Powered by Deep Web Technologies
Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

NF Energy Saving Corp | Open Energy Information  

Open Energy Info (EERE)

NF Energy Saving Corp Jump to: navigation, search Name: NF Energy Saving Corp Place: Shenyang, Liaoning Province, China Sector: Services Product: China-based company provides...

2

The REMOTE SENSlNf  

Office of Legacy Management (LM)

REMOTE REMOTE SENSlNf ' . 1 ARllRllRRv OF THE UNITED STATES DEPARTMENT OF ENERGY . . . . .a. * ~~&hrEAWWMms Gap ~~&hrEAwwMms Gap ECT FOLLdW-UP REPORT ECT FOLLdW-UP REPORT NOVEMBER 1979 NOVEMBER 1979 AN AERIAL RADIOLOGICAL SURVEY OF THE CURTIS BAY FACILITY OF THE W. FL GRACE COMPANY Baltimore, Maryland t. Kent Hilton Project Scientist APPROVED FORPUBLlCATlON ' : T. P. Stuart, Manager Remote Sensing Sciences Department ATTACHMENT 4- ECT Follow-Up Report AN AERIAL RADIOLOGICAL SURVEY OF THE CURTIS BAY FACILITY This is the second of two reports discussing the gamma ray radiation levels measured at the Curtis Bay facility of the W. R. Grace Company. The first report presented gross count contours and gamma ray spectra over the most active areas. Refined gross count isopleth maps will be

3

Mass spectrometric study of NF3 plasma etching of silicon  

Science Journals Connector (OSTI)

NF3 plasma etching is used for dry cleaning of reactors after plasma-enhanced chemical vapor deposition of hydrogenated amorphous silicon from SiH4. The NF3 plasma chemistry, in a closed isothermal plasma box wit...

Jerome Perrin; Jacques Méot; Jean-Marie Siéfert…

1990-12-01T23:59:59.000Z

4

NF 3 , the greenhouse gas missing from Kyoto  

E-Print Network [OSTI]

for NF 3 has exploded. Air Products has just announced aof 3,200 tons by 2009 (Air Products boosts NF 3 capacity inU.S. and Asia, Air Products press release of 27 November

Prather, Michael J; Hsu, Juno

2008-01-01T23:59:59.000Z

5

Performance and fate of organics in a pilot MBR–NF for treating antibiotic production wastewater with recycling NF concentrate  

Science Journals Connector (OSTI)

Abstract A double membrane system comprising a membrane bioreactor (MBR) combined with a nanofiltration (NF) membrane was investigated on a pilot scale for the treatment of antibiotic production wastewater over a three-month period at a pharmaceutical company in Wuxi, China. By recycling the NF concentrate, the combined MBR–NF process was shown to be effective for the treatment of antibiotic production wastewater, resulting in excellent water quality and a high water yield of 92 ± 5.6%. The water quality of the pilot-scale MBR–NF process was excellent; e.g., the concentrations of TOC, NH4+-N, TP were stable at 5.52, 0.68, 0.34 mg L?1, respectively, and the values of turbidity and conductivity of the NF permeate were 0.15 NTU and 2.5 mS cm?1, respectively; these values meet China’s water quality standard requirements for industrial use (GB21903-2008). Not only were the antibiotic removal rates of spiramycin (SPM) and new spiramycin (NSPM) over 95%, the acute toxicity was also drastically reduced by the MBR–NF pilot system. The main organics in the MBR effluent were proteins, polysaccharides, and humic-like substances; they were almost completely retained by the NF membrane and further biodegraded in the MBR because the NF concentrate was recycled. The microbial community of the MBR did not significantly change with the recycling of the NF concentrate.

Jianxing Wang; Kun Li; Yuansong Wei; Yutao Cheng; Dongbin Wei; Mingyue Li

2014-01-01T23:59:59.000Z

6

Cloning and expression of equine NF-kB2  

E-Print Network [OSTI]

Cloning and Expression of Equine NF-#1;B2. (May 2008) Negin Mirhosseini, B.A., Shahid Bahonar University Chair of Advisory Committee: Dr. Susan Payne Equine infectious anemia virus (EIAV) is a macrophage-tropic retrovirus that causes persistent... Cloning and Expression of Equine NF-#1;B2. (May 2008) Negin Mirhosseini, B.A., Shahid Bahonar University Chair of Advisory Committee: Dr. Susan Payne Equine infectious anemia virus (EIAV) is a macrophage-tropic retrovirus that causes persistent...

Mirhosseini, Negin

2009-05-15T23:59:59.000Z

7

Synthesis of super plasticizer NF-30 from coal coking by product washing oil and performance analysis  

Science Journals Connector (OSTI)

Super plasticizer was synthesized by using coal coking by product washing oil and industrial naphthalene....2 in exhaust (20%). Compared with NF, NF-30 have some advantages in lower cost, high water reducing rate...

Zifang Xu ???; Mingxu Zhang; Wenpei Hu

2013-10-01T23:59:59.000Z

8

Symmetric genuine Spherical Whittaker functions on GSp2n(F)  

E-Print Network [OSTI]

be the absolute value on F normalized in the usual way. For a ? F? ... Sp2n(F) be the semi-direct product corresponding to this action. ..... 2n(F)) eigen values.

2013-07-05T23:59:59.000Z

9

Removal of BPA by enzyme polymerization using NF membranes  

Science Journals Connector (OSTI)

Abstract The application of laccase and peroxidase from horseradish (HRP) to facilitate the removal of bisphenol A (BPA) from aqueous solutions was investigated. Effect of pH and the enzyme dose was evaluated in order to determine the optimum conditions for the enzyme performance. The results indicate that BPA was quickly removed from aqueous solution since a BPA conversion over 95% was obtained in 180 min for both enzymes in optimal conditions; the higher the enzyme dose, the higher the removal percentage of BPA. It was also found that the optimum pH for the removal efficiency of BPA was around 7 for both enzymes. The use of a membrane-reactor integrated system with recycling of enzyme for BPA degradation is also presented. These results demonstrate the potential and limitations of using enzymatic BPA degradation, operated in a recycling mode coupled to a nanofiltration membrane. BPA removal efficiencies for several NF membranes were related to the BPA molecular weight, membrane pore sizes and membrane hydrophobicity. NF270 showed the best performance in membrane-assisted enzyme treatment: 89% removal of BPA for the two enzyme treatments and less than 35% flux decay were observed.

Ivonne Escalona; Joris de Grooth; Josep Font; Kitty Nijmeijer

2014-01-01T23:59:59.000Z

10

Hippo Pathway Phylogenetics Predicts Monoubiquitylation of Salvador and Merlin/Nf2  

E-Print Network [OSTI]

Hippo Pathway Phylogenetics Predicts Monoubiquitylation of Salvador and Merlin/Nf2 Robert G a phylogenetic approach to the Hippo pathway and predict that two of its signal transducers, Salvador and Merlin Monoubiquitylation of Salvador and Merlin/Nf2. PLoS ONE 7(12): e51599. doi:10.1371/journal.pone.0051599 Editor

Newfeld, Stuart J.

11

Low Dose Radiation Research Program: Regulation of NF-kB and MnSOD in Low  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

NF-kB and MnSOD in Low Dose Radiation-Induced Adaptive NF-kB and MnSOD in Low Dose Radiation-Induced Adaptive Responses in Mouse and Human Skin Cells Jian Jian Li School of Health Sciences, Purdue University West Lafayette, Indiana Why this Project? To determine if low dose ionizing radiation-induced adaptive responses in skin cells are mediated by activation of signaling networks. Project Goals To evaluate the signaling networks involving transcription factor NF-kB and the mitochondrial antioxidant protein MnSOD. To determine if NF-kB is activated by low dose radiation in vivo. To determine if NF-kB activation is critical in the pathways that produce adaptive responses. Experimental Approach Cells transfected with NF-kB luciferase responder genes will be used to define a dose-response relationship for activation of the NF-kB gene. NF-kB

12

Removal of bisphenol A (BPA) from water by various nanofiltration (NF) and reverse osmosis (RO) membranes  

Science Journals Connector (OSTI)

Abstract The removal of an endocrine disrupting compound, bisphenol A (BPA), from model solutions by selected nanofiltration (NF) and reverse osmosis (RO) membranes was studied. The commercially available membranes NF 90, NF 270, XLE BWRO, BW 30 (Dow FilmTech), CE BWRO and AD SWRO (GE Osmonics) were used to compare their performances for BPA removal. The water permeability coefficients, rejection of BPA and permeate flux values were calculated for all membranes used. No significant changes in their BPA removal were observed for all tight polyamide based NF and RO membranes tested except for loose NF 270 membrane. The polyamide based membranes exhibited much better performance than cellulose acetate membrane for BPA removal. Almost a complete rejection (?98%) for BPA was obtained with three polyamide based RO membranes (BW 30, XLE BWRO and AD SWRO). But cellulose acetate based CE BWRO membrane offered a low and variable (10–40%) rejection for BPA.

Suna Yüksel; Nalan Kabay; Mithat Yüksel

2013-01-01T23:59:59.000Z

13

Tumor Necrosis Factor-related Apoptosis-inducing Ligand Receptors Signal NF-B and JNK Activation and  

E-Print Network [OSTI]

factor NF- B. TRAIL-R4 can activate NF- B and protect cells from TRAIL-induced apoptosis. Here we show pathway. We also show that activa- tion of NF- B or overexpression of TRAIL-R4 does not protect TRAIL-R1, 5). Previous stud- ies suggest that TRAIL is capable of inducing apoptosis of various cancer cell

Hu, Wen-Hui

14

IKK{epsilon} modulates RSV-induced NF-{kappa}B-dependent gene transcription  

SciTech Connect (OSTI)

Respiratory syncytial virus (RSV), a negative-strand RNA virus, is the most common cause of epidemic respiratory disease in infants and young children. RSV infection of airway epithelial cells induces the expression of immune/inflammatory genes through the activation of a subset of transcription factors, including Nuclear Factor-{kappa}B (NF-{kappa}B). In this study we have investigated the role of the non canonical I{kappa}B kinase (IKK){epsilon} in modulating RSV-induced NF-{kappa}B activation. Our results show that inhibition of IKK{epsilon} activation results in significant impairment of viral-induced NF-{kappa}B-dependent gene expression, through a reduction in NF-{kappa}B transcriptional activity, without changes in nuclear translocation or DNA-binding activity. Absence of IKK{epsilon} results in a significant decrease of RSV-induced NF-{kappa}B phosphorylation on serine 536, a post-translational modification important for RSV-induced NF-{kappa}B-dependent gene expression, known to regulate NF-{kappa}B transcriptional activity without affecting nuclear translocation. This study identifies a novel mechanism by which IKK{epsilon} regulates viral-induced cellular signaling.

Bao Xiaoyong; Indukuri, Hemalatha; Liu Tianshuang; Liao Suiling [Department of Pediatrics, University of Texas Medical Branch, Galveston, TX (United States); Tian, Bing; Brasier, Allan R. [Department of Internal Medicine, University of Texas Medical Branch, Galveston, TX (United States); Garofalo, Roberto P. [Department of Pediatrics, University of Texas Medical Branch, Galveston, TX (United States); Department of Microbiology and Immunology, University of Texas Medical Branch, Galveston, TX (United States); Sealy Center for Vaccine Development, University of Texas Medical Branch, Galveston, TX (United States); Casola, Antonella, E-mail: ancasola@utmb.ed [Department of Pediatrics, University of Texas Medical Branch, Galveston, TX (United States); Department of Microbiology and Immunology, University of Texas Medical Branch, Galveston, TX (United States); Sealy Center for Vaccine Development, University of Texas Medical Branch, Galveston, TX (United States)

2010-12-20T23:59:59.000Z

15

Response and Resistance to NF-?B Inhibitors in Mouse Models of Lung Adenocarcinoma  

E-Print Network [OSTI]

Lung adenocarcinoma is a leading cause of cancer death worldwide. We recently showed that genetic inhibition of the NF-?B pathway affects both the initiation and the maintenance of lung cancer, identifying this pathway as ...

Xue, Wen

16

Elastic neutron-scattering experiments at the Geesthacht Neutron Facility (GeNF)  

Science Journals Connector (OSTI)

The Geesthacht Neutron Facility (GeNF) comprises experimental facilities for elastic neutron scattering for materials research and engineering problems as well as for environmental research purposes at the research reactor FRG-1. The experimental facilities for elastic neutron-scattering experiments at GeNF, most of which can be optimally used with polarized neutrons, will be presented. They are open to national and international users from universities and other research institutes at no cost.

R Kampmann; R Wagner

1997-01-01T23:59:59.000Z

17

Development of NF3 Deposit Removal Technology for the Portsmouth Gaseous Diffusion Plant  

SciTech Connect (OSTI)

This paper summarizes the Battelle, Stoller, and WASTREN (BSW) team's efforts, to date, in support of the United States Department of Energy's plans to remove uranium and technetium deposits before decommissioning the Portsmouth Gaseous Diffusion Plant. The BSW team investigated nitrogen trifluoride (NF{sub 3}) as a safer yet effective alternative gaseous treatment to the chlorine trifluoride (ClF{sub 3})-elemental fluorine (F{sub 2}) treatment currently used to remove uranium and technetium deposits from the uranium enrichment cascade. Both ClF{sub 3} and F{sub 2} are highly reactive, toxic, and hazardous gases, while NF{sub 3}, although toxic [1], is no more harmful than moth balls [2]. BSW's laboratory thermo-analytical and laboratory-scale prototype studies with NF{sub 3} established that thermal NF{sub 3} can effectively remove likely and potential uranium (UO{sub 2}F{sub 2} and UF{sub 4}) and technetium deposits (a surrogate deposit material, TcO{sub 2}, and pertechnetates) by conversion to volatile compounds. Our engineering evaluations suggest that NF{sub 3}'s effectiveness could be enhanced by combining with a lesser concentration of ClF{sub 3}. BSW's and other's studies indicate compatibility with Portsmouth materials of construction (aluminum, copper, and nickel). (authors)

Scheele, R.D.; McNamara, B.K.; Rapko, B.M.; Edwards, M.K.; Kozelisky, A.E.; Daniel, R.C. [Battelle Pacific Northwest Division, PO Box 999, Battelle Blvd, Richland, Washington 99352 (United States); McSweeney, T.I.; Maharas, S.J.; Weaver, P.J.; Iwamasa, K.J. [Battelle Columbus Operations, 505 King Avenue, Columbus, Ohio 43201 (United States); Kefgen, R.B. [WASTREN, Inc., 1864 Shyville Road, Piketon, Ohio 45661 (United States)

2006-07-01T23:59:59.000Z

18

Nucleon matrix elements with Nf=2+1+1 maximally twisted fermions  

SciTech Connect (OSTI)

We present the first lattice calculation of nucleon matrix elements using four dynamical flavors. We use the Nf=2+1+1 maximally twisted mass formulation. The renormalization is performed non-perturbatively in the RI'-MOM scheme and results are given for the vector and axial vector operators with up to one-derivative. Our calculation of the average momentum of the unpolarized non-singlet parton distribution is presented and compared to our previous results obtained from the Nf=2 case.

Simon Dinter, Constantia Alexandrou, Martha Constantinou, Vincent Drach, Karl Jansen, Dru Renner

2010-06-01T23:59:59.000Z

19

Separation of NF3 and CF4 using amorphous glassy perfluoropolymer Teflon AF and Hyflon AD60 membranes  

Science Journals Connector (OSTI)

Abstract In this study, the pure and mixed gas permeabilities of Teflon AF2400, Teflon AF1600 and Hyflon AD60 membranes towards NF3 and CF4 were measured to determine whether membrane gas separation can be applied to purify NF3 of CF4. In accordance with literature results, it was shown that thermal annealing of the solution cast films was necessary to reach optimum performance, wherein all membranes studied had a preferential permeation of NF3 rather than CF4. The Teflon AF and Hyflon AD60 membranes displayed rather high pure and mixed gas selectivities (?(NF3/CF4)) considering the high free volume of the polymers. Furthermore, the ?(NF3/CF4) increased with increasing diffusion selectivity of the glassy perfluoropolymers, of which the pure gas He/N2 ideal selectivities gave an indication, and which is related to the fractional free volume (FFV). As a result, Hyflon AD60 displayed the highest NF3/CF4 pure and mixed gas selectivity of just above 12, albeit with a rather low NF3 permeability of ca. 1.9 Barrer. Although the membranes were sufficiently inert towards penetrant induced swelling, a Hyflon AD60 membrane swollen by residual casting solvent displayed an increase in the pure and mixed gas NF3 and CF4 permeabilites and reduced selectivity compared to that of an annealed, fully relaxed Hyflon AD60 membrane.

D.J. Branken; H.M. Krieg; J.P. le Roux; G. Lachmann

2014-01-01T23:59:59.000Z

20

NF3: UV absorption spectrum temperature dependence and the atmospheric and climate forcing implications  

E-Print Network [OSTI]

NF3: UV absorption spectrum temperature dependence and the atmospheric and climate forcing absorption spectrum, s(l,T), was measured at 16 wavelengths between 184.95 and 250 nm at temperatures between. Including the UV absorption spectrum temperature dependence increased the stratospheric photolysis lifetime

Jackman, Charles H.

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Cytokine gene expression and activation of NF-{kappa}B in aniline-induced splenic toxicity  

SciTech Connect (OSTI)

Exposure to aniline results in selective toxicity to the spleen, leading to a variety of sarcomas on chronic exposure in rats, and fibrosis appears to be an important initiating preneoplastic lesion of the spleen. However, the molecular mechanism(s) by which aniline leads to fibrogenic response is not well understood. Previously, we have shown that aniline exposure leads to iron overload and induction of oxidative stress in the spleen. We hypothesized that aniline-induced oxidative stress in the spleen causes transcriptional up-regulation of fibrogenic cytokines via activation of redox-sensitive transcription factor, nuclear factor-kappa B (NF-{kappa}B). To test this hypothesis, male SD rats were treated with 0.5 mmol/kg/day aniline hydrochloride via drinking water for 30 days. Cytokine mRNAs were measured by real-time quantitative PCR, while cytokine release was determined in the supernatants of the cultured splenocytes using specific ELISAs. IL-1{alpha}, IL-6, and TNF-{alpha} mRNA levels showed 6.9-, 2.9-, and 2.6-fold increases, respectively, in the spleens of aniline-treated rats in comparison to the controls. The increases in mRNA levels were associated with enhanced secretion of these cytokines in the splenocyte culture supernatants. NF-{kappa}B p65 level in the nuclear extracts of cultured splenocytes of aniline-treated rats showed a 2-fold increase in comparison to the controls as quantitated by NF-{kappa}B p65-specific ELISA. The binding activity of NF-{kappa}B, determined by electrophoretic mobility shift assay (EMSA), also showed an increase in NF-{kappa}B binding in the nuclear extracts of the splenocytes from aniline-treated rats. The specificity of NF-{kappa}B binding was further confirmed by supershift assays. The results indicate that aniline exposure causes enhanced expression of IL-1{alpha}, IL-6, and TNF-{alpha}, both at mRNA and protein levels, suggesting their role in splenic fibrosis. Also, the increased NF-{kappa}B binding activity suggests that up-regulation of these cytokines in the spleen is a redox-dependent mechanism.

Wang Jianling [Department of Pathology, University of Texas Medical Branch, Galveston, TX 77555-0609 (United States); Kannan, Subburaj [Department of Pathology, University of Texas Medical Branch, Galveston, TX 77555-0609 (United States); Li Hui [Department of Pathology, University of Texas Medical Branch, Galveston, TX 77555-0609 (United States); Firoze Khan, M. [Department of Pathology, University of Texas Medical Branch, Galveston, TX 77555-0609 (United States)]. E-mail: mfkhan@utmb.edu

2005-02-15T23:59:59.000Z

22

Coal dust contiguity-induced changes in the concentration of TNF- and NF- B p65 on the ocular surface  

SciTech Connect (OSTI)

To observe the influence of coal dust on ocular surface of coal miners and rabbits with coal dust contiguity on expression TNF- and NF- Bp65 and dry eye occurrence. Expression TNF- and NF- Bp65 in ocular surface were determined. Results showed tear production, BUT and lysozyme decreased for coal miners and rabbits with coal dust contiguity. Coal dust exposure was linked to development of xerophthalmia, and induced a higher expression of NF- B p65 and TNF- perhaps as a mechanism to resist coal dust ocular surface injury.

Sun, Z.Y.; Hong, J.; Liu, Z.Y.; Jin, X.D.; Gu, C.H. [China Medical University, Shenyang (China)

2009-07-01T23:59:59.000Z

23

Agreement Execution Process Study: CRADAs and NF-WFO Agreements and the Speed of Business  

SciTech Connect (OSTI)

This report summarizes the findings of a study on the execution of Cooperative Research and Development Agreements (CRADAs) and Non-Federal Work for Others (NF-WFO) agreements across the U.S. Department of Energy (DOE) laboratory complex. The study provides quantitiative estimates of times required to negotiate and execute these agreements across the DOE complex. It identifies factors impacting on cycle times and describes best practicies used at various laboratories and site offices that reduce cycle times.

Harrer, Bruce J.; Cejka, Cheryl L.; Macklin, Richard; Miksovic, Ann

2011-02-01T23:59:59.000Z

24

TAK1 regulates NF-{Kappa}B and AP-1 activation in airway epithelial cells following RSV infection  

SciTech Connect (OSTI)

Respiratory syncytial virus (RSV) is the most common cause of epidemic respiratory diseases in infants and young children. RSV infection of airway epithelial cells induces the expression of immune/inflammatory genes through the activation of a subset of transcription factors, including Nuclear Factor-{kappa}B (NF-{kappa}B) and AP-1. In this study, we have investigated the signaling pathway leading to activation of these two transcription factors in response to RSV infection. Our results show that IKK{beta} plays a key role in viral-induced NF-{kappa}B activation, while JNK regulates AP-1-dependent gene transcription, as demonstrated by using kinase inactive proteins and chemical inhibitors of the two kinases. Inhibition of TAK1 activation, by overexpression of kinase inactive TAK1 or using cells lacking TAK1 expression, significantly reduced RSV-induced NF-{kappa}B and AP-1 nuclear translocation and DNA-binding activity, as well as NF-{kappa}B-dependent gene expression, identifying TAK1 as an important upstream signaling molecule regulating RSV-induced NF-{kappa}B and AP-1 activation. - Highlights: > IKK{beta} is a major kinase involved in RSV-induced NF-{kappa}B activation. > JNK regulates AP-1-dependent gene transcription in RSV infection. > TAK1 is a critical upstream signaling molecule for both pathways in infected cells.

Dey, Nilay; Liu Tianshuang [Department of Pediatrics, University of Texas Medical Branch, Galveston, TX (United States); Garofalo, Roberto P. [Department of Pediatrics, University of Texas Medical Branch, Galveston, TX (United States); Department of Microbiology and Immunology, University of Texas Medical Branch, Galveston, TX (United States); Department of Sealy Center for Vaccine Development, University of Texas Medical Branch, Galveston, TX (United States); Casola, Antonella, E-mail: ancasola@utmb.edu [Department of Pediatrics, University of Texas Medical Branch, Galveston, TX (United States); Department of Microbiology and Immunology, University of Texas Medical Branch, Galveston, TX (United States); Department of Sealy Center for Vaccine Development, University of Texas Medical Branch, Galveston, TX (United States)

2011-09-30T23:59:59.000Z

25

Selection of NF membrane to improve quality of chemically treated surface water  

Science Journals Connector (OSTI)

The requirement for higher quality drinking water necessitates the application of more efficient water treatment techniques. Nanofiltration is one promising option for enhanced water treatment, for example, in enhanced organic matter removal. The characteristics of different nanofiltration membranes vary remarkably, and the selection of a membrane has to be made according to the requirements of an application. In this study six nanofiltration membranes (NF70, NF255, NTR-7450, NTR-7410, Desal-5 and TFC-S) were evaluated in improving the quality of chemically pre-treated surface water in a pilot-scale process. The results indicate that the membrane with high organics removal and slightly reduced ion removal characteristics (NF255) performed best in terms of product water quality as well as membrane productivity and fouling. The most permeable membrane (NTR-7410) suffered intensive fouling and insufficient product water quality. An interesting finding was that the permeates of all the tested membranes possessed a significant potential for microbial growth, despite the low nutrient contents.

Riina Liikanen; Ilkka Miettinen; Risto Laukkanen

2003-01-01T23:59:59.000Z

26

Nuclear IL-33 is a transcriptional regulator of NF-{kappa}B p65 and induces endothelial cell activation  

SciTech Connect (OSTI)

Highlights: Black-Right-Pointing-Pointer IL-33 as nuclear factor regulated expression of ICAM-1 and VCAM-1. Black-Right-Pointing-Pointer Nuclear IL-33 increased the transcription of NF-{kappa}B p65 by binding to the p65 promoter. Black-Right-Pointing-Pointer Nuclear IL-33 controls NF-{kappa}B-dependent inflammatory responses. -- Abstract: Interleukin (IL)-33, an IL-1 family member, acts as an extracellular cytokine by binding its cognate receptor, ST2. IL-33 is also a chromatin-binding transcriptional regulator highly expressed in the nuclei of endothelial cells. However, the function of IL-33 as a nuclear factor is poorly defined. Here, we show that IL-33 is a novel transcriptional regulator of the p65 subunit of the NF-{kappa}B complex and is involved in endothelial cell activation. Quantitative reverse transcriptase PCR and Western blot analyses indicated that IL-33 mediates the expression of intercellular adhesion molecule (ICAM)-1 and vascular cell adhesion molecule (VCAM)-1 in endothelial cells basally and in response to tumor necrosis factor-{alpha}-treatment. IL-33-induced ICAM-1/VCAM-1 expression was dependent on the regulatory effect of IL-33 on the nuclear factor (NF)-{kappa}B pathway; NF-{kappa}B p65 expression was enhanced by IL-33 overexpression and, conversely, reduced by IL-33 knockdown. Moreover, NF-{kappa}B p65 promoter activity and chromatin immunoprecipitation analysis revealed that IL-33 binds to the p65 promoter region in the nucleus. Our data provide the first evidence that IL-33 in the nucleus of endothelial cells participates in inflammatory reactions as a transcriptional regulator of NF-{kappa}B p65.

Choi, Yeon-Sook; Park, Jeong Ae; Kim, Jihye; Rho, Seung-Sik; Park, Hyojin [Department of Biochemistry, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of)] [Department of Biochemistry, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of); Kim, Young-Myeong [Department of Molecular and Cellular Biochemistry, School of Medicine, Kangwon National University, Chuncheon (Korea, Republic of)] [Department of Molecular and Cellular Biochemistry, School of Medicine, Kangwon National University, Chuncheon (Korea, Republic of); Kwon, Young-Guen, E-mail: ygkwon@yonsei.ac.kr [Department of Biochemistry, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of)] [Department of Biochemistry, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of)

2012-05-04T23:59:59.000Z

27

Core magnetic islands and plasma confinement in the H-1NF heliac  

SciTech Connect (OSTI)

Plasma confinement in the vicinity of vacuum magnetic islands near the magnetic axis in the H-1NF heliac [S. M. Hamberger et al., Fusion Technol. 17, 123 (1990)] has been experimentally studied in a low temperature argon plasma. Experimental results indicate that, under favorable conditions, these low order (m=2) islands near the core of the plasma serve as 'pockets' of higher electron density. This results in significant profile modifications including enhancement of the core radial electric field to a large positive value, possibly through an electron-root ambipolar condition. The characteristics of islands are found to be dependent on the plasma collisionality and island width.

Kumar, Santhosh T. A.; Blackwell, Boyd D.; Howard, John; Harris, Jeffrey H. [Plasma Research Laboratory, Research School of Physical Sciences and Engineering, Australian National University, Canberra, ACT 0200 (Australia)

2010-08-15T23:59:59.000Z

28

FY13 Summary Report on the Augmentation of the Spent Fuel Composition Dataset for Nuclear Forensics: SFCOMPO/NF  

SciTech Connect (OSTI)

This report documents the FY13 efforts to enhance a dataset of spent nuclear fuel isotopic composition data for use in developing intrinsic signatures for nuclear forensics. A review and collection of data from the open literature was performed in FY10. In FY11, the Spent Fuel COMPOsition (SFCOMPO) excel-based dataset for nuclear forensics (NF), SFCOMPO/NF was established and measured data for graphite production reactors, Boiling Water Reactors (BWRs) and Pressurized Water Reactors (PWRs) were added to the dataset and expanded to include a consistent set of data simulated by calculations. A test was performed to determine whether the SFCOMPO/NF dataset will be useful for the analysis and identification of reactor types from isotopic ratios observed in interdicted samples.

Brady Raap, Michaele C.; Lyons, Jennifer A.; Collins, Brian A.; Livingston, James V.

2014-03-31T23:59:59.000Z

29

Activation of primary human T-lymphocytes through CD2 plus CD28 adhesion molecules induces long-term nuclear expression of NF-kappa B  

Science Journals Connector (OSTI)

...Stars, other minor bands. 4 U. Zabel, T. Hankel, M. Dos Santos Silva, and P. A. Baeuerle. Nuclear uptake control of NF-KB...Acknowledgments The authors would like to thank Drs. Alain Israel and Rodrigo Bravo for providing the NF-KB antisera, Remy Galindo and...

R Costello; C Lipcey; M Algarte; C Cerdan; PA Baeuerle; D Olive; and J Imbert

1993-04-01T23:59:59.000Z

30

Combined Targeting of STAT3/NF-?B/COX-2/EP4 for Effective Management of Pancreatic Cancer  

Science Journals Connector (OSTI)

...anti-inflammatory agent for centuries in traditional Chinese medicine...including Akt, NF-kappaB, cAMP response element-binding...increasing levels of cyclic AMP (cAMP; EP2 and EP4); or (iii) by decreasing cAMP levels (EP3; refs. 40-42...

Jingjing Gong; Jianping Xie; Roble Bedolla; Paul Rivas; Divya Chakravarthy; James W. Freeman; Robert Reddick; Scott Kopetz; Amanda Peterson; Huamin Wang; Susan M. Fischer; and Addanki P. Kumar

2014-03-01T23:59:59.000Z

31

MODULATION OF THE NF-KAPPA B SIGNALING PATHWAY BY THE BACTERIAL TYPE III SECRETION SYSTEM EFFECTORS  

E-Print Network [OSTI]

(s) was unknown. In this thesis, my goals were to identify T3SS effectors from attaching and effacing (A/E) pathogens responsible for modulating NF-?B activation and reveal the working mechanism of these identified effectors. In the first project, NleH1 and NleH2...

Gao, Xiaofei

2012-08-31T23:59:59.000Z

32

Initial Configuration of Acceleration for the IDS-NF Neutrino Factory  

SciTech Connect (OSTI)

The IDS-NF neutrino factory acceleration system must accelerate the muon beam coming out of cooling to a total energy of 25 GeV. The parameters of the beam being accelerated are given in Table 1. While a certain fraction of the beam will be lost early in acceleration, losses of the beam that falls within the acceptance (see Table 1) should be dominated by decay losses (as opposed to dynamic losses or losses on apertures). Decay losses will be kept small, and the cost of the machine will be reduced to the extent possible, consistent with the above requirements. There is a tradeoff between machine cost and the amount of decay losses, and a reasonable compromise will be made between them. Both muon signs will be accelerated simultaneously.

Berg, J.S.

2011-10-01T23:59:59.000Z

33

Baryon spectrum using Nf=2+1+1 ensembles of twisted mass fermions  

E-Print Network [OSTI]

We present results on the masses of the low-lying baryons using ten ensembles of gauge configurations with $N_f =2+1+1$ dynamical twisted mass fermions, at three values of the lattice spacing, spanning a pion mass range from about 210 MeV to about 430 MeV. The strange and charm quark masses are tuned to approximately their physical values. We examine isospin symmetry breaking effects on the baryon mass and the dependence on the lattice spacing. After taking the continuum limit we use chiral perturbation theory to extrapolate to the physical vlaue of the pion mass for all forty baryons. We provide predictions for the masses of doubly and triply charmed baryons that have not yet been measured experimentally.

Alexandrou, C; Hadjiyiannakou, K; Jansen, K; Kallidonis, C; Koutsou, G

2014-01-01T23:59:59.000Z

34

Charmless chiral perturbation theory for N_f=2+1+1 twisted mass lattice QCD  

E-Print Network [OSTI]

The chiral Lagrangian describing the low-energy behavior of N_f=2+1+1 twisted mass lattice QCD is constructed through O(a^2). In contrast to existing results the effects of a heavy charm quark are consistently removed, leaving behind a charmless 3-flavor Lagrangian. This Lagrangian is used to compute the pion and kaon masses to one loop in a regime where the pion mass splitting is large and taken as a leading order effect. In comparison with continuum chiral perturbation theory additional chiral logarithms are present in the results. In particular, chiral logarithms involving the neutral pion mass appear. These predict rather large finite volume corrections in the kaon mass which roughly account for the finite volume effects observed in lattice data.

Oliver Baer; Ben Horz

2014-08-29T23:59:59.000Z

35

3D calculation of Tucson-Melbourne 3NF effect in triton binding energy  

E-Print Network [OSTI]

As an application of the new realistic three-dimensional (3D) formalism reported recently for three-nucleon (3N) bound states, an attempt is made to study the effect of three-nucleon forces (3NFs) in triton binding energy in a non partial wave (PW) approach. The spin-isospin dependent 3N Faddeev integral equations with the inclusion of 3NFs, which are formulated as function of vector Jacobi momenta, specifically the magnitudes of the momenta and the angle between them, are solved with Bonn-B and Tucson-Melbourne NN and 3N forces in operator forms which can be incorporated in our 3D formalism. The comparison with numerical results in both, novel 3D and standard PW schemes, shows that non PW calculations avoid the very involved angular momentum algebra occurring for the permutations and transformations and it is more efficient and less cumbersome for considering the 3NF.

M. R. Hadizadeh; L. Tomio; S. Bayegan

2010-03-24T23:59:59.000Z

36

High glucose induces activation of NF-?B inflammatory signaling through I?B? sumoylation in rat mesangial cells  

SciTech Connect (OSTI)

Highlights: •The expression of SUMO1, SUMO2/3 under high glucose was obviously enhanced. •High glucose induced degradation of I?B? and activation of NF-?B pathway. •Sumoylation of I?B? in high glucose were significantly decreased. •The proteasome inhibitor MG132 could partially revert the degradation of I?B?. -- Abstract: The posttranslational modification of proteins by small ubiquitin-like modifiers (SUMOs) has emerged as an important regulatory mechanism for the alteration of protein activity, stability, and cellular localization. The latest research demonstrates that sumoylation is extensively involved in the regulation of the nuclear factor ?B (NF-?B) pathway, which plays a critical role in the regulation of inflammation and contributes to fibrosis in diabetic nephropathy (DN). However, the role of sumoylation in the regulation of NF-?B signaling in DN is still unclear. In the present study, we cultured rat glomerular mesangial cells (GMCs) stimulated by high glucose and divided GMCs into six groups: normal glucose group (5.6 mmol/L), high glucose groups (10, 20, and 30 mmol/L), mannitol group (i.e., osmotic control group), and MG132 intervention group (30 mmol/L glucose with MG132, a proteasome inhibitor). The expression of SUMO1, SUMO2/3, I?B?, NF-?Bp65, and monocyte chemotactic protein 1 (MCP-1) was measured by Western blot, reverse-transcription polymerase chain reaction, and indirect immunofluorescence laser scanning confocal microscopy. The interaction between SUMO1, SUMO2/3, and I?B? was observed by co-immunoprecipitation. The results showed that the expression of SUMO1 and SUMO2/3 was dose- and time-dependently enhanced by high glucose (p < 0.05). However, the expression of I?B? sumoylation in high glucose was significantly decreased compared with the normal glucose group (p < 0.05). The expression of I?B? was dose- and time-dependently decreased, and NF-?Bp65 and MCP-1 were increased under high glucose conditions, which could be mostly reversed by adding MG132 (p < 0.05). The present results support the hypothesis that high glucose may activate NF-?B inflammatory signaling through I?B? sumoylation and ubiquitination.

Huang, Wei [Department of Endocrinology, Affiliated Hospital of Luzhou Medical College, Luzhou, Sichuan 646000 (China) [Department of Endocrinology, Affiliated Hospital of Luzhou Medical College, Luzhou, Sichuan 646000 (China); Department of Endocrinology, The People’s Hospital of Xindu, Xindu, Sichuang, 610500 (China); Xu, Ling [Department of Endocrinology, Affiliated Hospital of Luzhou Medical College, Luzhou, Sichuan 646000 (China)] [Department of Endocrinology, Affiliated Hospital of Luzhou Medical College, Luzhou, Sichuan 646000 (China); Zhou, Xueqin [Department of Endocrinology, Affiliated Hospital of Luzhou Medical College, Luzhou, Sichuan 646000 (China) [Department of Endocrinology, Affiliated Hospital of Luzhou Medical College, Luzhou, Sichuan 646000 (China); Department of Endocrinology, The People’s Hospital of Leshan, Sichuang (China); Gao, Chenlin; Yang, Maojun; Chen, Guo; Zhu, Jianhua; Jiang, Lan [Department of Endocrinology, Affiliated Hospital of Luzhou Medical College, Luzhou, Sichuan 646000 (China)] [Department of Endocrinology, Affiliated Hospital of Luzhou Medical College, Luzhou, Sichuan 646000 (China); Gan, Huakui [Department of Endocrinology, The First Hospital of NeiJiang, Sichuang (China)] [Department of Endocrinology, The First Hospital of NeiJiang, Sichuang (China); Gou, Fang; Feng, Hong; Peng, Juan [Department of Endocrinology, Affiliated Hospital of Luzhou Medical College, Luzhou, Sichuan 646000 (China)] [Department of Endocrinology, Affiliated Hospital of Luzhou Medical College, Luzhou, Sichuan 646000 (China); Xu, Yong, E-mail: xywyll@aliyun.com [Department of Endocrinology, Affiliated Hospital of Luzhou Medical College, Luzhou, Sichuan 646000 (China)] [Department of Endocrinology, Affiliated Hospital of Luzhou Medical College, Luzhou, Sichuan 646000 (China)

2013-08-30T23:59:59.000Z

37

Thermal Reactions of Uranium Metal, UO2, U3O8, UF4, and UO2F2 with NF3 to Produce UF6  

SciTech Connect (OSTI)

he objective of this paper is to demonstrate that NF3 fluorinates uranium metal, UO2, UF4, UO3, U3O8, and UO2F2•2H2O to produce the volatile UF6 at temperatures between 100 and 500?C. Thermogravimetric reaction profiles are described that reflect changes in the uranium oxidation state and discrete chemical speciation. Differences in the onset temperatures for each system indicate that NF3-substrate interactions are important for the temperature at which NF3 reacts: U metal > UO3 > UO2 > UO2F2 > UF4 and in fact may indicate different fluorination mechanisms for these various substrates. These studies demonstrate that NF3 is a potential replacement fluorinating agent in the existing nuclear fuel cycle and in oft-proposed actinide volatility reprocessing.

McNamara, Bruce K.; Scheele, Randall D.; Kozelisky, Anne E.; Edwards, Matthew K.

2009-11-01T23:59:59.000Z

38

Differential Effects of ?-catenin and NF-?B Interplay in the Regulation of Cell Proliferation, Inflammation and Tumorigenesis in Response to Bacterial Infection  

E-Print Network [OSTI]

Both ?-catenin and NF-?B have been implicated in our laboratory as candidate factors in driving proliferation in an in vivo model of Citrobacter rodentium (CR)-induced colonic crypt hyper-proliferation and hyperplasia. ...

Chandrakesan, Parthasarathy; Jakkula, Laxmi Uma Maheswar Rao; Ahmed, Ishfaq; Roy, Badal; Anant, Shrikant; Umar, Shahid

2013-11-21T23:59:59.000Z

39

Curcumin Regulates Low-Linear Energy Transfer {gamma}-Radiation-Induced NF{kappa}B-Dependent Telomerase Activity in Human Neuroblastoma Cells  

SciTech Connect (OSTI)

Purpose: We recently reported that curcumin attenuates ionizing radiation (IR)-induced survival signaling and proliferation in human neuroblastoma cells. Also, in the endothelial system, we have demonstrated that NF{kappa}B regulates IR-induced telomerase activity (TA). Accordingly, we investigated the effect of curcumin in inhibiting IR-induced NF{kappa}B-dependent hTERT transcription, TA, and cell survival in neuroblastoma cells. Methods and Materials: SK-N-MC or SH-SY5Y cells exposed to IR and treated with curcumin (10-100 nM) with or without IR were harvested after 1 h through 24 h. NF{kappa}B-dependent regulation was investigated either by luciferase reporter assays using pNF{kappa}B-, pGL3-354-, pGL3-347-, or pUSE-I{kappa}B{alpha}-Luc, p50/p65, or RelA siRNA-transfected cells. NF{kappa}B activity was analyzed using an electrophoretic mobility shift assay and hTERT expression using the quantitative polymerase chain reaction. TA was determined using the telomerase repeat amplification protocol assay and cell survival using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltertrazolium bromide and clonogenic assay. Results: Curcumin profoundly inhibited IR-induced NF{kappa}B. Consequently, curcumin significantly inhibited IR-induced TA and hTERT mRNA at all points investigated. Furthermore, IR-induced TA is regulated at the transcriptional level by triggering telomerase reverse transcriptase (TERT) promoter activation. Moreover, NF{kappa}B becomes functionally activated after IR and mediates TA upregulation by binding to the {kappa}B-binding region in the promoter region of the TERT gene. Consistently, elimination of the NF{kappa}B-recognition site on the telomerase promoter or inhibition of NF{kappa}B by the I{kappa}B{alpha} mutant compromises IR-induced telomerase promoter activation. Significantly, curcumin inhibited IR-induced TERT transcription. Consequently, curcumin inhibited hTERT mRNA and TA in NF{kappa}B overexpressed cells. Furthermore, curcumin enhanced the IR-induced inhibition of cell survival. Conclusions: These results strongly suggest that curcumin inhibits IR-induced TA in an NF{kappa}B dependent manner in human neuroblastoma cells.

Aravindan, Natarajan, E-mail: naravind@ouhsc.ed [Department of Radiation Oncology, University of Oklahoma Health Sciences Center, Oklahoma City, OK (United States); Veeraraghavan, Jamunarani; Madhusoodhanan, Rakhesh; Herman, Terence S. [Department of Radiation Oncology, University of Oklahoma Health Sciences Center, Oklahoma City, OK (United States); Natarajan, Mohan [Department of Otolaryngology, Head and Neck Surgery, University of Texas Health Sciences Center at San Antonio, San Antonio, TX (United States)

2011-03-15T23:59:59.000Z

40

3D Tomography of MHD Fluctuations in the H-1NF Heliac  

E-Print Network [OSTI]

A 3D tomographic reconstruction technique which does not rely on a set of radial basis functions is described for inversion of a set of limited-angle high-resolution 2D visible light emission projections (extended in the vertical and toroidal directions) of global MHD eigenmodes in the H-1NF heliac. This paper deals with some of the features and challenges that will arise in the application of tomographic imaging systems to fusion reactors, especially the strong shaping of optimised stellarator/heliotron configurations, and limited access in all types. The fluctuations are represented as a finite sum of Fourier modes characterised by toroidal and poloidal mode numbers having fixed amplitude and phase in a set of nested cylindrical flux volumes in Boozer space. The amplitudes and phases are calculated using iterative tomographic inversion techniques such as ART, SIRT and standard linear least-squares methods. The tomography is applied to synchronous camera images of singly charged carbon impurity ion emission ...

Haskey, S R; Seiwald, B; Howard, J

2014-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Dual mechanisms of NF-kappaB inhibition in carnosol-treated endothelial cells  

SciTech Connect (OSTI)

The increased adhesion of monocytes to injured endothelial layers is a critical early event in atherogenesis. Under inflammatory conditions, there is increased expression of specific cell adhesion molecules on activated vascular endothelial cells, which increases monocyte adhesion. In our current study, we demonstrate a putative mechanism for the anti-inflammatory effects of carnosol, a diterpene derived from the herb rosemary. Our results show that both carnosol and rosemary essential oils inhibit the adhesion of TNFalpha-induced monocytes to endothelial cells and suppress the expression of ICAM-1 at the transcriptional level. Moreover, carnosol was found to exert its inhibitory effects by blocking the degradation of the inhibitory protein IkappaBalpha in short term pretreatments but not in 12 h pretreatments. Our data show that carnosol reduces IKK-beta phosphorylation in pretreatments of less than 3 h. In TNFalpha-treated ECs, NF-kappaB nuclear translocation and transcriptional activity was abolished by up to 12 h of carnosol pretreatment and this was blocked by Nrf-2 siRNA. The long-term inhibitory effects of carnosol thus appear to be mediated through its induction of Nrf-2-related genes. The inhibition of ICAM-1 expression and p65 translocation is reversed by HO-1 siRNA. Carnosol also upregulates the Nrf-2-related glutathione synthase gene and thereby increases the GSH levels after 9 h of exposure. Treating ECs with a GSH synthesis inhibitor, BSO, blocks the inhibitory effects of carnosol. In addition, carnosol increases p65 glutathionylation. Hence, our present findings indicate that carnosol suppresses TNFalpha-induced singling pathways through the inhibition of IKK-beta activity or the upregulation of HO-1 expression. The resulting GSH levels are dependent, however, on the length of the carnosol pretreatment period.

