Powered by Deep Web Technologies
Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Norfolk Offshore Wind NOW | Open Energy Information  

Open Energy Info (EERE)

Norfolk Offshore Wind NOW Jump to: navigation, search Name Norfolk Offshore Wind (NOW) Place United Kingdom Sector Wind energy Product Formed to develop the 100MW Cromer offshore...

2

DOE - Office of Legacy Management -- Norfolk Naval Station - VA 05  

NLE Websites -- All DOE Office Websites (Extended Search)

Norfolk Naval Station - VA 05 Norfolk Naval Station - VA 05 FUSRAP Considered Sites Site: NORFOLK NAVAL STATION (VA.05) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Norfolk , Virginia VA.05-1 Evaluation Year: 1993 VA.05-1 Site Operations: Demonstration of extinguishing a uranium fire at the Fire Fighters School for AEC contractors. VA.05-3 VA.05-2 Site Disposition: Eliminated - Potential for contamination considered remote based on the limited quantity of materials handled VA.05-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium VA.05-2 Radiological Survey(s): Yes - Health and Safety Monitoring during operations only VA.05-2 Site Status: Eliminated from consideration under FUSRAP

3

A Solar Decathlon Entry for Historic Norfolk | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

A Solar Decathlon Entry for Historic Norfolk A Solar Decathlon Entry for Historic Norfolk A Solar Decathlon Entry for Historic Norfolk August 11, 2011 - 3:22pm Addthis Erin R. Pierce Erin R. Pierce Digital Communications Specialist, Office of Public Affairs How can I participate? The next Solar Decathlon will be held Sept. 23-Oct. 2, 2011, at the National Mall's West Potomac Park in Washington, D.C. Come check it out! In honor of the U.S Department of Energy's Solar Decathlon -- which challenges 20 collegiate teams to design, build, and operate solar-powered houses that are cost-effective, energy-efficient, and attractive -- we are profiling each of the 20 teams participating in the competition. It's a tale of two universities with a vision for one historic city. Students from both Hampton and Old Dominion universities have joined forces

4

A Solar Decathlon Entry for Historic Norfolk | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

A Solar Decathlon Entry for Historic Norfolk A Solar Decathlon Entry for Historic Norfolk A Solar Decathlon Entry for Historic Norfolk August 11, 2011 - 3:22pm Addthis Erin R. Pierce Erin R. Pierce Digital Communications Specialist, Office of Public Affairs How can I participate? The next Solar Decathlon will be held Sept. 23-Oct. 2, 2011, at the National Mall's West Potomac Park in Washington, D.C. Come check it out! In honor of the U.S Department of Energy's Solar Decathlon -- which challenges 20 collegiate teams to design, build, and operate solar-powered houses that are cost-effective, energy-efficient, and attractive -- we are profiling each of the 20 teams participating in the competition. It's a tale of two universities with a vision for one historic city. Students from both Hampton and Old Dominion universities have joined forces

5

Norfolk County, Massachusetts: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Norfolk County, Massachusetts: Energy Resources Norfolk County, Massachusetts: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.17668°, -71.1448516° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.17668,"lon":-71.1448516,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

6

Norfolk Public Schools Wind Project | Open Energy Information  

Open Energy Info (EERE)

Public Schools Wind Project Public Schools Wind Project Jump to: navigation, search Name Norfolk Public Schools Wind Project Facility Norfolk Public Schools Sector Wind energy Facility Type Community Wind Location NE Coordinates 42.043221°, -97.41452° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.043221,"lon":-97.41452,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

7

Naval Station Norfolk, VA- Energy Conservation Program UESC Partnership Success Story  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Station Norfolk, VA Station Norfolk, VA Energy Conservation Program UESC Partnership Success Story 20 November 2008 2 Agenda Background Basis for Success Phase I Phase I Mod 01 Phase II Other / Future Program Aspects Why the Partnership Works 3 Background Minimal structured plan for NS Norfolk prior to 2006 Other MidLant Installations had aggressive ESPC programs in place The largest US Navy Installation in the World had only scratched the surface on all the opportunities for energy conservation Decision made to establish long term UESC partnership / program with VNG 4 NS Norfolk Basis for Success Focus on long term partnership with Utility to meet infrastructure needs and energy goals Gear project efforts to support core Mission of NS Norfolk Long term benefits more important than strict

8

Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...

9

US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

10

US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

11

RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.

12

Norfolk Southern boxcar blocking/bracing plan for the mixed waste disposal initiative project. Environmental Restoration Program  

Science Conference Proceedings (OSTI)

The US Department of Energy`s (DOE) Environmental Restoration and Waste Management programs will dispose of mixed waste no longer deemed useful. This project is one of the initial activities used to help meet this goal. The project will transport the {approximately}46,000 drums of existing stabilized mixed waste located at the Oak Ridge K-25 Site and presently stored in the K-31 and K-33 buildings to an off-site commercially licensed and permitted mixed waste disposal facility. Shipping and disposal of all {approximately}46,000 pond waste drums ({approximately}1,000,000 ft{sup 3} or 55,000 tons) is scheduled to occur over a period of {approximately}5--10 years. The first shipment of stabilized pond waste should transpire some time during the second quarter of FY 1994. Martin Marietta Energy Systems, Inc., proposes to line each of the Norfolk Southem boxcars with a prefabricated, white, 15-mm low-density polyethylene (LDPE) liner material. To avoid damaging the bottom of the polyethylene floor liner, a minimum .5 in. plywood will be nailed to the boxcars` nailable metal floor. At the end of the Mixed Waste Disposal Initiative (MWDI) Project workers at the Envirocare facility will dismantle and dispose of all the polyethylene liner and plywood materials. Envirocare of Utah, Inc., located in Clive, Utah, will perform a health physic survey and chemically and radiologically decontaminate, if necessary, each of the rail boxcars prior to them being released back to Energy Systems. Energy Systems will also perform a health physic survey and chemically and radiologically decontaminate, if necessary, each of the rail boxcars prior to them being released back to Norfolk Southem Railroad.

Seigler, R.S.

1994-01-01T23:59:59.000Z

13

Geology and mineral resources of the Florence, Beaufort, Rocky Mount, and Norfolk 1/sup 0/ x 2/sup 0/ NTMS quadrangles. National Uranium Resource Evaluation program  

Science Conference Proceedings (OSTI)

This document provides geologic and mineral resources data for previously-issued Savannah River Laboratory hydrogeochemical and stream sediment reports of the Beaufort, Florence, Norfolk, and Rocky Mount 1/sup 0/ x 2/sup 0/ National Topographic Map Series quadrangles in the southeastern United States. This report is issued in draft form, without detailed technical and copy editing. This was done to make the report available to the public before the end of the National Uranium Resource Evaluation program.

Harris, W.B.

1982-08-01T23:59:59.000Z

14

DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility

15

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed

16

MI  

NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)

17

DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4

18

DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP

19

Alterations in PTEN and PIK3CA in colorectal cancers in the EPIC Norfolk study: associations with clinicopathological and dietary factors  

E-Print Network (OSTI)

RESEARCH ARTICLE Open Access Alterations in PTEN and PIK3CA in colorectal cancers in the EPIC Norfolk study: associations with clinicopathological and dietary factors Adam Naguib1, James C Cooke1, Lisa Happerfield2, Lucy Kerr2, Laura J Gay1, Robert... N Luben3, Richard Y Ball4, Panagiota N Mitrou3, Alison McTaggart3 and Mark J Arends2* Abstract Background: The PTEN tumour suppressor gene and PIK3CA proto-oncogene encode proteins which contribute to regulation and propagation of signal transduction...

Naguib, Adam; Cooke, James C; Happerfield, Lisa; Kerr, Lucy; Gay, Laura J; Luben, Robert; Ball, Richard Y; Mitrou, Panagiota N; McTaggart, Alison; Arends, Mark J

2011-04-07T23:59:59.000Z

20

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...

22

DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.

23

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either

24

DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical

25

DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated

26

Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...

27

MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab

2008-10-01T23:59:59.000Z

28

DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP

29

Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)

2012-01-01T23:59:59.000Z

30

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state

31

Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio

2010-02-01T23:59:59.000Z

32

In vitro and in vivo analysis of differential gene expression between normal norfolk terrier dogs and those with an autosomal recessive mutation in KRT10  

E-Print Network (OSTI)

Natural diseases caused by keratin mutations are rare and have only been reported in humans. We have recently identified a heritable skin disorder in Norfolk terriers caused by a mutation in KRT10. Affected dogs have a tendency to form shallow erosions or blisters following mild trauma, which is first noted after the birthing process. As the dogs age, they display generalized hyperpigmentation and scaling that is most severe in the axillary and inguinal regions. The main histologic and ultrastructural features include: marked hyperkeratosis, epidermal hyperplasia, prominent vacuolation of the upper suprabasal layers, eosinophilic intracytoplasmic aggregates (keratin bundles), numerous and frequently enlarged keratohyaline granules, and epidermal hyperplasia. Analysis of an extended pedigree through seven generations confirmed an autosomal recessive mode of inheritance. The keratin 10 mutation was defined as a G-T point mutation in intron 5 that affected splicing at the boundary of exon 4 and intron 5. The primary outcome of the mutation was a 35 bp deletion in exon 4 caused by use of a cryptic splice site. Real-time PCR quantitation of KRT10 confirmed that this mutation led to premature mRNA decay and an average 35-fold decrease in KRT10 message. Organotypic cell culture techniques were used to establish in vitro models for normal and affected Norfolk terriers. After 21 days of culture, normal epidermis was cornified with a compact and multifocally parakeratotic stratum corneum. Affected epidermis largely reproduced the expected morphologic alterations. Immunoblotting and immunohistochemistry for keratin 10 protein and real-time PCR quantitation of KRT10 message showed significantly less keratin expression in vitro than in vivo suggesting that the differentiation program in vitro underwent significant alterations. A diagnostic PCR assay was established for detection of the carrier state. Global analysis of gene expression between normal, carrier and affected dogs was performed with DermArray cDNA microarrays. Affected and carrier dogs showed differential regulation of 320 and 298 genes, respectively, between normal dogs. In affected dogs, 217 were upregulated and 103 were downregulated. In carrier dogs, 222 were upregulated and 76 were downregulated. 72 genes (65 upregulated, 7 downregulated) were altered in both affected and heterozygous dogs.

Barnhart, Kirstin Faye

2004-08-01T23:59:59.000Z

33

Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png

34

Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls

35

,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

36

,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

37

Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.

38

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:

39

The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.

2005-05-01T23:59:59.000Z

40

DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;

42

DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co

43

McGrawNorfolk.ppt  

NLE Websites -- All DOE Office Websites (Extended Search)

CLOUD PROCESSES USING THE QUADRATURE METHOD OF CLOUD PROCESSES USING THE QUADRATURE METHOD OF MOMENTS Robert McGraw and Yangang Liu Atmospheric Sciences Division Brookhaven National Laboratory, Upton, NY 11973 0 100 200 300 400 500 600 time HsecondsL 0.15 0.175 0.2 0.225 0.25 0.275 0.3 frI 0 100 200 300 400 500 600 time HsecondsL 0.4 0.45 0.5 0.55 0.6 0.65 0.7 frII 0 100 200 300 400 500 600 time HsecondsL 0 0.1 0.2 0.3 0.4 0.5 frIII QMOM with 7 moment tracking Particle-resolved simulation (circa 100000 particles) EVOLUTION OF PARTICLE NUMBER FRACTION Population I Population II Population III QMOM with 14 moment tracking Q Q Q QM M M MO O O OM M M M s s s si i i im m m mu u u ul l l la a a at t t ti i i io o o on n n ns s s s o o o on n n n l l l la a a ap p p pt t t to o o op p p p i i i in n n n u u u un n n nd d d de e e er r r r 1 1 1 1 s s s se e e ec c c co o o on n n nd d d d 2. Evolution of moments during diffusion-controlled growth

44

DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on

45

DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:

46

REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

47

MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units

48

Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper

2012-02-20T23:59:59.000Z

49

www.eia.gov  

U.S. Energy Information Administration (EIA)

... is through August, the latest data available",,,,, ,"Norfolk, VA","Baltimore, MD","Mobile, AL","New Orleans, LA","Detroit, MI","Seattle, ...

50

Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-10-01T23:59:59.000Z

51

Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel

2010-01-01T23:59:59.000Z

52

MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-12-01T23:59:59.000Z

53

Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)

2011-12-01T23:59:59.000Z

54

A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)

2012-07-15T23:59:59.000Z

55

Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.

1997-10-01T23:59:59.000Z

56

OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown

2013-10-01T23:59:59.000Z

57

In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma

2013-06-01T23:59:59.000Z

58

NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk

59

miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay

60

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA

62

20080310arm2008_norfolk_pos.ppt  

NLE Websites -- All DOE Office Websites (Extended Search)

Introduction: Introduction: An active remote-sensing using radar and/or lidar can provide the vertical structure of cloud properties. Okamoto et al. [2007] showed the vertical cloud structure over the Pacific Ocean near Japan using radar and lidar on the Research Vessel Mirai during MR01/K02 cruise (May 2001). This study reports the substitute result by a nest-grid simulation using a three dimensional non-hydrostatic model with a spectral bin microphysics for clouds. Model Description: A numerical model for atmospheric dynamics used in this study is based on a multi-purpose non-hydrostatic atmospheric model developed by the Japan Meteorological Agency (JMA-NHM) [Saito et al., 2006]. We replaced the original bulk-type cloud microphysical scheme with a bin-type

63

Norfolk, Massachusetts: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

195426°, -71.3250563° 195426°, -71.3250563° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.1195426,"lon":-71.3250563,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

64

miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li

2009-01-01T23:59:59.000Z

65

Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)

2010-01-01T23:59:59.000Z

66

DEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE  

E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.

67

Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)

2012-07-01T23:59:59.000Z

68

File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload

69

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See Block 16C I  

National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)

70

MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.

2011-05-01T23:59:59.000Z

71

Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab

2007-03-01T23:59:59.000Z

72

Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A

2008-01-01T23:59:59.000Z

73

T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab

2012-02-11T23:59:59.000Z

74

Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester

2012-07-01T23:59:59.000Z

75

PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos

2008-06-27T23:59:59.000Z

76

LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance

77

Norfolk County, Virginia: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

41°, -76.247912° 41°, -76.247912° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":36.9414041,"lon":-76.247912,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

78

Microsoft PowerPoint - Lamb_et_al_Norfolk_Poster  

NLE Websites -- All DOE Office Websites (Extended Search)

AMF 2006 Niamey Radiosonde AMF 2006 Niamey Radiosonde Data: Some Preliminary Results Peter J. Lamb 1 , Abdelkrim Ben Mohamed 2 , Mark Miller 3 , Ibrah Seidou Sanda 2 , Hamidou Hama 4 , Abebe Abdou Adam 5 1 University of Oklahoma-CIMMS, 2 Université Abdou Moumouni, 3 Rutgers University, 4 ASECNA-Niger, 5 ACMAD Introduction The 2006 ARM Mobile Facility (AMF) deployment in Niamey in support of the RADAGAST component of the AMMA Programme brought out a more complete picture of the Sahelian atmospheric environment. This poster presents an analysis of the AMF rawinsonde soundings made in Niamey between January 07, 2006 and January 07, 2007. This is a comprehensive study of all soundings considered together and at the principal synoptic observation times (0000, 0600, 1200, and 1800 UTC). The analysis focuses on temperature, humidity,

79

Norfolk, New York: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

8008872°, -74.9910336° 8008872°, -74.9910336° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.8008872,"lon":-74.9910336,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

80

Microsoft PowerPoint - ARM2008_norfolk.ppt  

NLE Websites -- All DOE Office Websites (Extended Search)

Properties from CloudSat and ARM Observations at Manus Island Zheng Zheng Liu, Roger Liu, Roger Marchand Marchand , and Thomas Ackerman , and Thomas Ackerman University of Washington Sally McFarlane Sally McFarlane Pacific Northwest National Laboratory 2 Motivation * Radiative heating is important * Cloud vertical differential heating affects local convective dynamics * Horizontal differential heating helps to maintain large scale tropical dynamics * Challenge and solution * Radiative heating calculation requires information about vertical structures of cloud properties * CloudSat mission: a cloud radar in space provide opportunity to observe vertical structure of cloud in global coverage. * Together with ARM surface measurements, it enable us to compare the heating rates retrievals from different perspectives.

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

NORFOLK STATE (0-0) VIRGINIA STATE (0-0)  

E-Print Network (OSTI)

Mills Jr. Dr. Thomas Stanley Roehr Dr. Thomas Glenn Sidor Dr. Arthur Marshall Spencer III Class of 1974 Class of 1995 15.8% Class Participation Dr. Lara Lee Allison Dr. Bernard Austin Bean Jr. Dr. Johanna B. Butler Clifford S. Campbell Jr. and Frances Sinback Campbell Sandra and Curly Cook Larry Randall

Noakes, David R.

82

Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.

2003-12-01T23:59:59.000Z

83

Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available

2011-10-01T23:59:59.000Z

84

Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.

2006-08-29T23:59:59.000Z

85

Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-

2009-01-01T23:59:59.000Z

86

Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan

2008-01-01T23:59:59.000Z

87

Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah

2011-04-21T23:59:59.000Z

88

Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI

2012-06-01T23:59:59.000Z

89

A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.

2008-06-01T23:59:59.000Z

90

Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan

2008-09-30T23:59:59.000Z

91

NONPROFIT ORG DETROIT, MI  

E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor

92

Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use

93

Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.

94

Self-reported parkinsonian symptoms in the EPIC-Norfolk cohort  

E-Print Network (OSTI)

. Neurol Clin 2001, 19:565-78, vi. 16. Wszolek ZK, Markopoulou K: Olfactory dysfunction in Parkin- son's disease. Clin Neurosci 1998, 5:94-101. 17. Doty RL, Bromley SM, Stern MB: Olfactory testing as an aid in the diagnosis of Parkinson's disease...

Ishihara, Lianna S; Khaw, Kay-Tee; Luben, Robert; Bingham, Sheila; Welch, Ailsa; Day, Nicholas E; Brayne, Carol

2005-08-24T23:59:59.000Z

95

A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada

2005-09-01T23:59:59.000Z

96

The local dimensions of defence: the standing army and militia in Norfolk, Suffolk and Essex, 1649-1660  

E-Print Network (OSTI)

particular interest in the protection of the coast of the Eastern Counties. 1.3.4 tf~mufacture The wool-weaving industry was the dominant manufacturing activity in the Eastern Counties. At the end of the sixteenth century, better quality cloths, the 'new...

Ive, Jeremy George Augustus

1987-03-13T23:59:59.000Z

97

Breast cancer risk in relation to urinary and serum biomarkers of phytoestrogen exposure in the EPIC-Norfolk study  

E-Print Network (OSTI)

isoflavone daidzein: exploring the relevance to human health. Exp Biol Med (Maywood) 2005, 230:155-170. 8. Adlercreutz H, Bannwart C, Wahala K, Makela T, Brunow G, Hase T, Arosemena PJ, Kellis JT Jr, Vickery LE: Inhibition of human aro- matase by mammalian...

Ward, Heather A; Chapelais, Gaelle; Kuhnle, Gunter G C; Luben, Robert; Khaw, Kay-Tee; Bingham, Sheila

2008-04-17T23:59:59.000Z

98

Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997

99

MI ROPYROLIZER FOR RAPID IOIDENTIFI ATION  

POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...

100

MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...

102

Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...

103

Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...

104

Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...

105

Oracle at Trec8: A Lexical Approach  

Science Conference Proceedings (OSTI)

... CATEGORY: rail transportation Conrail, Incorporated Amtrak Association of American Railroads Norfolk Southern Corporation Southern Pacific ...

2000-02-08T23:59:59.000Z

106

Oracle at Trec8: A Lexical Approach1  

Science Conference Proceedings (OSTI)

... Conrail, Incorporated Amtrak Association of American Railroads Norfolk Southern Corporation Southern Pacific Union Pacific Corporation ...

2000-02-04T23:59:59.000Z

107

Dietary, lifestyle and clinicopathological factors associated with BRAF and K-ras mutations arising in distinct subsets of colorectal cancers in the EPIC Norfolk study  

E-Print Network (OSTI)

was defined as fish where fat is dis- tributed throughout the flesh, such as herring and mackerel. Shellfish were not included in either fish cate- gory. Fruit consumption was defined as intake of fruits in all forms, including fruit included in composite...

Naguib, Adam; Mitrou, Panagiota N; Gay, Laura J; Cooke, James C; Luben, Robert; Ball, Richard Y; McTaggart, Alison; Arends, Mark J; Rodwell, Sheila A

2010-03-16T23:59:59.000Z

108

PHASE II CHARACTERIZATION SURVEY OF THE USNS BRIDGE (T AOE 10), MILITARY SEALIFT FLEET SUPPORT COMMAND, NAVAL STATION, NORFOLK, VIRGINIA DCN 5180-SR-01-0  

SciTech Connect

In March 2011, the USNS Bridge was deployed off northeastern Honshu, Japan with the carrier USS Ronald Reagan to assist with relief efforts after the 2011 T?hoku earthquake and tsunami. During that time, the Bridge was exposed to air-borne radioactive materials leaking from the damaged Fukushima I Nuclear Power Plant. The proximity of the Bridge to the air-borne impacted area resulted in the contamination of the ships air-handling systems and the associated components, as well as potential contamination of other ship surfaces due to either direct intake/deposition or inadvertent spread from crew/operational activities. Preliminary surveys in the weeks after the event confirmed low-level contamination within the heating, ventilation, and air conditioning (HVAC) ductwork and systems, and engine and other auxiliary air intake systems. Some partial decontamination was performed at that time. In response to the airborne contamination event, Military Sealift Fleet Support Command (MSFSC) contracted Oak Ridge Associated Universities (ORAU), under provisions of the Oak Ridge Institute for Science and Education (ORISE) contract, to assess the radiological condition of the Bridge. Phase I identified contamination within the CPS filters, ventilation systems, miscellaneous equipment, and other suspect locations that could not accessed at that time (ORAU 2011b). Because the Bridge was underway during the characterization, all the potentially impacted systems/spaces could not be investigated. As a result, MSFSC contracted with ORAU to perform Phase II of the characterization, specifically to survey systems/spaces previously inaccessible. During Phase II of the characterization, the ship was in port to perform routine maintenance operations, allowing access to the previously inaccessible systems/spaces.

NICK A. ALTIC

2012-08-30T23:59:59.000Z

109

A Study of Air Quality in the Southeastern HamptonNorfolkVirginia Beach Region with Airborne Lidar Measurements and MODIS Aerosol Optical Depth Retrievals  

Science Conference Proceedings (OSTI)

A study of air quality was performed using a compact, aircraft aerosol lidar designed in the Science Directorate at NASA Langley Research Center and Moderate Resolution Imaging Spectroradiometer (MODIS) aerosol optical depth (AOD) retrievals. ...

Jasper Lewis; Russell De Young; D. Allen Chu

2010-01-01T23:59:59.000Z

110

Register as a New User  

Science Conference Proceedings (OSTI)

... Nigeria, Norfolk Island, Norway, Oman, Pakistan, Palau, Panama, Papua New Guinea, Paraguay, Peru, Philippines, Pitcairn Island, Poland, Ponape, Portugal...

111

DOE Solar Decathlon: News Blog Blog Archive DOE Announces...  

NLE Websites -- All DOE Office Websites (Extended Search)

at Lowell (Boston and Lowell, Massachusetts) Middlebury College (Middlebury, Vermont) Old Dominion University and Hampton University (Norfolk and Hampton, Virginia)...

112

DOE Solar Decathlon: News Blog 2010 April  

NLE Websites -- All DOE Office Websites (Extended Search)

at Lowell (Boston and Lowell, Massachusetts) Middlebury College (Middlebury, Vermont) Old Dominion University and Hampton University (Norfolk and Hampton, Virginia)...

113

Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P

2003-01-01T23:59:59.000Z

114

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...

115

Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...

