument at appropriate points and detects PCR bands and identifies DNA fragments by size (retention time) and quantifies each by the amount of light generated as each phototransistor positioned below each CE channel detects a passing band. The instrument is so compact that at least 100 PCR/CE reactions/analyses can be performed easily on one detection device.

  18. Chain Reaction Innovation is DOE's Newest Investment in the Clean...

    Office of Environmental Management (EM)

    in the Clean Energy Innovation Ecosystem Chain Reaction Innovation is DOE's Newest Investment in the Clean Energy Innovation Ecosystem June 1, 2016 - 4:00pm Addthis Ribbon ...

  19. NUCLEAR FISSION CHAIN REACTING SYSTEM

    DOE Patents [OSTI]

    Anderson, H.L.; Brown, H.S.

    1961-06-27

    The patent describes a reactor consisting of a plurality of tubes passing through a body of heavy water or graphite, a heat exchanger, means for flowing UF/sub 6/ through the tubes and the heat exchangar, and means for bleeding off some of the UF/sub 6/ and separating plutonium therefrom. A specific suggestion contained is that the amount of the UF/sub 6/ outside the reaction unit be a multiple of that within it.

  20. Nuclear reactions from lattice QCD

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Briceño, Raúl A.; Davoudi, Zohreh; Luu, Thomas C.

    2015-01-13

    In this study, one of the overarching goals of nuclear physics is to rigorously compute properties of hadronic systems directly from the fundamental theory of strong interactions, Quantum Chromodynamics (QCD). In particular, the hope is to perform reliable calculations of nuclear reactions which will impact our understanding of environments that occur during big bang nucleosynthesis, the evolution of stars and supernovae, and within nuclear reactors and high energy/density facilities. Such calculations, being truly ab initio, would include all two-nucleon and three- nucleon (and higher) interactions in a consistent manner. Currently, lattice QCD provides the only reliable option for performing calculationsmore » of some of the low-energy hadronic observables. With the aim of bridging the gap between lattice QCD and nuclear many-body physics, the Institute for Nuclear Theory held a workshop on Nuclear Reactions from Lattice QCD on March 2013. In this review article, we report on the topics discussed in this workshop and the path planned to move forward in the upcoming years.« less

  1. Nuclear reactions from lattice QCD

    SciTech Connect (OSTI)

    Briceño, Raúl A.; Davoudi, Zohreh; Luu, Thomas C.

    2015-01-13

    In this study, one of the overarching goals of nuclear physics is to rigorously compute properties of hadronic systems directly from the fundamental theory of strong interactions, Quantum Chromodynamics (QCD). In particular, the hope is to perform reliable calculations of nuclear reactions which will impact our understanding of environments that occur during big bang nucleosynthesis, the evolution of stars and supernovae, and within nuclear reactors and high energy/density facilities. Such calculations, being truly ab initio, would include all two-nucleon and three- nucleon (and higher) interactions in a consistent manner. Currently, lattice QCD provides the only reliable option for performing calculations of some of the low-energy hadronic observables. With the aim of bridging the gap between lattice QCD and nuclear many-body physics, the Institute for Nuclear Theory held a workshop on Nuclear Reactions from Lattice QCD on March 2013. In this review article, we report on the topics discussed in this workshop and the path planned to move forward in the upcoming years.

  2. On nuclear reactions in defects

    SciTech Connect (OSTI)

    Sienes, J.K. )

    1991-05-01

    The variability of results concerning cold fusion, together with the difficulty of explaining the observations, suggests that some nonstandard processes may be occurring. One such possibility is that nuclear reactions occur in defects of a deuterated lattice as a result of transient motions that momentarily bring deuterium atoms into close proximity. In this paper a mechanism involving shear of a one-dimensional lattice is described that illustrates this possibility. Order-of-magnitude estimates indicate that the expected fusion rate is not inconsistent with some experiments.

  3. Nuclear Structure and Nuclear Reactions | Argonne Leadership...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    x2 - triaxiality, and x3 - pairing correlations. Calculations were carried out using nuclear density functional theory. The collective action was minimized using the dynamical...

  4. EXFOR Library of Experimental Nuclear Reaction Data

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    The EXFOR library contains an extensive compilation of experimental nuclear reaction data up to 1 GeV. Neutron reactions have been compiled systematically since the discovery of the neutron, while charged particle(up to carbon) and photon reactions have been covered less extensively. Files contain nuclear reaction data such as cross sections, spectra, angular distributions, polarizations, etc, along with information on experimental technique, error analysis, and applied standards. Numerous search parameters include: target, beam, product, experimental method, and even author and publication names. The library contains data from more than 20,000 experiments. (Specialized Interface)

  5. Chain Reaction Innovations: A More Powerful Incubator for Energy and

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Science Technology | Argonne National Laboratory A More Powerful Incubator for Energy and Science Technology Chain Reaction Innovations (CRI) is a two-year program for innovators focusing on energy and science technologies. Through an annual application call, four to six teams will be selected to join CRI. Program participants will receive the financial and technical support needed to mature nascent technologies that face long development cycles to the proof-of-concept level, thus getting

  6. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOE Patents [OSTI]

    Nasarabadi, Shanavaz

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.

  7. Calculation of nuclear reaction cross sections on excited nuclei...

    Office of Scientific and Technical Information (OSTI)

    Calculation of nuclear reaction cross sections on excited nuclei with the coupled-channels method Citation Details In-Document Search Title: Calculation of nuclear reaction cross ...

  8. Nuclear reaction and decay data evaluation capabilities at LANL...

    Office of Scientific and Technical Information (OSTI)

    Conference: Nuclear reaction and decay data evaluation capabilities at LANL Citation Details In-Document Search Title: Nuclear reaction and decay data evaluation capabilities at ...

  9. Ab Initio Calculations Of Nuclear Reactions And Exotic Nuclei...

    Office of Scientific and Technical Information (OSTI)

    Technical Report: Ab Initio Calculations Of Nuclear Reactions And Exotic Nuclei Citation Details In-Document Search Title: Ab Initio Calculations Of Nuclear Reactions And Exotic ...

  10. Nuclear reaction and decay data evaluation capabilities at LANL...

    Office of Scientific and Technical Information (OSTI)

    Nuclear reaction and decay data evaluation capabilities at LANL Citation Details In-Document Search Title: Nuclear reaction and decay data evaluation capabilities at LANL You ...

  11. Experimental nuclear reaction data collection EXFOR

    SciTech Connect (OSTI)

    Semkova, V.; Otuka, N.; Simakov, S. P.; Zerkin, V.

    2011-07-01

    The International Network of Nuclear Reaction Data Centres (NRDC) constitutes a worldwide cooperation of 14 nuclear data centres. The main activity of the NRDC Network is collection and compilation of experimental nuclear reaction cross section data and the related bibliographic information in the EXFOR and CINDA databases as well as dissemination of nuclear reaction data and associated documentation to users. The database contains information and numerical data from more than about 19000 experiments consisting of more than 140000 datasets. EXFOR is kept up to date by constantly adding newly published experimental information. Tools developed for data dissemination utilise modern database technologies with fast online capabilities over the Internet. Users are provided with sophisticated search options, a user-friendly retrieval interface for downloading data in different formats, and additional output options such as improved data plotting capabilities. The present status of the EXFOR database will be presented together with the latest development for data access and retrieval. (authors)

  12. Chain Reaction Innovations Opens Call for First Startup Cohort of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Innovators | Department of Energy Chain Reaction Innovations Opens Call for First Startup Cohort of Energy Innovators Chain Reaction Innovations Opens Call for First Startup Cohort of Energy Innovators July 20, 2016 - 3:29pm Addthis Chain Reaction Innovations Opens Call for First Startup Cohort of Energy Innovators Earlier this year, we announced the launch of Chain Reaction Innovations (CRI), the newest addition to the Department of Energy's (DOE) Lab-Embedded Entrepreneurship Programs

  13. Theory of Neutron Chain Reactions: Extracts from Volume I, Diffusion and Slowing Down of Neutrons: Chapter I. Elementary Theory of Neutron Diffusion. Chapter II. Second Order Diffusion Theory. Chapter III. Slowing Down of Neutrons

    DOE R&D Accomplishments [OSTI]

    Weinberg, Alvin M.; Noderer, L. C.

    1951-05-15

    The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.

  14. MEANS FOR TERMINATING NUCLEAR REACTIONS

    DOE Patents [OSTI]

    Cooper, C.M.

    1959-02-17

    An apparatus is presented for use in a reactor of the heterogeneous, fluid cooled type for the purpose of quickly terminating the reaction, the coolant being circulated through coolant tubes extending through the reactor core. Several of the tubes in the critical region are connected through valves to a tank containing a poisoning fluid having a high neutron capture crosssection and to a reservoir. When it is desired to quickly terminate the reaction, the valves are operated to permit the flow of the poisoning fluid through these particular tubes and into the reservoir while normal coolant is being circulated through the remaining tubes. The apparatus is designed to prevent contamination of the primary coolant by the poisoning fluid.

  15. On fusion/fission chain reactions in the Fleischmann-Pons cold fusion experiment

    SciTech Connect (OSTI)

    Anghaie, S.; Froelich, P.; Monkhorst, H.J. )

    1990-05-01

    In this paper the possibility of fusion/fission chain reactions following d-d source reactions in electrochemical cold fusion experiments have been investigated. The recycling factors for the charged particles in fusion reactions with consumable nuclei deuteron, {sup 6}Li nd {sup 7}Li, are estimated. It is concluded that, based on the established nuclear fusion cross sections and electronic stopping power, the recycling factor is four to five orders of magnitude less than required for close to critical conditions. It is argued that the cross generation of charged particles by neutrons does not play a significant role in this process, even if increased densities at the surface of electrodes do occur.

  16. Supply Chain Management Center | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Supply Chain Management Center

  17. maritime supply chain | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    National Nuclear Security Administration (DOENNSA) and the U.K. Department of Energy and Climate Change concluded a workshop at Wilton Park, About This Site Budget IG Web Policy...

  18. Nested methylation-specific polymerase chain reaction cancer detection method

    DOE Patents [OSTI]

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  19. Nuclear reactions used for superheavy element research

    SciTech Connect (OSTI)

    Stoyer, M A

    2008-02-26

    Some of the most fascinating questions about the limits of nuclear stability are confronted in the heaviest nuclei. How many more new elements can be synthesized? What are the nuclear and chemical properties of these exotic nuclei? Does the 'Island of Stability' exist and can we ever explore the isotopes inhabiting that nuclear region? This paper will focus on the current experimental research on the synthesis and characterization of superheavy nuclei with Z > 112 from the Dubna/Livermore collaboration. Reactions using 48Ca projectiles from the U400 cyclotron and actinide targets ({sup 233,238}U, {sup 237}Np, {sup 242,244}Pu, {sup 243}Am, {sup 245,248}Cm, {sup 249}Cf) have been investigated using the Dubna Gas Filled Recoil Separator in Dubna over the last 8 years. In addition, several experiments have been performed to investigate the chemical properties of some of the observed longer-lived isotopes produced in these reactions. Some comments will be made on nuclear reactions used for the production of the heaviest elements. A summary of the current status of the upper end of the chart of nuclides will be presented.

  20. Nuclear Reactions Induced by a Pyroelectric Accelerator

    SciTech Connect (OSTI)

    Geuther, Jeffrey; Danon, Yaron; Saglime, Frank

    2006-02-10

    This work demonstrates the use of pyroelectric crystals to induce nuclear reactions. A system based on a pair of pyroelectric crystals is used to ionize gas and accelerate the ions to energies of up to 200 keV. The system operates above room temperature by simply heating or cooling the pyroelectric crystals. A D-D fusion reaction was achieved with this technique, and 2.5 MeV neutrons were detected. The measured neutron yield is in good agreement with the calculated yield. This work also verifies the results published by Naranjo, Gimzewski, and Putterman [Nature (London) 434, 1115 (2005)].

  1. Toward A Fundamental Understanding Of Nuclear Reactions And Exotic...

    Office of Scientific and Technical Information (OSTI)

    Conference: Toward A Fundamental Understanding Of Nuclear Reactions And Exotic Nuclei Citation Details In-Document Search Title: Toward A Fundamental Understanding Of Nuclear ...

  2. Hadron Cancer Therapy: Role of Nuclear Reactions

    DOE R&D Accomplishments [OSTI]

    Chadwick, M. B.

    2000-06-20

    Recently it has become feasible to calculate energy deposition and particle transport in the body by proton and neutron radiotherapy beams, using Monte Carlo transport methods. A number of advances have made this possible, including dramatic increases in computer speeds, a better understanding of the microscopic nuclear reaction cross sections, and the development of methods to model the characteristics of the radiation emerging from the accelerator treatment unit. This paper describes the nuclear reaction mechanisms involved, and how the cross sections have been evaluated from theory and experiment, for use in computer simulations of radiation therapy. The simulations will allow the dose delivered to a tumor to be optimized, whilst minimizing the dos given to nearby organs at risk.

  3. Chain Reaction Innovation is DOE's Newest Investment in the Clean Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Innovation Ecosystem | Department of Energy Chain Reaction Innovation is DOE's Newest Investment in the Clean Energy Innovation Ecosystem Chain Reaction Innovation is DOE's Newest Investment in the Clean Energy Innovation Ecosystem June 1, 2016 - 4:00pm Addthis Ribbon cutting ceremony for the Chain Reaction Innovations program launch. From left to right: Dr. David Danielson, Assistant Secretary for Energy Efficiency and Renewable Energy; Dr. Peter Littlewood, Director of Argonne National

  4. Chain Reaction Innovations Opens the Call for its First Startup Cohort |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Department of Energy Chain Reaction Innovations Opens the Call for its First Startup Cohort Chain Reaction Innovations Opens the Call for its First Startup Cohort July 12, 2016 - 11:52am Addthis Announcement from Argonne National Laboratory Argonne National Laboratory has opened a new innovation incubator called Chain Reaction Innovations (CRI), which wants to ensure that innovators who are pursuing transformational technologies thrive by giving them an unparalleled level of support that

  5. First-Hand Recollections of the First Self-Sustaining Chain Reaction

    Broader source: Energy.gov [DOE]

    Seventy years later, two of the men present at the first nuclear reaction recall the events of the memorable day.

  6. Numerical simulations for low energy nuclear reactions including...

    Office of Scientific and Technical Information (OSTI)

    Numerical simulations for low energy nuclear reactions including direct channels to validate statistical models Citation Details In-Document Search Title: Numerical simulations for ...

  7. Numerical simulations for low energy nuclear reactions including...

    Office of Scientific and Technical Information (OSTI)

    Numerical simulations for low energy nuclear reactions including direct channels to ... Visit OSTI to utilize additional information resources in energy science and technology. A ...

  8. Nuclear waste vitrification efficiency: cold cap reactions

    SciTech Connect (OSTI)

    Hrma, Pavel R.; Kruger, Albert A.; Pokorny, Richard

    2012-12-15

    The cost and schedule of nuclear waste treatment and immobilization are greatly affected by the rate of glass production. Various factors influence the performance of a waste-glass melter. One of the most significant, and also one of the least understood, is the process of batch melting. Studies are being conducted to gain fundamental understanding of the batch reactions, particularly those that influence the rate of melting, and models are being developed to link batch makeup and melter operation to the melting rate. Batch melting takes place within the cold cap, i.e., a batch layer floating on the surface of molten glass. The conversion of batch to glass consists of various chemical reactions, phase transitions, and diffusion-controlled processes. These include water evaporation (slurry feed contains as high as 60% water), gas evolution, the melting of salts, the formation of borate melt, reactions of borate melt with molten salts and with amorphous oxides (Fe2O3 and Al2O3), the formation of intermediate crystalline phases, the formation of a continuous glass-forming melt, the growth and collapse of primary foam, and the dissolution of residual solids. To this list we also need to add the formation of secondary foam that originates from molten glass but accumulates on the bottom of the cold cap. This study presents relevant data obtained for a high-level-waste melter feed and introduces a one-dimensional (1D) mathematical model of the cold cap as a step toward an advanced three-dimensional (3D) version for a complete model of the waste glass melter. The 1D model describes the batch-to-glass conversion within the cold cap as it progresses in a vertical direction. With constitutive equations and key parameters based on measured data, and simplified boundary conditions on the cold-cap interfaces with the glass melt and the plenum space of the melter, the model provides sensitivity analysis of the response of the cold cap to the batch makeup and melter conditions

  9. NUCLEAR WASTE VITRIFICATION EFFICIENCY COLD CAP REACTIONS

    SciTech Connect (OSTI)

    KRUGER AA; HRMA PR; POKORNY R

    2011-07-29

    The cost and schedule of nuclear waste treatment and immobilization are greatly affected by the rate of glass production. Various factors influence the performance of a waste-glass melter. One of the most significant, and also one of the least understood, is the process of batch melting. Studies are being conducted to gain fundamental understanding of the batch reactions, particularly those that influence the rate of melting, and models are being developed to link batch makeup and melter operation to the melting rate. Batch melting takes place within the cold cap, i.e., a batch layer floating on the surface of molten glass. The conversion of batch to glass consists of various chemical reactions, phase transitions, and diffusion-controlled processes. These include water evaporation (slurry feed contains as high as 60% water), gas evolution, the melting of salts, the formation of borate melt, reactions of borate melt with molten salts and with amorphous oxides (Fe{sub 2}O{sub 3} and Al{sub 2}O{sub 3}), the formation of intermediate crystalline phases, the formation of a continuous glass-forming melt, the growth and collapse of primary foam, and the dissolution of residual solids. To this list we also need to add the formation of secondary foam that originates from molten glass but accumulates on the bottom of the cold cap. This study presents relevant data obtained for a high-level-waste melter feed and introduces a one-dimensional (1D) mathematical model of the cold cap as a step toward an advanced three-dimensional (3D) version for a complete model of the waste glass melter. The 1D model describes the batch-to-glass conversion within the cold cap as it progresses in a vertical direction. With constitutive equations and key parameters based on measured data, and simplified boundary conditions on the cold-cap interfaces with the glass melt and the plenum space of the melter, the model provides sensitivity analysis of the response of the cold cap to the batch makeup

  10. EMPIRE: A Reaction Model Code for Nuclear Astrophysics

    SciTech Connect (OSTI)

    Palumbo, A.; Herman, M.; Capote, R.

    2014-06-15

    The correct modeling of abundances requires knowledge of nuclear cross sections for a variety of neutron, charged particle and γ induced reactions. These involve targets far from stability and are therefore difficult (or currently impossible) to measure. Nuclear reaction theory provides the only way to estimate values of such cross sections. In this paper we present application of the EMPIRE reaction code to nuclear astrophysics. Recent measurements are compared to the calculated cross sections showing consistent agreement for n-, p- and α-induced reactions of strophysical relevance.

  11. Method of carbon chain extension using novel aldol reaction

    DOE Patents [OSTI]

    Silks, Louis A; Gordon, John C; Wu, Ruilan; Hangson, Susan Kloek

    2013-08-13

    Method of producing C.sub.8-C.sub.15 hydrocarbons comprising providing a ketone starting material; providing an aldol starting material comprising hydroxymethylfurfural; mixing the ketone starting material and the aldol starting material in a reaction in the presence of a proline-containing catalyst selected from the group consisting of Zn(Pro).sub.2, Yb(Pro).sub.2, and combinations thereof, or a catalyst having one of the structures (I), (II) or (III), and in the presence of a solvent, wherein the solvent comprises water and is substantially free of organic solvents, where (I), (II) and (III) respectively are: ##STR00001## where R.sub.1 is a C.sub.1-C.sub.6 alkyl moiety, X=(OH) and n=2. ##STR00002## In (III), X may be CH.sub.2, sulfur or selenium, M may be Zn, Mg, or a lanthanide, and R.sub.1 and R.sub.2 each independently may be a methyl, ethyl, phenyl moiety.

  12. Method of carbon chain extension using novel aldol reaction

    DOE Patents [OSTI]

    Silks, Louis A; Gordon, John C; Wu, Ruilan; Hanson, Susan Kloek

    2013-07-30

    Method of producing C.sub.8-C.sub.15 hydrocarbons. comprising providing a ketone starting material; providing an aldol starting material comprising chloromethylfurfural; mixing the ketone starting material and the aldol starting material in a reaction in the presence of a proline-containing catalyst selected from the group consisting of Zn(Pro).sub.2, Yb(Pro).sub.3, and combinations thereof, or a catalyst having one of the structures (I), (II) or (III), and in the presence of a solvent, wherein the solvent comprises water and is substantially free of organic solvents, where (I), (II) and (III) respectively are: ##STR00001## where R.sub.1 is a C.sub.1-C.sub.6 alkyl moiety, X=(OH) and n=2. ##STR00002## In (III), X may be CH.sub.2, sulfur or selenium, M may be Zn, Mg, or a lanthanide, and R.sub.1 and R.sub.2 each independently may be a methyl, ethyl, phenyl moiety.

  13. Nuclear reaction modeling, verification experiments, and applications

    SciTech Connect (OSTI)

    Dietrich, F.S.