Lian, K.-C.; Chuang, J.-J.; Hsieh, C.-W. [Department of Microbiology and Immunology, National Chiayi University, Chiayi, Taiwan (China); Wung, B.-S., E-mail: bswung@mail.ncyu.edu.t [Department of Microbiology and Immunology, National Chiayi University, Chiayi, Taiwan (China); Huang, G.-D.; Jian, T.-Y. [Department of Microbiology and Immunology, National Chiayi University, Chiayi, Taiwan (China); Sun, Y.-W. [Department of Biotechnology, Seed Improvement and Propagation Station, Taichung, Taiwan (China)

2010-05-15T23:59:59.000Z

42

Sirt2 suppresses glioma cell growth through targeting NF-?B–miR-21 axis  

SciTech Connect (OSTI)

Highlights: •Sirt2 expression is down-regulated in human glioma tissues and cell lines. •Sirt2 regresses glioma cell growth and colony formation via inducing apoptosis. •miR-21 is essential for the functions of Sirt2 in glioma cells. •Sirt2 deacetylates p65 to decrease miR-21 expression. -- Abstract: Sirtuins are NAD{sup +}-dependent deacetylases that regulate numerous cellular processes including aging, DNA repair, cell cycle, metabolism, and survival under stress conditions. The roles of sirtuin family members are widely studied in carcinogenesis. However, their roles in glioma remain unclear. Here we report that Sir2 was under expressed in human glioma tissues and cell lines. We found that Sirt2 overexpression decreased cell proliferation and colony formation capacity. In addition, Sirt2 overexpression induced cellular apoptosis via up-regulating cleaved caspase 3 and Bax, and down-regulating anti-apoptotic protein Bcl-2. Sirt2 knockdown obtained opposing results. We showed that Sirt2 overexpression inhibited miR-21 expression, and Sirt2 was not sufficient to reduce cell proliferation and colony formation as well as to induce apoptosis when miR-21 was knocked down in glioma cells. Mechanically, we demonstrated that Sirt2 deacetylated p65 at K310 and blocked p65 binding to the promoter region of miR-21, thus regressing the transcription of miR-21. In summary, Sirt2 is critical in human glioma via NF-?B–miR-21 pathway and Sirt2 activator may serve as candidate drug for glioma therapy.

Li, Ya’nan; Dai, Dongwei [Department of Neurosurgery, Changhai Hospital, Second Military Medical University, Shanghai (China)] [Department of Neurosurgery, Changhai Hospital, Second Military Medical University, Shanghai (China); Lu, Qiong; Fei, Mingyu [Department of Laboratory Medicine, Changhai Hospital, Second Military Medical University, Shanghai (China)] [Department of Laboratory Medicine, Changhai Hospital, Second Military Medical University, Shanghai (China); Li, Mengmeng [Department of Rheumatology, Changzheng Hospital, Second Military Medical University, Shanghai (China)] [Department of Rheumatology, Changzheng Hospital, Second Military Medical University, Shanghai (China); Wu, Xi, E-mail: xiwuchh@sina.com [Department of Neurosurgery, Changhai Hospital, Second Military Medical University, Shanghai (China)] [Department of Neurosurgery, Changhai Hospital, Second Military Medical University, Shanghai (China)

2013-11-22T23:59:59.000Z

43

PKD prevents H{sub 2}O{sub 2}-induced apoptosis via NF-{kappa}B and p38 MAPK in RIE-1 cells  

SciTech Connect (OSTI)

Previously, we demonstrated that protein kinase D (PKD) plays a protective role during H{sub 2}O{sub 2}-induced intestinal cell death. Here, we sought to determine whether this effect is mediated by nuclear factor-{kappa}B (NF-{kappa}B) and mitogen-activated protein kinases (MAPKs). Treatment with H{sub 2}O{sub 2} activated NF-{kappa}B in RIE-1 cells; H{sub 2}O{sub 2} also induced the translocation of NF-{kappa}B p65 as well as phosphorylation of I{kappa}B-{alpha}. PKD1 siRNA inhibited H{sub 2}O{sub 2}-induced activation, translocation of NF-{kappa}B, and phosphorylation of I{kappa}B-{alpha}. We also found that overexpression of wild type PKD1 attenuated H{sub 2}O{sub 2}-induced phosphorylation of p38 MAPK and its upstream activator, MAPK kinase (MKK) 3/6, whereas the phosphorylation was increased by PKD1 siRNA or kinase-dead PKD1. Phosphorylation of neither extracellular signal-regulated kinases (ERK) 1/2 nor c-Jun N-terminal kinases (JNK) was altered by PKD1 plasmids or siRNA. Our findings suggest that PKD protects intestinal cells through up-regulation of NF-{kappa}B and down-regulation of p38 MAPK.

Song Jun [Department of Surgery, University of Texas Medical Branch, 301 University Blvd., Galveston, TX 77555-0353 (United States); Li Jing [Department of Surgery, University of Texas Medical Branch, 301 University Blvd., Galveston, TX 77555-0353 (United States); Sealy Center for Cancer Cell Biology, University of Texas Medical Branch, Galveston, TX 77555 (United States); Qiao Jingbo [Department of Surgery, University of Texas Medical Branch, 301 University Blvd., Galveston, TX 77555-0353 (United States); Jain, Sunil [Department of Pediatrics, University of Texas Medical Branch, Galveston, TX 77555 (United States); Mark Evers, B. [Department of Surgery, University of Texas Medical Branch, 301 University Blvd., Galveston, TX 77555-0353 (United States); Sealy Center for Cancer Cell Biology, University of Texas Medical Branch, Galveston, TX 77555 (United States); Chung, Dai H. [Department of Surgery, University of Texas Medical Branch, 301 University Blvd., Galveston, TX 77555-0353 (United States); Sealy Center for Cancer Cell Biology, University of Texas Medical Branch, Galveston, TX 77555 (United States)], E-mail: dhchung@utmb.edu

2009-01-16T23:59:59.000Z

44

Caffeic acid phenethyl ester downregulates phospholipase D1 via direct binding and inhibition of NF?B transactivation  

SciTech Connect (OSTI)

Highlights: •We found CAFÉ, a natural product that suppresses expression and activity of PLD1. •CAPE decreased PLD1 expression by inhibiting NF?B transactivation. •CAPE rapidly inhibited PLD activity via its binding to a Cys837 of PLD1. •PLD1 downregulation by CAPE inhibited invasion and proliferation of glioma cells. -- Abstract: Upregulation of phospholipase D (PLD) is functionally linked with oncogenic signals and tumorigenesis. Caffeic acid phenethyl ester (CAPE) is an active compound of propolis extract that exhibits anti-proliferative, anti-inflammatory, anti-oxidant, and antineoplastic properties. In this study, we demonstrated that CAPE suppressed the expression of PLD1 at the transcriptional level via inhibition of binding of NF?B to PLD1 promoter. Moreover, CAPE, but not its analogs, bound to a Cys837 residue of PLD1 and inhibited enzymatic activity of PLD. CAPE also decreased activation of matrix metalloproteinases-2 induced by phosphatidic acid, a product of PLD activity. Ultimately, CAPE-induced downregulation of PLD1 suppressed invasion and proliferation of glioma cells. Taken together, the results of this study indicate that CAPE might contribute to anti-neoplastic effect by targeting PLD1.

Park, Mi Hee; Kang, Dong Woo [Department of Molecular Biology, Pusan National University, Busan 609-735 (Korea, Republic of)] [Department of Molecular Biology, Pusan National University, Busan 609-735 (Korea, Republic of); Jung, Yunjin [College of Pharmacy, Pusan National University, Busan 609-735 (Korea, Republic of)] [College of Pharmacy, Pusan National University, Busan 609-735 (Korea, Republic of); Choi, Kang-Yell [Translational Research Center for Protein Function Control, Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University, Seoul (Korea, Republic of)] [Translational Research Center for Protein Function Control, Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University, Seoul (Korea, Republic of); Min, Do Sik, E-mail: minds@pusan.ac.kr [Department of Molecular Biology, Pusan National University, Busan 609-735 (Korea, Republic of)

2013-12-06T23:59:59.000Z

45

PGC-1-related coactivator (PRC) negatively regulates endothelial adhesion of monocytes via inhibition of NF ?B activity  

SciTech Connect (OSTI)

Highlights: •First time to display that LPS downregulate the expression of PRC. •First time to show that PRC inhibits the induction of VCAM-1 and E-selectin. •First time to show that PRC inhibit monocytes attachment to endothelial cells. •First time to display that PRC inhibits transcriptional activity of NF-?B. •PRC protects the respiration rate and suppresses the glycolysis rate against LPS. -- Abstract: PGC-1-related coactivator (PRC) is a growth-regulated transcriptional cofactor known to activate many of the nuclear genes specifying mitochondrial respiratory function. Endothelial dysfunction is a prominent feature found in many inflammatory diseases. Adhesion molecules, such as VCAM-1, mediate the attachment of monocytes to endothelial cells, thereby playing an important role in endothelial inflammation. The effects of PRC in regards to endothelial inflammation remain unknown. In this study, our findings show that PRC can be inhibited by the inflammatory cytokine LPS in cultured human umbilical vein endothelial cells (HUVECs). In the presence of LPS, the expression of endothelial cell adhesion molecular, such as VCAM1 and E-selectin, is found to be increased. These effects can be negated by overexpression of PRC. Importantly, monocyte adhesion to endothelial cells caused by LPS is significantly attenuated by PRC. In addition, overexpression of PRC protects mitochondrial metabolic function and suppresses the rate of glycolysis against LPS. It is also found that overexpression of PRC decreases the transcriptional activity of NF-?B. These findings suggest that PRC is a negative regulator of endothelial inflammation.

Chengye, Zhan; Daixing, Zhou, E-mail: dxzhou7246@hotmail.com; Qiang, Zhong; Shusheng, Li

2013-09-13T23:59:59.000Z

46

D O M A I NF A L L 2 0 0 4 55555 How a Top Secret Satellite and Fast-Thinking  

E-Print Network [OSTI]

D O M A I NF A L L 2 0 0 4 55555 How a Top Secret Satellite and Fast-Thinking Navy and Air Force a tour in Rota, Spain, Houston had taken command of Fleet Weather Central, Pearl Harbor, just 48 hours man in the Navy who had worked directly with the top secret Corona Air Force spy satellite, knew what

47

Fisetin attenuates cerulein-induced acute pancreatitis through down regulation of JNK and NF-?B signaling pathways  

Science Journals Connector (OSTI)

Abstract Acute pancreatitis (AP) is a complicated disease which is largely undiscovered. Fisetin, a natural flavonoid from fruits and vegetables, has been shown to have anti-inflammatory, antioxidant, and anti-cancer activities in various disease models. However, the effects of fisetin on AP have not been determined. Pre- and post- treatment of mice with fisetin reduced the severity of AP and pancreatitis-associated lung injury and inhibited several biochemical parameters (pancreatic weight to body weight ratio, amylase, lipase, and myeloperoxidase activity) and production of inflammatory cytokines. In pancreatic acinar cells, fisetin also inhibited cell death and production of inflammatory cytokines. In addition, fisetin inhibited activation of c-Jun NH2-terminal kinase (JNK) and nuclear factor (NF)-?B in vivo and in vitro. In conclusion, these results suggest that fisetin exhibits anti-inflammatory effect on AP and could be a beneficial agent in the treatment of AP and its pulmonary complications.

Il-Joo Jo; Gi-Sang Bae; Sun Bok Choi; Dong-Goo Kim; Joon-Yeon Shin; Seung-Hee Seo; Mee-Ok Choi; Tae-Hyeon Kim; Ho-Joon Song; Sung-Joo Park

2014-01-01T23:59:59.000Z

48

Integrated Genomic Analysis Identifies Clinically Relevant Subtypes of Glioblastoma Characterized by Abnormalities in PDGFRA, IDH1, EGFR, and NF1  

SciTech Connect (OSTI)

The Cancer Genome Atlas Network recently cataloged recurrent genomic abnormalities in glioblastoma multiforme (GBM). We describe a robust gene expression-based molecular classification of GBM into Proneural, Neural, Classical, and Mesenchymal subtypes and integrate multidimensional genomic data to establish patterns of somatic mutations and DNA copy number. Aberrations and gene expression of EGFR, NF1, and PDGFRA/IDH1 each define the Classical, Mesenchymal, and Proneural subtypes, respectively. Gene signatures of normal brain cell types show a strong relationship between subtypes and different neural lineages. Additionally, response to aggressive therapy differs by subtype, with the greatest benefit in the Classical subtype and no benefit in the Proneural subtype. We provide a framework that unifies transcriptomic and genomic dimensions for GBM molecular stratification with important implications for future studies.

Verhaak, Roel GW; Hoadley, Katherine A; Purdom, Elizabeth; Wang, Victoria; Qi, Yuan; Wilkerson, Matthew D; Miller, C Ryan; Ding, Li; Golub, Todd; Mesirov, Jill P; Alexe, Gabriele; Lawrence, Michael; O'Kelly, Michael; Tamayo, Pablo; Weir, Barbara A; Gabriel, Stacey; Winckler, Wendy; Gupta, Supriya; Jakkula, Lakshmi; Feiler, Heidi S; Hodgson, J Graeme; James, C David; Sarkaria, Jann N; Brennan, Cameron; Kahn, Ari; Spellman, Paul T; Wilson, Richard K; Speed, Terence P; Gray, Joe W; Meyerson, Matthew; Getz, Gad; Perou, Charles M; Hayes, D Neil; Network, The Cancer Genome Atlas Research

2009-09-03T23:59:59.000Z

49

Magnetic susceptibility and equation of state of N_f = 2+1 QCD with physical quark masses  

E-Print Network [OSTI]

We determine the free energy of strongly interacting matter as a function of an applied constant and uniform magnetic field. We consider N_f = 2+1 QCD with physical quark masses, discretized on a lattice by stout improved staggered fermions and a tree level improved Symanzik pure gauge action, and explore three different lattice spacings. For magnetic fields of the order of those produced in non-central heavy ion collisions (eB ~ 0.1 GeV^2) strongly interacting matter behaves like a medium with a linear response, and is paramagnetic both above and below the deconfinement transition, with a susceptibility which steeply rises in the deconfined phase. We compute the equation of state, showing that the relative increase in the pressure due to the magnetic field gets larger around the transition, and of the order of 10 % for eB ~ 0.1 GeV^2.

Claudio Bonati; Massimo D'Elia; Marco Mariti; Francesco Negro; Francesco Sanfilippo

2014-05-13T23:59:59.000Z

50

Endothelial glutathione-S-transferase A4-4 protects against oxidative stress and modulates iNOS expression through NF-{kappa}B translocation  

SciTech Connect (OSTI)

Our recent work in endothelial cells and human atherosclerotic plaque showed that overexpression of glutathione-S-tranferases (GSTs) in endothelium protects against oxidative damage from aldehydes such as 4-HNE. Nuclear factor (NF)-{kappa}B plays a crucial role during inflammation and immune responses by regulating the expression of inducible genes such as inducible nitric oxide synthase (iNOS). 4-HNE induces apoptosis and affects NF-{kappa}B mediated gene expression, but conflicting results on 4-HNE's effect on NF-{kappa}B have been reported. We compared the effect of 4-HNE on iNOS and the NF-{kappa}B pathway in control mouse pancreatic islet endothelial (MS1) cells and those transfected with mGSTA4, a {alpha}-class GST with highest activity toward 4-HNE. When treated with 4-HNE, mGSTA4-transfected cells showed significant upregulation of iNOS and nitric oxide (NO) through (NF)-{kappa}B (p65) translocation in comparison with wild-type or vector-transfected cells. Immunohistochemical studies of early human plaques showed lower 4-HNE content and upregulation of iNOS, which we take to indicate that GSTA4-4 induction acts as an enzymatic defense against high levels of 4-HNE, since 4-HNE accumulated in more advanced plaques, when detoxification and exocytotic mechanisms are likely to be overwhelmed. These studies suggest that GSTA4-4 may play an important defensive role against atherogenesis through detoxification of 4-HNE and upregulation of iNOS.

Yang Yongzhen [Department of Pathology, University of Texas Medical Branch, Galveston, Texas, 77555 (United States); Yang Yusong [Department of Human Biological Chemistry and Genetics, University of Texas Medical Branch, Galveston, Texas, 77555 (United States); Xu Ya [Department of Pathology, University of Texas Medical Branch, Galveston, Texas, 77555 (United States); Lick, Scott D. [Department of Human Biological Chemistry and Surgery, University of Texas Medical Branch, Galveston, Texas, 77555 (United States); Awasthi, Yogesh C. [Department of Human Biological Chemistry and Genetics, University of Texas Medical Branch, Galveston, Texas, 77555 (United States); Boor, Paul J. [Department of Pathology, University of Texas Medical Branch, Galveston, Texas, 77555 (United States)], E-mail: pboor@utmb.edu

2008-07-15T23:59:59.000Z

51

DU145 human prostate cancer cells express functional Receptor Activator of NF-B: New insights in the prostate cancer bone metastasis process.  

E-Print Network [OSTI]

1 DU145 human prostate cancer cells express functional Receptor Activator of NF-B: New insights in the prostate cancer bone metastasis process. Mori K.1, 2, * , Le Goff B. 1, 2 , Charrier C. 1, 2 , Battaglia S;40(4):981-90" DOI : 10.1016/j.bone.2006.11.006 #12;2 Abstract Prostate cancer metastases to bone are observed

Boyer, Edmond

52

Moderate extracellular acidification inhibits capsaicin-induced cell death through regulating calcium mobilization, NF-{kappa}B translocation and ROS production in synoviocytes  

SciTech Connect (OSTI)

Highlights: Black-Right-Pointing-Pointer Moderate extracellular acidification regulates intracellular Ca{sup 2+} mobilization. Black-Right-Pointing-Pointer Moderate acidification activates NF-{kappa}B nuclear translocation in synoviocytes. Black-Right-Pointing-Pointer Moderate acidification depresses the ROS production induced by capsaicin. Black-Right-Pointing-Pointer Moderate acidification inhibits capsaicin-caused synoviocyte death. -- Abstract: We previously show the expression of transient receptor potential vanilloid 1 (TRPV1) in primary synoviocytes from collagen-induced arthritis (CIA) rats. Capsaicin and lowered extracellular pH from 7.4 to 5.5 induce cell death through TRPV1-mediated Ca{sup 2+} entry and reactive oxygen species (ROS) production. However, under the pathological condition in rheumatoid arthritis, the synovial fluid is acidified to a moderate level (about pH 6.8). In the present study, we examined the effects of pH 6.8 on the TRPV1-mediated cell death. Our finding is different or even opposite from what was observed at pH 5.5. We found that the moderate extracellular acidification (from pH 7.4 to 6.8) inhibited the capsaicin-induced Ca{sup 2+} entry through attenuating the activity of TRPV1. In the mean time, it triggered a phospholipse C (PLC)-related Ca{sup 2+} release from intracellular stores. The nuclear translocation of NF-{kappa}B was found at pH 6.8, and this also depends on PLC activation. Moreover, the capsaicin-evoked massive ROS production and cell death were depressed at pH 6.8, both of which are dependent on the activation of PLC and NF-{kappa}B. Taken together, these results suggested that the moderate extracellular acidification inhibited the capsaicin-induced synoviocyte death through regulating Ca{sup 2+} mobilization, activating NF-{kappa}B nuclear translocation and depressing ROS production.

Hu, Fen; Yang, Shuang; Zhao, Dan; Zhu, Shuyan; Wang, Yuxiang [Department of Biophysics, School of Physics and Key Laboratory of Bioactive Materials of Education Ministry, Nankai University, Tianjin 300071 (China)] [Department of Biophysics, School of Physics and Key Laboratory of Bioactive Materials of Education Ministry, Nankai University, Tianjin 300071 (China); Li, Junying, E-mail: jyli04@nankai.edu.cn [Department of Biophysics, School of Physics and Key Laboratory of Bioactive Materials of Education Ministry, Nankai University, Tianjin 300071 (China)] [Department of Biophysics, School of Physics and Key Laboratory of Bioactive Materials of Education Ministry, Nankai University, Tianjin 300071 (China)

2012-07-20T23:59:59.000Z

53

YANMAR NFD9-M, NF19-SK,--p,A"R--,, OEy, Ad,Zg--p,AOESw`'u,,,"rKX', PM,`',,D  

E-Print Network [OSTI]

Flying Wheel Hydrolic Dynamometer Exhaust Gas Pipe DO Tank Suction Pipe Measuring Point Specification,ð`ª'è,µ,½·D Z� OE± Ds Ds Ds(nm) Da Simulated Form of Aggregated PM in Exhaust Gas --±Zq on Diesel Engine 25 50 75 100 0 10 20 0 200 400 600 AirRatio Exp. results on NF-19SK Diesel Eng. Fuel oil

Ishii, Hitoshi

54

Involvement of a chromatin modifier in response to mono-(2-ethylhexyl) phthalate (MEHP)-induced Sertoli cell injury: Probably an indirect action via the regulation of NF?B/FasL circuitry  

SciTech Connect (OSTI)

Highlights: •MTA1 expression is upregulated in SCs upon MEHP treatment. •Knockdown of MTA1 in SCs impairs the MEHP-induced NF?B signaling activation. •Knockdown of MTA1 inhibits recruitment of NF?B onto FasL promoter in MEHP-treated SCs. -- Abstract: The Fas/FasL signaling pathway, controlled by nuclear factor-?B (NF?B) at the transcriptional level, is critical for triggering germ cell apoptosis in response to mono-(2-ethylhexyl) phthalate (MEHP)-induced Sertoli cell (SC) injury, but the exact regulation mechanism remain unknown. Here, we discovered that expression level of Metastasis associated protein 1 (MTA1), a component of the Mi-2/nucleosome remodeling and deacetylase complex, was upregulated in SCs during the early recovery after MEHP exposure. This expression change was in line with the dynamic changes in germ cell apoptosis in response to MEHP treatment. Furthermore, a knockdown of MTA1 by RNAi in SCs was found to impair the MEHP-induced early activation of NF?B pathway and abolish the recruitment of NF?B onto FasL promoter, which consequently diminished the MEHP-triggered FasL induction. Considering that Fas/FasL is a well characterized apoptosis initiating signaling during SCs injury, our results point to a potential “switch on” effect of MTA1, which may govern the activation of NF?B/FasL cascade in MEHP-insulted SCs. Overall, the MTA1/NF?B/FasL circuit may serve as an important defensive/repairing mechanism to help to control the germ cell quality after SCs injury.

Chen, Shiwei [Department of Urology, 174th Hospital of PLA, Fujian 361001 (China)] [Department of Urology, 174th Hospital of PLA, Fujian 361001 (China); Dong, Yushu [Department of Neurosurgery, 463rd Hospital of PLA, Shenyang 110042 (China)] [Department of Neurosurgery, 463rd Hospital of PLA, Shenyang 110042 (China); Xu, Chun; Jiang, Liming; Chen, Yongjie; Jiang, Cheng [Department of Urology, 174th Hospital of PLA, Fujian 361001 (China)] [Department of Urology, 174th Hospital of PLA, Fujian 361001 (China); Hou, Wugang, E-mail: gangwuhou@163.com [Department of Anesthesiology, Xijing Hospital, Fourth Military Medical University, Xi’an 710032 (China)] [Department of Anesthesiology, Xijing Hospital, Fourth Military Medical University, Xi’an 710032 (China); Li, Wei, E-mail: liweipepeyato@163.com [Department of Human Anatomy, Histology and Embryology, Fourth Military Medical University, Xi’an 710032 (China)] [Department of Human Anatomy, Histology and Embryology, Fourth Military Medical University, Xi’an 710032 (China)

2013-11-01T23:59:59.000Z

55

Anti-neuroinflammatory efficacy of the aldose reductase inhibitor FMHM via phospholipase C/protein kinase C-dependent NF-?B and MAPK pathways  

SciTech Connect (OSTI)

Aldose reductase (AR) has a key role in several inflammatory diseases: diabetes, cancer and cardiovascular diseases. Therefore, AR inhibition seems to be a useful strategy for anti-inflammation therapy. In the central nervous system (CNS), microglial over-activation is considered to be a central event in neuroinflammation. However, the effects of AR inhibition in CNS inflammation and its underlying mechanism of action remain unknown. In the present study, we found that FMHM (a naturally derived AR inhibitor from the roots of Polygala tricornis Gagnep.) showed potent anti-neuroinflammatory effects in vivo and in vitro by inhibiting microglial activation and expression of inflammatory mediators. Mechanistic studies showed that FMHM suppressed the activity of AR-dependent phospholipase C/protein kinase C signaling, which further resulted in downstream inactivation of the I?B kinase/I?B/nuclear factor-kappa B (NF-?B) inflammatory pathway. Therefore, AR inhibition-dependent NF-?B inactivation negatively regulated the transcription and expression of various inflammatory genes. AR inhibition by FMHM exerted neuroprotective effects in lipopolysaccharide-induced neuron–microglia co-cultures. These findings suggested that AR is a potential target for neuroinflammation inhibition and that FMHM could be an effective agent for treating or preventing neuroinflammatory diseases. - Highlights: • FMHM is a natural-derived aldose reductase (AR) inhibitor. • FMHM inhibits various neuroinflammatory mediator productions in vitro and in vivo. • FMHM inhibits neuroinflammation via aldose reductase/PLC/PKC-dependent NF-?B pathway. • FMHM inhibits neuroinflammation via aldose reductase/PLC/PKC-dependent MAPK pathway. • FMHM protects neurons against inflammatory injury in microglia-neuron co-cultures.

Zeng, Ke-Wu [State Key Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences, Peking University Health Science Center, Beijing 100191 (China); Li, Jun [Modern Research Center for Traditional Chinese Medicine, Beijing University of Chinese Medicine, Beijing 100029 (China); Dong, Xin; Wang, Ying-Hong; Ma, Zhi-Zhong; Jiang, Yong; Jin, Hong-Wei [State Key Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences, Peking University Health Science Center, Beijing 100191 (China); Tu, Peng-Fei, E-mail: pengfeitu@vip.163.com [State Key Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences, Peking University Health Science Center, Beijing 100191 (China); Modern Research Center for Traditional Chinese Medicine, Beijing University of Chinese Medicine, Beijing 100029 (China)

2013-11-15T23:59:59.000Z

56

DETEW!INATION OF THE NEUTRON MAGNETIC FlONENT G.L. Greene and N.F. Ramsey  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

DETEW!INATION OF THE NEUTRON MAGNETIC FlONENT DETEW!INATION OF THE NEUTRON MAGNETIC FlONENT * G.L. Greene and N.F. Ramsey Harvard U n i v e r s i t y , Cambridge, N a s s a c h u s e t t s 02138 h W. Plampe i - I n s t i t u t Laue-Langevin, 38042 Grenoble, France' 9/ \ P J . M . P e n d l e b u r y and K. Smith " ' , \30ddb * A , 4 U n i v e r s i t y o f S u s s e x , Falmer, B r i g h t o n , B N I 9 Q H , U n i t e d Kingdom W . B . Dress and P.D. Miller -3 Oak Ridge N a t i o n a l L a b o r a t o r y , Oak Ridge, Tennessee 37838 P a u l P e r r i n C e n t r e d ' E t u d e s N u c l e a i r e s , 38042 C r e n o b l e , F r a n c e The n e u t r o n m a g n e t i c moment h a s been measured w i t h an improvement of a f a c t o r of 100 o v e r t h e p r e v i o u s b e s t measurement. s p e c t r o m e t e r o f t h e s e p a r a t e d o s c i l l a t o r y f i e l d t y p e c a p a b l e o f d e t e r m i n i n g a r e s o n a n c e s i g n a l f o r b o t h n e u t r o n s and p r o t o n s ( i n f l o w i n g H20), we f i n d u n / p p = 0.68497935(17)

57

TGF-{beta}1 increases invasiveness of SW1990 cells through Rac1/ROS/NF-{kappa}B/IL-6/MMP-2  

SciTech Connect (OSTI)

Research highlights: {yields} Rac1 mediates TGF-{beta}1-induced SW1990 invasion through MMP-2 secretion and activation. {yields} NADPH-generated ROS act downstream of Rac1 in TGF-{beta}1-challenged SW1990 cells. {yields} TGF-{beta}1-stimulated ROS activate NF-{kappa}B in SW1990 cells. {yields} NF{kappa}B-induced IL-6 release is required for secretion and activation of MMP-2 in SW1990 cells. -- Abstract: Human pancreatic cancer invasion and metastasis have been found to correlate with increased levels of active matrix metalloproteinase 2 (MMP-2). The multifunctional cytokine transforming growth factor beta 1 (TGF-{beta}1) has been shown to increase both secretion of MMP-2 and invasion by several pancreatic cancer cell types. In the present study, we investigated the signaling pathway involved in TGF-{beta}1-promoted MMP-2 secretion and invasion by human pancreatic cancer cells SW1990. Using specific inhibitors, we found that stimulation of these tumor cells with TGF-{beta}1 induced secretion and activation of the collagenase MMP-2, which was required for TGF-{beta}1-stimulated invasion. Our results also indicate that signaling events involved in TGF-{beta}1-enhanced SW1990 invasiveness comprehend activation of Rac1 followed by generation of reactive oxygen species through nicotinamide adenine dinucleotide phosphate-oxidase, activation of nuclear factor-kappa beta, release of interleukin-6, and secretion and activation of MMP-2.

Binker, Marcelo G. [Departments of Medicine and Physiology, University of Toronto, Toronto, Ontario, Canada M5S 1A8 (Canada) [Departments of Medicine and Physiology, University of Toronto, Toronto, Ontario, Canada M5S 1A8 (Canada); CBRHC Research Center, Buenos Aires (Argentina); Binker-Cosen, Andres A. [CBRHC Research Center, Buenos Aires (Argentina)] [CBRHC Research Center, Buenos Aires (Argentina); Gaisano, Herbert Y. [Departments of Medicine and Physiology, University of Toronto, Toronto, Ontario, Canada M5S 1A8 (Canada)] [Departments of Medicine and Physiology, University of Toronto, Toronto, Ontario, Canada M5S 1A8 (Canada); Cosen, Rodica H. de [CBRHC Research Center, Buenos Aires (Argentina)] [CBRHC Research Center, Buenos Aires (Argentina); Cosen-Binker, Laura I., E-mail: laura.cosen.binker@utoronto.ca [Departments of Medicine and Physiology, University of Toronto, Toronto, Ontario, Canada M5S 1A8 (Canada); CBRHC Research Center, Buenos Aires (Argentina)

2011-02-04T23:59:59.000Z

58

Baincalein alleviates early brain injury after experimental subarachnoid hemorrhage in rats: Possible involvement of TLR4/NF-?B-mediated inflammatory pathway  

Science Journals Connector (OSTI)

Abstract Early brain injury (EBI) following subarachnoid hemorrhage (SAH) largely contributes to unfavorable outcomes. Hence, effective therapeutic strategies targeting on EBI have recently become a major goal in the treatment of SAH patients. Baicalein is a flavonoid that has been shown to offer neuroprotection in kinds of brain injury models. This study investigated the effects of baicalein on EBI in rats following SAH. SAH was inducted in male Sprauge-Dawley rats by injection of fresh non-heparinized arterial blood into the prechiasmatic cistern. Baicalein (30 or 100 mg/kg) or vehicle were administrated 30 min after injury. Neurological deficit, brain edema, blood–brain barrier (BBB) permeability and neural cell apoptosis were assessed. To explore the further mechanisms, the change of toll-like receptor 4 (TLR4) and nuclear factor-?B (NF-?B) signaling pathway and the levels of apoptosis associated proteins were also examined. Our study showed that treatment with baicalein (30 mg/kg) significantly improved neurological function at 24 h after SAH and reduced brain edema at both 24 h and 72 h after SAH. Baicalein also significantly reduced neural cell death, BBB permeability. These changes were associated with the remarkable reductions of TLR4 expression, I?B-? degradation, NF-?B translocation to nucleus, as well as the expressions of matrix metalloproteinase-9, tight junctions protein, interleukin-1? and tumor necrosis factor- ?. These findings suggest that baicalein may ameliorate EBI after SAH potentially via inhibition of inflammation-related pathway.

Chun-xi Wang; Guang-bin Xie; Chen-hui Zhou; Xiang-sheng Zhang; Tao Li; Jian-guo Xu; Ning Li; Ke Ding; Chun-hua Hang; Ji-xin Shi; Meng-liang Zhou

2015-01-01T23:59:59.000Z

59

Celastrol ameliorates HIV-1 Tat-induced inflammatory responses via NF-kappaB and AP-1 inhibition and heme oxygenase-1 induction in astrocytes  

Science Journals Connector (OSTI)

Abstract HIV-1 Tat causes extensive neuroinflammation that may progress to AIDS-related encephalitis and dementia. Celastrol possesses various biological activities such as anti-oxidant, anti-tumor, and anti-inflammatory activities. In this study, we investigated the modulatory effects of celastrol on HIV-1 Tat-induced inflammatory responses and the molecular mechanisms underlying its action in astrocytes. Pre-treatment of CRT-MG human astroglioma cells with celastrol significantly inhibited HIV-1 Tat-induced expression of ICAM-1/VCAM-1 and subsequent monocyte adhesiveness in CRT-MG cells. In addition, celastrol suppressed HIV-1 Tat-induced expression of pro-inflammatory chemokines, such as CXCL10, IL-8, and MCP-1. Celastrol decreased HIV-1 Tat-induced activation of JNK MAPK, AP-1, and NF-?B. Furthermore, celastrol induced mRNA and protein expression of HO-1 as well as Nrf2 activation. Blockage of HO-1 expression using siRNA reversed the inhibitory effect of celastrol on HIV-1 Tat-induced inflammatory responses. These results suggest that celastrol has regulatory effects on HIV-1 Tat-induced inflammatory responses by blocking the JNK MAPK-AP-1/NF-?B signaling pathways and inducing HO-1 expression in astrocytes.

Gi Soo Youn; Dong-Joo Kwon; Sung Mi Ju; Hyangshuk Rhim; Yong Soo Bae; Soo Young Choi; Jinseu Park

2014-01-01T23:59:59.000Z

60

Relation between two-point Green functions of ${\\cal N}=1$ SQED with $N_f$ flavors, regularized by higher derivatives, in the three-loop approximation  

E-Print Network [OSTI]

We verify the identity which relates the two-point Green functions of ${\\cal N}=1$ SQED with $N_f$ flavors, regularized by higher derivatives, by explicit calculations in the three-loop approximation. This identity explains why in the limit of the vanishing external momentum the two-point Green function of the gauge superfield is given by integrals of double total derivatives in the momentum space. It also allows to derive the NSVZ $\\beta$-function exactly in all loops if the renormalization group functions are defined in terms of the bare coupling constant. In order to verify the considered identity we use it for constructing integrals giving the three-loop $\\beta$-function starting from the two-point Green functions of the matter superfields in the two-loop approximation. Then we demonstrate that the results for these integrals coincide with the sums of the corresponding three-loop supergraphs.

A. E. Kazantsev; K. V. Stepanyantz

2014-10-05T23:59:59.000Z

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Improvement of the double crystal diffractometer at the Geesthacht Neutron Facility (GeNF) by means of perfect channel-cut silicon crystals  

Science Journals Connector (OSTI)

High resolution small-angle neutron scattering (HR-SANS) investigations have been performed by means of the double crystal diffractometer (DCD) at the Geesthacht Neutron Facility (GeNF). The two single perfect silicon crystals of the instrument have recently been replaced by channel-cut ones in the non-dispersive (1, ?1) setting to reduce the intensity of the rocking curve in its wings by three-fold reflections. Thereby a very strong decrease of this intensity has been achieved, whereby its former dependence on the scattering vector q of q?2 has been changed to q?6. This improvement of the rocking curve leading to a reduction of the inherent background is presented, and a new perspective for future HR-SANS investigations is pointed out.

D Bellmann; M Klatt; R Kampmann; R Wagner

1997-01-01T23:59:59.000Z

62

Lipopolysaccharide-induced inhibition of transcription of tlr4 in vitro is reversed by dexamethasone and correlates with presence of conserved NF?B binding sites  

SciTech Connect (OSTI)

Highlights: ? Chimpanzees, horses and humans have regions of similarity on TLR4 and MD2 promoters. ? Rodents have few regions of similarity on TLR4 promoter when compared to primates. ? Conserved NFkB binding sites were found in the promoters of TLR4 and MD2. ? LPS-induced inhibition of TLR4 transcription is reversed by dexamethasone. ? LPS-induced transcription of MD2 is inhibited by dexamethasone. -- Abstract: Engagement of Toll-like receptor 4 (TLR4) by lipopolysaccharide (LPS) is a master trigger of the deleterious effects of septic shock. Horses and humans are considered the most sensitive species to septic shock, but the mechanisms explaining these phenomena remain elusive. Analysis of tlr4 promoters revealed high similarity among LPS-sensitive species (human, chimpanzee, and horse) and low similarity with LPS-resistant species (mouse and rat). Four conserved nuclear factor kappa B (NF?B) binding sites were found in the tlr4 promoter and two in the md2 promoter sequences that are likely to be targets for dexamethasone regulation. In vitro treatment of equine peripheral blood mononuclear cells (eqPBMC) with LPS decreased transcripts of tlr4 and increased transcription of md2 (myeloid differentiation factor 2) and cd14 (cluster of differentiation 14). Treatment with dexamethasone rescued transcription of tlr4 after LPS inhibition. LPS-induced transcription of md2 was inhibited in the presence of dexamethasone. Dexamethasone alone did not affect transcription of tlr4 and md2.

Bonin, Camila P., E-mail: mila_bonin@yahoo.com.br [Department of Immunology, Institute of Biomedical Sciences, University of São Paulo, São Paulo 05508-900 (Brazil); Baccarin, Raquel Y.A., E-mail: baccarin@usp.br [Department of Clinics, School of Veterinary Medicine, University of São Paulo, São Paulo 05508-900 (Brazil); Nostell, Katarina, E-mail: katarina.nostell@slu.se [Department of Clinical Sciences, Swedish University of Agricultural Sciences, Box 7054, 750 07 Uppsala (Sweden)] [Department of Clinical Sciences, Swedish University of Agricultural Sciences, Box 7054, 750 07 Uppsala (Sweden); Nahum, Laila A., E-mail: laila@nahum.com.br [Centro de Pesquisas René Rachou, Fundação Oswaldo Cruz, Belo Horizonte 30190-002 (Brazil); Faculdade Infórium de Tecnologia, Belo Horizonte 30130-180 (Brazil); Fossum, Caroline, E-mail: caroline.fossum@bvf.slu.se [Department of Biomedicine and Veterinary Public Health, Section for Immunology, Swedish University of Agricultural Sciences, BMC, Box 588, SE 751 23 Uppsala (Sweden)] [Department of Biomedicine and Veterinary Public Health, Section for Immunology, Swedish University of Agricultural Sciences, BMC, Box 588, SE 751 23 Uppsala (Sweden); Camargo, Maristela M. de, E-mail: mmcamar@usp.br [Department of Immunology, Institute of Biomedical Sciences, University of São Paulo, São Paulo 05508-900 (Brazil)] [Department of Immunology, Institute of Biomedical Sciences, University of São Paulo, São Paulo 05508-900 (Brazil)

2013-03-08T23:59:59.000Z

63

Activation of ROS/NF-{kappa}B and Ca{sup 2+}/CaM kinase II are necessary for VCAM-1 induction in IL-1{beta}-treated human tracheal smooth muscle cells  

SciTech Connect (OSTI)

Histone acetylation regulated by histone acetyltransferases (HATs) and histone deacetylases (HDACs) plays a critical role in the expression of inflammatory genes, such as vascular cell adhesion molecule-1 (VCAM-1). Oxidative processes have been shown to induce VCAM-1 expression. Here, we investigated the mechanisms underlying IL-1{beta}-induced VCAM-1 expression in human tracheal smooth muscle cells (HTSMCs). Our results showed that IL-1{beta} enhanced HTSMCs-monocyte adhesion through up-regulation of VCAM-1, which was inhibited by pretreatment with selective inhibitors of PKC{alpha} (Goe6976), c-Src (PP1), NADPH oxidase [diphenylene iodonium (DPI) and apocynin (APO)], intracellular calcium chelator (BAPTA/AM), PI-PLC (U73122), CaM (calmidazolium chloride), CaM kinase II (KN62), p300 (garcinol), NF-{kappa}B (Bay11-7082), HDAC (trichostatin A), and ROS scavenger [N-acetyl-L-cysteine (NAC)] or transfection with siRNAs of MyD88, PKC{alpha}, Src, p47{sup phox}, p300, and HDAC4. Moreover, IL-1{beta} stimulated NF-{kappa}B and CaMKII phosphorylation through MyD88-dependent PI-PLC/PKC{alpha}/c-Src/ROS and PI-PLC/Ca{sup 2+}/CaM pathways, respectively. Activation of NF-{kappa}B and CaMKII may eventually lead to the acetylation of histone residues and phosphorylation of histone deacetylases. These findings suggested that IL-1{beta} induced VCAM-1 expression via these multiple signaling pathways in HTSMCs. Blockade of these pathways may reduce monocyte adhesion via VCAM-1 suppression and attenuation of the inflammatory responses in airway diseases.

Luo, S.-F. [Department of Internal Medicine, Chang Gung University, Kwei-San, Tao-Yuan, Taiwan (China); Chang, C.-C.; Lee, I-T. [Department of Physiology and Pharmacology, Chang Gung University, Kwei-San, Tao-Yuan, Taiwan (China); Lee, C.-W. [Department of Nursing, Division of Basic Medical Sciences, Chang Gung Institute of Technology, Chia-Yi, Taiwan (China); Lin, W.-N. [Department of Physiology and Pharmacology, Chang Gung University, Kwei-San, Tao-Yuan, Taiwan (China); Lin, C.-C. [Department of Anesthetics, Chang Gung University, Kwei-San, Tao-Yuan, Taiwan (China); Yang, C.-M. [Department of Physiology and Pharmacology, Chang Gung University, Kwei-San, Tao-Yuan, Taiwan (China)], E-mail: chuenmao@mail.cgu.edu.tw

2009-05-15T23:59:59.000Z

64

Determination of the Pa233(n,f) reaction cross section from 11.5 to 16.5 MeV neutron energy by the hybrid surrogate ratio approach  

Science Journals Connector (OSTI)

A new hybrid surrogate ratio approach has been employed to determine neutron-induced fission cross sections of Pa233 in the energy range of 11.5 to 16.5 MeV for the first time. The fission probability of Pa234 and U236 compound nuclei produced in Th232(Li6, ?)Pa234 and Th232(Li6, d)U236 transfer reaction channels has been measured at Elab=38.0 MeV in the excitation energy range of 17.0 to 22.0 MeV within the framework of the absolute surrogate method. The Pa233(n,f) cross sections are then deduced from the measured fission decay probability ratios of Pa234 and U236 compound nuclei using the surrogate ratio method. The Pa233(n,f) cross section data from the present experiment along with the data from the literature, covering the neutron energy range of 1.0 to 16.5 MeV have been compared with the predictions of statistical model code EMPIRE-2.19. While the present data are consistent with the model predictions, there is a discrepancy between the earlier experimental data and EMPIRE-2.19 predictions in the neutron energy range of 7.0 to 10.0 MeV.

B. K. Nayak, A. Saxena, D. C. Biswas, E. T. Mirgule, B. V. John, S. Santra, R. P. Vind, R. K. Choudhury, and S. Ganesan

2008-12-12T23:59:59.000Z

65

Cyclooxygenase (COX)-2 Inhibitor Celecoxib Abrogates Activation of Cigarette Smoke-Induced Nuclear Factor (NF)-?B by Suppressing Activation of I-?B ? Kinase in Human Non-Small Cell Lung Carcinoma: Correlation with Suppression of Cyclin D1, COX-2, and Matrix Metalloproteinase-9  

Science Journals Connector (OSTI)

...Cancer Research. The costs of publication of this...condensate (CSC)-dependent nuclear factor-kB (NF-kB...RL, Wang Y, Zweifel BS, Koki AT, Masferrer...18 Kisley LR, Barrett BS, Dwyer-Nield LD, Bauer...Garg A, Aggarwal BB. Nuclear transcription factor-kappaB...