116

A FUNDAMENTAL REAKTHROUGH IN HEAT TRANSFER TE HNOLOGY FOR MI ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION

117

Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)

118

Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael

2008-01-01T23:59:59.000Z

119

MI ROFA RI ATED FIELD ALI RATION ASSEM LY  

Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as

120

MI ROFA RI ATED FIELD ALI RATION ASSEM LY  

Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

NEVADA BUREAU OF MINES AND GEOLOGY SPECIAL PUBLICATION MI-1996  

E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.

122

NEVADA BUREAU OF MINES AND GEOLOGY SPECIAL PUBLICATION MI-1994  

E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.

123

Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...

124

Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...

125

Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...

126

Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...

127

Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...

128

Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...

129

Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...

130

Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...

131

Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...

132

Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...

133

St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...

134

Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...

135

Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...

136

St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...

137

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...

138

Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...

139

Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...

140

Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...

142

ENERGY SURETY MI ROGRID - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment assists in planning and analysis of potential risks

143

miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha

2012-01-01T23:59:59.000Z

144

Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.

145

U.S. International Trade in Goods and Services | Data.gov  

NLE Websites -- All DOE Office Websites (Extended Search)

xtile,nonwool,Noonan,Norfolk,DAKOTA,CAROLINA,North,Northern,Northgate,Norton,Norway,Noyes,Nuclear,Numismatic,Nursery,Nuts,NV,NY,NYACC,Oakland,Oakland-Pontiac,oats,Ocala,Ocean,Ogden...

146

Processing and Performance II  

Science Conference Proceedings (OSTI)

Oct 10, 2012... over conventional high-strength steels used for current automobiles. ... of Norfolk Southern's new public relations effort 21st Century Steam.

147

Chicago Office 9800 South Cass Avenue  

NLE Websites -- All DOE Office Websites (Extended Search)

SEP 29 2010 Mr. Ian Smith Research Assistant, Laboratory Investigations Division People for Ethical Treatment of Animals 501 Front Street Norfolk, VA 23510 Dear Mr. Smith:...

148

CX-002164: Categorical Exclusion Determination | Department of...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Categorical Exclusion Determination Virginia-Maryland-District of Columbia Public Ethanol-85 Fueling Project CX(s) Applied: B5.1 Date: 05042010 Location(s): Norfolk,...

149

U.S. DEPARTMENT OF ENERGY - NETL CATEGORICAL EXCLUSION (CX) DESIGNATIO...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1012006 - 09302010 1560 Mall Drive Norfolk, Virginia 23511 VA-MD-DC Public E85 Fueling Project The proposed action will install public E85 fueling infrastructure at...

150

Portraits of the Sun: Violence, Gender, and Nation in the Art of Shiraga Kazuo and Tanaka Atsuko  

E-Print Network (OSTI)

to Challenge the Midsummer Burning Sun." Gutai 3 (1955): 24.Dazai, Osamu. The Setting Sun. Norfolk: J. Laughlin, 1956.and Sachiko Nakajima. Rising Suns, Rising Daughters: Gender,

Kunimoto, Thalia Namiko

2010-01-01T23:59:59.000Z

151

United States Government  

Office of Legacy Management (LM)

l National Smelt & Refining, Cleveland, O h io l Sutton, Steele & Steele, Dallas, Texas l Norfolk Naval Station, Virginia In each case, the potential for radiological...

152

United States Government  

Office of Legacy Management (LM)

l National Smelt & Refining, Cleveland, Ohio l Sutton, Steele & Steele, Dallas, Texas l Norfolk Naval Station, Virginia In each case, the potential for radiological...

153

Step-by-Step Instructions  

NLE Websites -- All DOE Office Websites (Extended Search)

Hampden Hampshire Middlesex Nantucket Norfolk Plymouth Suffolk Worcester Windows Insulation Foundation Fenestration U-Factor Skylight U-Factor Glazed Fenestration SHGC Ceiling...

154

S. Crewell  

NLE Websites -- All DOE Office Websites (Extended Search)

Chile, 2009 ARM Science Team Meeting, 10-14 March, Norfolk, VA Reconstruction of humidity field " IWV measured with HATPRO shows similar dependence on azimuth direction as...

155

SEMIPERMEA LE MEM RANES FOR MI ROMA HINED SILI ON SURFA ES 5 US ...  

co-fabricated filtration system for enhancement of ... increases functionality and integration of micro ... for the U.S. Department of Energys National Nuclear ...

156

Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

DOE Green Energy (OSTI)

gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.

2006-08-29T23:59:59.000Z

157

ANRV286-MI60-17 ARI 25 May 2006 23:56 The Bacterial  

E-Print Network (OSTI)

Molecular Genetics and Microbiology, University of Texas, Austin, Texas 78712-0231; email: philipl energy-transducing membranes (133). It is widespread within the microbial world and in plants. Homologs

Georgiou, George

158

UCRL-MI-224010 ARM-06-012 ARM's Support for GCM Improvement:...  

NLE Websites -- All DOE Office Websites (Extended Search)

updrafts. Because the total mass of water condensed into clouds is controlled by thermodynamics, a greater number of droplets for the same mass of cloud water means that the...

159

May All Good Things Gather Here: Life, Religion and Marriage in a Mi nyag Tibetan Village  

E-Print Network (OSTI)

;#15; #29;#31;#3;#14;#12; 3 #11;#5;#12;#6;#3;#20; #8;#20; #31;#6;#7; #29;#7;#5;8#16;#11;#3; #14; #15;#7;#5;#14;#3;#19;#5;#17;.#7;#5; #5;#14; #14;#5;#7;#8; #5;#7;#8;#11;#12; #6;#5;#20;#5;9 : ?@AB@A : >C?DEFGH@AB@A : CIH@AB@A : EKDLMAB@A : N...

Bkra shis bzang po

2012-01-01T23:59:59.000Z

160

"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

May ________. A vistas la pornografa. Primera Hora, 22la medida contra la pornografa. El Nuevo Da, 13 Junecomunicacin contra la pornografa. El Nuevo Da, 16 May

Rivera, Petra Raquel

2010-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Classes Are Starting Soon! Prof"..roMI Photography G,aph~ o..,rgn  

E-Print Network (OSTI)

Simone Gori and Val HamburQer, then atthe UnOiersily of FreiburQ in Germany, is a noyel Yariation ofthe .... S~deshows > Mind~Br'" Combiml1iOll of the RO'il1illU_liKed_lilies ""d Enigma Gori and HamburQer

162

Superfund Record of Decision (EPA Region 5): Wash King Laundry, Baldwin, MI, March 1993  

SciTech Connect

This decision document presents the selected remedial action for the Wash King Laundry Superfund site in Baldwin, Pleasant Plains Township, Michigan. The groundwater remedial action consists of the following: groundwater monitoring; deed restrictions; and groundwater extraction with physical/chemical treatment. The lagoon remedial action consists of the following: excavation of contaminated sediments and soils and off-site disposal.

1993-03-01T23:59:59.000Z

163

Characterization of UNUSUAL LATERAL ORGANS : a miRNA regulated F-Box protein  

E-Print Network (OSTI)

between ULO and the HD-ZIP proteins in planta. Anotherof homodomain-leucine zipper (HD-Zip) proteins. Plant SignalKANADI and class III HD-Zip gene families regulate embryo

Smith, Peter Thomas

2009-01-01T23:59:59.000Z

164

Integrated modeling within a Hydrologic Information System: An OpenMI based approach  

Science Conference Proceedings (OSTI)

This paper presents a prototype software system for integrated environmental modeling that provides interoperability between the Consortium of Universities for the Advancement of Hydrologic Science, Inc. (CUAHSI) Hydrologic Information System (HIS) and ... Keywords: Data management, Environmental management, Integrated modeling, Systems analysis

Anthony M. Castronova; Jonathan L. Goodall; Mehmet B. Ercan

2013-01-01T23:59:59.000Z

165

"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

Puertorriquea. Humacao, Puerto Rico: Editorial Furidi,and Colonization of Puerto Rico, 1493-1599. San Juan: Centroand U.S. Imperialism in Puerto Rico. Berkeley: University of

Rivera, Petra Raquel

2010-01-01T23:59:59.000Z

166

"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn.  

E-Print Network (OSTI)

??My dissertation examines entanglements of race, place, gender, and class in Puerto Rican reggaetn. Based on ethnographic and archival research in San Juan, Puerto Rico, (more)

Rivera, Petra Raquel

2010-01-01T23:59:59.000Z

167

Ruofan Wu, Hieu Pham Trung Nguyen and Zetian Mi INTRODUCTION TO LEDs  

E-Print Network (OSTI)

-in-a-Wire Light Emitting Diodes and Prevention Method Nano-electronic Devices and Materials, Electrical Computer., Efficiency droop in nitride-based light-emitting diodes. Physica Status Solidi a-Applications and Materials history. Nature Photonics 2007, 1 (4), 189-192. [4] Holonyak, N., Is the light emitting diode (LED

Barthelat, Francois

168

Informa(on and Resources Water Quality and Mi/ga/on: Bifenthrin and Fipronil  

E-Print Network (OSTI)

strategy, Pesticides fluxes, Surface water, Vineyard Introduction The intensive use of pesticides for crop on the mobilisation of pesticides and total fluxes in surface water. Moreover, the effect of the sampling strategy ranged from 1.0 to 60 g. Effect of sampling strategy on the estimation of pesticides fluxes in the river

Hammock, Bruce D.

169

Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in  

E-Print Network (OSTI)

Universidad Católica de Chile, Santiago 8331010, Chile; b Department of Plant and Soil Sciences, Delaware activated cell sorter (FACS) and extracted total RNA as described previously (9). KNO3 treat- ment induced

Green, Pamela

170

Technical Section: CHuMI viewer: Compressive huge mesh interactive viewer  

Science Conference Proceedings (OSTI)

The preprocessing of large meshes to provide and optimize interactive visualization implies a complete reorganization that often introduces significant data growth. This is detrimental to storage and network transmission, but in the near future could ... Keywords: Interactive visualization, Large meshes, Lossless compression, Out-of-core

Clment Jamin; Pierre-Marie Gandoin; Samir Akkouche

2009-08-01T23:59:59.000Z

171

LAT HING MI RO OPTI AL SWIT H - Home - Energy Innovation ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2013-10084P

172

Still Seeking 1%Other 3% Post Graduate Activities  

E-Print Network (OSTI)

, and combustion. The Master of Engineering Degree (M.Eng.) is a flexible nine- month program of advanced Systems Missile Defense Agency Navigant Consulting Norfolk Naval Shipyard Northern Power Systems Northrop

Lipson, Michal

173

u.s. DI!PARTlIIENT OF ENERGY EERE PROJECT MANAGEMENT CENTER  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CENTER NlPA DETERJ.llNATION RECIPIENT:Norfolk State University PROJECf TITLE: Cost Effective Polymer Solar Cells Research and Education Page 1 of2 STATE: VA Funding...

174

Admiral John M. Richardson | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

U.S. 6th Fleet; Chief of Staff, U.S. Naval Forces Europe and U.S. Naval Forces Africa, in Naples, Italy; and Commander, Naval Submarine Forces in Norfolk, Virginia. His...

175

CX-002843: Categorical Exclusion Determination  

Energy.gov (U.S. Department of Energy (DOE))

Evergreen Energy Efficiency RetrofitCX(s) Applied: B5.1Date: 07/01/2010Location(s): Norfolk, VirginiaOffice(s): Energy Efficiency and Renewable Energy, Golden Field Office

176

RTG_min_10-4-07_final  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

of Ohio Ralph Hail, Norfolk Southern Lisa Janairo, CSG-MW Paul Johnson, ORNL Candice Jordan, ECA Marsha Keister, INL Mel Massaro, DOTFRA Doug Osborn, SNL Cort Richardson, CSG-NE...

177

Integration of Molecular Networks in the Shoot Apical Meristem that Controls Floral Specification in Arabidopsis thaliana  

E-Print Network (OSTI)

lycopersicum_miR156b Solanum_lycopersicum_miR156c Sorghum_bicolor_miR156a Sorghum_bicolor_miR156b Sorghum_bicolor_miR156c Sorghum_

Lal, Shruti

2011-01-01T23:59:59.000Z

178

Atliekinio fosfogipso panaudojimas sunki?j? metal? immobilizacijai nuotek? dumble ir dumblo-dirvoemio miiniuose.  

E-Print Network (OSTI)

??Nuotek? dumble esan?i? sunki?j? metal? neigiam? poveik? aplinkai bei mogaus sveikatai galima sumainti apribojant metal? judrum? aplinkoje. Magistro darbe tiriamas sunki?j? metal? judrumas ir j? (more)

Puodi?nas,; Marius

2009-01-01T23:59:59.000Z

179

Creative Reconstruction in the City: An Analysis of Art, Shrinking, and the Story of the American Dream in Detroit, MI.  

E-Print Network (OSTI)

??A right to the city is a human right that is overlooked in American cities. Cities reflect humanity in collective form, but are manipulated by (more)

Marotta, Stephen J.

2011-01-01T23:59:59.000Z

180

1996 Department of Energy pre-freshman enrichment program at GMI Engineering and Management Institute, Flint, MI  

SciTech Connect

This document reports on a summer program to encourage students to pursue scientific or engineering professions. The topics of the report include a description of the recruitment program, selection criteria for participants, workshops, nine follow up activities, research projects and student`s presentation, and field trips. Course descriptions and schedule are included as appendices.

1996-12-31T23:59:59.000Z

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

I Volume 5, Number 2 Spring 1992 A Ne\\izsletter for the RLE Community at MI'T  

E-Print Network (OSTI)

:l XI:~ri:l Ticchi. Inq~tiriesmay he ;~ddrcsscdto: RLE undercurrents Rescarcli Lahor:ltory of Electrc

182

Volume 2, Number 2 June 1989 A Nelr-sletter for the KL,t.: Communitv at MI'1'  

E-Print Network (OSTI)

Lahoratory of Electrc~nicsfor the RLE community at MIT. The following individuals contributed their time ancl

183

Advanced composites III: expanding the technology; Proceedings of the Third Annual Conference, Detroit, MI, Sept. 15-17, 1987  

Science Conference Proceedings (OSTI)

The present conference discusses topics in the design features and methods, manufacturing processes, secondary fabrication techniques, and materials science aspects of advanced composites. Attention is given to composite structural armor for ground combat vehicles, composite structures for automotive energy management, CAD/CAM of braided preforms for advanced composites, composite automobile bumper beams, preforming for structural applications, the three-dimensional braiding of thermoplastic composite preforms, and recent advancements in tooling technology. Also discussed are instrument-grade MMCs for imaging IR guidance systems, automated tape layup of a vertical stabilizer fin, the mechanical properties of thermoplastic matrix composites, surface chemistry and adhesion of SMCs, fiber-matrix bonding, and hybrid yarns for high performance thermoplastic composites.

Not Available

1987-01-01T23:59:59.000Z

184

LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 2002 Place Time Name Group Group  

E-Print Network (OSTI)

37 192 19:28.7 John Wool 40-49 men 48 193 19:32.4 Jaimin Wan page 7 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS 1st

185

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 1996 Dummy first body page  

E-Print Network (OSTI)

-59 59 668 34:20.7 Seung-yu Rah 30-39 157 669 34:21.4 John Wool 40-49 120 670 34:25.6 Manny Gonzalez 30:42.8 Pete Valerio HISTORY OF LBL RUNAROUND WINNERS

186

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 14, 1990 Place Time Name Group Group  

E-Print Network (OSTI)

:56.4 John Wool 30­39 105 483 30:00.0 David O'Neill ) Group Time Name Overall Place Place 1 24:24.3 John Magee 373 2 25:41.9 Edward Lofgren 400 HISTORY OF LBL

187

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 22, 1995 Dummy first body page  

E-Print Network (OSTI)

198 16:04.7 Alan Meier 40-49 30 199 16:05.7 John Wool 40-49 31 200 16:07.5 Ginny Lackner 50-59F 1 201 Don Krieger Frances Mann Peter Morley Bob Shilling HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION

188

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 10, 1997 Place Time Name Group  

E-Print Network (OSTI)

Larnon, Frank 50-59 13 156 15:17.4 157 15:18.0 Bartholomew, J 50-59 14 158 15:18.4 Wool, John 40-49 18 159 15 Time Name Group Group Place HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN

189

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 15, 1989 Envel. Time Name Group Group  

E-Print Network (OSTI)

40-49 8 67 12:51.4 Desiderio Kovar Wool 30-39 20 69 12:56.7 Antoine Mensch Envelope Place Number 1 21:59.8 John L. Magee 354 2 26:14.8 Ed Lofgren 427 HISTORY OF LBL RUNAROUND WINNERS

190

LBL RUNAROUND RESULTS 2.95 km (1.84 mi) September 16, 1988 Envelope Time Name Group Group  

E-Print Network (OSTI)

120 14:08.2 Z. Mei 30-39 26 121 14:09.5 John Wool 30-39 27 122 14:10.3 Timothy Edberg 30-39 28 123 14 Time Name Envelope Place Number 1 30:14.0 Peter Endt 447 HISTORY OF LBL RUNAROUND WINNERS Year Distance

191

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 11, 1992 Place Time Name Group Group  

E-Print Network (OSTI)

14:26.2 Barry Freifeld Wool 30-39 39 122 14:28.2 Ken Woolfe 40-49 18 123 14 Williams HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS

192

I Volume 7, Number 2 Spring 1994 A Newsleccer for the RLE Communitv at MI'I'  

E-Print Network (OSTI)

Robert J. Birgeneau, Dean of the School of Science and a principal investigator in RLE's Surfaces has his blue belt in karate. Seventh grader Amanda's bowl~ngteam competed in the state finals

193

Corrosion mechanisms of low level vitrified radioactive waste in a loamy soil M.I. Ojovan1  

E-Print Network (OSTI)

Topic: Briefings by environmental groups, industry groups, pub- lic policy groups, and state, is the central authority responsi- ble for evaluating and supervising the nuclear industry's research and 1.95 meters in diameter. It is fabricated from forged steel with a stainless steel coating. The cask

Sheffield, University of

194

Informa(on and Resources Prac&ces for Mi&ga&ng Urban Pes&cide Runoff  

E-Print Network (OSTI)

. Producers can then use these records to analyze the effectiveness of past pesticide applications a documentation system for determining crop replant, rotation and #12;Pesticide Recordkeeping 2 prePI-20 Pesticide Recordkeeping 1 Michael Aerts, O. Norman Nesheim, and Frederick M. Fishel2 1

Hammock, Bruce D.

195

Microsoft Word - Sample Abstract and Format Instructions.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Dearborn, MI 48128, Wayne State University 2 , Department of Physics and Astronomy, Detroit, MI 48202, Kettering University 3 , Flint, MI 48504, University of Paris-Sud 4 ,...

196

Language Assimilation Today: Bilingualism Persists More Than in the Past, But English Still Dominates  

E-Print Network (OSTI)

Somerset- Hunterdon, NJ Detroit, MI Table 2 Childrens homeSomerset- Hunterdon, NJ Detroit, MI Bergen-Passaic, NJSomerset- Hunterdon, NJ Detroit, MI Appendix Table 2

Alba, Richard

2004-01-01T23:59:59.000Z

197

Former Worker Program - Defunct Beryllium Vendor Screening Program  

NLE Websites -- All DOE Office Websites (Extended Search)

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Wolverine Tube Division (Detroit, MI); National Beryllia (Haskell, NJ);...

198

Beryllium Vender Screening Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Speedring Systems, Inc. (Detroit, MI); Wolverine Tube Division...

199

--No Title--  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Michigan Total Sum City, County, and SEO Allocations All 76,601,500 MI Michigan State Energy Office 19,599,600 MI Ann Arbor City 1,243,400 MI Battle Creek City 545,100...

200

Non-traumatic Shoulder Dislocation  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, MI Supervising SectionFord Hospital, 2799 W. Grand Blvd, Detroit, MI 48201. Email

Manteuffel, Jacob

2009-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Whither the Keiretsu, Japan's Business Networks? How Were They Structured? What Did They Do? Why Are They Gone?  

E-Print Network (OSTI)

Construction Nippon Flour Mills Kirin Brewery Oji PaperSa Textile NIPPON FLOUR MILLS Mi Food TORAY INDUSTRIES Mi

Lincoln, James R.; Shimotani, Masahiro

2009-01-01T23:59:59.000Z

202

Microsoft PowerPoint - Conf 10 PPT Template  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

The Institution of Choice The Institution of Choice Annemarie Delgado, MA, MPA, CRA Assistant Director Office of Sponsored Programs Assistant Director, Office of Sponsored Programs Norfolk State University 700 Park Avenue Norfolk, VA 23504 757-823-9053 adelgado@nsu.edu g @ www.nsu.edu Small Businesses Leading the Way to Recovery and Reinvestment Page 1 Overview of Norfolk State University (NSU) Established 1935 The largest HBCU in Virginia Dr. Carolyn W. Meyers, 4 th president of NSU Academics - Seven Colleges/Schools: College of Science, Engineering, and Technology College of Liberal Arts School of Business School of Business School of Social Work School of Education School of Extended Learning ll Honors College Ph.D. in Materials Science & Engineering, Social Work, and a joint doctoral

203

Epigenetic Alterations in High and Low LET Radiation Induced...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the unstable clones. Among these, altered miRNA expression could be validated by qRT-PCR for mmu-miR-466g, hsa-miR-30a and hsa- miR-195. Hsa-miR-30a and hsa-miR-195 were...

204

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI  

Science Conference Proceedings (OSTI)

The principal objective of the study was to test a new analytical technique, Solid-Phase Microextraction (SPME), for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. This involved measuring the effectiveness of SPME to extract hydrocarbons under controlled conditions in the laboratory. As part of the study, a field demonstration was undertaken to assess the validity and usefulness of the laboratory results. Presented in this quarterly report is the condensed version of the Case History and Well Summary for the Bear Lake area in Manistee County, Michigan. The full version will be in the annual report. The condensed case history presents the important technical details regarding the geochemistry and horizontal lateral for Bear Lake, as well as the field demonstration results and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and will be used on all subsequent field demonstrations as they near completion.

James R. Wood; W. Quinlan

2003-04-01T23:59:59.000Z

205

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

The geochemical sampling team collected additional 148 samples at Vernon Field along 5 new traverses. Most of the locations were sampled for three types of analyses: microbial, iodine and enzyme leach; no results from the second batch of samples were available in time for this report. In addition to the sampling, a study was begun on the feasibility of collecting and analyzing hydrocarbon gases (C1-C8) directly. Although several companies offer these services, the cost ($200-300/sample w/o sampling fee) is high, on par with the cost of a 3D seismic survey, and may not include the raw data. However direct sampling of reservoir gases collecting in the soil appear to offer the best approach and should be included in this study. It would probably work well at Vernon Field. It may be possible to lower costs considerably; initial estimates of $20/sample for GCMS (Gas Chromatography--mass spectrometry) analysis are attractive and might induce to Michigan producers to include soil surveys in their routine field work-ups. A complete set of digital data was assembled for Vernon Field and nearby locations. The set consists of well locations, formation top picks, lithologies and scanned images of driller's reports and scout tickets. Well logs are still being located. The annual meeting for the Class Revisit work group is tentatively scheduled for the week of March 1-7 in Tampa, Fl. By that time all of the geochemical data will be available and final decisions regarding drilling can be made.