    1995-10-01

    This presentation summarized the recent accomplishments and future promise of the neutron nuclear physics program at the Manuel Lujan Jr. Neutron Scatter Center (MLNSC) and the Weapons Neutron Research (WNR) facility. The unique capabilities of the spallation sources enable a broad range of experiments in weapons-related physics, basic science, nuclear technology, industrial applications, and medical physics.

  14. Theoretical studies in nuclear reactions and nuclear structure. Progress report

    SciTech Connect (OSTI)

    Not Available

    1992-05-01

    Research in the Maryland Nuclear Theory Group focusses on problems in four basic areas of current relevance. Hadrons in nuclear matter; the structure of hadrons; relativistic nuclear physics and heavy ion dynamics and related processes. The section on hadrons in nuclear matter groups together research items which are aimed at exploring ways in which the properties of nucleons and the mesons which play a role in the nuclear force are modified in the nuclear medium. A very interesting result has been the finding that QCD sum rules supply a new insight into the decrease of the nucleon`s mass in the nuclear medium. The quark condensate, which characterizes spontaneous chiral symmetry breaking of the late QCD vacuum, decreases in nuclear matter and this is responsible for the decrease of the nucleon`s mass. The section on the structure of hadrons contains progress reports on our research aimed at understanding the structure of the nucleon. Widely different approaches are being studied, e.g., lattice gauge calculations, QCD sum rules, quark-meson models with confinement and other hedgehog models. A major goal of this type of research is to develop appropriate links between nuclear physics and QCD. The section on relativistic nuclear physics represents our continuing interest in developing an appropriate relativistic framework for nuclear dynamics. A Lorentz-invariant description of the nuclear force suggests a similar decrease of the nucleon`s mass in the nuclear medium as has been found from QCD sum rules. Work in progress extends previous successes in elastic scattering to inelastic scattering of protons by nuclei. The section on heavy ion dynamics and related processes reports on research into the e{sup +}e{sup {minus}} problem and heavy ion dynamics.

  15. Theoretical studies in nuclear reactions and nuclear structure

    SciTech Connect (OSTI)

    Not Available

    1992-05-01

    Research in the Maryland Nuclear Theory Group focusses on problems in four basic areas of current relevance. Hadrons in nuclear matter; the structure of hadrons; relativistic nuclear physics and heavy ion dynamics and related processes. The section on hadrons in nuclear matter groups together research items which are aimed at exploring ways in which the properties of nucleons and the mesons which play a role in the nuclear force are modified in the nuclear medium. A very interesting result has been the finding that QCD sum rules supply a new insight into the decrease of the nucleon's mass in the nuclear medium. The quark condensate, which characterizes spontaneous chiral symmetry breaking of the late QCD vacuum, decreases in nuclear matter and this is responsible for the decrease of the nucleon's mass. The section on the structure of hadrons contains progress reports on our research aimed at understanding the structure of the nucleon. Widely different approaches are being studied, e.g., lattice gauge calculations, QCD sum rules, quark-meson models with confinement and other hedgehog models. A major goal of this type of research is to develop appropriate links between nuclear physics and QCD. The section on relativistic nuclear physics represents our continuing interest in developing an appropriate relativistic framework for nuclear dynamics. A Lorentz-invariant description of the nuclear force suggests a similar decrease of the nucleon's mass in the nuclear medium as has been found from QCD sum rules. Work in progress extends previous successes in elastic scattering to inelastic scattering of protons by nuclei. The section on heavy ion dynamics and related processes reports on research into the e{sup +}e{sup {minus}} problem and heavy ion dynamics.

  16. Direct reactions for nuclear structure and nuclear astrophysics

    SciTech Connect (OSTI)

    Jones, Katherine Louise

    2014-12-18

    Direct reactions are powerful probes for studying the atomic nucleus. Modern direct reaction studies are illuminating both the fundamental nature of the nucleus and its role in nucleosynthetic processes occurring in the cosmos. This report covers experiments using knockout reactions on neutron-deficient fragmentation beams, transfer reactions on fission fragment beams, and theoretical sensitivity studies relating to the astrophysical r-process. Results from experiments on 108,106Sn at the NSCL, and on 131Sn at HRIBF are presented as well as the results from the nucleosynthesis study.

  17. The Role of the Nuclear Reaction Data Centres in Experimental Nuclear Data Knowledge Sharing

    SciTech Connect (OSTI)

    Otuka, N.; Schwerer, O.; Otuka,N.; Dunaeva,S.; Dupont,e.; Schwerer,O.; Blokhin,A.

    2011-08-01

    The International Network of Nuclear Reaction Data Centres (NRDC) consists of 14 data centers from 10 countries and 2 international organizations, and is collaborating for compilation, exchange and dissemination of various types of nuclear reaction data information. The nuclear data centers common data collection, the EXFOR library today contains experimental information and numerical data from more than 18,000 experiments consisting of more than 134,000 data sets mainly of nuclear reaction data for incident neutrons, charged-particles and photons with incident energy lower than 1 GeV. A brief history and the current status of NRDC collaboration are presented for EXFOR as well as CINDA and ENDF.

  18. Statistical methods of spin assignment in compound nuclear reactions

    SciTech Connect (OSTI)

    Mach, H.; Johns, M.W.

    1985-01-15

    Spin assignment to nuclear levels can be obtained from standard in-beam gamma-ray spectroscopy techniques and in the case of compound nuclear reactions can be complemented by statistical methods. These are based on a correlation pattern between level spin and gamma-ray intensities feeding low-lying levels. Three types of intensity and level spin correlations are found suitable for spin assignment: shapes of the excitation functions, ratio of intensity at two beam energies or populated in two different reactions, and feeding distributions. Various empirical attempts are examined and the range of applicability of these methods as well as the limitations associated with them are given.

  19. EXFOR SYSTEMS MANUAL NUCLEAR REACTION DATA EXCHANGE FORMAT.

    SciTech Connect (OSTI)

    MCLANE,V.; NUCLEAR DATA CENTER NETWORK

    2000-05-19

    EXFOR is an exchange format designed to allow transmission of nuclear reaction data between the members of the Nuclear Data Centers Network. This document has been written for use by the members of the Network and includes matters of procedure and protocol, as well as detailed rules for the compilation of data. Users may prefer to consult EXFOR Basics' for a brief description of the format.

  20. Nuclear Structure and Nuclear Reactions | Argonne Leadership Computing

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Facility path Projections of the 3D dynamic spontaneous fission path for 264Fm on the x1-x2 plane for x3 = 0 (a) and x1-x3 plane for x2= 0 (b), where x1 is the elongation of the nucleus, x2 - triaxiality, and x3 - pairing correlations. Calculations were carried out using nuclear density functional theory. The collective action was minimized using the dynamical programing method. The dash-dotted line shows for comparison the 2D path computed without pairing fluctuations. The static

  1. Towards a More Complete and Accurate Experimental Nuclear Reaction Data Library (EXFOR): International Collaboration Between Nuclear Reaction Data Centres (NRDC)

    SciTech Connect (OSTI)

    Otuka, N.; Dupont, E.; Semkova, V.; Pritychenko, B.; Blokhin, A.I.; Aikawa, M.; Babykina, S.; Bossant, M.; Chen, G.; Dunaeva, S.; Forrest, R.A.; Fukahori, T.; Furutachi, N.; Ganesan, S.; Ge, Z.; Gritzay, O.O.; Herman, M.; Hlavač, S.; and others

    2014-06-15

    The International Network of Nuclear Reaction Data Centres (NRDC) coordinated by the IAEA Nuclear Data Section (NDS) successfully collaborates in the maintenance and development of the EXFOR library. As the scope of published data expands (e.g. to higher energy, to heavier projectile) to meet the needs of research and applications, it has become a challenging task to maintain both the completeness and accuracy of the EXFOR library. Evolution of the library highlighting recent developments is described.

  2. Towards a More Complete and Accurate Experimental Nuclear Reaction Data Library (EXFOR). International Collaboration Between Nuclear Reaction Data Centres (NRDC)

    SciTech Connect (OSTI)

    Otuka, N.; Pritychenko, B.; Otuka, N.; Dupont, E.; Semkova, V.; Pritychenko, B.; Blokhin, A. I.; Aikawa, M.; Babykina, S.; Bossant, M.; Chen, G.; Dunaeva, S.; Forrest, R. A.; Fukahori, T.; Furutachi, N.; Ganesan, S.; Ge, Z.; Gritzay, O. O.; Herman, M.; Hlavac, S.; Kato, K.; Lalremruata, B.; Lee, Y. O.; Makinaga, A.; Matsumoto, K.; Mikhaylyukova, M.; Pikulina, G.; Pronyaev, V. G.; Saxena, A.; Schwerer, O.; Simakov, S. P.; Soppera, N.; Suzuki, R.; Takacs, S.; Tao, X.; Taova, S.; Tarkanyi, F.; Varlamov, V. V.; Wang, J.; Yang, S. C.; Zerkin, V.; Zhuang, Y.

    2014-06-01

    The International Network of Nuclear Reaction Data Centres (NRDC) coordinated by the IAEA Nuclear Data Section (NDS) successfully collaborates in the maintenance and development of the EXFOR library. Likewise, as the scope of published data expands (e.g. to higher energy, to heavier projectile) to meet the needs of research and applications, it has become a challenging task to maintain both the completeness and accuracy of the EXFOR library. Evolution of the library highlighting recent developments is described.

  3. Do nuclear reactions take place under chemical stimulation?

    SciTech Connect (OSTI)

    Bockris, J.O.; Lin, G.H.; Bush, R.T.

    1996-09-01

    Several examples of nuclear reactions occurring under the stimulation of chemical type energies are given. The production of tritium from deuterium in Pd has more than 100 published confirmations. Three models suggest circumstances such that barriers between nucleii may become transparent. 24 refs.

  4. Sigma: Web Retrieval Interface for Nuclear Reaction Data

    SciTech Connect (OSTI)

    Pritychenko,B.; Sonzogni, A.A.

    2008-06-24

    The authors present Sigma, a Web-rich application which provides user-friendly access in processing and plotting of the evaluated and experimental nuclear reaction data stored in the ENDF-6 and EXFOR formats. The main interface includes browsing using a periodic table and a directory tree, basic and advanced search capabilities, interactive plots of cross sections, angular distributions and spectra, comparisons between evaluated and experimental data, computations between different cross section sets. Interactive energy-angle, neutron cross section uncertainties plots and visualization of covariance matrices are under development. Sigma is publicly available at the National Nuclear Data Center website at www.nndc.bnl.gov/sigma.

  5. Fusion reactions in nuclear astrophysics: The MUSIC approach

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    reactions in nuclear astrophysics: The MUSIC approach The MUSIC approach Sergio Almaraz-Calderon Sergio Almaraz-Calderon Physics Division Argonne National Laboratory 2014 ATLAS USER'S MEETING 05/15/2014 Carbon burning reactions in the stars Carbon burning in massive stars Ignition phase of Type Ia supernovae X-ray binaries NASA/CXC/PSU/L University of Chicago Flash Center S. Almaraz-Calderon ATLAS user's meeting 05/15/2014 H. Schatz X-Ray Bursts and Superbursts ● H and He burning (rp-process)

  6. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOE Patents [OSTI]

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  7. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    SciTech Connect (OSTI)

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  8. Experimental Observation of Nuclear Reactions in Palladium and Uranium

    SciTech Connect (OSTI)

    J. Dufour; D. Murat; X. Dufour; J. Foos

    2001-11-12

    By submitting various metals (Pd, U) containing hydrogen (from 2000 to 700 000 atoms of hydrogen for 1 000 000 atoms of the host metal) to the combined action of electrical currents and magnetic fields, we have observed a sizeable exothermal effect (from 0.1 to 8 W for 500 mg of metal used). This effect is beyond experimental errors, the energy output being typically 130 to 250{percent} of the energy input and not of chemical origin (exothermal effect in the range of 7000 MJ/mol of metal in the case of palladium and of 60 MJ/mol in the case of uranium). New chemical species also appear in the processes metals. It has been shown by a QED calculation that resonances of long lifetime (s), nuclear dimensions (fm), and low energy of formation (eV) could exist. This concept seems to look like the 'shrunken hydrogen atoms' proposed by various authors. It is indeed very different in two ways (a) being a metastable state, it needs energy to be formed (a few eV) and reverts to normal hydrogen after a few seconds, liberating back its energy of formation (it is thus not the source of the energy observed); (b) its formation can be described as the electron spin/proton nuclear spin interaction becoming first order in the lattice environment (whereas it is third order in a normal hydrogen atom). Moreover, we consider that the hydrex cannot yield a neutron because this reaction is strongly endothermic. To explain our results, we put forward the following working hypothesis: In a metal lattice and under proper conditions, the formation of such resonances (metastable state) could be favored. We propose to call them HYDREX, and we assume that they are actually formed in cold fusion (CF) and low-energy nuclear reaction (LENR) experiments. Once formed, a number of HYDREX could gather around a nucleus of the lattice to form a cluster of nuclear size and of very long life time compared to nuclear time (10{sup -22} s). In this cluster, nuclear rearrangements could take place, yielding

  9. Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

    DOE Patents [OSTI]

    Chen, Xian; Gupta, Goutam; Bradbury, E. Morton

    2001-01-01

    Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

  10. Ab Initio Nuclear Structure and Reaction Calculations for Rare Isotopes

    SciTech Connect (OSTI)

    Draayer, Jerry P.

    2014-09-28

    We have developed a novel ab initio symmetry-adapted no-core shell model (SA-NCSM), which has opened the intermediate-mass region for ab initio investigations, thereby providing an opportunity for first-principle symmetry-guided applications to nuclear structure and reactions for nuclear isotopes from the lightest p-shell systems to intermediate-mass nuclei. This includes short-lived proton-rich nuclei on the path of X-ray burst nucleosynthesis and rare neutron-rich isotopes to be produced by the Facility for Rare Isotope Beams (FRIB). We have provided ab initio descriptions of high accuracy for low-lying (including collectivity-driven) states of isotopes of Li, He, Be, C, O, Ne, Mg, Al, and Si, and studied related strong- and weak-interaction driven reactions that are important, in astrophysics, for further understanding stellar evolution, X-ray bursts and triggering of s, p, and rp processes, and in applied physics, for electron and neutrino-nucleus scattering experiments as well as for fusion ignition at the National Ignition Facility (NIF).

  11. Probing Nuclear Reactions in Stars | U.S. DOE Office of Science (SC)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Probing Nuclear Reactions in Stars Nuclear Physics (NP) NP Home About Research Facilities Science Highlights Benefits of NP Funding Opportunities Nuclear Science Advisory Committee (NSAC) Community Resources Contact Information Nuclear Physics U.S. Department of Energy SC-26/Germantown Building 1000 Independence Ave., SW Washington, DC 20585 P: (301) 903-3613 F: (301) 903-3833 E: Email Us More Information » 11.01.15 Probing Nuclear Reactions in Stars Novel experiments measure unusual

  12. A comparative analysis of accident risks in fossil, hydro, and nuclear energy chains

    SciTech Connect (OSTI)

    Burgherr, P.; Hirschberg, S.

    2008-07-01

    This study presents a comparative assessment of severe accident risks in the energy sector, based on the historical experience of fossil (coal, oil, natural gas, and LPG (Liquefied Petroleum Gas)) and hydro chains contained in the comprehensive Energy-related Severe Accident Database (ENSAD), as well as Probabilistic Safety Assessment (PSA) for the nuclear chain. Full energy chains were considered because accidents can take place at every stage of the chain. Comparative analyses for the years 1969-2000 included a total of 1870 severe ({>=} 5 fatalities) accidents, amounting to 81,258 fatalities. Although 79.1% of all accidents and 88.9% of associated fatalities occurred in less developed, non-OECD countries, industrialized OECD countries dominated insured losses (78.0%), reflecting their substantially higher insurance density and stricter safety regulations. Aggregated indicators and frequency-consequence (F-N) curves showed that energy-related accident risks in non-OECD countries are distinctly higher than in OECD countries. Hydropower in non-OECD countries and upstream stages within fossil energy chains are most accident-prone. Expected fatality rates are lowest for Western hydropower and nuclear power plants; however, the maximum credible consequences can be very large. Total economic damages due to severe accidents are substantial, but small when compared with natural disasters. Similarly, external costs associated with severe accidents are generally much smaller than monetized damages caused by air pollution.

  13. Resilience of nuclear matter in light ion induced reactions

    SciTech Connect (OSTI)

    Colonna, M.; Cugnon, J.; Pollacco, E.C.

    1997-03-01

    Cavitation and heating of the target nucleus in the first instances of {sup 3}He-induced collisions in the GeV/nucleon range are investigated in an intranuclear cascade model for the formation of this structure and a stochastic one-body dynamics calculation to study its evolution. The hard collisions having essentially ceased when the structure is fully developed, the latter model is particularly suited to study the possible breakup of the system. It is shown, however, that the target recovers a spherical shape rather rapidly, and has thus a good chance to decay by standard evaporation, justifying the use of a cascade + evaporation model to analyze the data. It is also shown that the system has to be much more modified to break up into pieces instead of recovering a compact shape: in these reactions, it is thus expected that nuclear matter is resilient to shape deformation and thermal excitation. Arguments are given to explain that expansion of the system, not important in these reactions, is required to overcome this resilience. {copyright} {ital 1997} {ital The American Physical Society}

  14. Solving The Long-Standing Problem Of Low-Eneregy Nuclear Reactions...

    Office of Scientific and Technical Information (OSTI)

    Eneregy Nuclear Reactions At The Highest Microscopic Level: Annual Continuation And Progress Report Citation Details In-Document Search Title: Solving The Long-Standing Problem Of ...

  15. Nuclear Reaction Cross Sections Database at BNL | U.S. DOE Office of

    Office of Science (SC) Website

    Science (SC) Reaction Cross Sections Database at BNL Nuclear Physics (NP) NP Home About Research Facilities Science Highlights Benefits of NP Applications of Nuclear Science Applications of Nuclear Science Archives Small Business Innovation Research / Small Business Technology Transfer Funding Opportunities Nuclear Science Advisory Committee (NSAC) Community Resources Contact Information Nuclear Physics U.S. Department of Energy SC-26/Germantown Building 1000 Independence Ave., SW

  16. Estimation of Nuclear Reaction Effects in Proton-Tissue-Dose Calculations.

    Energy Science and Technology Software Center (OSTI)

    1983-01-14

    Version 00 REPC reviews calculational methods for the estimation of dose from external proton exposure of arbitrary convex bodies and presents the necessary information for the estimation of dose in soft tissue. The effects of nuclear reactions, especially in relation to the dose equivalent, are retained. REPC subroutines can be used to convert existing computer programs which neglect nuclear reaction effects to include them.

  17. Establishing a value chain for human factors in nuclear power plantcontrol room modernization

    SciTech Connect (OSTI)

    Joe, Jeffrey Clark; Thomas, Kenneth David; Boring, Ronald Laurids

    2015-07-01

    Commercial nuclear power plants in the United States (U.S.) have operated reliably and efficiently for decades. With the life extensions of plants now being planned for operation beyond their original operating licenses, there are opportunities to achieve even greater efficiencies, while maintaining high operational reliabilities, with strategic, risk- and economically-informed, upgrades to plant systems and infrastructure. The U.S. Department of Energy’s Light Water Reactor Sustainability (LWRS) program supports the commercial nuclear industry’s modernization efforts through research and development (R&D) activities across many areas to help establish the technical and economic bases for modernization activities. The Advanced Instrumentation, Information, and Control Systems Technologies pathway is one R&D focus area for the LWRS program, and has researchers at Idaho National Laboratory working with select utility partners to use human factors and instrumentation and controls R&D to help modernize the plant’s main control room. However, some in the nuclear industry have not been as enthusiastic about using human factors R&D to inform life extension decision making. Part of the reason for this may stem from uncertainty decision-makers have regarding how human factors fits into the value chain for nuclear power plant control room modernization. This paper reviews past work that has attempted to demonstrate the value of human factors, and then describes the value chain concept, how it applies to control room modernization, and then makes a case for how and why human factors is an essential link in the modernization value chain.

  18. Modeled Neutron Induced Nuclear Reaction Cross Sections for Radiochemistry in the region of Iriduim and Gold

    SciTech Connect (OSTI)

    Hoffman, R D; Dietrich, F S; Kelley, K; Escher, J; Bauer, R; Mustafa, M

    2008-02-26

    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron induced nuclear reaction cross sections for targets ranging from osmium (Z = 76) to gold (Z = 79). Of particular interest are the cross sections on Ir and Au including reactions on isomeric targets.

  19. Uncovering Special Nuclear Materials by Low-energy Nuclear Reaction Imaging

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Rose, P. B.; Erickson, A. S.; Mayer, M.; Nattress, J.; Jovanovic, I.

    2016-04-18

    Weapons-grade uranium and plutonium could be used as nuclear explosives with extreme destructive potential. The problem of their detection, especially in standard cargo containers during transit, has been described as “searching for a needle in a haystack” because of the inherently low rate of spontaneous emission of characteristic penetrating radiation and the ease of its shielding. Currently, the only practical approach for uncovering well-shielded special nuclear materials is by use of active interrogation using an external radiation source. However, the similarity of these materials to shielding and the required radiation doses that may exceed regulatory limits prevent this method frommore » being widely used in practice. We introduce a low-dose active detection technique, referred to as low-energy nuclear reaction imaging, which exploits the physics of interactions of multi-MeV monoenergetic photons and neutrons to simultaneously measure the material’s areal density and effective atomic number, while confirming the presence of fissionable materials by observing the beta-delayed neutron emission. For the first time, we demonstrate identification and imaging of uranium with this novel technique using a simple yet robust source, setting the stage for its wide adoption in security applications.« less

  20. Equation of state of hot polarized nuclear matter and heavy-ion fusion reactions

    SciTech Connect (OSTI)

    Ghodsi, O. N.; Gharaei, R.