Shishir Shishodia and Bharat B. Aggarwal

2004-07-15T23:59:59.000Z

66

Mercury Chamber NF-IDS Meeting  

E-Print Network [OSTI]

-Battelle for the U.S. Department of Energy Mercury Chamber Update Oct 2011 Starting Point: Coil and Shielding Concept IDS120H #12;3 Managed by UT-Battelle for the U.S. Department of Energy Mercury Chamber Update Oct 2011 · Penetrations (ports) into chamber ­ Nozzle ­ Hg drains (overflow and maintenance) ­ Vents (in and out) ­ Beam

McDonald, Kirk

67

Fission of light actinides: Th232(n,f) and Pa231(n,f) reactions  

Science Journals Connector (OSTI)

A model to describe fission on light actinides, which takes into account transmission through a triple-humped fission barrier with absorption, is proposed. The fission probability derived in the WKB approximation within an optical model for fission has been incorporated into the statistical model of nuclear reactions. The complex resonant structure in the first-chance neutron-induced fission cross sections of Th232 and Pa231 nuclei has been reproduced by the proposed model. Consistent sets of parameters describing the triple-humped fission barriers of Th233 and Pa232 have been obtained. The results confirm the attribution of the gross resonant structure in the fission probability of these light actinides to partially damped vibrational states in the second well and undamped vibrational states in the third well of the corresponding fission barriers.

M. Sin; R. Capote; A. Ventura; M. Herman; P. ObložinskÝ

2006-07-27T23:59:59.000Z

68

Beam Loading Computation for the IDS-NF FFAG  

SciTech Connect (OSTI)

I accumulate the information we have for the current baseline design for a neutrino factory to determine the maximum current we can expect at the final FFAG accelerating stage. I then determine the energy extracted from the RF cavities in the FFAG, and from that determine how much time there must be between bunch trains to restore the energy to the RF cavities so that each bunch train has the same energy at the storage ring. I also estimate the amount of energy variation from the head to the tail of the bunch train.

Berg, J.S.

2011-10-01T23:59:59.000Z

69

Down to the wire for the NF gene  

Science Journals Connector (OSTI)

...will launch Astro-1 im-mediately following the Ulysses mission. In tests carried out last week on the launch pad and at Rocketdyne laboratories in Downey, California, NASA engineers exonerated their "prime suspect"-the main seal in the disconnect...

L Roberts

1990-07-20T23:59:59.000Z

70

NF1 Inactivation in Adult Acute Myelogenous Leukemia  

Science Journals Connector (OSTI)

...Discussion In this study, we have used ultra-high-density SNP arrays to interrogate...1909-18. 2 Pedersen-Bjergaard J , Andersen MK, Andersen MT Christiansen DH. Genetics...recurrent genomic microdeletions using ultra-high density Affymetrix single nucleotide...

Brian Parkin; Peter Ouillette; Yin Wang; Yan Liu; Whitney Wright; Diane Roulston; Anjali Purkayastha; Amanda Dressel; Judith Karp; Paula Bockenstedt; Ammar Al-Zoubi; Moshe Talpaz; Lisa Kujawski; Yang Liu; Kerby Shedden; Sajid Shakhan; Cheng Li; Harry Erba; and Sami N. Malek

2010-08-15T23:59:59.000Z

71

NF 3 , the greenhouse gas missing from Kyoto  

E-Print Network [OSTI]

of the world’s largest coal-fired power plants. If released,exceeding the world’s largest coal-fired power stations (O b CH 4b CO 2b 3600 MW Coal-Fired Plants Scherer (Georgia,

Prather, Michael J; Hsu, Juno

2008-01-01T23:59:59.000Z

72

Vol. 2003, Issue 36, pp. nf17, 10 September 2003 [DOI: 10.1126/sageke.2003.36.nf17  

E-Print Network [OSTI]

with memory disorders. (116K):View larger version [in this window] [in a new window] Adam Gazzaley is using and shadow, simplicity and complexity. Last month, he shot 32 rolls of film during a 2-week trip to Alaska

73

Activation of NF-kappa B by interleukin 2 in human blood monocytes  

Science Journals Connector (OSTI)

...uv irradiation (254 nm(. Protein coniple'xes svere' analyzed on 12% polyacrylaniide-SDS gel under reducing condi-iions. 1,)rke'r6 indic.ite I)rote'in complexes that are' 50/55, 75, and 85 kI) ii si/K'. Cell Crowth, 5 Diffe'rentiation...

MA Brach; HJ Gruss; D Riedel; R Mertelsmann; F Herrmann

1992-07-01T23:59:59.000Z

74

Effects of water chemistry on NF/RO membrane structure and performance  

E-Print Network [OSTI]

oil that has been widely detected around petroleum and natural gas production sites, gas stations, and underground storage tanks.

Mo, Yibing

2013-01-01T23:59:59.000Z

75

Bound states of multi-nucleon channels in N_f=2+1 lattice QCD  

E-Print Network [OSTI]

We calculate the energies for multi-nucleon ground states with the nuclear mass number less than or equal to 4 in 2+1 flavor QCD at the lattice spacing of a = 0.09 fm employing a relatively heavy quark mass corresponding to m_pi = 0.51 GeV. We investigate the volume dependence of the energy shift of the ground state and the state of free nucleons to distinguish a bound state from attractive scattering states. From the investigation we conclude that ^4He, ^3He, deuteron and dineutron are bound at m_pi = 0.51 GeV. We compare their binding energies with those in our quenched studies and also with some recent investigations.

Takeshi Yamazaki; Ken-ichi Ishikawa; Yoshinobu Kuramashi; Akira Ukawa

2012-11-19T23:59:59.000Z

76

A Genome-Scale RNA Interference Screen Implicates NF1 Loss in Resistance to RAF Inhibition  

Science Journals Connector (OSTI)

...These algorithms were executed using the Broad Firehose Infrastructure (47). Disclosure of Potential Conflicts of Interest N...Maguire J, Rogov P, LeProust EM, Brockman W, et alSolution hybrid selection with ultra-long oligonucleotides for massively...

Steven R. Whittaker; Jean-Philippe Theurillat; Eliezer Van Allen; Nikhil Wagle; Jessica Hsiao; Glenn S. Cowley; Dirk Schadendorf; David E. Root; and Levi A. Garraway

2013-03-01T23:59:59.000Z

77

www.nasa.gov/aeronautics NF-2013-05-565-HQ  

E-Print Network [OSTI]

from improved engine combustors, and fuel consumption and com- munity noise reduction through from advanced composite materials, fuel and noise reduction from advanced engines, emissions reductions's goal is to reduce aircraft fuel consumption, emissions and noise simultaneously. Image credit: NASA #12

78

Baryon spectrum with $N_f=2+1+1$ twisted mass fermions  

E-Print Network [OSTI]

The masses of the low lying baryons are evaluated using a total of ten ensembles of dynamical twisted mass fermion gauge configurations. The simulations are performed using two degenerate flavors of light quarks, and a strange and a charm quark fixed to approximately their physical values. The light sea quarks correspond to pseudo scalar masses in the range of about 210~MeV to 430~MeV. We use the Iwasaki improved gluonic action at three values of the coupling constant corresponding to lattice spacing $a=0.094$~fm, 0.082~fm and 0.065~fm determined from the nucleon mass. We check for both finite volume and cut-off effects on the baryon masses. We examine the issue of isospin symmetry breaking for the octet and decuplet baryons and its dependence on the lattice spacing. We show that in the continuum limit isospin breaking is consistent with zero, as expected. We performed a chiral extrapolation of the forty baryon masses using SU(2) $\\chi$PT. After taking the continuum limit and extrapolating to the physical pion mass our results are in good agreement with experiment. We provide predictions for the mass of the doubly charmed $\\Xi_{cc}^*$, as well as of the doubly and triply charmed $\\Omega$s that have not yet been determined experimentally.

C. Alexandrou; V. Drach; K. Jansen; C. Kallidonis; G. Koutsou

2014-06-17T23:59:59.000Z

79

E-Print Network 3.0 - attenuates nf-kappab-dependent icam-1 Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

in mouse brain Summary: Differences in ICAM-1 and TNF-a expression between large single fraction and fractionated... molecular response to irradiation. The expression of...

80

Effects of water chemistry on NF/RO membrane structure and performance  

E-Print Network [OSTI]

1.1.1. Drinking water…………………………. ……………………. … 1.1.2.concern (CEC’s) in drinking water………… 2.1.1. Classes ofOther Nitrosamines - Drinking Water Issues, in, 2011. [4

Mo, Yibing

2013-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Some Spectroscopic Properties of Fine Structures Observed near the Pa231(n,f) Fission Threshold  

Science Journals Connector (OSTI)

The Pa231 neutron-induced fission cross section from 140 to 400 keV was resolved into finer structures. For some of the fractionated vibrational resonances in this energy region, the assignment of spectroscopic parameters may support evidence for an asymmetrically deformed third minimum in the Pa232 fission barrier. Also, for the first time, narrow fission resonances are observed above 1.3 eV exhibiting an average fission width ??f?ob s=8 ?eV.

S. Plattard; G. F. Auchampaugh; N. W. Hill; G. de Saussure; J. A. Harvey; R. B. Perez

1981-03-09T23:59:59.000Z

82

Determining Pa234(n,f) cross sections using the surrogate method  

Science Journals Connector (OSTI)

The fission decay probabilities of the Pa235 and U236 compound nuclei produced in a single experiment in Th232(Li7, ?f)Pa235 and Th232(Li7, tf)U236 transfer induced fission reaction channels, have been measured at Elab=39.5 MeV in the excitation energy range of 14–20 MeV. The Pa234(n, f) cross sections are then deduced from the measured fission decay probability ratios of Pa235 and U236 compound systems in the equivalent neutron energy range of 8–14 MeV within the framework of the hybrid surrogate ratio method, considering the well-measured U235(n, f) cross sections as the reference. The experimental data on Pa234(n, f) cross sections have been compared with the calculated fission cross sections using empire-3.1 code with the fission barrier height values obtained from barrier formula (BF) as well as ripl-3 [24]. The present experimental results are found to be in very good agreement with the empire-3.1 predictions for the fission barrier heights predicted by the BF.

V. V. Desai; B. K. Nayak; A. Saxena; E. T. Mirgule

2014-02-13T23:59:59.000Z

83

Breaking the NF-?B and STAT3 Alliance Inhibits Inflammation and Pancreatic Tumorigenesis  

Science Journals Connector (OSTI)

...Pancreatic Cancer: Results from CALGB80303 (Alliance) Andrew B. Nixon 1 Herbert Pang 2 Mark...Venook 6 Herbert I. Hurwitz 1 for the Alliance for Clinical Trials In Oncology Corresponding...1 Division of Medical Oncology; 2 Alliance Statistics and Data Center, Duke University...

Young-Joon Surh; Ann M. Bode; Zigang Dong

2010-11-01T23:59:59.000Z

84

An Unholy Alliance: Cooperation between BRAF and NF1 in Melanoma Development and BRAF Inhibitor Resistance  

Science Journals Connector (OSTI)

...Perspective from NCI Nanotechnology Alliance William C. Zamboni 1 Vladimir Torchilin...Frederick; and 5 NCI Nanotechnology Alliance, National Cancer Institute, Bethesda...Characterization Laboratory (NCL) is part of the Alliance for Nanotechnology in Cancer at NCI's...

Geoffrey T. Gibney and Keiran S.M. Smalley

2013-03-01T23:59:59.000Z

85

Journal of Membrane Science 256 (2005) 134142 Characterization of novel acid-stable NF membranes before and after  

E-Print Network [OSTI]

of the Negev, Beer-Sheva 84105, Israel b Department of Biotechnology and Environmental Engineering, Ben of the active layer gradually increases upon degradation, presumably due to disruption of the cross-links and/or generation of a larger number of hydrophilic groups. The change in swelling, which apparently proceeds

Freger, Viatcheslav "Slava"

86

Oncogenic EGFR Signaling Activates an mTORC2–NF-?B Pathway That Promotes Chemotherapy Resistance  

Science Journals Connector (OSTI)

...bisexual women (2-7 ). Recent research has identified a constellation of risk factors, including overweight, nulliparity, and...disease: a comparison of approaches to adjusting for total energy intake and modeling repeated dietary measurements.Am J Epidemiol...

Kazuhiro Tanaka; Ivan Babic; David Nathanson; David Akhavan; Deliang Guo; Beatrice Gini; Julie Dang; Shaojun Zhu; Huijun Yang; Jason De Jesus; Ali Nael Amzajerdi; Yinan Zhang; Christian C. Dibble; Hancai Dan; Amanda Rinkenbaugh; William H. Yong; Harry V. Vinters; Joseph F. Gera; Webster K. Cavenee; Timothy F. Cloughesy; Brendan D. Manning; Albert S. Baldwin; and Paul S. Mischel

2011-11-01T23:59:59.000Z

87

Dose-Dependent Effects of Focal Fractionated Irradiation on Secondary Malignant Neoplasms in Nf1 Mutant Mice  

Science Journals Connector (OSTI)

...Oncology, University of California, Helen Diller Family Cancer Research Building, 1450 Third Street, Room 231, San Francisco...keratinocyte stem cells and skin tumors during multi-stage mouse skin carcinogenesis.Anticancer Res...

Jean L. Nakamura; Connie Phong; Emile Pinarbasi; Scott C. Kogan; Scott Vandenberg; Andrew E. Horvai; Bruce A. Faddegon; Dorothea Fiedler; Kevan Shokat; Benjamin T. Houseman; Richard Chao; Russell O. Pieper; and Kevin Shannon

2011-01-01T23:59:59.000Z

88

On the Use of Thermal NF3 as the Fluorination and Oxidation Agent in Treatment of Used Nuclear Fuels  

SciTech Connect (OSTI)

This paper presents results of our investigation on the use of nitrogen trifluoride as the fluorination or fluorination/oxidation agent for use in a process for separating valuable constituents from used nuclear fuels by employing the volatility of many transition metal and actinide fluorides. Nitrogen trifluoride is less chemically and reactively hazardous than the hazardous and aggressive fluorinating agents used to prepare uranium hexafluoride and considered for fluoride volatility based nuclear fuels reprocessing. In addition, nitrogen trifluoride’s less aggressive character may be used to separate the volatile fluorides from used fuel and from themselves based on the fluorination reaction’s temperature sensitivity (thermal tunability) rather than relying on differences in sublimation/boiling temperature and sorbents. Our thermodynamic calculations found that nitrogen trifluoride has the potential to produce volatile fission product and actinide fluorides from candidate oxides and metals. Our simultaneous thermogravimetric and differential thermal analyses found that the oxides of lanthanum, cerium, rhodium, and plutonium fluorinated but did not form volatile fluorides and that depending on temperature volatile fluorides formed from the oxides of niobium, molybdenum, ruthenium, tellurium, uranium, and neptunium. We also demonstrated near-quantitative removal of uranium from plutonium in a mixed oxide.

Scheele, Randall D.; McNamara, Bruce K.; Casella, Andrew M.; Kozelisky, Anne E.

2012-05-01T23:59:59.000Z

89

Nmero Nome 1T 2T R1T R2T E AC NF 42200 Armando Dias  

E-Print Network [OSTI]

Baltazar Cordeiro 10.7 7.2 2 10 75285 Afonso Almeida 9.6 7.5 2 10 75314 Rodrigo Santos 7.5 7.4 6.2 2 7 75353 Gustavo Nogueira 6.3 5.5 1 3 75490 Eunice Ferreira 7.5 6.5 8.8 2 8 75686 Francisco Santos 75767 76000 Rodrigo Vaz 10.6 7.5 1 9 76085 Jorge Natividade 13.5 6.6 1 10 76103 F�bio Albuquerque 9.2 11.8 2

Baia, Margarida

90

Abstract 1545: Education of macrophages through modulation of NF-kappaB: an opportunity for targeted therapy.  

Science Journals Connector (OSTI)

...Social Science Other Other: Poster Presentations - Proffered...Center Partnership's Education and Training Program...Center Partnership has an Education and Training Program that provides cancer education and research training for...

Whitney Barham; Oleg Tikhomirov; Lianyi Chen; Ryan Ortega; Linda Gleaves; Halina Onishko; Taylor Sherrill; Linda Connelly; Timothy S. Blackwell; and Fiona E. Yull

2013-08-14T23:59:59.000Z

91

Combined Targeting of STAT3/NF-?B/COX-2/EP4 for Effective Management of Pancreatic Cancer  

Science Journals Connector (OSTI)

...distinctive aspects of their approach to screening emphasized...morbidity of screening management. Furthermore, if smaller...as other intervention approaches can be considered...NCI) State of the Science Meeting ( http...aspects of the clinical management of screen-identified...

Jingjing Gong; Jianping Xie; Roble Bedolla; Paul Rivas; Divya Chakravarthy; James W. Freeman; Robert Reddick; Scott Kopetz; Amanda Peterson; Huamin Wang; Susan M. Fischer; and Addanki P. Kumar

2014-03-01T23:59:59.000Z

92

Abstract B21: Disruption of NF?B/Stat3 interaction as a potential therapeutic avenue for pancreatic cancer management.  

Science Journals Connector (OSTI)

...Clinical and Biological Sciences, University of Torino...Stage Lung Cancer-New Approaches to Evaluation and Treatment...surgery, and basic science were presented from...prognosis, and appropriate management of screen-detected...these models. Promising approaches include gene expression...

Jingjing Gong; Jianping Xie; Izhar Batth; James W. Freeman; Divya Chakravarthy; and Addanki pratap Kumar

2012-07-15T23:59:59.000Z

93

Noscapine, a Benzylisoquinoline Alkaloid, Sensitizes Leukemic Cells to Chemotherapeutic Agents and Cytokines by Modulating the NF-?B Signaling Pathway  

Science Journals Connector (OSTI)

...Cancer Center, Houston, Texas A naturally occuring component of opium that is used...sensitizes human gliomas to taxol and radiation (11). Noscapine inhibits the...and diltiazem augment taxol and radiation-induced S-phase arrest and...

Bokyung Sung; Kwang Seok Ahn; and Bharat B. Aggarwal

2010-04-15T23:59:59.000Z

94

NMR studies of the transcriptional inhibitor I kappa B alpha and its interaction with the transcription factor NF kappa B  

E-Print Network [OSTI]

conformational ensemble of disordered proteins. In order toensemble. Although NMR studies of disordered proteins are

Cervantes, Carla F.

2010-01-01T23:59:59.000Z

95

Modeling green fluorescent protein transcription, translation and modification as a method to obtain NF-kappaB activation profiles  

E-Print Network [OSTI]

Jayaraman Committee Members, Juergen Hahn Mike McShane Head of Department, N.K. Anand August 2007 Major Subject: Chemical Engineering iii ABSTRACT Modeling Green Fluorescent Protein Transcription, Translation and Modification as a Method... my profound thanks to my advisor, Dr. Arul Jayaraman, and my committee members, Dr. Juergen Hahn and Dr. Mike McShane, for their guidance and support throughout the course of this research. I would like to extend my gratitude to Jacky Huang who...

Laible, Allyson Marie

2009-05-15T23:59:59.000Z

96

Studies of resonantly produced plasmas in the H-1NF heliac using a far-infrared scanning interferometer  

E-Print Network [OSTI]

and a typical minor radius of 0.2 m. The addition of a helical winding to the poloidal field coil allows access at half maximum of 2 cm at the plasma center. Recently, the air turbine grating drive was replaced and signal to noise ratio. We typically choose N 30. A Fourier shifting algorithm is used to correct

Howard, John

97

PTEN Is a Major Tumor Suppressor in Pancreatic Ductal Adenocarcinoma and Regulates an NF-?B–Cytokine Network  

Science Journals Connector (OSTI)

...Cruz Biotechnology), Smad4 (sc-7966; Santa Cruz Biotechnology...Signaling), IkappaBalpha (sc-371; Santa Cruz Biotechnology...the Gene Expression Omnibus website under superseries accession...Epithelial decision makers: in search of the epimmunome. Nat Immunol...

Haoqiang Ying; Kutlu G. Elpek; Anant Vinjamoori; Stephanie M. Zimmerman; Gerald C. Chu; Haiyan Yan; Eliot Fletcher-Sananikone; Hailei Zhang; Yingchun Liu; Wei Wang; Xiaojia Ren; Hongwu Zheng; Alec C. Kimmelman; Ji-hye Paik; Carol Lim; Samuel R. Perry; Shan Jiang; Brian Malinn; Alexei Protopopov; Simona Colla; Yonghong Xiao; Aram F. Hezel; Nabeel Bardeesy; Shannon J. Turley; Y. Alan Wang; Lynda Chin; Sarah P. Thayer; and Ronald A. DePinho

2011-07-01T23:59:59.000Z

98

p53-Dependent Regulation of Mitochondrial Energy Production by the RelA Subunit of NF-?B  

Science Journals Connector (OSTI)

...cell metabolism and energy production. Cancer...gradient (Sigma). Measurement of ATP levels ATP...relative luciferase units (RLU) per cell. Measurement of oxygen consumption...phosphorylation and cellular energy production, the consequences...

Renée F. Johnson; Ini-Isabée Witzel; and Neil D. Perkins

2011-08-15T23:59:59.000Z

99

NF-{kappa}B inhibits osteogenic differentiation of mesenchymal stem cells by promoting {beta}-catenin degradation  

Science Journals Connector (OSTI)

...PS-341 and histone deacetylase inhibitor synergistically induce apoptosis in...apatite-coated alginate/chitosan microparticles...PBS (control) or IKK-2 inhibitor (20 or 50 M...apatite-coated alginate/chitosan microparticles as osteogenic...

Jia Chang; Fei Liu; Min Lee; Benjamin Wu; Kang Ting; Janette N. Zara; Chia Soo; Khalid Al Hezaimi; Weiping Zou; Xiaohong Chen; David J. Mooney; Cun-Yu Wang

2013-01-01T23:59:59.000Z

100

NQO1 Suppresses NF-?B–p300 Interaction to Regulate Inflammatory Mediators Associated with Prostate Tumorigenesis  

Science Journals Connector (OSTI)

...with Prostate Tumorigenesis Dinesh Thapa 1 Peng Meng 1 Roble G...L. Reddick 2 3 Addanki P. Kumar 1 3 4 5 6 Rita Ghosh 1 3 4 5...design: D. Thapa, A.P. Kumar, R. Ghosh Development of methodology...R.L. Reddick, A.P. Kumar, R. Ghosh Analysis and interpretation...

Dinesh Thapa; Peng Meng; Roble G. Bedolla; Robert L. Reddick; Addanki P. Kumar; and Rita Ghosh

2014-10-01T23:59:59.000Z

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

QCD thermodynamics with $N_f=2+1$ near the continuum limit at realistic quark masses  

E-Print Network [OSTI]

We report on our study of QCD thermodynamics with 2+1 flavors of dynamical quarks. In this proceeding we present several thermodynamic quantities and our recent calculation of the critical temperature. In order to investigate the thermodynamic properties of QCD near the continuum limit we adopt improved staggered (p4) quarks coupled with tree-level Symanzik improved glue on $N_t=4$ and 6 lattices. The simulations are performed with a physical value of the strange quark mass and light quark masses which are in the range of $m_q/m_s=0.05-0.4$. The lightest quark mass corresponds to a pion mass of about 150 MeV.

Takashi Umeda

2006-10-03T23:59:59.000Z

102

Tumor Site–Specific Silencing of NF-?B p65 by Targeted Hollow Gold Nanosphere–Mediated Photothermal Transfection  

Science Journals Connector (OSTI)

...has a key role in regulation of mRNA stability, de novo synthesis of mRNA was blocked...expression and poor survival (5). C, bubble plot reporting the number of TUBB3...Nabors LB, et al. The ELAV RNA-stability factor HuR binds the 5-untranslated...

Wei Lu; Guodong Zhang; Rui Zhang; Leo G. Flores II; Qian Huang; Juri G. Gelovani; and Chun Li

2010-04-15T23:59:59.000Z

103

PTEN Is a Major Tumor Suppressor in Pancreatic Ductal Adenocarcinoma and Regulates an NF-?B–Cytokine Network  

Science Journals Connector (OSTI)

...Ji-hye Paik 1 2 Carol Lim 1 2 Samuel R. Perry 1 2 Shan Jiang 1 2 Brian Malinn...Chung, Y, Fukunaga, A, Nurieva, R, Pappu, B, .CCR6 regulates the migration...Crosby, K, Guimaraes, AR, Upadhyay, R, .Effective use of PI3K and MEK inhibitors...

Haoqiang Ying; Kutlu G. Elpek; Anant Vinjamoori; Stephanie M. Zimmerman; Gerald C. Chu; Haiyan Yan; Eliot Fletcher-Sananikone; Hailei Zhang; Yingchun Liu; Wei Wang; Xiaojia Ren; Hongwu Zheng; Alec C. Kimmelman; Ji-hye Paik; Carol Lim; Samuel R. Perry; Shan Jiang; Brian Malinn; Alexei Protopopov; Simona Colla; Yonghong Xiao; Aram F. Hezel; Nabeel Bardeesy; Shannon J. Turley; Y. Alan Wang; Lynda Chin; Sarah P. Thayer; and Ronald A. DePinho

2011-07-01T23:59:59.000Z

104

Bcl10 and Malt1 control lysophosphatidic acid-induced NF-{kappa}B activation and cytokine production  

Science Journals Connector (OSTI)

...determined by an ELISA DuoSet (R & D Systems, Minneapolis, MN) as recommended...23 : 561 – 574 . 12 Matsumoto R Wang D Blonska M Li H Kobayashi M Pappu B Chen Y Wang D Lin X ( 2005 ) Immunity...337 – 347 . 14 Fredriksson R Lagerstrom MC Lundin LG Schioth HB ( 2003...

Stefanie Klemm; Stephanie Zimmermann; Christian Peschel; Tak W. Mak; Jürgen Ruland

2007-01-01T23:59:59.000Z

105

Bcl10 plays a critical role in NF-{kappa}B activation induced by G protein-coupled receptors  

Science Journals Connector (OSTI)

...the MIP-2 Quantikine kit from R&D Systems (Minneapolis, MN) according...274 : 3828 – 3833 . 10 Cummings R Zhao Y Jacoby D Spannhake EW Ohba M...5184 – 5194 . 14 Matsumoto R Wang D Blonska M Li H Kobayashi M Pappu B Chen Y Wang D Lin X ( 2005 ) Immunity 23...

Donghai Wang; Yun You; Pei-Chun Lin; Liquan Xue; Stephan W. Morris; Hu Zeng; Renren Wen; Xin Lin

2007-01-01T23:59:59.000Z

106

p53-Dependent Regulation of Mitochondrial Energy Production by the RelA Subunit of NF-?B  

Science Journals Connector (OSTI)

...in tumor cell metabolism and energy production. Cancer Res; 71...Individual experiments used a mix of cells with different passage...phosphorylation and cellular energy production, the consequences...these changes by analyzing the energy-sensing protein, 5-AMP-activated...

Renée F. Johnson; Ini-Isabée Witzel; and Neil D. Perkins

2011-08-15T23:59:59.000Z

107

Subunits of the Heterotrimeric Transcription Factor NF-Y Are Imported into the Nucleus by Distinct Pathways Involving Importin ? and Importin 13  

Science Journals Connector (OSTI)

...suggest that a distinct binding platform derived from the HFM of both...accumulate against gradients of chemical activities (21, 29, 38...receptors to the preformed HMF-dimer was insignificant...suggest that a distinct binding platform derived from the HFM of both...

Joerg Kahle; Matthias Baake; Detlef Doenecke; Werner Albig

2005-07-01T23:59:59.000Z

108

Fatty Acids Isolated from Toxoplasma gondii Reduce Glycosylphosphatidylinositol-Induced Tumor Necrosis Factor Alpha Production through Inhibition of the NF-?B Signaling Pathway  

Science Journals Connector (OSTI)

...Palmitic acid crosses the macrophage plasma membrane. In all experiments, inhibitory...indicating its entrance through the plasma membrane. Thus, fatty acids were not...block the access of fatty acids to the plasma membrane or form complexes with them...

Françoise Debierre-Grockiego; Khamran Rabi; Jörg Schmidt; Hildegard Geyer; Rudolf Geyer; Ralph T. Schwarz

2007-03-26T23:59:59.000Z

109

In Silico Screening Reveals Structurally Diverse, Nanomolar Inhibitors of NQO2 That Are Functionally Active in Cells and Can Modulate NF-?B Signaling  

Science Journals Connector (OSTI)

...Nolan 1 Mark S. Dunstan 2 Mary C. Caraher 1 Katherine A. Scott 1 David Leys 2 Ian...1999;38:9881-6. 3. Nolan KA , Caraher MC, Humphries MP, Bettley HA, Bryce...Humphries MP, Barnes J, Doncaster Jr, Caraher MC, Tirelli N, et alTriazoloacridin-6-ones...

Karen A. Nolan; Mark S. Dunstan; Mary C. Caraher; Katherine A. Scott; David Leys; Ian J. Stratford

2012-01-01T23:59:59.000Z

110

C/EBP? (NF-M) Is Essential for Activation of the p20K Lipocalin Gene in Growth-Arrested Chicken Embryo Fibroblasts  

Science Journals Connector (OSTI)

...intensively investigated in cells submitted to ionizing radiations. In these conditions, the p53 tumor suppressor is...RodanIdentification of fatty acid methyl ester as naturally occuring transcriptional regulators of the members of the peroxysome...

Selena Kim; Pei-Lin Mao; Mark Gagliardi; Pierre-André Bédard

1999-08-01T23:59:59.000Z

111

Lactate Influx through the Endothelial Cell Monocarboxylate Transporter MCT1 Supports an NF-?B/IL-8 Pathway that Drives Tumor Angiogenesis  

Science Journals Connector (OSTI)

...generated from pyruvate fuels production of intracellular...Introduction Tumor cells fuel their metabolism...contribute to reduce consumption of glucose (and...vicinity of blood vessels and thereby to increase...alBoth host and graft vessels contribute to revascularization...generated from pyruvate fuels production of intracellular...

Frédérique Végran; Romain Boidot; Carine Michiels; Pierre Sonveaux; and Olivier Feron

2011-04-01T23:59:59.000Z

112

Leading-order hadronic contribution to the anomalous magnetic moment of the muon from N_f=2+1+1 twisted mass fermions  

SciTech Connect (OSTI)

We present results for the leading order QCD correction to the anomalous magnetic moment of the muon including the first two generations of quarks as dynamical degrees of freedom. Several light quark masses are examined in order to yield a controlled extrapolation to the physical pion mass. We analyse ensembles for three different lattice spacings and several volumes in order to investigate lattice artefacts and finite-size effects, respectively. We also provide preliminary results for this quantity for two flavours of mass-degenerate quarks at the physical value of the pion mass.

Burger, Florian [Humboldt U. Berlin; Feng, Xu [KEK; Hotzel, Grit [Humboldt U. Berlin; Jansen, Karl [DESY; Petschlies, Marcus [The Cyprus Institute; Renner, Dru B. [JLAB

2013-11-01T23:59:59.000Z

113

Leading-order hadronic contribution to the anomalous magnetic moment of the muon from N_f=2+1+1 twisted mass fermions  

E-Print Network [OSTI]

We present results for the leading order QCD correction to the anomalous magnetic moment of the muon including the first two generations of quarks as dynamical degrees of freedom. Several light quark masses are examined in order to yield a controlled extrapolation to the physical pion mass. We analyse ensembles for three different lattice spacings and several volumes in order to investigate lattice artefacts and finite-size effects, respectively. We also provide preliminary results for this quantity for two flavours of mass-degenerate quarks at the physical value of the pion mass.

Florian Burger; Xu Feng; Grit Hotzel; Karl Jansen; Marcus Petschlies; Dru B. Renner

2013-11-15T23:59:59.000Z

114

Involvement of the transcription factor NF-IL6 in phorbol ester induction of P-glycoprotein in U937 cells  

Science Journals Connector (OSTI)

...binding protein a expression in the gut epithelium of normal and transgenic mice. Proc. Natl. Acad. Sd. USA, 90: 8871-9975, 1993. 19. Piontkewitz, V., Enerback, S., and Hedin, L Expression and hormonal regulation of the CCMT enhancer binding...

NJ Combates; PO Kwon; RW Rzepka; D Cohen

1997-02-01T23:59:59.000Z

115

15-Deoxy-?{sup 12,14}-prostaglandin J{sub 2} inhibits IL-13 production in T cells via an NF-?B-dependent mechanism  

SciTech Connect (OSTI)

Highlights: ? 15d-PGJ{sub 2} decreased IL-13 mRNA transcription and secretion in activated T cells. ? IL-13 inhibition by 15d-PGJ{sub 2} is independent of PPAR-?. ? The nuclear factor-?B mediates the 15d-PGJ{sub 2}-dependent down regulation of IL-13. -- Abstract: Interleukin (IL)-13 is a cytokine produced by activated CD4{sup +} T cells that plays a critical role in promoting allergic responses and tumor cell growth. The 15-deoxy-?{sup 12,14}-prostaglandin J{sub 2} (15d-PGJ{sub 2}) is a natural ligand for the nuclear receptor peroxisome proliferator-activated receptor gamma (PPAR-?), a known regulator of anti-inflammatory activities. We determined the effects of 15d-PGJ{sub 2} on IL-13 expression in the Jurkat E6.1 T-cell line and in peripheral blood mononuclear cells. Semi-quantitative reverse transcription-polymerase chain reaction and enzyme-linked immunosorbent assay revealed that treatment of activated T cells with 15d-PGJ{sub 2} significantly decreased IL-13 mRNA transcription and secretion, respectively. This inhibition by 15d-PGJ{sub 2} was independent of PPAR-? since treatment with GW9662, an irreversible antagonist of the nuclear receptor, produced no effect. Our data also revealed the involvement of nuclear factor-?B in mediating 15d-PGJ{sub 2}-dependent down regulation of IL-13 expression. Collectively, these results demonstrate the potential of 15d-PGJ{sub 2} in attenuating expression and production of IL-13 in activated T cells.

Doyle, Marie-Christine; Tremblay, Sarah [Département de Biologie, Faculté des Sciences, Université de Sherbrooke, Sherbrooke (QC), Canada J1K 2R1 (Canada)] [Département de Biologie, Faculté des Sciences, Université de Sherbrooke, Sherbrooke (QC), Canada J1K 2R1 (Canada); Dumais, Nancy, E-mail: nancy.dumais@usherbrooke.ca [Département de Biologie, Faculté des Sciences, Université de Sherbrooke, Sherbrooke (QC), Canada J1K 2R1 (Canada)] [Département de Biologie, Faculté des Sciences, Université de Sherbrooke, Sherbrooke (QC), Canada J1K 2R1 (Canada)

2013-02-15T23:59:59.000Z

116

Role of the E1A Rb-binding domain in repression of the NF-?B-dependent defense against tumor necrosis factor-?  

Science Journals Connector (OSTI)

...Hung M C Yu D Crispens M A van Golen K L Price J E ( 1997 ) Clin Cancer Res 3 : 2017 – 2024...Herrmann J L Estrov Z Shao R Andreeff M Price J Paul R W Anklesaria P Yu D Hung M C...649 – 683 , 8717528 . 45 Smits P H de Wit L van der Eb A J Zantema A ( 1996 ) Oncogene...

James L. Cook; Thomas A. Walker; G. Scott Worthen; Jay R. Radke

2002-01-01T23:59:59.000Z

117

,FLY AMERICA ACT WAIVER CHECKLIST (/'0 a.rsisl in determining quclificati~nf"" a waiver ofthe restricrionS ofrhe Fly America Act  

E-Print Network [OSTI]

carrier in authorized class ofservice is unavailable. seal on foreign air carner in authorized class.) __ Use offoreign air carrier is a inatter'ofnecessity because ,of. (MlISt check onl! below) ___U.S. flag air carrier cannot provide the air transportation needed, e.g. ~ Use offoreign air carrier

Massachusetts at Amherst, University of

118

Extracellular HIV-1 Tat induces human beta-defensin-2 production via NF-kappaB/AP-1 dependent pathways in human B cells  

Science Journals Connector (OSTI)

Defensins, a family of antimicrobial peptides, are one of the first lines of host defense. Human beta-defensins (hBD) such as hBD-2 and -3 have anti-HIV activity. Previous studies have shown that HIV-1 virion can...

Sung Mi Ju; Ah Ra Goh; Dong-Joo Kwon; Gi Soo Youn; Hyung-Joo Kwon…

2012-04-01T23:59:59.000Z

119

Regulation of cytochrome P450 3A4 gene expression through modulating pregnane X receptor transcriptional activity by NF-? aryl hydrocarbon receptor and xenobiotics  

E-Print Network [OSTI]

), Uranium (U), Vanadium (V) Industrial chemicals include environmental pollutants and waste chemicals such as PBBs, PCBs, dioxins and furans, estrogens in the environment, pulp mill effluents, heavy metals, Radon and Radon decay products, Asbestos....6 Immunocytochemistry?????????.????????.??.... 66 2.7 Reporter gene assay???????????????????.??. 66 2.8 Western blot analysis???????????.???????.??.. 66 2.9 GST pull-down???????????????????????. 67 2.10 Co...

Gu, Xinsheng

2009-05-15T23:59:59.000Z

120

Phosphorylation of the ? Subunit of Eukaryotic Initiation Factor 2 Is Required for Activation of NF-?B in Response to Diverse Cellular Stresses  

Science Journals Connector (OSTI)

...that phosphorylation of eIF2a is fundamental to the process by which diverse...with DAPI mountain medium, and electronic images from the Rhodamine Red and...initiation factor 2 (eIF2) is fundamental to the process by which many stress...

Hao-Yuan Jiang; Sheree A. Wek; Barbara C. McGrath; Donalyn Scheuner; Randal J. Kaufman; Douglas R. Cavener; Ronald C. Wek

2003-08-01T23:59:59.000Z

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

CARMA3/Bcl10/MALT1-dependent NF-{kappa}B activation mediates angiotensin II-responsive inflammatory signaling in nonimmune cells  

Science Journals Connector (OSTI)

...34331 . 43 Wang D Matsumoto R You Y Che T Lin XY Gaffen SL Lin...24 : 164 – 171 . 44 Matsumoto R Wang D Blonska M Li H Kobayashi M Pappu B Chen Y Wang D Lin X ( 2005 ) Immunity...23 : 561 – 574 . 46 El Bekay R Alvarez M Monteseirin J Alba G Chacon...

Linda M. McAllister-Lucas; Jürgen Ruland; Katy Siu; Xiaohong Jin; Shufang Gu; David S. L. Kim; Peter Kuffa; Dawn Kohrt; Tak W. Mak; Gabriel Nuñez; Peter C. Lucas

2007-01-01T23:59:59.000Z

122

S:\VM3\RX97\TBL_LIST.WPD  

U.S. Energy Information Administration (EIA) Indexed Site

Million U.S. Households, 1997 Housing Unit Characteristics RSE Column Factor: Total Four Most Populated States RSE Row Factors New York California Texas Florida 0.4 1.1 1.1 1.2 1.7 Total .............................................................. 101.5 6.8 11.5 7.0 5.9 NF Census Region and Division Northeast ..................................................... 19.7 6.8 -- -- -- NF New England ............................................. 5.3 Q -- -- -- NF Middle Atlantic ........................................... 14.4 6.8 -- -- -- NF Midwest ....................................................... 24.1 -- -- -- -- NF East North Central ..................................... 16.9 -- -- -- -- NF West North Central .................................... 7.2 -- -- -- -- NF South ...........................................................

123

A Novel Mutation within the Central Listeria monocytogenes Regulator PrfA That Results in Constitutive Expression of Virulence Gene Products  

Science Journals Connector (OSTI)

...containing an integrated copy of WT prfA [WTi]), NF-L1011 (containing an integrated...addition, in contrast to NF-L1041 (prfA WTi) or NF-L1042 (prfA L147Pi), the NF-L1011...in the control strain NF-L1041 (prfA WTi) (Fig. 3A). Interestingly, no PrfA...

Kendy K. Y. Wong; Nancy E. Freitag

2004-09-01T23:59:59.000Z

124

Interplay Between Liquid Crystalline And Isotropic Gels in Self-Assembled Neurofilament Networks  

SciTech Connect (OSTI)

Neurofilaments (NFs) are a major constituent of nerve cell axons that assemble from three subunit proteins of low (NF-L), medium (NF-M), and high (NF-H) molecular weight into a 10nm diameter rod with radiating sidearms to form a bottle-brush-like structure. Here, we reassemble NFs in vitro from varying weight ratios of the subunit proteins, purified from bovine spinal cord, to form homopolymers of NF-L or filaments composed of NF-L and NF-M (NF-LM), NF-L and NF-H (NF-LH), or all three subunits (NF-LMH). At high protein concentrations, NFs align to form a nematic liquid crystalline gel with a well-defined spacing determined with synchrotron small angle x-ray scattering. Near physiological conditions (86mM monovalent salt and pH 6.8), NF-LM networks with a high NF-M grafting density favor nematic ordering whereas filaments composed of NF-LH transition to an isotropic gel at low protein concentrations as a function of increasing mole fraction of NF-H subunits. The interfilament distance decreases with NF-M grafting density, opposite the trend seen with NF-LH networks. This suggests a competition between the more attractive NF-M sidearms, forming a compact aligned nematic gel, and the repulsive NF-H sidearms, favoring a more expansive isotropic gel, at 86mM monovalent salt. These interactions are highly salt dependent and the nematic gel phase is stabilized with increasing monovalent salt.

Jones, J.B.; Safinya, C.R.

2009-05-18T23:59:59.000Z

125

Arabidopsis DPB3-1, a DREB2A Interactor, Specifically Enhances Heat Stress-Induced Gene Expression by Forming a Heat Stress-Specific Transcriptional Complex with NF-Y Subunits  

Science Journals Connector (OSTI)

...Graduate School of Agricultural and Life Sciences, University of Tokyo, Tokyo 113-8657...International Research Center for Agricultural Sciences, Tsukuba 305-8686, Japan c RIKEN Center for Sustainable Resource Science, Tsurumi-ku, Yokohama 230-0045...

Hikaru Sato; Junya Mizoi; Hidenori Tanaka; Kyonosin Maruyama; Feng Qin; Yuriko Osakabe; Kyoko Morimoto; Teppei Ohori; Kazuya Kusakabe; Maika Nagata; Kazuo Shinozaki; Kazuko Yamaguchi-Shinozaki

2014-12-09T23:59:59.000Z

126

Arabidopsis DPB3-1, a DREB2A Interactor, Specifically Enhances Heat Stress-Induced Gene Expression by Forming a Heat Stress-Specific Transcriptional Complex with NF-Y Subunits  

Science Journals Connector (OSTI)

...figures in this article are displayed in color online but in black and white in the print edition. [W] Online version contains Web-only data. The DNA polymerase II subunit B3-1 interacts with DEHYDRATION-RESPONSIVE ELEMENT BINDING PROTEIN2A and NUCLEAR...

Hikaru Sato; Junya Mizoi; Hidenori Tanaka; Kyonosin Maruyama; Feng Qin; Yuriko Osakabe; Kyoko Morimoto; Teppei Ohori; Kazuya Kusakabe; Maika Nagata; Kazuo Shinozaki; Kazuko Yamaguchi-Shinozaki

2014-12-09T23:59:59.000Z

127

Abstract 3400: Integrated functional RNAi screening and structural genomics identifies inverse co-modulators of TP53 family and NF-kB transitional activation as potential therapeutic targets in head and neck squamous cell carcinoma  

Science Journals Connector (OSTI)

...Tumor Cell and Molecular Biology Genomics CTRC-AACR San Antonio Breast Cancer...Symposium: 2008 Abstracts UCSC cancer genomics browser. J Zhu 1 JZ Sanborn 1 T...technology platforms. The UCSC Cancer Genomics Browser is a suite of web-based...

Anthony D. Saleh; Shaleeka Cornelius; Hui Cheng; Scott Martin; Pinar Ormanoglu; Xinping Yang; Zhong Chen; Carter VanWaes

2014-10-01T23:59:59.000Z

128

$ TfTiT7(TvJ/f^ Ris-M-2756 |g u w i i ^ i y / ntCtfCVW-D'""""  

E-Print Network [OSTI]

", G. Aeppli: "Muons, neutrons and superconductivity", N.F. Pedersen: "The Josephson junction", CVITY .... C. Aeppli THE JOSEPHSON JUNCTION N.F. Pedersen PHYSICOCHEMISTRY OF HIGH Tc SUPERCONDUCTORS C

129

The effect of continuous, broad-band random noise, both alone and in combination with a food odor on the lemon shark, Negaprion brevirostris  

E-Print Network [OSTI]

parentheses) of that period in hours. 1878 (11) NFR FU SS8 (3) N NF FU 724 (12) NFs NF 490 (12) NF NF Fi C-1 FO C-2 RN8 FO 689 (30) NFg NF 2368 (28) NFq FU 2393 (12) N NF2 FU C-3 NF I RN NF, C-4 FIG. 6. Experiment ll2. Circular..." of the hourly response (see text). + = significance at n * = significance at o ; f = significance at a 400 1&IFOII CR QQN&FOHI ? C4~~RN ? I~C2? W 250 9 200 |50 Z 50 40 50 50 0 80 90 100 1 0 HOURS 37 exception (exp. 112, RN&FO). It should be noted...