James R. Wood; T.J. Bornhorst; S.D. Chittichk; William B. Harrison; W. Quinlan

2001-01-01T23:59:59.000Z

206

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

A principal goal of the Budget Period I was to demonstrate that surface geochemistry could be used to locate bypassed hydrocarbons in old fields. This part of the program was successful. A surface geochemical survey, employing 5 different techniques, was carried out in the Spring and Summer of 2000 and a demonstration well, the State Vernon & Smock 13-23 HD1 (permit number: PN 53945) was drilled in Vernon Township, Isabella County, Michigan in the late fall of 2000. A demonstration well was selected and drilled based on geologic considerations and surface geochemistry. Over 460 soil samples were collected and analyzed over the drill site. A good anomaly was detected near the proposed well site and the demonstration well, the Smock 13-23, was drilled to a depth of 3157 feet by November 17, 2000. Two laterals were drilled, and hydrocarbons were located in a zone approximately 175 feet in length. However, it was determined that the pay zone was too small and difficult reservoir conditions (water production) prevented putting the well in production. The Smock 13-23 was shut in and abandoned January 15, 2001. A post-mortem determined that the main reason the well was not economic was because the zone was nearly completely flushed by earlier recovery operations. The post mortem also revealed the presence of an unmapped shale plug crossing the first lateral. It appears that this shale was detected by the geochemical survey, but its significance was not appreciated at the time. It is possible that sections of the well were faulty, ''porposing'' up and down so as to create water blockages. We are continuing to use the Vernon Field and the demonstration well to calibrate the geochemical data. Eventually, this study may provide a standard site that can be used to test and calibrate geochemical anomalies, something that does not presently exist. A postmortem report on the well, including the geology and geochemistry used to site the well, is presented in Appendix I. Five geochemical techniques have been tested in Phase I. These include surface iodine, microbial, enzyme leaching, soil gas and subsurface iodine. We are most comfortable with the results of the microbial surveys but feel that direct measurement of soil gas is the best method if analytical difficulties can be overcome. The reason the microbial surveys are presently favored is because they provide a logical, consistent picture that is easy to interpret and easy to explain. This in turn is because the microbial anomaly is manifested as an ''apical'' as opposed to an ''edge'' or ''halo'' anomaly. Several lessons were learned during Phase I activities. The main one was that surface geochemistry could locate anomalies over old fields such as Vernon. We also learned that horizontal drilling has advantages and disadvantages in situations such as this. On the plus side, it does provide a means to probe for pockets of bypassed oil, but it is expensive relative to vertical (or slant wells?) and is difficult to control in a narrow pay zone. We tentatively conclude that horizontal wells do not provide a cost-effective solution in this setting and suggest that geochemical anomalies be investigated via a single vertical well or multiple vertical wells.

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan; E. Taylor

2001-07-31T23:59:59.000Z

207

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTRY, MI  

Science Conference Proceedings (OSTI)

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. A major part of the remaining project will focus on using surface geochemistry to delineate prospects. A Niagaran reef field geochemical survey, the Bagley Prospect area in Otsego County, Michigan is scheduled to take place this summer. Previous wells drilled in Bagley Prospect area in the early 1970's and in place in late 2002 and early 2003 resulted in discoveries and numerous hydrocarbon shows in the Brown Niagaran reservoir interval. The Bagley region is still considered an area of interest by the industry and appears ripe for a geochemical survey. Our industry partner is interested in a possible test in the Bagley prospect because subsurface geophysical and geological interpretation indicates the presence of structures. Anomalous production and pressure data further suggest the region is not yet well understood and should not be considered mature. The most recent well, the Bagley 1-22A sidetrack, was unsuccessful at locating a new reef culmination to the south of the original vertical well and did not encounter hydrocarbon shows. The sidetrack and well were plugged and abandoned. The proposed geochemical survey will concentrate on areas away from the Bagley 1-22A to the north and west but will include the entire prospect so that the existing data can be used in interpretations. Bagley appears to offer a unique combination of potential and data for a geochemical study that focuses on looking for new oil in an area that has exhausted traditional geologic and geophysical methods. The Bear Lake pinnacle reef trend in Manistee County, Michigan, is also scheduled for further geochemical work this summer. Industry interest, mostly by small companies, is picking up in this area and it is also ripe for targeted geochemical surveys for the same reasons cited above.

James R. Wood; A. Wylie; W. Quinlan

2004-04-01T23:59:59.000Z

208

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI  

Science Conference Proceedings (OSTI)

One of the main objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. As part of the project, several field demonstrations were undertaken to assess the validity and usefulness of the microbial surface geochemical technique. The important observations from each of these field demonstrations are briefly reviewed in this annual report. These demonstrations have been successful in identifying the presence or lack of hydrocarbons in the subsurface and can be summarized as follows: (1) The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path of the State Springdale & O'Driscoll No.16-16 horizontal demonstration well in Manistee County, Michigan. The well was put on production in December 2003. To date, the well is flowing nearly 100 barrels of liquid hydrocarbons per day plus gas, which is a good well in Michigan. Reserves have not been established yet. Two successful follow-up horizontal wells have also been drilled in the Springdale area. Additional geochemistry data will be collected in the Springdale area in 2004. (2) The surface geochemistry sampling in the Bear Lake demonstration site in Manistee County, Michigan was updated after the prospect was confirmed and production begun; the original subsurface and seismic interpretation used to guide the location of the geochemical survey for the Charlich Fauble re-entry was different than the interpretation used by the operator who ultimately drilled the well. As expected, the anomaly appears to be diminishing as the positive (apical) microbial anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir. (3) The geochemical sampling program over the Vernon Field, Isabella County, Michigan is now interpreted as a large negative anomaly associated with the entire field. The results of the State Smock horizontal well and the Bowers 4-25 well confirmed the lack of additional recoverable hydrocarbons in the Vernon Field. (4) The surface geochemistry data showed a strong anomaly in the Myrtle Beach, Burke County, North Dakota area that would justify drilling by itself and even more so in conjunction with the structural interpretation from the geological and geophysical data; the microbial values here were the highest we have observed. The Myrtle Beach geochemical survey indicated a good to excellent prospect which was confirmed by drilling, however, a pipeline has not yet been completed that would allow the wells to be placed into production. We also present in this annual report the results of recent efforts to map carbonate facies tracts in the middle Devonian Dundee and Rogers City Limestones using gamma ray, bulk density, and photoelectric effect geophysical well log amplitudes. This work was undertaken to identify fairways for exploration in the Dundee and Rogers City where surface geochemical techniques could then be used to screen potential leads.

James R. Wood; A. Wylie; W. Quinlan

2004-04-01T23:59:59.000Z

209

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

Two major accomplishments resulted from Phase I. One is the success of the surface geochemistry program, which collected over 800 samples from the site of the 1st demonstration well in Vernon Field and has pretty well provided us with the tools to delineate favorable ground from unfavorable. The second is the recent detailed mapping of the Central Michigan Basin that for the first time revealed the presence of at least two major faults that control the location of many of the reservoirs in the Michigan Basin. These faults were located from structure maps obtained by contouring the surface of the Dundee Formation using top picks from 9861 wells in 14 counties. Faults were inferred where the contour lines were most dense (''stacked'').

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan

2001-10-31T23:59:59.000Z

210

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

The fault study continues to find more faults and develop new techniques to visualize them. Data from the Dundee Formation has been used to document 11 major faults in the Michigan Basin which have now been verified using data from other horizons. These faults control the locations of many of the large anticlinal structures in the Michigan Basin and likely controlled fluid movements as well. The surface geochemistry program is also moving along well with emphasis on measuring samples collected last sampling season. The new GC laboratory is now functional and has been fully staffed as of December. The annual project review was held March 7-9 in Tampa, Florida. Contracts are being prepared for drilling the Bower's prospects in Isabella County, Michigan, this spring or summer. A request was made to extend the scope of the project to include the Willison Basin. A demonstration well has been suggested in Burke County, N. Dakota, following a review of 2D seismic and surface geochem. A 3D seismic survey is scheduled for the prospect.

James R. Wood; T.J. Bornhorst; William B. Harrison; W. Quinlan

2002-04-01T23:59:59.000Z

211

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

In this reporting period, we extended the fault study to include more faults and developed new techniques to visualize the faults. We now have used data from the Dundee Formation to document 11 major faults in the Michigan Basin and are in the process of reviewing data from other horizons. These faults appear to control the locations of many of the large anticlinal structures in the Michigan Basin and likely controlled fluid movements as well. The surface geochemistry program is also moving along well with emphasis on measuring samples collected last sampling season. The new laboratory is now functional and has been fully staffed as of December. The annual project review has been set for March 7-9 in Tampa, Florida. Contracts are being prepared for drilling the Bower's prospects in Isabella County, Michigan, this spring or summer.

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan

2002-01-01T23:59:59.000Z

212

Role of microRNA?155 in dendritic cells and macrophages MiR?155 directly targets PU.1 and IL13R1.  

E-Print Network (OSTI)

??In search of genes differentially expressed between M1 (pro?Th1 or pro?inflammatory) and M2 (pro?Th2 or pro?tolerogenic) macrophages, BIC (microRNA 155 hosting gene) was found up (more)

Martinez?Nunez, Rocio Teresa

2010-01-01T23:59:59.000Z

213

1. (P) M.I. Ojovan, W.E. Lee. New Developments in Glassy Nuclear Wasteforms. Nova Science Publishers, New York, 131p. (2007).  

E-Print Network (OSTI)

xxx Keywords: A. Intermetallics, miscellaneous B. Phase diagrams B. Thermodynamic and thermochemical in the Vienna ab-initio simulation package (VASP) [27]. We used the generalized gradient approximation (GGA, Lamoreaux RH. Molybdenum: physicochemical properties of its compounds and alloys. I. thermochemical

Ojovan, Michael

214

Summary of the EPRI Early Event Analysis of the Fukushima Daiichi Spent Fuel Pools Following the March 11, 2011 Earthquake and Tsuna mi in Japan  

Science Conference Proceedings (OSTI)

Damage to the Fukushima Daiichi Unit 4 reactor building observed on March 15, 2011, initially generated confusion and concern throughout the nuclear industry. The reactor had been defueled approximately 100 days prior to the March 11 earthquake and tsunami; therefore, any explosion in Unit 4 could not be linked to a recently operating reactor within that unit. With the full core in the spent fuel pool, suspicions immediately turned to hydrogen generated by oxidation of overheating spent fuel cladding fol...

2012-05-31T23:59:59.000Z

215

Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

converting any H 2 gas produced to water) and measuring thefor the tritium produced in pore water of the fractured rockfor the tritium produced in pore water of the fractured rock

2006-01-01T23:59:59.000Z

216

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 16, 1994 Place Time Name GroupGroup Place Time Name GroupGroup  

E-Print Network (OSTI)

-49 8 30 11:56.7 Dan Gheng Wool 40-49 1 89 13 of the participants. The official number of finishers was 780, including babies in strollers page 7 #12;HISTORY OF LBL

217

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR; VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, a new field demonstration, Springdale Prospect in Manistee County, Michigan was begun to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path. The main news this reporting period is the confirmed discovery of producing hydrocarbons at the State Springdale & O'Driscoll No.16-16 demonstration well in Manistee County. This well was spudded in late November, tested and put on production in December 2003. To date it is flowing nearly 100 barrels of liquid hydrocarbons per day, which is a good well in Michigan. Reserves have not been established yet. The surface geochemistry sampling at the Springdale demonstration site will be repeated this spring after the well has been on production for several months to see if the anomaly pattern changes. We expect that the anomaly will diminish as the original positive (apical) anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir. This is the behavior that we observed at the Bear lake demonstration well reported last quarter.

James R. Wood; A. Wylie; W. Quinlan

2004-01-01T23:59:59.000Z

218

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

In this reporting period two main accomplishments stand out. The Springdale task is in play in the northern Michigan Basin and the geochemical survey work over the Springdale prospect continued to progress. We still need to characterize the play in terms of the type of trap (basal reef diagenetic (?)) and its relation to the well documented pinnacle reef play. Also, we have become aware that Capac Field in the southern reef trend (Figure 1) is a possible analog to Springdale and so will be looking more closely at the literature on that field, particularly the work by Bowers (1987). Future work is directed toward further defining the Springdale project via more wells and examination and characterization of well cuttings. One to two more geochemical surveys are planned, one this spring and a final one in early fall. Based on current oil prices and Springdale production as of January 2005, an ROI, (defined as Total liquids revenue, $5.45m/DOE support, $1.45m) better than 3.75. This does not include gas revenues, which have not yet been calculated.

James R. Wood; A. Wylie; W. Quinlan

2005-04-01T23:59:59.000Z

219

USING RECENT ADVANCES IN 2ND SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

Science Conference Proceedings (OSTI)

Three horizontal wells have been completed (St. Springdale & Trezil 9-15 HD, St. Springdale 13-14 HD, St. Springdale & Stedronsky 10-15 HD) and three more wells were spudded (St. Springdale & CSX 2-22 HD, St. Springdale & Mann 9-21 HD and St. Springdale 7-22 HD) in the Springdale play this past reporting period. All are horizontal wells in the Brown Niagaran. This brings the total wells in the play to 12 with seven wells contributing to a total daily production exceeding 350 bbls/day. Data from these wells has been converted from drillers logs (footage calls) and converted to Michigan GeoRef coordinates and plotted. The Gamma Ray data along the well bore was available since it was used to steer the tool during drilling and this data was superimposed on the well trajectories in an effort to help distinguish pay zones from unproductive rock. One new geochemical survey was conducted over the projected surface path of the State Springdale & Stedronsky 14-15 HD and a final project survey was planned over one of the unsurveyed wells. This will bring the total surveyed wells to five and should provide enough data to determine if the idea of only sampling along the well bore is a sound strategy.

James R. Wood; A. Wylie; W. Quinlan

2005-06-30T23:59:59.000Z

220

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI  

Science Conference Proceedings (OSTI)

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, plans were finalized for additional surface geochemical sampling in the new Springdale Prospect field demonstration in Manistee County, Michigan. Plans were also developed to acquire additional surface geochemical data in the vicinity of the Bagley Prospect area in Otsego County, Michigan. The main news this reporting period is the continued success in the Springdale demonstration area. The State Springdale & O'Driscoll No.16-16 and the State Springdale & Herban 12-16 horizontal demonstration wells in Manistee County, Michigan are both flowing nearly 100 barrels of liquid hydrocarbons per day plus gas, which are good wells in Michigan. Reserves have not been established yet. A third horizontal well, the State Springdale & Wilburn 1-21 HD has been drilled and is waiting on completion. Two more horizontal wells have been permitted in the Springdale area by our industry partner.

James R. Wood; A. Wylie; W. Quinlan

2004-07-01T23:59:59.000Z

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

One of the principal objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, microbial samples were collected from the Springdale prospect area in Manistee County, Michigan. The samples were taken along the trace of the proposed horizontal wells. The samples are presently being analyzed and the results will be reported in the next quarterly report. The main news this reporting period is that the Springdale prospect area in Manistee County, Michigan, continues to see drilling activity. Our industry partner, Jordan Development Company, LLC, is permitting additional horizontal wells following their success in the prospect area.

James R. Wood; A. Wylie; W. Quinlan

2004-12-31T23:59:59.000Z

222

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI  

SciTech Connect

Presented in this quarterly report is the Case History and Well Summary for the Vernon Field demonstration project in Isabella County, Michigan. This new case history and well summary format organizes and presents the technical and historical details of the Vernon Field demonstration, as well as the field demonstration results and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and will be used on all subsequent field demonstrations as they near completion. Planning for the annual project meeting in Tampa, Florida has begun. This meeting will be held March 7-9, 2003 at the same site as the last three meetings. The goals of this project were to: (1) test the use of multi-lateral wells to recover bypassed hydrocarbons and (2) to access the potential of using surface geochemistry to reduce drilling risk. Two new demonstration wells, the State-Smock and the Bowers 4-25, were drilled to test the Dundee Formation at Vernon Field for bypassed oil. Neither well was commercial, although both produced hydrocarbon shows. An extensive geochemical survey in the vicinity of Vernon Field, covering much of Isabella County, has produced a base map for interpretation of anomalies in Michigan. Several potential new anomalies were discovered that could be further investigated.

James R. Wood; W. Quinlan

2003-01-01T23:59:59.000Z

223

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI  

SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, a new field demonstration, Springdale Prospect in Manistee County, Michigan was begun to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path. The surface geochemistry sampling at the original Bear Lake demonstration site was updated several months after the prospect was confirmed and production begun. As expected, the anomaly appears to be diminishing as the positive (apical) anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir.

James R. Wood; W. Quinlan

2003-10-01T23:59:59.000Z

224

Functional miRNA regulation of metastatic genes promotes tumor cell dissemination in non-small cell and small cell lung carcinomas  

E-Print Network (OSTI)

Tumor progression, from initiation to advanced metastatic disease, requires the orchestration of a diverse group of cell-intrinsic and extrinsic factors. This multifactorial disease is promoted by an accumulation of genetic ...

Blat, Irene Catherine

2013-01-01T23:59:59.000Z

225

Energetics of gas-driven limnic and volcanic eruptions Department of Geological Sciences, The University of Michigan, Ann Arbor, MI 48109-1063, USA  

E-Print Network (OSTI)

and when equilibrium is reached between the gas and liquid phases Natural silicate melts often contain two.3. Dynamics of reversible gas-driven eruptions through a fluid medium Because buoyancy plays an important roleEnergetics of gas-driven limnic and volcanic eruptions Y. Zhang* Department of Geological Sciences

Zhang, Youxue

226

Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

from three different sources (fractured rock, concrete, and+Rock Concentration, no Decay, Rock Source Concentration,Decay, Rock Source Mass Storage, no Decay, Rock Source Mass

2006-01-01T23:59:59.000Z

227

50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links  

E-Print Network (OSTI)

2) and the concentration of 65Cu2+ estimated by the speciation model WHAM (1.0 (28)), we could]e^ equals zero and that [65 Cu2+ ] was constant (i.e., nominal [65 Cu2+ ] ) 5.2-µg L-1). That is, WHAM the speciation model WHAM (28) assuming that the lake water has a pH near 8 (30), a dissolved organic carbon

Allen, Gale

228

Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

nontritium-bearing drilling fluid during the coring process,nontritium-bearing drilling fluid during the coring process,cores be drilled with drilling fluid spiked with a tracer.

2006-01-01T23:59:59.000Z

229

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. As part of the project, a field demonstration was undertaken to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a strong anomaly in the Myrtle Beach area that would justify drilling by itself and even more so in conjunction with the structural interpretation from the 3D seismic data. The Myrtle Beach geochemical survey indicated a good to excellent prospect which was confirmed by drilling. Presented in this quarterly report is the Case History and Well Summary for the Myrtle Beach area in Burke County, North Dakota. This case history presents the important technical details regarding the geochemistry and the two vertical wells that are part of this field demonstration, and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and is being used on all subsequent field demonstrations as they near completion.

James R. Wood; W. Quinlan

2003-07-01T23:59:59.000Z

230

AND FINANCIAL 2011 Edition | EConoMiC And FinAnCiAL PRoFiLE oF QUBEC  

E-Print Network (OSTI)

ENERGY AGENCY. SOURCE: HYDRO-QU?BEC, COMPARISON OF ELECTRICITY PRICES IN MAJOR NORTH AMERICAN CITIES renewable energy, hydro-electricity in particular. It supports the development of wind power through its Energy Strategy 2006-2015, Hydro-Québec is actively pursuing development of Québec's hydroelectric

Rosei, Federico

231

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI  

SciTech Connect

One of the principal objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, microbial samples were collected from the Trusty Steed prospect area in Grand Traverse County, Michigan. The samples were analyzed using the Microbial Oil Surveying Technique (MOST) technique and revealed only a local (1-point) anomaly. A decision to resample over that point is pending, but drilling has been postponed for the time being. The main news this reporting period is that in the Bear Lake area, northwest Michigan, Federated Oil & Gas Properties' Charlich-Fauble 2-9HD horizontal lateral, has cumulative production of more than 72,000 barrels of oil and is still producing 50 to 75 bopd from a Silurian Niagaran reef reservoir eighteen months after the well was completed. Surface geochemical surveys conducted in the demonstration area were consistent with production results although the ultimate decision to drill was based on interpretation of conventional subsurface and 2D seismic data. The surface geochemical techniques employed were Solid Phase MicroExtraction (SPME) and MOST. The geochemical results have been submitted to World Oil for publication. New geochemical surveys are planned for November in the Springdale quadrangle in Manistee County, Michigan. These surveys will concentrate on sampling over the trace of the proposed horizontal wells rather than a broad grid survey.

James R. Wood; A. Wylie; W. Quinlan

2004-10-01T23:59:59.000Z

232

SPECIAL ACTIVITIES ( A ) Classroom Projects  

E-Print Network (OSTI)

-Udvar Hazy Center 4. Spirit of Norfolk For Questions Regarding this Program Contact: Amber Dollete HBCU UP/STIP-6768 Fax: 804/524-6518 Summer Transportation Institute Program I (STIP I) June 20 ­ July 15, 2010 Supported Institute Program I (STIP I) Virginia State University will host the 2010 Summer Transportation Institute

Noakes, David R.

233

NUMBER: 1001 TITLE: The Mission of the University  

E-Print Network (OSTI)

MISSION Old Dominion University, located in the City of Norfolk in the metropolitan Hampton Roads region and culture, and in national security. Now a complex of seven major cities, it is a microcosm, ship design and construction, advanced electronics, and nuclear physics. The University takes its

234

Mitch S. Daugherty Nuclear Engineering and Planning Manager  

E-Print Network (OSTI)

. Daugherty also headed the Nuclear Refueling Division, the Nuclear Test Engineering Division, and the NuclearMitch S. Daugherty Nuclear Engineering and Planning Manager Naval Sea Systems Command, Norfolk Naval Shipyard Mitch Daugherty is the Nuclear Engineering and Planning Manager and the senior civilian

235

Epigenetic Alterations in High and Low LET Radiation Induced...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the unstable clones. Among these, altered miRNA expression could be validated by qRT-PCR for mmu-miR-466g, hsa-miR-30a and hsamiR- 195. Hsa-miR-30a and hsa-miR-195 were...

236

,"Michigan Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050MI3","N3010MI3","N3020MI3","N3035MI3","N3045MI3" "Date","Natural Gas Citygate Price in Michigan (Dollars per Thousand Cubic Feet)","Michigan Price of...

237

Applications in the Nuclear Industry for Thermal Spray Amorphous Metal and Ceramic Coatings  

E-Print Network (OSTI)

Science & Technology 2007, Detroit, MI, Sept. 16 20, 2007,2007, Sept. 1620, 2007, Detroit, MI, American CeramicExhib. , Sept. 1620, 2007, Detroit, MI, American Ceramic

Blink, J.; Farmer, J.; Choi, J.; Saw, C.

2009-01-01T23:59:59.000Z

238

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

Vehicle Usage Number of trips 773,602 Total distance traveled (mi) 5,558,155 Avg trip distance (mi) 7.2 Avg distance traveled per day when the vehicle was driven (mi) 30.2 Avg...

239

Computational Enhancements in Low-Rank Semidefinite ...  

E-Print Network (OSTI)

Jul 12, 2004 ... curvature condition necessary for L-BFGS, to be more efficient than the WP linesearch if the ... The precise condition ..... (Mi D)Mi, Mi := AiR.

240

Tradeoffs between Costs and Greenhouse Gas Emissions in the Design of Urban Transit Systems  

E-Print Network (OSTI)

mi) Maintenance emissions (g/veh-mi) Total emissions (g/veh-mi) Total emissions (g/veh-km) Comments 15,300 Based onfrom Chester (2008); emissions from EIO-LCA (CMU 2012) 1,841

Griswold, Julia Baird

2013-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Energy Information Administration/Oil and Gas Field Code ...  

U.S. Energy Information Administration (EIA)

mississippi union 01-26n-9w grand traverse mi 055 003557 n 1969 union 02-26n-9w grand traverse mi 055 006252 n 1973 union 03-26n-9w grand traverse mi ...

242

Service/Product Provider  

NLE Websites -- All DOE Office Websites (Extended Search)

816 Maple St. 738 E. Gull Lake Dr. Three Rivers, MI 49093 Augusta, MI 49012 Business: Steam, air & hot water systems Business: Pharmaceutical manufacturing Tom Henry, Director of...

243

Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

experiments with approximately 25 hours and 51 minutes of luminosity - NuMI off due to power supply - MI transformer replaced Monday evening - Store established Tuesday morning...

244

Subsidized Housing and Neighborhood Change  

E-Print Network (OSTI)

97 Figure 3-6a Detroit, MI PMSA Neighborhood Quintile98 Figure 3-6b Detroit, MI PMSA Neighborhood Quintileinterviewing from the Detroit Area Study. Neighborhood

Wilson, Florence Louise

2011-01-01T23:59:59.000Z

245

DOE - Office of Legacy Management -- General Motors Co - Flint...  

Office of Legacy Management (LM)

Motors Co - Flint - MI 07 FUSRAP Considered Sites Site: GENERAL MOTORS CO. (MI.07 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate...