    2011-08-15

    We employ the equation of state of hot polarized nuclear matter to simulate the repulsive force caused by the incompressibility effects of nuclear matter in the fusion reactions of heavy colliding ions. The results of our studies reveal that temperature effects of compound nuclei have significant importance in simulating the repulsive force on the fusion reactions for which the temperature of the compound nucleus increases up to about 2 MeV. Since the equation of state of hot nuclear matter depends upon the density and temperature of the nuclear matter, it has been suggested that, by using this equation of state, one can simulate simultaneously both the effects of the precompound nucleons' emission and the incompressibility of nuclear matter to calculate the nuclear potential in fusion reactions within a static formalism such as the double-folding (DF) model.

  1. High temperature spin dynamics in linear magnetic chains, molecular rings, and segments by nuclear magnetic resonance

    SciTech Connect (OSTI)

    Adelnia, Fatemeh; Lascialfari, Alessandro; Mariani, Manuel; Ammannato, Luca; Caneschi, Andrea; Rovai, Donella; Winpenny, Richard; Timco, Grigore; Corti, Maurizio Borsa, Ferdinando

    2015-05-07

    We present the room temperature proton nuclear magnetic resonance (NMR) nuclear spin-lattice relaxation rate (NSLR) results in two 1D spin chains: the Heisenberg antiferromagnetic (AFM) Eu(hfac){sub 3}NITEt and the magnetically frustrated Gd(hfac){sub 3}NITEt. The NSLR as a function of external magnetic field can be interpreted very well in terms of high temperature spin dynamics dominated by a long time persistence of the decay of the two-spin correlation function due to the conservation of the total spin value for isotropic Heisenberg chains. The high temperature spin dynamics are also investigated in Heisenberg AFM molecular rings. In both Cr{sub 8} closed ring and in Cr{sub 7}Cd and Cr{sub 8}Zn open rings, i.e., model systems for a finite spin segment, an enhancement of the low frequency spectral density is found consistent with spin diffusion but the high cut-off frequency due to intermolecular anisotropic interactions prevents a detailed analysis of the spin diffusion regime.

  2. Proton Reaction Data Library for Nuclear Activation (Medium Energy Nuclear Data Library.)

    Energy Science and Technology Software Center (OSTI)

    2002-03-01

    Version 00 GROUPXS does file handling and processing of the double-differential continuum-emission cross sections stored in the new MF6 format of ENDF/VI. It treats the energy-angle data that are supposed to be represented by a Legendre-polynomial expansion in the center-of-mass system and can do the following: (1) Conversion of MF6 data from center-of-mass system to the laboratory system, with the possibility to continue the calculation with the options (2), (3), and (4). (2) Conversion ofmore » Legendre-polynomial representation into point-wise angular data, in MF6 format. (3) Conversion of data from MF6 into MF4 + MF5 (ENDF-V). (4) Calculation of group constants, scattering matrices and transfer matrices for arbitrary group structures with a fusion micro-flux weighting spectrum (PN-approximation). The code treats only continuum reaction types that are stored in the MF6 format with the restrictions as specified for the European Fusion File (EFF1). These restrictions are not inconvenient for the purpose of fusion neutronics calculations and they facilitate relatively simple processing . This neutron reaction data library can be used for nuclear activation and transmutation applications at energies up to 100 MeV.« less

  3. Solving The Long-Standing Problem Of Nuclear Reactions At The...

    Office of Scientific and Technical Information (OSTI)

    Long-Standing Problem Of Nuclear Reactions At The Highest Microscopic Level: Annual Continuation And Progress Report Citation Details In-Document Search Title: Solving The Long-Sta...

  4. Solving The Long-Standing Problem Of Low-Eneregy Nuclear Reactions...

    Office of Scientific and Technical Information (OSTI)

    Solving The Long-Standing Problem Of Low-Eneregy Nuclear Reactions At The Highest ... Citation Details In-Document Search Title: Solving The Long-Standing Problem Of ...

  5. Solving The Long-Standing Problem Of Low-Energy Nuclear Reactions...

    Office of Scientific and Technical Information (OSTI)

    Solving The Long-Standing Problem Of Low-Energy Nuclear Reactions At The Highest ... Citation Details In-Document Search Title: Solving The Long-Standing Problem Of Low-Energy ...

  6. Summary Report of the Workshop on The Experimental Nuclear Reaction Data Database

    SciTech Connect (OSTI)

    Semkova, V.; Pritychenko, B.

    2014-10-10

    The Workshop on the Experimental Nuclear Reaction Data Database (EXFOR) was held at IAEA Headquarters in Vienna from 6 to 10 October 2014. The workshop was organized to discuss various aspects of the EXFOR compilation process including compilation rules, different techniques for nuclear reaction data measurements, software developments, etc. A summary of the presentations and discussions that took place during the workshop is reported here.

  7. Study of components and statistical reaction mechanism in simulation of nuclear process for optimized production of {sup 64}Cu and {sup 67}Ga medical radioisotopes using TALYS, EMPIRE and LISE++ nuclear reaction and evaporation codes

    SciTech Connect (OSTI)

    Nasrabadi, M. N. Sepiani, M.

    2015-03-30

    Production of medical radioisotopes is one of the most important tasks in the field of nuclear technology. These radioactive isotopes are mainly produced through variety nuclear process. In this research, excitation functions and nuclear reaction mechanisms are studied for simulation of production of these radioisotopes in the TALYS, EMPIRE and LISE++ reaction codes, then parameters and different models of nuclear level density as one of the most important components in statistical reaction models are adjusted for optimum production of desired radioactive yields.

  8. LDRD Final Report: Surrogate Nuclear Reactions and the Origin of the Heavy Elements (04-ERD-057)

    SciTech Connect (OSTI)

    Escher, J E; Bernstein, L A; Bleuel, D; Burke, J; Church, J A; Dietrich, F S; Forssen, C; Gueorguiev, V; Hoffman, R D

    2007-02-23

    Research carried out in the framework of the LDRD project ''Surrogate Nuclear Reactions and the Origin of the Heavy Elements'' (04-ERD-057) is summarized. The project was designed to address the challenge of determining cross sections for nuclear reactions involving unstable targets, with a particular emphasis on reactions that play a key role in the production of the elements between Iron and Uranium. This report reviews the motivation for the research, introduces the approach employed to address the problem, and summarizes the resulting scientific insights, technical findings, and related accomplishments.

  9. EXTENSION OF THE NUCLEAR REACTION MODEL CODE EMPIRE TO ACTINIDES NUCLEAR DATA EVALUATION.

    SciTech Connect (OSTI)

    CAPOTE,R.; SIN, M.; TRKOV, A.; HERMAN, M.; CARLSON, B.V.; OBLOZINSKY, P.

    2007-04-22

    Recent extensions and improvements of the EMPIRE code system are outlined. They add new capabilities to the code, such as prompt fission neutron spectra calculations using Hauser-Feshbach plus pre-equilibrium pre-fission spectra, cross section covariance matrix calculations by Monte Carlo method, fitting of optical model parameters, extended set of optical model potentials including new dispersive coupled channel potentials, parity-dependent level densities and transmission through numerically defined fission barriers. These features, along with improved and validated ENDF formatting, exclusive/inclusive spectra, and recoils make the current EMPIRE release a complete and well validated tool for evaluation of nuclear data at incident energies above the resonance region. The current EMPIRE release has been used in evaluations of neutron induced reaction files for {sup 232}Th and {sup 231,233}Pa nuclei in the fast neutron region at IAEA. Triple-humped fission barriers and exclusive pre-fission neutron spectra were considered for the fission data evaluation. Total, fission, capture and neutron emission cross section, average resonance parameters and angular distributions of neutron scattering are in excellent agreement with the available experimental data.

  10. Dynamical dipole mode in fusion reactions with exotic nuclear beams

    SciTech Connect (OSTI)

    Baran, V.; Rizzo, C.; Colonna, M.; Toro, M. Di; Pierroutsakou, D.

    2009-02-15

    We report the properties of the prompt dipole radiation, produced via a collective bremsstrahlung mechanism, in fusion reactions with exotic beams. We show that the {gamma} yield is sensitive to the density dependence of the symmetry energy below/around saturation. Moreover, we find that the angular distribution of the emitted photons from such fast collective mode can represent a sensitive probe of its excitation mechanism and of fusion dynamics in the entrance channel.

  11. Coulomb reacceleration as a clock for nuclear reactions -- II

    SciTech Connect (OSTI)

    Bertulani, C.A.; Bertsch, G.F.

    1994-03-01

    Reacceleration effects in the Coulomb breakup of nuclei are modeled with the two-dimensional time-dependent Schroedinger equation, extending a previous one-dimensional study. The present model better describes the individual contributions of longitudinal and transverse forces to the breakup and reacceleration. Reacceleration effects are found to preserve a strong memory of the pre-breakup phase of the reaction, as was concluded with the one-dimensional model.

  12. Experimental study of nuclear fusion reactions in muonic molecular systems

    SciTech Connect (OSTI)

    Bogdanova, L. N.

    2013-03-15

    Since the pioneering discovery of the muon catalysis by Alvarez [L. W. Alvarez, K. Brander, F. S. Crawford, et al., Phys. Rev. 105, 1127 (1957)], considerable efforts were aimed at observation of various fusion processes. Results of these studies facilitated understanding the properties of lightest nuclei and dynamics of low-energy fusion reactions. There still remain unsolved theoretical and experimental problems, especially in case of pt fusion.

  13. Low-Energy Nuclear Reactions of Protons in Host Metals at Picometre Distance

    SciTech Connect (OSTI)

    Heinrich Hora; George H. Miley; Jak C. Kelly

    2000-11-12

    A review is given for the explanation of the measurements of Miley et al. of a fully reproducible generation of nuclei of the whole periodic table by protons in host metals during a several-weeks reaction. Similar low-energy nuclear reactions (LENR) were observed by other groups. The fact that the heavy nuclides are not due to pollution can be seen from the fact that such very rare elements as thulium and terbium were detected by unique K-shell X-ray spectra. The nuclear reaction energy goes into the heavy nuclei as measured from much bigger traces in CR39 than from alphas. The fact that any reaction of the protons results in stable daughter nuclei is confirmed by the fact that the highest energy gain is resulting with stable reaction products. This has been explained in Ref. 2, and the energy gain for the heavy element generation by a compound reaction was discussed. The explanation is based on the model of the authors from 1989 to assume free motion of the protons contrary to localized crystalline states. A relation of the reaction time U on distance d of the reacting nuclei by a power law with an exponent 34.8 was derived. Based on few reproducible D-D reactions, a reaction time near the range of megaseconds and a reaction distance of nanometers was concluded. A splendid confirmation of the picometre-megasecond reactions was achieved by Li et al. from his direct quantum mechanical calculations of the hot fusion D-T reactions based on a one-step selective resonance tunneling model. Li et al. were able for the first time to derive the cross sections of the hot fusion. Li's application to picometre distance showed megasecond reaction times with no neutron or gamma emission. Because of the imaginary part in the Schroedinger potential, the problem of the level width is reduced by damping.

  14. Examining Supply Chain Resilience for the Intermodal Shipment of Spent Nuclear Fuel and High Level Radioactive Materials

    SciTech Connect (OSTI)

    Peterson, Steven K

    2016-01-01

    The U.S. Department of Energy (DOE) has a significant programmatic interest in the safe and secure routing and transportation of Spent Nuclear Fuel (SNF) and High Level Waste (HLW) in the United States, including shipments entering the country from locations outside U.S borders. In any shipment of SNF/HLW, there are multiple chains; a jurisdictional chain as the material moves between jurisdictions (state, federal, tribal, administrative), a physical supply chain (which mode), as well as a custody chain (which stakeholder is in charge/possession) of the materials being transported. Given these interconnected networks, there lies vulnerabilities, whether in lack of communication between interested stakeholders or physical vulnerabilities such as interdiction. By identifying key links and nodes as well as administrative weaknesses, decisions can be made to harden the physical network and improve communication between stakeholders. This paper examines the parallel chains of oversight and custody as well as the chain of stakeholder interests for the shipments of SNF/HLW and the potential impacts on systemic resiliency. Using the Crystal River shutdown location as well as a hypothetical international shipment brought into the United States, this paper illustrates the parallel chains and maps them out visually.

  15. Tracking of Ions Produced at Near Barrier Energies in Nuclear Reactions

    SciTech Connect (OSTI)

    Shapira, Dan

    2010-01-01

    Examples of detectors, presently in use, for tracking products from nuclear reactions induced by radioactive ion beams are described. A new tracking detector is being designed to study the binary products from reactions induced by heavy neutron-rich radioactive ion beams on heavy neutron-rich target nuclei. The motivation for such studies and the features designed to accomplish this goal will be presented.

  16. Refined scenario of standard Big Bang nucleosynthesis allowing for nonthermal nuclear reactions in the primordial plasma

    SciTech Connect (OSTI)

    Voronchev, Victor T.; Nakao, Yasuyuki; Nakamura, Makoto; Tsukida, Kazuki [Institute of Nuclear Physics, Moscow State University, Moscow 119991 (Russian Federation); Department of Applied Quantum Physics and Nuclear Engineering, Kyushu University, Motooka, Fukuoka 819-0395 (Japan); Division of Advanced Plasma Research, Japan Atomic Energy Agency, 2-166 Oaza-Obuchi-Aza-Omotedate, Rokkasho, Kamikita, Aomori 039-3212 (Japan); Department of Applied Quantum Physics and Nuclear Engineering, Kyushu University, Motooka, Fukuoka 819-0395 (Japan)

    2012-11-12

    The standard scenario of big bang nucleosynthesis (BBN) is generalized to take into account nonthermal nuclear reactions in the primordial plasma. These reactions are naturally triggered in the BBN epoch by fast particles generated in various exoergic processes. It is found that, although such particles can appreciably enhance the rates of some individual reactions, their influence on the whole process of element production is not significant. The nonthermal corrections to element abundances are obtained to be 0.1% ({sup 3}H), -0.03% ({sup 7}Li), and 0.34 %-0.63% (CNO group).

  17. Cross-checking of Large Evaluated and Experimental Nuclear Reaction Databases

    SciTech Connect (OSTI)

    Zeydina, O.; Koning, A.J.; Soppera, N.; Raffanel, D.; Bossant, M.; Dupont, E.; Beauzamy, B.

    2014-06-15

    Automated methods are presented for the verification of large experimental and evaluated nuclear reaction databases (e.g. EXFOR, JEFF, TENDL). These methods allow an assessment of the overall consistency of the data and detect aberrant values in both evaluated and experimental databases.

  18. Enrico Fermi and the First Self-Sustaining Nuclear Chain Reaction

    Office of Scientific and Technical Information (OSTI)

    about Enrico Fermi and his work is available in full-text DOE reports and on the Web. ... FGST (Fermi Gamma-ray Space Telescope) Remembering Fermi (video) Top Additional Web Pages: ...

  19. Towards a nonequilibrium Green's function description of nuclear reactions: One-dimensional mean-field dynamics

    SciTech Connect (OSTI)

    Rios, Arnau; Barker, Brent; Buchler, Mark; Danielewicz, Pawel

    2011-05-15

    Research Highlights: > Dynamics of central nuclear reactions. > Nonequilibrium Green's functions and Kadanoff-Baym formalism. > Adiabatic switching on of interactions. > Mean-field time evolution of nuclear slabs. > Off-diagonal spatial structure of a collision density matrix. - Abstract: Nonequilibrium Green's function methods allow for an intrinsically consistent description of the evolution of quantal many-body body systems, with inclusion of different types of correlations. In this paper, we focus on the practical developments needed to build a Green's function methodology for nuclear reactions. We start out by considering symmetric collisions of slabs in one dimension within the mean-field approximation. We concentrate on two issues of importance for actual reaction simulations. First, the preparation of the initial state within the same methodology as for the reaction dynamics is demonstrated by an adiabatic switching on of the mean-field interaction, which leads to the mean-field ground state. Second, the importance of the Green's function matrix-elements far away from the spatial diagonal is analyzed by a suitable suppression process that does not significantly affect the evolution of the elements close to the diagonal. The relative lack of importance of the far-away elements is tied to system expansion. We also examine the evolution of the Wigner function and verify quantitatively that erasing of the off-diagonal elements corresponds to averaging out of the momentum-space details in the Wigner function.

  20. Experimental Observation of Nuclear Reactions in Palladium and Uranium - Possible Explanation by Hydrex Mode

    SciTech Connect (OSTI)

    Dufour, J.; Murat, D.; Dufour, X.; Foos, J

    2001-07-15

    Experiments with uranium are presented that show a highly exothermal reaction, which can only be of nuclear origin. One striking point of these results is that they clearly show that what is being observed is not some kind of fusion reaction of the deuterium present (only exceedingly small amounts of it are present). This is a strong indication that hydrogen can trigger nuclear reactions that seem to involve the nuclei of the lattice (which would yield a fission-like pattern of products). Confronted with a situation where some experiments in the field yield a fusion-like pattern of products (CF experiments) and others a fissionlike one (LENR experiments), one can reasonably wonder whether one is not observing two aspects of the same phenomenon. Thus, it is proposed to describe CF and LENR reactions as essentially the same phenomenon based on the possible existence of a still hypothetical proton/electron resonance, which would catalyze fissionlike reactions with a neutron sink. Finally, a series of experiments is proposed to assess this hypothesis.

  1. Level density inputs in nuclear reaction codes and the role of the spin cutoff parameter

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Voinov, A. V.; Grimes, S. M.; Brune, C. R.; Burger, A.; Gorgen, A.; Guttormsen, M.; Larsen, A. C.; Massey, T. N.; Siem, S.

    2014-09-03

    Here, the proton spectrum from the 57Fe(α,p) reaction has been measured and analyzed with the Hauser-Feshbach model of nuclear reactions. Different input level density models have been tested. It was found that the best description is achieved with either Fermi-gas or constant temperature model functions obtained by fitting them to neutron resonance spacing and to discrete levels and using the spin cutoff parameter with much weaker excitation energy dependence than it is predicted by the Fermi-gas model.

  2. Nuclear reaction products that would appear if substantial cold fusion occurred

    SciTech Connect (OSTI)

    Mueller, D.; Grisham, L.R. . Plasma Physics Lab.)

    1989-11-01

    This paper reports on recent claims of net energy production by cold fusion that have prompted an examination of all the positive Q value, two-body nuclear reactions that might result from the fusion of any of the isotopes in the apparatus used by Fleischmann and Pons. Any energy production that may result from cold fusion would be accompanied by copious production of nuclear reaction products (on the order of 10{sup 13}/s). Furthermore, the elementary properties of the alpha particle at the deuteron + deuteron threshold are discussed. An important property of the alpha at this high excitation is its nearly prompt (10{sup {minus}20} s) decay by particle emission to {sup 3}He + n or triton + proton.

  3. Using Nuclear Fusion Reactions to Peer Inside the Core of a Dense Hot

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Plasma | U.S. DOE Office of Science (SC) Using Nuclear Fusion Reactions to Peer Inside the Core of a Dense Hot Plasma Fusion Energy Sciences (FES) FES Home About Research Facilities Science Highlights Benefits of FES Funding Opportunities Fusion Energy Sciences Advisory Committee (FESAC) Community Resources Contact Information Fusion Energy Sciences U.S. Department of Energy SC-24/Germantown Building 1000 Independence Ave., SW Washington, DC 20585 P: (301) 903-4941 F: (301) 903-8584 E: Email

  4. Advancing the Theory of Nuclear Reactions with Rare Isotopes: From the Laboratory to the Cosmos

    SciTech Connect (OSTI)

    Elster, Charlotte

    2015-06-01

    The mission of the TORUS Topical Collaboration is to develop new methods that will advance nuclear reaction theory for unstable isotopes by using three-body techniques to improve direct-reaction calculations, and, by using a new partial-fusion theory, to integrate descriptions of direct and compound-nucleus reactions. Ohio University concentrates its efforts on the first part of the mission. Since direct measurements are often not feasible, indirect methods, e.g. (d,p) reactions, should be used. Those (d,p) reactions may be viewed as three-body reactions and described with Faddeev techniques. Faddeev equations in momentum space have a long tradition of utilizing separable interactions in order to arrive at sets of coupled integral equations in one variable. While there exist several separable representations for the nucleon-nucleon interaction, the optical potential between a neutron (proton) and a nucleus is not readily available in separable form. For this reason we first embarked in introducing a separable representation for complex phenomenological optical potentials of Woods-Saxon type.