Jones, Keith Anthony

2012-06-07T23:59:59.000Z

130

Exercise training reverses age-induced inducible nitric oxide synthase upregulation  

E-Print Network [OSTI]

(SOL) ................................................................................37 5 iNOS activity in soleus (SOL) and white gastrocnemius (WG) .............................38 6 Total NOS activity in soleus (SOL) and white... gastrocnemius (WG).....................39 7 NF-? B DNA binding activity in white gastrocnemius (WG) .................................40 8 NF-? B DNA binding activity in soleus (SOL)........................................................41 9 NF...

Song, Wook

2005-02-17T23:59:59.000Z

131

Mercury-Related Materials Studies  

E-Print Network [OSTI]

. Pawel, "Assessment of Cavitation-Erosion Resistance of Potential Pump Impeller Materials for MercuryMercury-Related Materials Studies Van Graves IDS NF Ph M tiIDS-NF Phone Meeting Jan 26, 2010 ­ updated Feb 3, 2010 #12;ORNL Material Reports Reviewed · IDS-NF requested ORNL research any past SNS

McDonald, Kirk

132

Expressions of Nuclear Factor ?B, Inducible Nitric Oxide Synthase, and Vascular Endothelial Growth Factor in Adenoid Cystic Carcinoma of Salivary Glands: Correlations with the Angiogenesis and Clinical Outcome  

Science Journals Connector (OSTI)

...microscopy (Olympus, Tokyo, Japan). NF-kappaB staining...or nucleus, and the nuclear localization of NF-kappaB...expression. The rate of the nuclear localization of p65 was...by counting positive nuclear staining NF-kappaB...randomly selected high-power fields (200). iNOS...

Jiali Zhang; Bin Peng; and Xinming Chen

2005-10-15T23:59:59.000Z

133

Application of different TL detectors for the photon dosimetry in mixed radiation fields used for BNCT  

Science Journals Connector (OSTI)

......response ratio of such a pair at the Geesthacht Neutron Facility (GeNF) operated by...reference field, operated by PTB at the Geesthacht Neutron Facility (GeNF)(4) and...response ratio of such a pair at the Geesthacht Neutron Facility (GeNF) operated by......

B. Burgkhardt; P. Bilski; M. Budzanowski; R. Böttger; K. Eberhardt; G. Hampel; P. Olko; A. Straubing

2006-09-01T23:59:59.000Z

134

MSC p43 required for axonal development in motor neurons  

Science Journals Connector (OSTI)

...ZZQQhyNF-L ZZQQhyhead, pGilda ZZQQhyNF-L ZZQQhyrod, or pGilda ZZQQhyNF-L ZZQQhytail. Col-onies grown on His/ Trp m edia were dotted onto a yeast peptone dextrose plate for-galactosidase assay. Colony-lifting assays for-galactosidase expression...

Xiaodong Zhu; Yang Liu; Yanqing Yin; Aiyun Shao; Bo Zhang; Sunghoon Kim; Jiawei Zhou

2009-01-01T23:59:59.000Z

135

Table HC1-12a. Housing Unit Characteristics by West Census Region,  

U.S. Energy Information Administration (EIA) Indexed Site

2a. Housing Unit Characteristics by West Census Region, 2a. Housing Unit Characteristics by West Census Region, Million U.S. Households, 2001 Housing Unit Characteristics RSE Column Factor: Total U.S. West Census Region RSE Row Factors Total Census Division Mountain Pacific 0.5 1.0 1.7 1.1 Total .............................................................. 107.0 23.3 6.7 16.6 NE Census Region and Division Northeast ..................................................... 20.3 -- -- -- NF New England ............................................. 5.4 -- -- -- NF Middle Atlantic ........................................... 14.8 -- -- -- NF Midwest ....................................................... 24.5 -- -- -- NF East North Central ..................................... 17.1 -- -- -- NF West North Central ....................................

136

Effects of a chiral three-nucleon force on nucleus-nucleus scattering  

E-Print Network [OSTI]

We investigate the effects of chiral NNLO three-nucleon force (3NF) on nucleus-nucleus elastic scattering, using a standard prescription based on the Brueckner-Hartree-Fock method and the g-matrix folding model. The g-matrix calculated in nuclear matter from the chiral N3LO two-nucleon forces (2NF) is close to that from the Bonn-B 2NF. Because the Melbourne group have already developed a practical g-matrix interaction by localizing the nonlocal g-matrix calculated from the Bonn-B 2NF, we consider the effects of chiral 3NF, in this first attempt to study the 3NF effects, by modifying the local Melbourne g-matrix according to the difference between the g-matrices of the chiral 2NF and 2NF+3NF. For nucleus-nucleus elastic scattering, the 3NF corrections make the folding potential less attractive and more absorptive. The latter novel effect is due to the enhanced tensor correlations in triplet channels. These changes reduce the differential cross section at the middle and large angles, improving the agreement wit...

Minomo, Kosho; Kohno, Michio; Yahiro, Masanobu

2014-01-01T23:59:59.000Z

137

Broadband RF Front-End Design for Multi-Standard Receiver with High-Linearity and Low-Noise Techniques  

E-Print Network [OSTI]

. gm,CS and Vov,bias scaling at RCG = 200, RCS = 200/n, and ? = 43 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57 35 NF vs. AV,CS at ? = 43 and Vov,bias Vov,CG = 1. . . . . . . . . . . . . . . . . . 59 36 Balun...-LNA. . . . . . . . . . . . . . . . . . . . 64 39 Simulated S11 and S21. . . . . . . . . . . . . . . . . . . . . . . . . . . 65 40 Simulated power gain (S21) and voltage gain (AV ) of Balun-LNA core. 65 41 Simulated NF and NF of balun-LNA core versus frequency. . . . . . 66 42 Simulated IIP...

Kim, Ju Sung

2012-02-14T23:59:59.000Z

138

Life-cycle Assessment of Semiconductors  

E-Print Network [OSTI]

nm node 120 nm kg/wafer GWG CF4 CHF3 C2F6 CH4 CO2 NF3 C4F6120 nm node 90nm kg/wafer GWG CF4 CHF3 C2F6 CH4 CO2 NF3 C4F690 nm node 65 nm kg/wafer GWG CF4 CHF3 C2F6 CH4 CO2 NF3 C4F6

Boyd, Sarah B.

2009-01-01T23:59:59.000Z

139

Nucleon generalized form factors with twisted mass fermions  

E-Print Network [OSTI]

We present results on the nucleon form factors, momentum fraction and helicity moment for $N_f=2$ and $N_f=2+1+1$ twisted mass fermions for a number of lattice volumes and lattice spacings. First results for a new $N_f=2$ ensemble at the physical pion mass are also included. The implications of these results on the spin content of the nucleon are discussed taking into account the disconnected contributions at one pion mass.

C. Alexandrou; M. Constantinou; V. Drach; K. Jansen; Ch. Kallidonis; G. Koutsou

2013-12-10T23:59:59.000Z

140

Table HC1-11a. Housing Unit Characteristics by South Census Region,  

U.S. Energy Information Administration (EIA) Indexed Site

1a. Housing Unit Characteristics by South Census Region, 1a. Housing Unit Characteristics by South Census Region, Million U.S. Households, 2001 Housing Unit Characteristics RSE Column Factor: Total U.S. South Census Region RSE Row Factors Total Census Division South Atlantic East South Central West South Central 0.5 0.9 1.2 1.4 1.4 Total .............................................................. 107.0 38.9 20.3 6.8 11.8 NE Census Region and Division Northeast ..................................................... 20.3 -- -- -- -- NF New England ............................................. 5.4 -- -- -- -- NF Middle Atlantic ........................................... 14.8 -- -- -- -- NF Midwest ....................................................... 24.5 -- -- -- -- NF East North Central .....................................

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Dartmouth College HANOVER NEW HAMPSHIRE 03755-3586 Office of Pluralism and Leadership, Native American Program  

E-Print Network [OSTI]

_campaign=DartmouthNAP&utm_content=157886900294782 976&ref=nf Registrar's Office Link to the ORC http://dartmouth.smartcatalogiq.com/2012/orc

142

Schutzhelme und Sicherheitswesten fr Arbeiten an Deck Hard tops and life vests for work deck  

E-Print Network [OSTI]

Impuls und Wärme. Während das Schiff sich langsam dem Eishindernis näherte, wurde jeweils in fünf Höhen

Meissner, Katrin Juliane

143

NVN-079667 | Open Energy Information  

Open Energy Info (EERE)

Case Status Authorized Case Type GEOLSENONCOMPPRE2005 Total Acreage 1920 Bid PriceAcre Managing Field Office none provided Surface Manager TOIYABE NF Lessee 1 GRADIENT...

144

NVN-079292 | Open Energy Information  

Open Energy Info (EERE)

Case Status Authorized Case Type GEOLSENONCOMPPRE2005 Total Acreage 1980.23 Bid PriceAcre Managing Field Office none provided Surface Manager TOIYABE NF Lessee 1 GRADIENT...

145

NVN-079307 | Open Energy Information  

Open Energy Info (EERE)

Case Status Authorized Case Type GEOLSENONCOMPPRE2005 Total Acreage 1280 Bid PriceAcre Managing Field Office none provided Surface Manager TOIYABE NF Lessee 1 GRADIENT...

146

NVN-080159 | Open Energy Information  

Open Energy Info (EERE)

(section) Case Status Authorized Case Type GEOLEASENONCOMPETITI Total Acreage 640 Bid PriceAcre Managing Field Office none provided Surface Manager TOIYABE NF Lessee 1 NGP BLUE...

147

UTU-085605 | Open Energy Information  

Open Energy Info (EERE)

Case Status Authorized Case Type GEOLSECOMPPOST2005 Total Acreage 2441.53 Bid PriceAcre Managing Field Office none provided Surface Manager FISHLAKE NF Lessee 1 ENEL...

148

NVN-077646 | Open Energy Information  

Open Energy Info (EERE)

Acres) Case Status Authorized Case Type GEOLSENONCOMPPRE2005 Total Acreage 80 Bid PriceAcre Managing Field Office none provided Surface Manager TOIYABE NF Lessee 1 GRADIENT...

149

NVN-079662 | Open Energy Information  

Open Energy Info (EERE)

Case Status Authorized Case Type GEOLSENONCOMPPRE2005 Total Acreage 1324 Bid PriceAcre Managing Field Office none provided Surface Manager TOIYABE NF Lessee 1 GRADIENT...

150

Control of size and charge selectivity in amphiphilic graft copolymer nanofiltration membranes  

E-Print Network [OSTI]

The throughput and efficiency of membrane separations make polymer filtration membranes an important resource for the pharmaceutical, food and wastewater treatment industries. Nanofiltration (NF) membranes fill an important ...

Lovell, Nathan Gary

2010-01-01T23:59:59.000Z

151

E-Print Network 3.0 - anticarcinogenic enzyme inducers Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

upstream of NF-kB-inducing kinase (NIK), an enzyme which... , such as those present in green tea have been shown to exhibit cardioprotective and anticarcinogenic effects......

152

Forschung mit Photonen Forschung mit Photonen  

E-Print Network [OSTI]

and GKSS GeNF SANS1 06 http://dx.doi.org/10.1021/ja072725 M.N. ANTIPINA, I. SCHULZE, B. DOBNER, A. LANGNER

153

MINISTRIO DA EDUCAO UNIVERSIDADE FEDERAL DO PARAN  

E-Print Network [OSTI]

projetado para a medicao de indice de refracao (nD) e da dispersao optica media (NF-NC) da transparencia, ou

Paraná, Universidade Federal do

154

E-Print Network 3.0 - acute fetal hypoxia Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

70 mmHg) in developing larvae... investigated. The results revealed two distinct response patterns to acute hypoxia in "early" (NF stages 45... to acute hypoxia with a...

155

E-Print Network 3.0 - anti-infective protective properties Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Immediate Past... petussis vaccine that is used to protect people from whooping cough. Ref: P Emsley, IG Charles , NF Source: Baird, Mark - Climate and Environmental...

156

E-Print Network 3.0 - ankyrin-repeat membrane protein Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

10 Stabilizing IB by "Consensus" Design Diego U. Ferreiro1,3 Summary: Keywords: protein folding; ankyrin repeat protein; NF-B; transcription factor; repeat protein...

157

E-Print Network 3.0 - ankyrin protein networks Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

>> 21 Stabilizing IB by "Consensus" Design Diego U. Ferreiro1,3 Summary: Keywords: protein folding; ankyrin repeat protein; NF-B; transcription factor; repeat protein...

158

Desalination of Brackish Water Using Nanofiltration: Performance Comparison of Different Membranes  

Science Journals Connector (OSTI)

Characterization and performance screening of NF membranes are essential to evaluate their suitability for application in brackish water desalination. In this study, two commercial and two fabricated nanoparti...

A. A. Abuhabib; Mostafa Ghasemi…

2013-11-01T23:59:59.000Z

159

Parallel comparison of accuracy of API 20E, Vitek GNI, MicroScan Walk/Away Rapid ID, and Becton Dickinson Cobas Micro ID-E/NF for identification of members of the family Enterobacteriaceae and common gram-negative, non-glucose-fermenting bacilli.  

Science Journals Connector (OSTI)

...were purchased. Quality control for each system was performed...information relating to the cost of iden- tification per...systems. While there is no capital investment in equipment...A and Vitek systems cost $120,000.00, and...and set up and then load 10 panels. The additional...

C M O'Hara; F C Tenover; J M Miller

1993-12-01T23:59:59.000Z

160

Dynamics and control of ELM-like events using a diffusive running sandpile model  

E-Print Network [OSTI]

et al, Nuclear Fusion 41, 247 (2001)Slope Cell x t - D0 ( Zc - N F ) S0 Z = -Zc + NF 2 Z = - Zc SOC continuous input of free energy to allow for shear-suppression to be activated: substitute the transfer of NF

Martín-Solís, José Ramón

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Mercury-Related Materials Studies  

E-Print Network [OSTI]

Mercury-Related Materials Studies Van Graves IDS NF Ph M tiIDS-NF Phone Meeting Jan 26, 2010 #12 Evaluation of Cavitation Resistance of Type 316LN Stainless Steel in Mercury Using a Vibratory Horn," J. Nucl Pump Impeller Materials for Mercury Service at the Spallation Neutron Source," Oak Ridge National

McDonald, Kirk

162

Antiviral Activity of Trappin-2 and Elafin In Vitro and In Vivo against Genital Herpes  

Science Journals Connector (OSTI)

...significance indicated in the graphs. In panels C and D...immunofluorescence analysis of IRF3 nuclear translocation is demonstrated...cytokines and have reduced nuclear translocation of NF-kappaB...significance indicated in graphs. In panels D, E, and...NF-kappaB p65 subunit nuclear translocation is demonstrated...

Anna G. Drannik; Kakon Nag; Jean-Michel Sallenave; Kenneth L. Rosenthal

2013-05-01T23:59:59.000Z

163

Abstract 4204: Chronic ultraviolet radiation exposure of mouse skin activates GATA and PAX families of transcription factors, which regulate expression of cell survival genes  

Science Journals Connector (OSTI)

...9/10, PAX-4, LH-2/lim-1, NF-4FA, NCAM BP, WTI, E12, EBP40/45, CEA, MUSF) were activated compared to...CTCF, MyoD, KBF-A, PPAR, HOXD9/10, Myb, RSRFC4, PYR, WTI, MZF, SAA, COUP-TF, CCAC, EGR, E2F-1, NF-E1/YY-1...

Mohammad S. Jamal; Bilal B. Hafeez; Ajit K. Verma

2011-04-15T23:59:59.000Z

164

Noise Suppression using a Perceptual Model for Wideband Speech Signals Joachim Thiemann  

E-Print Network [OSTI]

is derived from a method devel- oped by Soulodre [2] to remove camera noise from film soundtracks. Soulodre[n, p] (where p denotes the frame counter) is windowed by a window obtained from the square root of the Hann window, defined by h[n] = 1 2 1 - cos 2 n + 0.5 NF , (1) where n = 0, . . . , NF - 1. The f

Kabal, Peter

165

Communicating oscillatory networks: Frequency Domain Analysis  

E-Print Network [OSTI]

oscillatory mode of NF-#1;Bn, at about 0.01 cycles per minute, is an order of magnitude lower than the peak corresponding to its transient. This perhaps explains why we find that the oscillatory mode of NF- #1;Bn is less apparent in those species of the cell...

Ihekwaba, Adaoha E C; Sedwards, Sean

2011-12-22T23:59:59.000Z

166

Antiviral Activity of Trappin-2 and Elafin In Vitro and In Vivo against Genital Herpes  

Science Journals Connector (OSTI)

...TNF-alpha) and decreased NF-kappaB nuclear translocation. Additionally, protected...interferon regulatory factor 3 (IRF3) nuclear translocation and increased antiviral...CA) (1:500) was used to detect nuclear translocation of NF-kappaB p65; gD...

Anna G. Drannik; Kakon Nag; Jean-Michel Sallenave; Kenneth L. Rosenthal

2013-05-01T23:59:59.000Z

167

UNIVERSIT D'ANGERS Anne 2008 N d'ordre 897  

E-Print Network [OSTI]

a technico-economical study comparing RO and NF processes for Tan Tan brackish water (4 g.L-1 ) desalination2009 #12;Abstract A competing membrane process to Reverse Osmosis (RO) for brackish water desalination for brackish water desalination is of a good relevance. In order to predict and compare NF and RO membranes

Paris-Sud XI, Université de

168

Nuclear Factor-KB Dimer Exchange Promotes a p21waf1/cip1 Superinduction Response in Human T Leukemic Cells  

E-Print Network [OSTI]

Nuclear Factor-KB Dimer Exchange Promotes a p21waf1/cip1 Superinduction Response in Human ability to induce p21waf1/cip1 . Here, we provide evidence that sequential NF-KB-activating signals induce heightened NF-KB DNA binding and p21waf1/cip1 induction in CEM and additional T leukemic cell lines

Miyamoto, Shigeki

169

Topological susceptibility from twisted mass fermions using spectral projectors  

E-Print Network [OSTI]

We discuss the computation of the topological susceptibility using the method of spectral projectors and dynamical twisted mass fermions. We present our analysis concerning the O(a)-improvement of the topological susceptibility and we show numerical results for Nf=2 and Nf=2+1+1 flavours, performing a study of the quark mass dependence in terms of leading order chiral perturbation theory.

Krzysztof Cichy; Elena Garcia-Ramos; Karl Jansen; Andrea Shindler

2013-12-12T23:59:59.000Z

170

Dr. Pete's useful stuff College Physics I*  

E-Print Network [OSTI]

/nelson Hooke's Law & SHM Friction NfNf kkss µµ = kineticstatic Gravitation Quadratic functions ax2 + bx + c = 0 Momentum im= = p v P p rr rr Conservation laws for an isolated system i f i fE E P P= = simple pendulum k g

Nelson, Peter Hugo

171

ROCKY MOUNTAIN JOURNAL OF MATHEMATICS  

E-Print Network [OSTI]

factors of i = 1,...,t, j = 1,...,n-1, by n, we have nfAjm+i = (jmnf +nif -nf +n).-.(jmnf +nif) = (.(if - f +1) -j)...(nif - j) (modp), so that Multiplying both sides of this congruence by Bn = n(2n) .(tf n

Williams, Kenneth Stuart

172

Some results in the theory of genuine representations of the ...  

E-Print Network [OSTI]

of eigen functionals corresponding to ?. Theorem E. Let ? be smooth .... Sp2n(F) be the semi-direct product corresponding to this action. ..... enables the extension of c(·,·) to a 2-cocycle ˜c(·,·) on GSp2n(F) which takes values in {±1}: We define ...

2013-04-21T23:59:59.000Z

173

Table HC1-9a. Housing Unit Characteristics by Northeast Census Region,  

U.S. Energy Information Administration (EIA) Indexed Site

9a. Housing Unit Characteristics by Northeast Census Region, 9a. Housing Unit Characteristics by Northeast Census Region, Million U.S. Households, 2001 Housing Unit Characteristics RSE Column Factor: Total U.S. Northeast Census Region RSE Row Factors Total Census Division Middle Atlantic New England 0.5 1.0 1.2 1.6 Total .............................................................. 107.0 20.3 14.8 5.4 NE Census Region and Division Northeast ..................................................... 20.3 20.3 14.8 5.4 NF New England ............................................. 5.4 5.4 Q 5.4 NF Middle Atlantic ........................................... 14.8 14.8 14.8 Q NF Midwest ....................................................... 24.5 -- -- -- NF East North Central ..................................... 17.1 -- -- -- NF

174

Property:SurfaceManager | Open Energy Information  

Open Energy Info (EERE)

SurfaceManager SurfaceManager Jump to: navigation, search Property Name SurfaceManager Property Type Page Pages using the property "SurfaceManager" Showing 25 pages using this property. (previous 25) (next 25) A AZA-009168 + COCONINO NF + AZA-009169 + COCONINO NF + AZA-009170 + COCONINO NF + AZA-009171 + FOREST SERVICE + AZA-009172 + FOREST SERVICE + AZA-009173 + FOREST SERVICE + AZA-009174 + FOREST SERVICE + AZA-009175 + COCONINO NF + AZA-009176 + BUREAU OF LAND MGMT + AZA-009177 + FOREST SERVICE + AZA-009178 + FOREST SERVICE + AZA-009179 + FOREST SERVICE + AZA-009180 + FOREST SERVICE + AZA-009181 + FOREST SERVICE + AZA-009182 + FOREST SERVICE + AZA-009183 + FOREST SERVICE + AZA-009184 + FOREST SERVICE + AZA-009185 + FOREST SERVICE + AZA-009186 + COCONINO NF +

175

Roles of chiral three-nucleon forces in nucleon-nucleus scattering  

E-Print Network [OSTI]

We investigate the roles of chiral three-nucleon force (3NF) in nucleon-nucleus elastic scattering, using the standard framework based on the Brueckner-Hartree-Fock method for nuclear matter and the $g$-matrix folding model for the nucleon-nucleus scattering. In nuclear matter, chiral 3NF at NNLO level (mainly the 2$\\pi$-exchange diagram) makes the single particle potential less attractive for the singlet-even channel and more absorptive for the triplet channels. The single-particle potential calculated from chiral two-nucleon force (2NF) at N$^{3}$LO level is found to be close to that from Bonn-B 2NF. The Melbourne $g$-matrix interaction is a practical effective interaction constructed by localizing the $g$-matrices calculated from Bonn-B 2NF. We then introduce the chiral-3NF effects to the local Melbourne $g$-matrix interaction. For nucleon-nucleus elastic scattering on various targets at 65 MeV, chiral 3NF makes the folding potential less attractive and more absorptive. The novel property for the imaginary...

Toyokawa, Masakazu; Kohno, Michio; Yahiro, Masanobu

2014-01-01T23:59:59.000Z

176

Influence of the Torsion Angle in 3,3'-Dimethyl-2,2'-bipyridine on the Intermediate Valence of Yb in (C5Me5)2 Yb(3,3'-Me2-bipy)  

SciTech Connect (OSTI)

The synthesis and X-ray crystal structures of Cp-2*Yb(3,3'-Me(2)bipy) and [Cp-2 Yb(3,3'-Me(2)bipy)][Cp-2 YbCl1.6I0.4]center dot CH2Cl2 are described. In both complexes, the NCCN torsion angles are approximately 40 degrees. The temperature-independent value of n(f) of 0.17 shows that the valence of ytterbium in the neutral adduct is multiconfigurational, in reasonable agreement with a CASSCF calculation that yields a n(f) value of 0.27; that is, the two configurations in the wave function are f(13)(pi(1))(1) and f(14)(pi(1))(0) in a ratio of 0.27:0.73, respectively, and the open-shell singlet lies 0.28 eV below the triplet state (n(f) accounts for f-hole occupancy; that is, n(f) = 1 when the configuration is f(13) and n(f) = 0 when the configuration is f(14)). A correlation is outlined between the value of nf and the individual ytterbocene and bipyridine fragments such that, as the reduction potentials of the ytterbocene cation and the free x,x'-R-2-bipy ligands approach each other, the value of nf and therefore the f(13):f(14) ratio reaches a maximum; conversely, the ratio is minimized as the disparity increases.

Nocton, Gr& #233; gory; Booth, Corwin H.; Maron, Laurent; Andersen, Richard A.

2014-06-26T23:59:59.000Z

177

Activation of the canonical nuclear factor-?B pathway is involved in isoflurane-induced hippocampal interleukin-1? elevation and the resultant cognitive deficits in aged rats  

SciTech Connect (OSTI)

Highlights: •Isoflurane induces hippocampal IL-1? elevation and cognitive deficits in aged rats. •Isoflurane transiently activates the canonical NF-?B pathway in aged rat hippocampus. •NF-?B inhibitor mitigates isoflurane-induced IL-1? elevation and cognitive deficits. •We report a linkage between NF-?B signaling, IL-1? expression, and cognitive changes. -- Abstract: Although much recent evidence has demonstrated that neuroinflammation contributes to volatile anesthetic-induced cognitive deficits, there are few existing mechanistic explanations for this inflammatory process. This study was conducted to investigate the effects of the volatile anesthetic isoflurane on canonical nuclear factor (NF)-?B signaling, and to explore its association with hippocampal interleukin (IL)-1? levels and anesthetic-related cognitive changes in aged rats. After a 4-h exposure to 1.5% isoflurane in 20-month-old rats, increases in I?B kinase and I?B phosphorylation, as well as a reduction in the NF-?B inhibitory protein (I?B?), were observed in the hippocampi of isoflurane-exposed rats compared with control rats. These events were accompanied by an increase in NF-?B p65 nuclear translocation at 6 h after isoflurane exposure and hippocampal IL-1? elevation from 1 to 6 h after isoflurane exposure. Nevertheless, no significant neuroglia activation was observed. Pharmacological inhibition of NF-?B activation by pyrrolidine dithiocarbamate markedly suppressed the IL-1? increase and NF-?B signaling, and also mitigated the severity of cognitive deficits in the Morris water maze task. Overall, our results demonstrate that isoflurane-induced cognitive deficits may stem from upregulation of hippocampal IL-1?, partially via activation of the canonical NF-?B pathway, in aged rats.

Li, Zheng-Qian; Rong, Xiao-Ying; Liu, Ya-Jie; Ni, Cheng [Department of Anesthesiology, Peking University Third Hospital, Beijing 100191 (China)] [Department of Anesthesiology, Peking University Third Hospital, Beijing 100191 (China); Tian, Xiao-Sheng [Neuroscience Research Institute and Department of Neurobiology, Key Laboratory for Neuroscience, Ministry of Education and Ministry of Public Health, Peking University Health Science Center, Beijing 100191 (China)] [Neuroscience Research Institute and Department of Neurobiology, Key Laboratory for Neuroscience, Ministry of Education and Ministry of Public Health, Peking University Health Science Center, Beijing 100191 (China); Mo, Na [Cancer Institute and Hospital, Chinese Academy of Medical Sciences, Beijing 100021 (China)] [Cancer Institute and Hospital, Chinese Academy of Medical Sciences, Beijing 100021 (China); Chui, De-Hua, E-mail: dchui@bjmu.edu.cn [Neuroscience Research Institute and Department of Neurobiology, Key Laboratory for Neuroscience, Ministry of Education and Ministry of Public Health, Peking University Health Science Center, Beijing 100191 (China)] [Neuroscience Research Institute and Department of Neurobiology, Key Laboratory for Neuroscience, Ministry of Education and Ministry of Public Health, Peking University Health Science Center, Beijing 100191 (China); Guo, Xiang-Yang, E-mail: puthmzk@163.com [Department of Anesthesiology, Peking University Third Hospital, Beijing 100191 (China)] [Department of Anesthesiology, Peking University Third Hospital, Beijing 100191 (China)

2013-09-06T23:59:59.000Z

178

Table HC1-10a. Housing Unit Characteristics by Midwest Census Region,  

U.S. Energy Information Administration (EIA) Indexed Site

0a. Housing Unit Characteristics by Midwest Census Region, 0a. Housing Unit Characteristics by Midwest Census Region, Million U.S. Households, 2001 Housing Unit Characteristics RSE Column Factor: Total U.S. Midwest Census Region RSE Row Factors Total Census Division East North Central West North Central 0.5 1.0 1.2 1.8 Total .............................................................. 107.0 24.5 17.1 7.4 NE Census Region and Division Northeast ..................................................... 20.3 -- -- -- NF New England ............................................. 5.4 -- -- -- NF Middle Atlantic ........................................... 14.8 -- -- -- NF Midwest ....................................................... 24.5 24.5 17.1 7.4 NF East North Central ..................................... 17.1 17.1

179

SIViP (2010) 4:319329 DOI 10.1007/s11760-009-0122-7  

E-Print Network [OSTI]

by the U.S. Army Research Office under Grant No. W911NF-07-1-0376, and by NASA under Cooperative Agreement in diverse applications (e.g., elect

Ray, Asok

180

E-Print Network 3.0 - acute arterial injury Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

flow Summary: -mediated dilation was improved by an acute antioxidant (tempol) in NF and HF arteries from ZDF rats (no effect in LZ... catalyzes the transformation of ROS into H2O2...

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Indoor Air Quality in 24 California Residences Designed as High Performance Green Homes  

E-Print Network [OSTI]

quality in southeastern U.S. homes. Paper presented at thehighly energy efficient homes—A review No. NF18. Amersham,of energy-efficiency in homes. Environment International, 8(

Less, Brennan

2012-01-01T23:59:59.000Z

182

appl_household2001.pdf  

Gasoline and Diesel Fuel Update (EIA)

Q Q 31.0 2 or More ... Q Q Q Q Q NF Other Appliances Automobile BlockEngine Battery Heater ... 0.5 0.3 Q 0.1 Q 37.2...

183

E-Print Network 3.0 - alpha pparalpha protects Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

GTTTTGCTTTCTCAGATCTT GGC P h PPAR-alpha... G 6.83 1.21 + L15702 Complement factor B CFB 4.45 1.18 + X01683 Alpha-1-antitrypsin SERPINA1 2... identifies the NF-kappa...

184

NVN-079291 | Open Energy Information  

Open Energy Info (EERE)

88 Bid PriceAcre Managing Field Office none provided Surface Manager TOIYABE NF Lessee 1 GRADIENT RESOURCES INC Lessee 2 none provided Effective Date 612006 Expire Date Held By...

185

NVN-077668 | Open Energy Information  

Open Energy Info (EERE)

94 Bid PriceAcre Managing Field Office none provided Surface Manager TOIYABE NF Lessee 1 NGP BLUE MOUNTAIN I LLC Lessee 2 none provided Effective Date 812004 Expire Date Held By...

186

UTU-029557 | Open Energy Information  

Open Energy Info (EERE)

Lot Case Status Authorized Case Type GEOLSECOMPPRE2005 Total Acreage 2594.37 Bid PriceAcre Managing Field Office none provided Surface Manager FISHLAKE NF Lessee 1 ENEL...

187

NVN-074249 | Open Energy Information  

Open Energy Info (EERE)

9 Bid PriceAcre Managing Field Office none provided Surface Manager TOIYABE NF Lessee 1 GRADIENT RESOURCES INC Lessee 2 none provided Effective Date 912007 Expire Date Held By...

188

NVN-077739 | Open Energy Information  

Open Energy Info (EERE)

Bid PriceAcre Managing Field Office none provided Surface Manager TOIYABE NF Lessee 1 PATUA PROJECT LLC Lessee 2 none provided Effective Date 8312016 Expire Date Held By...

189

NVN-080086 | Open Energy Information  

Open Energy Info (EERE)

50.32 Bid PriceAcre Managing Field Office none provided Surface Manager TOIYABE NF Lessee 1 NGP BLUE MOUNTAIN I LLC Lessee 2 none provided Effective Date 812006 Expire Date Held...

190

NVN-079305 | Open Energy Information  

Open Energy Info (EERE)

Bid PriceAcre Managing Field Office none provided Surface Manager TOIYABE NF Lessee 1 GRADIENT RESOURCES INC Lessee 2 none provided Effective Date 712006 Expire Date Held By...

191

NVN-079106 | Open Energy Information  

Open Energy Info (EERE)

Case Status Authorized Case Type GEOLSENONCOMPPRE2005 Total Acreage 2588.75 Bid PriceAcre Managing Field Office none provided Surface Manager TOIYABE NF Lessee 1 ORNI 16...

192

CACA-014407 | Open Energy Information  

Open Energy Info (EERE)

Acres) Case Status Authorized Case Type GEOLSECOMPPRE2005 Total Acreage 2561.25 Bid PriceAcre Managing Field Office none provided Surface Manager INYO NF Lessee 1 ORNI 51 LLC...

193

Design and synthesis of probes for detection of protein-protein interaction and RNA localization  

E-Print Network [OSTI]

The use of the ketone biotin - benzophenone-biotin hydrazide system for detecting the formation of cyan fluorescent protein and NF-kappaB p50 dimers was assessed. A series of benzophenone-based probes were synthesized and ...

Ryan, Jeremy Adam

2005-01-01T23:59:59.000Z

194

Renewable energy powered membrane technology. 2. The effect of energy fluctuations on performance of a photovoltaic hybrid membrane system   

E-Print Network [OSTI]

This paper reports on the performance fluctuations during the operation of a batteryless hybrid ultrafiltration – nanofiltration / reverse osmosis (UF-NF/RO) membrane desalination system powered by photovoltaics treating ...

Richards, B.S.; Capão, D.P.S.; Schäfer, Andrea

2008-01-01T23:59:59.000Z

195

Table HC1-7a. Housing Unit Characteristics by Four Most Populated...  

Gasoline and Diesel Fuel Update (EIA)

0.4 Q Q Q 15.6 More than 20 Floors ... Q Q Q Q Q NF FoundationBasement of Single-Family Homes and Apartments in Buildings With 2 to 4 Units (More...

196

Temporal Databases with Null Values  

Science Journals Connector (OSTI)

In this paper we present a temporal data model capable of representing null values in valid time based on first normal form (1NF) and temporal intervals. As opposed to previous temporal data models, we store t...

Mansik Park; 1]Hans-Hermann Leinen

2000-01-01T23:59:59.000Z

197

Cryogenic Electron Beam Induced Chemical Etching  

Science Journals Connector (OSTI)

Cryogenic cooling is used to enable efficient, gas-mediated electron beam induced etching (EBIE) in cases where the etch rate is negligible at room and elevated substrate temperatures. The process is demonstrated using nitrogen trifluoride (NF3) as the ...

Aiden A. Martin; Milos Toth

2014-10-21T23:59:59.000Z

198

Nitrogen trifluoride global emissions estimated from updated atmospheric measurements  

E-Print Network [OSTI]

Nitrogen trifluoride (NF[subscript 3]) has potential to make a growing contribution to the Earth’s radiative budget; however, our understanding of its atmospheric burden and emission rates has been limited. Based on a ...

Ivy, Diane J.

199

LS-96(11-8-88) LS-96 S. Kramer  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

n ) 1. The frequencies are then f2 nf 1 * Although this need not be the case (i.e., f1 and f2 need only be harmonically related to f o )' operationally this harmonic...

200

Numerical Investigation of Interaction Between Hydraulic Fractures and Natural Fractures  

E-Print Network [OSTI]

Hydraulic fracturing of a naturally-fractured reservoir is a challenge for industry, as fractures can have complex growth patterns when propagating in systems of natural fractures in the reservoir. Fracture propagation near a natural fracture (NF...

Xue, Wenxu

2011-02-22T23:59:59.000Z

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Dendritic Anion Hosts: Perchlorate Uptake by G5-NH2  

E-Print Network [OSTI]

may limit their utilization in drinking water treatment. Reverse osmosis (RO), nanofiltration (NF), and electrodialysis (ED) are also not cost-effective or efficient at recovering perchlorate from contaminated water

Goddard III, William A.

202

E-Print Network 3.0 - algorithms elucidate nrf2 Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Medicine 70 Kinetics and Mechanism of Protein Tyrosine Phosphatase 1B Inactivation by Acrolein Summary: channels (TRPA1) (17), and some transcription factors (NF-B, Keap1Nrf2)...

203

E-Print Network 3.0 - agent-sensor keap1 protein Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Medicine 48 Kinetics and Mechanism of Protein Tyrosine Phosphatase 1B Inactivation by Acrolein Summary: channels (TRPA1) (17), and some transcription factors (NF-B, Keap1Nrf2)...

204

Systems and methods for treating material  

DOE Patents [OSTI]

Systems for treating material are provided that can include a vessel defining a volume, at least one conduit coupled to the vessel and in fluid communication with the vessel, material within the vessel, and NF.sub.3 material within the conduit. Methods for fluorinating material are provided that can include exposing the material to NF.sub.3 to fluorinate at least a portion of the material. Methods for separating components of material are also provided that can include exposing the material to NF.sub.3 to at least partially fluorinate a portion of the material, and separating at least one fluorinated component of the fluorinated portion from the material. The materials exposed to the NF.sub.3 material can include but are not limited to one or more of U, Ru, Rh, Mo, Tc, Np, Pu, Sb, Ag, Am, Sn, Zr, Cs, Th, and/or Rb.

Scheele, Randall D; McNamara, Bruce K

2014-10-21T23:59:59.000Z

205

Reciprocal Encoding of Signal Intensity and Duration  

E-Print Network [OSTI]

that an incoherent feedforward loop between three transcriptional regulators enhances the inflammatory response of intracellular calcium induces activation of the transcriptional activator NF-kB, whereas low sustained calcium

Jones, Alan M.

206

GLK Transcription Factors Coordinate Expression of the Photosynthetic Apparatus in Arabidopsis  

Science Journals Connector (OSTI)

...plastid damage. While NF and L led to much lower transcript levels...light (85 mumol quanta21) from fluorescent bulbs. Light and Plastid Inhibitor Treatments...white light was supplied by fluorescent tubes at 40 mumol quanta21. Tissue...

Mark T. Waters; Peng Wang; Muris Korkaric; Richard G. Capper; Nigel J. Saunders; Jane A. Langdale

2009-04-17T23:59:59.000Z

207

ALL GRADE 5 AND GRADE 8 FASTENERS ...  

Office of Environmental Management (EM)

GRADE 8 FASTENERS WITH THE FOLLOWING MANUFACTURERS' HEADMARKS: MARK KS MARK J (CA TW JP YU) (Greater than 12 inch dia) MARK A NF H M MS Hollow Triangle E MARK KS RT FM...

208

E-Print Network 3.0 - active catheter navigation Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

nf@ffn f ff Jfn n f Summary: with a Haptic Catheter: Feeling the Inside of the Beating Heart Samuel B. Kesner 1 , Student Member, IEEE... -MIT Division of Health Sciences &...

209

Bioremediation of contaminated groundwater  

DOE Patents [OSTI]

Disclosed is an apparatus and method for in situ remediation of contaminated subsurface soil or groundwater contaminated by chlorinated hydrocarbons. A nutrient fluid (NF) is selected to simulated the growth and reproduction of indigenous subsurface microorganisms capable of degrading the contaminants; an oxygenated fluid (OF) is selected to create an aerobic environment with anaerobic pockets. NF is injected periodically while OF is injected continuously and both are extracted so that both are drawn across the plume. NF stimulates microbial colony growth; withholding it periodically forces the larger, healthy colony of microbes to degrade the contaminants. Treatment is continued until the subsurface concentration of contaminants is acceptable. NF can be methane and OF be air, for stimulating production of methanotrophs to break down chlorohydrocarbons, especially TCE and tetrachloroethylene.

Hazen, T.C.; Fliermans, C.B.

1994-01-01T23:59:59.000Z

210

Is Bloom's Taxonomy Appropriate for Computer Colin G. Johnson  

E-Print Network [OSTI]

Is Bloom's Taxonomy Appropriate for Computer Science? Colin G. Johnson Computing Laboratory University of Kent Canterbury, Kent, CT2 7NF England C.G.Johnson@kent.ac.uk Ursula Fuller Computing

Kent, University of

211

Search and notions of creativity Colin G. Johnson  

E-Print Network [OSTI]

Search and notions of creativity Colin G. Johnson Computing Laboratory University of Kent at Canterbury Canterbury, Kent, CT2 7NF, England C.G.Johnson@kent.ac.uk Abstract In this paper we consider

Kent, University of

212

Genetic Programming with Guaranteed Constraints Colin G. Johnson  

E-Print Network [OSTI]

Genetic Programming with Guaranteed Constraints Colin G. Johnson Computing Laboratory University of Kent at Canterbury Canterbury, Kent, CT2 7NF, England e-mail: C.G.Johnson@ukc.ac.uk Abstract: Genetic

Kent, University of

213

A Design Framework for Metaheuristics Colin G. Johnson  

E-Print Network [OSTI]

A Design Framework for Metaheuristics Colin G. Johnson School of Computing University of Kent Canterbury, Kent, CT2 7NF C.G.Johnson@kent.ac.uk Published in Artificial Intelligence Review, 29(2), April

Kent, University of

214

Using Tabu Search and Genetic Algorithms in Mathematics Colin G. Johnson  

E-Print Network [OSTI]

Using Tabu Search and Genetic Algorithms in Mathematics Research Colin G. Johnson Computing Laboratory University of Kent Canterbury, Kent, CT2 7NF, England e-mail: C.G.Johnson@kent.ac.uk Abstract

Kent, University of

215

E-Print Network 3.0 - adeno-associated virus gene Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

(AAV) for expressing short hairpin RNA (sh... the human immunodeficiency virus type 1 (HIV-1) tat gene and the NF-B p65 subunit, respectively. 23 adeno-associated... 23...

216

Measurement of the fluence response of the GSI neutron ball dosemeter in the energy range from thermal to 19 MeV  

Science Journals Connector (OSTI)

......the GKSS research reactor FRG-1 in Geesthacht. For the accelerator measurements...thermal neutrons was performed at the Geesthacht Neutron Facility (GeNF) laboratory...the GKSS research reactor FRG-1 in Geesthacht. For the accelerator measurements......

G. Fehrenbacher; E. Kozlova; F. Gutermuth; T. Radon; R. Schütz; R. Nolte; R. Böttger

2007-08-01T23:59:59.000Z

217

Evaluation of Membrane Processes for Reducing Total Dissolved Solids Discharged to the Truckee River  

E-Print Network [OSTI]

for endangered species. Reverse osmosis RO and nanofiltration NF , in conjunction with ultrafiltration UF also have to be removed from the effluent in order to maintain their TMDLs. Reverse osmosis RO

218

The ecology of coral-microbe interactions  

E-Print Network [OSTI]

algal symbioses. Molecular Ecology 18:1823-1833. Webster, N.F. Rohwer. 2008. Microbial ecology of four coral atolls inin Caribbean coral reefs. Ecology Letters 9:818-826. Porter,

Marhaver, Kristen Laura

2010-01-01T23:59:59.000Z

219

Nanofiltration membranes based on polyvinylidene fluoride nanofibrous scaffolds and crosslinked polyethyleneimine networks  

Science Journals Connector (OSTI)

In this article, we describe the synthesis of new and ion-selective nanofiltration (NF) membranes using polyvinylidene fluoride (PVDF) nanofibers and hyperbranched polyethylenimine (PEI) as building blocks. Th...

Seong-Jik Park; Ravi Kumar Cheedrala…

2014-01-01T23:59:59.000Z

220

Characterization and applications of nanofiltration membranes: State of the art  

Science Journals Connector (OSTI)

There is a voluminous literature on the determination of structural and electrical properties of a nanofiltration (NF) membrane and its separation performance. Theories used to characterize a NF membrane usually include: the non-equilibrium thermodynamic model, the pore model, the TMS model, the electrostatic and steric-hindrance pore model, and the semi-emprical model. In the article, we briefly trace the origins or the general ideas of the above-mentioned theories. From there, recent researches on the evaluation of membrane structural and electrical properties are reviewed. We then turn to research on the separation performance of a NF membrane for single component solutions of inorganic electrolytes, neutral organic solutions, and mixture solution of inorganic electrolytes or that of electrolyte and neutral organic solute. Finally, we conclude with suggestions as to the role of models in the contributions to the application of the NF technology in product separation processes.

Xiao-Lin Wang; Wei-Juan Shang; Da-Xin Wang; Ling Wu; Cong-Hui Tu

2009-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

LINE","COMPNAME","COMPID","YEAR","PURCNAME","SALETYPE","MEGAWATT...  

U.S. Energy Information Administration (EIA) Indexed Site

Service","NF",123991,0,0,3566208,3566208 438,"Bonneville Power Admin",1738,1999,"Williams Energy Service","OT",0,0,0,2621,2621 999999,"Bonneville Power Admin",1738,1999,,,78575192,...