246

E Pluribus...Separation: Deepening Double Segregation for More Students  

E-Print Network (OSTI)

TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-

Orfield, Gary; Kucsera, John; Siegel-Hawley, Genevieve

2012-01-01T23:59:59.000Z

247

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Clean Energy Coalition - Michigan Green Fleets This CX form is for installing propane refueling infrastructure at one site in MI. This CX is for project selected under...

248

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

41 - 25150 of 28,560 results. 41 - 25150 of 28,560 results. Download Microsoft PowerPoint- UAE Masdar 2-24-10 final for distribution.pptx http://energy.gov/downloads/microsoft-powerpoint-uae-masdar-2-24-10-final-distributionpptx Download Fossil Energy's HBCU Research Activities http://energy.gov/diversity/downloads/fossil-energy-s-hbcu-research-activities Download NSU Norfolk State University http://energy.gov/diversity/downloads/nsu-norfolk-state-university Download Environmental Impact Statement Summary This DOE guidance is intended to help EIS preparers draft the EIS summary. http://energy.gov/nepa/downloads/environmental-impact-statement-summary Download REPORT98.PDF http://energy.gov/management/downloads/report98pdf Download Mark Caffarey, UMICORE, "Opportunities and Limits to Recycling of

249

Chu, Salazar to Announce Major Offshore Wind Energy Initiatives |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Salazar to Announce Major Offshore Wind Energy Initiatives Salazar to Announce Major Offshore Wind Energy Initiatives Chu, Salazar to Announce Major Offshore Wind Energy Initiatives February 4, 2011 - 12:00am Addthis NORFOLK,VA - On Monday, February 7, 2011 Energy Secretary Steven Chu and Secretary of the Interior Ken Salazar will announce major new initiatives to accelerate the responsible siting and development of offshore wind energy projects. WHAT: Offshore Wind Energy News Conference WHEN: Monday, February 7, 11:00 AM EST WHO: Steven Chu, Secretary of Energy Ken Salazar, Secretary of the Interior WHERE: Half Moone Center 11 Waterside Dr Norfolk, VA 23510 DIAL-IN: News media, state and local stakeholders, industry representatives and other interested parties can join a listen-only teleconference of the announcement by dialing 800-369-3311 and entering code: OFFSHORE.

250

DOE Solar Decathlon: Tidewater Virginia: Old Dominion University and  

NLE Websites -- All DOE Office Websites (Extended Search)

Tidewater Virginia: Old Dominion University and Hampton University Tidewater Virginia: Old Dominion University and Hampton University Old Dominion University and Hampton University's U.S. Department of Energy Solar Decathlon 2013 entry, Unit 6 Unplugged, is now located on the campus of Old Dominion University in Norfolk, Virginia. It is used as a design studio for continued collaboration between the university's engineering students and architecture students from Hampton University. Photo of Unit 6 Unplugged. Enlarge image Unit 6 Unplugged is a modular house designed as part of a larger, six-unit multifamily building. (Credit: Jim Tetro/U.S. Department of Energy Solar Decathlon) Who: Old Dominion University and Hampton University What: Unit 6 Unplugged Where: Old Dominion University Norfolk, VA 23529 Map This House Public tours: Not available

251

Virginia Gasoline Price Data  

NLE Websites -- All DOE Office Websites (Extended Search)

Virginia Virginia Exit Fueleconomy.gov The links below are to pages that are not part of the fueleconomy.gov. We offer these external links for your convenience in accessing additional information that may be useful or interesting to you. Selected Cities Alexandria AlexandriaGasPrices.com Automotive.com Mapquest.com Arlington ArlingtonGasPrices.com Automotive.com Mapquest.com Chesapeake ChesapeakeGasPrices.com Automotive.com Mapquest.com Hampton HamptonGasPrices.com Automotive.com Mapquest.com Newport News NewportNewsGasPrices.com Automotive.com Mapquest.com Norfolk NorfolkGasPrices.com Automotive.com Mapquest.com Portsmouth PortsmouthGasPrices.com Automotive.com Mapquest.com Richmond RichmondGasPrices.com Automotive.com Mapquest.com Virginia Beach VirginiaBeachGasPrices.com Automotive.com Mapquest.com

252

Wind Power Renewables | Open Energy Information  

Open Energy Info (EERE)

Norfolk, United Kingdom Norfolk, United Kingdom Zip NR29 5BG Sector Wind energy Product Wind project developer Coordinates 36.846825°, -76.285069° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":36.846825,"lon":-76.285069,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

253

S Pastore  

NLE Websites -- All DOE Office Websites (Extended Search)

Address: Physics Division, Bldg 203, Rm B202 Argonne National Laboratory 9700 S Cass Avenue Argonne, IL60439 USA Phone: +1 (630) 252-4092 Fax: +1 (630) 252-3903 E-mail: pastore@anl.gov Biographical sketch December 2012-present Postdoctoral Fellow, University of South Carolina November 2010-December 2012 Postdoctoral Fellow, Argonne National Laboratory, Argonne, IL 60439, USA May 2010: PhD, Old Dominion University, Norfolk, VA 23529, USA May 2005: MS, Old Dominion University, Norfolk, VA 23529, USA December 2002: BS, Università degli Studi di Lecce, Lecce, I73100, Italy Publications Charge-symmetry breaking forces and isospin mixing in 8Be R. B. Wiringa, S. Pastore, Steven C. Pieper, and Gerald A. Miller Phys. Rev. C 88, 044333 (2013) [8 pages] Electromagnetic Transition from the 4+ to 2+ Resonance in 8Be

254

NSTAR Electric Company | Open Energy Information  

Open Energy Info (EERE)

Place Norfolk, Massachusetts Place Norfolk, Massachusetts Service Territory Massachusetts Website www.nstar.com/residential Green Button Landing Page www.nstar.com/residential Green Button Reference Page www.nstar.com/ss3/nstar_n Green Button Implemented Yes Utility Id 54913 Utility Location Yes Ownership I NERC Location NPCC NERC NPCC Yes ISO NE Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] SGIC[2] Energy Information Administration Form 826[3] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. NSTAR Electric Company Smart Grid Project was awarded $10,061,883 Recovery

255

VNG's Hampton Roads Pipeline Crossing  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

VNG's Hampton Roads Pipeline Crossing VNG's Hampton Roads Pipeline Crossing FUPWG Conference Fall 2008 Williamsburg, Virginia Connection to DTI at Quantico Columbia Limitations South Hampton Roads served by a single pipeline Southside dependent on back up systems LNG Propane/air Two supply sources to VNG What if we connected pipelines? It would take Two Water Crossings Two Compressor Stations Construction in densely populated cities It could Deliver over 200,000 Dth of incremental supply Serve VNG, Columbia and Dominion customers ...we would get... Hampton Roads Crossing - HRX Hampton / Newport News Craney Island Norfolk 21 miles of 24" pipe 7 miles in Hampton/Newport News 4 miles in Norfolk 10 miles of water and island crossing 4 mile harbor crossing 4.5 miles on Craney

256

DOE Solar Decathlon: News Blog » Blog Archive » A Solar Decathlon Entry  

NLE Websites -- All DOE Office Websites (Extended Search)

A Solar Decathlon Entry for Historic Norfolk A Solar Decathlon Entry for Historic Norfolk Friday, August 19, 2011 By Erin Pierce Editor's Note: This entry has been cross-posted from DOE's Energy Blog. In honor of the U.S. Department of Energy Solar Decathlon-which challenges collegiate teams to design, build, and operate solar-powered houses that are cost-effective, energy-efficient, and attractive-we are profiling each of the teams participating in the competition. I t's a tale of two universities with a vision for one historic city. Students from both Hampton and Old Dominion universities have joined forces to compete in the upcoming U.S. Department of Energy Solar Decathlon with their entry, called Unit 6 Unplugged. As Tidewater Virginia, the students will unveil their vision for the future -an energy-efficient house that

257

Acknowledgments  

Science Conference Proceedings (OSTI)

...Tim Webber, IPG Photonics, Oxford, MA Frank Brennan, Trumpf, Plymouth, MI Rainer Uhlig, ABB, Fort Collins, CO Jim Cann, Rofin Sinar, Plymouth, MI Urban Widén, Permanova, Mölndal, Sweden Robert Borgstrom, Precitec, New Hudson, MI Scott Green, LT Ultra, New Hudson, MI Mike...

258

Supporting Information Evolution of Dendritic Platinum Nanosheets  

E-Print Network (OSTI)

87131. 3 Toyota Technical Center, Toyota Motor Engineering & Manufacturing North America, Ann Arbor, MI

Shelnutt, John A.

259

Civil Works Fact Sheets  

E-Print Network (OSTI)

HAMILTON DAM, FLINT RIVER, FLINT, MI ............................................ LRD-19 HOLES CREEK, WEST

US Army Corps of Engineers

260

MFR PAPER 1039 ational Marine Fisheries  

E-Print Network (OSTI)

In Norfolk Canyo" ., d~j..or~ cnicc.. - In Decem - her Il!?:' the .1l1(lnal Oce,1nle .Inu tl11l1spheric \\Ul11- search and Development Act of 1964 (P.L. 88-309) , as amended. Authorizes the Secretary of Com- merce with the Fisheries Re- search Institute of the U ni versity of Washington, Seattle, and the Washing- ton State

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Annual Report 2010-11  

E-Print Network (OSTI)

and positive development and the Syndicate anticipate that the programme of reviews will identify areas of operation where efficiencies can be gained and non-essential activities discontinued. It is also anticipated that the current organisational structure... : ? Norwich Castle Museum & Art Gallery, The art of faith: 3,500 years of art & belief in Norfolk ? The Royal Society, London, Frederick Gowland Hopkins and the chemistry of life ? Manchester Museum of Science and Industry, Rutherford: the father...

Cambridge University Library

2013-09-26T23:59:59.000Z

262

Biochars impact on soil moisture storage in an Ultisol and two Aridisols  

Science Conference Proceedings (OSTI)

Biochar additions to soils can improve soil water storage capability, however, there is sparse information identifying feedstocks and pyrolysis conditions that maximize this improvement. Nine biochars were pyrolyzed from five feedstocks at two temperatures and their physical and chemical properties were characterized. Biochars were mixed at 2% wt w{sup -1} into a Norfolk loamy sand (Fine-loamy, kaolinitic, thermic Typic Kandiudult), a Declo silt loam (Coarse-loamy, mixed, superactive, mesic xeric Haplocalcid), or a Warden silt loam (Coarse-silty, mixed, superactive, mesic xeric Haplocambid). Untreated soils served as controls. Soils were laboratory incubated in pots for 127 days and were leached about every 30 days with deionized water. Soil bulk densities were measured before each leaching event. For six days thereafter, pot holding capacities (PHC) for water were determined gravimetrically and were used as a surrogate for soil moisture contents. Water tension curves were also measured on the biochar treated and untreated Norfolk soil. Biochar surface area, surface tension, ash, C, and Si contents, in general, increased when produced under higher pyrolytic temperatures ({ge}500 C). Both switchgrass biochars caused the most significant water PHC improvements in the Norfolk, Declo and Warden soils compared to the controls. Norfolk soil water tension results at 5 and 60 kPa corroborated that biochar from switchgrass caused the most significant moisture storage improvements. Significant correlation occurred between the PHC for water with soil bulk densities. In general, biochar amendments enhanced the moisture storage capacity of Ultisols and Aridisols, but the effect varied with feedstock selection and pyrolysis temperature.

Novak, Jeffrey M.; Busscher, Warren J.; Watts, Don W.; Amonette, James E.; Ippolito, James I.; Lima, Isabel M.; Gaskin, Julia; Das, K. C.; Steiner, Christoph; Ahmedna, Mohamed; Rehrah, Djaafar; Schomberg, Harry

2012-05-31T23:59:59.000Z

263

MicroRNA expression in canine mammary cancer  

E-Print Network (OSTI)

MicroRNAs (miRNAs) play a vital role in differentiation, proliferation and tumorigenesis by binding to messenger RNAs (mRNA) and inhibiting translation. To initiate an investigation into the identification of miRNAs in the domestic dog, an emerging model for human disease, a comparison of the human and canine genetic databases was conducted. The bioinformatics work revealed significant conservation of miRNA genes between the two species. Proof of principle experiments, including serial dilutions and sequencing, were performed to verify that primers made to amplify human mature miRNAs can be used to amplify canine miRNAs, providing that the mature sequences are conserved. TaqMan Real-time RT-PCR, a sensitive and specific method, was used to isolate the first miRNA mature products from canine tissues. The expression levels of miR-17-3p, miR-17-5p, miR-18, miR-19a, miR-19b, miR-20, and miR-92 were evaluated in five canine tissues (heart, lung, brain, kidney, and liver). Because miRNAs have been found to act as both tumor suppressors and oncogenes in several different cancers, expression patterns of ten miRNAs (miR-15a, miR-16, miR-17-5p, miR-21, miR-29b, miR-125b, miR-145, miR-155, miR-181b, let-7f) known to be associated with human breast cancer were compared between malignant canine mammary tumors (n=6) and normal canine mammary tissue (n=10). Resulting data revealed miR-29b and miR-21 to have a statistically significant (p<0.05) up-regulation in cancerous samples. Overall expression patterns showed nine of the ten miRNAs follow the same pattern of expression in the domestic dog as the human, while the miR-145 expression does not show a difference between the normal and cancerous samples.

Boggs, Rene' Michelle

2008-05-01T23:59:59.000Z

264

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

2 2 Overall AC electrical energy consumption (AC Wh/mi)¹ 45 Overall DC electrical energy consumption (DC Wh/mi)² 22 Total number of trips 1,585 Total distance traveled (mi) 14,910 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 34 DC electrical energy consumption (DC Wh/mi) 49 Number of trips 883 Percent of trips city | highway 81% | 19% Distance traveled (mi) 4,778 Percent of total distance traveled 32%

265

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

4 4 Overall AC electrical energy consumption (AC Wh/mi)¹ 64 Overall DC electrical energy consumption (DC Wh/mi)² 31 Total number of trips 831 Total distance traveled (mi) 7,559 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 35 DC electrical energy consumption (DC Wh/mi) 54 Number of trips 541 Percent of trips city | highway 79% | 21% Distance traveled (mi) 3,402 Percent of total distance traveled 45%

266

IL-1 beta and TNF-alpha upregulate angiotensin II type 1 (AT(1)) receptors on cardiac fibroblasts and are associated with increased AT(1) density in the post-MI heart  

E-Print Network (OSTI)

broblasts and the infarcted heart. Am J Physiol 1998;274:matrix remodeling in heart failure: a role for de novoin right and left heart after myocardial infarction. Mol

Gurantz, D; Cowling, R T; Varki, N; Frikovsky, E; Moore, C D; Greenberg, Barry H

2005-01-01T23:59:59.000Z

267

P LUS: A DVENT URES I N VET ERI NA RY M EDI CI NE s T RA NSF O R MI N G D A I RY FA R MS Boosting the  

E-Print Network (OSTI)

doxycycline make a difference? Maybe, but here was the catch: To slow IMHA's destruction of red blood cells- tion. How to get out of this catch-22? Start the doxycycline but "contin- ue to treat the IMHA because

Tufts University

268

A Kallikrein 15 (KLK15) single nucleotide polymorphism located close to a novel exon shows evidence of association with poor ovarian cancer survival  

E-Print Network (OSTI)

of the UTR and splice site SNPs. Analysis for putative microRNA (miRNA) sites was performed using miRBase Targets V4, Target scan, miRanda, PicTar and Patrocles. Cell culture, RT PCR and sequencing of KLK15 putative promoter region The normal ovarian cell... intronic SNPs located within 30 bp of exon- intron boundaries. We also predicted miRNA binding sites using three different software programs; Target Scan, miRanda and Patrocles. A maximum of 32 miRNA bind- ing sites scattered throughout the gene were...

Batra, Jyotsna; Nagle, Christina M; O'Mara, Tracy; Higgins, Melanie; Dong, Ying; Tan, Olivia L; Lose, Felicity; Skeie, Lene Marie; Srinivasan, Srilakshmi; Bolton, Kelly L; Song, Honglin; Ramus, Susan J; Gayther, Simon A; Pharoah, Paul D P; Kedda, Mary-Anne; Spurdle, Amanda B; Clements, Judith A

2011-04-01T23:59:59.000Z

269

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

74 74 Number of trips 399 Distance traveled (mi) 148 Percent of total distance traveled (%) 73% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 6.3 Average Stops per mile 35.5 Percent of Regen Braking Energy Recovery (%) 11% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 423 Number of trips 27 Distance traveled (mi) 54 Percent of total distance traveled (%) 27% Average Trip Distance (mi) 2.0 Average Driving Speed (mph) 20.7 Average Stops per mile 3.5 Percent of Regen Braking Energy Recovery (%) 15% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 0 Number of trips 0 Distance traveled (mi) 0 Percent of total distance traveled (%) 0% Average Trip Distance (mi) 0.0 Average Driving Speed (mph)

270

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

5 5 Overall AC electrical energy consumption (AC Wh/mi)¹ 111 Overall DC electrical energy consumption (DC Wh/mi)² 71 Overall DC electrical energy captured from regenerative braking (DC Wh/mi) 61 Total number of trips 1,135 Total distance traveled (mi) 4,408 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 22 DC electrical energy consumption (DC Wh/mi) 296 Number of trips 264 Percent of trips city | highway 100% | 0% Distance traveled (mi) 781 Percent of total distance traveled 18% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 19 DC electrical energy consumption (DC Wh/mi) 141 Number of trips 44 Percent of trips city | highway 96% | 4% Distance traveled CD | CS (mi) 333 | 389 Percent of total distance traveled CD | CS

271

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Number of trips 493 Distance traveled (mi) 189 Percent of total distance traveled (%) 38% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 4.9 Average Stops per mile 28.7 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 377 Number of trips 67 Distance traveled (mi) 275 Percent of total distance traveled (%) 56% Average Trip Distance (mi) 4.1 Average Driving Speed (mph) 17.9 Average Stops per mile 3.7 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 438 Number of trips 1 Distance traveled (mi) 29 Percent of total distance traveled (%) 6% Average Trip Distance (mi) 28.7 Average Driving Speed (mph)

272

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

505 505 Number of trips 601 Distance traveled (mi) 245 Percent of total distance traveled (%) 62% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 5.4 Average Stops per mile 34.8 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 373 Number of trips 35 Distance traveled (mi) 124 Percent of total distance traveled (%) 31% Average Trip Distance (mi) 3.5 Average Driving Speed (mph) 23.0 Average Stops per mile 3.7 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 319 Number of trips 3 Distance traveled (mi) 25 Percent of total distance traveled (%) 6% Average Trip Distance (mi) 8.5 Average Driving Speed (mph)

273

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

1 1 Overall AC electrical energy consumption (AC Wh/mi)¹ 93 Overall DC electrical energy consumption (DC Wh/mi)² 71 Overall DC electrical energy captured from regenerative braking (DC Wh/mi) 40 Total number of trips 11,047 Total distance traveled (mi) 119,879 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 25 DC electrical energy consumption (DC Wh/mi) 208 Number of trips 4,491 Percent of trips city | highway 92% | 8% Distance traveled (mi) 30,376 Percent of total distance traveled 25% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 22 DC electrical energy consumption (DC Wh/mi) 71 Number of trips 1,352 Percent of trips city | highway 69% | 31% Distance traveled CD | CS (mi) 12,772 | 20,001 Percent of total distance traveled CD | CS

274

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

613 613 Number of trips 89 Distance traveled (mi) 9 Percent of total distance traveled (%) 30% Average Trip Distance (mi) 0.1 Average Driving Speed (mph) 7.0 Average Stops per mile 44.5 Percent of Regen Braking Energy Recovery (%) 9% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 487 Number of trips 8 Distance traveled (mi) 5 Percent of total distance traveled (%) 16% Average Trip Distance (mi) 0.6 Average Driving Speed (mph) 25.0 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 6% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 487 Number of trips 7 Distance traveled (mi) 16 Percent of total distance traveled (%) 54% Average Trip Distance (mi) 2.3 Average Driving Speed (mph)

275

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Number of trips 1,610 Distance traveled (mi) 372 Percent of total distance traveled (%) 72% Average Trip Distance (mi) 0.2 Average Driving Speed (mph) 5.2 Average Stops per mile 32.1 Percent of Regen Braking Energy Recovery (%) 13% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 383 Number of trips 114 Distance traveled (mi) 144 Percent of total distance traveled (%) 28% Average Trip Distance (mi) 1.3 Average Driving Speed (mph) 18.3 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 16% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 549 Number of trips 5 Distance traveled (mi) 2 Percent of total distance traveled (%) 0% Average Trip Distance (mi) 0.4 Average Driving Speed (mph)

276

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

530 530 Number of trips 1,308 Distance traveled (mi) 495 Percent of total distance traveled (%) 69% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 5.6 Average Stops per mile 31.4 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 471 Number of trips 91 Distance traveled (mi) 175 Percent of total distance traveled (%) 24% Average Trip Distance (mi) 1.9 Average Driving Speed (mph) 16.6 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 357 Number of trips 2 Distance traveled (mi) 49 Percent of total distance traveled (%) 7% Average Trip Distance (mi) 24.7 Average Driving Speed (mph)

277

Computational and experimental analysis of plant microRNAs  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are small, endogenous, non-coding RNAs that mediate gene regulation in plants and animals. We demonstrated that Arabidopsis thaliana miRNAs are highly complementary (0-3 mispairs in an ungapped alignment) ...

Jones-Rhoades, Matthew W. (Matthew William)

2005-01-01T23:59:59.000Z

278

Service/Product Provider  

NLE Websites -- All DOE Office Websites (Extended Search)

Johnson Controls, Inc. Ford Motor Company 2875 High Meadow Cir. 550 Town Center Dr., Ste 200 Auburn Hills, MI 48326-2773 Dearborn, MI 48126 Business: Building Automation, Facility...

279

Bang smad Villages New Year in 2011  

E-Print Network (OSTI)

and Mi Nyag Tibetan ??????? ??????????????????? Performer(s)'s first / native language Khams Tibetan and Mi Nyag Tibetan ??????? last updated by World Oral Literature Project staff on Wednesday, Tuesday, June 8, 2010 ??????????????????? Performer...

Bkar shis bzang po

280

Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

,"Next Release Date:","11292013" ,"Excel File Name:","n9050mi2a.xls" ,"Available from Web Page:","http:tonto.eia.govdnavnghistn9050mi2a.htm" ,"Source:","Energy Information...

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

C:\\DS\\08-2225 - Final with Errata Page.wpd  

NLE Websites -- All DOE Office Websites (Extended Search)

per liter MgO magnesium oxide mi milemiles mi 2 square miles mL millilitermilliliters MOU memorandum of understanding mph miles per hour mrem milliremmillirem MRL method...

282

Screening SNPs residing in the microRNA-binding sites of Hepatocellular Carcinoma related genes  

Science Conference Proceedings (OSTI)

Single nucleotide polymorphisms located at miRNA-binding sites are likely to affect the expression of the miRNA targets and may contribute to the susceptibility of humans to common diseases. Here we selected 289 candidate Hepatocellular Carcinoma ...

Jun Ding; Yuzhen Gao; Yan He; Yifeng Zhou; Moli Huang; Haiyan Liu

2011-02-01T23:59:59.000Z

283

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

with battery state of charge below 90% (for charging events with SOC reported) Vehicle Usage Number of trips 3,364 Total distance traveled (mi) 21,706 Avg trip distance (mi) 5.8...

284

Many families of Caenorhabditis elegans microRNAs are not essential for development or viability  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are approximately 23 nt regulatory RNAs that posttranscriptionally inhibit the functions of protein-coding mRNAs. We previously found that most C. elegans miRNAs are individually not essential for ...

Alvarez-Saavedra, Ezequiel

285

Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

Technical Publications website. The URA tracks the number of theses we produce each year. Power Outage News MI-65 October 25 Power will be off to the MI-65 service building and...