  5. Coupled-Channels Density-Matrix Approach to Low-Energy Nuclear Reaction Dynamics

    SciTech Connect (OSTI)

    Diaz-Torres, Alexis

    2011-10-28

    Atomic nuclei are complex, quantum many-body systems whose structure manifests itself through intrinsic quantum states associated with different excitation modes or degrees of freedom. Collective modes (vibration and/or rotation) dominate at low energy (near the ground-state). The associated states are usually employed, within a truncated model space, as a basis in (coherent) coupled channels approaches to low-energy reaction dynamics. However, excluded states can be essential, and their effects on the open (nuclear) system dynamics are usually treated through complex potentials. Is this a complete description of open system dynamics? Does it include effects of quantum decoherence? Can decoherence be manifested in reaction observables? In this contribution, I discuss these issues and the main ideas of a coupled-channels density-matrix approach that makes it possible to quantify the role and importance of quantum decoherence in low-energy nuclear reaction dynamics. Topical applications, which refer to understanding the astrophysically important collision {sup 12}C+{sup 12}C and achieving a unified quantum dynamical description of relevant reaction processes of weakly-bound nuclei, are highlighted.

  6. Evaluated Nuclear (reaction) Data from the Evaluated Nuclear Data File (ENDF)

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    The ENDF libraries are a collection of documented data evaluations stored in a defined computer-readable format that can be used as the main input to nuclear data processing programs. An evaluation is the process of analyzing experimentally measured cross-section data, combining them with the predictions of nuclear model calculations, and attempting to extract the true value of a cross section. Parameterization and reduction of the data to tabular form produces an evaluated data set. If a written description of the preparation of a unique data set from the data sources is available, the data set is referred to as a documented evaluation. The data sets contained on the ENDF/B library are those chosen by CSEWG from evaluations submitted for review. The choice is made on the basis of requirements for applications, conformance of the evaluation to the formats and procedures, and performance in testing. The data set that represents a particular material may change when (1) new significant experimental results become available, (2) integral tests show that the data give erroneous results, or (3) user's requirements indicate a need for more accurate data and/or better representations of the data for a particular material. New or revised data sets are included in new releases of the ENDF/B library. ENDF/B data sets are revised or replaced only after extensive review and testing. This allows them to be used as standard reference data during the lifetime of the particular ENDF/B version. (This information is copied from the ENDF- 6 Formats Manual, Data Formats and Procedures for the Evaluated Nuclear Data File ENDF/B-VI and ENDF/B-VII, Document ENDF-102, Report BNL-NCS-44945-05-Rev.) The current version is ENDF/B VII.0, released in 2006. Users can search ENDF via specialized interfaces, browse sub-libraries or download them as zipped files. Data plots can be generated through the Sigma interface. The ENDF web page also provides access to covariance data processing and plots

  7. Low-energy RI beam technology and nuclear clusters in the explosive pp-chain breakout process

    SciTech Connect (OSTI)

    Kubono, S. [Institute of Modern Physics, Chinese Academy of Sciences, Nanchang Road 509, Lanzhou 73000 (China); RIKEN Nishina Center, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Center for Nuclear Study, University of Tokyo, 2-1 Hirosawa, Wako, Saitama 351-0 (Japan); Yamaguchi, H.; Kahl, D. M.; Ohshiro, Y.; Watanabe, S.; Yamazaki, N. [Center for Nuclear Study, University of Tokyo, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Teranishi, T. [Department of Physics, Kyushu University, 6-10-1 Hakozaki, Fukuoka 812-858 (Japan); Yanagisawa, Y.; Wakabayashi, Y.; Kase, M. [RIKEN Nishina Center, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Hayakawa, S. [Laboratori Nazionali del Sud, Istituto Nazionale di Fisica Nucleare, Via S. Sofia 62, 95125 Catania (Italy); Kwon, Y. K. [Institute for Basic Science, 70, Yuseong-daero 1689-gil, Yuseong-gu, Daejeon 305-81 (Korea, Republic of); Hashimoto, T.; Fukuda, Y. [Research Center for Nuclear Physics, Osaka University, 10-1 Mihogaoka, Ibaraki, Osaka 567-0047 (Japan); He, J. J. [Institute of Modern Physics, Chinese Academy of Sciences, Nanchang Road 509, Lanzhou 73000 (China); Goto, A. [Faculty of Medcine, Yamagata University, Yamagata 990-2331 (Japan); Muto, H. [Center of General Education, Tokyo University of Science at Suwa, Chino, Nagano 391-0292 (Japan)

    2014-05-09

    The lecture includes two parts: One is a discussion on the technology for developing RIB beam facility based on the in-flight method and relevant experimental technology. The second part is a discussion on experimental efforts for studying the breakout process from the pp-chain region based on recent works with low energy RI beams. The discussion of the second part specifically covers the problem of the vp-process in type II supernovae in terms of alpha cluster nature for the reactions.

  8. Advancing the Theory of Nuclear Reactions with Rare Isotopes. From the Laboratory to the Cosmos

    SciTech Connect (OSTI)

    Nunes, Filomena

    2015-06-01

    The mission of the Topical Collaboration on the Theory of Reactions for Unstable iSotopes (TORUS) was to develop new methods to advance nuclear reaction theory for unstable isotopes—particularly the (d,p) reaction in which a deuteron, composed of a proton and a neutron, transfers its neutron to an unstable nucleus. After benchmarking the state-of-the-art theories, the TORUS collaboration found that there were no exact methods to study (d,p) reactions involving heavy targets; the difficulty arising from the long-range nature of the well known, yet subtle, Coulomb force. To overcome this challenge, the TORUS collaboration developed a new theory where the complexity of treating the long-range Coulomb interaction is shifted to the calculation of so-called form-factors. An efficient implementation for the computation of these form factors was a major achievement of the TORUS collaboration. All the new machinery developed are essential ingredients to analyse (d,p) reactions involving heavy nuclei relevant for astrophysics, energy production, and stockpile stewardship.

  9. 3D reconstruction of nuclear reactions using GEM TPC with planar readout

    SciTech Connect (OSTI)

    Bihałowicz, Jan Stefan

    2015-02-24

    The research program of the Extreme Light Infrastructure – Nuclear Physics (ELI-NP) laboratory under construction in Magurele, Romania facilities the need of developing a gaseous active-target detector providing 3D reconstruction of charged products of nuclear reactions induced by gamma beam. The monoenergetic, high-energy (E{sub γ} > 19 MeV) gamma beam of intensity 10{sup 13}γ/s allows studying nuclear reactions in astrophysics. A Time Projection Chamber with crossed strip readout (eTPC) is proposed as one of the imaging detectors. The special feature of the readout electrode structure is a 2D reconstruction based on the information read out simultaneously from three arrays of strips that form virtual pixels. It is expected to reach similar spatial resolution as for pixel readout at largely reduced cost of electronics. The paper presents the current progress and first results of the small scale prototype TPC which is a one of implementation steps towards eTPC detector proposed in the Technical Design Report of Charged Particles Detection at ELI-NP.

  10. The Trojan Horse method for nuclear astrophysics: Recent results on resonance reactions

    SciTech Connect (OSTI)

    Cognata, M. La; Pizzone, R. G.; Spitaleri, C.; Cherubini, S.; Romano, S.; Gulino, M.; Tumino, A.; Lamia, L.

    2014-05-09

    Nuclear astrophysics aims to measure nuclear-reaction cross sections of astrophysical interest to be included into models to study stellar evolution and nucleosynthesis. Low energies, < 1 MeV or even < 10 keV, are requested for this is the window where these processes are more effective. Two effects have prevented to achieve a satisfactory knowledge of the relevant nuclear processes, namely, the Coulomb barrier exponentially suppressing the cross section and the presence of atomic electrons. These difficulties have triggered theoretical and experimental investigations to extend our knowledge down to astrophysical energies. For instance, indirect techniques such as the Trojan Horse Method have been devised yielding new cutting-edge results. In particular, I will focus on the application of this indirect method to resonance reactions. Resonances might dramatically enhance the astrophysical S(E)-factor so, when they occur right at astrophysical energies, their measurement is crucial to pin down the astrophysical scenario. Unknown or unpredicted resonances might introduce large systematic errors in nucleosynthesis models. These considerations apply to low-energy resonances and to sub-threshold resonances as well, as they may produce sizable modifications of the S-factor due to, for instance, destructive interference with another resonance.

  11. Nuclear Reactions X-Sections By Evaporation Model, Gamma-Cascades

    Energy Science and Technology Software Center (OSTI)

    2000-06-27

    Calculation of energy-averaged cross sections for nuclear reactions with emission of particles and gamma rays and fission. The models employed are the evaporation model with inclusion of pre-equilibrium decay and gamma ray cascade model. Angular momentum and parity conservation are accounted for. Major improvement to the 1976 STAPRE program (NEA 0461) relates to level density approach, implemwnted in subroutine ZSTDE. Generalized superfluid model is incorporated, Boltzman-gas modelling of intrinsic state density and semi-empirical modelling ofmore » a few quasiparticle effects in total level density in equilibrium and saddle deformations of actinide nuclei.« less

  12. COMMENTS ON "A NEW LOOK AT LOW-ENERGY NUCLEAR REACTION RESEARCH"

    SciTech Connect (OSTI)

    Shanahan, K.

    2009-12-30

    Cold fusion researchers have accumulated a large body of anomalous results over the last 20 years that they claim proves a new, mysterious nuclear reaction is active in systems they study. Krivit and Marwan give a brief and wholly positive view of this body of research. Unfortunately, cold fusion researchers routinely ignore conventional explanations of their observations, and claim much greater than real accuracy and precision for their techniques. This paper attempts to equally briefly address those aspects of the field with the intent of providing a balanced view of the field, and to establish some criteria for subsequent publications in this arena.

  13. Applications of nuclear reaction analysis to metal hydride film characterization at the GEND 200 KeV accelerator facility

    SciTech Connect (OSTI)

    Malbrough, D.J.; Becker, R.H.

    1985-01-01

    Nuclear reaction analysis (NRA) is a quantitative analytical technique that usually involves the use of MeV ion beams and resonant nuclear reactions to non-destructively probe materials for elemental content and depth profiles. Low energy, non-resonant nuclear reactions can also be exploited for NRA and procedures have been developed for using the GEND 200-KeV accelerator to characterize neutron generator components by that technique. The procedures involve the detection and analysis of fusion reaction products generated by the interactions of deuteron beams with light elements in metal hydride films. A description of the accelerator system is presented along with some of the unique NRA procedures that have recently been developed for its use. The system is used to measure neutron output efficiencies of metal deuterides and tritides by the associated particle technique (APT) and accurate neutron yield measurements have been made for a number of materials for which data was formerly not available.

  14. Compact Detection System for High Sensitivity Hydrogen Profiling of Materials by Nuclear Reaction Analysis

    SciTech Connect (OSTI)

    Marble, Daniel Keith; Urban, Ben; Pacheco, Jose

    2009-03-10

    Hydrogen is a ubiquitous contaminant that is known to have dramatic effects on the electrical, chemical, and mechanical properties of many types of materials in even minute quantities. Thus, the detection of hydrogen in materials is of major importance. Nuclear Reaction Analysis (NRA) is a powerful technique for nondestructive profiling hydrogen in materials. However, NRA has found only limited use in many applications because of poor sensitivity due to cosmic ray background (CSRB). Most attempts to eliminate CSRB to achieve ppm detection levels using higher energy nuclear reactions or tons of passive shielding are not compatible with commercial ion beam analysis space and equipment requirements Zimmerman, et al. have previously reported upon a coincidence detector that meets IBA space requirements and reduces the cosmic ray background, but the detector suffers from lower detection efficiency and small sample size. We have replaced the BGO well detector in the Zimmerman coincidence detection scheme with a larger Nal well detector and used faster timing electronics to produce a detector that can handle larger samples with higher detection efficiency, and still eliminate cosmic ray background.

  15. Nucleus-nucleus total reaction cross sections, and the nuclear interaction radius

    SciTech Connect (OSTI)

    Abu-Ibrahim, Badawy

    2011-04-15

    We study the nucleus-nucleus total reaction cross sections for stable nuclei, in the energy region from 30A MeV to about 1A GeV, and find them to be in proportion to ({radical}({sigma}{sub pp}{sup tot}Z{sub 1}{sup 2/3}+{sigma}{sub pn}{sup tot}N{sub 1}{sup 2/3})+{radical}({sigma}{sub pp}{sup tot}Z{sub 2}{sup 2/3}+{sigma}{sub pn}{sup tot}N{sub 2}{sup 2/3})) {sup 2} in the mass range 8 to 100. Also, we find a parameter-free relation that enables us to predict a total reaction cross section for any nucleus-nucleus within 10% uncertainty at most, using the experimental value of the total reaction cross section of a given nucleus-nucleus. The power of the relation is demonstrated by several examples. The energy dependence of the nuclear interaction radius is deduced; it is found to be almost constant in the energy range from about 200A MeV to about 1A GeV; in this energy range and for nuclei with N=Z, R{sub I}(A)=(1.14{+-}0.02)A{sup 1/3} fm.

  16. STARLIB: A NEXT-GENERATION REACTION-RATE LIBRARY FOR NUCLEAR ASTROPHYSICS

    SciTech Connect (OSTI)

    Sallaska, A. L.; Iliadis, C.; Champange, A. E.; Goriely, S.; Starrfield, S.; Timmes, F. X.

    2013-07-15

    STARLIB is a next-generation, all-purpose nuclear reaction-rate library. For the first time, this library provides the rate probability density at all temperature grid points for convenient implementation in models of stellar phenomena. The recommended rate and its associated uncertainties are also included. Currently, uncertainties are absent from all other rate libraries, and, although estimates have been attempted in previous evaluations and compilations, these are generally not based on rigorous statistical definitions. A common standard for deriving uncertainties is clearly warranted. STARLIB represents a first step in addressing this deficiency by providing a tabular, up-to-date database that supplies not only the rate and its uncertainty but also its distribution. Because a majority of rates are lognormally distributed, this allows the construction of rate probability densities from the columns of STARLIB. This structure is based on a recently suggested Monte Carlo method to calculate reaction rates, where uncertainties are rigorously defined. In STARLIB, experimental rates are supplemented with: (1) theoretical TALYS rates for reactions for which no experimental input is available, and (2) laboratory and theoretical weak rates. STARLIB includes all types of reactions of astrophysical interest to Z = 83, such as (p, {gamma}), (p, {alpha}), ({alpha}, n), and corresponding reverse rates. Strong rates account for thermal target excitations. Here, we summarize our Monte Carlo formalism, introduce the library, compare methods of correcting rates for stellar environments, and discuss how to implement our library in Monte Carlo nucleosynthesis studies. We also present a method for accessing STARLIB on the Internet and outline updated Monte Carlo-based rates.

  17. Supporting Technology for Chain of Custody of Nuclear Weapons and Materials throughout the Dismantlement and Disposition Processes

    SciTech Connect (OSTI)

    Bunch, Kyle J.; Jones, Anthony M.; Ramuhalli, Pradeep; Benz, Jacob M.; Denlinger, Laura Schmidt

    2014-05-04

    The ratification and ongoing implementation of the New START Treaty have been widely regarded as noteworthy global security achievements for both the Obama Administration and the Putin (formerly Medvedev) regime. But deeper cuts that move beyond the United States and Russia to engage the P-5 and other nuclear weapons possessor states are envisioned under future arms control regimes, and are indeed required for the P-5 in accordance with their Article VI disarmament obligations in the Nuclear Non-Proliferation Treaty. Future verification needs will include monitoring the cessation of production of new fissile material for weapons, monitoring storage of warhead components and fissile materials and verifying dismantlement of warheads, pits, secondary stages, and other materials. A fundamental challenge to implementing a nuclear disarmament regime is the ability to thwart unauthorized material diversion throughout the dismantlement and disposition process through strong chain of custody implementation. Verifying the declared presence, or absence, of nuclear materials and weapons components throughout the dismantlement and disposition lifecycle is a critical aspect of the disarmament process. From both the diplomatic and technical perspectives, verification under these future arms control regimes will require new solutions. Since any acceptable verification technology must protect sensitive design information and attributes to prevent the release of classified or other proliferation-sensitive information, non-nuclear non-sensitive modalities may provide significant new verification tools which do not require the use of additional information barriers. Alternative verification technologies based upon electromagnetic and acoustics could potentially play an important role in fulfilling the challenging requirements of future verification regimes. For example, researchers at the Pacific Northwest National Laboratory (PNNL) have demonstrated that low frequency electromagnetic

  18. Nuclear Reaction Cross Sections Database at BNL | U.S. DOE Office...

    Office of Science (SC) Website

    by: DOE-NP, Nuclear Regulatory Commission, DOE-NNSA, Nuclear Industry Impactbenefit to spin-off field: Applications in nuclear energy, national security, radiation protection. ...

  19. Code System to Calculate Nuclear Reaction Cross Sections by Evaporation Model.

    Energy Science and Technology Software Center (OSTI)

    2000-11-27

    Version: 00 Both STAPRE and STAPREF are included in this package. STAPRE calculates energy-averaged cross sections for nuclear reactions with emission of particles and gamma rays and fission. The models employed are the evaporation model with inclusion of pre-equilibrium decay and a gamma-ray cascade model. Angular momentum and parity conservation are accounted for. Major improvement in the 1976 STAPRE program relates to level density approach, implemented in subroutine ZSTDE. Generalized superfluid model is incorporated, boltzman-gasmore » modeling of intrinsic state density and semi-empirical modeling of a few-quasiparticle effects in total level density at equilibrium and saddle deformations of actinide nuclei. In addition to the activation cross sections, particle and gamma-ray production spectra are calculated. Isomeric state populations and production cross sections for gamma rays from low excited levels are obtained, too. For fission a single or a double humped barrier may be chosen.« less

  20. Advancing the Theory of Nuclear Reactions with Rare Isotopes: From the Laboratory to the Cosmos

    SciTech Connect (OSTI)

    Zhanov, Akram

    2015-08-30

    The Main goal of my research is to develop indirect methods, which allows one to connect the reactions measured in the labs with astrophysical reactions.

  1. Application of evolved gas analysis to cold-cap reactions of melter feeds for nuclear waste vitrification

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Rodriguez, Carmen P.; Chun, Jaehun; Schweiger, Michael J.; Kruger, Albert A.; Hrma, Pavel

    2014-09-01

    In the vitrification of nuclear wastes, the melter feed (a mixture of nuclear waste and glass forming and modifying additives) experiences multiple gas-evolving reactions in an electrical glass-melting furnace. Foams from the residual gases can significantly alter the melting rate through mass and heat transfers. We employed the thermogravimetry-gas chromatography-mass spectrometry (TGA-GC-MS) combination to perform quantitative evolved gas analysis (EGA) and developed a simple calibration model which correlates the overall mass loss rate with the evolution rates for individual gases. The model parameters are obtained from the least squares analysis, assuming that the gas-evolving reactions are independent. Thus, the EGAmore » adds the ‘chemical identity’ to the reactions indicated by the ‘phenomenological’ kinetic model.« less

  2. Investigations of nuclear structure and nuclear reactions induced by complex projectiles. Progress report for the period September 1, 1992--August 31, 1993

    SciTech Connect (OSTI)

    Sarantites, D.G.

    1993-09-06

    This is a progress report on activities of the Washington University group in nuclear reaction studies for the period Sept 1, 1992 to Aug 31, 1993. This group has a research program which touches five areas of nuclear physics: nuclear structure studies at high spin; studies at the interface between structure and reactions; production and study of hot nuclei; reaction mechanism studies; development and use of novel techniques and instrumentation in the above areas of research. Specific activities of the group include in part: superdeformation in {sup 82}Sr; structure of and identical bands in {sup 182}Hg and {sup 178}Pt; a highly deformed band in {sup 136}Pm; particle decay of the {sup 164}Yb compound nucleus; fusion reactions; proton evaporation; two-proton decay of {sup 12}O; modeling and theoretical studies; excited {sup 16}O disassembly into four alpha particles; {sup 209}Bi + {sup 136}Xe collisions at 28.2 MeV/amu; and development work on 4{pi} solid angle gamma detectors, and x-ray detectors.

  3. Modeled Neutron and Charged-Particle Induced Nuclear Reaction Cross Sections for Radiochemistry in the Region of Yttrium, Zirconium, Niobium, and Molybdenum

    SciTech Connect (OSTI)

    Hoffman, R D; Kelley, K; Dietrich, F S; Bauer, R; Mustafa, M G

    2006-06-13

    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron, proton, and deuteron induced nuclear reaction cross sections for targets ranging from strontium (Z = 38) to rhodium (Z = 45).

  4. Melter Feed Reactions at T ≤ 700°C for Nuclear Waste Vitrification

    SciTech Connect (OSTI)

    Xu, Kai; Hrma, Pavel R.; Rice, Jarrett A.; Riley, Brian J.; Schweiger, Michael J.; Crum, Jarrod V.

    2015-07-23

    Batch reactions and phase transitions in a nuclear waste feed heated at 5 K min-1 up to 600°C were investigated by optical microscopy, scanning electron microscopy with energy dispersive X-ray spectrometer, and X-ray diffraction. Quenched samples were leached in deionized water at room temperature and 80°C to extract soluble salts and early glass-forming melt, respectively. To determine the content and composition of leachable phases, the leachates were analyzed by the inductively-coupled plasma spectroscopy. By ~400°C, gibbsite and borax lost water and converted to amorphous and intermediate crystalline phases. Between 400°C and 600°C, the sodium borate early glass-forming melt reacted with amorphous aluminum oxide and calcium oxide to form intermediate products containing Al and Ca. At ~600°C, half Na and B converted to the early glass-forming melt, and quartz began to dissolve in the melt.