222

The Mobile Test and Demonstration Unit, A Cooperative Project Between EPRI, Utilities and Industry to Demonstrate New Water Treatment Technologies  

E-Print Network [OSTI]

and has demonstrated that membrane processes like MF, UF, NF and RO can successfully be applied to remove BOD and TSS from process streams, often recovering valuable solids, reducing sewer charges and meeting environmental regulations....

Strasser, J.; Mannapperuma, J.

223

S:\VM3\RX97\TBL_LIST.WPD  

U.S. Energy Information Administration (EIA) Indexed Site

b. Housing Unit Characteristics by Four Most Populated States, b. Housing Unit Characteristics by Four Most Populated States, Percent of U.S. Households, 1997 Housing Unit Characteristics RSE Column Factor: Total Four Most Populated States RSE Row Factors New York California Texas Florida 0.4 1.1 1.1 1.2 1.7 Total .............................................................. 100.0 100.0 100.0 100.0 100.0 0.0 Census Region and Division Northeast ..................................................... 19.4 100.0 -- -- -- NF New England ............................................. 5.2 Q -- -- -- NF Middle Atlantic ........................................... 14.2 100.0 -- -- -- NF Midwest ....................................................... 23.7 -- -- -- -- NF East North Central ..................................... 16.7 --

224

CRYOPUMP BEHAVIOR IN THE PRESENCE OF BEAM OR NUCLEAR RADIATION  

E-Print Network [OSTI]

63, 151 T. Kaimcash. Fusion Reactor Physics (Ann ArborTritium Technology For Fusion Reactors. C0NF-750989 (OakA. Impurity Effects in Fusion Reactor Operations B.

Law, P.K.

2011-01-01T23:59:59.000Z

225

Endodermal ABA Signaling Promotes Lateral Root Quiescence during Salt Stress in Arabidopsis Seedlings  

Science Journals Connector (OSTI)

...stage and MFC-2000 controller (Applied Scientific Instrumentation), samples were backlit using an infrared light-emitting diode panel, and images were captured using a digital monochrome camera (CoolSnap) fitted with an NF Micro-Nikor...

Lina Duan; Daniela Dietrich; Chong Han Ng; Penny Mei Yeen Chan; Rishikesh Bhalerao; Malcolm J. Bennett; José R. Dinneny

2013-01-22T23:59:59.000Z

226

Exploration of nucleon structure in lattice QCD with chiral quarks  

E-Print Network [OSTI]

In this work, we calculate various nucleon structure observables using the fundamental theory of quarks and gluons, QCD, simulated on a lattice. In our simulations, we use the full QCD action including Nf = 2+ 1 dynamical ...

Syritsyn, Sergey Nikolaevich

2010-01-01T23:59:59.000Z

227

Molecular pathogenesis of Salmonella enterica serotype Typhimurium-induced inflammatory responses  

E-Print Network [OSTI]

secretion of IL-8 (103) mediated by cytosolic calcium and NF?B translocation (53), and a NF?B-independent apical secretion of a pathogen- elicited epithelial chemoattractant (PEEC), identified as the eicosanoid hepoxilin A 3 , which directs PMNs through... intestinal epithelial cells (54, 106, 116). The polarized secretion of PEEC was induced by SipA through an Arf6-mediated lipid signaling 14 pathway and consequent redistribution and phosphorylation of protein kinase-C (PKC)? (27, 97, 152). The PMN...

Figueiredo, Josely Ferreira

2009-05-15T23:59:59.000Z

228

Q.A.BREAK SHARP EDGES USED ON DRAWING NO.  

E-Print Network [OSTI]

(31) (29) 18 - - - 19 - - - 20 - - - 21 - - - 22 - - - 23 7 - SCR, HEX HD, .312-18NC X 1.5 LG. SST 24 - - - 25 5 - SCR, HEX HD, .375-16NC X 2,0 LG. 26 - - - 27 14 - SCR, HEX HD, .250-20NC X 1.5 LG. 28 - - - 29 9 - ROD, CONT. THD, 10-32NF X 3.5 LG. 30 - - - 31 12 - SCR, HEX HD, 10-32NF X .75 LG. 32 - - - 33 6

Llope, William J.

229

Enhanced G2-M Arrest by Nuclear Factor-KB-Dependent p21waf1/cip1  

E-Print Network [OSTI]

Enhanced G2-M Arrest by Nuclear Factor-KB-Dependent p21waf1/cip1 Induction Shelly M. Wuerzberger cell death. Importantly, p21waf1/cip1 was induced in S-G2-M phases in a NF-KB-dependent manner, and RNA­coupled induction of p21waf1/cip1 by NF-KB represents a resistance mechanism in certain cancer cells. (Mol Cancer

Miyamoto, Shigeki

230

Dmarche qualit au sein d'un laboratoire de recherche du CNRS: FEMTO-ST  

E-Print Network [OSTI]

également lancés dans la mise en place de la norme NF EN ISO 9001 afin d'obtenir une certification : recherche, qualité, laboratoires, label Carnot, ISO 9001, ISO/CEI 17025, Université de Franche-Comté, FEMTO décennies des laboratoires accrédités par le COFRAC selon le référentiel NF EN ISO/CEI 17025. Ainsi, le

Paris-Sud XI, Université de

231

Donald Byrne (white) vs. Robert James "Bobby" Fischer (black) 1956 White Black  

E-Print Network [OSTI]

Donald Byrne (white) vs. Robert James "Bobby" Fischer (black) 1956 White Black 1. Nf3 Nf6 comments here are called "annotation" 2. c4 g6 3. Nc3 Bg7 black bishop sits on long diagonal 4. d4 0-0 white black threatens the queen 7. Qxc4 c6 8. e4 Nbd7 black's knight on b moves to d7 9. Rd1 Nb6 white's rook

Zirbel, Craig L.

232

Structural studies of magnesium nitride fluorides by powder neutron diffraction  

SciTech Connect (OSTI)

Samples of ternary nitride fluorides, Mg{sub 3}NF{sub 3} and Mg{sub 2}NF have been prepared by solid state reaction of Mg{sub 3}N{sub 2} and MgF{sub 2} at 1323-1423 K and investigated by powder X-ray and powder neutron diffraction techniques. Mg{sub 3}NF{sub 3} is cubic (space group: Pm3m) and has a structure related to rock-salt MgO, but with one cation site vacant. Mg{sub 2}NF is tetragonal (space group: I4{sub 1}/amd) and has an anti-LiFeO{sub 2} related structure. Both compounds are essentially ionic and form structures in which nitride and fluoride anions are crystallographically ordered. The nitride fluorides show temperature independent paramagnetic behaviour between 5 and 300 K. - Graphical abstract: Definitive structures of the ternary magnesium nitride fluorides Mg{sub 3}NF{sub 3} and the lower temperature polymorph of Mg{sub 2}NF have been determined from powder neutron diffraction data. The nitride halides are essentially ionic and exhibit weak temperature independent paramagnetic behaviour. Highlights: Black-Right-Pointing-Pointer Definitive structures of Mg{sub 3}NF{sub 3} and Mg{sub 2}NF were determined by neutron diffraction. Black-Right-Pointing-Pointer Nitride and fluoride anions are crystallographically ordered in both structures. Black-Right-Pointing-Pointer Both compounds exhibit weak, temperature independent paramagnetic behaviour. Black-Right-Pointing-Pointer The compounds are essentially ionic with ionicity increasing with F{sup -} content.

Brogan, Michael A. [School of Chemistry, University of Nottingham, Nottingham NG7 2RD (United Kingdom); Hughes, Robert W. [WestCHEM, School of Chemistry, University of Glasgow, Glasgow G12 8QQ (United Kingdom); Smith, Ronald I. [ISIS Pulsed Neutron and Muon Source, Science and Technology Facilities Council, Rutherford Appleton Laboratory, Harwell Oxford, Didcot OX11 0QX (United Kingdom); Gregory, Duncan H., E-mail: Duncan.Gregory@glasgow.ac.uk [WestCHEM, School of Chemistry, University of Glasgow, Glasgow G12 8QQ (United Kingdom)

2012-01-15T23:59:59.000Z

233

NETL: Water-Energy Interface - Power Plant Water Management  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Nanofiltration Treatment Options for Thermoelectric Power Plant Water Treatment Demands Nanofiltration Treatment Options for Thermoelectric Power Plant Water Treatment Demands Sandia National Laboratories (SNL) is conducting a study on the use of nanofiltration (NF) treatment options to enable use of non-traditional water sources as an alternative to freshwater make-up for thermoelectric power plants. The project includes a technical and economic evaluation of NF for two types of water that contain moderate to high levels of total dissolved solids (TDS): (1) cooling tower recirculating water and (2) produced waters from oil & gas extraction operations. Reverse osmosis (RO) is the most mature and commonly considered option for high TDS water treatment. However, RO is generally considered to be too expensive to make treatment of produced waters for power plant use a feasible application. Therefore, SNL is investigating the use of NF, which could be a more cost effective treatment option than RO. Similar to RO, NF is a membrane-based process. Although NF is not as effective as RO for the removal of TDS (typical salt rejection is ~85 percent, compared to >95 percent for RO), its performance should be sufficient for typical power plant applications. In addition to its lower capital cost, an NF system should have lower operating costs because it requires less pressure to achieve an equivalent flux of product water.

234

Is MR spectroscopy capable of detecting metabolic abnormalities in neurofibromatosis type 1 that are not revealed in brain parenchyma of normal appearance?  

Science Journals Connector (OSTI)

AbstractBackground Results of magnetic resonance spectroscopy (MRS) studies on metabolic abnormalities in normal-appearing brain and in non-neoplastic brain lesions in individuals with neurofibromatosis type 1 (NF1) have been discrepant. Objective We aimed at using MRS to analyze the metabolic patterns in the basal ganglia of patients with NF1 and examine their correlation with focal hyperintense lesions in T2-weighted images (T2-W hyperintensities). Methods We studied MRS data of 42 individuals with NF1 (18 with and 24 without T2-W hyperintensities) and 25 controls matched for gender and age. A single-voxel technique was employed by manually placing a region of interest with a uniform size over a predetermined anatomical region including the globus pallidum and putamen (capsulolenticular region). We further analyzed the ratios of choline/creatine (Cho/Cr), N-acetyl aspartate/creatine (NAA/Cr), and myoinositol/creatine (Mi/Cr) metabolites and the occurrence of T2-W hyperintensities in these regions in individuals with NF1. Results There was a significant difference between the NF1 and control groups with regard to the mean values ??of Mi/Cr and Cho/Cr, with higher metabolite values observed in the NF1 group (p 1). Only the Mi/Cr ratio was able to discriminate between NF1 subgroups with and without T2-W hyperintensities. For the NAA/Cr ratio, no significant difference was observed between the NF1 and control groups. Conclusion MRS allows the characterization of tissue abnormalities not demonstrable in the structural images of patients with NF1 through Cho and Mi metabolite analysis. Yet, the findings of preserved NAA values argue against the hypothesis of demyelination and axonal degeneration occurring in the region, suggesting instead a functional neuronal stability. Taken in association with the findings of lack of clinical manifestations and the known transient nature of T2-W hyperintensities in NF1 as demonstrated by other studies, our results support the current histopathologically driven hypothesis that such T2-W hyperintensities may be related to intramyelinic edema.

Antonio Carlos Pondé Rodrigues Jr.; José Roberto Lopes Ferraz-Filho; Ulysses S. Torres; Antônio José da Rocha; Marcos Pontes Muniz; Antônio Soares Souza; Eny Maria Goloni-Bertollo; Érika Cristina Pavarino

2014-01-01T23:59:59.000Z

235

Application of various membranes to remove NOM typically occurring in Korea with respect to DBP, AOC and transport parameters  

Science Journals Connector (OSTI)

Bench- and pilot-scale membrane tests were performed to remove natural organic matter (NOM) originating from Paldang Lake in Korea. Membrane performance was demonstrated in terms of DOC, biodegradable organic carbon (BDOC), assimilable organic carbon (AOC), and transport parameters. Various membranes such as reverse osmosis (RO), nanofiltration (NF) and ultrafiltration (UF) were investigated for this study. Four different NF membranes were selected for pilot-scale filtration testing and investigated in terms of both flux decline and DOC removal. To demonstrate the effect of temperature on the source water seasonally, the flux of membranes was measured with pure water at different temperatures ranging from 25 to 7°C. Coagulation/sedimentation treated water was used as feed water without removing residual chlorine; related plants were located at the Suji water treatment plant of Yongin City. To investigate more rigorously the organic fouling for various NF membranes, mass transport behaviors of organic matter solutes were evaluated by an irreversible thermodynamic model. The pore sizes of the NF membranes tested in the pilot slightly increased due to the oxidation of the polymer structure of the membranes from residual chlorine during the 4-month tests. Periodic chemical cleaning with a caustic solution was made to prevent accumulation of foulants on the membrane surface. The NF membranes exhibited stable efficiencies in terms of DOC and AOC removal during the test for 4 months.

Noeon Park; Boksoon Kwon; Minjeong Sun; Hyowon Ahn; Chunghwan Kim; Changho Kwoak; Dongju Lee; Seonha Chae; Hoon Hyung; Jaeweon Cho

2005-01-01T23:59:59.000Z

236

USFS Humboldt-Toiyabe National Forest | Open Energy Information  

Open Energy Info (EERE)

USFS Humboldt-Toiyabe National Forest USFS Humboldt-Toiyabe National Forest Jump to: navigation, search Name USFS Humboldt-Toiyabe National Forest Short Name Humbolt-Toiyabe NF Parent Organization United States Forest Service Address 1200 Franklin Way Place Sparks, NV Zip 89431 Phone number (775) 331-6444 Website http://www.fs.usda.gov/main/ht References Humboldt-Toiyabe NF Website[1] This article is a stub. You can help OpenEI by expanding it. USFS Toiyabe National Forest is an organization based in Sparks, Nevada, Sparks, Nevada. References ↑ "Humboldt-Toiyabe NF Website" Retrieved from "http://en.openei.org/w/index.php?title=USFS_Humboldt-Toiyabe_National_Forest&oldid=640692" Categories: Government Agencies Stubs What links here Related changes Special pages Printable version

237

Low Dose Radiation Research Program: Molecular Characterization of Survival  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Survival Advantage, Bystander Effect, and Survival Advantage, Bystander Effect, and Genomic Instability after Low-LET Low Dose Radiation Exposure Mohan Natarajan University of Texas Health Science Center Why this Project? To understand the molecular link between the activation of NF-kB and cellular outcomes such as better cell survival after low-LET radiation and to determine whether low dose radiation-induced NF-kB signaling can mediate telomerase activation and thus confer enhanced cell survival of normal aortic endothelial cells. Project Goals To determine whether low-linear energy transfer (LET) radiation can cause a positive feedback signal initiated by the activation of the NF-kB. To examine one of the mechanisms involving TNF-a as a signaling mediator, which could mediate the bystander effect through the generation

238

Low Dose Radiation Research Program: Radiation-Induced Nuclear Factor kB  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Radiation-Induced Nuclear Factor kB mediates survival advantage by Radiation-Induced Nuclear Factor kB mediates survival advantage by Telomerase Activation. Authors: Natarajan M.,1 Mohan S.,2 Pandeswara, S.L.,1 and Herman T.S.1 Institutions: Departments of 1Radiation Oncology and 2Pathology, The University of Texas Health Science Center, San Antonio, Texas Activation of NF-kB in response to low doses of ionizing radiation was first shown in our laboratory. Although studies have shown that NF-kB plays an important role in anti-apoptotic function, little has been done to understand the molecular link between the activation of NF-kB and cellular outcome such as enhanced cell survival after low dose low-linear transfer (LET) radiation. Because upregulation of telomerase activity is associated with longevity and allows cells to escape from senescence, we hypothesize

239

EIS-0350-S1: Mitigation Action Plan | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Mitigation Action Plan Mitigation Action Plan EIS-0350-S1: Mitigation Action Plan Nuclear Facility Portion of the Chemistry and Metallurgy Research Building Replacement Project at Los Alamos National Laboratory, Los Alamos, NM This Mitigation Action Plan (MAP) describes mitigation and monitoring commitments for constructing and operating the Modified CMRR-NF. The commitments made in this MAP are designed to mitigate potentially adverse environmental consequences associated with the CMRR-NF Project as the CMRR-NF is constructed and operated, and as direct, indirect, and cumulative impacts from these actions occur over time. EIS-0350-S1-MAP-2011.pdf More Documents & Publications EIS-0350-S1: Final Supplemental Environmental Impact Statement EIS-0350-S1: Draft Supplemental Environmental Impact Statement

240

First order switched-capacitor building blocks for analog circuits  

E-Print Network [OSTI]

of the stray sensitive configuration with V3 connected to V and V2 grounded . C 1 =4 . 5 91 nF 0 C3=255. 4pP, and C4=14. 7nF. 32 15 Magnitude response of the stray sensitive configuration with V3 connected to VO and Vl grounded. Cp4. 591nF, C3=255. 4p... capacitor, stray sensitive configuration with Vl connected to V , V2 grounded and C4 in parallel with C5. . . . . . 56 0 30 Phase response of the integrated version of the common capacitor, stray sensitive configuration with V connected to V, V grounded...

Nguyen, Liem Thanh

2012-06-07T23:59:59.000Z

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Multi-instanton calculus in N=2 supersymmetric gauge theory. II. Coupling to matter  

Science Journals Connector (OSTI)

We further discuss the N=2 superinstantons in SU(2) gauge theory, obtained from the general self-dual solutions of topological charge n constructed by Atiyah, Drinfeld, Hitchin, and Manin (ADHM). We realize the N=2 supersymmetry algebra as actions on the superinstanton moduli. This allows us to recast in concise superfield notation our previously obtained expression for the exact classical interaction between n ADHM superinstantons mediated by the adjoint Higgs bosons, and, moreover, to incorporate NF flavors of hypermultiplets. We perform explicit one- and two-instanton checks of the Seiberg-Witten prepotentials for all NF and arbitrary hypermultiplet masses. Our results for the low-energy couplings are all in precise agreement with the predictions of Seiberg and Witten except for NF=4, where we find a finite renormalization of the coupling which is absent in the proposed solution.

Nicholas Dorey; Valentin V. Khoze; Michael P. Mattis

1996-12-15T23:59:59.000Z

242

Sequential fractionation of value-added coconut products using membrane processes  

Science Journals Connector (OSTI)

Abstract The coconut waste-skimmed coconut milk was employed for sequential fractionation using UF and NF membranes to produce value-added products (coconut proteins, plant hormones – kinetin and zeatin). The retention factors achieved by UF membrane (PS10): albumin (0.9822 ± 0.0799) and globulin (0.9975 ± 0.0783); NF membrane (NF1): kinetin (0.9238 ± 0.0345) and zeatin (0.9511 ± 0.0355). Coconut protein powder was obtained after spray-drying process using concentrated coconut protein (UF retentate). SDS-PAGE showed that molecular weights of the coconut proteins were 17, 34, 55 and 150 kDa. Proximate and HPLC analyses revealed that the obtained samples were enriched with basic nutrients and well-balanced amino acids composition, respectively.

Ching Yin Ng; Abdul Wahab Mohammad; Law Yong Ng; Jamaliah Md Jahim

2014-01-01T23:59:59.000Z

243

Quantum and stringy corrections to the equation of state of holographic QCD matter and the nature of the chiral transition  

E-Print Network [OSTI]

We consider the finite temperature phase diagram of holographic QCD in the Veneziano limit (Nc large, Nf large with xf=Nf/Nc fixed) and calculate one string-loop corrections to the free energy in certain approximations. Such corrections, especially due to the pion modes are unsuppressed in the Veneziano limit. We find that under some extra assumptions the first order transition following from classical gravity solutions can become second order. If stringy asymptotics are of a special form and there are residual interactions it may even become of third order. Operationally these computations imply modelling the low temperature chiral symmetry breaking phase with a hadron gas containing Nf^2 massless Goldstone bosons and an exponential spectrum of massive hadrons. A third order transition is possible only if repulsive hadron interactions via the excluded volume effect are included.

Alho, T; Kajantie, K; Kiritsis, E; Tuominen, K

2015-01-01T23:59:59.000Z

244

The design of efficient input circuits for class C amplifiers  

E-Print Network [OSTI]

?XXXXXXXXXXXXXXXXXXXXXXXXXXX?? ??X ??o?? hen?in? c?o?ef? tiinf?s?sfg o? g?s rn?eo jis??sf?? linfd?eggsi X ? ? ? ? ? ? ? ? X X X X X X X ?? m?cl aj lt?m?c lt?m? ?n?s ?? uni?ofe? tfn??ded o? ?nien? linfd?oi?si XXXXXXXXXXXXXXXXXXXXXXXX ?? ??X ?snd?is? nf? ?n????ngs? a...?geof ???? ??????? l?s ?fdgeg?gs o? rn?eo ?f?efssidX jX ?X lsi?nf? ?rn?eo sf?efssief????? ???in? ue?? ?oo? ?o??nf?? ????X ??X mX ??siegg? ??a?ge??? o?singef? ?of?egeofd ?oi ??ndd ? n???e?esid?? ?io?ss?ef?d o? ?fdgeg?gs o? rn?eo ?f?efssid ??? ??? ??????X ??jX ?X...

Fristoe, Harold T.

2013-10-04T23:59:59.000Z

245

Cross Sections for Neutron-induced Reactions on Actinide Targets Extracted from Surrogate Experiments: A Status Report  

SciTech Connect (OSTI)

The Surrogate nuclear reactions method, an indirect approach for determining cross sections for compound-nuclear reactions involving difficult-to-measure targets, is reviewed. Focusing on cross sections for neutron-induced reactions on actinides, we review the successes of past and present applications of the method and assess its uncertainties and limitations. The approximations used in the analyses of most experiments work reasonably well for (n,f) cross sections for neutron energies above 1-2 MeV, but lead to discrepancies for low-energy (n,f) reactions, as well as for (n,{gamma}) applications. Correcting for some of the effects neglected in the approximate analyses leads to improved (n,f) results. We outline steps that will further improve the accuracy and reliability of the Surrogate method and extend its applicability to reactions that cannot be approached with the present implementation of the method.

Escher, J E; Burke, J T; Dietrich, F S; Lesher, S R; Scielzo, N D; Thompson, I J; Younes, W

2009-10-01T23:59:59.000Z

246

Toward a Unified Treatment of Electronic Processes in Organic Semiconductors  

SciTech Connect (OSTI)

A quantitative study of n-type doping in highly crystalline organic semiconductor films establishes the predominant influence of electrostatic forces in these low-dielectric materials. Based on these findings, a self-consistent model of doped (purposely or not) organic semiconductors is proposed in which: (1) the equilibrium free carrier density, nf, is a small fraction of the total charge density; (2) a superlinear increase in conductivity with doping density is universal; (3) nf increases with applied electric field; and (4) the carrier mobility is field-dependent regardless of crystallinity.

Gregg. B.A.

2005-01-01T23:59:59.000Z

247

Holographic Viscosity of Fundamental Matter  

E-Print Network [OSTI]

A holographic dual of a finite-temperature SU(N_c) gauge theory with a small number of flavours N_f viscosity to entropy ratio in these theories saturates the conjectured universal bound eta/s >= 1/4\\pi. The contribution of the fundamental matter eta_fund is therefore enhanced at strong 't Hooft coupling lambda; for example, eta_fund ~ lambda N_c N_f T^3 in four dimensions. Other transport coefficients are analogously enhanced. These results hold with or without a baryon number chemical potential.

David Mateos; Robert C. Myers; Rowan M. Thomson

2006-10-16T23:59:59.000Z

248

K semileptonic form factor with HISQ fermions at the physical point  

E-Print Network [OSTI]

We present results for the form factor $f_+^{K \\pi}(0)$, needed to extract the CKM matrix element $|V_{us}|$ from experimental data on semileptonic $K$ decays, on the HISQ $N_f=2+1+1$ MILC configurations. The HISQ action is also used for the valence sector. The data set used for our final result includes three different values of the lattice spacing and data at the physical light quark masses. We discuss the error budget and how this calculation improves on our previous determination of $f_+^{K \\pi}(0)$ on the asqtad $N_f=2+1$ MILC configurations.

E. Gámiz; A. Bazavov; C. Bernard; C. Bouchard; C. DeTar; D. Du; A. X. El-Khadra; J. Foley; E. D. Freeland; Steven Gottlieb; U. M. Heller; J. Kim; A. S. Kronfeld; J. Laiho; L. Levkova; P. B. Mackenzie; E. T. Neil; M. B. Oktay; Si-Wei Qiu; J. N. Simone; R. Sugar; D. Toussaint; R. S. Van de Water; Ran Zhou

2013-11-28T23:59:59.000Z

249

Use of nanofiltration to reduce cooling tower water usage.  

SciTech Connect (OSTI)

Nanofiltration (NF) can effectively treat cooling-tower water to reduce water consumption and maximize water usage efficiency of thermoelectric power plants. A pilot is being run to verify theoretical calculations. A side stream of water from a 900 gpm cooling tower is being treated by NF with the permeate returning to the cooling tower and the concentrate being discharged. The membrane efficiency is as high as over 50%. Salt rejection ranges from 77-97% with higher rejection for divalent ions. The pilot has demonstrated a reduction of makeup water of almost 20% and a reduction of discharge of over 50%.

Sanchez, Andres L.; Everett, Randy L.; Jensen, Richard Pearson; Cappelle, Malynda A.; Altman, Susan Jeanne

2010-09-01T23:59:59.000Z

250

Chiara Piccolo, Anu Dudhia Atmospheric, Oceanic and Planetary Physics, Department of Physics, Oxford University, Oxford, UK  

E-Print Network [OSTI]

) above 10 pmol/mol for CF4 above 100 mol/mol for C2F6 (50 pmol/mol after 2011) Air /Air modified CCQM-P41.06 at 6 pmol/mol for SF6 0.01 at 1 nmol/mol for NF3 0.1 at 10 pmol/mol for CF4 Air /Air modified CCQM-K68 SF6, N2, O2 NF3, N2, O2 Air /Air modified CCQM-K15, Paper preparation CF4 (C2F6), N2, O2 Air /Air

Oxford, University of

251

NMIJ NIM VSL WCC NOAA VNIIM KRISSNIST  

E-Print Network [OSTI]

) above 10 pmol/mol for CF4 above 100 mol/mol for C2F6 (50 pmol/mol after 2011) Air /Air modified CCQM-P41.06 at 6 pmol/mol for SF6 0.01 at 1 nmol/mol for NF3 0.1 at 10 pmol/mol for CF4 Air /Air modified CCQM-K68 SF6, N2, O2 NF3, N2, O2 Air /Air modified CCQM-K15, Paper preparation CF4 (C2F6), N2, O2 Air /Air

252

Role of Three-Nucleon Forces in Neutron-Rich Nuclei Beyond 132Sn  

E-Print Network [OSTI]

The role of three-nucleon forces (3NF) in the description of nuclear structure properties is nowadays a main topic in the field of microscopic many-nucleon calculations. We investigate the relative weight between effective two- and three-nucleon forces in neutron-rich nuclei beyond the doubly-closed 132Sn core within the realistic shell-model framework, studying the evolution of the spectroscopic properties of N=82 isotopes and heavy tin isotopes. This problem is tackled indirectly without explicitly taking into account effective 3NF through the comparison of the results of shell-model calculations obtained from realistic on-shell-equivalent low-momentum potentials.

Coraggio, L; Itaco, N

2014-01-01T23:59:59.000Z

253

A new use for the Wheatstone bridge and transducer elements in measuring and computing  

E-Print Network [OSTI]

zneasureznent computing system panel is shown in Figure 7. Figure 8 pictures the complete test set-up on the axial fan-dynamometer set. The vibration of the motor causes the force transducer to EXTERNAL INPUT SWITCH NF 5h -90 EXTERNAL OUTPUT EXTERNAL... zneasureznent computing system panel is shown in Figure 7. Figure 8 pictures the complete test set-up on the axial fan-dynamometer set. The vibration of the motor causes the force transducer to EXTERNAL INPUT SWITCH NF 5h -90 EXTERNAL OUTPUT EXTERNAL...

Jobe, William Dibrell

2012-06-07T23:59:59.000Z

254

Sigma-terms and axial charges for hyperons and charmed baryons  

E-Print Network [OSTI]

We present results for the $\\sigma$-terms and axial charges for various hyperons and charmed baryons using $N_f=2+1+1$ twisted mass fermions. For the computation of the three-point function we use the fixed current method. For one of the $N_f=2+1+1$ ensembles with pion mass of 373 MeV we compare the results of the fixed current method with those obtained with a stochastic method for computing the all-to-all propagator involved in the evaluation of the three point functions.

C. Alexandrou; K. Hadjiyiannakou; K. Jansen; Ch. Kallidonis

2014-04-25T23:59:59.000Z

255

Nucleon observables and axial charges of other baryons using twisted mass fermions  

E-Print Network [OSTI]

We present results on the nucleon scalar, axial and tensor charges, as well as, on the first moments of the unpolarized, polarized and transversity parton distributions using $N_f=2$ and $N_f=2+1+1$ twisted mass fermions. These include an ensemble that yields the physical value of the ratio of the nucleon to the pion mass. Results on the axial charges of hyperons and charmed baryons are also presented for a range of pion masses including the physical one.

Constantia Alexandrou; Martha Constantinou; Kyriakos Hadjiyiannakou; Karl Jansen; Christos Kallidonis; Giannis Koutsou

2014-11-13T23:59:59.000Z

256

Table A37. Total Inputs of Energy for Heat, Power, and Electricity  

U.S. Energy Information Administration (EIA) Indexed Site

2" 2" " (Estimates in Trillion Btu)" ,,,,,,,"Coal" ,,,,"Distillate",,,"(excluding" ,,,,"Fuel Oil",,,"Coal Coke",,"RSE" ,,"Net","Residual","and Diesel",,,"and",,"Row" "End-Use Categories","Total","Electricity(a)","Fuel Oil","Fuel(b)","Natural Gas(c)","LPG","Breeze)","Other(d)","Factors" "Total United States" "RSE Column Factors:","NF",0.4,1.6,1.5,0.7,1,1.6,"NF" "TOTAL INPUTS",15027,2370,414,139,5506,105,1184,5309,3 "Boiler Fuel","--","W",296,40,2098,18,859,"--",3.6

257

Table A11. Total Inputs of Energy for Heat, Power, and Electricity Generatio  

U.S. Energy Information Administration (EIA) Indexed Site

2" 2" " (Estimates in Trillion Btu)" ,,,,,,,"Coal" ,,,,"Distillate",,,"(excluding" ,,,,"Fuel Oil",,,"Coal Coke",,"RSE" ,,"Net","Residual","and Diesel",,,"and",,"Row" "End-Use Categories","Total","Electricity(a)","Fuel Oil","Fuel(b)","Natural Gas(c)","LPG","Breeze)","Other(d)","Factors" ,"Total United States" "RSE Column Factors:"," NF",0.5,1.3,1.4,0.8,1.2,1.2," NF" "TOTAL INPUTS",16515,2656,441,152,6141,99,1198,5828,2.7 "Indirect Uses-Boiler Fuel"," --",28,313,42,2396,15,875," --",4

258

Can 3-D models explain the observed fractions of fossil and non-fossil carbon in and near Mexico City?  

SciTech Connect (OSTI)

Abstract. A 3-D chemistry-transport model has been applied to the Mexico City metropolitan area to investigate the origin of elevated levels of non-fossil (NF) carbonaceous aerosols observed in this highly urbanized region. High time resolution measurements of the fine aerosol concentration and composition, and 12 or 24 h integrated 14C measurements of aerosol modern carbon have been performed in and near Mexico City during the March 2006 MILAGRO field experiment. The non-fossil carbon fraction (fNF), which is lower than the measured modern fraction (fM) due to the elevated 14C in the atmosphere caused by nuclear bomb testing, is estimated from the measured fM and the source-dependent information on modern carbon enrichment. The fNF contained in PM1 total carbon analyzed by a US team (f TC NF ) ranged from 0.37 to 0.67 at the downtown location, and from 0.50 to 0.86 at the suburban site. Substantially lower values (i.e. 0.24–0.49) were found for PM10 filters downtown by an independent set of measurements (Swiss team), which are inconsistent with the modeled and known differences between the size ranges, suggesting higher than expected uncertainties in the measurement techniques of 14C. An increase in the non-fossil organic carbon (OC) fraction (f OC NF ) by 0.10–0.15 was observed for both sets of filters during periods with enhanced wildfire activity in comparison to periods when fires were suppressed by rain, which is consistent with the wildfire impacts estimated with other methods. Model results show that the relatively high fraction of nonfossil carbon found in Mexico City seems to arise from the combination in about equal proportions of regional biogenic SOA, biomass burning POA and SOA, as well as non-fossil urban POA and SOA. Predicted spatial and temporal variations for f OC NF are similar to those in the measurements between the urban vs. suburban sites, and high-fire vs. low-fire periods. The absolute modeled values of f OC NF are consistent with the Swiss dataset but lower than the US dataset. Resolving the 14C measurement discrepancies is necessary for further progress in model evaluation. The model simulations that included secondary organic aerosol (SOA) formation from semi-volatile and intermediate volatility (S/IVOC) vapors showed improved closure for the total OA mass compared to simulations which only included SOA from VOCs, providing a more realistic basis to evaluate the fNF predictions. f OC NF urban sources of modern carbon are important in reducing or removing the difference in fNF between model and measurements, even though they are often neglected on the interpretation of 14C datasets. An underprediction of biomass burning POA by the model during some mornings also explains a part of the model-measurement differences. The fNF of urban POA and SOA precursors is an important parameter that needs to be better constrained by measurements. Performing faster ( 3 h) 14C measurements in future campaigns is critical to further progress in this area. To our knowledge this is the first time that radiocarbon measurements are used together with aerosol mass spectrometer (AMS) organic components to assess the performance of a regional model for organic aerosols.

Hodzic, Alma; Jimenez, Jose L.; Prevot, A. S. H.; Szidat, S.; Fast, Jerome D.; Madronich, Sasha

2010-11-25T23:59:59.000Z

259

Timed CSP and Object-Z John Derrick  

E-Print Network [OSTI]

Timed CSP and Object-Z John Derrick Computing Laboratory, University of Kent, Canterbury, CT2 7NF a simple integration of timed CSP and Object-Z. Following existing work, the components in such an inte- gration are written as either Object-Z classes, or timed CSP processes, and are combined together using

Kent, University of

260

BREAST CANCER GROUP WOMEN'S HEALTH INTERDISCIPLINARY  

E-Print Network [OSTI]

BREAST CANCER GROUP May 2009 WOMEN'S HEALTH INTERDISCIPLINARY RESEARCH CENTER [WHIRC] #12;2 Table: Breast Cancer Research and Treatment 4 Basic/Translational Research Carcinogenesis and Signaling Group 5R) Signaling in Breast Cancer 6 NF-B Family of Transcription Factors in Breast Cancer 7 Transgenic Mouse

Spence, Harlan Ernest

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Mercury Beam Dump Simulations Tristan Davenne Ottone Caretta Chris Densham  

E-Print Network [OSTI]

Mercury Beam Dump Simulations Tristan Davenne Ottone Caretta Chris Densham STFC Rutherford Appleton Laboratory, UK 1st joint meeting of EUROnu WP2 (Superbeam) and NF-IDS target 15-17 December-2008 #12;Mercury beam dump design from NUFACT Feasibility Study #12;Peter Loveridge, November-2008 Mercury beam dump

McDonald, Kirk

262

Reflective Cracking Study: Second-Level Analysis Report  

E-Print Network [OSTI]

2 and ? 2 ln? 3 and ? 3 lnG lnkcy5 lnn 1 lnn 2 lnNf lnpct52 . Shear response variables: lnG, lnpct5, lnkcyc5, and theResilient Shear Modulus (lnG) The initial resilient shear

Jones, David; Tsai, Bor-Wen; Ullidtz, Per; Wu, R.; Harvey, John T; Monismith, Carl L.

2008-01-01T23:59:59.000Z

263

Reflective Cracking Study: First-level Report on Laboratory Shear Testing  

E-Print Network [OSTI]

2 and ? 2 ln? 3 and ? 3 lnG lnkcy5 lnn 1 lnn 2 lnNf lnpct559 Figure 4.28: Residual plots of LnG. (Pooled ShearResilient Shear Modulus, G* (lng) The Resilient Shear

Tsai, Bor-Wen; Jones, David; Harvey, John T; Monismith, Carl L.; Guada, I.; Signore, J,

2008-01-01T23:59:59.000Z

264

Sum Rules and Cutoff Effects in Wilson Lattice QCD  

E-Print Network [OSTI]

We use the transfer matrix formalism to derive non-perturbative sum rules in Wilson's lattice QCD with N_f flavours of quarks. The discretization errors on these identities are treated in detail. As an application, it is shown how the sum rules can be exploited to give improved estimates of the continuum spectrum and static potential.

Harvey B. Meyer

2006-09-06T23:59:59.000Z

265

SN52, a novel nuclear factor-?B inhibitor, blocks nuclear import of RelB:p52 dimer and sensitizes prostate cancer cells to ionizing radiation  

Science Journals Connector (OSTI)

...St. Clair). The costs of publication of this...fact. The activation of nuclear factor-kappaB (NF-kappaB...changes in RelA and RelB nuclear levels were observed...in the right panels of graphs in Fig. 1A and B. To...immunocytochemistry, cytoplasmic and nuclear extracts were quantified...

Yong Xu; Fang Fang; Daret K. St. Clair; Pradoldej Sompol; Sajni Josson; and William H. St. Clair

2008-08-01T23:59:59.000Z

266

Physiological Genomics of Response to Soil Drying in Diverse Arabidopsis Accessions  

Science Journals Connector (OSTI)

...factor Y, subunit A2 AT5G06510 NF-YA10; nuclear factor Y, subunit A10 Major intrinsic...plants acclimate to water deficit at low cost through changes of carbon usage: An integrated...generate, display, and annotate overview graphs for profiling experiments. BMC Bioinformatics...

David L. Des Marais; John K. McKay; James H. Richards; Saunak Sen; Tierney Wayne; Thomas E. Juenger

2012-03-09T23:59:59.000Z

267

Systematic binding analysis of the insulin gene transcription control region: insulin and immunoglobulin enhancers utilize similar transactivators.  

Science Journals Connector (OSTI)

...IgHjElb ........ 358 GGCCAT CTTG IgHp.E2b ........ 39OTGCCAGCTGC IgHp.E3b ........ 409TGCCACATGA AMLP-USEC .. ...... -63GGCCACGTGA -104 -230 349 381 400 -54 . ~~ _ FIG. 4. Methylation interference analysis of NF-1-InsEl...

L G Moss; J B Moss; W J Rutter

1988-06-01T23:59:59.000Z

268

Generation of a Canine Anti-EGFR (ErbB-1) Antibody for Passive Immunotherapy in Dog Cancer Patients  

Science Journals Connector (OSTI)

...cats.J Vet Intern Med 2005;19:860-4. 8. Bergman PJ , Camps-Palau MA, McKnight JA, Leibman NF, Craft DM, Leung C...antibodies for human diseases at the dawn of the twenty-first century.Nat Rev Drug Discov 2003;2:52-62. 24. Mendelsohn J...

Josef Singer; Judit Fazekas; Wei Wang; Marlene Weichselbaumer; Miroslawa Matz; Alexander Mader; Willibald Steinfellner; Sarah Meitz; Diana Mechtcheriakova; Yuri Sobanov; Michael Willmann; Thomas Stockner; Edzard Spillner; Renate Kunert; and Erika Jensen-Jarolim

2014-07-01T23:59:59.000Z

269

Use of Drop-nets for Wild Pig Damage and Disease Abatement  

E-Print Network [OSTI]

pigs were first observed on the ranch in the mid 1990?s. In 2000, NF took ownership of ORR. Bill Hoffmann owns HR. It is unknown when pigs were first observed on ORR or HR. Past wild pig management included drop-nets and corral traps on ORR...

Gaskamp, Joshua Alden

2012-11-15T23:59:59.000Z

270

AmLTii..in I'lannint; AiMJciatirin 17 By [Vleghun Slroinhcr^  

E-Print Network [OSTI]

buildings be built green, using tbe I.F.IT) standards. (So far, the U.S. Cireen Building Council is the only, corporations, homeowners, ar- Lhitects, and developers bave also cbosen to go green, using standards from LEF for the installation nf a smaller HVAC system, but also diminishes the building s capacity to expel excess mois- ture

Handy, Susan L.

271

Development of a Molecular Assay for Rapid Screening of  

E-Print Network [OSTI]

Development of a Molecular Assay for Rapid Screening of Chemopreventive Compounds Targeting Nrf2 Zhaohui Wang, Vinay Gidwani, Zheng Sun, Donna D. Zhang, and Pak Kin Wong* University of Arizona, Tucson, AZ Emerging molecular studies have shown that the transcription factor NF-E2-related factor (Nrf2

Wong, Pak Kin

272

Tetrahedron Letters,Vo1.26,No.30,pp 3523-3526,1985 0040-4039/85 $3.00 + .OO Printed in Great Britain 61985 Pergamon Press Ltd.  

E-Print Network [OSTI]

-6 days) azide 1 was transformed to triazoline z.ll Flash pyrolysis nf 1 at 450" or 500" gave a mixture of 8, &J, and 11 (approx.50:40:10) in 86%- yield. Pyrolysis of imine fi gave similar results as did

Hudlicky, Tomas

273

Computing with the Lie correspondence Scott H. Murray  

E-Print Network [OSTI]

Computing with the Lie correspondence Scott H. Murray University of Sydney July 30, 2009 #12;Linear: symplectic groups Sp2n(F) Types B and D: orthogonal Types E, F, G: exceptional #12;Almost reductive Lie The Lie algebra of a connected reductive linear algebraic group I sln(F) is almost reductive F has

Murray, Scott H.

274

Genetic analyses of bovine CARD15, a putative disease resistance gene  

E-Print Network [OSTI]

Through a binding partner the CARD15 gene activates NF-kB, a molecule with a role in the initiation of the inflammatory immune response. The gene is highly conserved in both structure and function in human and mouse and has recently been implicated...

Taylor, Kristen Hawkins

2004-09-30T23:59:59.000Z

275

Nitrogen trifluoride global emissions estimated from updated atmospheric measurements  

E-Print Network [OSTI]

Nitrogen trifluoride global emissions estimated from updated atmospheric measurements Tim Arnolda,1's radiative budget; however, our understand- ing of its atmospheric burden and emission rates has been limited together with an atmo- spheric model and inverse method, we estimate that the global emissions of NF3

Severinghaus, Jeffrey P.

276

J. Phys. II France 2 (1992) 715-725 APRIL1992, PAGE 715 Classification  

E-Print Network [OSTI]

.80D High f double-Rydberg states 7d5/2nf of barium P. Camus, 3.-M. Lecomte, C-R- Mahon, P. Pilfer presents the onset of correlation and the breakdown of the independent particle model. Camus et al. [15

Paris-Sud XI, Université de

277

Adrenaline promotes cell proliferation and increases chemoresistance in colon cancer HT29 cells through induction of miR-155  

SciTech Connect (OSTI)

Highlights: Black-Right-Pointing-Pointer Adrenaline increases colon cancer cell proliferation and its resistance to cisplatin. Black-Right-Pointing-Pointer Adrenaline activates NF{kappa}B in a dose dependent manner. Black-Right-Pointing-Pointer NF{kappa}B-miR-155 pathway contributes to cell proliferation and resistance to cisplatin. -- Abstract: Recently, catecholamines have been described as being involved in the regulation of cancer genesis and progression. Here, we reported that adrenaline increased the cell proliferation and decreased the cisplatin induced apoptosis in HT29 cells. Further study found that adrenaline increased miR-155 expression in an NF{kappa}B dependent manner. HT29 cells overexpressing miR-155 had a higher cell growth rate and more resistance to cisplatin induced apoptosis. In contrast, HT29 cells overexpressing miR-155 inhibitor displayed decreased cell proliferation and sensitivity to cisplatin induced cell death. In summary, our study here revealed that adrenaline-NF{kappa}B-miR-155 pathway at least partially contributes to the psychological stress induced proliferation and chemoresistance in HT29 cells, shedding light on increasing the therapeutic strategies of cancer chemotherapy.