286

PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Chow, T. Edwin  

E-Print Network (OSTI)

a ; Michael E. Hodgson b a Department of Earth and Resource Science, University of Michigan--Flint, Flint, MI*{ and MICHAEL E. HODGSON{ {Department of Earth and Resource Science, University of Michigan--Flint, Flint, MI

Chow, Tzeekiu Edwin

287

GTdemo (.mw) - CECM  

E-Print Network (OSTI)

Algorithm: Backtracking (Branch & Bound) MaximumIndependentSet(G); NygiIiMiIiQiIiYiIiciIigiIzc= MaximumClique(G); NyUiIiMiIikiIio= ChromaticNumber( G...

288

Species Revision and Generic Systematics of World Rileyinae (Hymenoptera: Eurytomidae)  

E-Print Network (OSTI)

Woolley (9F TAMU); 23 mi. S. Trona, 13.v.1980, J. Woolley,Gates (2m UCR); 23 mi. S. Trona, 13.v.1980, J. Woolley (1m

Gates, Michael William

2008-01-01T23:59:59.000Z

289

PowerPoint Presentation  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

law * Tech transfer and licensing Why do GIV and V2G make sense? Basic GIVV2G Math * US car used 1 hour day, parked 23 h d * Battery 100 mi, daily travel 30 mi, thus * Drive...

290

Modulation of Intestinal Micrornas by a Chemoprotective Diet  

E-Print Network (OSTI)

We have hypothesized that dietary modulation of intestinal miRNA expression may contribute to the chemoprotective effects of nutritional bioactives (fish oil and pectin). Using a rat colon carcinogen model, we determined miRNAs-let-7d, miR-15b, miR-107, miR-191 and miR-324-5p were modulated by fish oil + pectin. We also demonstrated that BACE1 and PTEN are targets of miR-107 and miR-21, respectively. To further elucidate the biological effects of diet and carcinogen on miRNAs, we integrated global miRNAs, total and polysomal gene expression datasets obtained from the above mentioned study and used four computational approaches. We demonstrated that polysomal profiling is tightly related to microRNA changes when compared with total mRNA profiling. In addition, diet and carcinogen exposure modulated a number of microRNAs and complementary gene expression analyses showed that oncogenic PTK2B, PDE4B, and TCF4 were suppressed by the chemoprotective diet at both the mRNA and protein levels. To determine the function of select diet and colon carcinogen modulated miRNAs and to validate their targets, we carried out a series of loss and gain of function experiments along with luciferase reporter assays. We verified that PDE4B and TCF4 are direct targets of miR-26b and miR-203, respectively. PTK2B was determined to be an indirect target of miR-19b. In addition, microRNA physiological function was assessed by examining effects on apoptosis and cell proliferation. To better understand how the colonic stem cell population responds to environmental factors such as diet and carcinogen, we investigated the chemoprotective effects of dietary agents on miRNAs in colonic stem cells obtained from Lgr5-EGFP-IRES-creERT2 knock in mice injected with AOM. We demonstrated that based on relative expression of miR-125a-5p, miR-190b and miR-191 in stem cells vs. daughter cells and differentiated cells, these miRNAs may be stem cell specific miRNAs. We also identified miR-21 to be significantly reduced in stem cells compared to differentiated cells and selectively modulated by these dietary agents in stem cells. In summary, our results indicate for the first time that fish oil plus pectin protect against colon tumorigenesis in part by modulating a subset of miRNAs and their target genes (mRNAs) implicated in the regulation of the colon stem cell niche and tumor development.

Shah, Manasvi 1984-

2012-12-01T23:59:59.000Z

291

Semiconductor Landing  

Science Conference Proceedings (OSTI)

Title Goes Here. Lorem ipsum dolor sit amet, consectetur adipiscing elit. Sed malesuada accumsan mi, et adipiscing nunc varius quis. ...

2013-08-14T23:59:59.000Z

292

R 0 G RES S ASSOCIATE EDITORS  

E-Print Network (OSTI)

: Gole Mi" Myrtle Williomson. Deye Muey. Chris Moderl. led Row: Dr. Gron· yille Price. Deen Judd. Ed

O'Laughlin, Jay

293

Particulate matter chemistry and dynamics in the Twilight Zone at VERTIGO ALOHA and K2 Sites  

E-Print Network (OSTI)

Marine Chemistry 105, 208 Volk, T. , Hoffert, M.I. , 1985.Broecker and Peng, 1982; Volk and Hoffert, 1985; Armstrong

Bishop, James K.B.

2008-01-01T23:59:59.000Z

294

The export of carbon mediated by mesopelagic fishes in the northeast Pacific Ocean  

E-Print Network (OSTI)

Chapman and Hall, New York. Volk, T. , Hoffert, M.I. , 1985.the biological pump (Volk and Hoffert, 1985). The

Davison, Peter Charles

2011-01-01T23:59:59.000Z

295

I Cant Walk! Acute Thrombosis of Descending Aorta Causing Paraplegia  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, Michigan Supervising SectionWest Grand Boulevard, CFP-258, Detroit, MI 48202. Email:

Mitchell, Matthew Lee; Yucebey, Elif; Weaver, Mitchell R; Jaehne, A Kathrin; Rivers, Emanuel P

2013-01-01T23:59:59.000Z

296

Observation of a Narrow Charm-Strange Meson D A.V. Evdokimov,8  

E-Print Network (OSTI)

University of Iowa, Iowa City, IA 52242, USA 17 University of Michigan-Flint, Flint, MI 48502, USA 18

Akgun, Ugur

297

Preserving the U.S. Underground and Alternative Press of the 1960s and '70s: History, Prospects, and Microform Sources  

E-Print Network (OSTI)

Reporter, Washington, DC, 1985- , UMI Navajo Times, WindowWashington, DC Native Sun, Detroit, MI Navajo Times, Window

Tsang, Daniel C

1993-01-01T23:59:59.000Z

298

Materials Technology @ TMS  

Science Conference Proceedings (OSTI)

... MI; Elizabeth Holm, Carnegie Mellon University, Pittsburgh, PA; Peter Gumbsch, Fraunhofer Institute for Mechanics of Materials IWM, Freiburg, Germany.

299

2012 Proceedings of the Performance Metrics for Intelligent ...  

Science Conference Proceedings (OSTI)

Page 1. NIST Special Publication 1136 2012 Proceedings of the Performance Metrics for Intelligent Systems (PerMI '12) Workshop ...

2012-11-19T23:59:59.000Z

300

The FASEB Journal Research Communication Structure-function analysis of human l-prostaglandin D  

E-Print Network (OSTI)

the commercially available PGD2-MOX ELISA kit (Cay- man Chemicals, Ann Arbor, MI, USA). One unit of enzyme activity

Zhijie, Liu

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

PNIC*F.F2a U.S. DEPARTMENT OF ENERGY EERE PROJECT MANAGEMENT...  

NLE Websites -- All DOE Office Websites (Extended Search)

Sciences STATE: MI PROJECT TITLE : Manufacturing Industrial Development for the Alternative Energy Systems Funding Opportunity Announcement Number Procurement Instrument...

302

Au  

Science Conference Proceedings (OSTI)

... the permission of GJ Ackland and MI Mendelev. These potentials are not designed for simulations of radiation damage. ...

2013-07-06T23:59:59.000Z

303

Thermal Insulation Materials  

Science Conference Proceedings (OSTI)

... IN. Knauf Insulation Product Testing Laboratory, Shelbyville, IN [200883- 0] MI. Dow Chemical Building Solutions Product Perf. ...

2014-01-03T23:59:59.000Z

304

Project Brief: Michigan Aerospace Corporation  

Science Conference Proceedings (OSTI)

... RECIPIENT: Michigan Aerospace Corporation, Ann Arbor, MI. Project duration: 3 Years; Total NIST Funding: $1,499,463. ...

2010-10-05T23:59:59.000Z

305

Mark Iadicola  

Science Conference Proceedings (OSTI)

... 2002-2003 Postdoctoral Research Fellow University of Michigan, Ann Arbor, MI. 1996-2002 University of Michigan, Ann ...

2012-10-01T23:59:59.000Z

306

California Cuckoo Wasps in the Family Chrysididae (Hymenoptera)  

E-Print Network (OSTI)

Panamint Springs; 13 mi. n Trona; Lone Pine; Death Valley;San Bernardino Co. : Trona. Map 89. California distribution

Kimsey, Lynn S.

2006-01-01T23:59:59.000Z

307

Available Technologies: Long-term Growth of Finite Life ...  

APPLICATIONS OF TECHNOLOGY: Examine carcinogenesis, aging, expression of genes, proteins and miRNA, signaling pathways, epigenetics, and genomic ...

308

U.S. Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI : 140 : 2011-2013: Marysville, MI: 176 : 1,080: 14 : 2011-2013: St. Clair, MI: 1,562: 1,422: 2 : 26 : 2011-2013: Noyes, MN: 13,380: 14,460: 20,624: 33,889 ...

309

U.S. Price of Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI: 3.80 : 4.50 : 2011-2013: Marysville, MI: 3.63: 3.65 : 4.57: 4.70 : 2011-2013: St. Clair, MI: 3.75: 3.67: 4.09: 4.41 : 4.35: 2011-2013: Noyes, MN: 3.74: 3 ...

310

U.S. Natural Gas Pipeline Exports by Point of Exit  

U.S. Energy Information Administration (EIA)

Detroit, MI: 22,904: 27,220: 43,980: 44,275: 43,690: 50,347: 1996-2011: Marysville, MI: 9,158: 8,756: 14,925: 22,198: 41,964: 42,866: 1996-2011: Sault Ste. Marie, MI ...

311

U.S. Price of Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI: 8.28: 6.58: 4.53: 8.37: 5.17 : 1996-2011: Marysville, MI: 7.59: 8.59: 3.80: 4.44: 4.42: 2.99: 1996-2012: St. Clair, MI: 6.97: 10.03: 5.10: 4.97: 4.29: 2 ...

312

U.S. Price of Natural Gas Pipeline Exports by Point of Exit  

U.S. Energy Information Administration (EIA)

Detroit, MI: 6.88: 8.37: 4.01: 4.69: 4.26: 3.10: 1996-2012: Marysville, MI: 7.77: 7.48: 4.85: 4.87: 4.48: 3.18: 1996-2012: Sault Ste. Marie, MI: 7.13: 8.75: 5.04: 5 ...

313

Brief communication: Genome-wide computational identification of microRNAs and their targets in the deep-branching eukaryote Giardialamblia  

Science Conference Proceedings (OSTI)

Using a combined computational program, we identified 50 potential microRNAs (miRNAs) in Giardia lamblia, one of the most primitive unicellular eukaryotes. These miRNAs are unique to G. lamblia and no homologues have been found in other organisms; miRNAs, ... Keywords: CDS, Computational, EST, Gene regulation, Giardia lamblia, MicroRNA, UTR, VSPs

Yan-Qiong Zhang; Dong-Liang Chen; Hai-Feng Tian; Bao-Hong Zhang; Jian-Fan Wen

2009-10-01T23:59:59.000Z

314

July 2009 NW Michigan Regional Fruit Grower Newsletter CALENDER OF EVENTS  

E-Print Network (OSTI)

Basket Sparta, MI 7/10 Grape IPM Update L. Mawby's Tasting Room 7/13 Canola Research 2009 Plot Days Central Lake, MI 7/14 Canola Research 2009 Plot Days Marion, MI 7/16 Backyard Chicken Production Workshop

315

SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Imports by Customs District" Coal Imports by Customs District" "(short tons)" ,,,,"Year to Date" "Customs District","April - June","January - March","April - June",2013,2012,"Percent" ,2013,2013,2012,,,"Change" "Eastern Total",469878,331008,156004,800886,350124,128.7 " Baltimore, MD","-","-",106118,"-",154318,"-" " Boston, MA",373985,154438,"-",528423,51185,"NM" " Buffalo, NY",44,"-","-",44,"-","-" " New York City, NY",1373,1402,487,2775,507,447.3 " Norfolk, VA","-",68891,"-",68891,35856,92.1 " Ogdensburg, NY","-",1,12,1,12,-91.7

316

Gazette d'Amsterdam  

E-Print Network (OSTI)

Flandres[3 FLANDERS] complimenter Mons. le Con?table de Castille[2 CC], de la part du Roy[2 KE], sur sa venu? au pa?s bas, & sur la civilit? qu'il avoit d?ja faite ? Sa Majest?[2 KE]. *b Le Sieur Houard de Nortfolc[2 HOWARD OF NORFOLK], que le Roy[2 KE... ] est retourn? aux environs de c?te ville, ce qui fait fort murmurer les habitans du dehors, tant contre les troupes que contre leurs propres Magistrats. Et que les troupes qui sont dans le Pa?s-bas[3 PA?S-BAS] vivent avec tant de licence qu'elles volent...

Ries, Paul

2006-04-03T23:59:59.000Z

317

SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

Metallurgical Coal Exports by Customs District" Metallurgical Coal Exports by Customs District" "(short tons)" ,,,,"Year to Date" "Customs District","April - June","January - March","April - June",2013,2012,"Percent" ,2013,2013,2012,,,"Change" "Eastern Total",11716074,14136513,15167377,25852587,27578514,-6.3 " Baltimore, MD",2736470,4225450,5123600,6961920,9037970,-23 " Boston, MA","-","-","-","-",28873,"-" " Buffalo, NY",247714,121347,524040,369061,725698,-49.1 " Norfolk, VA",8730257,9784866,9519119,18515123,17784479,4.1 " Ogdensburg, NY",1633,4850,618,6483,1494,333.9 "Southern Total",3551564,3824484,4264938,7376048,8976503,-17.8

318

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

Usage Usage Overall fuel economy (mpg) 139 Overall electrical energy consumption (AC Wh/mi) 293 Number of trips¹ 76,425 Total distance traveled (mi) 609,737 Avg trip distance (mi) 8.0 Avg distance traveled per day when the vehicle was driven (mi) 36.4 Avg number of trips between charging events 3.0 Avg distance traveled between charging events (mi) 24.1 Avg number of charging events per day when the vehicle was driven 1.5

319

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

6 6 Overall AC electrical energy consumption (AC Wh/mi) 175 Average Trip Distance 12.2 Total distance traveled (mi) 272,366 Average Ambient Temperature (deg F) 54.1 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 368 Distance traveled (mi) 129,389 Percent of total distance traveled 47.5% Average driving style efficiency (distance weighted)¹ 75% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.0 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 142,977 Percent of total distance traveled 52.4% Average driving style efficiency (distance weighted)¹ 77% City³ Highway³ Percent of miles in EV operation (%) 65.1% 31.1% Percent Number of trips 85.5% 14.5% Average trip distance (mi)

320

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

45 45 Overall DC electrical energy consumption (DC Wh/mi)² 29 Total number of trips 1,839 Total distance traveled (mi) 21,089 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 39 DC electrical energy consumption (DC Wh/mi) 61 Number of trips 654 Percent of trips city | highway 66% | 34% Distance traveled (mi) 5,717 Percent of total distance traveled 27% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 38 DC electrical energy consumption (DC Wh/mi) 57 Number of trips 117 Percent of trips city | highway 39% | 62% Distance traveled (mi) 3,683 Percent of total distance traveled 17% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 33 Number of trips 1,068 Percent of trips city | highway 71% | 30% Distance traveled (mi)

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

4.8 4.8 Overall AC electrical energy consumption (AC Wh/mi) 185 Average Trip Distance 13.1 Total distance traveled (mi) 208,165 Average Ambient Temperature (deg F) 77.6 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 369 Distance traveled (mi) 104,687 Percent of total distance traveled 50.3% Average driving style efficiency (distance weighted)¹ 87% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 37.2 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 103,478 Percent of total distance traveled 49.7% Average driving style efficiency (distance weighted)¹ 82% City³ Highway³ Percent of miles in EV operation (%) 69.8% 33.9% Percent Number of trips 85.0% 15.0% Average trip distance (mi)

322

Microsoft PowerPoint - Junior_ONR  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mi Mi it S i I tit ti (MSI ) Minority Serving Institutions (MSIs): Bridging the Gap between Federal g g p Agencies and MSIs Dr. Anthony Junior, Program Manager Naval Historically Black Colleges and University/Minority Institutions Program Office of Naval Research 874 North Randolph Street, Arlington, VA 22203 anthony.junior@navy.mil AVJ HBCU/MI SP Concepts V2 Agenda * The Requirement The Requirement * The Strategic Plan * HBCU/MI Full Engagement Model HBCU/MI Full Engagement Model * STEM Research Pipeline * HBCU/MI Accredited Engineering Schools * HBCU/MI Accredited Engineering Schools 2 10 USC 2362 Objective: Enhance defense-related research and education at HBCU/MIs to assist the Department in education at HBCU/MIs to assist the Department in defense-related research, development, testing, and

323

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

2.5 2.5 Overall AC electrical energy consumption (AC Wh/mi) 166 Average Trip Distance 12.1 Total distance traveled (mi) 385,849 Average Ambient Temperature (deg F) 78.2 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 332 Distance traveled (mi) 193,336 Percent of total distance traveled 50.1% Average driving style efficiency (distance weighted)¹ 85% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.2 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 192,512 Percent of total distance traveled 49.9% Average driving style efficiency (distance weighted)¹ 79% City³ Highway³ Percent of miles in EV operation (%) 67.2% 31.5% Percent Number of trips 86.7% 13.3% Average trip distance (mi)

324

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

36 36 Overall DC electrical energy consumption (DC Wh/mi)² 18 Total number of trips 1,290 Total distance traveled (mi) 13,023 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 39 DC electrical energy consumption (DC Wh/mi) 58 Number of trips 432 Percent of trips city | highway 75% | 25% Distance traveled (mi) 2,835 Percent of total distance traveled 22% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 41 DC electrical energy consumption (DC Wh/mi) 48 Number of trips 52 Percent of trips city | highway 31% | 69% Distance traveled (mi) 1,613 Percent of total distance traveled 12% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 34 Number of trips 806 Percent of trips city | highway 73% | 27% Distance traveled (mi)

325

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

7.8 7.8 Overall AC electrical energy consumption (AC Wh/mi) 180 Average Trip Distance 12.8 Total distance traveled (mi) 346,409 Average Ambient Temperature (deg F) 51.5 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 384 Distance traveled (mi) 161,982 Percent of total distance traveled 46.8% Average driving style efficiency (distance weighted)¹ 74% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.1 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 184,427 Percent of total distance traveled 53.2% Average driving style efficiency (distance weighted)¹ 76% City³ Highway³ Percent of miles in EV operation (%) 63.8% 28.4% Percent Number of trips 85.7% 14.3% Average trip distance (mi)

326

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

49 49 Overall DC electrical energy consumption (DC Wh/mi)² 27 Total number of trips 927 Total distance traveled (mi) 9,301 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 39 DC electrical energy consumption (DC Wh/mi) 66 Number of trips 313 Percent of trips city | highway 68% | 32% Distance traveled (mi) 2,138 Percent of total distance traveled 23% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 41 DC electrical energy consumption (DC Wh/mi) 63 Number of trips 46 Percent of trips city | highway 30% | 70% Distance traveled (mi) 1,462 Percent of total distance traveled 16% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 34 Number of trips 568 Percent of trips city | highway 75% | 25% Distance traveled (mi)

327

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

8 8 Overall AC electrical energy consumption (AC Wh/mi)¹ 148 Overall DC electrical energy consumption (DC Wh/mi)² 104 Total number of trips 1,212 Total distance traveled (mi) 11,846 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 58 DC electrical energy consumption (DC Wh/mi) 160 Number of trips 823 Percent of trips city | highway 81% | 19% Distance traveled (mi) 5,559 Percent of total distance traveled 47% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 46 DC electrical energy consumption (DC Wh/mi) 85 Number of trips 195 Percent of trips city | highway 40% | 61% Distance traveled (mi) 4,217 Percent of total distance traveled 36% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 34 Number of trips

328

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Overall AC electrical energy consumption (AC Wh/mi) 174 Average Trip Distance 12.6 Total distance traveled (mi) 1,243,988 Average Ambient Temperature (deg F) 63.2 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 352 Distance traveled (mi) 615,161 Percent of total distance traveled 49.5% Average driving style efficiency (distance weighted)¹ 80% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 35.4 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 628,828 Percent of total distance traveled 50.5% Average driving style efficiency (distance weighted)¹ 78% City³ Highway³ Percent of miles in EV operation (%) 66.8% 31.7% Percent Number of trips 85.5% 14.5% Average trip distance (mi)

329

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

50 50 Overall DC electrical energy consumption (DC Wh/mi)² 22 Total number of trips 730 Total distance traveled (mi) 9,164 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 40 DC electrical energy consumption (DC Wh/mi) 61 Number of trips 225 Percent of trips city | highway 68% | 32% Distance traveled (mi) 1,768 Percent of total distance traveled 19% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 36 DC electrical energy consumption (DC Wh/mi) 53 Number of trips 40 Percent of trips city | highway 23% | 78% Distance traveled (mi) 1,638 Percent of total distance traveled 18% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 35 Number of trips 465 Percent of trips city | highway 70% | 30% Distance traveled (mi)

330

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

71.0 71.0 Overall AC electrical energy consumption (AC Wh/mi) 169 Average Trip Distance 12.5 Total distance traveled (mi) 1,661,080 Average Ambient Temperature (deg F) 67.1 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 340 Distance traveled (mi) 826,775 Percent of total distance traveled 49.8% Average driving style efficiency (distance weighted)¹ 81% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 35.7 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 834,306 Percent of total distance traveled 50.2% Average driving style efficiency (distance weighted)¹ 78% City³ Highway³ Percent of miles in EV operation (%) 66.9% 31.6% Percent Number of trips 85.8% 14.2% Average trip distance (mi)

331

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

5 5 Overall AC electrical energy consumption (AC Wh/mi) 170 Average Trip Distance 12.4 Total distance traveled (mi) 2,041,556 Average Ambient Temperature (deg F) 64.4 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 345 Distance traveled (mi) 1,002,495 Percent of total distance traveled 49.1% Average driving style efficiency (distance weighted)¹ 80% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 35.9 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 1,039,061 Percent of total distance traveled 50.9% Average driving style efficiency (distance weighted)¹ 78% City³ Highway³ Percent of miles in EV operation (%) 66.2% 31.0% Percent Number of trips 86.0% 14.0% Average trip distance (mi)

332

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

1.1 1.1 Overall AC electrical energy consumption (AC Wh/mi) 182 Average Trip Distance 11.8 Total distance traveled (mi) 355,058 Average Ambient Temperature (deg F) 46.0 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 416 Distance traveled (mi) 155,080 Percent of total distance traveled 43.7% Average driving style efficiency (distance weighted)¹ 69% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 34.4 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 199,978 Percent of total distance traveled 56.3% Average driving style efficiency (distance weighted)¹ 74% City³ Highway³ Percent of miles in EV operation (%) 60.5% 27.0% Percent Number of trips 86.3% 13.7% Average trip distance (mi)

333

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

53 53 Overall DC electrical energy consumption (DC Wh/mi)² 34 Total number of trips 1,515 Total distance traveled (mi) 15,617 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 37 DC electrical energy consumption (DC Wh/mi) 65 Number of trips 739 Percent of trips city | highway 74% | 26% Distance traveled (mi) 4,915 Percent of total distance traveled 31% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 38 DC electrical energy consumption (DC Wh/mi) 58 Number of trips 93 Percent of trips city | highway 38% | 62% Distance traveled (mi) 2,842 Percent of total distance traveled 18% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 33 Number of trips 683 Percent of trips city | highway 72% | 28% Distance traveled (mi)

334

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

6.6 6.6 Overall AC electrical energy consumption (AC Wh/mi) 171 Average Trip Distance 11.9 Total distance traveled (mi) 370,316 Average Ambient Temperature (deg F) 53.8 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 371 Distance traveled (mi) 170,860 Percent of total distance traveled 46.1% Average driving style efficiency (distance weighted)¹ 75% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 35.9 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 199,456 Percent of total distance traveled 53.9% Average driving style efficiency (distance weighted)¹ 77% City³ Highway³ Percent of miles in EV operation (%) 63.2% 28.1% Percent Number of trips 86.7% 13.3% Average trip distance (mi)

335

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

2 2 Overall AC electrical energy consumption (AC Wh/mi) 157 Average Trip Distance 12.3 Total distance traveled (mi) 407,245 Average Ambient Temperature (deg F) 67.9 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 338 Distance traveled (mi) 189,426 Percent of total distance traveled 46.5% Average driving style efficiency (distance weighted)¹ 82% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.5 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 217,819 Percent of total distance traveled 53.5% Average driving style efficiency (distance weighted)¹ 79% City³ Highway³ Percent of miles in EV operation (%) 65.2% 28.3% Percent Number of trips 86.5% 13.5% Average trip distance (mi)

336

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

73.7 73.7 Overall AC electrical energy consumption (AC Wh/mi) 170 Average Trip Distance 12.6 Total distance traveled (mi) 370,987 Average Ambient Temperature (deg F) 71.0 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 341 Distance traveled (mi) 185,282 Percent of total distance traveled 49.9% Average driving style efficiency (distance weighted)¹ 83% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.9 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 185,705 Percent of total distance traveled 50.1% Average driving style efficiency (distance weighted)¹ 79% City³ Highway³ Percent of miles in EV operation (%) 68.0% 32.4% Percent Number of trips 85.4% 14.6% Average trip distance (mi)

337

Hampton University and Old Dominion University Solar Decathlon 2011 Construction Drawings  

NLE Websites -- All DOE Office Websites (Extended Search)

3 3 WWW.SOLARDECATHLON.GOV TEAM NAME: ADDRESS: CONTACT: CLARK NEXSEN ARCHITECTURE & ENGINEERING CONSULTANTS NONE: PROJECT IS PUBLIC DOMAIN CONSTRUCTION DOCUMENTS 2/14/2013 NORFOLK, VIRGINIA 2/14/2013 2:18:32 PM G-001 COVER SHEET 108 TEAM TIDEWATER VIRGINIA HAMPTON UNIVERSITY DEPARTMENT OF ARCHITECTURE HAMPTON, VIRGINIA OLD DOMINION UNIVERSITY SCHOOL OF ENGINEERING NORFOLK, VIRGINIA TEAMTIDEWATER MARK DATE DESCRIPTION PRODUCED BY AN AUTODESK STUDENT PRODUCT PRODUCED BY AN AUTODESK STUDENT PRODUCT P R O D U C E D B Y A N A U T O D E S K S T U D E N T P R O D U C T PRODUCED BY AN AUTODESK STUDENT PRODUCT DN 211 SF LIVING ROOM 223 SF KITCHEN 90 SF BATHROOM 205 SF BEDROOM 45 SF HALL 72 SF OFFICE MECHANICAL ROOM 6 1 2 3 4 5 6 7 A B C D E 1 2 3 4 5 6 7 A B C D E SHEET TITLE LOT NUMBER: DRAWN BY: CHECKED BY: COPYRIGHT: CLIENT U.S. DEPARTMENT OF ENERGY

338

Revue dEtudes Tibtaines  

E-Print Network (OSTI)

. Moscou : Nauka. Zhang Yisun 1993. Bod rgya tshig mdzod chen mo, Pkin : Mi rigs dpe skrun khang LA ROCA BLANCA DE LHANG LHANG Un santuario en Nyag rong Oriol Aguilar En Tbet, el Pas de las Nieves, en el centro de... mi nyag pa en el Nyag rong, procedentes del norte. La predominancia del dialecto mi nyag habra cambiado el antiguo nombre del rea, que era Brag dmar, en Rag dmar8. Tambin facilita los nombres de los diversos centros religiosos desde tiempos...