  5. The effect of nuclear reaction rates and convective mixing on the evolution of a 6M{sub ?} star

    SciTech Connect (OSTI)

    Halabi, Ghina M.

    2014-05-09

    We present the evolution of a 6M{sub ?} star, of solar-like initial metallicity, and investigate the effects of key nuclear reaction rates, as well as the treatment of the convective mixing on its evolution along the Cepheid instability strip. In particular, we study the effect of recent estimates of the {sup 14}N(p,?){sup 15}O reaction on the formation and extension of the blue loop during core helium burning. We also investigate the effects induced on this blue loop by the adoption of non-standard convective mixing prescriptions, as well as the implications of modifying the Mixing Length Theory.

  6. Computer experiments concerning palladium-deuterium and titanium-deuterium lattices - implications to phenomenon of low-energy nuclear reaction

    SciTech Connect (OSTI)

    Rao, K.R.; Chaplot, S.L.

    1996-12-01

    Short-lived large energy fluctuations (SLEFs) in solids, proposed by Khait, are known to be responsible for several anomalous properties in a variety of materials. The study of SLEFs in palladium-deuterium and titanium-deuterium lattices via computer experiments is reported. The relevance of these large energy fluctuations in penetrating coulombic barriers in these systems is discussed. Such dynamical effects arising from the phonon bath in solids may enhance nuclear reaction probabilities leading to cold fusion. Expected cold fusion reaction rates are reported taking into account the effective charges of the deuterium atoms in the solid and SLEF frequencies. 25 refs., 7 figs., 1 tab.

  7. Fission-Fusion: A new reaction mechanism for nuclear astrophysics based on laser-ion acceleration

    SciTech Connect (OSTI)

    Thirolf, P. G.; Gross, M.; Allinger, K.; Bin, J.; Henig, A.; Kiefer, D.; Habs, D.; Ma, W.; Schreiber, J.

    2011-10-28

    We propose to produce neutron-rich nuclei in the range of the astrophysical r-process around the waiting point N = 126 by fissioning a dense laser-accelerated thorium ion bunch in a thorium target (covered by a CH{sub 2} layer), where the light fission fragments of the beam fuse with the light fission fragments of the target. Via the 'hole-boring' mode of laser Radiation Pressure Acceleration using a high-intensity, short pulse laser, very efficiently bunches of {sup 232}Th with solid-state density can be generated from a Th target and a deuterated CD{sub 2} foil, both forming the production target assembly. Laser-accelerated Th ions with about 7 MeV/u will pass through a thin CH{sub 2} layer placed in front of a thicker second Th foil (both forming the reaction target) closely behind the production target and disintegrate into light and heavy fission fragments. In addition, light ions (d,C) from the CD{sub 2} layer of the production target will be accelerated as well, inducing the fission process of {sup 232}Th also in the second Th layer. The laser-accelerated ion bunches with solid-state density, which are about 10{sup 14} times more dense than classically accelerated ion bunches, allow for a high probability that generated fission products can fuse again. The high ion beam density may lead to a strong collective modification of the stopping power, leading to significant range and thus yield enhancement. Using a high-intensity laser as envisaged for the ELI-Nuclear Physics project in Bucharest (ELI-NP), order-of-magnitude estimates promise a fusion yield of about 10{sup 3} ions per laser pulse in the mass range of A = 180-190, thus enabling to approach the r-process waiting point at N = 126.

  8. Following the Transient Reactions in Lithium-Sulfur Batteries Using In an In Situ Nuclear Magnetic Resonance Technique

    SciTech Connect (OSTI)

    Xiao, Jie; Hu, Jian Z.; Chen, Honghao; Vijayakumar, M.; Zheng, Jianming; Pan, Huilin; Walter, Eric D.; Hu, Mary Y.; Deng, Xuchu; Feng, Ju; Liaw, Bor Yann; Gu, Meng; Deng, Zhiqun; Lu, Dongping; Xu, Suochang; Wang, Chong M.; Liu, Jun

    2015-05-13

    Li-S batteries hold great potential for next-generation, large-format power source applications; yet, the fundamental understanding of the electrochemical reaction pathways remains lacking to enable their functionality as promised. Here, in situ NMR technique employing a specially designed cylindrical micro battery was used to monitor the chemical environments around Li+ ions during repetitive charge-discharge process and track the transient electrochemical and chemical reactions occurring in the whole Li-S system. The in situ NMR provides real time, quantitative information related to the temporal concentration variations of the polysulfides with various chain lengths, providing important clues for the reaction pathways during both discharge and charge processes. The in-situ technique also reveals that redox reactions may involve transient species that are difficult to detect in ex-situ NMR study. Intermediate species such as charged free radicals may play an important role in the formation of the polysulfide products. Additionally, in situ NMR measurement simultaneously reveals vital information on the 7Li chemical environments in the electrochemical and parasitic reactions on the lithium anode that promotes the understanding of the failure mechanism in the Li-S system. These new insights could help design effective strategies to accelerate the development of Li-S battery technology.

  9. TORUS: Theory of Reactions for Unstable iSotopes.Topical Collaboration for Nuclear Theory Project. Period: June 1, 2010 - May 31, 2015

    SciTech Connect (OSTI)

    Arbanas, Goran; Elster, Charlotte; Escher, Jutta; Nunes, Filomena; Thompson, Ian

    2015-08-28

    The work of this collaboration during its existence is summarized. The mission of the TORUS Topical Collaboration was to develop new methods that advance nuclear reaction theory for unstable isotopes by using three-body techniques to improve direct reaction calculations. This multi-institution collaborative effort was and remains directly relevant to three areas of interest: the properties of nuclei far from stability, microscopic studies of nuclear input parameters for astrophysics, and microscopic nuclear reaction theory. The TORUS project focused on understanding the details of (d,p) reactions for neutron transfer to heavier nuclei. The bulk of the work fell into three areas: coupled channel theory, modeling (d,p) reactions with a Faddeev-AGS approach, and capture reactions.

  10. Selected spectroscopic results on element 115 decay chains

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Rudolph, D.; Forsberg, U.; Golubev, P.; Sarmiento, L. G.; Yakushev, A.; Andersson, L. -L.; Di Nitto, A.; Düllmann, Ch. E.; Gates, J. M.; Gregorich, K. E.; et al

    2014-08-24

    We observed thirty correlated α-decay chains in an experiment studying the fusion-evaporation reaction 48Ca + 243Am at the GSI Helmholtzzentrum fur Schwerionenforschung. The decay characteristics of the majority of these 30 chains are consistent with previous observations and interpretations of such chains to originate from isotopes of element Z = 115. High-resolution α-photon coincidence spectroscopy in conjunction with comprehensive Monte-Carlo simulations allow to propose excitation schemes of atomic nuclei of the heaviest elements, thereby probing nuclear structure models near the 'Island of Stability' with unprecedented experimental precision.

  11. Selected spectroscopic results on element 115 decay chains

    SciTech Connect (OSTI)

    Rudolph, D.; Forsberg, U.; Golubev, P.; Sarmiento, L. G.; Yakushev, A.; Andersson, L. -L.; Di Nitto, A.; Düllmann, Ch. E.; Gates, J. M.; Gregorich, K. E.; Gross, C. J.; Herzberg, R. -D.; Heßberger, F. P.; Khuyagbaatar, J.; Kratz, J. V.; Rykaczewski, K.; Schädel, M.; Åberg, S.; Ackermann, D.; Block, M.; Brand, H.; Carlsson, B. G.; Cox, D.; Derkx, X.; Eberhardt, K.; Even, J.; Fahlander, C.; Gerl, J.; Jäger, E.; Kindler, B.; Krier, J.; Kojouharov, I.; Kurz, N.; Lommel, B.; Mistry, A.; Mokry, C.; Nitsche, H.; Omtvedt, J. P.; Papadakis, P.; Ragnarsson, I.; Runke, J.; Schaffner, H.; Schausten, B.; Thörle-Pospiech, P.; Torres, T.; Traut, T.; Trautmann, N.; Türler, A.; Ward, A.; Ward, D. E.; Wiehl, N.

    2014-08-24

    We observed thirty correlated α-decay chains in an experiment studying the fusion-evaporation reaction 48Ca + 243Am at the GSI Helmholtzzentrum fur Schwerionenforschung. The decay characteristics of the majority of these 30 chains are consistent with previous observations and interpretations of such chains to originate from isotopes of element Z = 115. High-resolution α-photon coincidence spectroscopy in conjunction with comprehensive Monte-Carlo simulations allow to propose excitation schemes of atomic nuclei of the heaviest elements, thereby probing nuclear structure models near the 'Island of Stability' with unprecedented experimental precision.

  12. Interacting-boson-approximation study on the nuclear structural factor in double-charge-exchange reactions

    SciTech Connect (OSTI)

    Wu, H.; Wang, R.; Liu, Y.; Zhao, E. , P.O. Box 8730, Beijing Physics Department, Suzhou University, Suzhou Institute of High Energy Physics, Academia Sinica, Beijing Institute of Theoretical Physics, Academia Sinica, Beijing )

    1992-04-01

    The double-charge-exchange (DCX) reaction with Ca isotopes as targets is studied by employing the interacting-boson approximation (IBA). A comparison between the IBA and the shell-model results shows that IBA is a good approximation of the shell model in describing the DCX reactions.

  13. CP-1 Anniversary: Nuclear Pioneers Remember the Dawn of the Nuclear Age |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Argonne National Laboratory Anniversary: Nuclear Pioneers Remember the Dawn of the Nuclear Age Share Topic Energy Energy sources Nuclear energy On December 2, 1942, 49 scientists, led by Enrico Fermi, made history when Chicago Pile 1 went critical and produced the world's first self-sustaining, controlled nuclear chain reaction. Seventy years later, two of the last surviving CP-1 pioneers, Harold Agnew and Warren Nyer, recall that historic day

  14. Mass chain evaluations for the evaluated nuclear structure data file (ENSDF) - an urgent appeal for European participation.

    SciTech Connect (OSTI)

    Kondev, F. G.; Nichols, A. L.; Tuli, J. K.; Nuclear Engineering Division; International Atomic Energy Agency; BNL

    2007-01-01

    Reliable nuclear structure and decay data represent the fundamental building blocks of nuclear physics and astrophysics research, and are also of vital importance in a significant number of applied nuclear fields such as power generation and associated fuel cycle operations (e.g., fuel manufacture, transport, reprocessing, and waste management), materials analysis, medical diagnosis, and radiotherapy. There is a continuous demand for good quality data formulated and recommended through the speedy assessment and incorporation of new and improved measurements.

  15. Disassembly of hot nuclear matter formed in Au-induced reactions near the Fermi energy

    SciTech Connect (OSTI)

    Delis, D.N.

    1993-09-01

    Complex fragment emission has been studied in the 60 MeV/A {sup 197}Au + {sup 12}C, {sup 27}Al, {sup 51}V, {sup nat}Cu, and {sup 197}Au reactions. Velocity spectra, angular distributions and cross sections have been constructed for each target from the inclusive data. Coincidence data including 2-, 3-, 4-, and 5-fold events have also been examined. Furthermore neutron multiplicity distributions have been obtained for the above reactions by utilizing a novel neutron calorimetric approach.

  16. Flow cytometric detection of human immunodeficiency virus type 1 proviral DNA by the polymerase chain reaction incorporating digoxigenin- or fluorescein-labeled dUTP

    SciTech Connect (OSTI)

    Yang, Gang; Olson, J.C.; Pu, R.; Vyas, G.N.

    1995-10-01

    Serological assays are routinely used in the laboratory diagnosis of human immunodeficiency virus type-1 (HrV-1) infection, but the polymerase chain reaction (PCR) is ultimately the most sensitive and direct method for establishing definitive diagnosis. As an alternative to the conventional radioactive PCR procedure we have developed and evaluated a pair of rapid nonradioisotopic flow cytometric detection methods. Using heminested PCR we directly incorporated fluorescein-12-dUTP (fluo-dUTP) or digoxigenin-11-dUTP (dig-dUTP) into the PCR-amplicons. The labeled amplicons were hybridized with biotinylated antisense and sense probes, followed by capture of the hybrid DNA using streptavidin-coated beads which were finally analyzed in a flow cytometer by (1) direct detection of the fluorescence intensity of the amplicons incorporating fluo-dUTP and (2) immunodetection of the amplicons incorporating dig-dUTP by anti-digoxigenin IgG labeled with fluorescein isothiocyanate (FITC). Although both assays were functionally comparable with radiolabeled probe in reliably detecting as low as five copies of HIV-1 proviral DNA sequences, the immunodetection of dig-dUTP consistently yielded higher mean channel fluorescence and gave a stable signal over an extended period of 12-14 weeks. In testing a panel of 20 pedigreed PBMC specimens from blood donors with or without HIV-1 infection, the results of both flow cytometric assays were identical with those of the conventional radioactive procedure. Therefore, we conclude that the dig-dUTP incorporation in amplicons, hybridization with a pair of sense-antisense biotinylated probes and immunodetection of hybrids by flow cytometric analyses is the nonisotopic method of choice for PCR-diagnosis of HIV-1 infection. 21 refs., 2 figs., 4 tabs.

  17. The Trojan Horse method for nuclear astrophysics: Recent results for direct reactions

    SciTech Connect (OSTI)

    Tumino, A.; Gulino, M.; Spitaleri, C.; Cherubini, S.; Romano, S.; Cognata, M. La; Pizzone, R. G.; Rapisarda, G. G.; Lamia, L.

    2014-05-09

    The Trojan Horse method is a powerful indirect technique to determine the astrophysical factor for binary rearrangement processes A+x→b+B at astrophysical energies by measuring the cross section for the Trojan Horse (TH) reaction A+a→B+b+s in quasi free kinematics. The Trojan Horse Method has been successfully applied to many reactions of astrophysical interest, both direct and resonant. In this paper, we will focus on direct sub-processes. The theory of the THM for direct binary reactions will be shortly presented based on a few-body approach that takes into account the off-energy-shell effects and initial and final state interactions. Examples of recent results will be presented to demonstrate how THM works experimentally.

  18. Positronium formation as a three-body reaction. II. The second-order nuclear amplitudes

    SciTech Connect (OSTI)

    Shojaei, F.; Bolorizadeh, M. A.; Ghanbari-Adivi, E.; Brunger, M. J.

    2009-01-15

    We derive an exact analytic form for the second-order nuclear amplitudes, under the Faddeev three-body approach, which is applicable to the nonrelativistic high energy impact interaction where positronium is formed in the collision of a positron with an atom.

  19. On the nonstationary quantum-mechanical origin of nuclear reactions in solids

    SciTech Connect (OSTI)

    Chechin, V.A.; Tsarev, V.A. )

    1994-07-01

    A model for deuteron reactions in solids is suggested in which an increase in the penetrability of the Coulomb barrier is attributed to a quantum-mechanical perturbation of the wave function caused by nonstationary deuterons in a crystalline lattice. 15 refs.

  20. Nuclear reactors and the nuclear fuel cycle

    SciTech Connect (OSTI)

    Pearlman, H

    1989-11-01

    According to the author, the first sustained nuclear fission chain reaction was not at the University of Chicago, but at the Oklo site in the African country of Gabon. Proof of this phenomenon is provided by mass spectrometric and analytical chemical measurements by French scientists. The U.S. experience in developing power-producing reactors and their related fuel and fuel cycles is discussed.

  1. Sensitivity of the blue loops of intermediate-mass stars to nuclear reactions

    SciTech Connect (OSTI)

    Halabi, Ghina M.; El Eid, Mounib

    2012-11-20

    We investigate the effects of a modification of the {sup 14}N(p,{gamma}){sup 15}O reaction rate, as suggested by recent evaluations, on the formation and extension of the blue loops encountered during the evolution of the stars in the mass range 5M{sub Circled-Dot-Operator} to 12M{sub Circled-Dot-Operator }. We show that the blue loops of stars in the mass range 5M{sub Circled-Dot-Operator} to 8M{sub Circled-Dot-Operator }, that is the range of super ABG stars, are severely affected by a modification of the important {sup 14}N(p,{gamma}){sup 15}O reaction rate. We also show that the blue loops can be restored if envelope overshooting is included, which is necessary to explain the observations of the Cepheid stars.

  2. Coulomb reacceleration as a clock for nuclear reactions: A two-dimensional model

    SciTech Connect (OSTI)

    Bertulani, C.A. ); Bertsch, G.F. )

    1994-05-01

    Reacceleration effects in the Coulomb breakup of nuclei are modeled with the two-dimensional time-dependent Schroedinger equation, extending a previous one-dimensional study. The present model better describes the individual contributions of longitudinal and transverse forces to the breakup and reacceleration. Reacceleration effects are found to preserve a strong memory of the pre-breakup phase of the reaction, as was concluded with the one-dimensional model.

  3. U.S. Department of Energy Office of Nuclear Energy, Science and Technology

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    One the cover: Albert Einstein (1879-1955) U.S. Department of Energy Office of Nuclear Energy, Science and Technology Washington, D.C. 20585 The History of Nuclear Energy Table of Contents Preface ................................................................... 1 Introduction .......................................................... 3 The Discovery of Fission ...................................... 4 The First Self-Sustaining Chain Reaction ............ 5 The Development of Nuclear Energy for

  4. Russian Military and Security Forces: A Postulated Reaction to a Nuclear Detonation

    SciTech Connect (OSTI)

    Ball, D

    2005-04-29

    In this paper, we will examine how Russia's military and security forces might react to the detonation of a 10-kiloton nuclear weapon placed next to the walls surrounding the Kremlin. At the time of this 'big bang,' Putin is situated outside Moscow and survives the explosion. No one claims responsibility for the detonation. No other information is known. Numerous variables will determine how events ultimately unfold and how the military and security forces will respond. Prior to examining these variables in greater detail, it is imperative to elucidate first what we mean by Russia's military and security forces.

  5. Theoretical nuclear reaction and structure studies using hyperons and photons. Final report

    SciTech Connect (OSTI)

    Cotanch, S.R.

    1998-12-31

    This report details research progress and results obtained during the ten period from June 1, 1988 through May 31, 1998. In compliance with grant requirements the Principal Investigator, Professor Stephen R. Cotanch, has conducted a research program addressing theoretical investigations of reactions involving hyperons and photons. The Principal Investigator has devoted to this program 50% of his time during the academic year and 100% of this time in the summer. Highlights of significant research results are briefly summarized in this report which respectively correspond to the three sub-programs of this project.

  6. Nuclear reaction analysis for H, Li, Be, B, C, N, O and F with an RBS check

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Lanford, W. A.; Parenti, M.; Nordell, B. J.; Paquette, M. M.; Caruso, A. N.; Mäntymäki, M.; Hämäläinen, J.; Ritala, M.; Klepper, K. B.; Miikkulainen, V.; et al

    2015-11-12

    In this paper, 15N nuclear reaction analysis (NRA) for H is combined with 1.2 MeV deuteron (D) NRA which provides a simultaneous analysis for Li, Be, B, C, N, O and F. The energy dependence of the D NRA has been measured and used to correct for the D energy loss in film being analyzed. A 2 MeV He RBS measurement is made. Film composition is determined by a self-consistent analysis of the light element NRA data combined with an RBS analysis for heavy elements. This composition is used to simulate, with no adjustable parameters, the complete RBS spectrum. Finally,more » comparison of this simulated RBS spectrum with the measured spectrum provides a powerful check of the analysis.« less

  7. The ({sup 18}O, {sup 16}O) reaction as a probe for nuclear spectroscopy

    SciTech Connect (OSTI)

    Cappuzzello, F.; Bond, M.; Nicolosi, D.; Tropea, S.; Agodi, A.; Carbone, D.; Cavallaro, M.; Cunsolo, A.; Borello-Lewin, T.; Rodrigues, M. R. D.; De Napoli, M.; Linares, R.

    2014-11-11

    The response of nuclei to the ({sup 18}O, {sup 16}O) two-neutron transfer reaction at 84 MeV incident energy has been systematically studied at the Catania INFN-LNS laboratory. The experiments were performed using several solid targets from light ({sup 9}Be, {sup 11}B, {sup 12,13}C, {sup 16}O, {sup 28}Si) to heavy ones ({sup 58,64}Ni, {sup 120}Sn, {sup 208}Pb). The {sup 16}O ejectiles were detected at forward angles by the MAGNEX magnetic spectrometer. Exploiting the large momentum acceptance (?10%, +14%) and solid angle (50 msr) of the spectrometer, energy spectra were obtained with a relevant yield up to about 20 MeV excitation energy. The application of the powerful trajectory reconstruction technique did allow to get energy spectra with energy resolution of about 150 keV and angular distributions with angular resolution better than 0.3. A common feature observed with light nuclei is the appearance of unknown resonant structures at high excitation energy. The strong population of these latter together with the measured width can reveal the excitation of a collective mode connected with the transfer of a pair.