Pu, Jun [Department of General Surgery, Tangdu Hospital of the Fourth Military Medical University, Xi'an 710038 (China)] [Department of General Surgery, Tangdu Hospital of the Fourth Military Medical University, Xi'an 710038 (China); Bai, Danna [Department of Cardiology, 323 Hospital of PLA, Xi'an 710054 (China)] [Department of Cardiology, 323 Hospital of PLA, Xi'an 710054 (China); Yang, Xia [Department of Teaching and Medical Administration, Tangdu Hospital of the Fourth Military Medical University, Xi'an 710038 (China)] [Department of Teaching and Medical Administration, Tangdu Hospital of the Fourth Military Medical University, Xi'an 710038 (China); Lu, Xiaozhao [Department of Nephrology, The 323 Hospital of PLA, Xi'an 710054 (China)] [Department of Nephrology, The 323 Hospital of PLA, Xi'an 710054 (China); Xu, Lijuan, E-mail: 13609296272@163.com [Department of Nephrology, The 323 Hospital of PLA, Xi'an 710054 (China)] [Department of Nephrology, The 323 Hospital of PLA, Xi'an 710054 (China); Lu, Jianguo, E-mail: lujianguo029@yahoo.com.cn [Department of General Surgery, Tangdu Hospital of the Fourth Military Medical University, Xi'an 710038 (China)] [Department of General Surgery, Tangdu Hospital of the Fourth Military Medical University, Xi'an 710038 (China)

2012-11-16T23:59:59.000Z

278

Quark-gluon plasma phenomenology from anisotropic lattice QCD  

E-Print Network [OSTI]

The FASTSUM collaboration has been carrying out simulations of N_f=2+1 QCD at nonzero temperature in the fixed-scale approach using anisotropic lattices. Here we present the status of these studies, including recent results for electrical conductivity and charge diffusion, and heavy quarkonium (charm and beauty) physics.

Jon-Ivar Skullerud; Gert Aarts; Chris Allton; Alessandro Amato; Yannis Burnier; P. Wynne M. Evans; Pietro Giudice; Simon Hands; Tim Harris; Aoife Kelly; Seyong Kim; Maria Paola Lombardo; Mehmet B. Oktay; Alexander Rothkopf; Sinéad M. Ryan

2014-12-30T23:59:59.000Z

279

Photoresist Trimming in Oxygen-Based High-Density Plasmas:? Effect of HBr and Cl2 Addition to CF4/O2 Mixtures  

Science Journals Connector (OSTI)

Cl2/CF4/O2c ... using NF3, CF4, SiF4, Cl2, HBr, and He/O2. ... Resist trimming in high-density CF4/O2 plasmas for sub-0.1 ?m device fabrication ...

Chian-Yuh Sin; Bing-Hung Chen; W. L. Loh; J. Yu; P. Yelehanka; A. See; L. Chan

2003-10-23T23:59:59.000Z

280

Inclusive spectra in charmless semileptonic B decays by dressed gluon exponentiation.  

E-Print Network [OSTI]

assignments of the parameter C that controls the residue of the Borel singularity in the Sudakov exponent at u = 32 : C = 0.01 is shown as a dotdashed line while the default value C = 1 and C = 2, 4, 6, 8, 10, 12 are shown as full lines. with Nf = 4 by setting...

Andersen, Jeppe R; Gardi, Einan

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Expression of Nuclear Factor-?B and I?B? Proteins in Prostatic Adenocarcinomas: Correlation of Nuclear Factor-?B Immunoreactivity with Disease Recurrence  

Science Journals Connector (OSTI)

...Pharmaceuticals, Inc. The costs of publication of this...edu. Fig. 1. A, nuclear factor-kB (NFkB...Hashizume K, et al Nuclear factor-kB p65 (RelA...Jaffe BM, Beckman BS. NF-kB-mediated...expression of RelA/nuclear factor-kB protein correlates...

Jeffrey S. Ross; Bhaskar V. S. Kallakury; Christine E. Sheehan; Hugh A. G. Fisher; Ronald P. Kaufman, Jr.; Prabhjot Kaur; Karen Gray; and Bradley Stringer

2004-04-01T23:59:59.000Z

282

Active roles for inhibitory ?B kinases ? and ? in nuclear factor-?B–mediated chemoresistance to doxorubicin  

Science Journals Connector (OSTI)

...Baldwin) equally. The costs of publication of this...transcription factor nuclear factor-kappaB (NF-kappaB...Evidence that activation of nuclear factor-kappaB is essential...regulation of RelA (p65) nuclear factor-kappaB transactivation...Stinchcombe TE, Mitchell BS, et al. Phase I trial...

Brian K. Bednarski; Xiaoyu Ding; Kavita Coombe; Albert S. Baldwin; and Hong J. Kim

2008-07-01T23:59:59.000Z

283

Inhibition of Nuclear Factor-?B DNA Binding by Organoselenocyanates through Covalent Modification of the p50 Subunit  

Science Journals Connector (OSTI)

...c) blockage of the nuclear activity of NF-kappaB...and P01-CA70972. The costs of publication of this...158-69. 13 Van Waes C. Nuclear factor-kappaB in development...Bharti AC, Aggarwal BB. Nuclear factor-kappaB and cancer...C, Cohen LA, Reddy BS. Inhibition of 7,12-dimethylbenz...

Kun-Ming Chen; Thomas E. Spratt; Bruce A. Stanley; Dan A. De Cotiis; Maria C. Bewley; John M. Flanagan; Dhimant Desai; Arunangshu Das; Emerich S. Fiala; Shantu Amin; and Karam El-Bayoumy

2007-11-01T23:59:59.000Z

284

Soluble Receptor Activator of Nuclear Factor ?B Fc Diminishes Prostate Cancer Progression in Bone  

Science Journals Connector (OSTI)

...Comparative Integrative Genomics. The costs of publication of this article...tumor necrosis factor; NF-kB, nuclear factor kB; RANKL, receptor...osteoblast perimeter (ObS/BS) represents the number of osteoblasts...osteoclast perimeter (OcS/BS) represents the number of osteoclasts...

Jian Zhang; Jinlu Dai; Zhi Yao; Yi Lu; William Dougall; and Evan T. Keller

2003-11-15T23:59:59.000Z

285

Reports and other Publications  

Science Journals Connector (OSTI)

... Stationery Office, 1962.) 47.25 NF.; 69s.; 13.50 dollars. [15Norsk Polarinstitutt. Skrifter Nr. 123: On the Snow Accumulation in Dronning Maud Land. By ... 60. Scientific Results, No. 1). Pp. iii4-48+4 plates. (Oslo: Norsk Polarinsfcitutt, 1961. Distributed by Oslo University Press, 1961.) 9kr. [15

1962-07-07T23:59:59.000Z

286

Soy isoflavones do not affect colon tumorigenesis: investigations in F1 generation of rats exposed pre and post-natally to soy isoflavones, or in a rat model emulating a high risk for developing colon cancer  

Science Journals Connector (OSTI)

...Epithelial-to-Mesenchymal Transition by Repressing Forkhead Box F1 Jeanette Nilsson 1 Khalil Helou 2 Aniko...factor 1-C2 (NF1-C2) and Forkhead box F1 (FoxF1), downstream of prolactin/nuclear...suppressor of EMT, (e) that the Forkhead box F1 gene (FoxF1) is a direct target of transcriptional...

Gacheri Ann Kiunga; Rekha Mehta; Eric Lok; Ivan Curran; Gerard Cooke; Donald Caldwell; Rudolf Mueller; Jayadev Raju; Ranjana Bird

2007-05-01T23:59:59.000Z

287

Copyright 2002 by the Genetics Society of America Approximate Bayesian Computation in Population Genetics  

E-Print Network [OSTI]

statistics with their ally, the next step would be to accept with probability null distribution under and Statistics, University of Kent, Canterbury, Kent CT2 7NF, United Kingdom and Department of Epidemiology propose a new method for approximate Bayesian statistical inference on the basis of summary statistics

Hadly, Elizabeth

288

The Status of Mirror Research Based on a Workshop in  

E-Print Network [OSTI]

Construction, Confinement, and Power Balance · Circular coils enable smaller end plugs and higher fields by Deuterium Neutral Beams 10 #12;recent achievements max 60% nf 5x1019 m-3 11 GDT Central Beta Reaches 60.al., J. Fusion Energy, 17, p253 (1998) · [2] J. Pratt & W. Horton, Phys. Plasmas, 13,042513 (2006) · [3

289

letters to nature 90 NATURE |VOL 406 |6 JULY 2000 |www.nature.com  

E-Print Network [OSTI]

as indicated and analysed. EMSA The kB-binding activities of embryonic ®broblasts incubated with lithium, equivalent amounts of nuclear extract protein (3 mg) were preincubated for 5 min with a 200-fold excess. To examine the effect of lithium treatment on NF-kB-mediated gene transcription, HEK293 epithelial cells were

Botstein, David

290

Nanofiltration separation of polyvalent and monovalent anions in desalination brines  

Science Journals Connector (OSTI)

Abstract This work, as part of a global membrane process for the recovery of alkali and acids from reverse osmosis (RO) desalination brines, focuses on the nanofiltration (NF) separation of polyvalent and monovalent anions, more specifically sulfate and chloride. This pretreatment stage plays a key role in the whole recovery process. Working with model brines simulating the concentration of RO concentrates, 0.2–1.2 M chloride concentration and 0.1 M sulfate concentration, the experimental performance and modeling of the NF separation is reported. The study has been carried out with the NF270 (Dow Filmtec) membrane. The effect of operating pressure (500–2000 kPa), ionic strength (0.4–1.3 M) and chloride initial concentration (0.2–1.2 M) on the membrane separation capacity has been investigated. Finally, the Donnan Steric Pore Model (DSPM) together with experimentally determined parameters, effective pore radius (rp), thickness of the membrane effective layer (?) and effective membrane charge density (Xd), was proved accurate enough to satisfactorily describe the experimental results. In this work we provide for the first time the analysis of partitioning effects and transport mechanism in the NF separation of sulfate and chloride anions in concentrations that simulate those found in RO desalination brines.

A. Pérez-González; R. Ibáñez; P. Gómez; A.M. Urtiaga; I. Ortiz; J.A. Irabien

2015-01-01T23:59:59.000Z

291

A Mouse Model for the Carney Complex Tumor Syndrome Develops Neoplasia in Cyclic AMP–Responsive Tissues  

Science Journals Connector (OSTI)

...Lymphoproliferative disease 318 F 23.9 + + Bronchioloalveolar carcinoma, pit adenoma 290 F 24.3 + + + (Usual, atypical) Carcinoma 974...Genet 2000;9:3055-64. 45 Zhu Y, Ghosh P, Charnay P, Burns DK, Parada LF. Neurofibromas in NF1: Schwann cell origin and...

Lawrence S. Kirschner; Donna F. Kusewitt; Ludmila Matyakhina; William H. Towns II; J. Aidan Carney; Heiner Westphal; and Constantine A. Stratakis

2005-06-01T23:59:59.000Z

292

Inhibition of the Acetyltransferases p300 and CBP Reveals a Targetable Function for p300 in the Survival and Invasion Pathways of Prostate Cancer Cell Lines  

Science Journals Connector (OSTI)

...transition of PC3 and LNCaP cells through 8-mum pores of a poly(ethylene terephthalate) membrane in Boyden chambers assays (Fig...37. Palayoor ST , Youmell MY, Calderwood SK, Coleman CN, Price BD. Constitutive activation of IkappaB kinase alpha and NF-kappaB...

Frédéric R. Santer; Philipp P.S. Höschele; Su Jung Oh; Holger H.H. Erb; Jan Bouchal; Ilaria T. Cavarretta; Walther Parson; David J. Meyers; Philip A. Cole; and Zoran Culig

2011-09-01T23:59:59.000Z

293

Possibility of c-axis voltage steps for a cuprate superconductor in a resonant cavity I. Tornes* and D. Stroud  

E-Print Network [OSTI]

, when driven by currents parallel to the c axis, behave like stacks of underdamped Josephson junctions's in stacks of artificial Josephson junctions. We conclude that such steps might be observable with a suitably, 74.25.Nf I. INTRODUCTION Barbara et al.1 have recently shown that underdamped Josephson-junction

Stroud, David

294

Coherence transition of small Josephson junctions coupled to a single-mode resonant cavity: Connection to the Dicke model  

E-Print Network [OSTI]

Coherence transition of small Josephson junctions coupled to a single-mode resonant cavity 5 February 2009 PACS: 74.50.+r 74.25.Nf 85.25.Cp 64.60.Cn Keywords: Josephson junctions properties of a collection of N small Josephson junctions coupled to a single-mode resonant electromagnetic

Stroud, David

295

Alphavirus production is inhibited in neurofibromin 1-deficient cells through activated RAS signalling  

SciTech Connect (OSTI)

Virus-host interactions essential for alphavirus pathogenesis are poorly understood. To address this shortcoming, we coupled retrovirus insertional mutagenesis and a cell survival selection strategy to generate clonal cell lines broadly resistant to Sindbis virus (SINV) and other alphaviruses. Resistant cells had significantly impaired SINV production relative to wild-type (WT) cells, although virus binding and fusion events were similar in both sets of cells. Analysis of the retroviral integration sites identified the neurofibromin 1 (NF1) gene as disrupted in alphavirus-resistant cell lines. Subsequent analysis indicated that expression of NF1 was significantly reduced in alphavirus-resistant cells. Importantly, independent down-regulation of NF1 expression in WT HEK 293 cells decreased virus production and increased cell viability during SINV infection, relative to infected WT cells. Additionally, we observed hyperactive RAS signalling in the resistant HEK 293 cells, which was anticipated because NF1 is a negative regulator of RAS. Expression of constitutively active RAS (HRAS-G12V) in a WT HEK 293 cell line resulted in a marked delay in virus production, compared with infected cells transfected with parental plasmid or dominant-negative RAS (HRAS-S17N). This work highlights novel host cell determinants required for alphavirus pathogenesis and suggests that RAS signalling may play an important role in neuronal susceptibility to SINV infection.

Kolokoltsova, Olga A. [Department of Biochemistry and Molecular Biology, University of Texas Medical Branch, Galveston, TX (United States)], E-mail: oakoloko@utmb.edu; Domina, Aaron M. [Department of Biochemistry and Molecular Biology, University of Texas Medical Branch, Galveston, TX (United States)], E-mail: aaron.domina@enc.edu; Kolokoltsov, Andrey A. [Department of Microbiology and Immunology, University of Texas Medical Branch, Galveston, TX (United States)], E-mail: aakoloko@utmb.edu; Davey, Robert A. [Department of Microbiology and Immunology, University of Texas Medical Branch, Galveston, TX (United States)]|[Sealy Center for Structural Biology, University of Texas Medical Branch, Galveston, TX (United States)], E-mail: radavey@utmb.edu; Weaver, Scott C. [Department of Microbiology and Immunology, University of Texas Medical Branch, Galveston, TX (United States)]|[Department of Pathology, University of Texas Medical Branch, Galveston, TX (United States)]|[Sealy Center for Vaccine Development, University of Texas Medical Branch, Galveston, TX (United States)], E-mail: sweaver@utmb.edu; Watowich, Stanley J. [Department of Biochemistry and Molecular Biology, University of Texas Medical Branch, Galveston, TX (United States)]|[Sealy Center for Structural Biology, University of Texas Medical Branch, Galveston, TX (United States)]|[Sealy Center for Vaccine Development, University of Texas Medical Branch, Galveston, TX (United States)], E-mail: watowich@xray.utmb.edu

2008-07-20T23:59:59.000Z

296

INTRODUCTION Neural intermediate filaments (NIF) containing one or more of  

E-Print Network [OSTI]

INTRODUCTION Neural intermediate filaments (NIF) containing one or more of five different types, NIF possess common structural features, including a conserved alpha-helical central rod domain of NIF in the presence of NF-L (Zackroff et al., 1982; Hisanaga and Hirokawa, 1988; Balin and Lee, 1991

Goldman, Robert D.

297

ISBN 3-938345-05-5 Int. Meeting on Substrate-Integrated Microelectrodes, 2008 1  

E-Print Network [OSTI]

Z at 1 kHz increases the signal to noise ratio, the knowledge of the Z(f) variation inside a larger : electrochemical circu- its including for example Warburg impedance show better concordance with experimental data of a theoretical RC// circuit with R=10 M and C=100nF. The equivalent electrochemical circuit fitting MEA Z(f) data

Paris-Sud XI, Université de

298

Depositional environment of lower Green River Formation sandstones (Eocene), Red Wash field (Uinta Basin), Uintah County, Utah  

E-Print Network [OSTI]

control on reservoir properties, and predict reservoir geometry and morphology. This thesis follows the f'ormat and style nf the American Associa- tion of Petroleum Geolo ists Bulletin. WYOMING UTAH MO?T U i N T~ ~WASATCH MTS. /y 8'G ROOSEVELT...

McClain, Anthony Scott

2012-06-07T23:59:59.000Z

299

Systemic Administration of Polymeric Nanoparticle-Encapsulated Curcumin (NanoCurc) Blocks Tumor Growth and Metastases in Preclinical Models of Pancreatic Cancer  

Science Journals Connector (OSTI)

...free curcumin is a potent inhibitor of NF-kappaB activity in...bioavailable small-molecule inhibitor of Hedgehog signaling inhibits...Chemosensitization to cisplatin by inhibitors of the Fanconi anemia/BRCA...of curcumin in alginate-chitosan-pluronic composite nanoparticles...

Savita Bisht; Masamichi Mizuma; Georg Feldmann; Niki A. Ottenhof; Seung-Mo Hong; Dipankar Pramanik; Venugopal Chenna; Collins Karikari; Rajni Sharma; Michael G. Goggins; Michelle A. Rudek; Rajani Ravi; Amarnath Maitra; and Anirban Maitra

2010-08-01T23:59:59.000Z

300

Nanofiltration of hazardous Congo red dye: Performance and flux decline analysis  

Science Journals Connector (OSTI)

Abstract The effectiveness of nanofiltration (NF) for dye wastewater treatment has been well established. However, detailed study on the fouling phenomena during the NF of dye is still limited. This paper provides the understanding on the performance and fouling phenomena of the polypiperazine amide nanofiltration (PA–NF) membrane for the treatment of hazardous Congo red (CR) dye. The 20 mg L?1 dye at pH 9 was successfully 100% removed with minimum flux decline under the specific conditions: room temperature (25 °C) and trans-membrane pressure 5 bar. In addition, the membrane retained more Na2SO4 (62–91%) than NaCl (14–31%), owing to the ion size and negative charges on the membrane surface. The experimental results showed that fouling was the significant reason of the membrane flux decline which principally caused by the favourable/irreversible adsorption. Mechanisms of the PA–NF membrane fouling were investigated using the linearized forms according to Wiesner and Aptel equations. It had been found that the fouling mechanisms were influenced by the solution pH and concentration. Under 20 mg L?1 of initial CR concentration at pH 9, the decline of permeate flux was due to standard blocking mechanism during the initial filtration. The cake formation took place rapidly at the second stage of filtration which contributed to the relatively constant permeate flux decline.

Nur Hanis Hayati Hairom; Abdul Wahab Mohammad; Abdul Amir Hassan Kadhum

2014-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

P–T evolution and timing of a late Palaeozoic fore-arc system and its heterogeneous Mesozoic overprint in north-central Chile (latitudes 31–32°S)  

Science Journals Connector (OSTI)

...Universita¤t Potsdam after neutron activation of polished sections (1 cm diameter) at the Geesthacht Neutron Facility (GeNF) of the GKSS in Geesthacht, Germany. The polished thick-sections were wrapped in commercial Al foils and set into...

ARNE P. WILLNER; HANS-JOACHIM MASSONNE; UWE RING; MASAFUMI SUDO; STUART N. THOMSON

302

The multistage exhumation history of the Kaghan Valley UHP series, NW Himalaya, Pakistan from U-Pb and 40Ar/39Ar ages  

Science Journals Connector (OSTI)

...irradiated for 96 h in position 6 of the ICI (In Core Irradiation) system in the Geesthacht Neutron Facility (GeNF) at FRG-1, GKSS research centre at Geesthacht (Germany). The neutron flux variation over the length of the sample capsule...

Franziska D.H. Wilke; Patrick J. O’Brien; Axel Gerdes; Martin J. Timmerman; Masafumi Sudo; M. Ahmed Khan

303

Measurement of the fluence response of the GSI neutron ball in high-energy neutron fields produced by 500 AMeV and 800 AMeV deuterons  

Science Journals Connector (OSTI)

......investigations by means of Monte Carlo methods(1,2)-was carried out for thermal energies at the GeNF facility at GKSS (Geesthacht, Germany) and in the quasi-monoenergetic neutron fields at the PTB accelerator facility (Braunschweig, Germany) for......

G. Fehrenbacher; F. Gutermuth; E. Kozlova; T. Radon; T. Aumann; S. Beceiro; T. Le Bleis; K. Boretzky; H. Emling; H. Johansson; O. Kiselev; H. Simon; S. Typel

2007-08-01T23:59:59.000Z

304

Two-dimensional position-sensitive gaseous detectors for high-resolution neutron and X-ray diffraction  

Science Journals Connector (OSTI)

Two-dimensional position-sensitive gaseous detectors have been developed at the Geesthacht Neutron Facility (GeNF) for high-resolution...2, 3He/CF4 and Xe/CO2, respectively. One neutron detector is used at the AR...

M. Marmotti; M. Haese-Seiller; R. Kampmann

2002-12-01T23:59:59.000Z

305

Published: August 12, 2011 r 2011 American Chemical Society 8483 dx.doi.org/10.1021/es201654k |Environ. Sci. Technol. 2011, 45, 84838490  

E-Print Network [OSTI]

such as microfiltration (MF), reverse osmosis (RO), and ultraviolet irradiation with advanced oxidation processes (UV for desalination processes such as reverse osmosis (RO) and nanofiltration (NF) to protect the membranes from-Scale Investigation of Trace Organic Compounds Rejection by Forward Osmosis Nathan T. Hancock, Pei Xu, Dean M. Heil

306

1 Removal of Trace Organic Chemicals and Performance of a Novel 2 Hybrid Ultrafiltration-Osmotic Membrane Bioreactor  

E-Print Network [OSTI]

diluted during the process. A reverse osmosis (RO) system is then used to 16 reconcentrate the diluted DS, additional 46 treatment processes such as nanofiltration (NF) or reverse 47 osmosis (RO),3-7 activated carbon from municipal wastewater. The UFO-MBR 10 system uses both ultrafiltration (UF) and forward osmosis (FO

307

This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research  

E-Print Network [OSTI]

-barrier protection of drinking water, reduction in reverse osmosis membrane fouling due to impurities in impaired, such as reverse osmosis (RO) and nanofiltration (NF), are capable of rejecting most dissolved constituents 2010 Accepted 29 June 2010 Available online 5 August 2010 Keywords: Osmosis Forward osmosis Osmotic

308

Final External Peer Review Report for Freeport Harbor, Texas  

E-Print Network [OSTI]

Final External Peer Review Report for Freeport Harbor, Texas Draft Feasibility Report. W911NF-07-D-0001 Task Control Number: 08192 August 20, 2008 #12;FINAL EXTERNAL PEER REVIEW REPORT Battelle Final External Peer Review Report August 20, 2008 TABLE OF CONTENTS EXECUTIVE SUMMARY

US Army Corps of Engineers

309

Nuclear Janus-Activated Kinase 2/Nuclear Factor 1-C2 Suppresses Tumorigenesis and Epithelial-to-Mesenchymal Transition by Repressing Forkhead Box F1  

Science Journals Connector (OSTI)

...Association for Cancer Research. 1 March 2010 research-article Tumor...Stem Cell Biology Nuclear Janus-Activated...component of the program, other EMT regulators...39). Future research will reveal how...patients with nuclear NF1-C2 staining...

Jeanette Nilsson; Khalil Helou; Anikó Kovács; Pär-Ola Bendahl; Gunnar Bjursell; Mårten Fernö; Peter Carlsson; and Marie Kannius-Janson

2010-03-01T23:59:59.000Z

310

Nuclear Factor-?B and Tumor-Associated Macrophages  

Science Journals Connector (OSTI)

...but recent research has highlighted...and function. Nuclear factor-kappaB...transcriptional programs (20). NF-kappaB...transcriptional program expressed by...et al. p50 nuclear factor-kappaB...but recent research has highlighted...and function. Nuclear factor-kappaB...

Alessandra Mancino and Toby Lawrence

2010-02-01T23:59:59.000Z

311

JOURNAL OF LIGHTWAVE TECHNOLOGY, VOL. 31, NO. 19, OCTOBER 1, 2013 3181 Noise Figure in Near-Infrared Amorphous and  

E-Print Network [OSTI]

JOURNAL OF LIGHTWAVE TECHNOLOGY, VOL. 31, NO. 19, OCTOBER 1, 2013 3181 Noise Figure in Near-Infrared, Senior Member, IEEE Abstract--The noise figures (NF) of near-infrared (near-IR) amorphous silicon (a Amorphous and Mid-Infrared Crystalline Silicon Optical Parametric Amplifiers Jichi Ma and Sasan Fathpour

Fathpour, Sasan

312

Electromagnetic corrections to light hadron masses  

E-Print Network [OSTI]

At the precision reached in current lattice QCD calculations, electromagnetic effects are becoming numerically relevant. We will present preliminary results for electromagnetic corrections to light hadron masses, based on simulations in which a $\\mathrm{U}(1)$ degree of freedom is superimposed on $N_f=2+1$ QCD configurations from the BMW collaboration.

A. Portelli; S. Dürr; Z. Fodor; J. Frison; C. Hoelbling; S. D. Katz; S. Krieg; T. Kurth; L. Lellouch; T. Lippert; K. K. Szabó; A. Ramos

2011-01-12T23:59:59.000Z

313

Marco Apollonio, Alan Bross, Joachim Kopp (Presenter), Ken Long (on behalf of the collaboration) The International Design Study for the Neutrino FactoryThe International Design Study for the Neutrino Factory  

E-Print Network [OSTI]

Nozzle Tube SC-1 SC-2 SC-3 SC-4 SC-5 Window Mercur y Drains Mercury Pool Water-cooled Tungsten Shield target / fluidized powder time Layout of the Neutrino Factory according to the IDS-NF scheme Agitation of mercury pool surface due to a 20 m/s impinging jet Emittance reduction and Transmission in the cooling

McDonald, Kirk

314

Large System Analysis of Beamforming for MIMO Systems with Limited Training  

E-Print Network [OSTI]

and the power allocated to training operation and data transmission was evaluated in [3]. In particularLarge System Analysis of Beamforming for MIMO Systems with Limited Training Francisco Rubio, and the DARPA IT- MANET program Grant W911NF-07-1-0028. optimum number of pilots and training power allocation

Honig, Michael L.

315

Nesting-based Relational-to-XML Schema Translation  

E-Print Network [OSTI]

Nesting-based Relational-to- XML Schema Translation Dongwon Lee Murali Mani Frank Chiu Wesley W Proposed Techniques Flat Translation (FT) Nesting-based Translation (NeT) Translation using InclusionDB'01 Nesting Nested relational model: allows non-1NF Nest operator: nesting on column X collects all

Lee, Dongwon

316

Mysteries of the lightest nuclear systems R. Lazauskas,  

E-Print Network [OSTI]

In this contribution current advances and challenge in low energy few- nucleon scattering problem are discussed. SomeNF,..), however nuclear binding energies being strongly correlated does not permit to form a full of already the simplest nuclear reactions meets serious theoretical drawbacks on the formal level, resulting

Boyer, Edmond

317

Quark-gluon plasma phenomenology from anisotropic lattice QCD  

E-Print Network [OSTI]

The FASTSUM collaboration has been carrying out simulations of N_f=2+1 QCD at nonzero temperature in the fixed-scale approach using anisotropic lattices. Here we present the status of these studies, including recent results for electrical conductivity and charge diffusion, and heavy quarkonium (charm and beauty) physics.

Skullerud, Jon-Ivar; Allton, Chris; Amato, Alessandro; Burnier, Yannis; Evans, P Wynne M; Giudice, Pietro; Hands, Simon; Harris, Tim; Kelly, Aoife; Kim, Seyong; Lombardo, Maria Paola; Oktay, Mehmet B; Rothkopf, Alexander; Ryan, Sinéad M

2015-01-01T23:59:59.000Z

318

The effects of ethylenediurea and sodium erythorbate on photosynthetic function of ozone-exposed loblolly pine seedlings  

E-Print Network [OSTI]

-top chambers in east Texas for one growing season beginning in April 1994 while being exposed to either sub-ambient (CF), approximate ambient (NF), 1.5Y,, 2.OX, or 2.5X ambient ozone levels. Net photosynthesis (A), stomatal conductance (g), and chloroplast...

Kuehler, Eric Anthony

2012-06-07T23:59:59.000Z

319

SIRT1 inactivation induces inflammation through the dysregulation of autophagy in human THP-1 cells  

SciTech Connect (OSTI)

Highlights: Black-Right-Pointing-Pointer SIRT1 inactivation decreases autophagy in THP-1 cell. Black-Right-Pointing-Pointer Inhibition of autophagy induces inflammation. Black-Right-Pointing-Pointer SIRT1 inactivation induces inflammation through NF-{kappa}B activation. Black-Right-Pointing-Pointer The p62/Sqstm1 accumulation by impairment of autophagy is related to NF-{kappa}B activation. Black-Right-Pointing-Pointer SIRT1 inactivation is involved in the activation of mTOR and decreased AMPK activation. -- Abstract: Inflammation plays a crucial role in atherosclerosis. Monocytes/macrophages are some of the cells involved in the inflammatory process in atherogenesis. Autophagy exerts a protective effect against cellular stresses like inflammation, and it is regulated by nutrient-sensing pathways. The nutrient-sensing pathway includes SIRT1, a NAD{sup +}-dependent histone deacetylase, which is implicated in the regulation of a variety of cellular processes including inflammation and autophagy. The mechanism through which the dysfunction of SIRT1 contributes to the regulation of inflammation in relation to autophagy in monocytes/macrophages is unclear. In the present study, we demonstrate that treatment with 2-[(2-Hydroxynaphthalen-1-ylmethylene)amino]-N-(1-phenethyl)benzamide (Sirtinol), a chemical inhibitor of SIRT1, induces the overexpression of inflammation-related genes such as tumor necrosis factor (TNF)-{alpha} and interleukin (IL)-6 through nuclear factor (NF)-{kappa}B signaling activation, which is associated with autophagy dysfunction, as shown through p62/Sqstm1 accumulation and decreased expression of light chain (LC) 3 II in THP-1 cells. The autophagy inhibitor, 3-methyladenine, also induces inflammation-related NF-{kappa}B activation. In p62/Sqstm1 knockdown cells, Sirtinol-induced inflammation through NF-{kappa}B activation is blocked. In addition, inhibition of SIRT1 is involved in the activation of the mammalian target of rapamycin (mTOR) pathway and is implicated in decreased 5 Prime -AMP activated kinase (AMPK) activation, leading to the impairment of autophagy. The mTOR inhibitor, rapamycin, abolishes Sirtinol-induced inflammation and NF-{kappa}B activation associated with p62/Sqstm1 accumulation. In summary, SIRT1 inactivation induces inflammation through NF-{kappa}B activation and dysregulates autophagy via nutrient-sensing pathways such as the mTOR and AMPK pathways, in THP-1 cells.

Takeda-Watanabe, Ai; Kitada, Munehiro; Kanasaki, Keizo [Diabetology and Endocrinology, Kanazawa Medical University, Kahoku-Gun, Ishikawa (Japan)] [Diabetology and Endocrinology, Kanazawa Medical University, Kahoku-Gun, Ishikawa (Japan); Koya, Daisuke, E-mail: koya0516@kanazawa-med.ac.jp [Diabetology and Endocrinology, Kanazawa Medical University, Kahoku-Gun, Ishikawa (Japan)] [Diabetology and Endocrinology, Kanazawa Medical University, Kahoku-Gun, Ishikawa (Japan)

2012-10-12T23:59:59.000Z

320

Silencing MR-1 attenuates inflammatory damage in mice heart induced by AngII  

SciTech Connect (OSTI)

Myofibrillogenesis regulator-1(MR-1) can aggravate cardiac hypertrophy induced by angiotensin(Ang) II in mice through activation of NF-{kappa}B signaling pathway, and nuclear transcription factor (NF)-{kappa}B and activator protein-1(AP-1) regulate inflammatory and immune responses by increasing the expression of specific inflammatory genes in various tissues including heart. Whether inhibition of MR-1 expression will attenuate AngII-induced inflammatory injury in mice heart has not been explored. Herein, we monitored the activation of NF-{kappa}B and AP-1, together with expression of pro-inflammatory of interleukin(IL)-6, tumor necrosis factor(TNF)-{alpha}, vascular-cell adhesion molecule (VCAM)-1, platelet endothelial cell adhesion molecule (PECAM), and inflammatory cell infiltration in heart of mice which are induced firstly by AngII (PBS),then received MR-1-siRNA or control-siRNA injecting. We found that the activation of NF-{kappa}B and AP-1 was inhibited significantly, together with the decreased expression of IL-6, TNF-{alpha}, VCAM-1, and PECAM in AngII-induced mice myocardium in MR-1-siRNA injection groups compared with control-siRNA injecting groups. However, the expression level of MR-1 was not an apparent change in PBS-infused groups than in unoperation groups, and MR-1-siRNA do not affect the expression of MR-1 in PBS-infused mice. Our findings suggest that silencing MR-1 protected mice myocardium against inflammatory injury induced by AngII by suppression of pro-inflammatory transcription factors NF-{kappa}B and AP-1 signaling pathway.

Dai, Wenjian [Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences, Key Lab of Antibiotic Biotechnology, Ministry of Health, Beijing 100050 (China) [Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences, Key Lab of Antibiotic Biotechnology, Ministry of Health, Beijing 100050 (China); Hunan Environment-Biological Polytechnic College, Hengyang Hunan 421005 (China); Chen, Haiyang [Hunan Environment-Biological Polytechnic College, Hengyang Hunan 421005 (China)] [Hunan Environment-Biological Polytechnic College, Hengyang Hunan 421005 (China); Jiang, Jiandong [Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences, Key Lab of Antibiotic Biotechnology, Ministry of Health, Beijing 100050 (China)] [Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences, Key Lab of Antibiotic Biotechnology, Ministry of Health, Beijing 100050 (China); Kong, Weijia, E-mail: wjkong894@sohu.com [Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences, Key Lab of Antibiotic Biotechnology, Ministry of Health, Beijing 100050 (China)] [Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences, Key Lab of Antibiotic Biotechnology, Ministry of Health, Beijing 100050 (China); Wang, Yiguang, E-mail: wangyh456@yahoo.com.cn [Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences, Key Lab of Antibiotic Biotechnology, Ministry of Health, Beijing 100050 (China)] [Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences, Key Lab of Antibiotic Biotechnology, Ministry of Health, Beijing 100050 (China)

2010-01-15T23:59:59.000Z

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Anti-inflammatory activity of structurally related flavonoids, Apigenin, Luteolin and Fisetin  

Science Journals Connector (OSTI)

Flavonoids are widely distributed in many fruits and plants, and it has been shown that most flavonoids have anti-inflammatory activity; however, the mechanisms of how the flavonoids exhibit their anti-inflammatory activity have not been clarified. We therefore focus on flavonoids Apigenin, Luteolin and Fisetin because of their related structure. We found that these compounds significantly inhibited TNF?-induced NF-?B transcriptional activation; however, they had no effect on the degradation of I?B proteins and the nuclear translocation and DNA binding activity of NF-?B p65. Interestingly, the suppression of NF-?B activation by these flavonoids is due to inhibition of the transcriptional activation of NF-?B, since the compounds markedly inhibited the transcriptional activity of GAL4-NF-?B p65 fusion protein. In addition, while Apigenin and Luteolin slightly inhibited TNF?-induced JNK activation, they had no effect on TNF?-induced activation of ERK and p38. Unexpectedly, Fisetin enhanced and sustained activation of ERK and JNK but not p38 in response to TNF?. Strikingly, TNF?-induced expression of CCL2/MCP-1 and CXCL1/KC was significantly inhibited by Apigenin and Luteolin but not Fisetin. Furthermore, the administration of Apigenin and Luteolin markedly inhibited acute carrageenan-induced paw edema in mice; however, Fisetin failed to have an effect. These observations strongly suggest that the slight structural difference in flavonoids may cause a defective effect of Fisetin on these inflammatory responses, and this may be due to the differences in their direction of the effect on the activation pathways of MAP kinases.

Megumi Funakoshi-Tago; Kei Nakamura; Kenji Tago; Tadahiko Mashino; Tadashi Kasahara

2011-01-01T23:59:59.000Z

322

Tetramethylpyrazine attenuates TNF-?-induced iNOS expression in human endothelial cells: Involvement of Syk-mediated activation of PI3K-IKK-I?B signaling pathways  

SciTech Connect (OSTI)

Endothelial cells produce nitric oxide (NO) by activation of constitutive nitric oxide synthase (NOS) and transcription of inducible NO synthase (iNOS). We explored the effect of tetramethylpyrazine (TMP), a compound derived from chuanxiong, on tumor necrosis factor (TNF)-?-induced iNOS in human umbilical vein endothelial cells (HUVECs) and explored the signal pathways involved by using RT-PCR and Western blot. TMP suppressed TNF-?-induced expression of iNOS by inhibiting I?B kinase (IKK) phosphorylation, I?B degradation and nuclear factor ?B (NF-?B) nuclear translocation, which were required for NO gene transcription. Exposure to wortmannin abrogated IKK/I?B/NF-?B-mediated iNOS expression, suggesting activation of such a signal pathway might be phosphoinositide-3-kinase (PI3K) dependent. Spleen tyrosine kinase (Syk) inhibitor piceatannol significantly inhibited NO production. Furthermore, piceatannol obviously suppressed TNF-?-induced I?B phosphorylation and the downstream NF-?B activation, suggesting that Syk is an upstream key regulator in the activation of PI3K/IKK/I?B-mediated signaling. TMP significantly inhibited TNF-?-induced phosphorylation of Syk and PI3K. Our data indicate that TMP might repress iNOS expression, at least in part, through its inhibitory effect of Syk-mediated PI3K phosphorylation in TNF-?-stimulated HUVECs. -- Highlights: •TMP suppressed TNF-?-induced expression of iNOS by inhibiting IKK/I?B/NF-?B pathway. •PI3K inhibitor wortmannin abrogated IKK/I?B/NF-?B-mediated iNOS expression. •Syk inhibitor piceatannol repressed PI3K/IKK/I?B mediated NO production. •Syk is an upstream regulator in the activation of PI3K/IKK/I?B-mediated signaling. •TMP might repress iNOS expression through Syk-mediated PI3K pathway.

Zheng, Zhen; Li, Zhiliang; Chen, Song; Pan, Jieyi; Ma, Xiaochun, E-mail: zjoever@gmail.com

2013-08-15T23:59:59.000Z

323

Exposure to diesel exhaust up-regulates iNOS expression in ApoE knockout mice  

SciTech Connect (OSTI)

Traffic related particulate matter air pollution is a risk factor for cardiovascular events; however, the biological mechanisms are unclear. We hypothesize that diesel exhaust (DE) inhalation induces up-regulation of inducible nitric oxide synthase (iNOS), which is known to contribute to vascular dysfunction, progression of atherosclerosis and ultimately cardiovascular morbidity and mortality. Methods: ApoE knockout mice (30-week) were exposed to DE (at 200 {mu}g/m{sup 3} of particulate matter) or filtered-air (control) for 7 weeks (6 h/day, 5 days/week). iNOS expression in the blood vessels and heart was evaluated by immunohistochemistry and western blotting analysis. To examine iNOS activity, thoracic aortae were mounted in a wire myograph, and vasoconstriction stimulated by phenylephrine (PE) was measured with and without the presence of the specific inhibitor for iNOS (1400 W). NF-{kappa}B (p65) activity was examined by ELISA. The mRNA expression of iNOS and NF-{kappa}B (p65) was determined by real-time PCR. Results: DE exposure significantly enhanced iNOS expression in the thoracic aorta (4-fold) and heart (1.5 fold). DE exposure significantly attenuated PE-stimulated vasoconstriction by {approx} 20%, which was partly reversed by 1400 W. The mRNA expression of iNOS and NF-{kappa}B was significantly augmented after DE exposure. NF-{kappa}B activity was enhanced 2-fold after DE inhalation, and the augmented NF-{kappa}B activity was positively correlated with iNOS expression (R{sup 2} = 0.5998). Conclusions: We show that exposure to DE increases iNOS expression and activity possibly via NF-{kappa}B-mediated pathway. We suspect that DE exposure-caused up-regulation of iNOS contributes to vascular dysfunction and atherogenesis, which could ultimately lead to urban air pollution-associated cardiovascular morbidity and mortality. - Highlights: > Exposed ApoE knockout mice (30-week) to diesel exhaust (DE) for 7 weeks. > Examine iNOS expression and activity in the blood vessels and heart. > DE exposure enhanced iNOS protein and mRNA expression in the aorta and heart. > iNOS activity was also increased after DE exposure. > This up-regulation of iNOS may contribute to vascular dysfunction and atherogenesis.