Achard, Jean-Luc

2007-01-01T23:59:59.000Z

339

microRNA: human disease and development  

Science Conference Proceedings (OSTI)

microRNAs or miRNAs are an abundant class of highly conversed, small non-coding RNAs that present an entirely new theme of post-transcriptional gene regulation. miRNAs play a key role in diverse biological systems, such as virology, embryogenesis, ... Keywords: bioinformatics, biomarkers, cancer, eukaryotes, gene regulation, immune system development, immune system response, immunity regulation, metabolic pathways, miRNAs, microRNA expression, stem cells, target predictions

Virendra S. Gomase; Akshay N. Parundekar

2009-09-01T23:59:59.000Z

340

www.eia.gov  

U.S. Energy Information Administration (EIA)

Pilgrim Nuclear Power Station Massachusetts Total MD Calvert Cliffs Nuclear Power Plant Maryland Total MI Fermi Donald C Cook Michigan Total MN Prairie Island ...

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Materials Week '97: Wednesday AM Session  

Science Conference Proceedings (OSTI)

... MI 48104; Gordon Geiger, Qualitech Steel Corporation, 301 Merchant Bank .... hardness and impact energy are reported during austempering at 400, 375,...

342

CNST Group Seminars - 2008  

Science Conference Proceedings (OSTI)

... Joshua Hihath Arizona State University. ... electrostatic potential in high spatial and energy resolutions, and ... MI is a four-wave-mixing (FWM) process ...

2013-05-07T23:59:59.000Z

343

Ecosystem dynamics of the Aleutian Islands.  

E-Print Network (OSTI)

??Located between Asia and America and extending over a 1,000 mi., the Aleutian Islands have commonly been studied in a partial or fragmented manner. This (more)

Ortiz, Ivonne

2007-01-01T23:59:59.000Z

344

Molecular characterization of animal microRNAs : sequence, expression, and stability  

E-Print Network (OSTI)

(cont.) miRNAs. These cells lines may also be useful for other functional studies, such as validation of putative mRNA target genes.

Lau, Nelson C., 1978-

2004-01-01T23:59:59.000Z

345

fcmlbig - Energy Information Administration  

U.S. Energy Information Administration (EIA)

256821 TX Freeman-Martin 256852 MI Freeman-Redding 256914 WV Freemansburg 256945 IL Freemanspur 256976 KS Freemeyer 257007 CA Fremont Landing 257038 OK Freeny

346

Service/Product Provider  

NLE Websites -- All DOE Office Websites (Extended Search)

Bay Controls, LLC Ford Motor Company 6528 Weatherfield Ct. 550 Town Center Dr., Ste 200 Maumee, OH 43537 Dearborn, MI 48126 Business: Air Compressor Controls Business: Automotive...

347

La Roca Blanca de Lhang lhang - Un santuario en Nyag rong  

E-Print Network (OSTI)

de Rag dmar, debido a la progresiva influencia a lo largo de los siglos de la emigracin de poblacin mi nyag pa en el Nyag rong, procedentes del norte. La predominancia del dialecto mi nyag habra cambiado el antiguo nombre del rea, que era Brag... mi nyag pa shar dang lho phyogs su phos mthus mi nyag log skad da ltaang lus yod pa de sa gnas dir rag dmar go zer ba ni brag dmar go zer ba yin/ La Roca Blanca de Lhang lhang 15 masculina(dbon brgyud) 9 . Muchos de estos centros religiosos...

Aguillar, Oriol

2007-01-01T23:59:59.000Z

348

Past Chairmen of the Conference  

Science Conference Proceedings (OSTI)

... 73rd 1988 Grand Rapids, MI D. Guensler, CA 74th 1989 Seattle, WA J. Bartfai, NY 75th 1990 Washington, DC F. Gerk, NM ...

2013-07-08T23:59:59.000Z

349

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

- 07312013 Midland, MI CONTRIBUTING TO NET ZERO BUILDING: HIGH ENERGY EFFICIENT EIFS WALL SYSTEMS Enhance exterior insulation and finishing system (EIFS) envelope systems to...

350

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Project Management Center 2010 Gary Sames 812010 - 7312013 Midland, MI Advanced Insulation for High-Performance, Cost-Effective Wall, Roof and Foundation Systems Develop...

351

VERTIGO (VERtical Transport In the Global Ocean): A study of particle sources and flux attenuation in the North Pacific  

E-Print Network (OSTI)

Research II, this volume. Volk, T. , Hoffert, M.I. , 1985.the oceans biological pump (Volk and Hoffert, 1985). This

Buesseler, K.O.

2008-01-01T23:59:59.000Z

352

High Biomass Low Export Regimes in the Southern Ocean  

E-Print Network (OSTI)

Research-Oceans 106 (C12) Volk, T. , Hoffert, M.I. , 1985.in the atmosphere (Volk and Hoffert 1985), understanding the

Lam, Phoebe J.; Bishop, James K.B.

2006-01-01T23:59:59.000Z

353

Quantifying the surface-subsurface biogeochemical coupling during the VERTIGO ALOHA and K2 studies  

E-Print Network (OSTI)

projects/vertigo.html Volk, T. , Hoffert, M.I. , 1985. Oceanto the oceans interior (Volk and Hoffert, 1985). The source

Boyd, P.W.

2008-01-01T23:59:59.000Z

354

Chrysler RAM PHEV Fleet Results Report  

NLE Websites -- All DOE Office Websites (Extended Search)

istance (mi) 4 45 Trips in Charge Depleting (CD) mode City Highway Gasoline fuel economy (mpg) DC electrical energy consumption (DC Whmi) Percent of miles with internal combustion...

355

Michigan | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Assistance to Dow Kokam Mi, LLC To Manufacture Advanced Lithium Polymer Batteries for Hybrid and Electric Vehicles At Midland, Michigan March 1, 2010 EA-1721: Final...

356

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

Braking Energy Recovery (%) 14% City Trips ( < 5 stopsmile & <37 mph avg) DC electrical energy consumption (DC Whmi) 380 Number of trips 106 Distance traveled (mi) 237 Percent...

357

EnergyCS Prius Altairnano 2009 Report.xls  

NLE Websites -- All DOE Office Websites (Extended Search)

period: All trips combined Overall gasoline fuel economy (mpg) Overall DC electrical energy consumption (DC Whmi) 2 Total number of trips Total distance traveled (mi) Trips...

358

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

Braking Energy Recovery (%) 15% City Trips ( < 5 stopsmile & <37 mph avg) DC electrical energy consumption (DC Whmi) 414 Number of trips 152 Distance traveled (mi) 131 Percent...

359

EnergyCS Prius Valence 2009 Report.xls  

NLE Websites -- All DOE Office Websites (Extended Search)

period: All trips combined Overall gasoline fuel economy (mpg) Overall DC electrical energy consumption (DC Whmi) 2 Total number of trips Total distance traveled (mi) Trips...

360

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

Braking Energy Recovery (%) 15% City Trips ( < 5 stopsmile & <37 mph avg) DC electrical energy consumption (DC Whmi) 410 Number of trips 94 Distance traveled (mi) 307 Percent of...

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

1 Introduction  

E-Print Network (OSTI)

1Department of Mathematics, Wayne State University, Detroit, MI 48202 (boris@ math.wayne.edu). Research of this author was partly supported by the National...

362

1 Introduction  

E-Print Network (OSTI)

2Department of Mathematics, Wayne State University, Detroit, MI 48202, USA; email: boris@math.wayne.edu. Research of this author was also partly supported ...

363

Approximate Maximum Principle for Discrete Approximations of ...  

E-Print Network (OSTI)

Detroit, MI 48202. Email: boris@math.wayne.edu. ILYA SHVARTSMAN. Department of Mathematics and Computer Science. Penn State University - Harrisburg.

364

Hlder Metric Subregularity with Applications to Proximal Point Method  

E-Print Network (OSTI)

Feb 2, 2012 ... Department of Mathematics, Wayne State University, Detroit, MI 48202, USA. Email: boris@math.wayne.edu. Research of this author was also...

365

1 Introduction  

E-Print Network (OSTI)

Strategic Reference Framework under grant PTDC/MAT/111809/2009. 3Doctoral Student, Department of Mathematics, Wayne State University, Detroit, MI 48202...

366

www.eia.gov  

U.S. Energy Information Administration (EIA)

... , "Detroit, MI",, ,Coking,Steam 2000,61542,1142280 2005,177414,8456023 2010,160896,6187802 Jan-Aug 2011,9323,1227071 ,, "Mobile, AL", ...

367

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DTE Energy PMCPVT FY2012Appx. 11 months Rondle Harp Detroit, MI GM Battery Pack Assembly Plant - Electric Substation Upgrade General business actions to support the EDV battery...

368

1 Introduction  

E-Print Network (OSTI)

2Department of Mathematics, Wayne State University, Detroit, MI 48202, USA; email: boris@math.wayne.edu. Research of this author was also partially...

369

LIGHT WEIGHT ALLOYS FOR AEROSPACE APPLICATION IV: III ...  

Science Conference Proceedings (OSTI)

Room: 330A. Session Chairperson: J.E. Benci, Wayne State University, Dept. of Materials Science and Engineering, Detroit, MI 48202...

370

Girls Will Be Boys: Cross-Dressed Women and the Legitimation of American Silent Cinema  

E-Print Network (OSTI)

in American Film. Detroit: Wayne State University Press,159. Washington--The Prince and the Pauper. Detroit News.Detroit, MI, December 6, 1915. Waters, Sarah. A Girton

Horak, Laura

2011-01-01T23:59:59.000Z

371

1 Introduction  

E-Print Network (OSTI)

2Department of Mathematics, Wayne State University, Detroit, MI 48202 (boris@ math.wayne.edu). Re- search of this author was also partly supported by the...

372

Transfac 2009: Home Page  

Science Conference Proceedings (OSTI)

TRANSFAC 2009 OCT. 31 - NOV. 3, 2009 DETROIT, MI USA ... and Materials (KIM), Metsoc Metallurgical Society of CIM, ASM International Detroit Chaper...

373

New Fractional Error Bounds for Nonconvex Polynomial Systems ...  

E-Print Network (OSTI)

Jan 7, 2013 ... Department of Mathematics, Wayne State University, Detroit, MI 48202, USA. Email: boris@math.wayne.edu. Re- search of this author was...

374

Evaluation of I-15 Devore (08-0A4224) Long-Life Pavement Rehabilitation Costs  

E-Print Network (OSTI)

Cost Indirect Costs Engineer's Estimate Category Amount2 lane-mi. Administrative Costs Engineer's Estimate CategoryMiles) Total (All Costs) Engineer's Estimate Amount Original

Fermo, Mary G; Santero, Nicholas J; Nokes, William; Harvey, John T

2005-01-01T23:59:59.000Z

375

Journal of Research Volume 94  

Science Conference Proceedings (OSTI)

... L; Cabeza, MI; Rico, FR; Garciariquelme, O.; Kaufman, V. http://dx ... Database for XQQ instruments - A kinetics-based measurement protocol, p. 281 ...

2012-10-03T23:59:59.000Z

376

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

- Clean Energy Coalition Michigan Green Fleets Improvements andor upgrades to existing CNG refueling station in Detroit, MI. This CX form is for one location in this project...

377

FINAL ENVIRONMENTAL ASSESSWW LEASE OF LANDAND FACILFIlES W I  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

f a succcssfigyJI&&@ anETTPpropaty, W E T adW E signa MaMI.andumdUndct.9tanding (MOU), whichstatear thatallpartiesagreetothe objadivedaspccificpicetdpropatyfbtadctinnl...

378

Preserving research data  

E-Print Network (OSTI)

Consortium for Political and Social Research. Ann Arbor, MI;Access to Publicly Funded Research Data. The Public Domainof the products of scientific research. Meanwhile, research

Jacobs, James A; Humphrey, Charles

2004-01-01T23:59:59.000Z

379

Altered microRNA expression patterns in irradiated hematopoietic tissues suggest a sex-specific protective mechanism  

Science Conference Proceedings (OSTI)

To investigate involvement of miRNAs in radiation responses we used microRNAome profiling to analyze the sex-specific response of radiation sensitive hematopoietic lymphoid tissues. We show that radiation exposure resulted in a significant and sex-specific deregulation of microRNA expression in murine spleen and thymus tissues. Among the regulated miRNAs, we found that changes in expression of miR-34a and miR-7 may be involved in important protective mechanisms counteracting radiation cytotoxicity. We observed a significant increase in the expression of tumor-suppressor miR-34a, paralleled by a decrease in the expression of its target oncogenes NOTCH1, MYC, E2F3 and cyclin D1. Additionally, we show that miR-7 targets the lymphoid-specific helicase LSH, a pivotal regulator of DNA methylation and genome stability. While miR-7 was significantly down-regulated LSH was significantly up-regulated. These cellular changes may constitute an attempt to counteract radiation-induced hypomethylation. Tissue specificity of miRNA responses and possible regulation of miRNA expression upon irradiation are discussed.

Ilnytskyy, Yaroslav; Zemp, Franz J.; Koturbash, Igor [Department of Biological Sciences, University of Lethbridge, 4401 University Drive, Lethbridge, Alta., T1K 3M4 (Canada); Kovalchuk, Olga [Department of Biological Sciences, University of Lethbridge, 4401 University Drive, Lethbridge, Alta., T1K 3M4 (Canada)], E-mail: olga.kovalchuk@uleth.ca

2008-12-05T23:59:59.000Z

380

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

through December 2012 Vehicle Usage Overall fuel economy (mpg) 126 Overall electrical energy consumption (AC Whmi) 229 Number of trips 369,118 Total distance traveled (mi)...

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

SOLVENT EXTRACTION OF PHENOLS FROM WATER  

E-Print Network (OSTI)

Prog. , 21. (5), 67 (1977). Exxon Research & EngineeringMI 48640. 2. Present address: Exxon Research & Engineeringprocesses (Singer, et al, 1977; Exxon Research & Engineering

Greminger, Douglas C.

2012-01-01T23:59:59.000Z

382

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Vehma EE DE-EE0005574 PMCPVT 2011 Aaron Yocum 10012011 - 09302015 Troy, Oakland County, MI Demonstration of a Multi-Material Lightweight Prototype Vehicle Design, build, and...

383

Adaptive Materials Inc | Open Energy Information  

Open Energy Info (EERE)

Zip MI 48108 Product Adaptive Materials Inc (AMI) is a developer of portable fuel cell technology. References Adaptive Materials Inc1 LinkedIn Connections CrunchBase...

384

Development of a Damage Tolerant Heat Treatment for Cast + HIP ...  

Science Conference Proceedings (OSTI)

Supplier Institute - Dearborn, MI; 1986; pg 182. Acknowledgments ... A. Koren, et. al.; The Effect of Weld Energy Input Parameters on the Crack Sensitivity of...

385

Application of Optical Diagnostics for Fuel Spray Characterization  

NLE Websites -- All DOE Office Websites (Extended Search)

Optical Diagnostics for Fuel Spray Characterization Scott Parrish General Motors Global Research, 30500 Mound Road, Warren, MI 48090-9055 USA It is well known that fuel spray...

386

Author Biography Form  

Science Conference Proceedings (OSTI)

Author Biography Form. Title: ? Dr. ? Prof. ? Mr. ? Mrs. ? Ms. Gender: ? Male ? Female. Name: First. M.I.. Last. Current Status: Position: Company: Address:.

387

Individual Particle-Analysis of Ambient PM2.5 Using Advanced...  

NLE Websites -- All DOE Office Websites (Extended Search)

communities near southwestern Detroit, MI (close to multiple combustion sources including motor vehiclediesel, incinerators, and oil and coal combustion sources) and Steubenville,...

388

Economic Assessment of Electric-Drive Vehicle Operation in California and the United States  

E-Print Network (OSTI)

Seattle City Light XCEL Energy (If Applicable) Light) $2.77 Seattle ( WA) Colorado (XCEL CO) $2.50 Colorado Michigan (XCEL MI) $2.49 Michigan

Lidicker, Jeffrey R.; Lipman, Timothy E.; Shaheen, Susan A.

2010-01-01T23:59:59.000Z

389

Exploration of Resource and Transmission Expansion Decisions in the Western Renewable Energy Zone Initiative  

E-Print Network (OSTI)

Capacity Factor ITC Availability Transmission Cost 500 kVwhere the availability of transmission-congestion managementxiv New Transmission Capacity (GW-mi) 16K availability of

Mills, Andrew

2010-01-01T23:59:59.000Z

390

Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

turbine replaced - MI-50 Upper power supply brought back online - Pbar dry engine flywheel replaced Read the Current Accelerator Update Read the Early Bird Report View the...

391

Accelerator Update | Archive | 2008  

NLE Websites -- All DOE Office Websites (Extended Search)

turbine replaced - MI-50 Upper power supply brought back online - Pbar dry engine flywheel replaced October 17, 2008 - October 20, 2008 - four stores provided 61 hours and 15...

392

Materials for Transportation Applications: Selected Proceedings ...  

Science Conference Proceedings (OSTI)

Sep 16, 2007 ... A collection of papers from MS&T'07 held in Detroit, MI, September 16-20, 2007, covering topics related to Materials for Transportation...

393

Engineering microbial biofuel tolerance and export using ...  

Ramos JL, Duque E, Gallegos MT, Godoy P, Ramos-Gonzalez MI, Rojas A, Teran W, Segura A (2002) Mechanisms of solvent tolerance in gram-negative bacteria.

394

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Strategy to Accelerate US Transition to Electric Vehicles Demonstrate a plug-in hybrid vehicle, install charging systems. 07 20 2010 John Jason Conley Digitally signed by...

395

Finishing in the Future  

NLE Websites -- All DOE Office Websites (Extended Search)

The Genome Institute, Washington University Areas of emphasis at this meeting included: Genome Sequencing: New sequencing technologies (454, illumina, SOLiD, Ion Torrent, MiSeq,...

396

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2012 48 months Aaron Yocum Auburn Hills, MI Validation of Material Models for Automotive Carbon-Fiber Composite Structures via Physical and.... The project is the validation of...

397

A Sample Approximation Approach for Optimization with ...  

E-Print Network (OSTI)

... ? is a random vector with suport ? ? Rd, G : Rn Rd ? Rm is a given constraint mapping ...... The suppliers have limited capacity Mi for i ? I. There is a .

398

Thermal-Mechanical Fatigue Life Model for Coated Superalloy ...  

Science Conference Proceedings (OSTI)

in an aggressive combustion gas environment. Coating ..... M.I. Wood and G.F. Harrison, "Modeling The Deformation Of Coated. Superalloys Under Thermal...

399

Evaluating the Effectiveness of the Massachusetts Workforce Development System Using No-Shows as a Non-Experimental Comparison Group  

E-Print Network (OSTI)

the Effect of Training Programs, Review of Economics andGroup in Evaluating Training Programs, Kalamazoo, MI: W. E.ed. ) Evaluating Manpower Training Programs , JAI Press:

Raphael, Steve; Stoll, Michael A.

2005-01-01T23:59:59.000Z

400

David Chamulak  

NLE Websites -- All DOE Office Websites (Extended Search)

Laboratory, USA 2009: Ph.D., Michigan State University, East Lansing, MI, USA. curriculum vitae Publications Asymmetry and the Nucleosynthetic Signature of Nearly Edge-Lit...

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Ivan Brida  

NLE Websites -- All DOE Office Websites (Extended Search)

Laboratory, USA 2009: Ph.D., Michigan State University, East Lansing, MI, USA. curriculum vitae Publications I. Brida and F. M. Nunes, A microscopic hyper-spherical model:...

402

Event or Meeting Title  

Science Conference Proceedings (OSTI)

... Page 22. Representation Root Causes 22 Kilogram Kilogram per Sq Kilograms per D Kilograms per Cu Kilograms per Un Kilograms per Mi ...

2012-05-23T23:59:59.000Z

403

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PVTD 2009 S. Richardson 102009 - 122013 Detroit, MI Installation of Retail Biofuel Infrastructure Supporting I-75 Green Corridor Project Install retail biofuel fueling...

404

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PMCPVTD FY2009 102009 - 122013 S. Richardson Royal Oak, MI Installation of Retail Biofuel Infrastructure Supporting I-75 Green Corridor Project Install retail biodiesel...

405

NETL: Mercury Emissions Control Technologies - Pilot Testing...  

NLE Websites -- All DOE Office Websites (Extended Search)

Utilities, ND; Detroit Edison, MI; and SaskPower, Canada. Contacts: For further information on this project, contact NETL Project Manager, Barbara Carney or Alan Bland from WRI...

406

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Motors LLC OEPMPVTD FY14-15 100113 - 093015 Bruce Mixer Warren, MI High Energy Lithium Batteries for PHEV Applications Develop technology and demonstrate a lithium ion...