  8. The series of carbon-chain complexes {Ru(dppe)Cp*}?{?-(C?C)x} (x = 48, 11): Synthesis, structures, properties and some reactions

    SciTech Connect (OSTI)

    Bruce, Michael I.; Cole, Marcus L.; Ellis, Benjamin G.; Gaudio, Maryka; Nicholson, Brian K.; Parker, Christian R.; Skelton, Brian W.; White, Allan H.

    2015-01-28

    The construction of a series of compounds {Ru(dppe)Cp*}2(?-C2x) (Ru*-C2x-Ru*, x = 48, 11)) is described. A direct reaction between RuCl(dppe)Cp* and Me3Si(Ctriple bond; length of mdashC)4SiMe3 afforded Ru*-C8-Ru* in 89% yield. The Pd(0)/Cu(I)-catalysed coupling of Ru{Ctriple bond; length of mdashCCtriple bond; length of mdashCAu(PPh3)}(dppe)Cp*Ru*-C4-Au (2 equiv.) with diiodoethyne gave Ru*-C10-Ru* (64%), or of 1 equiv. with I(Ctriple bond; length of mdashC)3I gave Ru*-C14-Ru* (36%); similarly, Ru{(Ctriple bond; length of mdashC)4Au(PPh3)}(dppe)Cp*Ru*-C8-Au and I(Ctriple bond; length of mdashC)3I gave Ru*-C22-Ru* (12%). Desilylation (TBAF) of Ru{(Ctriple bond; length of mdashC)xSiMe3}(dppe)Cp*Ru*-C2x-Si (x = 3, 4) followed by oxidative coupling [Cu(OAc)2/py] gave Ru*-C12-Ru* (82%) and Ru*-C16-Ru* (58%), respectively. Similar oxidative coupling of Ru(Ctriple bond; length of mdashCCtriple bond; length of mdashCH)(dppe)Cp* was a second route to Ru*-C8-Ru* (82%). Appropriate precursors are already known, or obtained by coupling of Ru*-C2x-Si (x = 2, 4) with AuCl(PPh3)/NaOMe [Ru*-C4-Au, 95%; Ru*-C8-Au, 74%] or from Pd(0)/Cu(I) catalysed coupling of Ru*-C2x-Au (x = 2, 3) with I(Ctriple bond; length of mdashC)2SiMe3 (Ru*-C8-Si, 64%; Ru*-C10-Si, 2%). Reactions between Ru*-C2x-Ru* (x = 3, 4) and Fe2(CO)9 gave {Fe3(CO)9}{?3-CCtriple bond; length of mdashC[Ru(dppe)Cp*]}2Fe(C3-Ru*)2 and {Fe3(CO)9}{?3-CCtriple bond; length of mdashC[Ru(dppe)Cp*]}{?3-C(Ctriple bond; length of mdashC)2[Ru(dppe)Cp*]} Fe(C3-Ru*)(C5-Ru*), respectively. The redox properties of the series of complexes with 2x = 216 were measured and showed a diminution of the separation of

  9. METHOD OF OPERATING NUCLEAR REACTORS

    DOE Patents [OSTI]

    Untermyer, S.

    1958-10-14

    A method is presented for obtaining enhanced utilization of natural uranium in heavy water moderated nuclear reactors by charging the reactor with an equal number of fuel elements formed of natural uranium and of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction. The reactor is operated until the rate of burnup of plutonium equals its rate of production, the fuel elements are processed to recover plutonium, the depleted uranium is discarded, and the remaining uranium is formed into fuel elements. These fuel elements are charged into a reactor along with an equal number of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction, and reuse of the uranium is continued as aforesaid until it wlll no longer support a chain reaction when combined with an equal quantity of natural uranium.

  10. Solving The Long-Standing Problem Of Low-Energy Nuclear Reactions At The Highest Microscopic Level. Annual Continuation And Progress Report, August 15, 2014 -- August 14, 2015

    SciTech Connect (OSTI)

    Quaglioni, Sofia

    2015-03-19

    The aim of this project is to develop a comprehensive framework that will lead to a fundamental description of both structural properties and reactions of light nuclei in terms of constituent protons and neutrons interacting through nucleon-nucleon (NN) and three-nucleon (3N) forces. This project will provide the research community with the theoretical and computational tools what will enable: an accurate prediction for fusion reactions that power stars and Earth-based fusion facilities; an improved description of the spectroscopy of exotic nuclei, including light Borromean systems; and, a fundamental understanding of the three-nucleon force in nuclear reaction and nuclei at the drip line.

  11. Localization of human elav-like neuronal protein 1 (Hel-N1) on chromosome 9p21 by chromosome microdissection polymerase chain reaction and fluorescence in situ hybridization

    SciTech Connect (OSTI)

    Han, Jian; Knops, J.F.; Longshore, J.W.; King, P.H.

    1996-08-15

    Hel-N1 is a member of the highly conserved elav family of neuronal genes. It shares considerable sequence homology with HuD, another human member, and both genes are expressed in brain. HuD was recently mapped to chromosome 1p34. Here, we have utilized chromosome microdissection polymerase chain reaction and fluorescence in situ hybridization to map Hel-N1 to chromosome 9p21. The different chromosomal locations of these homologous genes underscore their distinct identities. 10 refs., 2 figs.

  12. Argonne nuclear pioneers: Chicago Pile 1

    ScienceCinema (OSTI)

    Agnew, Harold; Nyer, Warren

    2013-04-19

    On December 2, 1942, 49 scientists, led by Enrico Fermi, made history when Chicago Pile 1 (CP-1) went critical and produced the world's first self-sustaining, controlled nuclear chain reaction. Seventy years later, two of the last surviving CP-1 pioneers, Harold Agnew and Warren Nyer, recall that historic day.

  13. Argonne nuclear pioneers: Chicago Pile 1

    SciTech Connect (OSTI)

    Agnew, Harold; Nyer, Warren

    2012-01-01

    On December 2, 1942, 49 scientists, led by Enrico Fermi, made history when Chicago Pile 1 (CP-1) went critical and produced the world's first self-sustaining, controlled nuclear chain reaction. Seventy years later, two of the last surviving CP-1 pioneers, Harold Agnew and Warren Nyer, recall that historic day.

  14. Tetramethyl-1-silacycloprop-2-ene: its characterization and reactions

    SciTech Connect (OSTI)

    Cornett, B.J.

    1980-05-01

    The object of this research is to fully characterize and study some of the reactions of tetramethyl-1-silacycloprop-2-ene. The final characterization of this compound was accomplished by obtaining both Si29 and 13C nuclear magnetic resonance spectra. The reactions studied included those with fluorenone, acetone, styrene, phenylacetylene, acetonitrile, t-butylcyanide, methyl isocyanate, phenyl azide, and azobenzene. Product analyses suggest that aside from addition reactions tetramethylsilacyclopropene can react either via a radical chain polymerization or an anionic chain polymerization mechanism with the latter being the more prevalent. Other reactions studied included the photolysis of tetramethylsilacyclopropene and its reactions in the presence of Pd(PPh/sub 3/)/sub 2/Cl/sub 2/. An appendix includes a study of trimethylsilyl radical disproportionation in the liquid phase to a sila olefin. Trimethylsilyl radicals in solution undergo disproportionation as well as recombination in a 1:5 ratio. The sila olefin formed by disproportionation was trapped by alcohols.

  15. Argonne's Major Nuclear Energy Milestones | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Argonne's Major Nuclear Energy Milestones Argonne's reactor tree Argonne's reactor tree December 2, 1942: Enrico Fermi's team produces the world's first sustained nuclear chain reaction. March 20, 1943: Chicago Pile 2 achieves criticality. It was CP-1, Fermi's first reactor, dismantled and reassembled at the Argonne Forest site in the Cook Country Forest Preserve. May 15, 1944: Walter Zinn starts Chicago Pile 3, the world's first heavy-water-moderated nuclear reactor, at Site A. January 31,

  16. Nuclear Science/Nuclear Chemistry

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    nuclear science nuclear chemistry Nuclear Science/Nuclear Chemistry Nuclear Physics The 10-MV tandem accelerator at CAMS provides a platform for conducting nuclear physics experiment both for basic science and lab mission-related programs. For example, we performed a new cross section measurement of the astrophysically important reaction 40Ca(a,g)44Ti in which high purity CaO targets were irradiated with helium ions at several different discrete energies. The reaction rate was measured on-line

  17. Coupled-channels density-matrix approach to low-energy nuclear collision dynamics: A technique for quantifying quantum decoherence effects on reaction observables

    SciTech Connect (OSTI)

    Diaz-Torres, Alexis

    2010-11-15

    The coupled-channels density-matrix technique for nuclear reaction dynamics, which is based on the Liouville-von Neumann equation with Lindblad dissipative terms, is developed with the inclusion of full angular momentum couplings. It allows a quantitative study of the role and importance of quantum decoherence in nuclear scattering. Formulas of asymptotic observables that can reveal effects of quantum decoherence are given. A method for extracting energy-resolved scattering information from the time-dependent density matrix is introduced. As an example, model calculations are carried out for the low-energy collision of the {sup 16}O projectile on the {sup 154}Sm target.

  18. nuclear

    National Nuclear Security Administration (NNSA)

    2%2A en U.S-, Japan Exchange Best Practices on Nuclear Emergency Response http:nnsa.energy.govmediaroompressreleasesu.s-japan-exchange-best-practices-nuclear-emergency-respon...

  19. Development of a high-density gas-jet target for nuclear astrophysics and reaction studies with rare isotope beams. Final Report

    SciTech Connect (OSTI)

    Uwe, Greife

    2014-08-12

    The purpose of this project was to develop a high-density gas jet target that will enable a new program of transfer reaction studies with rare isotope beams and targets of hydrogen and helium that is not currently possible and will have an important impact on our understanding of stellar explosions and of the evolution of nuclear shell structure away from stability. This is the final closeout report for the project.

  20. Kinetics of Cold-Cap Reactions for Vitrification of Nuclear Waste Glass Based on Simultaneous Differential Scanning Calorimetry - Thermogravimetry (DSC-TGA) and Evolved Gas Analysis (EGA)

    SciTech Connect (OSTI)

    Rodriguez, Carmen P.; Pierce, David A.; Schweiger, Michael J.; Kruger, Albert A.; Chun, Jaehun; Hrma, Pavel R.

    2013-12-03

    For vitrifying nuclear waste glass, the feed, a mixture of waste with glass-forming and modifying additives, is charged onto the cold cap that covers 90-100% of the melt surface. The cold cap consists of a layer of reacting molten glass floating on the surface of the melt in an all-electric, continuous glass melter. As the feed moves through the cold cap, it undergoes chemical reactions and phase transitions through which it is converted to molten glass that moves from the cold cap into the melt pool. The process involves a series of reactions that generate multiple gases and subsequent mass loss and foaming significantly influence the mass and heat transfers. The rate of glass melting, which is greatly influenced by mass and heat transfers, affects the vitrification process and the efficiency of the immobilization of nuclear waste. We studied the cold-cap reactions of a representative waste glass feed using both the simultaneous differential scanning calorimetry thermogravimetry (DSC-TGA) and the thermogravimetry coupled with gas chromatography-mass spectrometer (TGA-GC-MS) as complementary tools to perform evolved gas analysis (EGA). Analyses from DSC-TGA and EGA on the cold-cap reactions provide a key element for the development of an advanced cold-cap model. It also helps to formulate melter feeds for higher production rate.

  1. SECTION II: HEAVY ION REACTIONS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    II: HEAVY ION REACTIONS Experimental Determination of the Symmetry Energy of a Low Density Nuclear Gas ......II-1 S. ...

  2. Three-Dimensional Analysis of the Lattice Confinement Effect on Ion Dynamics in Condensed Matter and Lattice Effect on the D-D Nuclear Reaction Channel

    SciTech Connect (OSTI)

    Violante, Vittorio; Torre, Amalia; Selvaggi, Giovanna; Miley, George H.

    2001-03-15

    A three-dimensional analysis of the dynamics of hydrogen isotopes confined within a metal lattice, like palladium or nickel, is presented. It is assumed that the concentration of the hydrogen isotopes, as an atomic fraction, is close to unity and that coherent oscillations of the metal atom electrons near to the Fermi level take place. Coherent oscillations of the Fermi-level electrons in the metal lattice can produce an oscillating electric field within the cell and hence produce a radio-frequency oscillation of ions like protons or deuterons. The trajectories of the ions can be studied by means of the equations of motion. The results show that under proper initial conditions, the closest distance of approach between two ions or between an ion and the nucleus of an atom of the host metal lattice can be reduced below 0.1 Angst. An evaluation of the excess of heat production has been done for the D-D reaction within a Pd lattice by approximating the reaction both to an s-wave and a d-wave process, respectively. Last, the effect of the lattice field, which causes the collisions between ions, on the nuclear reaction channel for the D-D reaction is investigated by evaluating the transition probability for a stimulated decay.

  3. Nuclear Physics from Lattice QCD

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Thursday, May 26, 2011 Exa-Scale Computational Resources Nuclear Astrophysics Accelerator Physics Cold QCD and Nuclear Forces Hot and Dense QCD Nuclear Structure and Reactions ...

  4. Resonant thermonuclear reaction rate

    SciTech Connect (OSTI)

    Haubold, H.J.; Mathai, A.M.

    1986-08-01

    Basic physical principles for the resonant and nonresonant thermonuclear reaction rates are applied to find their standard representations for nuclear astrophysics. Closed-form representations for the resonant reaction rate are derived in terms of Meijer's G-italic-function. Analytic representations of the resonant and nonresonant nuclear reaction rates are compared and the appearance of Meijer's G-italic-function is discussed in physical terms.

  5. Chain Reaction Innovations | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Unparalleled access to an innovation ecosystem Advisory network of business mentors ... A Fertile Ecosystem to Seed Complex Science Innovators in CRI can leverage the unique ...

  6. Nuclear structure studies with ([ital e],[ital e][prime]), ([pi],[pi][prime]), and ([gamma],[pi]) reactions: Applications to [sup 10]B

    SciTech Connect (OSTI)

    Sato, T.; Odagawa, N.; Ohtsubo, H. ); Lee, T.H. )

    1994-02-01

    Theoretical approaches for investigating nuclear structure with ([ital e],[ital e][prime]), ([pi],[pi][prime]), and ([gamma],[pi]) reactions are presented and applied to study the shell-model description of [sup 10]B. The distorted wave impulse approximation formulated in momentum space is used to calculate the cross sections of ([pi],[pi][prime]) and ([gamma],[pi]) reactions from the [pi][ital N][r arrow][pi][ital N] and [pi][ital N][r arrow][gamma][ital N] off-shell amplitudes which are generated from the model of Nozawa, Blankleider, and Lee[1]. It is found that the nonlocal effects due to [pi][ital N] off-shell dynamics and nucleon Fermi motion are important in predicting ([gamma],[pi]) cross sections. The one-pion-exchange two-body exchange currents are included in ([ital e],[ital e][prime]) calculations. It is shown that the core polarization effects, calculated in a perturbation approach including excitations up to 6[h bar][omega], are essential in obtaining quantitative agreements with the data with no adjustable parameters. The predictions based on the shell model of Cohen and Kurath [2] and Hague and Maripuu [3] are compared in order to illustrate the use of ([ital e],[ital e][prime]), ([pi],[pi][prime]), and ([gamma],[pi]) reactions in distinguishing nuclear structure theories which are almost equivalent in describing static properties in nuclei. Predictions for future ([ital e],[ital e][prime]) and ([gamma],[pi]) experiments are also presented.

  7. Random-matrix approach to the statistical compound nuclear reaction at low energies using the Monte-Carlo technique

    SciTech Connect (OSTI)

    Kawano, Toshihiko

    2015-11-10

    This theoretical treatment of low-energy compound nucleus reactions begins with the Bohr hypothesis, with corrections, and various statistical theories. The author investigates the statistical properties of the scattering matrix containing a Gaussian Orthogonal Ensemble (GOE) Hamiltonian in the propagator. The following conclusions are reached: For all parameter values studied, the numerical average of MC-generated cross sections coincides with the result of the Verbaarschot, Weidenmueller, Zirnbauer triple-integral formula. Energy average and ensemble average agree reasonably well when the width I is one or two orders of magnitude larger than the average resonance spacing d. In the strong-absorption limit, the channel degree-of-freedom ν a is 2. The direct reaction increases the inelastic cross sections while the elastic cross section is reduced.

  8. Experimental differential cross sections, level densities, and spin cutoffs as a testing ground for nuclear reaction codes

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Voinov, Alexander V.; Grimes, Steven M.; Brune, Carl R.; Burger, Alexander; Gorgen, Andreas; Guttormsen, Magne; Larsen, Ann -Cecilie; Massey, Thomas N.; Siem, Sunniva

    2013-11-08

    Proton double-differential cross sections from 59Co(α,p)62Ni, 57Fe(α,p)60Co, 56Fe(7Li,p)62Ni, and 55Mn(6Li,p)60Co reactions have been measured with 21-MeV α and 15-MeV lithium beams. Cross sections have been compared against calculations with the empire reaction code. Different input level density models have been tested. It was found that the Gilbert and Cameron [A. Gilbert and A. G. W. Cameron, Can. J. Phys. 43, 1446 (1965)] level density model is best to reproduce experimental data. Level densities and spin cutoff parameters for 62Ni and 60Co above the excitation energy range of discrete levels (in continuum) have been obtained with a Monte Carlo technique. Furthermore,more » excitation energy dependencies were found to be inconsistent with the Fermi-gas model.« less

  9. Nuclear Data Sheets for A = 88

    SciTech Connect (OSTI)

    McCutchan, E.A.; Sonzogni, A.A.

    2014-01-15

    The experimental results from the various reaction and radioactive decay studies leading to nuclides in the A=88 mass chain have been reviewed. Nuclides ranging from Ge (Z=32) to Ru (Z=44) are included. For these nuclei, level and decay schemes, as well as tables of nuclear properties, are given. This work supersedes the previous evaluation of the data on these nuclides (G. Mukherjee, A.A. Sonzogni Nucl.Data Sheets 105, 419 (2005))

  10. Nuclear Data Sheets for A=150

    SciTech Connect (OSTI)

    Basu, S.K.; Sonzogni, A.A.

    2013-04-15

    The experimental results from the various reaction and decay studies leading to nuclides in the A=150 mass chain have been reviewed. These data are summarized and presented, together with the adopted level schemes and properties, for the nuclides from Cs(Z=55) through Lu(Z=71). This evaluation replaces the previous evaluation by E. der Mateosian and J. K. Tuli (1995De28), which appeared in Nuclear Data Sheets 75, 827 (1995)

  11. Nuclear Data Sheets for A = 68

    SciTech Connect (OSTI)

    McCutchan, E. A.

    2012-07-01

    The experimental results from the various reaction and radioactive decay studies leading to nuclides in the A = 68 mass chain have been reviewed. Nuclides ranging from Cr (Z = 24) to Br (Z = 35) are included. For these nuclei, level and decay schemes, as well as tables of nuclear properties, are given. This work supersedes the previous evaluation of the data on these nuclides (2002Bu29).

  12. NNSA TRITIUM SUPPLY CHAIN

    SciTech Connect (OSTI)

    Wyrick, Steven; Cordaro, Joseph; Founds, Nanette; Chambellan, Curtis

    2013-08-21

    Savannah River Site plays a critical role in the Tritium Production Supply Chain for the National Nuclear Security Administration (NNSA). The entire process includes: • Production of Tritium Producing Burnable Absorber Rods (TPBARs) at the Westinghouse WesDyne Nuclear Fuels Plant in Columbia, South Carolina • Production of unobligated Low Enriched Uranium (LEU) at the United States Enrichment Corporation (USEC) in Portsmouth, Ohio • Irradiation of TPBARs with the LEU at the Tennessee Valley Authority (TVA) Watts Bar Reactor • Extraction of tritium from the irradiated TPBARs at the Tritium Extraction Facility (TEF) at Savannah River Site • Processing the tritium at the Savannah River Site, which includes removal of nonhydrogen species and separation of the hydrogen isotopes of protium, deuterium and tritium.

  13. LUNA: Nuclear astrophysics underground

    SciTech Connect (OSTI)

    Best, A.

    2015-02-24

    Underground nuclear astrophysics with LUNA at the Laboratori Nazionali del Gran Sasso spans a history of 20 years. By using the rock overburden of the Gran Sasso mountain chain as a natural cosmic-ray shield very low signal rates compared to an experiment on the surface can be tolerated. The cross sectons of important astrophysical reactions directly in the stellar energy range have been successfully measured. In this proceeding we give an overview over the key accomplishments of the experiment and an outlook on its future with the expected addition of an additional accelerator to the underground facilities, enabling the coverage of a wider energy range and the measurement of previously inaccessible reactions.

  14. Method of controlling fusion reaction rates

    DOE Patents [OSTI]

    Kulsrud, R.M.; Furth, H.P.; Valeo, E.J.; Goldhaber, M.

    1983-05-09

    This invention relates to a method of controlling the reaction rates in a nuclear fusion reactor; and more particularly, to the use of polarized nuclear fuel.