Bai Ni [Department of Anesthesiology, Pharmacology and Therapeutics, University of British Columbia, Vancouver, BC (Canada); James Hogg Research Centre, Providence Heart and Lung Institute, St. Paul's Hospital, University of British Columbia, Vancouver, BC (Canada); Kido, Takashi [James Hogg Research Centre, Providence Heart and Lung Institute, St. Paul's Hospital, University of British Columbia, Vancouver, BC (Canada); Kavanagh, Terrance J.; Kaufman, Joel D.; Rosenfeld, Michael E. [Department of Occupational and Environmental Health, University of Washington, Seattle, WA (United States); Breemen, Cornelis van [Department of Anesthesiology, Pharmacology and Therapeutics, University of British Columbia, Vancouver, BC (Canada); Eeden, Stephan F. van, E-mail: Stephan.vanEeden@hli.ubc.ca [James Hogg Research Centre, Providence Heart and Lung Institute, St. Paul's Hospital, University of British Columbia, Vancouver, BC (Canada)

2011-09-01T23:59:59.000Z

324

Microsoft Word - Summary.doc  

Broader source: Energy.gov (indexed) [DOE]

Summary Summary To submit questions regarding this CMRR-NF SEIS, or to request a copy, please contact: AVAILABILITY OF THE FINAL SUPPLEMENTAL ENVIRONMENTAL IMPACT STATEMENT FOR THE NUCLEAR FACILITY PORTION OF THE CHEMISTRY AND METALLURGY RESEARCH BUILDING REPLACEMENT PROJECT AT LOS ALAMOS NATIONAL LABORATORY, LOS ALAMOS, NEW MEXICO (CMRR-NF SEIS) Printed with soy ink on recycled paper John Tegtmeier, EIS Document Manager Los Alamos Site Office National Nuclear Security Administration U.S. Department of Energy 3747 West Jemez Road Los Alamos, NM 87544 Telephone: 505-665-0113 Conceptual Drawing CMRR Facility Past Present Future Past Final Supplemental Environmental Impact Statement for the Nuclear Facility Portion of the Chemistry and Metallurgy Research Building Replacement Project

325

Manufacturing Consumption of Energy 1994  

U.S. Energy Information Administration (EIA) Indexed Site

A9. A9. Total Inputs of Energy for Heat, Power, and Electricity Generation by Fuel Type, Census Region, and End Use, 1994: Part 1 (Estimates in Btu or Physical Units) See footnotes at end of table. Energy Information Administration/Manufacturing Consumption of Energy 1994 166 End-Use Categories (trillion Btu) kWh) (1000 bbl) (1000 bbl) cu ft) (1000 bbl) tons) (trillion Btu) Total (million Fuel Oil Diesel Fuel (billion LPG (1000 short Other Net Distillate Natural and Electricity Residual Fuel Oil and Gas Breeze) a b c Coal (excluding Coal Coke d RSE Row Factors Total United States RSE Column Factors: NF 0.5 1.3 1.4 0.8 1.2 1.2 NF TOTAL INPUTS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16,515 778,335 70,111 26,107 5,962 25,949 54,143 5,828 2.7 Indirect Uses-Boiler Fuel . . . . . . . . . . . . . . . . . . . . . . . --

326

Low Dose Radiation Research Program: Universities  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Universities Universities | Duke University | Loma Linda University | Northwestern University | University of Chicago | University of California Davis | Northwestern University University of Chicago University of California Davis Effects of Low Dose Irradiation on NF-κB Signaling Networks and Mitochondria Principal Investigator: Dr. Gayle Woloschak DOE Low Dose Research Program Projects Low dose-low dose rate irradiation leads to long term changes in numbers of mitochondria and mitochondrial genomes - Principal Investigator: Gayle Woloschak, Professor, Department of Radiation Oncology, Northwestern University, Chicago, IL, USA NF-κB-mediated pro-survival network in low dose radiation-induced adaptive protection - Principal Investigator: Jian Jian Li, Professor, Department of Radiation Oncology, University of California Davis, Davis,

327

http://www.ornl.gov/Procurement.PDF  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

93 93 1. All Grade 5 and Grade 8 fasteners of foreign origin which do not bear any manufacturer's headmarks: Grade 5 Grade 8 2. Grade 5 fasteners with the following manufacturers' headmarks: J Jinn Her (TW) KS Kosaka Kogyo (JP) J KS 3. Grade 8 fasteners with the following manufacturers' headmarks: A Asahi Mfg (JP) KS Kosaka Kogyo (JP) A KS NF RT NF Nippon Fasteners (JP) RT Takai Ltd (JP) H Hinomoto Metal (JP) FM Fastener Co (of JP) H FM J M MS KY M Minamida Sieybo (JP) KY Kyoei (JP) MS Minato Kogyo (JP) J Jinn Her (JP) E Hollow Infasco Co. (CA TW JP YU) Triangle (sizes greater than 1/2-in dia) UNY E Daiei (JP) UNY Unytite (JP) 4. Grade 8.2 fasteners with the following headmarks: KS Kosaka Kogyo (JP) KS 5. Grade A325 Fasteners (Bennett Denver Target only) with the following headmarks: A325 KS Kosaka Kogyo (JP)

328

ORNL/RASA-85/1 RESULTS OF THE II4OBILE GAMMA SCANNING ACTIVITIES IN NIAGARA FALLS, NEvl YORK AREA  

Office of Legacy Management (LM)

Nf7 n-q Nf7 n-q gz75 tLtY r 1 irl,r:'a :.a l: i , l : i l ',:lr.:'. itl:t i .,,::l ' i , t . . ORNL/RASA-85/1 RESULTS OF THE II4OBILE GAMMA SCANNING ACTIVITIES IN NIAGARA FALLS, NEvl YORK AREA Access to the information in this report is limited to thoss indicated on the distribution list and io Department ol Energy ancl Depsrtment of Energy Contractors This report was prepared as an account ol work sponsored by an agency of the United States Government. Neither the U nited StatesGovernment nor any agency thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any informalion, apparatus, product, or process disclosed, or represents thal its use would not inf ringe

329

EIS-0350-S1: Draft Supplemental Environmental Impact Statement | Department  

Broader source: Energy.gov (indexed) [DOE]

Draft Supplemental Environmental Impact Statement Draft Supplemental Environmental Impact Statement EIS-0350-S1: Draft Supplemental Environmental Impact Statement Nuclear Facility Portion of the Chemistry and Metallurgy Research Building Replacement Project at Los Alamos National Laboratory, New Mexico National Nuclear Security Administration, a semiautonomous agency within DOE, proposes to complete the Chemistry and Metallurgy Research Building Replacement (CMRR) Project at Los Alamos National Laboratory (LANL) by constructing the nuclear facility portion (CMRR-NF) of the CMRR Project to provide the analytical chemistry and materials characterization capabilities currently or previously performed in the existing Chemistry and Metallurgy Research (CMR) Building. This CMRR-NF SEIS examines the potential environmental impacts associated with NNSA's proposed

330

Conceptual Drawing CMRR Facility Past  

Broader source: Energy.gov (indexed) [DOE]

Volume 1 Volume 1 Chapters 1 through 10 Appendices A through D To submit questions regarding this CMRR-NF SEIS, or to request a copy, please contact: AVAILABILITY OF THE FINAL SUPPLEMENTAL ENVIRONMENTAL IMPACT STATEMENT FOR THE NUCLEAR FACILITY PORTION OF THE CHEMISTRY AND METALLURGY RESEARCH BUILDING REPLACEMENT PROJECT AT LOS ALAMOS NATIONAL LABORATORY, LOS ALAMOS, NEW MEXICO (CMRR-NF SEIS) Printed with soy ink on recycled paper John Tegtmeier, EIS Document Manager Los Alamos Site Office National Nuclear Security Administration U.S. Department of Energy 3747 West Jemez Road Los Alamos, NM 87544 Telephone: 505-665-0113 Conceptual Drawing CMRR Facility Past Present Future Past Final Supplemental Environmental Impact Statement for the

331

D3-D7 background and flavor dependence of Regge trajectories  

Science Journals Connector (OSTI)

In the context of AdS/CFT with flavor, we consider the type IIB supergravity solution corresponding to a fully localized D3/D7 intersection. We complete the standard metric ansatz by providing an analytic expression for the warp factor, under the assumption of a logarithmically running axion-dilaton. From the gauge dual perspective, this behavior is related to the positive beta function of the N=4, d=4 SU(Nc) super Yang-Mills gauge theory, coupled to Nf fundamental N=2 hypermultiplets. We comment on the existence of tadpoles and relate them to the same gauge theory beta function. Next we consider a classical spinning string configuration in the decoupling limit of the D3/D7 geometry and extract the flavor (Nf) dependence of the associated meson Regge trajectory. Including the backreaction of the D7-branes in the supergravity dual allows for going beyond the quenched approximation on the dual gauge theory side.

Ingo Kirsch and Diana Vaman

2005-07-29T23:59:59.000Z

332

Infra-red divergences in the large-N expansion  

E-Print Network [OSTI]

We investigate a vectorial O(N) model with a generic nearest-neighbor interaction W(\\bsigma_i\\cdot \\bsigma_j) (depending on {\\cal N} tunable parameters), a Yukawa (and Gross Neveu) model with N_f fermions at finite temperature and the vectorial \\phi^6 model, in the large N (N_f) limit. All this models exhibit a Mean Field critical point for N=\\infinity. When 1/N fluctuations are included, infra red divergences appear near the critical point. In the framework of a generalized 1/N expansion we show that these divergences are related to a universal crossover mechanism between the Mean Field universality class (N=\\infinity) and the nonclassical one for N<\\infinity. For the generic nearest-neighbor interaction multicritical points are also investigated.

Bortolo Matteo Mognetti

2007-03-20T23:59:59.000Z

333

The influence of educational expenditures on educational attainment levels: a comparison of rural, urban, suburban, and metropolitan counties in the Southwest and Northeast United States  

E-Print Network [OSTI]

. The $1 la 0 0 V ro al 0 0 V c' I rrl cfog 0 I 4 a al 4 td 4J 0 ai 0 g td Ql QI j1 U 0 Ja V CQ Ot '0 Ql 4J V Ql QI c' 0 Ql QJ IO 0 Ql 'Cl u Qj 4J 4 0 QJ 0 0 0 cd Ch IJ 0 0 Ql al 8 ttl 0 4J 0 0 CJ al '0 4. J aj 4... Lelsud l'. Pnsuor'h Submll. ted to the Grsdusto Colleg. of . 'uses A ll Uuiu. I. Jtv fu f srti!" . . ul TJ llm! ot. nf tie rcqv'rts! nt for the degree nf J1ASTER OF SCT !ECE December J. 97h Pic Jor S!!bject: So-ioJ! At- THE INFLUENCE OF EDUCATIONAL...

Bosworth, Leland D

2012-06-07T23:59:59.000Z

334

Investigation of cracking and leaking of nuclear reactor pools  

E-Print Network [OSTI]

nf Ql ced coal. l 8 te Bnd. 8 5 f t *bi ck out ex' pox't1an Gf 183. nf arced high aensity tlal'3 te. Bggl*egate concx'ete? Tbcx'8 3 8 also 8 O. 2 j xn. BIIUBinUQI liner l Gne 181 ge, slUml num thai lllal cQ1Umn thx'QUgl'I the caner'e*e wall snd. 6... and vertical plane but slope up and down as one portion of cracliing is joined to another (Figure 6b ). fj: V:~N) ~ E P f l: Fignre 6b. Gsl!ch Patherxls on Pood Nail. Gage points have heen located et points. i thxough 6, shovxl on Figare 3q Bhont Kl d...

Cooper, William Bernard

2012-06-07T23:59:59.000Z

335

Design and development of a high-temperature sodium compatibility testing facility  

SciTech Connect (OSTI)

The use of advanced alloys within sodium-cooled fast reactors (SFRs) has been identified as a means of increasing plant efficiency and reducing construction costs. In particular, alloys such as NF-616, NF-709 and HT-UPS are promising because they exhibit greater strength than traditional structural materials such as 316-SS. However, almost nothing is known about the sodium compatibility of these new alloys. Therefore, research taking place at the Univ. of Wisconsin-Madison is focused on studying the effects of sodium corrosion on these materials under prototypic SFR operating conditions (600 [ deg. C], V Na=10 [m/s], C 0{approx} 1 [wppm]). This paper focuses on the design and construction of the testing facility with an emphasis on moving magnet pumps (MMPs). Corrosion data from a preliminary 500 [hr] natural convection test will also be presented. (authors)

Hvasta, M. G.; Nolet, B. K.; Anderson, M. H. [Univ. of Wisconsin-Madison, 1500 Engineering Dr., Madison - ERB 841, WI 53705 (United States)

2012-07-01T23:59:59.000Z

336

Reverse osmosis performance of modified polyvinyl alcohol thin-film composite membranes  

SciTech Connect (OSTI)

Membrane separation characteristics in the nanofiltration (NF) and reverse osmosis (RO) regions of the filtration spectrum are governed by a complex combination of both steric hindrance and surface force interactions. NF and RO membranes having surface charges show unusual selectivity behavior not predicted on the basis of physical pore size alone. Hence, practical characterizations should employ techniques to gain insight on membrane function. In this work, the separation characteristics of an anionically charged modified polyvinyl alcohol (PVA) thin-film composite membrane under different operating pressures were investigated. A qualitative measurement of the surface force interactions between solutes and membrane polymer was conducted using liquid chromatography technique. An attempt was also made to study the chlorine resistance of the composite membrane.

Lang, K.; Chowdhury, G.; Matsuura, T.; Sourirajan, S. (Univ. of Ottawa, Ontario (Canada))

1994-08-01T23:59:59.000Z

337

Muon Collider design status  

SciTech Connect (OSTI)

Muon Collider (MC) - proposed by G.I. Budker and A.N. Skrinsky a few decades ago - is now considered as the most exciting option for the energy frontier machine in the post-LHC era. A national Muon Accelerator Program (MAP) is being formed in the USA with the ultimate goal of building a MC at the Fermilab site with c.o.m. energy in the range 1.5-3 TeV and luminosity of {approx} 1.5 {center_dot} 10{sup 34} cm{sup -2} s{sup -1}. As the first step on the way to MC it envisages construction of a Neutrino Factory (NF) for high-precision neutrino experiments. The baseline scheme of the NF-MC complex is presented and possible options for its main components are discussed.

Alexahin, Y.; /Fermilab

2010-09-01T23:59:59.000Z

338

Mercury Chamber Considerations  

E-Print Network [OSTI]

Mercury Chamber Considerations V. Graves IDS-NF Target Studies July 2011 #12;2 Managed by UT-Battelle for the U.S. Department of Energy Mercury Chamber Considerations, July 2011 Flow Loop Review · 1 cm dia nozzle, 20 m/s jet requires 1.57 liter/sec mercury flow (94.2 liter/min, 24.9 gpm). · MERIT experiment

McDonald, Kirk

339

Neutrino Factory Mercury Flow Loop  

E-Print Network [OSTI]

Neutrino Factory Mercury Flow Loop V. GravesV. Graves C. Caldwell IDS-NF Videoconference March 9, 2010 #12;Flow Loop Review · 1 cm dia nozzle, 20 m/s jet requires 1.57 liter/sec mercury flow (94 2 liter/min 24 9 gpm)mercury flow (94.2 liter/min, 24.9 gpm). · MERIT experiment showed that a pump

McDonald, Kirk

340

D-brane Configurations for Domain Walls and Their Webs  

SciTech Connect (OSTI)

Supersymmetric U(NC) gauge theory with NF massive hypermultiplets in the fundamental representation admits various BPS solitons like domain walls and their webs. In the first part we show as a review of the previous paper that domain walls are realized as kinky fractional D3-branes interpolating between separated D7-branes. In the second part we discuss brane configurations for domain wall webs. This is a contribution to the conference based on the talk given by MN.

Eto, Minoru; Isozumi, Youichi; Nitta, Muneto; Ohashi, Keisuke; Sakai, Norisuke [Department of Physics, Tokyo Institute of Technology, Tokyo 152-8551 (Japan); Ohta, Kazutoshi [Theoretical Physics Laboratory, Institute of Physical and Chemical Research (RIKEN), 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan)

2005-12-02T23:59:59.000Z

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Spring 2008 Qualifier -Part II 12 minute questions 11) Consider a parallel LCR circuit maintained at a temperature T >> h kB LC( ). Use  

E-Print Network [OSTI]

= vs 2 = constant , and assuming a spherically symmetric density distribution = r( ) = C r2 , find C in terms of vs and G. #12;14) A positron e+ is moving with a kinetic energy equal to its rest energy-dimensional gas of N free elections at T = 0 K is U0 = 3 5 NF , where F is the Fermi energy. #12;18) A straight

Yavuz, Deniz

342

First-Principles Calculations of the Pressure Stability and Elasticity of Dense TiO2 Phases Using the B3LYP Hybrid Functional  

Science Journals Connector (OSTI)

First-Principles Calculations of the Pressure Stability and Elasticity of Dense TiO2 Phases Using the B3LYP Hybrid Functional ... (41) The reciprocal space integration was carried out by sampling the Brillouin zone using an 8 × 8 × 8 Monkhorst–Pack grid. ... Computations were carried out at the National Computational Infrastructure – National Facility of Australia (http://nf.nci.org.au/). ...

Varghese Swamy; Nicholas C. Wilson

2014-04-07T23:59:59.000Z

343

Feeding Experiments with Steers and Hogs.  

E-Print Network [OSTI]

TEXAS AGRICULTURAL EXPERIMENT STATIONS FORT WORTH FEEDING STATION I BULLETIN NO. 135 November, 1910 Feeding Experiments With Steers and Hogs J. T. CRUSE Superintendent of Fort Worth Station POSTC'FFICE College Station, Rrazos County, Texas...~NF.~. ................................... .College Station Sri'dTTOX OFFICERS. R. H. HARI~INCTON. .................................... .Director J. FIT. CARSON. .......... .Assistant Director and Sta.te Feed Inspector 31. FRANCIS ........................................ Veterinarian G, S. FR-4...

Cruse, J.T.

1910-01-01T23:59:59.000Z

344

The electric dipole moment of the nucleon from simulations at imaginary vacuum angle theta  

E-Print Network [OSTI]

We compute the electric dipole moment of proton and neutron from lattice QCD simulations with N_f=2 flavors of dynamical quarks at imaginary vacuum angle theta. The calculation proceeds via the CP odd form factor F_3. A novel feature of our calculation is that we use partially twisted boundary conditions to extract F_3 at zero momentum transfer. As a byproduct, we test the QCD vacuum at nonvanishing theta.

R. Horsley; T. Izubuchi; Y. Nakamura; D. Pleiter; P. E. L. Rakow; G. Schierholz; J. Zanotti

2008-08-15T23:59:59.000Z

345

miR-122 targets NOD2 to decrease intestinal epithelial cell injury in Crohn’s disease  

SciTech Connect (OSTI)

Highlights: •NOD2 is a target gene of miR-122. •miR-122 inhibits LPS-induced apoptosis by suppressing NOD2 in HT-29 cells. •miR-122 reduces the expression of pro-inflammatory cytokines (TNF-? and IFN-?). •miR-122 promotes the release of anti-inflammatory cytokines (IL-4 and IL-10). •NF-?B signaling pathway is involved in inflammatory response induced by LPS. -- Abstract: Crohn’s disease (CD) is one of the two major types of inflammatory bowel disease (IBD) thought to be caused by genetic and environmental factors. Recently, miR-122 was found to be deregulated in association with CD progression. However, the underlying molecular mechanisms remain unclear. In the present study, the gene nucleotide-binding oligomerization domain 2 (NOD2/CARD15), which is strongly associated with susceptibility to CD, was identified as a functional target of miR-122. MiR-122 inhibited LPS-induced apoptosis by suppressing NOD2 in HT-29 cells. NOD2 interaction with LPS initiates signal transduction mechanisms resulting in the activation of nuclear factor ?B (NF-?B) and the stimulation of downstream pro-inflammatory events. The activation of NF-?B was inhibited in LPS-stimulated HT-29 cells pretreated with miR-122 precursor or NOD2 shRNA. The expression of the pro-inflammatory cytokines TNF-? and IFN-? was significantly decreased, whereas therelease of the anti-inflammatory cytokines IL-4 and IL-10 was increased in LPS-stimulated HT-29 cells pretreated with miR-122 precursor, NOD2 shRNA or the NF-?B inhibitor QNZ. Taken together, these results indicate that miR-122 and its target gene NOD2 may play an important role in the injury of intestinal epithelial cells induced by LPS.

Chen, Yu; Wang, Chengxiao; Liu, Ying; Tang, Liwei; Zheng, Mingxia [Department of Pediatrics, Jiangwan Hospital of Shanghai, Shanghai 200434 (China)] [Department of Pediatrics, Jiangwan Hospital of Shanghai, Shanghai 200434 (China); Xu, Chundi [Department of Pediatrics, Ruijin affiliated to Shanghai Jiaotong University School of Medicine, Shanghai, 200025 (China)] [Department of Pediatrics, Ruijin affiliated to Shanghai Jiaotong University School of Medicine, Shanghai, 200025 (China); Song, Jian, E-mail: jiansongkxy@126.com [Department of Gastroenterology, Jiangwan Hospital of Shanghai, Shanghai 200434 (China)] [Department of Gastroenterology, Jiangwan Hospital of Shanghai, Shanghai 200434 (China); Meng, Xiaochun [Department of Pediatrics, Jiangwan Hospital of Shanghai, Shanghai 200434 (China)] [Department of Pediatrics, Jiangwan Hospital of Shanghai, Shanghai 200434 (China)

2013-08-16T23:59:59.000Z

346

Loss-induced suppression and revival of lasing  

Science Journals Connector (OSTI)

...the resonators at {omega} ? (blue, I 1 of {mu}R 1 ; green, I 2 of {mu}R 2 ; red, total I T ) for (A) case 1 and...W911NF-12-1-0026. C.M.B. was supported by U.S. Department of Energy grant no. DE-FG02-91ER40628. F.N. is partially supported...

B. Peng; ?. K. Özdemir; S. Rotter; H. Yilmaz; M. Liertzer; F. Monifi; C. M. Bender; F. Nori; L. Yang

2014-10-17T23:59:59.000Z

347

Storage effects on desorption efficiencies of methyl ethyl ketone and styrene collected on activated charcoal  

E-Print Network [OSTI]

efficier&cy nf methyl etiiy', Ketone and styrene monomer adsorbed on activated charcoal samples, and stored under isotherm&al condit'ions, were investigated as a function of storage time. The dependence of the storage time effects on the storage temp...- erature and compound concentration were also studied. Results showed no siqnif', cant storag&e time effects on adsorbed styrene after sixty days of storage. A very significant decrease in the desorption ef iciency of methyl ethyl ketone was observed...

Dommer, Richard Alvin

2012-06-07T23:59:59.000Z

348

Evaluation of six cycles of reciprocal recurrent selection in maize  

E-Print Network [OSTI]

. The progress obtained was measured by the yield nf selections x composites and frequency di. stributions of higher yieldin- elec- tions. Variability was estimated by the standard deviatson, co- efficient of variation, and range of the . elections... ? composites yield trials. Coefficients of inbreeding were also calculated for each composite at th. . beginning of every cycle, Results indicated t?. at reciprocal recurrent selection improved the frequency of higher yielding selections in the Ferguson...

Llorente, Carlos Fernando

2012-06-07T23:59:59.000Z

349

VALIDATION DE METHODE D'ETALONNAGE ET EVALUATION DES INCERTITUDES DE MESURE EN ANALYSE  

E-Print Network [OSTI]

'INERIS, organisme accrédité ISO/CEI/17025, certifié ISO 9001 et reconnu BPL, a pour mission la maîtrise des risques mesure exposés dans ce document. Abstract : INERIS, a certified (ISO 9001) and accredited (ISO/CEI 17025 norme NF ISO 17993 [5]. Le diagramme d'Ishikawa de l'analyse du processus de mesure des HAP par CLHP

Boyer, Edmond

350

Dysregulation of nuclear factor kappa B activity and osteopontin expression in oxidant-induced atherogenesis  

E-Print Network [OSTI]

?????????????????.. 14 Fig. 3 A schematic representation of NF-? B activation????????.. 16 Fig. 4 A schematic representation of the allylamine model??????.? 24 Fig. 5 Metabolism and toxicity of acrolein?????????????.. 26 Fig. 6 Metabolism and toxicity of hydrogen... to acrolein and hydrogen peroxide in the vessel wall by semicarbazide-sensitive amine oxidase (SSAO). 24 Early experiments by Boor and Nelson demonstrated ?vigorous? acrolein production in aortic homogenates isolated from rats and humans, a levels six times...

Williams, Edward Spencer

2004-09-30T23:59:59.000Z

351

Results on the disconnected contributions for hadron structure  

E-Print Network [OSTI]

We present results on the disconnected contributions to three point functions entering in studies of hadron structure. We use $N_F = 2+1+1$ twisted mass fermions and give a detailed description on the results of the nucleon {\\sigma}-terms, isoscalar axial charge and first moments of bare parton distributions for a range of pions masses. In addition we give the {\\sigma}-terms and the computations are performed using QUDA code implemented on GPUs.

Constantia Alexandrou; Martha Constantinou; Vincent Drach; Kyriakos Hadjiyiannakou; Karl Jansen; Giannis Koutsou; Alejandro Vaquero

2014-10-31T23:59:59.000Z

352

Computation of disconnected contributions to nucleon observables  

E-Print Network [OSTI]

We compare several methods for computing disconnected fermion loops contributing to nucleon three-point functions. The comparison is carried out using one ensemble of $N_f=2+1+1$ twisted mass fermions with pion mass of 373 MeV. The complete set of operators up to one-derivative are examined by developing optimized code for mutli-GPUs. Simple guidelines are given as to the preferable method for each class of operators.

Constantia Alexandrou; Vincent Drach; Karl Jansen; Giannis Koutsou; Alejandro Vaquero

2014-01-27T23:59:59.000Z

353

R u t c o r R e p o r t  

E-Print Network [OSTI]

hereditary if ISub(G) ` P for every G 2 P . For a set Z of graphs denote FIS(Z) = fG : ISub(G) T Z = ;g. If P = FIS(Z) then Z is called a set of forbidden induced subgraphs (FIS) for P . A forbidden induced subgraph H 2 Z for P is minimal if ISub(H)nfHg ` P . A FIS­characterization of L l k is known when k = 2

354

ESAIM: Control, Optimisation and Calculus of Variations URL: http://www.emath.fr/cocv/  

E-Print Network [OSTI]

ESAIM: Control, Optimisation and Calculus of Variations URL: http://www.emath.fr/cocv/ December(fl(t))nf0g for almost every t: Let (; ) be the scalar product defined by g: The length of an admissible curve is: L(fl) = Z T 0 ( â?? fl(t); â?? fl(t)) 1 2 dt and the energy of fl is: E(fl) = Z T 0 ( â?? fl

Agrachev, Andrei

355

Modeling the -lectrons of Benzene as Particles on a Ring Calculate the wavelength of the photon required for the first allowed (HOMO-LUMO) electronic  

E-Print Network [OSTI]

+ nf 2 h 2 2 me C 2 = Fundamental constants and conversion factors: pm 10 12- m:= aJ 10 18- J:= h 6. Energy Level Diagram for Benzene's Electrons _______ _______4 h 2 2 m C 2 n = +/- 2 LUMO h 2 2 m C 2 ___xo___ ___xo___ n = +/- 1 HOMO ___xo___ 0 n = 0 Energy conservation requires: ni 2 h 2 2 me C 2 h c

Rioux, Frank

356

EIS-0350-S1: Supplemental Environmental Impact Statement for the Nuclear Facility Portion of the Chemistry and Metallurgy Research Building Replacement Project at Los Alamos National Laboratory, New Mexico  

Broader source: Energy.gov [DOE]

This Supplemental EIS evaluates the completion of the Chemistry and Metallurgy Research Building Replacement (CMRR) Project, which consists of constructing the nuclear facility portion (CMRR-NF) at Los Alamos National Laboratory (LANL). The CMRR Project provides the analytical chemistry and materials characterization capabilities currently or previously performed in the existing Chemistry and Metallurgy Research (CMR) Building. Because of recent detailed site geotechnical investigations, certain aspects of the CMRR-NR project have changed resulting in change to the environmental impacts.

357

de r eche r che INSTITUT NATIONAL DE RECHERCHE EN INFORMATIQUE ET EN AUTOMATIQUE  

E-Print Network [OSTI]

'' (R[ f\\Gamma1g; max; +), or the ``tropical semiring'' (N[f+1g;min;+), have been invented'algâ??ebre linâ??eaire (max,+) Râ??esumâ??e : Il s'agit d'une brâ??eve introduction au semi­anneau (max,+) et autres semiISSN 0249­6399 appo r t de r eche r che INSTITUT NATIONAL DE RECHERCHE EN INFORMATIQUE ET EN

O'Sullivan, Joseph A.

358

Assessment of energetic costs of AhR activation by ?-naphthoflavone in rainbow trout (Oncorhynchus mykiss) hepatocytes using metabolic flux analysis  

SciTech Connect (OSTI)

Exposure to environmental contaminants such as activators of the aryl hydrocarbon receptor (AhR) leads to the induction of defense and detoxification mechanisms. While these mechanisms allow organisms to metabolize and excrete at least some of these environmental contaminants, it has been proposed that these mechanisms lead to significant energetic challenges. This study tests the hypothesis that activation of the AhR by the model agonist ?-naphthoflavone (?NF) results in increased energetic costs in rainbow trout (Oncorhynchus mykiss) hepatocytes. To address this hypothesis, we employed traditional biochemical approaches to examine energy allocation and metabolism including the adenylate energy charge (AEC), protein synthesis rates, Na{sup +}/K{sup +}-ATPase activity, and enzyme activities. Moreover, we have used for the first time in a fish cell preparation, metabolic flux analysis (MFA) an in silico approach for the estimation of intracellular metabolic fluxes. Exposure of trout hepatocytes to 1 ?M ?NF for 48 h did not alter hepatocyte AEC, protein synthesis, or Na{sup +}/K{sup +}-ATPase activity but did lead to sparing of glycogen reserves and changes in activities of alanine aminotransferase and citrate synthase suggesting altered metabolism. Conversely, MFA did not identify altered metabolic fluxes, although we do show that the dynamic metabolism of isolated trout hepatocytes poses a significant challenge for this type of approach which should be considered in future studies. - Highlights: • Energetic costs of AhR activation by ?NF was examined in rainbow trout hepatocytes. • Metabolic flux analysis was performed on a fish cell preparation for the first time. • Exposure to ?NF led to sparing of glycogen reserves and altered enzyme activities. • Adenylate energy charge was maintained despite temporal changes in metabolism.

Nault, Rance, E-mail: naultran@msu.edu [Ottawa-Carleton Institute of Biology, Department of Biology and Centre for Advanced Research in Environmental Genomics, University of Ottawa, Ottawa, Ontario, K1N 6N5 (Canada); Abdul-Fattah, Hiba [Ottawa-Carleton Institute of Biology, Department of Biology and Centre for Advanced Research in Environmental Genomics, University of Ottawa, Ottawa, Ontario, K1N 6N5 (Canada); Mironov, Gleb G.; Berezovski, Maxim V. [Ottawa-Carleton Institute of Biology, Department of Biology and Centre for Advanced Research in Environmental Genomics, University of Ottawa, Ottawa, Ontario, K1N 6N5 (Canada); Department of Chemistry, University of Ottawa, Ottawa, Ontario, K1N 6N5 (Canada); Moon, Thomas W. [Ottawa-Carleton Institute of Biology, Department of Biology and Centre for Advanced Research in Environmental Genomics, University of Ottawa, Ottawa, Ontario, K1N 6N5 (Canada)

2013-08-15T23:59:59.000Z

359

Elevated COX2 expression and PGE2 production by downregulation of RXR? in senescent macrophages  

SciTech Connect (OSTI)

Highlights: •Downregulation of RXR? in senescent macrophage. •RXR? suppresses NF-?B activity and COX2 expression. •Increased PGE2 production due to downregulation of RXR?. -- Abstract: Increased systemic level of inflammatory cytokines leads to numerous age-related diseases. In senescent macrophages, elevated prostaglandin E2 (PGE2) production contributes to the suppression of T cell function with aging, which increases the susceptibility to infections. However, the regulation of these inflammatory cytokines and PGE2 with aging still remains unclear. We have verified that cyclooxygenase (COX)-2 expression and PGE2 production are higher in LPS-stimulated macrophages from old mice than that from young mice. Downregulation of RXR?, a nuclear receptor that can suppress NF-?B activity, mediates the elevation of COX2 expression and PGE2 production in senescent macrophages. We also have found less induction of ABCA1 and ABCG1 by RXR? agonist in senescent macrophages, which partially accounts for high risk of atherosclerosis in aged population. Systemic treatment with RXR? antagonist HX531 in young mice increases COX2, TNF-?, and IL-6 expression in splenocytes. Our study not only has outlined a mechanism of elevated NF-?B activity and PGE2 production in senescent macrophages, but also provides RXR? as a potential therapeutic target for treating the age-related diseases.

Chen, Huimin, E-mail: huiminchen.jq@gmail.com [Department of Geratology, Liaoning Jinqiu Hospital, Shenyang 110015 (China)] [Department of Geratology, Liaoning Jinqiu Hospital, Shenyang 110015 (China); Ma, Feng [Institute of Immunology, Zhejiang University of Medicine, Hangzhou 310058 (China)] [Institute of Immunology, Zhejiang University of Medicine, Hangzhou 310058 (China); Hu, Xiaona; Jin, Ting; Xiong, Chuhui [Department of Endocrinology and Metabolism, Institute of Endocrinology, Liaoning Provincial Key Laboratory of Endocrine Diseases, The First Affiliated Hospital of China Medical University, Shenyang 110001 (China)] [Department of Endocrinology and Metabolism, Institute of Endocrinology, Liaoning Provincial Key Laboratory of Endocrine Diseases, The First Affiliated Hospital of China Medical University, Shenyang 110001 (China); Teng, Xiaochun, E-mail: tengxiaochun@126.com [Department of Endocrinology and Metabolism, Institute of Endocrinology, Liaoning Provincial Key Laboratory of Endocrine Diseases, The First Affiliated Hospital of China Medical University, Shenyang 110001 (China)] [Department of Endocrinology and Metabolism, Institute of Endocrinology, Liaoning Provincial Key Laboratory of Endocrine Diseases, The First Affiliated Hospital of China Medical University, Shenyang 110001 (China)

2013-10-11T23:59:59.000Z

360

Rydberg states of HD  

Science Journals Connector (OSTI)

The triplet nf Rydberg states of HD with n=9–17, L=3, v=1, and R=1,3 have been observed and identified with the laser–molecular-beam method. A 20-eV electron beam excites a collimated HD beam to the metastable 2p ?3 state. Two counterpropagating cw single-frequency laser beams excite the metastable molecule first to the intermediate 3d ?3 state, then to a triplet nf Rydberg state. The transition frequencies between the 3d and nf states have been measured to an accuracy of 0.02 cm-1. The long-range model gives the transition frequencies to an accuracy of approximately 0.1 cm-1. Using these energy-level measurements, the ionization potential of the metastable state has been determined to be 27 460.98(30) cm-1 and the energy difference between the triplet metastable and the singlet ground state has been determined to be 97 105.50(30) cm-1. In addition, the linewidths of the triplet Rydberg states have been measured, giving the autoionization rates.

Sander H. Kim and Eric Mazur

1995-08-01T23:59:59.000Z

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Early embryonic lethality caused by targeted disruption of the TRAF-interacting protein (TRIP) gene  

SciTech Connect (OSTI)

Tumor necrosis factor receptor (TNFR)-associated factors (TRAFs) are key adaptor molecules in the TNFR-signaling complexes that promote a wide variety of signaling cascades including cell proliferation, activation, differentiation, and apoptosis. TRAF-interacting protein (TRIP) is required for the inhibitory regulation of TNF-induced NF-{kappa}B signaling via the TNFR/TRAF-signaling complexes in vitro. TRIP also directly interacts with the familial cylindromatosis tumor suppressor gene (CYLD) and negatively regulates NF-{kappa}B activation in vitro. However, although there appears to be a relationship between TRIP, the TRAFs and also CYLD as modulators of NF-{kappa}B signaling in vitro, the functional role of TRIP in vivo is still unclear. To identify the role of TRIP in vivo, we have generated TRIP-deficient mice. Homozygous mouse embryos were found to die shortly after implantation due to proliferation defects and excessive cell death. These results indicate that TRIP is an essential factor during early mouse embryonic development in vivo.

Park, Eui-Soon; Choi, Seunga [Department of Microbiology and BK21 BioBC, Chungnam National University, Daejeon 305-764 (Korea, Republic of); RCTCP, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Kim, Jin-Man [Department of Pathology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Jeong, Yongsu [Department of Pathology and Laboratory Medicine, University of Pennsylvania School of Medicine, Philadelphia, PA 19104 (United States); Choe, Joonho [Department of Biological Sciences, KAIST, Daejeon 305-701 (Korea, Republic of); Park, Chang-Sik [RCTCP, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Choi, Yongwon [Department of Pathology and Laboratory Medicine, University of Pennsylvania School of Medicine, Philadelphia, PA 19104 (United States); Rho, Jaerang [Department of Microbiology and BK21 BioBC, Chungnam National University, Daejeon 305-764 (Korea, Republic of); RCTCP, Chungnam National University, Daejeon 305-764 (Korea, Republic of)], E-mail: jrrho@cnu.ac.kr

2007-11-30T23:59:59.000Z

362

Solvothermal synthesis of NiAl double hydroxide microspheres on a nickel foam-graphene as an electrode material for pseudo-capacitors  

SciTech Connect (OSTI)

In this paper, we demonstrate excellent pseudo-capacitance behavior of nickel-aluminum double hydroxide microspheres (NiAl DHM) synthesized by a facile solvothermal technique using tertbutanol as a structure-directing agent on nickel foam-graphene (NF-G) current collector as compared to use of nickel foam current collector alone. The structure and surface morphology were studied by X-ray diffraction analysis, Raman spectroscopy and scanning and transmission electron microscopies respectively. NF-G current collector was fabricated by chemical vapor deposition followed by an ex situ coating method of NiAl DHM active material which forms a composite electrode. The pseudocapacitive performance of the composite electrode was investigated by cyclic voltammetry, constant charge–discharge and electrochemical impedance spectroscopy measurements. The composite electrode with the NF-G current collector exhibits an enhanced electrochemical performance due to the presence of the conductive graphene layer on the nickel foam and gives a specific capacitance of 1252 F g{sup ?1} at a current density of 1 A g{sup ?1} and a capacitive retention of about 97% after 1000 charge–discharge cycles. This shows that these composites are promising electrode materials for energy storage devices.

Momodu, Damilola; Bello, Abdulhakeem; Dangbegnon, Julien; Barzeger, Farshad; Taghizadeh, Fatimeh; Fabiane, Mopeli; Manyala, Ncholu, E-mail: ncholu.manyala@up.ac.za [Department of Physics, Institute of Applied Materials, SARChI Chair in Carbon Technology and Materials, University of Pretoria, Pretoria 0028, South Africa. (South Africa); Johnson, A. T. Charlie [Department of Physics and Astronomy, University of Pennsylvania, Philadelphia, Pennsylvania 19104 (United States)

2014-09-15T23:59:59.000Z

363

Expression of POEM, a positive regulator of osteoblast differentiation, is suppressed by TNF-{alpha}  

SciTech Connect (OSTI)

Highlights: {yields} TNF-{alpha} inhibits POEM gene expression. {yields} Inhibition of POEM gene expression is caused by NF-{kappa}B activation by TNF-{alpha}. {yields} Over-expression of POEM recovers inhibition of osteoblast differentiation by TNF-{alpha}. -- Abstract: POEM, also known as nephronectin, is an extracellular matrix protein considered to be a positive regulator of osteoblast differentiation. In the present study, we found that tumor necrosis factor-{alpha} (TNF-{alpha}), a key regulator of bone matrix properties and composition that also inhibits terminal osteoblast differentiation, strongly inhibited POEM expression in the mouse osteoblastic cell line MC3T3-E1. TNF-{alpha}-induced down-regulation of POEM gene expression occurred in both time- and dose-dependent manners through the nuclear factor kappa B (NF-{kappa}B) pathway. In addition, expressions of marker genes in differentiated osteoblasts were down-regulated by TNF-{alpha} in a manner consistent with our findings for POEM, while over-expression of POEM recovered TNF-{alpha}-induced inhibition of osteoblast differentiation. These results suggest that TNF-{alpha} inhibits POEM expression through the NF-{kappa}B signaling pathway and down-regulation of POEM influences the inhibition of osteoblast differentiation by TNF-{alpha}.

Tsukasaki, Masayuki [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)] [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Yamada, Atsushi, E-mail: yamadaa@dent.showa-u.ac.jp [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)] [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Suzuki, Dai [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)] [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Aizawa, Ryo [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan) [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan); Miyazono, Agasa [Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan)] [Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan); Miyamoto, Yoichi; Suzawa, Tetsuo; Takami, Masamichi; Yoshimura, Kentaro [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)] [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Morimura, Naoko [Laboratory for Comparative Neurogenesis, RIKEN Brain Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198 (Japan)] [Laboratory for Comparative Neurogenesis, RIKEN Brain Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198 (Japan); Yamamoto, Matsuo [Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan)] [Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan); Kamijo, Ryutaro [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)] [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)

2011-07-15T23:59:59.000Z

364

BPA-induced apoptosis of rat Sertoli cells through Fas/FasL and JNKs/p38 MAPK pathways  

Science Journals Connector (OSTI)

Abstract Bisphenol-A was examined for its effects on cultured Sertoli cells established from 18?22-day-old rat testes. Results indicated that exposure to BPA (0, 30, 50 and 70 ?M) decreased the cell viability in a concentration-dependent manner and induced cell apoptosis. Apoptosis-caused cell death was observed in cells exposed to 50 and 70 ?M BPA. The mRNA expressions of Fas, FasL and caspase-3 were all elevated, and the protein expressions of FasL and cleaved caspase-3 were also increased. In addition, levels of phosphorylation of JNKs/p38 MAPK were also increased and then activated JNKs/p38 MAPK up regulated target gene expressions, such as c-jun and CHOP. Translocation of NF-?B into nuclei indicated the activation of NF-?B after treatment with BPA. Taken together, observed results suggest that BPA induces apoptosis of Sertoli cells by the activation of JNKs/p38 MPAK and translocation of NF-?B, and Fas/FasL system plays a critical role in the initiation of apoptosis.

Suqin Qi; Wenjuan Fu; Chengmin Wang; Changjiang Liu; Chao Quan; Ansoumane Kourouma; Maosheng Yan; Tingting Yu; Peng Duan; Kedi Yang

2014-01-01T23:59:59.000Z

365

Influence of zinc oxide nanoparticles in the nanofiltration of hazardous Congo red dyes  

Science Journals Connector (OSTI)

Abstract Zinc oxide (ZnO) nanoparticles were produced via a simple and green precipitation method under stirring conditions (ZnO-St) and under ultrasonic radiation (ZnO-Us). The nanoparticles properties were characterised with X-ray fluorescence (XRF), X-ray diffractometry (XRD) and transmission electron microscopy (TEM); and compared with commercial ZnO and no ZnO. Their influence in the nanofiltration (NF) of hazardous Congo red dyes was studied in order to provide the fundamental understanding in the interacting effect of ZnO and NF membranes. The membrane performances were significantly improved after the addition of ZnO in the dye solution in descending order as follows: ZnO-Us > ZnO-St > commercial ZnO > no ZnO. It is believed that the preparation method, agglomerations and the morphology of nanoparticles influence their interaction with dye molecules and membrane surfaces. Membrane characterisations using contact angle, X-ray fluorescence (XRF), Field Emission Scanning electron microscopy (FESEM) and Energy Dispersive X-ray Analysis (EDX) confirmed that ZnO nanoparticles have great potential for fouling mitigation in industrial NF application.

Nur Hanis Hayati Hairom; Abdul Wahab Mohammad; Abdul Amir Hassan Kadhum

2015-01-01T23:59:59.000Z

366

Achieving very low mercury levels in refinery wastewater by membrane filtration.  

SciTech Connect (OSTI)

Microfiltration (MF), ultrafiltration (UF), nanofiltration (NF) and reverse osmosis (RO) membranes were evaluated for their ability to achieve the world's most stringent Hg discharge criterion (<1.3 ng/L) in an oil refinery's wastewater. The membrane processes were operated at three different pressures to demonstrate the potential for each membrane technology to achieve the targeted effluent mercury concentrations. The presence of mercury in the particulate form in the refinery wastewater makes the use of MF and UF membrane technologies more attractive in achieving very low mercury levels in the treated wastewater. Both NF and RO were also able to meet the target mercury concentration at lower operating pressures (20.7 bar). However, higher operating pressures ({ge}34.5 bar) had a significant effect on NF and RO flux and fouling rates, as well as on permeate quality. SEM images of the membranes showed that pore blockage and narrowing were the dominant fouling mechanisms for the MF membrane while surface coverage was the dominant fouling mechanism for the other membranes. The correlation between mercury concentration and particle size distribution was also investigated to understand mercury removal mechanisms by membrane filtration. The mean particle diameter decreased with filtration from 1.1 {+-} 0.0 {micro}m to 0.74 {+-} 0.2 {micro}m after UF.

Urgun Demirtas, M.; Benda, P.; Gillenwater, P. S.; Negri, M. C.; Xiong, H.; Snyder, S. W. (Center for Nanoscale Materials); ( ES)

2012-05-15T23:59:59.000Z

367

Concentration of marc extracts by membrane techniques  

Science Journals Connector (OSTI)

By-products obtained from red currant processing still contain large amounts of useful components, e.g. pectin. Pectin was extracted from red currant marc with water at a solid/liquid ratio of 1:10. To reduce the operating costs of further possessing, we concentrated the pectin solution by membrane separation, i.e. nanofiltration (NF) and reverse osmosis (RO). The objectives of our work were to study the effects of the operating pressure and cross-volume flow rate on the flux and on the membrane separation concentration ratio in order to establish the optimum operating conditions and to evaluate the contributions of the fouling, cake and membrane resistances to the overall resistance. Flat-sheet RO and a spiral-wound NF membrane were applied in the work. The conductivity, the color, the viscosity and the TSS of the permeate and the concentrate were followed during the measurements. Concentration by RO resulted in an increase of the TSS content to 4.28°Brix; for NF the corresponding level was 8.88°Brix. The membrane resistance and the fouling resistance were the determinant relative to the gel resistance.

C. Hodúr; Sz. Kertész; S. Beszédes; Zs. László; G. Szabó

2009-01-01T23:59:59.000Z

368

Low Dose Radiation Research Program: Jian Jian Li  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Jian Jian Li Jian Jian Li School of Health Sciences, Purdue University Newly Funded Projects Regulation of NF-kB and Mn SOD in Low Dose Radiation-Induced Adaptive Responses in Mouse and Human Skin Cells, abstract, description. Technical Abstracts 2006 Workshops: NF-kB Mediated Signaling Network in Low Dose X-Ray Induced Adaptive Protection on Mouse and Human Skin Epithelial Cells Ahmed, K.M., Fan, M., Spitz, and Li, J.J. 2005 Workshops: Adaptive Response of Mouse Skin Epithelial Cells to Low Dose Ionizing Radiation: Induction of NF-κB, MnSOD, 14-3-3ζ and Cyclin B1. Li, J.J., Ahmed, K.M., Fan, M., Dong, S., Spitz, D.R., and Yu, C.-R. 2003 Workshops: Gene Expression Profiles of Human Skin Keratinocytes Exposed to Acute and Chronic Ionizing Radiation Li, J.J., Ozeki, M., Wang, T., Tamae, D., Nelson, D., Wyrobek, A., and

369

NADPH oxidase/ROS-dependent PYK2 activation is involved in TNF-?-induced matrix metalloproteinase-9 expression in rat heart-derived H9c2 cells  

SciTech Connect (OSTI)

TNF-? plays a mediator role in the pathogenesis of chronic heart failure contributing to cardiac remodeling and peripheral vascular disturbances. The implication of TNF-? in inflammatory responses has been shown to be mediated through up-regulation of matrix metalloproteinase-9 (MMP-9). However, the detailed mechanisms of TNF-?-induced MMP-9 expression in rat embryonic-heart derived H9c2 cells are largely not defined. We demonstrated that in H9c2 cells, TNF-? induced MMP-9 mRNA and protein expression associated with an increase in the secretion of pro-MMP-9. TNF-?-mediated responses were attenuated by pretreatment with the inhibitor of ROS (N-acetyl-L-cysteine, NAC), NADPH oxidase [apocynin (APO) or diphenyleneiodonium chloride (DPI)], MEK1/2 (U0126), p38 MAPK (SB202190), JNK1/2 (SP600125), NF-?B (Bay11-7082), or PYK2 (PF-431396) and transfection with siRNA of TNFR1, p47{sup phox}, p42, p38, JNK1, p65, or PYK2. Moreover, TNF-? markedly induced NADPH oxidase-derived ROS generation in these cells. TNF-?-enhanced p42/p44 MAPK, p38 MAPK, JNK1/2, and NF-?B (p65) phosphorylation and in vivo binding of p65 to the MMP-9 promoter were inhibited by U0126, SB202190, SP600125, NAC, DPI, or APO. In addition, TNF-?-mediated PYK2 phosphorylation was inhibited by NAC, DPI, or APO. PYK2 inhibition could reduce TNF-?-stimulated MAPKs and NF-?B activation. Thus, in H9c2 cells, we are the first to show that TNF-?-induced MMP-9 expression is mediated through a TNFR1/NADPH oxidase/ROS/PYK2/MAPKs/NF-?B cascade. We demonstrated that NADPH oxidase-derived ROS generation is involved in TNF-?-induced PYK2 activation in these cells. Understanding the regulation of MMP-9 expression and NADPH oxidase activation by TNF-? on H9c2 cells may provide potential therapeutic targets of chronic heart failure. - Highlights: • TNF-? induces MMP-9 secretion and expression via a TNFR1-dependent pathway. • TNF-? induces ROS/PYK2-dependent MMP-9 expression in H9c2 cells. • TNF-? induces MMP-9 expression via a NADPH oxidase/ROS-dependent NF-?B signaling. • TNF-? activates MAPK phosphorylation through NADPH oxidase/ROS generation.