407

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Novi, MI Next Generation Ultra Lean Burn Powertrain Demonstrate 45% thermal efficiency on a light duty gasoline engine using MAHLE's Turbulent Jet Ignition System. Activities at...

408

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Pontiac, MI Lean Gasoline System Development for Fuel Efficient Small Cars This project accelerates development and synergistic integration of four cost competitive technologies to...

409

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Warren, MI Lean Gasoline System Development for Fuel Efficient Small Cars This project accelerates development and synergistic integration of four cost competitive technologies to...

410

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Milford, MI Lean Gasoline System Development for Fuel Efficient Small Cars This project accelerates development and synergistic integration of four cost competitive technologies to...

411

The use of pressurized bladders for stress control of superconducting magnets  

E-Print Network (OSTI)

separation as seen during the RTI test I o----c MiNd :weobolts as it was done in RTI. Further, a cantilever structure

Caspi, S.

2011-01-01T23:59:59.000Z

412

Ceramics - TMS  

Science Conference Proceedings (OSTI)

"The Suspension Plasma Spraying of Bioceramics by Induction Plasma" ( Research Summary), E. Bouyer, F. Gitzhofer, and M.I. Boulos, February 1997, pp.

413

Surface Modification and Coatings  

Science Conference Proceedings (OSTI)

"The Suspension Plasma Spraying of Bioceramics by Induction Plasma" ( Research Summary), E. Bouyer, F. Gitzhofer, and M.I. Boulos, February 1997, pp.

414

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Holland, MI Distributed TE HVAC for Vehicle Applications Develop distributed thermoelectric HVAC components to supplement the central HVAC system in automotive applications and...

415

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Troy, MI Distributed TE HVAC for Vehicle Applications Develop distributed thermoelectric HVAC components to supplement the central HVAC system in automotive applications and...

416

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PMCPVT FY10-FY13 100109 - 073113 Carl Maronde Warren, MI Distributed TE HVAC for Vehicle Applications Develop distributed thermoelectric HVAC components to supplement the...

417

Ford Electric Battery Group | Open Energy Information  

Open Energy Info (EERE)

Ford Electric Battery Group Jump to: navigation, search Name Ford Electric Battery Group Place Dearborn, MI Information About Partnership with NREL Partnership with NREL Yes...

418

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

VT, and MI A Comprehensive Investigation of Unsteady Reciprocating Effects on Near-Wall Heat Transfer in Engines The objective of the proposed project is to use collaborative...

419

September 4, 2013 Selections for Vehicle Technologies Office...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

relative to current lithium-ion batteries. 999,778 Lubricant Formulations to Enhance Fuel Efficiency (Area of Interest 10) Ford Motor Company Dearborn, MI This project will...

420

1 Introduction  

E-Print Network (OSTI)

cal/bilevel structures, stochastic programming with applications to electricity spot market. 1Department of Mathematics, Wayne State University, Detroit, MI 48202...

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Pulte/Del Webb | Open Energy Information  

Open Energy Info (EERE)

MI Information About Partnership with NREL Partnership with NREL Yes Partnership Type Test & Evaluation Partner Partnering Center within NREL Electricity Resources & Building...

422

Pulte | Open Energy Information  

Open Energy Info (EERE)

MI Information About Partnership with NREL Partnership with NREL Yes Partnership Type Test & Evaluation Partner Partnering Center within NREL Electricity Resources & Building...

423

MT@TMS  

Science Conference Proceedings (OSTI)

Apr 20, 2013 ... The authors of this articleand organizers of ICME 2013are Mei Li, Ford Motor Company, Dearborn, MI; Carelyn Campbell, NIST,...

424

jtechD1100195 1656..1671  

NLE Websites -- All DOE Office Websites (Extended Search)

bulence and volume-averaged vertical air motion within the radar sampling volume are the primary sources of uncertainty in retrieving cloud and precipitation mi- crophysical...

425

Universidad Collaboration  

E-Print Network (OSTI)

of Iowa, Iowa City, IA 52242, U.S.A. L.J. Dauwe University of Michigan­Flint, Flint, MI 48502, U.S.A. M

Fermi National Accelerator Laboratory

426

Double Charm Baryons at SELEX James S. Russ  

E-Print Network (OSTI)

of Michigan-Flint, Flint, MI 48502, U.S.A. M. Gaspero, M. Iori University of Rome "La Sapienza" and INFN, Rome

Fermi National Accelerator Laboratory

427

Doubly-charmed Discovered?  

E-Print Network (OSTI)

City , IA 52242, U.S.A. L.J. Dauwe University of Michigan-Flint, Flint, MI 48502, U.S.A. M. Gaspero, M

Fermi National Accelerator Laboratory

428

arXiv:0902.0355v1[hep-ex]2Feb2009 UASLPIF09001  

E-Print Network (OSTI)

University of Iowa, Iowa City, IA 52242, U.S.A. nUniversity of Michigan-Flint, Flint, MI 48502, U.S.A. o

Akgun, Ugur

429

Relocation Request Form The Ohio State University Page 1 of 1  

E-Print Network (OSTI)

____________________________________________ to ______________________________ , Ohio Expenses Mileage or For 1/1/12-12/31/12 _________ miles @ $ .23/mi = Gasoline For 1/1/13-12/31/13

430

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2217 General Motors Corporation EE PMCPVT FY2012 Appx. 11 months Rondle Harp Brownstown, MI GM Battery Pack Assembly Plant - Electric Substation Upgrade Addition of supplemental...

431

www.eia.gov  

U.S. Energy Information Administration (EIA)

SEPT02MI 1. Monroe Coal Detroit Edison Co 2. Donald C Cook Nuclear Indiana Michigan Power Co 3. Ludington Pumped Storage Consumers Energy Co 4. ...

432

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

302014 Farmington Hills, MI Silicon-Nanowire-Based Lithium-Ion Batteries with Doubling Energy Density Materials research and testing to double energy density of lithium-ion...

433

DOE Joint Genome Institute 2008 Progress Report  

E-Print Network (OSTI)

proteins for biofuel production. Trends in Mi- crobiology,could help improve biofuel production. Diatom Genome Helpsa key target. Current biofuel production meth- ods, such as

Gilbert, David

2009-01-01T23:59:59.000Z

434

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Upgrade Compressed Natural Gas Facility at existing station located in Detroit, MI. This CX form is for one location in this project selected under Clean Cities FOA...

435

Microsoft Word - Grazing Factsheet.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

by either a Vario MACRO Elemental analyzer (Elementar Americas, Inc., Mt Laurel, NJ) or a Leco Tru Spec CN analyzer (Leco Corporation, Saint Joseph, MI). Inorganic carbon...

436

Previous Session - TMS  

Science Conference Proceedings (OSTI)

... University, Houghton, MI 49931; B.K. Cheong, W.M. Kim, S.G. Kim, Materials Design Laboratory, Korea Institute of Science and Technology, Seoul, Korea.

437

Other Participants 1992 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

, Sparks , NV Gateway High School , Monroeville , PA Grant High School, Portland , OR Hanford High School , Richland , WA Harrison High School , Farmington Hills , MI Henry M....

438

New Tools, New Science: Biology  

NLE Websites -- All DOE Office Websites (Extended Search)

transcriptomics, proteomics, and metabolomics analyses as well as high spatial resolution electron and fluorescence microscopy. MiCRoSCoPy Multi-photon fluorescence microscope:...

439

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EE EE0001814 PMC 2010 John Jason Conley 01012010-05012013 Livonia, MI Commercial EV Development and Manufacturing Program Battery pack development for the EV truck...

440

Task 1: Hydrate Code release, Maintenance and Support  

NLE Websites -- All DOE Office Websites (Extended Search)

in preparation include studies of methanotrophy in mi- crobial mats, Arctic lakes, the Gulf of Mexico and suboxic marine basins. Each of these manuscripts has been drafted and...

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Black carbon aerosols and the third polar ice cap  

E-Print Network (OSTI)

estimations in global aerosol models, Atmos. Chem. Phys. ,Cloud mi- crophysics and aerosol indirect efefcts in theuncertainties in assessing aerosol effects on climate, Ann.

Menon, Surabi

2010-01-01T23:59:59.000Z

442

Tumor initiating but differentiated luminal-like breast cancer ...  

... Oslo, Norway; cCancer Stem Cell Innovation Center, Oslo ... the above explanation always must be ... Fold change analysis of the miRNA microarray ...

443

James Fekete  

Science Conference Proceedings (OSTI)

... Licensed Professional Engineer State of Michigan. ... Ph.D. Materials Science and Engineering, The University of Michigan, Ann Arbor, MI (1986). ...

2012-10-01T23:59:59.000Z

444

Full Text  

E-Print Network (OSTI)

Department of Mathematics, Michigan State University, East Lansing, MI 48824- 1027, USA. Received June 29, 1999. Abstract. Stanley (Advances in Math. 111...

445

Abstract for Ivan Brida  

NLE Websites -- All DOE Office Websites (Extended Search)

Michigan State University, East Lansing, MI A microscopic hyperspherical model: from structure to reactions. Application to 6He. We have developed a microscopic cluster model for...

446

Middle Eastern Entrepreneurs: At Home In The Mission  

E-Print Network (OSTI)

Print. Sengstock, Mary C. Chaldeans in Michigan. East Lansing, MI: Michigan State University, 2005. Arab Americans in Michigan. East Lansing: Michigan

Khoshaba, Christy

2013-01-01T23:59:59.000Z

447

Center for Tobacco Policy Research at Saint Louis University. Project LEAP. Michigan  

E-Print Network (OSTI)

I NTRODUCTION Michigan I T HIS REPORT PROVIDES AN OVERVIEWCTPR) partnered with Michigan and seven other states toParticipating Partners in Michigan's Network MI Dept of

Jenine Harris

2005-01-01T23:59:59.000Z

448

On feasibility based bounds tightening0  

E-Print Network (OSTI)

Jan 24, 2012 ... 3 Ind. and Op. Eng. Dept., University of Michigan, Ann Arbor MI, USA. Email: jonxlee@umich.edu. 4 LIX, Ecole Polytechnique, F-91128...

449

Validation Workshop  

Science Conference Proceedings (OSTI)

... Lewis Publishers: Chelsea, MI HY Aboul-Enein, et al. ... I've trusted system manufacturers to handle this. Should I have? ...

2006-05-12T23:59:59.000Z

450

TIME MONEY  

Science Conference Proceedings (OSTI)

... Measurements. Lewis Publishers: Chelsea, MI, p. 193 Page 8. ... hands. I've trusted system manufacturers to handle this. Should I have? ...

2007-08-10T23:59:59.000Z

451

AIRBORNE ASBESTOS ANALYSIS  

Science Conference Proceedings (OSTI)

... 5.8 Handling of test and calibration items ... JK Taylor, Quality Assurance of Chemical Measurements, Lewis Publishers, Chelsea, MI, 1987. ...

2011-09-21T23:59:59.000Z

452

Validation:  

Science Conference Proceedings (OSTI)

... Measurements. Lewis Publishers: Chelsea, MI, p. 193 Page 15. ... hands. I've trusted system manufacturers to handle this. Should I have? ...

2007-09-07T23:59:59.000Z

453

MFR PAPER 995 Millions are spent annually  

E-Print Network (OSTI)

. During Colu mbu 's time, bottoms of ships were covered with a mi xture of tallow and pitch in hope o f

454

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

(mi) 7.2 43.8 Average driving style efficiency (distance weighted) 76% 80% Chevrolet Volt Vehicle Demonstration Fleet Summary Report Reporting period: May 2011 through March...

455

Other Participants 1999 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

MI Shawnee Mission South High School , Shawnee Mission , KS Skyline High School , Idaho Falls, ID Smoky Hill High School, Aurora, CO St. James High School , Montgomery , AL...

456

WSU foUndation/2006-2007 2006-2007 annUaL REPoRt  

E-Print Network (OSTI)

, Loïc, Manu, Marie-Jo, Chantale, Mi chèle, Anastasia, Patrick, Pierre, Anne, Ilizabethe, Eléa, Boris

Collins, Gary S.

457

On two relaxations of quadratically-constrained cardinality ...  

E-Print Network (OSTI)

Oct 18, 2012 ... Department of Electrical Engineering and Computer Science, University of Michigan, 1301 Beal Avenue,. Ann Arbor, MI 48109, USA. E-mail:...

458

SP58: Hydrogels for Stem Cell-Based Heart Muscle Regeneration  

Science Conference Proceedings (OSTI)

MI leads to chronic heart failure due to insufficient cardiomyocyte regeneration. The goal of this project is to design injectable, pH- and temperature-sensitive...

459

A Continuous Measure of Gross Primary Production for the Conterminous U.S. Derived from MODIS and AmeriFlux Data  

E-Print Network (OSTI)

Oklahoma (ARM) Metolius intermediate aged ponderosa pine (MI) Metolius new young pine (MN) Brookings (Bro) Freeman Ranch Mesquite Juniper (FRM) Wind

Xia, Jingfeng

2010-01-01T23:59:59.000Z

460

Interatomic Potentials Repository Project  

Science Conference Proceedings (OSTI)

... EAM/FS setfl, Ti.eam.fs, This conversion was performed from GJ Ackland's parameters by MI Mendelev (Ames National Laboratory). ...

2013-07-06T23:59:59.000Z

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Functional profiling of microRNAs in stallions  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short non-coding RNAs that act as post-transcriptional regulators of gene expression in eukaryotic genomes and are thought to be critically involved in many biological processes. While the functions of sperm miRNAs in equine biology are yet to be determined, studies in mouse and humans suggest that sperm miRNAs regulate gene expression in the zygote and can indicate the status of male fertility. The aim of this study was to characterize the expression profiles of selected sperm miRNA in equine tissues and compare their expression levels in the sperm and testes of fertile/sexually mature and subfertile/sexually immature stallions. From sperm RNA-seq data, we selected 6 highly expressed miRNAs: miR-34b, -34c, -191, -223, -1248 and -1905c. Total RNA enriched with miRNAs was extracted from 10 adult tissues, sperm of 3 fertile and 3 subfertile stallions, and testes of five 1-year old and five 3-year old stallions. The RNA was polyadenylated, reverse transcribed into srcDNA, and examined through RT-PCR and qRT-PCR. Reverse transcriptase PCR on a panel of adult male tissues revealed ubiquitous expression of the 6 miRNAs, whereas transcription of miR-34c, -223, and -1905c was elevated in testes and sperm. Additionally, we showed that stallion sperm and testes contain transcripts of mature sperm-enriched tRNA-derived 2 small RNAs (mse-tsRNAs), which is a novel finding for the horse. A pilot study was conducted to quantify the expression of miR-34c and miR-1905c in the sperm of fertile and subfertile stallions. While the expression levels varied between individuals and the two fertility phenotypes, a significantly (p=0.04) elevated expression of miR-34c was observed in the subfertile group. Finally, due to the overall high expression of miR-1905c in sperm, its expression was qualified and quantified in the testes of 1-year old and 3-year old stallions. miR-1905c was expressed in all testes samples and no significant differences in expression level were observed between immature and maturing testes. Because the number of stallions was limited, the current results remain preliminary and further experimentation will be required. Nevertheless, the discovery of miRNAs in stallion sperm might lead to a new direction in the search of biomarkers for stallion fertility.

Wang, Aaron Stephen

2013-05-01T23:59:59.000Z

462

SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

Steam Coal Exports by Customs District" Steam Coal Exports by Customs District" "(short tons)" ,,,,"Year to Date" "Customs District","April - June","January - March","April - June",2013,2012,"Percent" ,2013,2013,2012,,,"Change" "Eastern Total",4951041,5566950,6554494,10517991,11407664,-7.8 " Baltimore, MD",1275530,831976,1715016,2107506,2852092,-26.1 " Boston, MA",7,"-",12,7,24,-70.8 " Buffalo, NY",1180,1516,2826,2696,5257,-48.7 " New York City, NY",3088,2664,2168,5752,6106,-5.8 " Norfolk, VA",3578715,4697769,4760354,8276484,8443756,-2 " Ogdensburg, NY",36894,3610,3090,40504,6838,492.3 " Philadelphia, PA",55513,29255,34241,84768,56733,49.4

463

NSTAR Electric Company Smart Grid Project | Open Energy Information  

Open Energy Info (EERE)

Company Smart Grid Project Company Smart Grid Project Jump to: navigation, search Project Lead NSTAR Electric Company Country United States Headquarters Location Norfolk, Massachusetts Recovery Act Funding $10,061,883.00 Total Project Value $20,123,766.00 Coverage Area Coverage Map: NSTAR Electric Company Smart Grid Project Coordinates 42.1195426°, -71.3250563° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}

464

Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

6, 2009 6, 2009 Subscribe | Contact Us | Archive | Classifieds | Guidelines | Help Search GO Calendar Have a safe day! Thursday, August 6 11 a.m. Particle Astrophysics Seminar - One North (NOTE DATE, TIME, LOCATION) Speaker: Pierre Sikivie, University of Florida Title: Bose-Einstein Condensation of Dark Matter Axions 11:30 a.m. Medical Health Seminar - One West Speaker: Virgene Galloway, Provena Mercy Medical Center Title: Osteoarthritis 2 p.m. Computing Techniques Seminar - FCC1 Speaker: Prathap Basappa, Norfolk State University Title: Measurement, Quantification and Analyses of Partial Discharges in Insulation Systems 2:30 p.m. Theoretical Physics Seminar - Curia II Speaker: Gabriela Barenboim, Valencia University and IFIC Title: A Tale of Two Right Handed Neutrinos

465

United States Government Department of Energy DATE:  

Office of Legacy Management (LM)

kE FJ325.8 d& * 9 -1 kE FJ325.8 d& * 9 -1 . (8-89) ZFG fO7440 1 United States Government Department of Energy DATE: DEC 2 3 :gg3 REPLY TO ATTN OF: EM-421 (W. A. Williams, 903-8149) SUBJECT: Elimination of the Sites from the Formerly Utilized Sites Remedial Action Program TO: The File I have reviewed the attached site summaries and elimination recommendations for the following sites: e l Mitts & Merrel Co., Saginaw, Michigan l North Carolina State University, Raleigh, North Carolina l National Smelt & Refining, Cleveland, Ohio l Sutton, Steele & Steele, Dallas, Texas --------+. Norfolk Naval Station, Virginia In each case, the potential for radiological contamination above applicable guidelines is small. In each case the amounts of radioactive materials handled was small. Based on these considerations, these sites

466

DOE TEC Radiation Monitoring Subtopic Group Conference Call 10_11_07  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Radiation Monitoring Subtopic Group Conference Call Radiation Monitoring Subtopic Group Conference Call Thursday, October 11, 2007, 3:00 p.m. - 4:30 p.m. EDT Conference Call Minutes Participants: Chair: Cort Richardson (CSG/NE) Members: Mel Massaro (DOT/FRA), Ed Wilds (State of Connecticut), Vernon Jensen (Winnebago Tribe of Nebraska), Sean Kice (SSEB), Ralph Hail (Norfolk Southern), Pat Edwards (CSG/NE), Kevin Blackwell (DOT/FRA), Larry Stern (CVSA), Sarah Wochos (CSG/MW), Tim Runyon (CSG/MW), Christina Nelson (NCSL), Tony Dimond (BLET), Matt Dennis & Doug Osborn (SNL), Jim Williams (WIEB), Ralph Best & Steve Schmid (BSC) Contractor Support: John Smegal (Legin) Summary: Cort Richardson welcomed the participants to the inaugural Radiation Monitoring Subtopic Group conference call and thanked them for their interest. He indicated that his

467

U.S. Department of Energys Office of Science  

NLE Websites -- All DOE Office Websites (Extended Search)

Office of Science Office of Science ARM Science Team Meeting Sheraton Waterside Hotel Norfolk, VA Rickey Petty March 13 th , 2008 Routine AVP Clouds with Low Optical Water Depths (CLOWD) Optical Radiative Observations (RACORO) Office of Science U.S. Department of Energy Objectives Routine Flights sampling Low-altitude liquid-water clouds in the BL @ SGP Obtain representative statistics cloud microphysical properties. Validate retrieval algorithms Support process studies/model simulations of CLOWD-type clouds Office of Science U.S. Department of Energy ACRF Mission and Structure Management Structure Office of Science U.S. Department of Energy ACRF IOPR Process New Instruments: ARM IOPR system located at: http://www.arm.gov/acrf/fc.stm Field Campaign Guideline (PDF) Proposal Submission Form

468

RoutingTG_5-31-07_call_minutes.rtf  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

May 31, 2007 2:00 p.m.-3:30 p.m. EDT May 31, 2007 2:00 p.m.-3:30 p.m. EDT Conference Call Minutes Chair: Jay Jones (RW) Participants: Melissa Bailey ( CSG-NE), Jane Beetem (MO Dept. of Natural Resources), Kevin Blackwell (DOT/FRA), Barbara Byron (CA Energy Commission), Kurt Colborn (MHF), Sandy Covi (UP), Matt Dennis (SNL), Tony Dimond (BLET), Pat Edwards (CSG/NE), Scott Field (WIEB), Aubrey Godwin (ARRA), Ralph Hail (Norfolk Southern), Bob Halstead (Nevada Agency For Nuclear Projects), Lisa Janairo (CSG-MW), Vernon Jensen (Winnebago Tribe of Nebraska), Paul Johnson (ORNL), Marsha Keister (INL), Angela Kordyak (DOE/General Counsel), Mel Massaro (DOT/FRA), Ed Mueller (Esmeralda County, Nevada), Christina Nelson (NCSL), Scott Palmer (BLET), Cort Richardson (CSG-NE), Larry Stern (CVSA), Sarah

469

burrell.cdr  

NLE Websites -- All DOE Office Websites (Extended Search)

Burrell, Burrell, Pennsylvania. The site is managed by the U.S. Department of Energy Office of Legacy Management. Site Description and History Regulatory Setting The Burrell Disposal Site is a former railroad landfill located about 1 mile east of the Borough of Blairsville, Indiana County, in southwestern Pennsylvania. The site is bordered on the south by the Conemaugh River and on the north by Norfolk Southern railroad tracks. The surrounding land is sparsely populated. The site was operated as a railroad landfill from the late 1940s through the late 1960s. In the late 1940s, the Pennsylvania Railroad constructed a berm along the bank of the Conemaugh River and began landfill operations. The landfill is believed to have been used for typical railroad wastes, such as railroad ties, cinders, and excess coal. In 1956 and 1957, 11,600 tons of radioactive mill tailings, a predominantly sandy

470

ARM Aerosol Working Group Meeting  

NLE Websites -- All DOE Office Websites (Extended Search)

Overview of the An Overview of the C Overview of the An Overview of the C C loud and loud and La La nd nd S S urface urface I I nteractions nteractions C C ampaign ampaign (CLASIC) (CLASIC) ARM Science Team Meeting March 13 th , 2008 Norfolk, VA Jason Tomlinson Pacific Northwest National Laboratory Introduction Archive Website WIKI Overview * The primary goal of CLASIC is to improve understanding of the physics of the early stages of cumulus cloud convection as it relates to land surface conditions, and to translate this new understanding into improved representations in GCMs and regional climate models 1 Overview * ARM Southern Great Plains Climate Research Facility - June 8-July 2, 2007 * Nine participating aircraft - In-situ * CIRPAS Twin Otter * Cessna 206 * Duke University Helicopter Observation Platform

471

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Texas Gateway Solar Solar Grade Silicon purity http www CenturySilicon com Texas Area Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation

472

Enertrag UK Ltd | Open Energy Information  

Open Energy Info (EERE)

Enertrag UK Ltd Enertrag UK Ltd Jump to: navigation, search Name Enertrag UK Ltd Place United Kingdom Sector Wind energy Product Involved throught the SPV Norfolk Offshore Wind in the development of Cromer Offshore Wind Farm. References Enertrag UK Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Enertrag UK Ltd is a company located in United Kingdom . References ↑ "Enertrag UK Ltd" Retrieved from "http://en.openei.org/w/index.php?title=Enertrag_UK_Ltd&oldid=344939" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load) Error 429 Throttled (bot load)

473

NSTAR Electric Company | Open Energy Information  

Open Energy Info (EERE)

(Redirected from Boston Edison Company) (Redirected from Boston Edison Company) Jump to: navigation, search Name NSTAR Electric Company Place Norfolk, Massachusetts Service Territory Massachusetts Website www.nstar.com/residential Green Button Landing Page www.nstar.com/residential Green Button Reference Page www.nstar.com/ss3/nstar_n Green Button Implemented Yes Utility Id 54913 Utility Location Yes Ownership I NERC Location NPCC NERC NPCC Yes ISO NE Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] SGIC[2] Energy Information Administration Form 826[3] LinkedIn Connections CrunchBase Profile No CrunchBase profile.