  15. CHARACTERIZATION OF INDIVIDUAL CHEMICAL REACTIONS CONSUMING ACID DURING NUCLEAR WASTE PROCESSING AT THE SAVANNAH RIVER SITE - 136B

    SciTech Connect (OSTI)

    Koopman, D.; Pickenheim, B.; Lambert, D.; Newell, J.; Stone, M.

    2009-09-02

    Conversion of legacy radioactive high-level waste at the Savannah River Site into a stable glass waste form involves a chemical pretreatment process to prepare the waste for vitrification. Waste slurry is treated with nitric and formic acids to achieve certain goals. The total quantity of acid added to a batch of waste slurry is constrained by the catalytic activity of trace noble metal fission products in the waste that can convert formic acid into hydrogen gas at many hundreds of times the radiolytic hydrogen generation rate. A large block of experimental process simulations were performed to characterize the chemical reactions that consume acid prior to hydrogen generation. The analysis led to a new equation for predicting the quantity of acid required to process a given volume of waste slurry.

  16. Migration of Nuclear Shell Gaps Studied in the d({sup 24}Ne,p{gamma}){sup 25}Ne Reaction

    SciTech Connect (OSTI)

    Catford, W. N.; Timis, C. N.; Baldwin, T. D.; Gelletly, W.; Pain, S. D.; Lemmon, R. C.; Pucknell, V. P. E.; Warner, D. D.; Labiche, M.; Orr, N. A.; Achouri, N. L.; Chapman, R.; Amzal, N.; Burns, M.; Liang, X.; Spohr, K.; Freer, M.; Ashwood, N. I.

    2010-05-14

    The transfer of neutrons onto {sup 24}Ne has been measured using a reaccelerated radioactive beam of {sup 24}Ne to study the (d,p) reaction in inverse kinematics. The unusual raising of the first 3/2{sup +} level in {sup 25}Ne and its significance in terms of the migration of the neutron magic number from N=20 to N=16 is put on a firm footing by confirmation of this state's identity. The raised 3/2{sup +} level is observed simultaneously with the intruder negative parity 7/2{sup -} and 3/2{sup -} levels, providing evidence for the reduction in the N=20 gap. The coincident gamma-ray decays allowed the assignment of spins as well as the transferred orbital angular momentum. The excitation energy of the 3/2{sup +} state shows that the established USD shell model breaks down well within the sd model space and requires a revised treatment of the proton-neutron monopole interaction.

  17. Spallation process with simultaneous multi-particle emission in nuclear evaporation

    SciTech Connect (OSTI)

    Santos, B. M.

    2013-05-06

    High energy probes have been used currently to explore nuclear reaction mechanism and nuclear structure. The spallation process governs the reaction process around 1 GeV energy regime. A new aspect introduced here to describe the nuclear reaction is the in-medium nucleonnucleon collision framework. The nucleon-nucleon scattering is kinematically treated by using an effective mass to represent the nuclear binding. In respect to the evaporation phase of the reaction, we introduce the simultaneous particles emission decay. This process becomes important due to the rise of new channels at high excitation energy regime of the compound nucleus. As results, the particles yields in the rapid and evaporation phases are obtained and compared to experimental data. The effect and relevance of these simultaneous emission processes in the evaporation chain is also discussed.

  18. Sleeve reaction chamber system

    SciTech Connect (OSTI)

    Northrup, M. Allen; Beeman, Barton V.; Benett, William J.; Hadley, Dean R.; Landre, Phoebe; Lehew, Stacy L.; Krulevitch, Peter A.

    2009-08-25

    A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

  19. Argonne's Major Nuclear Energy Milestones | Argonne National...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Argonne's Major Nuclear Energy Milestones Argonne's reactor tree Argonne's reactor tree December 2, 1942: Enrico Fermi's team produces the world's first sustained nuclear chain ...

  20. Nuclear Data Sheets for A = 222

    SciTech Connect (OSTI)

    Singh, S.; Tuli, J.; Jain,A.K.; Tuli,J.K.

    2011-11-01

    The ENSDF evaluation for A=222 mass chain (1996El01) has been updated on the basis of the experimental results, since September 1995 (literature cutoff date in 1996El01), from various reaction and decay studies for all nuclides in A=222 mass chain (Z=84 to 92). A new nuclide ({sup 222}Po) has since been observed. In addition, new measurements have been reported in Rn, Th and Ra nuclides. The results obtained from various theoretical studies are given as comments. The updated level and decay schemes, and experimental decay and reaction data on which they are based, are summarized and presented for all the nuclides with mass number A=222. The adopted values of level energies, level spins and parities are given, and {gamma}-ray energies, intensities, as well as other nuclear properties are presented.

  1. Absolute nuclear material assay

    DOE Patents [OSTI]

    Prasad, Manoj K.; Snyderman, Neal J.; Rowland, Mark S.

    2010-07-13

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  2. Absolute nuclear material assay

    DOE Patents [OSTI]

    Prasad, Manoj K.; Snyderman, Neal J.; Rowland, Mark S.

    2012-05-15

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  3. Charge separation in photoredox reactions. Final report

    SciTech Connect (OSTI)

    Kevan, L.

    1993-07-15

    The structural aspects controlling charge separation in molecular photoionization reactions in organized molecular assemblies involving micelles, reverse micelles and vesicles are being studied by optical and electron magnetic resonance techniques including the time domain technique of deuterium electron spin echo modulation (ESEM) and matrix proton electron nuclear double resonance (ENDOR) to measure weak electron-nuclear dipolar interactions. ESEM and matrix ENDOR are particularly well adapted to the study of disordered systems as exemplified by micelles and vesicles. The photoionization yields of alkylphenothiazines in micelles and vesicles have been shown to depend on the alkyl chain length and to correlate with relative distances from the surfactant assembly interface measured by deuterium ESEM and matrix proton ENDOR. The photoionization of alkylmethylviologens versus alkyl chain length has also been studied in vesicles, micelles and reverse micelles. Nitroxide spin probes have been used to study the degree of water penetration into mixed ionic/nonionic poly(ethylene oxide) and cationic/anionic micelles by using ESEM methods and selectively deuterated surfactants. The effect of urea interaction at micellar interfaces on the interface hydration has also been evaluated by studying nitroxide probes with ESEM.

  4. Laser amplifier chain

    DOE Patents [OSTI]

    Hackel, R.P.

    1992-10-20

    A laser amplifier chain has a plurality of laser amplifiers arranged in a chain to sequentially amplify a low-power signal beam to produce a significantly higher-power output beam. Overall efficiency of such a chain is improved if high-gain, low efficiency amplifiers are placed on the upstream side of the chain where only a very small fraction of the total pumped power is received by the chain and low-gain, high-efficiency amplifiers are placed on the downstream side where a majority of pumping energy is received by the chain. 6 figs.

  5. Laser amplifier chain

    DOE Patents [OSTI]

    Hackel, Richard P.

    1992-01-01

    A laser amplifier chain has a plurality of laser amplifiers arranged in a chain to sequentially amplify a low-power signal beam to produce a significantly higher-power output beam. Overall efficiency of such a chain is improved if high-gain, low efficiency amplifiers are placed on the upstream side of the chain where only a very small fraction of the total pumped power is received by the chain and low-gain, high-efficiency amplifiers are placed on the downstream side where a majority of pumping energy is received by the chain.

  6. Office of Nuclear Energy Doe/ne-0143

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    energy Office of Nuclear Energy Doe/ne-0143 Table of Contents Lesson 1 - Energy Basics Lesson 2 - Electricity Basics Lesson 3 - Atoms and Isotopes Lesson 4 - Ionizing Radiation Lesson 5 - Fission, Chain Reactions Lesson 6 - Atom to Electricity Lesson 7 - Waste from Nuclear Power Plants Lesson 8 - Concerns Lesson 9 - Energy and You 1 Lesson 1 Energy Basics ENERGY BASICS What is energy? Energy is the ability to do work. But what does that really mean? You might think of work as cleaning your room,

  7. Nuclear Astrophysics - Research - Cyclotron Institute

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    REACTION. Nuclear astrophysics research measures reaction rates for proton-capture reactions such as 7Be(p,)8B, which is the sole source of high energy neutrinos from our sun. ...

  8. Probable new type of reaction mechanism: Double. cap alpha. direct...

    Office of Scientific and Technical Information (OSTI)

    Language: English Subject: 73 NUCLEAR PHYSICS AND RADIATION PHYSICS; BERYLLIUM 8; CLUSTER MODEL; BISMUTH 209 TARGET; CARBON 12 REACTIONS; MULTI-NUCLEON TRANSFER REACTIONS; ALPHA ...

  9. Following the Transient Reactions in Lithium-Sulfur Batteries...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Following the Transient Reactions in Lithium-Sulfur Batteries Using an In Situ Nuclear ... cell electrochemical reactions in Li-S batteries using a microbattery design Interphase ...

  10. Microfabricated electrochemiluminescence cell for chemical reaction detection

    DOE Patents [OSTI]

    Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.

    2003-01-01

    A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  11. Radiative capture reactions in astrophysics

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Brune, Carl R.; Davids, Barry

    2015-08-07

    Here, the radiative capture reactions of greatest importance in nuclear astrophysics are identified and placed in their stellar contexts. Recent experimental efforts to estimate their thermally averaged rates are surveyed.

  12. CHAIN REACTING SYSTEM

    DOE Patents [OSTI]

    Fermi, E.; Leverett, M.C.

    1958-06-01

    A nuclear reactor of the gas-cooled, graphitemoderated type is described. In this design, graphite blocks are arranged in a substantially cylindrical lattice having vertically orienied coolant channels in which uranium fuel elements having through passages are disposed. The active lattice is contained within a hollow body. such as a steel shell, which, in turn, is surrounded by water and concrete shields. Helium is used as the primary coolant and is circulated under pressure through the coolant channels and fuel elements. The helium is then conveyed to heat exchangers, where its heat is used to produce steam for driving a prime mover, thence to filtering means where radioactive impurities are removed. From the filtering means the helium passes to a compressor and an after cooler and is ultimately returned to the reactor for recirculation. Control and safety rods are provided to stabilize or stop the reaction. A space is provided between the graphite lattice and the internal walls of the shell to allow for thermal expansion of the lattice during operation. This space is filled with a resilient packing, such as asbestos, to prevent the passage of helium.

  13. Silicon-based sleeve devices for chemical reactions

    DOE Patents [OSTI]

    Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.

    1996-12-31

    A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.

  14. Silicon-based sleeve devices for chemical reactions

    DOE Patents [OSTI]

    Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.

    1996-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  15. Impacts to the ethylene supply chain from a hurricane disruption.

    SciTech Connect (OSTI)

    Sun, Amy Cha-Tien; Downes, Paula Sue; Heinen, Russell; Welk, Margaret Ellen

    2010-03-01

    Analysis of chemical supply chains is an inherently complex task, given the dependence of these supply chains on multiple infrastructure systems (e.g., the petroleum sector, transportation, etc.). This effort requires data and information at various levels of resolution, ranging from network-level distribution systems to individual chemical reactions. Sandia National Laboratories (Sandia) has integrated its existing simulation and infrastructure analysis capabilities with chemical data models to analyze the chemical supply chains of several nationally critical chemical commodities. This paper describes how Sandia models the ethylene supply chain; that is, the supply chain for the most widely used raw material for plastics production including a description of the types of data and modeling capabilities that are required to represent the ethylene supply chain. The paper concludes with a description of Sandia's use the model to project how the supply chain would be affected by and adapt to a disruptive scenario hurricane.

  16. Influence of vertex coulomb effects on peripheral partial amplitudes for the consecutive transfer of two protons in A(X,Y)B peripheral nuclear reactions induced by light loosely bound (exotic) nuclei at low energies

    SciTech Connect (OSTI)

    Blokhintsev, L. D. [Moscow State University, Skobeltsyn Institute of Nuclear Physics (Russian Federation); Mukhamedzhanov, A. M. [Texas A and M University, MS 3366, Cyclotron Institute (United States); Tadzhibaeva, D. Kh.; Yarmukhamedov, R., E-mail: rakhim@inp.u [Uzbek Academy of Sciences, Institute of Nuclear Physics (Uzbekistan)

    2010-07-15

    The amplitude for the consecutive transfer of two protons in A(X, Y)B peripheral nuclear reactions induced by loosely bound light (exotic) nuclei and described by a nonrelativistic square Feynman diagram in which the first transferred proton is loosely bound while the second one in tightly bound is considered. It is shown that the inclusion of three-ray Coulomb vertex effects in the square diagram leads to the appearance of an additional 'Coulomb' singularity in the variable cos {theta} (here, {theta} is the c.m. scattering angle), this singularity being closer to the physical domain, -1 {<=} cos {theta} {<=} 1, than the well-known 'triangle' singularities corresponding to the amplitude of the square diagram in which the internal line is contracted. The asymptotic behavior of the partial-wave amplitudes for l >> 1 that are generated by the aforementioned singularities is found explicitly. A comparative analysis of the resulting partial-wave amplitudes for l >> 1 is performed for specific peripheral nuclear reactions induced by {sup 8}B and {sup 12}N ions at various energies.

  17. Powering the Nuclear Navy | National Nuclear Security Administration |

    National Nuclear Security Administration (NNSA)

    (NNSA) Programs Powering the Nuclear Navy The Naval Nuclear Propulsion Program provides militarily effective nuclear propulsion plants and ensures their safe, reliable and long-lived operation. This mission requires the combination of fully trained U.S. Navy men and women with ships that excel in endurance, stealth, speed, and independence from supply chains. The Naval Nuclear Propulsion Program provides militarily effective nuclear propulsion plants and ensures their safe, reliable and

  18. Nuclear Transparency and Single Particle Spectral Functions from Quasielastic A(e,e'p) Reactions up to Q2=8.1 GeV2

    SciTech Connect (OSTI)

    David McKee

    2003-05-01

    High statistics elastic and quasielastic scattering measurements were performed on hydrogen, deuterium, carbon, and iron at squared momentum transfers up to 8.1 GeV2. Both the nuclear transparency and the single particle spectral functions were extracted by means of comparison with a Plane- Wave Impulse Approximation calculation. Our data provide no evidence of the onset of color transparency within our kinematic range.

  19. The U.S. Nuclear Data Network: Summary of the twenty-first meeting

    SciTech Connect (OSTI)

    1996-08-01

    The following progress reports and related documents from the members of the US Nuclear Data Network (USNDN) are included at attachments: INEL Decay Data and Mass-chain Evaluation Project; Decay-data Evaluation Project; Isotopes Project Report; Report on High-spin Data Evaluations; The NNDC Activity Report, Parts A and B; Nuclear Science References (NSR) Task Force Report; Status of Mass Chains A = 1 to 266; Nuclear Data Project Activity Report; and TUNL Nuclear Data Evaluation Project Report; The progress report of the Center for Nuclear Information Technology; An Overview of the USNDN; Evaluated Nuclear Structure Data File-Status; Report on High-spin Evaluations for ENSDF since November 1994; The High-spin Data and the Workshop on Data Analysis; Decay Data Evaluation Project; Compilation of High Energy Heavy-ion and Electron Interaction Data; Dissemination/code development update; 8th Edition of the Table of Isotopes/VuENSDF; Bits of Power-Issues in the Transborder Flow of Scientific and Technical Data; Data activities at the Center for Nuclear Information Technology (CNIT), San Jose State University; The Agenda and the Minutes of the Formats and Procedures Subcommittee of the NSDD; A status report on the US Nuclear Reaction Data Network (USNRDN); Coordination/Cooperation and Communication as applied to the USNDN; Nuclear Structure Data Evaluations: Issues/Concerns; Electronic Publishing of Nuclear Data; The status of the Nuclear Astrophysics Data Project; and Nuclear Astrophysics Data needs for A=3-20/Possible contributions by TUNL. The attendees formed the three Discussion Groups. The charge to these Discussion Groups was how to achieve the goal of the USNDN to make the ENSDF and the NSR the best nuclear structure and bibliographic databases available, while maintaining a proper balance between evaluations and data dissemination.

  20. Supply Chain | NISAC

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    NISACSupply Chain content top National Transportation Fuels Model Posted by tmanzan on Oct 3, 2012 in | Comments 0 comments National Transportation Fuels Model This model informs analyses of the availability of transportation fuel in the event the fuel supply chain is disrupted. The portion of the fuel supply system represented by the network model (see figure) spans from oil fields to fuel distribution terminals. Different components of this system (e.g., crude oil import terminals, refineries,

  1. Microfabricated sleeve devices for chemical reactions

    DOE Patents [OSTI]

    Northrup, M. Allen

    2003-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  2. Towards consistent nuclear models and comprehensive nuclear data...

    Office of Scientific and Technical Information (OSTI)

    in terms of compound nucleus reaction theory from neutron separation energy to continuum. ... Subject: 73; CROSS SECTIONS; ENERGY RANGE; FISSION; NEUTRON SEPARATION ENERGY; NUCLEAR ...

  3. Pulsed deuterium lithium nuclear reactor

    SciTech Connect (OSTI)

    Fischer, A.G.

    1980-01-08

    A nuclear reactor that burns hydrogen bomb material 6-lithium deuterotritide to helium in successive microexplosions which are ignited electrically and enclosed by this same molten material, and that permits the conversion of the reaction heat into useful electrical power. A specially-constructed high-current pulse machine is discharged via a thermally-preformed highly conducting path through a mass of the molten salt 6lid1-xtx (0nuclear fire is extinguished in the surrounding cold matter. The energy set free is insufficient to convert the blanket into a hot plasma in which chain reactions could propagate and escalate. The liquid blanket also serves as a neutron radiation shield. The shock wave is attenuated in it by a curtain of rising deuterium bubbles. The heat shock is buffered by partial melting of the external solid crust. The reaction heat is carried by the liquid metal of the external cooling jacket to the heat exchanger of the associated turbo-generator. Every few seconds, a new pulse can take place.

  4. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices (Conference...

    Office of Scientific and Technical Information (OSTI)

    Resource Relation: Conference: Presented at: Transport Phenomena in Micro and Nano Devices, Kona Coast, HI (US), 10172004--10212004; Other Information: PBD: 28 Sep 2004 ...

  5. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    McInerney, Peter; Adams, Paul; Hadi, Masood Z.

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Errormore » rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less

  6. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices (Conference...

    Office of Scientific and Technical Information (OSTI)

    compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum ...

  7. Electrochemical Branched-DNA Assay for Polymerase Chain Reaction...

    Office of Scientific and Technical Information (OSTI)

    square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct ...

  8. Chain Reaction Innovations Business Mentor Solicitation | Argonne National

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Laboratory Innovations Business Mentor Solicitation PDF icon 2016_05_24_CRI_Business_Mentor_Solicitation_JWW_5bd

  9. NNSA Contract Reform in Action: Supply Chain Management Center | National

    National Nuclear Security Administration (NNSA)

    Nuclear Security Administration | (NNSA) Contract Reform in Action: Supply Chain Management Center December 22, 2009 As part of NNSA's commitment to being a responsible steward of tax dollars, NNSA Administrator Thomas D'Agostino (then the head of Defense Programs) created the Supply Chain Management Center (SCMC) in 2006 and selected Honeywell, operator of the Kansas City Plant, as the lead contractor for managing the initiative. Since Management and Operating (M&O) contractors spend

  10. Supply Chain Management Center event highlights how small businesses can

    National Nuclear Security Administration (NNSA)

    help NNSA carry out its missions | National Nuclear Security Administration | (NNSA) Supply Chain Management Center event highlights how small businesses can help NNSA carry out its missions Thursday, February 18, 2016 - 11:06am NNSA Blog The Supply Chain Management Center (SCMC) has been an important tool for NNSA to save taxpayer dollars. At the event on Feb. 18, NNSA leadership and the New Mexico congressional delegation were well represented. From left, Scott Bissen, SCMC Director; Rep.

  11. The Role of the Sellafield Ltd Centres of Expertise in Engaging with the Science, Environment and Technology Supply Chain and University Sector to Support Site Operations and Decommissioning in the UK Nuclear Industry - 13018

    SciTech Connect (OSTI)

    Butcher, Ed; Connor, Donna; Keighley, Debbie

    2013-07-01

    The development and maintenance of the broad range of the highly technical skills required for safe and successful management of nuclear sites is of vital importance during routine operations, decommissioning and waste treatment activities.. In order to maintain a core team of technical experts, across all of the disciplines required for these tasks, the approach which has been taken by the Sellafield Ltd has been the formation of twenty five Centres of Expertise (CoE), each covering key aspects of the technical skills required for nuclear site operations. Links with the Specialist University Departments: The CoE leads are also responsible for establishing formal links with university departments with specialist skills and facilities relevant to their CoE areas. The objective of these links is to allow these very specialist capabilities within the university sector to be more effectively utilized by the nuclear industry, which benefits both sectors. In addition to the utilization of specialist skills, the university links are providing an important introduction to the nuclear industry for students and researchers. This is designed to develop the pipeline of potential staff, who will be required in the future by both the academic and industrial sectors. (authors)

  12. METHOD OF SUSTAINING A NEUTRONIC CHAIN REACTING SYSTEM

    DOE Patents [OSTI]

    Fermi, E.; Leverett, M.C.

    1957-11-12

    This patent relates to neutronic reactors and a method of sustainlng a chain reaction. The reactor shown in the patent for carrying out the method is the gas-cooled type comprised of a solid moderator having a plurality of passages therethrough for receiving bodies of fissionable material. In carrying out the method, the reactor is loaded by inserting in the passages fuel elements and moderator material in a proportion to sustain a chain reaction As the reproduction ratio decreases below the desired fiiaire due to impurities formed during operation of the reactor, the moderator material is gradually replaced with additional fuel material to maintain the reproduction ratio above unity.

  13. Interplay between compound and fragments aspects of nuclear fission...

    Office of Scientific and Technical Information (OSTI)

    aspects of nuclear fission and heavy-ion reaction Citation Details In-Document Search Title: Interplay between compound and fragments aspects of nuclear fission and ...

  14. containers | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    containers NNSA Co-Hosts Nuclear Security Summit Workshop on Maritime Security with UK WASHINGTON - This week, the Department of Energy's National Nuclear Security Administration (DOE/NNSA) and the U.K. Department of Energy and Climate Change concluded a workshop at Wilton Park, United Kingdom, on the growing challenge of securing the global maritime supply chain. In

  15. Monte Carlo without chains

    SciTech Connect (OSTI)

    Chorin, Alexandre J.

    2007-12-12

    A sampling method for spin systems is presented. The spin lattice is written as the union of a nested sequence of sublattices, all but the last with conditionally independent spins, which are sampled in succession using their marginals. The marginals are computed concurrently by a fast algorithm; errors in the evaluation of the marginals are offset by weights. There are no Markov chains and each sample is independent of the previous ones; the cost of a sample is proportional to the number of spins (but the number of samples needed for good statistics may grow with array size). The examples include the Edwards-Anderson spin glass in three dimensions.

  16. POWER GENERATION FROM LIQUID METAL NUCLEAR FUEL

    DOE Patents [OSTI]

    Dwyer, O.E.

    1958-12-23

    A nuclear reactor system is described wherein the reactor is the type using a liquid metal fuel, such as a dispersion of fissile material in bismuth. The reactor is designed ln the form of a closed loop having a core sectlon and heat exchanger sections. The liquid fuel is clrculated through the loop undergoing flssion in the core section to produce heat energy and transferrlng this heat energy to secondary fluids in the heat exchanger sections. The fission in the core may be produced by a separate neutron source or by a selfsustained chain reaction of the liquid fuel present in the core section. Additional auxiliary heat exchangers are used in the system to convert water into steam which drives a turbine.

  17. TUNL Nuclear Data Project

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Energy Levels of Light Nuclei, A = 3 - 20 Nuclear Data Evaluation Project Triangular Universities Nuclear Laboratory TUNL Nuclear Data Evaluation Home Page Information on mass chains and nuclides 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Group Info Publications HTML General Tables Level Diagrams Tables of EL's NSR Key# Retrieval ENSDF Excitation Functions Thermal N Capt. G.S. Decays TUNL Dissertations NuDat at BNL Useful Links Citation Examples Home Sitemap Directory Email Us Search WWW

  18. Research in theoretical nuclear and neutrino physics. Final report

    Office of Scientific and Technical Information (OSTI)

    ANNIHILATION; FLAVOR MODEL; SUPERNOVAE; QUANTUM CHROMODYNAMICS; HEAVY ION REACTIONS; SUN; NUCLEAR THEORY; CONVERSION; CHARM PARTICLES; PROGRESS REPORT; NONLUMINOUS MATTER; STAR...

  19. Multiple-Reheat Brayton Cycles for Nuclear Power Conversion with...

    Office of Scientific and Technical Information (OSTI)

    Volume: 144; Journal Issue: 3; Other Information: Copyright (c) 2006 American Nuclear Society (ANS), United States, ... CAPITALIZED COST; CHEMICAL REACTIONS; ...

  20. Nuclear Reactions and Stellar Evolution: Unified Dynamics

    SciTech Connect (OSTI)

    Bauer, W.; Strother, T.

    2007-10-26

    Motivated by the success of kinetic theory in the description of observables in intermediate and high energy heavy ion collisions, we use kinetic theory to model the dynamics of collapsing iron cores in type II supernova explosions. The algorithms employed to model the collapse, some preliminary results and predictions, and the future of the code are discussed.

  1. Nuclear Science Division: 1993 Annual report

    SciTech Connect (OSTI)

    Myers, W.D.

    1994-06-01

    This report describes the activities of the Nuclear Science Division for the 1993 calendar year. This was another significant year in the history of the Division with many interesting and important accomplishments. Activities for the following programs are covered here: (1) nuclear structure and reactions program; (2) the Institute for Nuclear and Particle Astrophysics; (3) relativistic nuclear collisions program; (4) nuclear theory program; (5) nuclear data evaluation program, isotope project; and (6) 88-inch cyclotron operations.

  2. Transport of triplet excitons along continuous 100 nm polyfluorene chains

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Xi, Liang; Bird, Matthew; Mauro, Gina; Asaoka, Sadayuki; Cook, Andrew R.; Chen, Hung -Cheng; Miller, John R.

    2014-12-03

    Triplet excitons created in poly-2,7-(9,9-dihexyl)fluorene (pF) chains with end trap groups in solution are efficiently transported to and captured by the end groups. The triplets explore the entire lengths of the chains, even for ~100 nm long chains enabling determination of the completeness of end capping. The results show that the chains continuous: they may contain transient barriers or traps, such as those from fluctuations of dihedral angles, but are free of major defects that stop motion of the triplets. Quantitative determinations are aided by the addition of a strong electron donor, TMPD, which removes absorption bands of the end-trappedmore » triplets. For chains having at least one end trap, triplet capture is quantitative on the 1 µs timescale imposed by the use of the donor. Fractions of chains having no end traps were 0.15 for pF samples with anthraquinone (AQ) end traps and 0.063 with naphthylimide (NI) end traps. These determinations agreed with measurements by NMR for short (<40 polymer repeat units (PRU)) chains, where NMR determinations are accurate. The results find no evidence for traps or barriers to transport of triplets, and places limits on the possible presence of defects as impenetrable barriers to less than one per 300 PRU. The present results present a paradigm different from the current consensus, derived from observations of singlet excitons, that conjugated chains are divided into “segments,” perhaps by some kind of defects. For the present pF chains, the segmentation either does not apply to triplet excitons or is transient so that the defects are healed or surmounted in times much shorter than 1 µs. Triplets on chains without end trap groups transfer to chains with end traps on a slower time scale. Rate constants for these bimolecular triplet transfer reactions were found to increase with the length of the accepting chain, as did rate constants for triplet transfer to the chains from small molecules like biphenyl. As a

  3. Transport of triplet excitons along continuous 100 nm polyfluorene chains

    SciTech Connect (OSTI)

    Xi, Liang; Bird, Matthew; Mauro, Gina; Asaoka, Sadayuki; Cook, Andrew R.; Chen, Hung -Cheng; Miller, John R.

    2014-12-03

    Triplet excitons created in poly-2,7-(9,9-dihexyl)fluorene (pF) chains with end trap groups in solution are efficiently transported to and captured by the end groups. The triplets explore the entire lengths of the chains, even for ~100 nm long chains enabling determination of the completeness of end capping. The results show that the chains continuous: they may contain transient barriers or traps, such as those from fluctuations of dihedral angles, but are free of major defects that stop motion of the triplets. Quantitative determinations are aided by the addition of a strong electron donor, TMPD, which removes absorption bands of the end-trapped triplets. For chains having at least one end trap, triplet capture is quantitative on the 1 s timescale imposed by the use of the donor. Fractions of chains having no end traps were 0.15 for pF samples with anthraquinone (AQ) end traps and 0.063 with naphthylimide (NI) end traps. These determinations agreed with measurements by NMR for short (<40 polymer repeat units (PRU)) chains, where NMR determinations are accurate. The results find no evidence for traps or barriers to transport of triplets, and places limits on the possible presence of defects as impenetrable barriers to less than one per 300 PRU. The present results present a paradigm different from the current consensus, derived from observations of singlet excitons, that conjugated chains are divided into segments, perhaps by some kind of defects. For the present pF chains, the segmentation either does not apply to triplet excitons or is transient so that the defects are healed or surmounted in times much shorter than 1 s. Triplets on chains without end trap groups transfer to chains with end traps on a slower time scale. Rate constants for these bimolecular triplet transfer reactions were found to increase with the length of the accepting chain, as did rate constants for triplet transfer to the chains from small molecules like biphenyl. As a result, a second

  4. Nuclear Structure and Nuclear Reactions | Argonne Leadership Computing

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Facility ADLB (Asynchronous Dynamic Load-Balancing) version of GFMC The ADLB (Asynchronous Dynamic Load-Balancing) version of GFMC was used to make calculations of 12C with a complete Hamiltonian (two- and three-nucleon potential AV18+IL7) on 32,000 processors of Intrepid. These are believed to be the best converged ab initio calculations of 12^C ever made. The computed binding energy is 93.5(6) MeV compared to the experimental value of 92.16 MeV and the point rms radius is 2.35 fm vs 2.33

  5. Nuclear Structure and Nuclear Reactions | Argonne Leadership Computing

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Facility Slice of the translationally-invariant proton hexadecapole density of the ground state of 8Li, Slice of the translationally-invariant proton hexadecapole density of the ground state of 8Li, a nucleus with 3 protons and 5 neutrons. The results were calculated in the ab initio no core shell model with a realistic two-nucleon interaction. C. Cockrell, J.P. Vary and P. Maris, "Lithium isotopes within the ab initio no-core full configuration approach," Phys. Rev. C 86, 034325

  6. Evaluated Nuclear (reaction) Data from the Evaluated Nuclear...

    Office of Scientific and Technical Information (OSTI)

    The current version is ENDFB VII.0, released in 2006. Users can search ENDF via specialized interfaces, browse sub-libraries or download them as zipped files. ...

  7. Building a Universal Nuclear Energy Density Functional

    SciTech Connect (OSTI)

    Bertulani, Carlos A.

    2014-09-10

    This grant had two components: Density functional theory and pairing and Nuclear reactions. This final report summarizes the activities for this SciDAC-2 project.

  8. Nuclear Data Sheets for A = 99

    SciTech Connect (OSTI)

    Browne, E.; Tuli,J.K.

    2011-02-01

    The evaluators present in this publication spectroscopic data and level schemes from radioactive decay and nuclear reactions studies for all isobars with mass number A = 99.

  9. Nuclear Data Sheets for A=246

    SciTech Connect (OSTI)

    Browne, E. .; Tuli, J.; Browne,E.; Tuli,J.K.

    2011-07-01

    The evaluators present in this publication spectroscopic data and level schemes from radioactive decay and nuclear reaction studies for all nuclei with mass number A = 246.

  10. Microsoft Word - Nuclear_Astrophysics_Summary

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and ATLAS S. Almaraz-Calderon (ANL): Fusion Reactions in Nuclear Astrophysics: The MUSIC Approach P. Collon (Notre Dame): AMS for astrophysics, p-process work and other...

  11. Nuclear Science References Database

    SciTech Connect (OSTI)

    Pritychenko, B.; Běták, E.; Singh, B.; Totans, J.

    2014-06-15

    The Nuclear Science References (NSR) database together with its associated Web interface, is the world's only comprehensive source of easily accessible low- and intermediate-energy nuclear physics bibliographic information for more than 210,000 articles since the beginning of nuclear science. The weekly-updated NSR database provides essential support for nuclear data evaluation, compilation and research activities. The principles of the database and Web application development and maintenance are described. Examples of nuclear structure, reaction and decay applications are specifically included. The complete NSR database is freely available at the websites of the National Nuclear Data Center (http://www.nndc.bnl.gov/nsr) and the International Atomic Energy Agency (http://www-nds.iaea.org/nsr)

  12. Public Affairs | National Nuclear Security Administration | (NNSA)

    National Nuclear Security Administration (NNSA)

    Public Affairs The Naval Nuclear Propulsion Program provides militarily effective nuclear propulsion plants and ensures their safe, reliable and long-lived operation. This mission requires the combination of fully trained U.S. Navy men and women with ships that excel in endurance, stealth, speed, and independence from supply chains. The Naval Nuclear Propulsion Program provides militarily effective nuclear propulsion plants and ensures their safe, reliable and long-lived operation. This mission

  13. Public Affairs | National Nuclear Security Administration | (NNSA)

    National Nuclear Security Administration (NNSA)

    Public Affairs The Naval Nuclear Propulsion Program provides militarily effective nuclear propulsion plants and ensures their safe, reliable and long-lived operation. This mission requires the combination of fully trained U.S. Navy men and women with ships that excel in endurance, stealth, speed, and independence from supply chains. The Naval Nuclear Propulsion Program provides militarily effective nuclear propulsion plants and ensures their safe, reliable and long-lived operation. This mission

  14. Nuclear Science

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear Science Nuclear Science Experimental and theoretical nuclear research carried out at NERSC is driven by the quest for improving our understanding of the building blocks of...

  15. Chemical Supply Chain Analysis | NISAC

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    NISACCapabilitiesChemical Supply Chain Analysis content top Chemical Supply Chain Analysis NISAC has developed a range of capabilities for analyzing the consequences of disruptions to the chemical manufacturing industry. Each capability provides a different but complementary perspective on the questions of interest-questions like Given an event, will the entire chemical sector be impacted or just parts? Which chemicals, plants, and complexes could be impacted? In which regions of the country?

  16. Nuclear Astrophysics

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nuclear & Uranium Glossary › FAQS › Overview Data Status of U.S. nuclear outages (interactive) Nuclear power plants Uranium & nuclear fuel Spent nuclear fuel All nuclear data reports Analysis & Projections Major Topics Most popular Nuclear plants and reactors Projections Recurring Uranium All reports Browse by Tag Alphabetical Frequency Tag Cloud Current Issues & Trends See more › U.S. nuclear outages this summer were higher than in summer 2015

  17. Nuclear Forensics

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    nuclear forensics Nuclear Forensics AMS is a Powerful Tool for Nuclear Forensics Nuclear forensics, which can be applied to both interdicted materials and debris from a nuclear explosion, is the application of laboratory analysis and interpretation to provide technical conclusions (provenance, design, etc.) about a nuclear device or interdicted nuclear material. Nuclear forensic analysts can build confidence in their conclusions by employing multiple signatures that collectively minimize the

  18. Advanced Nuclear Reactors | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Advanced Nuclear Reactors Advanced Nuclear Reactors Turbulent Flow of Coolant in an Advanced Nuclear Reactor Visualizing Coolant Flow in Sodium Reactor Subassemblies Sodium-cooled Fast Reactor (SFR) Coolant Flow At the heart of a nuclear power plant is the reactor. The fuel assembly is placed inside a reactor vessel where all the nuclear reactions occur to produce the heat and steam used for power generation. Nonetheless, an entire power plant consists of many other support components and key

  19. Nuclear Theory and Applications progress report, January 1, 1989-- April 1, 1990

    SciTech Connect (OSTI)

    Strottman, D.D.; Mutschlecner, A.D.

    1990-12-01

    This report contains brief papers on the following topics: data evaluation and libraries; data processing; nuclear applications; reactions; fission; and nuclear structure.

  20. Nuclear Facilities

    Broader source: Energy.gov [DOE]

    The nuclear sites list and map shows how DOE nuclear operations are mostly divided between nuclear weapons stockpile maintenance, research and environmental cleanup. The operations are performed within several different facilities supporting nuclear reactor operations, nuclear research, weapons disassembly, maintenance and testing, hot cell operations, nuclear material storage and processing and waste disposal.

  1. gms | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    gms NNSA Co-Hosts Nuclear Security Summit Workshop on Maritime Security with UK WASHINGTON - This week, the Department of Energy's National Nuclear Security Administration (DOE/NNSA) and the U.K. Department of Energy and Climate Change concluded a workshop at Wilton Park, United Kingdom, on the growing challenge of securing the global maritime supply chain. In... NNSA Provides Tajikistan Specialized Vehicles to Transport Radiological Materials NNSA Program Manager Nick Cavellero, right, and NRSA

  2. Nuclear Fabrication Consortium

    SciTech Connect (OSTI)

    Levesque, Stephen

    2013-04-05

    This report summarizes the activities undertaken by EWI while under contract from the Department of Energy (DOE) – Office of Nuclear Energy (NE) for the management and operation of the Nuclear Fabrication Consortium (NFC). The NFC was established by EWI to independently develop, evaluate, and deploy fabrication approaches and data that support the re-establishment of the U.S. nuclear industry: ensuring that the supply chain will be competitive on a global stage, enabling more cost-effective and reliable nuclear power in a carbon constrained environment. The NFC provided a forum for member original equipment manufactures (OEM), fabricators, manufacturers, and materials suppliers to effectively engage with each other and rebuild the capacity of this supply chain by : • Identifying and removing impediments to the implementation of new construction and fabrication techniques and approaches for nuclear equipment, including system components and nuclear plants. • Providing and facilitating detailed scientific-based studies on new approaches and technologies that will have positive impacts on the cost of building of nuclear plants. • Analyzing and disseminating information about future nuclear fabrication technologies and how they could impact the North American and the International Nuclear Marketplace. • Facilitating dialog and initiate alignment among fabricators, owners, trade associations, and government agencies. • Supporting industry in helping to create a larger qualified nuclear supplier network. • Acting as an unbiased technology resource to evaluate, develop, and demonstrate new manufacturing technologies. • Creating welder and inspector training programs to help enable the necessary workforce for the upcoming construction work. • Serving as a focal point for technology, policy, and politically interested parties to share ideas and concepts associated with

  3. Psychological aspects of nuclear war

    SciTech Connect (OSTI)

    Thompson, J.

    1985-01-01

    Exploring the nature of nuclear war, this treatise examines human reaction to nuclear disaster and accidental explosions. The discussion is based on evidence of human fallibility that has emerged from the psychology of accidents and from research into decision-making in military and political contexts. The book draws on the psychology of negotiation and conflict resolution to suggest ways in which the threat of nuclear war might be reduced.

  4. Absolute nuclear material assay using count distribution (LAMBDA) space

    DOE Patents [OSTI]

    Prasad, Mano K.; Snyderman, Neal J.; Rowland, Mark S.

    2015-12-01

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  5. Absolute nuclear material assay using count distribution (LAMBDA) space

    DOE Patents [OSTI]

    Prasad, Manoj K.; Snyderman, Neal J.; Rowland, Mark S.

    2012-06-05

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  6. Nuclear fuel element

    DOE Patents [OSTI]

    Armijo, Joseph S.; Coffin, Jr., Louis F.

    1980-04-29

    A nuclear fuel element for use in the core of a nuclear reactor is disclosed and has an improved composite cladding comprised of a moderate purity metal barrier of zirconium metallurgically bonded on the inside surface of a zirconium alloy tube. The metal barrier forms a shield between the alloy tube and a core of nuclear fuel material enclosed in the composite cladding. There is a gap between the cladding and the core. The metal barrier forms about 1 to about 30 percent of the thickness of the composite cladding and has low neutron absorption characteristics. The metal barrier serves as a preferential reaction site for gaseous impurities and fission products and protects the alloy tube from contact and reaction with such impurities and fission products. Methods of manufacturing the composite cladding are also disclosed.

  7. Nuclear fuel element

    DOE Patents [OSTI]

    Armijo, Joseph S.; Coffin, Jr., Louis F.

    1983-01-01

    A nuclear fuel element for use in the core of a nuclear reactor is disclosed and has a composite cladding having a substrate and a metal barrier metallurgically bonded on the inside surface of the substrate so that the metal barrier forms a shield between the substrate and the nuclear fuel material held within the cladding. The metal barrier forms about 1 to about 30 percent of the thickness of the cladding and is comprised of a low neutron absorption metal of substantially pure zirconium. The metal barrier serves as a preferential reaction site for gaseous impurities and fission products and protects the substrate from contact and reaction with such impurities and fission products. The substrate of the composite cladding is selected from conventional cladding materials and preferably is a zirconium alloy. Methods of manufacturing the composite cladding are also disclosed.

  8. [Experimental nuclear physics]. Final report

    SciTech Connect (OSTI)

    1991-04-01

    This is the final report of the Nuclear Physics Laboratory of the University of Washington on work supported in part by US Department of Energy contract DE-AC06-81ER40048. It contains chapters on giant dipole resonances in excited nuclei, nucleus-nucleus reactions, astrophysics, polarization in nuclear reactions, fundamental symmetries and interactions, accelerator mass spectrometry (AMS), ultra-relativistic heavy ions, medium energy reactions, work by external users, instrumentation, accelerators and ion sources, and computer systems. An appendix lists Laboratory personnel, a Ph. D. degree granted in the 1990-1991 academic year, and publications. Refs., 41 figs., 7 tabs.

  9. Neutron multiplicity distributions for 30 MeVu sup 14 N reactions with the indicated targets

    SciTech Connect (OSTI)

    Not Available

    1992-06-01

    This report contains short papers on the following topics: Heavy ion reactions; nuclear structure and fundamental interactions; nuclear theory; atomic molecular and materials science; and superconducting cyclotron and instrumentation. (LSP)

  10. nuclear security

    National Nuclear Security Administration (NNSA)

    3%2A en Shaping the future of nuclear detection http:nnsa.energy.govblogshaping-future-nuclear-detection

    Learning techniques to combat nuclear trafficking, touring the...