474

pocforms06a0399.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Return Copy to: Bank of Return Copy to: Bank of America Government Card Services Unit P.O. Box 1637 Norfolk, VA 23501-1637 Facsimile: 757.624.6323 Toll Free Fax: 877.217.1033 Form: S06A0399 Revised: 05/17/99 Point of Contact Information Use this form to update point of contact information and/or establish EAGLS access for Agency/Organization Program Coordinators (A/OPCs), Transaction Dispute Offices (TDOs), Designated Billing Offices (DBOs) / Payment Offices, and EC/EDI coordinators. To delete EAGLS access, please use the EAGLS Access Application Form. Questions? Call GCSU toll-free (1.800.472.1424) from the US and Canada or, if dialing from international locations, call collect (1.757.441.4124). Add Modify Delete Hierarchy Level: Please list unit name and the seven (7) digit number associated with each level of the organization's

475

RPWG Overview  

NLE Websites -- All DOE Office Websites (Extended Search)

RPWG RPWG Overview of the Radiative Processes Working Group Dave Turner RPWG Chair 2008 ARM Science Team Meeting 11 March 2008 Norfolk, Virginia Overview of the RPWG RPWG Steering Group * Bob Ellingson * Chuck Long * Sally McFarlane * Andy Vogelmann Represent about 40 RPWG members Overview of the RPWG ARM Program Objectives * Relate observed radiative energy (spectrally and temporally resolved) to temperature and composition of the atmosphere * Develop and test parameterizations of the radiative properties and processes of water vapor, clouds, and aerosols, and incorporate these parameterizations in GCMs ARM Science Plan October 2004 Overview of the RPWG Clear-sky GCM vs observations comparisons Wild, Long, Ohmura, 2006, JGR Improved agreement for clear-sky SW from AMIP1

476

EPA Notice of Availability of the Site-wide Continued Operation of Lawrence Livermore National Laboratory and Stockpile Stewardship and Management, Implementation (DOE/EIS-0348/DOE/EIS-0236-S3)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

08 08 Federal Register / Vol. 70, No. 82 / Friday, April 29, 2005 / Notices beneficial uses of dredged materials (i.e., wetlands restoration in Dorchester County, MD). EPA expressed environmental concerns over the remaining three alternatives (i.e., the proposed multiple new Confined Disposal Facilities in the Patapsco River, the Poplar Island Environmental Restoration Project expansion and the Large Island Restoration Middle Bay). EPA recommended that continued use of Open Water Placement in Virginia include the already designated NorfolkOcean Disposal Site given its available capacity. Rating EC1 EIS No. 20050053, ERP No. D-CGD- E03013-00, Compass Port and Deepwater Port License Application, To Construct a Liquefied Natural Gas (LNG) Receiving, Storage and

477

슬라이드 1  

NLE Websites -- All DOE Office Websites (Extended Search)

th th Annual ARM Science Team Meeting, Norfolk, VA. 2008. 3. 10 Determination of aerosol single scattering albedo and radiative forcing from ground and space observations Earth System Science Interdisciplinary Center (ESSIC), Earth System Science Interdisciplinary Center (ESSIC), Univ. of Maryland (UMD) Univ. of Maryland (UMD) Kwon Kwon - - Ho Lee Ho Lee , Zhanqing Li , Zhanqing Li Contents Introduction 1 SSA retrieval 2 Applications 3 Summary 4 1 Contribution to The East-AIRE campaign Final objectives Introduction 2 3 Global Aerosol loading (2000~2006) MODIS AOT over land & oceans during 2000~2006 Linear regression slope (Δτ/yr) Global Aerosol Trend (2000~2006) 4 At the beginning of SSA retrieval "The absorption

478

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency 3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area ATS Lighting Inc ATS Lighting Inc PO Box Concord Massachusetts Efficiency Effienct lighting and portable lighting systems http www atslighting com Greater Boston Area AXI LLC AXI LLC Quincy Massachusetts Biofuels Aims to make commercially feasible strains of algae for fuel production Greater Boston Area Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation load management and competitive bidding http www acelaenergy com Greater Boston Area Aclara Software Aclara Software Laurel Avenue Wellesley Massachusetts Efficiency Software solutions for efficiency and demand management

479

United States Government Department of Energy  

Office of Legacy Management (LM)

;;Klisv; /l/IS , [ q -2 ;;Klisv; /l/IS , [ q -2 United States Government Department of Energy memorandum I q79Ll per, i, ' ) ' " Z? DATE: - - - j , ? REPLY TO ATTN OF: EM-421 (W. A. Williams, 903-8149) SUBJECT: Elimination of the Sites from the Formerly Utilized Program TO: The File I have reviewed the attached site summaries and elimination recommendations for the following sites: l Mitts & Merrel Co., Saginaw, Michigan l North Carolina State University, Raleigh, North Carolina l National Smelt & Refining, Cleveland, Ohio l Sutton, Steele & Steele, Dallas, Texas l Norfolk Naval Station, Virginia In each case, the potential for radiological contamination above applicable guidelines is small. In each case the amounts of radioactive materials handled was small. Based on these considerations, these sites

480

Charlotte Green Supply Chain: Reduce, Reuse, Recycle | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Charlotte Green Supply Chain: Reduce, Reuse, Recycle Charlotte Green Supply Chain: Reduce, Reuse, Recycle Charlotte Green Supply Chain: Reduce, Reuse, Recycle July 30, 2010 - 10:59am Addthis Andy Oare Andy Oare Former New Media Strategist, Office of Public Affairs Three years ago at Sacred Heart grade school in Norfolk, Neb., efforts to recycle were grim. "When I got here, we had no paper recycling program," says Troy Berryman, who is entering his sixth year as principal at Sacred Heart. "A couple years prior, we had a guy park a semi-truck in the parking lot for people to recycle paper." But Berryman says this system did not work out well, as the truck was often locked and papers would be left to blow around in the wind or get wet with rain. Knowing that something must be done, he began to look into the local

Note: This page contains sample records for the topic "norfolk mi 1970-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Flight Planning for the Flight Planning for the Flight Planning for the I I ndirect and ndirect and S S emi emi - - D D irect irect A A erosol erosol C C ampaign ampaign (ISDAC) (ISDAC) Jason Tomlinson Pacific Northwest National Laboratory ARM Science Team Meeting March 11 th , 2008 Norfolk, VA * ISDAC will occur from April 1 st to April 30 th * EC/NRC Convair Overview Explanation Examples 1 Overview 1 Overview Explanation Examples * ISDAC will occur from April 1 st to April 30 th * EC/NRC Convair - Full suite of instruments capable of aerosol, gas, and ice phase measurements * 94 Available flight hours - Roughly 12 flights with 2 to 3 occurring per week * Each flight will hopefully have 2 segments * Several opportunities for comparisons with the A- train satellites 1 Overview Explanation Examples Overview Flight Overview

482

The Status and Future of AERIs in ARM  

NLE Websites -- All DOE Office Websites (Extended Search)

Status and Future of AERIs Status and Future of AERIs in ARM Dave Turner Space Science and Engineering Center University of Wisconsin - Madison Longwave/Microwave Focus Group 11 March 2008 ARM STM, Norfolk, VA Background * Spectrally resolved IR radiances were considered key component of ARM's observational strategy * Stringent requirements placed on absolute radiometric accuracy (1% ambient radiance), spectral accuracy, noise level, and operability * Instrument development was successful! * ARM has 8 AERI systems: * 11 Million calibrated sky spectra have been collected by ARM AERIs (up to Dec 2007) * SGP-01 * SGP-E14 * AMF-M1 * NSA-C1 (ER) * TWP-C2 * TWP-C3 * Spare (NR) * Spare (ER) AERI Interferometer Assembly AERI Interferometer Assembly Bomem Interferometer ABB HBB Optics Optics Bench Bench Shock

483

Navy Technology Validation (Techval)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Technology Technology Validation (Techval) FUPWG Spring Meeting 2008 April 15, 2008 Destin, FL Paul Kistler, PE CEM NAVFAC Engineering Service Center Port Hueneme CA Navy Techval CURRENT PROJECTS * Cool Roof reflective roof coating  NS Pearl Harbor HI * Thermal Destratifiers  NAS Oceana VA * Boiler Combustion Controls  USNA Annapolis MD * Sand Filters  NAS Lemoore CA * Spectrally Enhanced Lighting  Navy Yard Washington DC * Desuperheater  NS Norfolk VA  NAS North Island CA * HVAC CO2 Controls  NAB Little Creek VA  NAVSUPPACT Mid-South TN  NB Kitsap Bremerton WA *HVAC Occupancy Controls NAS Oceana VA *Electromagnetic Pulse Water Treatment NADEP San Diego CA NSY Puget Sound WA *LED Parking Lot Lighting NBVC Port Hueneme CA Techval

484

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

81 - 22890 of 26,764 results. 81 - 22890 of 26,764 results. Download CX-006831: Categorical Exclusion Determination Cost Effective Polymer Solar Cells Research and Education CX(s) Applied: A9, B3.6 Date: 09/21/2011 Location(s): Norfolk, Virginia Office(s): Energy Efficiency and Renewable Energy http://energy.gov/nepa/downloads/cx-006831-categorical-exclusion-determination Download CX-006899: Categorical Exclusion Determination California-City-Paramount CX(s) Applied: A9, A11, B2.5, B3.6, B5.1 Date: 03/29/2010 Location(s): Paramount, California Office(s): Energy Efficiency and Renewable Energy, National Energy Technology Laboratory http://energy.gov/nepa/downloads/cx-006899-categorical-exclusion-determination Article Developer Resources for Apps for Energy Are you interested in participating in the Apps for Energy competition? Be

485

RTG_12 6 07_min  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Use for review and comment only Use for review and comment only Summary of Meeting TEC Routing Topic Group (RTG) Conference Call Thursday, December 6, 2007 3:00 p.m. to 4:30 p.m. Eastern Welcome and Introductions - A. Thrower List of Attendees and Callers: Alex Thrower, DOE/OLM Paul Johnson, ORNL Kevin Blackwell, DOT/FRA Doug Osborn, SNL Mel Massaro, DOT/FRA Jane Beetem, CSG/MW Melissa Bailey, CSG/NE Scott Palmer, BLET Lisa Janairo, CSG/MW Tony Dimond, BLET Barbara Byron, CA Energy Comm'n/WIEB Kurt Colborn, MHF Logistics Dan Fisher, OH PUCO Ralph Hail, Norfolk Southern Christina Nelson, NCSL David Blee, USTC Sean Kice, TN EMA Harry Hopes, CSX Cort Richardson, CSG/NW Jim Williams, WIEB Larry Stern, CVSA Ralph Best, BSC Tim Runyon, IL Dept.Nuc.Safety/CSG/MW Lee Finewood, BAH

486

Acela Energy Group Inc | Open Energy Information  

Open Energy Info (EERE)

Acela Energy Group Inc Acela Energy Group Inc Jump to: navigation, search Name Acela Energy Group Inc Address 290 Main St Place Norfolk, Massachusetts Zip 02056 Sector Efficiency Product Aims to reduce energy costs via rate negotiation, conservation, load management, and competitive bidding Website http://www.acelaenergy.com/ Coordinates 42.1146091°, -71.3463855° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.1146091,"lon":-71.3463855,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

487

Randolph Electric Biomass Facility | Open Energy Information  

Open Energy Info (EERE)

Randolph Electric Biomass Facility Randolph Electric Biomass Facility Jump to: navigation, search Name Randolph Electric Biomass Facility Facility Randolph Electric Sector Biomass Facility Type Landfill Gas Location Norfolk County, Massachusetts Coordinates 42.17668°, -71.1448516° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.17668,"lon":-71.1448516,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

488

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

21 - 14430 of 28,905 results. 21 - 14430 of 28,905 results. Article Capturing Fugitives to Reduce DOE's GHG Emissions Experts are hunting down fugitive carbon emissions from across 20 Energy Department laboratories, sites and program offices - and they've already prevented the release of more than 600,000 metric tons of CO2 equivalent since 2009 -- equal to taking 140,000 cars off the road for a year. http://energy.gov/articles/capturing-fugitives-reduce-doe-s-ghg-emissions Download CX-006831: Categorical Exclusion Determination Cost Effective Polymer Solar Cells Research and Education CX(s) Applied: A9, B3.6 Date: 09/21/2011 Location(s): Norfolk, Virginia Office(s): Energy Efficiency and Renewable Energy http://energy.gov/nepa/downloads/cx-006831-categorical-exclusion-determination Download CX-005306: Categorical Exclusion Determination

489

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

21 - 18230 of 26,764 results. 21 - 18230 of 26,764 results. Download CX-002843: Categorical Exclusion Determination Evergreen Energy Efficiency Retrofit CX(s) Applied: B5.1 Date: 07/01/2010 Location(s): Norfolk, Virginia Office(s): Energy Efficiency and Renewable Energy, Golden Field Office http://energy.gov/nepa/downloads/cx-002843-categorical-exclusion-determination Download CX-002852: Categorical Exclusion Determination Clean Energy Advanced Manufacturing Phase 2 - Polar Seal Windows CX(s) Applied: B5.1 Date: 07/01/2010 Location(s): Grand Rapids, Michigan Office(s): Energy Efficiency and Renewable Energy, Golden Field Office http://energy.gov/nepa/downloads/cx-002852-categorical-exclusion-determination Download CX-002855: Categorical Exclusion Determination Whitefish In-Line Hydro-Electric Project

490

Energy Sources | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

February 17, 2011 February 17, 2011 Department of Energy Offers Support for an Oregon Solar Manufacturing Project Project Estimated to Create Over 700 Jobs and Greater Efficiencies in the Production of Photovoltaic Panels February 4, 2011 Chu, Salazar to Announce Major Offshore Wind Energy Initiatives NORFOLK,VA - On Monday, February 7, 2011 Energy Secretary Steven Chu and Secretary of the Interior Ken Salazar will announce major new initiatives to accelerate the responsible siting and development of offshore wind energy projects. January 24, 2011 Departments of Energy and Commerce Announce New Partnership to Further Cooperation on Renewable Energy Modeling and Forecasting WASHINGTON - The Department of Energy and the Department of Commerce today announced a new agreement to further collaboration between the agencies on

491

Action items inspired by the IPCC exercise  

NLE Websites -- All DOE Office Websites (Extended Search)

PCMDI PCMDI ARM 13 March '08 K. E. Taylor Climate Radiative Responses and Clouds: What we are learning from CMIP3 Karl E. Taylor Program for Climate Model Diagnosis and Intercomparison with thanks to S. Bony, B. Soden, and others Presented at the ARM Science Team Meeting Norfolk, VA 13 March 2008 PCMDI ARM 13 March '08 K. E. Taylor CMIP3 terminology and background * CMIP = Coupled Model Intercomparison Project * Simulations performed in support of IPCC's Fourth Assessment Report (AR4) * WCRP's WGCM & CMIP panel coordinated activity * PCMDI archived and made available model output (funded by DOE) * 17 climate modeling centers (23 models) performed 12 expts. each * CMIP3 impact: Has resulted in more than 300 publications

492

Microsoft Word - RoutingTG_1-18-07_call_minutes  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

January 18, 2007 12:30 p.m.-1:45 p.m. EST January 18, 2007 12:30 p.m.-1:45 p.m. EST Conference Call Minutes Chair: Jay Jones (RW) Participants: Cloyce Brackett (SSEB), Kevin Blackwell (DOT/FRA), Barbara Byron (CA Energy Commission), Kurt Colborn (MHF), Sandy Covi (UP), Pat Edwards (CSG/NE), Ray English ( NNPP), Scott Field (WIEB), Dan Fisher (Public Utilities Commission of Ohio), Floyd Gilzow (CSG/MW), Aubrey Godwin (ARRA), Ralph Hail (Norfolk Southern), Bob Halstead (Nevada Agency For Nuclear Projects), Lisa Janairo (CSG-MW), Paul Johnson (ORNL), Candice Jordan (ECA), Marsha Keister (INL), Sean Kice (SSEB), Steve Maheras (Battelle), Mel Massaro (DOT/FRA), Ed Mueller (Esmeralda County, Nevada), Christina Nelson (NCSL), Doug Osborn (SNL), Cort Richardson (CSG-NE), Larry Stern (CVSA),

493

PowerPoint Presentation  

NLE Websites -- All DOE Office Websites (Extended Search)

Lori Borg, David Turner, Robert Holz, David Tobin, Bob Knuteson, Lori Borg, David Turner, Robert Holz, David Tobin, Bob Knuteson, Leslie Moy, Daniel DeSlover, Ed Eloranta, Hank Revercomb (PI) University of Wisconsin - Madison Space Science and Engineering Center 18th ARM STM, Norfolk, VA 10 - 14 March 2008 21 October 2005 panorama Assessing the Vertical Structure of Radiative Heating Using Radar & Lidar for Cirrus Cloud Events at SGP UW-Madison SSEC Team David Turner Bob Holz David Tobin Bob Knuteson Leslie Moy Dan DeSlover Ed Eloranta Hank Revercomb History Extension of previous work, which assessed ARM Broad Band Heating Rate Profiles (BBHRP) under clear-sky conditions. BBHRP collaboration of all working groups which produces vertical profiles of fluxes and heating rates to drive climate models. BBHRP primarily radar (MMCR) based logic for cloud properties.

494

fleetappforms04f1298.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

R R e t u r n C o p y t o : Bank of America Government Card Services Unit P.O. Box 1637 Norfolk, VA 23501-1637 Facsimile: 757.624.6323 Toll Free Fax: 877.217.1033 Form S04F1298 Revised: 05/9/99 Fleet Account Setup (Fields in Bold are Mandatory) ___ Driver Assigned ___ Vehicle Assigned Account Hierarchy Hierarchy Point HL1 HL2 HL3 HL4 HL5 HL6 HL7 HL8 General Information : Agency/Organization Name Business Phone Central Account Number Billing Address, Line 1 Master Accounting Code Billing Address, Line 2 Tax Exempt Number City Driver/Contact Name State Embossing Name 1 Zip/Postal Code Embossing Name 2 Account Information and Spending Limits: a) Driver ID f) Max. cycle dollar limit $ b) Credit limit g) Max. cycle number of

495

Commander, Naval Base ATTN: Ms. Cheryl Barnett Building N-26  

Office of Legacy Management (LM)

.J>?j 1.2 1990 .J>?j 1.2 1990 Commander, Naval Base ATTN: Ms. Cheryl Barnett Building N-26 Code N 9 E Norfolk, Virginia 23511-6002 Dear Ms. Barnett: I enjoyed speaking with you on the phone. The Department of Energy (DOE) has established its Formerly Utilized Sites Remedial Action Program (FUSRAP) to identify sites formerly utilized by its predecessor agencies in the early days of the nation's atomic energy program and to determine the potential for these sites to contain radiological contamination, related to DOE's past activities, which may require remedial action. When necessary, radiological surveys of individual sites are performed to provide the data necessary to make this necessary determination. As we discussed, in July 1956, the Atomic Energy Commission (a DOE

496

Salazar, Chu Announce Major Offshore Wind Initiatives | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Major Offshore Wind Initiatives Major Offshore Wind Initiatives Salazar, Chu Announce Major Offshore Wind Initiatives February 7, 2011 - 12:00am Addthis NORFOLK, VA - Unveiling a coordinated strategic plan to accelerate the development of offshore wind energy, Secretary of the Interior Ken Salazar and Secretary of Energy Steven Chu today announced major steps forward in support of offshore wind energy in the United States, including new funding opportunities for up to $50.5 million for projects that support offshore wind energy deployment and several high priority Wind Energy Areas in the mid-Atlantic that will spur rapid, responsible development of this abundant renewable resource. Deployment of clean, renewable offshore wind energy will help meet the President's goal of generating 80 percent of the Nation's electricity from

497

Alexis Park Hotel, Las Vegas Topic Group Meeting Participants were:  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Notes Tuesday, January 20, 1998 8:00-11:30 a.m. Notes Tuesday, January 20, 1998 8:00-11:30 a.m. Alexis Park Hotel, Las Vegas Topic Group Meeting Participants were: Audrey Adamson, UETC Daren Gilbert, State of Nevada James Baranski, State of New York Phil Marbut, Canadian Pacific Railway Kevin Blackwell, US DOT/FRA Bruce Marriott, US DOT/FRA Mike Butler, UETC Kevin Miller, CSX Transportation Sandy Covi, Union Pacific RR Markus Popa, US DOE-OCRWM Ray English, US DOE-NR David Schoendorfer, Norfolk Southern RR Bob Fronczak, AAR John Tijan, US DOT/FRA The group convened at approximately 8:00 a.m. Mr. Butler distributed a meeting agenda, welcomed participants and introduced himself as the new Rail Topic Group lead and facilitator. He introduced Item I, "Existing Business"; specifically the two matrices tasked to the Group by

498

PowerPoint Presentation  

NLE Websites -- All DOE Office Websites (Extended Search)

ARM-NSA products to evaluate ARM-NSA products to evaluate Arctic cloud and radiative simulations in global models John E.Walsh, Diane H. Portis, William L. Chapman Department of Atmospheric Sciences University of Illinois, Urbana, IL USA ARM Science Team Meeting, Norfolk, VA 12 March 2008 Objectives * Use ARM/NSA measurements to assess simulated clouds and surface radiation fluxes in global models * Diagnose cloud/radiation performance based on characteristics of model parameterizations Motivation: Cloud-radiative forcing in atmospheric reanalyses * NCEP/NCAR * ERA40 (ECMWF) * NARR (North American Regional Reanalysis) * JRA-25 (Japan) Validation with ARM/NSA data, 1999-2006 Cloud-Radiative-Forcing (CRF): Net surface radiation (SW + LW) with actual cloudiness minus clear-sky net surface radiation

499

Radiative Heating in Underexplored Bands Campaign (RHUBC)  

NLE Websites -- All DOE Office Websites (Extended Search)

Bands Campaign (RHUBC) D. Turner and E. Mlawer RHUBC Breakout Session 2008 ARM Science Team Meeting 13 March, 2008 Norfolk, Virginia Motivation * Radiative heating/cooling in the mid-troposphere modulate the vertical motions of the atmosphere - This heating/cooling occurs primarily in water vapor absorption bands that are opaque at the surface * Approximately 40% of the OLR comes from the far-IR * Until recently, the observational tools were not available to evaluate the accuracy of the far-IR radiative transfer models - Spectrally resolved far-IR radiances, accurate PWV * Need to validate both clear sky (WV) absorption and cirrus scattering properties in these normally opaque bands Scientific Objectives * Conduct clear sky radiative closure studies in order to reduce uncertainties

500

Categorical Exclusion Determinations: B5.1 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

6, 2010 6, 2010 CX-002134: Categorical Exclusion Determination Rocky Mountain Solar Training Provider CX(s) Applied: B1.15, B5.1 Date: 05/06/2010 Location(s): Salt Lake City, Utah Office(s): Energy Efficiency and Renewable Energy, Golden Field Office May 5, 2010 CX-002187: Categorical Exclusion Determination Hempfield Park Baseball Field Lighting Replacement CX(s) Applied: B1.3, B5.1 Date: 05/05/2010 Location(s): Hempfield, Pennsylvania Office(s): Energy Efficiency and Renewable Energy May 4, 2010 CX-002164: Categorical Exclusion Determination Virginia-Maryland-District of Columbia Public Ethanol-85 Fueling Project CX(s) Applied: B5.1 Date: 05/04/2010 Location(s): Norfolk, Virginia Office(s): Energy Efficiency and Renewable Energy, National Energy Technology Laboratory May 4, 2010