Yang, Chuen-Mao, E-mail: chuenmao@mail.cgu.edu.tw [Department of Physiology and Pharmacology and Health Aging Research Center, Chang Gung University, Kwei-San, Tao-Yuan, Taiwan (China); Heart Failure Center, Division of Cardiology, Department of Internal Medicine, Chang Gung Memorial Hospital at Keelung, Keelung, Taiwan (China); Lee, I-Ta [Department of Physiology and Pharmacology and Health Aging Research Center, Chang Gung University, Kwei-San, Tao-Yuan, Taiwan (China); Department of Anesthetics, Chang Gung Memorial Hospital at Linkou and College of Medicine, Chang Gung University, Kwei-San, Tao-Yuan, Taiwan (China); Hsu, Ru-Chun; Chi, Pei-Ling; Hsiao, Li-Der [Department of Physiology and Pharmacology and Health Aging Research Center, Chang Gung University, Kwei-San, Tao-Yuan, Taiwan (China)

2013-10-15T23:59:59.000Z

370

TRAF2 regulates the cytoplasmic/nuclear distribution of TRAF4 and its biological function in breast cancer cells  

SciTech Connect (OSTI)

Highlights: •TRAF2 appears to interact with TRAF4 in breast cancer cell lines. •TRAF2 affects the localization and function of TRAF4 in breast cancer cell lines. •TRAF4 may play an important role in the activation of NF-?B via TRAF2. -- Abstract: Although numerous studies have shown that tumor necrosis factor receptor-associated factor 4 (TRAF4) plays an important role in the carcinogenesis of many tumor types, its exact molecular mechanism remains elusive. In this study, we examined the regulation function of TRAF2 to the cytoplasmic/nuclear distribution of TRAF4 in the breast cancer cell line. Using cell immunofluorescent staining, we found that TRAF2 and TRAF4 were co-localized to the cytoplasm in MCF-7 cells. Co-immunoprecipitation showed that TRAF2 could interact with TRAF4 in MCF-10A, MCF-7 and MDA-MB-231 cell lines. Western blotting showed TRAF2 depletion by targeted siRNA in MDA-MB-231 cells led to reduced TRAF4 expression in the cytoplasm and augmented TRAF4 expression in the nucleus. Cytoplasmic expression of TRAF4 was augmented and nuclear expression was reduced when MCF-7 cells were transfected with hTRAF2pLPCX-HA-Flag/P874. MCF-7 cells expressing hTRAF2pLPCX-HA-Flag/P874 had enhanced cell proliferation rates. The nuclear expression of NF-?B significantly increased after TNF-? treatment. When hTRAF2pLPCX-HA-Flag/P874 and the siRNA-TRAF4 plasmid were cotransfected, the nuclear expression of NF-?B was significantly reduced compared with cells transfected with hTRAF2pLPCX-HA-Flag/P874 only. In conclusion, TRAF2 appears to interact with TRAF4 and affect the localization of TRAF4 in breast cancer cell lines. The overexpression of TRAF2 augmented the cytoplasmic expression of TRAF4 which promoted cell proliferation and inhibited cell apoptosis by activating NF-?B nuclear transcription. TRAF4 may play an important role in the activation of NF-?B via TRAF2.

Zhang, Xiaoli [Department of Pathology, The First Affiliated Hospital and College of Basic Medical Sciences of China Medical University, Shenyang 110001 (China)] [Department of Pathology, The First Affiliated Hospital and College of Basic Medical Sciences of China Medical University, Shenyang 110001 (China); Wen, Zhifeng [Department of Neurosurgery, The First Affiliated Hospital, China Medical University, Shenyang 110001 (China)] [Department of Neurosurgery, The First Affiliated Hospital, China Medical University, Shenyang 110001 (China); Sun, Limei; Wang, Jian; Song, Min; Wang, Enhua [Department of Pathology, The First Affiliated Hospital and College of Basic Medical Sciences of China Medical University, Shenyang 110001 (China)] [Department of Pathology, The First Affiliated Hospital and College of Basic Medical Sciences of China Medical University, Shenyang 110001 (China); Mi, Xiaoyi, E-mail: xiaoyi_mi@163.com [Department of Pathology, The First Affiliated Hospital and College of Basic Medical Sciences of China Medical University, Shenyang 110001 (China)] [Department of Pathology, The First Affiliated Hospital and College of Basic Medical Sciences of China Medical University, Shenyang 110001 (China)

2013-06-28T23:59:59.000Z

371

Functional Toll-like receptor 4 expressed in lactotrophs mediates LPS-induced proliferation in experimental pituitary hyperplasia  

SciTech Connect (OSTI)

Toll like receptor 4 (TLR4) has been characterized for its ability to recognize bacterial endotoxin lipopolysaccharide (LPS). Considering that infections or inflammatory processes might contribute to the progression of pituitary tumors, we analyzed the TLR4 functional role by evaluating the LPS effect on lactotroph proliferation in primary cultures from experimental pituitary tumors, and examined the involvement of PI3K-Akt and NF-?B activation in this effect. In addition, the role of 17?-estradiol as a possible modulator of LPS-induced PRL cell proliferation was further investigated. In estrogen-induced hyperplasic pituitaries, LPS triggered lactotroph cell proliferation. However, endotoxin failed to increase the number of lactotrophs taking up BrdU in normal pituitaries. Moreover, incubation with anti-TLR4 antibody significantly reduced LPS-induced lactotroph proliferation, suggesting a functional role of this receptor. As a sign of TLR4 activation, an LPS challenge increased IL-6 release in normal and tumoral cells. By flow cytometry, TLR4 baseline expression was revealed at the plasma membrane of tumoral lactotrophs, without changes noted in the percentage of double PRL/TLR4 positive cells after LPS stimulus. Increases in TLR4 intracellular expression were detected as well as rises in CD14, p-Akt and NF-?B after an LPS challenge, as assessed by western blotting. The TLR4/PRL and PRL/NF-?B co-localization was also corroborated by immunofluorescence and the involvement of PI3K/Akt signaling in lactotroph proliferation and IL-6 release was revealed through the PI3K inhibitor Ly-294002. In addition, 17?-estradiol attenuated the LPS-evoked increase in tumoral lactotroph proliferation and IL-6 release. Collectively these results demonstrate the presence of functional TLR4 in lactotrophs from estrogen-induced hyperplasic pituitaries, which responded to the proliferative stimulation and IL-6 release induced by LPS through TLR4/CD14, with a contribution of the PI3K-Akt and NF-?B signaling pathways. - Highlights: • In hyperplastic pituitaries, LPS triggered the lactotroph cell proliferation and IL-6 release. • Functional Toll-like receptor 4 (TLR4) is expressed at the plasma membrane of tumoral lactotrophs. • Increases in TLR4 and CD14 intracellular expression levels were detected after an LPS challenge. • The proliferative stimulation and IL-6 release involved the PI3K-Akt pathway and NF-?B activation. • 17?-estradiol attenuated the LPS-evoked tumoral lactotroph proliferation and IL-6 secretion.

Sabatino, María Eugenia; Sosa, Liliana del Valle; Petiti, Juan Pablo; Mukdsi, Jorge Humberto [Centro de Microscopía Electrónica, Instituto de Investigaciones en Ciencias de la Salud (INICSA-CONICET), Facultad de Ciencias Médicas, Universidad Nacional de Córdoba, Av. Enrique Barros y Enfermera Gordillo, Ciudad Universitaria, CP 5000, Córdoba (Argentina); Mascanfroni, Iván Darío; Pellizas, Claudia Gabriela [Centro de Investigaciones en Bioquímica Clínica e Inmunología (CIBICI-CONICET), Facultad de Ciencias Químicas, Universidad Nacional de Córdoba, Av. Haya de la Torre y Medina Allende, Ciudad Universitaria, CP 5000, Córdoba (Argentina); Gutiérrez, Silvina; Torres, Alicia Inés [Centro de Microscopía Electrónica, Instituto de Investigaciones en Ciencias de la Salud (INICSA-CONICET), Facultad de Ciencias Médicas, Universidad Nacional de Córdoba, Av. Enrique Barros y Enfermera Gordillo, Ciudad Universitaria, CP 5000, Córdoba (Argentina); De Paul, Ana Lucía, E-mail: adepaul@cmefcm.uncor.edu [Centro de Microscopía Electrónica, Instituto de Investigaciones en Ciencias de la Salud (INICSA-CONICET), Facultad de Ciencias Médicas, Universidad Nacional de Córdoba, Av. Enrique Barros y Enfermera Gordillo, Ciudad Universitaria, CP 5000, Córdoba (Argentina)

2013-11-15T23:59:59.000Z

372

In vivo treatment with diphenyl ditelluride induces neurodegeneration in striatum of young rats: Implications of MAPK and Akt pathways  

SciTech Connect (OSTI)

In the present report 15 day-old Wistar rats were injected with 0.3 ?mol of diphenyl ditelluride (PhTe){sub 2}/kg body weight and parameters of neurodegeneration were analyzed in slices from striatum 6 days afterwards. We found hyperphosphorylation of intermediate filament (IF) proteins from astrocyte (glial fibrillary acidic protein—GFAP and vimentin) and from neuron (low-, medium- and high molecular weight neurofilament subunits: NF-L, NF-M and NF-H, respectively) and increased MAPK (Erk, JNK and p38MAPK) as well as PKA activities. The treatment induced reactive astrogliosis in the striatum, evidenced by increased GFAP and vimentin immunocontent as well as their mRNA overexpression. Also, (PhTe){sub 2} significantly increased the propidium iodide (PI) positive cells in NeuN positive population without altering PI incorporation into GFAP positive cells, indicating that in vivo exposure to (PhTe){sub 2} provoked neuronal damage. Immunohistochemistry showed a dramatic increase of GFAP staining characteristic of reactive astrogliosis. Moreover, increased caspase 3 in (PhTe){sub 2} treated striatal slices suggested apoptotic cell death. (PhTe){sub 2} exposure decreased Akt immunoreactivity, however phospho-GSK-3-? (Ser9) was unaltered, suggesting that this kinase is not directly implicated in the neurotoxicity of this compound. Therefore, the present results shed light into the mechanisms of (PhTe){sub 2}-induced neurodegeneration in rat striatum, evidencing a critical role for the MAPK and Akt signaling pathways and disruption of cytoskeletal homeostasis, which could be related with apoptotic neuronal death and astrogliosis. -- Highlights: ? Diphenyl ditelluride causes apoptotic neuronal death in the striatum of young rats. ? Diphenyl ditelluride causes reactive astrogliosis in the striatum of rats. ? Diphenyl ditelluride disrupts the homeostasis of the cytoskeleton of the striatum. ? The actions of diphenyl ditelluride are mediated by MAPK and Akt signaling pathways.

Heimfarth, Luana; Loureiro, Samanta Oliveira; Dutra, Márcio Ferreira; Andrade, Cláudia; Pettenuzzo, Letícia; Guma, Fátima T. Costa Rodrigues; Gonçalves, Carlos Alberto Saraiva [Departamento de Bioquímica, Instituto de Ciências Básicas da Saúde, UFRGS, Porto Alegre, RS (Brazil)] [Departamento de Bioquímica, Instituto de Ciências Básicas da Saúde, UFRGS, Porto Alegre, RS (Brazil); Batista Teixeira da Rocha, João [Departamento de Química, Centro de Ciências Naturais e Exatas, Universidade Federal de Santa Maria, RS Brazil (Brazil); Pessoa-Pureur, Regina, E-mail: rpureur@ufrgs.br [Departamento de Bioquímica, Instituto de Ciências Básicas da Saúde, UFRGS, Porto Alegre, RS (Brazil)] [Departamento de Bioquímica, Instituto de Ciências Básicas da Saúde, UFRGS, Porto Alegre, RS (Brazil)

2012-10-15T23:59:59.000Z

373

Role of endoplasmic reticulum stress in acrolein-induced endothelial activation  

SciTech Connect (OSTI)

Acrolein is a ubiquitous environmental pollutant and an endogenous product of lipid peroxidation. It is also generated during the metabolism of several drugs and amino acids. In this study, we examined the effects of acrolein on endothelial cells. Treatment of human umbilical vein endothelial cells (HUVECs) with 2 to 10 {mu}M acrolein led to an increase in the phosphorylation of eIF-2{alpha} within 10 to 30 min of exposure. This was followed by alternate splicing of XBP-1 mRNA and an increase in the expression of the endoplasmic reticulum (ER) chaperone genes Grp78 and Herp. Within 2-4 h of treatment, acrolein also increased the abundance and the nuclear transport of the transcription factors ATF3, AFT4, and CHOP. Acrolein-induced increase in ATF3 was prevented by treating the cells with the chemical chaperone - phenylbutyric acid (PBA). Treatment with acrolein increased phosphorylation of ERK1/2, p38, and JNK. The increase in JNK phosphorylation was prevented by PBA. Acrolein treatment led to activation and nuclear translocation of the transcription factor NF-{kappa}B and an increase in TNF-{alpha}, IL-6 and IL-8, but not MCP-1, mRNA. Increased expression of cytokine genes and NF-{kappa}B activation were not observed in cells treated with PBA. These findings suggest that exposure to acrolein induces ER stress and triggers the unfolded protein response and that NF-{kappa}B activation and stimulation of cytokine production by acrolein could be attributed, in part, to ER stress. Chemical chaperones of protein-folding may be useful in treating toxicological and pathological states associated with excessive acrolein exposure or production.

Haberzettl, Petra; Vladykovskaya, Elena; Srivastava, Sanjay [Institute of Molecular Cardiology, Department of Medicine, University of Louisville, Louisville, KY 40202 (United States); Bhatnagar, Aruni [Institute of Molecular Cardiology, Department of Medicine, University of Louisville, Louisville, KY 40202 (United States)], E-mail: aruni@louisville.edu

2009-01-01T23:59:59.000Z

374

Table A18. Quantity of Electricity Sold to Utility and Nonutility Purchasers  

U.S. Energy Information Administration (EIA) Indexed Site

8. Quantity of Electricity Sold to Utility and Nonutility Purchasers" 8. Quantity of Electricity Sold to Utility and Nonutility Purchasers" " by Census Region, Industry Group, and Selected Industries, 1991" " (Estimates in Million Kilowatthours)" " "," "," "," "," ","RSE" "SIC"," "," ","Utility ","Nonutility","Row" "Code(a)","Industry Groups and Industry","Total Sold","Purchaser(b)","Purchaser(c)","Factors" ,,"Total United States" ,"RSE Column Factors:",0.9,1,1 , 20,"Food and Kindred Products",988,940,48,16.2 2011," Meat Packing Plants",0,0,0,"NF"

375

ESS 2012 Peer Review - Novel High Energy Density Dielectrics for Scalable Capacitor Needs - Geoff Brennecka, SNL  

Broader source: Energy.gov (indexed) [DOE]

Novel High Energy Density Novel High Energy Density Dielectrics for Scalable Capacitor Needs 27 September 2012 Geoff Brennecka The author gratefully acknowledges the support of Dr. Imre Gyuk and the Department of Energy's Office of Electricity Delivery and Energy Reliability. 400nF 2000V Project  Currently-available capacitor options force undesired choices:  (power, capacitance) vs. reliability  performance vs. (temperature, voltage) stability  Capacitors are often not deployed where they could be beneficial, or are deployed and fail (or are severely derated)  Stationary storage and related applications can realize significant value via improved capacitor performance and reliability  Improve reliability and efficiency of high temperature power electronics

376

Methodology for predicting asphalt concrete overlay life against reflection cracking  

E-Print Network [OSTI]

Performance Curve. 51 57 13 Regression Model for Damage Level 0. 33. . . 14 Regression Model for Damage Level 0. 40. . . 15 Regression Model for Damage Level 0. 50. . . 75 76 77 16 Determination of the Aggregate Interlock Ratio. . 80 C-1 C-2... of load applications to failure of the pavement, is related in the following manner to the maximum tensile stress, o, or tensile strain, c, occurring on the underside of the pavement caused by traffic load . (2) or mZ Nf - cZ(e) (3) The constants...

Jayawickrama, Priyantha Warnasuriya

2012-06-07T23:59:59.000Z

377

A Non-scaling Fixed Field Alternating Gradient Accelerator for the Final Acceleration Stage of the International Design Study of the Neutrino Factory.  

SciTech Connect (OSTI)

The International Design Study of the Neutrino Factory (IDS-NF) has recently completed its Interim Design Report (IDR), which presents our current baseline design of the neutrino factory. To increase the efficiency and reduce the cost of acceleration, the IDR design uses a linear non-scaling fixed field alternating gradient accelerator (FFAG) for its final acceleration stage. We present the current lattice design of that FFAG, including the main ring plus its injection and extraction systems. We describe parameters for the main ring magnets, kickers, and septa, as well as the power supplies for the kickers. We present a first pass at an engineering layout for the ring and its subsystems.

Berg, J.S.; Aslaninejad, M.; Pasternak, J.; Witte, H.; Bliss, N. Cordwell M.; Jones, T.; Muir, A., Kelliher, D.; Machida, S.

2011-09-04T23:59:59.000Z

378

Geology of the Hilda-Northwest Area, Mason County, Texas  

E-Print Network [OSTI]

the Paleozoic age cf thr ocks immediately overly1ng the granite. B. F. Shum?rrd (1861) cnnfirmed I&o?srrer? s earl)? r work. H. r?iso described the fossils of the region and sade ccrrelatiorn with fossils in the Potsdam group (Upper Car brian) nf l he llew..., and have becose superimposed on, the Paleozoic end Precambrian rocks. The principal streams that, drain the eastern end western portions of the thesis area are Beaver Creek, located aiout one-fourth of a mile east of the thesis area, and Panther Creek...

Fisher, Neil E

2012-06-07T23:59:59.000Z

379

A study of the distribution and ecology of macrobenthic communities in Eckerts Bayou on Galveston Island, Texas  

E-Print Network [OSTI]

locations with yearly average water depth ) 1. 00 m. 38 0 Salinitv p. ofiles in the Galveston area, . . . 40 Dissolved oxygen profiles in the G alveston "1 area, vazl es n kF +C B. Jo'' s sed mien s 14 January sub st rate class' fications for LIS OP.... 9 cm and was below average for 6 of 12 months; from Feoruary through July (excepting Apri little ra'nf=-. . l occur ec. T1is dr& pe "'od was 35 30 25 20 / I / v 15 10 / / / / A S 0 N D 1976 J F N A N J J 1977 Figure 6. Temperature...

Potts, Deborah Lynne

2012-06-07T23:59:59.000Z

380

A conversational Chinese Tutoring Machine  

E-Print Network [OSTI]

CAI (LAMBDA NIL (PROG1 (SET PARA) (CAIM07) (CAIM03) (CLRSCRN) (PRINTX '(Thanks for joining the Chinese Tutoring Machine) 9 15) (PRINTX '(bye bye !) 11 35) ) )) t*'0 '0'0************'k 'k*****V '@*It%'**'k**'k****'k**'@**1k *ll 'Nf****'k 0 'kt... **'0 * FUNCTION : CAIM03 This is the main driver function for lesson section. ***4'***1@*'0 4 4 'P * a%****'k 'k****'0**4 *V k*%**%'**%********%'**'I*V 4 4*** (DEFUN CAIM03 (LAMBDA NIL ( PROG1 (CAIM04) (COND ((EQUAL RES 'E) T) (T (CAIM05) (CAIM...

Cheng, Long-Fung

2012-06-07T23:59:59.000Z

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Beef Cattle Performance at Bluebonnet Farm.  

E-Print Network [OSTI]

in the same experiment, compute heritability as 72 percent. Patterson, et al. (1949 reported on the rate of gain of animals tested 21 the Balmorhea substation of the Texas Agricul., tural Experiment Station for a period of 7 year; Six to 10 bull progeny... and the TPXRS Ranire Ststion. a11 test~d anim"1~ A~D suhiect tn reaictratinn. nllr- ina tho fiwf 4 vo~r~ POVPT~~ hv thi~ ~n-alv~ic! . the , anjmglq werp in airp nrnaenv ornilns nf 7 nr mnre The rennirement of a minimi~m nnvber ner cirp g.roun fnr br...

Cartwright, T. C. (Thomas Campbell); Warwick, B. L. (Bruce Lester); Hazen, M. W. (Marian William)

1954-01-01T23:59:59.000Z

382

Development of Baseline Monthly Utility Models for Fort Hood, Texas  

E-Print Network [OSTI]

Development of Baseline Monthly Utility Models for Fort Hood, Texas' T.A. Reddy, N.F Saman, D.E. Claridge, J.S. Haberl , W.D. Turner Energy Systems Laboratory, Texas A&M University System College Station, TX and Alan Chalifoux Army Corps..., Texas" by N.F.Saman, T.A. Reddy, J.S.Haberl, DEClaridge and W.D.Turner prepared by Energy Systems Laboratory report ESL-TR-95110-01, Department of Mechanical Engineering, Texas A&M University, College Station, TX, October 1995. Fort Hood is a large...

Reddy, T. A.; Saman, N. F.; Claridge, D. E.; Haberl, J. S.; Turner, W. D.; Chalifoux, A.

1996-01-01T23:59:59.000Z

383

Development of Baseline Monthly Utility Models for Fort Hood, Texas  

E-Print Network [OSTI]

Development of Baseline Monthly Utility Models for Fort Hood, Texas+ T.A. Reddy, N.F Saman, D.E. Claridge, J.S. Haberl, W.D. Tumer Energy Systems Laboratory, Texas A&M University System College Station, TX and Alan Chalifoux Army Corps... and development of metering plan and shopping types of energy modeling software- the Princeton list for Fort Hood, Texas" by N.F.Saman, TA Scorekeeping method (PRISM) and EModel- in Reddy, J.S.Haberl, D.E.Claridge and W.D.Turner prepared by Energy Systems...

Reddy, T. A.; Saman, N. F.; Claridge, D. E.; Haberl, J. S.; Turner, W. D.; Chalifoux, A.

384

Two-colour QCD at non-zero temperature in the presence of a strong magnetic field  

E-Print Network [OSTI]

In this talk we report on our study of two-colour lattice QCD with N_f=4 staggered fermion degrees of freedom with equal electric charge q in a homogeneous magnetic field B at non-zero temperature T. We find indications for a non-monotonic behaviour of the critical temperature as a function of the magnetic field strength and, as a consequence, for the occurence of `inverse magnetic catalysis' within the transition region for magnetic fields in the range 0 < qB < 0.7 GeV^2.

M. Muller-Preussker; B. Petersson; A. Schreiber; E. -M. Ilgenfritz; M. Kalinowski

2014-02-01T23:59:59.000Z

385

Field Notes, Idaho, Borell & Orr (1930-1932)  

E-Print Network [OSTI]

?n? ?v? oatyyo6 xtf fsmyt oatyyo gsia onm ibxnsli ?kyytio,,,,, v ?n?to ?1? oatyyo6 xtf fsmyt ?nsl iat nfsqsl-y ?nito -ft lni -l ,, KKa-lqto sl mnfd oxtyyslq gtft do,rt, sjik-isnl gtft TT X U JL? ? ?b...? ,,,,,,,,,,,,,,,,, ,,,,,,,,,,,,,,,,,,, b,,,,,,,,,,,,,,,,w )tf j-ds ?nf kot oxtjs-y oattio sl Ukotkd lnit?nj V?xnokft dtitf,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,? )tf j-ds O-? msyitf -lr anyrtf,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,w ot? )tf j-ds Oy...

Davis, William B.

2012-04-09T23:59:59.000Z

386

Effective Action of Domain Wall Networks  

E-Print Network [OSTI]

U(Nc) gauge theory with Nf fundamental scalars admits BPS junctions of domain walls. When the networks/webs of these walls contain loops, their size moduli give localized massless modes. We construct Kahler potential of their effective action. In the large size limit Kahler metric is well approximated by kinetic energy of walls and junctions, which is understood in terms of tropical geometry. Kahler potential can be expressed in terms of hypergeometric functions which are useful to understand small size behavior. Even when the loop shrinks, the metric is regular with positive curvature. Moduli space of a single triangle loop has a geometry between a cone and a cigar.

Minoru Eto; Toshiaki Fujimori; Takayuki Nagashima; Muneto Nitta; Keisuke Ohashi; Norisuke Sakai

2006-12-01T23:59:59.000Z

387

Determination of naphthenic acids in California crudes and refinery waste waters by fluoride ion chemical ionization mass spectrometry  

SciTech Connect (OSTI)

A method based on negative ion chemical ionization mass spectrometry using fluoride (F/sup -/) ions produced from NF/sub 3/ reagent gas has been applied to the analysis of naphthenic acids in California crude oils and refinery waste waters. Since complex mixtures of naphthenic acids cannot be separated into individual components, only the determination of relative distribution of acids classified by the hydrogen deficiency was possible. The identities and relative distribution of paraffinic and mono-, di-, tri, and higher polycyclic acids were obtained from the intensities of the carboxylate (RCOO/sup -/) ions.

Dzidic, I.; Somerville, A.C.; Raia, J.C.; Hart, H.V.

1988-07-01T23:59:59.000Z

388

The relationship between soil water utilization and the phosphorus status of sorghum  

E-Print Network [OSTI]

THE RELATIONSHIP BETWEEN SOIL WATER UTILIZATION AND THE PHOSPHORUS S'rATUS OF SORGHUM A Thesis ABDOUL ABDOULAYE SOW Submitted to the Office of Gi adua. e Stuches of Texas A8-M University in partial fulfillment nf the requirements... for the desmee of MASTER OF SCIENCE May 1990 Major Subject: Soil Science THE RELATIONSHIP BETWEEN SOIL WATER UTILIZATION AND THE PHOSPHORUS STATUS OF SORGHUM A Thesis ABDOUL ABDOULAYE SOW Approved as to style and content, by: I loyd R. Hossner (Chair of...

Sow, Abdoul Abdoulaye

1990-01-01T23:59:59.000Z

389

Short Modern Winnebago Text with Song  

E-Print Network [OSTI]

~ki,heeg~zaan~n~kahigen~~xg~; 24 higen~~xg~gi,hige eeze: 26 wakenigra: huuksikjaan~n~grehakiiz~ nihehaniin~, 27 he he wakeigroo, wakeik. 93 28 29 30 31 32 33 34 35 36 teeg~xeiz~. hagoreeg~hokawas roogeJa, heeg~eeJa, eeJeeg-(l miikse. hagoreigewaazan~n~zigean~xg~ze. ... , , - zige... declarative sentence final, length + -nfJ. demonstrative suffix -ga dubitative suffix emphatic -gi- gnomic suffix-gaj~ intensivizer -xJi intransitivizer wa- locative suffix -eja negative particle hike,h~e,ke negative suffix -ni nominalizer passivizing suffix...

Miner, Kenneth L.

1982-01-01T23:59:59.000Z

390

KLF2 mutation is the most frequent somatic change in splenic marginal zone lymphoma and identifies a subset with distinct genotype  

E-Print Network [OSTI]

Jose Angel Martinez Climent,9 David Oscier,10 A 7 James Watkins,1,6 Ming-Qing Du1 8 9 1Division of Molecular Histopathology, Department of Pathology, University of Cambridge, UK; 10 2Institute of Pathology, Centre Hospitalier Universitaire Vaudois... , Xue X, Huang Y, Bi Y et al. Distinct involvement of NF-kappaB 498 regulators by somatic mutation in ocular adnexal malt lymphoma. Br J Haematol 2013; 160: 499 851-854. 500 26 van Dongen JJ, Langerak AW, Bruggemann M, Evans PA, Hummel M, Lavender FL...

Clipson, Alexandra; Wang, Ming; de Leval, Laurence; Ashton-Key, Margaret; Wotherspoon, Andrew; Vassiliou, George; Bolli, Niccolo; Grove, Carolyn; Moody, Sarah; Ibarz, Leire Escudero; Gundem, Gunes; Brugger, Kim; Xue, Xuemin; Mi, Ella; Bench, Anthony; Scott, Mike; Liu, Hongxiang; Follows, George; Robles, Eloy F.; Climent, Jose Angel Martinez; Oscier, David; Watkins, A. James; Du, Ming-Qing

2014-11-27T23:59:59.000Z

391

Exposure to As, Cd and Pb-mixture impairs myelin and axon development in rat brain, optic nerve and retina  

SciTech Connect (OSTI)

Arsenic (As), lead (Pb) and cadmium (Cd) are the major metal contaminants of ground water in India. We have reported the toxic effect of their mixture (metal mixture, MM), at human relevant doses, on developing rat astrocytes. Astrocyte damage has been shown to be associated with myelin disintegration in CNS. We, therefore, hypothesized that the MM would perturb myelinating white matter in cerebral cortex, optic nerve (O.N.) and retina. We observed modulation in the levels of myelin and axon proteins, such as myelin basic protein (MBP), proteolipid protein, 2?-, 3?-cyclic-nucleotide-3?-phosphodiesterase, myelin-associated glycoprotein and neurofilament (NF) in the brain of developing rats. Dose and time-dependent synergistic toxic effect was noted. The MBP- and NF-immunolabeling, as well as luxol-fast blue (LFB) staining demonstrated a reduction in the area of intact myelin-fiber, and an increase in vacuolated axons, especially in the corpus-callosum. Transmission electron microscopy (TEM) of O.N. revealed a reduction in myelin thickness and axon-density. The immunolabeling with MBP, NF, and LFB staining in O.N. supported the TEM data. The hematoxylin and eosin staining of retina displayed a decrease in the thickness of nerve-fiber, plexiform-layer, and retinal ganglion cell (RGC) count. Investigating the mechanism revealed a loss in glutamine synthetase activity in the cerebral cortex and O.N., and a fall in the brain derived neurotrophic factor in retina. An enhanced apoptosis in MBP, NF and Brn3b-containing cells justified the diminution in myelinating axons in CNS. Our findings for the first time indicate white matter damage by MM, which may have significance in neurodevelopmental-pediatrics, neurotoxicology and retinal-cell biology. - Highlights: • As, Cd and Pb-mixture, at human relevant dose, demyelinate developing rat CNS. • The attenuation in myelin and axon is synergistic. • The optic nerve and brain demonstrate reduced glutamine synthetase. • The retina exhibits diminished neurotrophin levels and cellular differentiation. • The toxic effect is apoptotic.

Rai, Nagendra Kumar; Ashok, Anushruti [Academy of Scientific and Innovative Research (India); Developmental Toxicology, Council of Scientific and Industrial Research-Indian Institute of Toxicology Research (CSIR-IITR) (India); Rai, Asit; Tripathi, Sachin [Developmental Toxicology, Council of Scientific and Industrial Research-Indian Institute of Toxicology Research (CSIR-IITR) (India); Nagar, Geet Kumar [Endocrinology, CSIR-Central Drug Research Institute (CSIR-CDRI) (India); Mitra, Kalyan [Electron Microscopy Unit, CSIR-CDRI, Lucknow 226001 (India); Bandyopadhyay, Sanghamitra, E-mail: sanghmitra@iitr.res.in [Academy of Scientific and Innovative Research (India); Developmental Toxicology, Council of Scientific and Industrial Research-Indian Institute of Toxicology Research (CSIR-IITR) (India)

2013-12-01T23:59:59.000Z

392

Localized chemical switching of the charge state of nitrogen-vacancy luminescence centers in diamond  

E-Print Network [OSTI]

We present a beam-directed chemical technique for controlling the charge states of near-surface luminescence centers in semiconductors. Specifically, we fluorinate the surface of H-terminated diamond by electron beam irradiation in the presence of NF3 vapor. The fluorination treatment acts as a local chemical switch that alters the charge state of nitrogen-vacancy luminescence centers from the neutral to the negative state. The electron beam fluorination process is highly localized and can be used to control the emission spectrum of individual nanodiamonds and surface regions scanned by the electron beam

Shanley, Toby W; Aharonovich, Igor; Toth, Milos

2014-01-01T23:59:59.000Z

393

Polyatomic-buffered pulsed DF/HF laser using electron-beam or photolysis initiation  

SciTech Connect (OSTI)

The initial performance of pulsed DF/HF chain lasers is presented in which the effect of polyatomic diluents on laser behavior is systematically explored. Laser energy, pulse length, and spectral output were investigated as functions of diluent gas (NF3, SF6, CF4), total mixture pressure, the partial pressure of fuel and oxidizer, O/sub 2/ concentration, and strength of initiation. Magnetically-confined electron beam and photolytically initiated systems are found to yield comparable performance. Results include 65 J/liter-atm DF output at 200 Torr cavity pressure and the ability to suppress long wavelength transitions from the free-running spectrum. 21 references.

Amimoto, S.T.; Gross, R.W.F.; Harper, G.N.; Azevedo, L.S.; Hofland, R. Jr.

1987-06-01T23:59:59.000Z

394

NPR step-scaling across the charm threshold  

E-Print Network [OSTI]

Matching Non-Perturbative Renormalisation on the lattice and perturbative renormalisation would benefit from higher matching scales, which are needed for observables entering their permile era such as BK. In this work we lay down a strategy, within the Rome-Southampton framework, to push this scale higher across the charm threshold, and apply it to an exploration of the BK running from 3 GeV to 9 GeV. This is done on Nf = 2+1+1 ensembles generated by the RBC-UKQCD collaboration, and features a close study of the discretisation effects.

Frison, Julien; Garron, Nicolas

2014-01-01T23:59:59.000Z

395

On the feasibility of determining slant-range visibility by using measurements of scattered light  

E-Print Network [OSTI]

for the degree of MASTER OF SCIENCE December 1972 Major Subject: Meteorology ON THE IT. ASIFILITY Ol' DETElRl'1INING SIiANT-RANGE VISIBIL riTY BY US [NG NF&SUREMENTS OF SGATTERl. D LIGHT A 1hesfs FRED RICIIARD NFNCOMB App -oved as to style and content by...: I t, s ?7 I' (Cbaizll'An of Committee) (He. d of cpr! ' . enl-. ) (;i (ldiemibez) (Nctib r) December 1972 ABSTRACT On the Feasibility of Determining Slant-Range Visibility by using Measurements of Scattered Light. (December 1972) Fred...

Newcomb, Fred Richard

2012-06-07T23:59:59.000Z

396

Anger camera image generation with microcomputers  

E-Print Network [OSTI]

ANGER CAMERA IMAGE GENERATJON WITH iMICR0C0MPJJTERS A Thesis R, 'RI. MGVGAN NIJ. J. IAPLS SubiniL', ti tc: tbe ' taNua - CnlILEr nf Hnivetui ty ;-'r' Lal . '. . '. 6i', i. -ent oL th: ie9uite. . ;List. )i Lhe 4 El'. : ol MASTER 09 SC ENCE May... that with the u e of an innovat ive 'nterfsce system and appropriate software, a microcomputer was a). le tc acquire, display, and analyze Anger came;a images. The interface board designed for this projec. includes A ? D convert. era, a wo page memory system...

Williams, Karl Morgan

1988-01-01T23:59:59.000Z

397

Effects of electrical stimulation high temperature pre-rigor conditioning on myofibrillar proteins of bovine muscle  

E-Print Network [OSTI]

as an untreated control to compare with the treated side. The rate nf pH decline was monitored for 48 hr postmortem. d. pl*a df th ~t'" ' d 4 . 1 1 ddhp ddt th~4''1*lddf p Nyofibrils were purified from each of the muscle samples. The nyo- fibrillar proteins... to troponin solut ions during incubation, the loss of troponio activity is reduced. Proteolytic Systems in Huscle There are at least three theories regarding changes in myofibril- lar proteins and concomitant changes in tenderness. The first, typi- fied...

Adams, Keith LeRoy

2012-06-07T23:59:59.000Z

398

Cytokine secretion profiles in primary cultured cells and in mice stimulated with plasmid DNA  

E-Print Network [OSTI]

CpG motif5?- Pur Pur CG Pyr Pyr -3? Danger signal Naked CpG DNA DNA lipoplex Macrophages or dendritic cells ???? ???? Cytokine geneNF-?B AP-1 ???? ???? Endosome Nucleus ? TLR9 Interferon ?/? gene Inflammatory cytokines TNF-?, IL-6 etc. Type I... interferon IFN-?, INF-? ? Mechanisms of immune response induced by naked CpG DNA or DNA/cationic liposome complex (lipoplex) CpG motif recognition by Toll-like receptor 9 (TLR9) Significance of the immune response to DNA Apoptotic ornecrotic cells...

Yoshida, Hiroyuki

2006-10-27T23:59:59.000Z

399

Motexafin Gadolinium and Zinc Induce Oxidative Stress Responses and Apoptosis in B-Cell Lymphoma Lines  

Science Journals Connector (OSTI)

...001 1.1 0.403 1.3 0.104 3.6 0.012 4763 NF1 Neurofibromin 1 1.7 0.000 1.4 0.001 1.2 0.154 1.4 0.001 9975 NR1D2 Nuclear receptor subfamily 1, group D, member 2 3.7 0.001 1.2 0.163 1.2 0.157 2.8 0.000 8554 PIAS1 Protein...

Philip S. Lecane; Mazen W. Karaman; Mint Sirisawad; Louie Naumovski; Richard A. Miller; Joseph G. Hacia; Darren Magda

2005-12-15T23:59:59.000Z

400

Identification of a conserved domain among cyclic nucleotide phosphodiesterases from diverse species  

Science Journals Connector (OSTI)

...NH V Q T L L A C FA A I G S H D V G H UPSG TN|NQ L L C N C R Sk E VIA|Q N F I N V -I L E NF L DHI -A LJI S C H CDL DHR INIS NQ V A S kV LA L[1S S E G R 110 130 150 HV S AIAY R L M Q EaE E M N V L I N LK[D D W R D L R W L V I E M V LST D M|S GRF...

H Charbonneau; N Beier; K A Walsh; J A Beavo

1986-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

On Discrete Hyperbox Packing  

E-Print Network [OSTI]

22, 2006; revised November 23, 2006; approved by IEEE/ACM TRANSACTIONS ON NETWORKING Editor Z.-L. Zhang. The work of G. Xue, W. Zhang, and J. Tang was supported in part by the Army Research Office under Grant W911NF-04-1-0385 and by the National... State University, Tempe, AZ 85287-8809 USA (e-mail: xue@asu.edu). W. Zhang is with the Department of Computer Science, North Dakota State University, Fargo, ND 58105 USA (e-mail: weiyi.zhang@ndsu.edu). J. Tang is with the Department of Computer Science...

Li, Xiafeng

2010-01-14T23:59:59.000Z

402

Regional characteristics, timing, and significance of dissolution and collapse features in Lower Cretaceous carbonate platform strata, Desoto Canyon area, offshore Alabama-Florida  

E-Print Network [OSTI]

Crust ts rasota Arch Continental Crust Thick r s ional I'ust miles 100 200 0 100 200 km Boundaries between crustal types Figure 4. Structure map of the Pre-Louann basement in the study area. The map also shows the study area in relation... Cretaceous Unconformity James Limestone~ WILCOX MIOINAY Cl yl SELT IA McSh L r Euraw Tuacalooaa W P WILCOX Cia lon R play Bl fao n EUIaw I Ecalooaa L C *I 68 TARE TNANET141 rr / NF/ 1NN our clA/ CENO/ I N AN 3/ 6 r Paleocene...

Iannello, Christine

2012-06-07T23:59:59.000Z

403

Federal regulation of false advertising and other deceptive practices directed at the consumer  

E-Print Network [OSTI]

contcelling the preparation snd sale of foods and drugs nay have been caused by the inability nf governnent sgeacies to detect inpuri- g/ ties snd adulteration with any degree of validity. Thc need for valid nethods of detecting lnpurities stinulsted... willinR to insert ia his guns teeth pulle4 frou the jaws of 2/ ilupoverished youths ~ g~/C 1 L. A Wig. ~lt. , p. 117. g/R. S. Turner, e S s Ias. , New York, 1953, p. LS. A rtis, Ral lentine Rooks, Ia 1665, the year of the plague in Eaglaad, thoro...

Miner, George Edward

1962-01-01T23:59:59.000Z

404

Thermodynamics using p4-improved staggered fermion action on QCDOC  

E-Print Network [OSTI]

We present an exploratory study of the thermodynamics of $N_f=3$ QCD with an improved staggered fermions using the QCDOC supercomputer. We use a p4 action with MILC-style smeared links (Fat 7). Some details of the implementation of the p4 action on QCDOC are discussed and performance benchmarks are given. We show preliminary results for the quark mass dependence of the pseudo-critical temperature $T_c$ from several lattice volumes . We also make a comparison between p4fat7 and the old p4 action.

Chulwoo Jung

2005-10-05T23:59:59.000Z

405

Two-frequency excitation of hydrogen atoms  

Science Journals Connector (OSTI)

When a hydrogen atom in a state with principal quantum number ni is irradiated simultaneously with light of frequency ?L, nearly that required to produce a transition to a higher state with principal quantum number nf and with microwave radiation of frequency ?, the transition is very probable when the resonance condition ?L+k?=Ef-Ei is satisfied, the emission or absorption of the net number k of microwave photons just compensating for the detuning of the light from the resonance. This process is analyzed with the use of a forward scattering method and the results are used to discuss the experiments of Bayfield et al. on the excitation of hydrogen.

P. Stehle

1982-11-01T23:59:59.000Z

406

The effects of insecticide applications on predaceous insect and spider populations in cotton fields, and a comparison of sampling methods  

E-Print Network [OSTI]

Table l. S asonal incic!ence nf r~redaceous arthropods, F!arren and Stetz farms. ", . 'arren F'arm !!umber ver acre Stet. z Farm Date In:ect, s Sniders Tote! Insects Soiders Tntal Aldi car b (1. 00 lb /acre) June June June June June June... of the highest numbers of |ieliothis were contained in these plots. Al- though there was considerable variation in the numbers of ~ redaceous arthropods in the plots, and that some plots contained more Heliothi s than othez s, a serious Heliothi s outbreak...

Almand, Lyndon Keith

2012-06-07T23:59:59.000Z

407

ME323 B: Introduc~ao aos Modelos Probabilisticos I Semestre de 2011  

E-Print Network [OSTI]

Par^ametro 4.2 Estima¸c~ao Pontual e por Intervalo de Confian¸ca em Modelos Param´etricos (M´edia, Pro- por¸c~oes e Vari^ancias) 4.3 Teste de Hip´oteses em Modelos Param´etricos (M´edia, Propor¸c~oes e Vari segunda prova; e a m´edia das notas das listas de exerc´icios. A nota final ser´a calculada como NF = NG

Lachos, Victor

408

Electromagnetic corrections to pseudoscalar decay constants  

E-Print Network [OSTI]

The effects of electromagnetic interactions on pseudoscalar decay constants are investigated. Using a compact QED and QCD action we are able to resolve differences of about 0.1 MeV. We obtain the preliminary results f_pi^0-f_pi^+/- =0.09(3) MeV and f_D^0-f_D^+/- =0.79(11) MeV for light and charmed pseudoscalar decay constants on a N_f=2 nonperturbatively improved Sheikholeslami-Wohlert ensemble.

Benjamin Glaessle; Gunnar S. Bali

2011-11-16T23:59:59.000Z

409

Calculation of the neutron-induced fission cross section of Pa233  

Science Journals Connector (OSTI)

Since very recently, experimental data for the energy dependence of the Pa233(n,f) cross section are finally available. This has stimulated a new, self-consistent cross section evaluation for the system n+Pa233 in the incident neutron energy range 0.01–6MeV. The results are quite different compared to earlier evaluation attempts. Since Pa233 is an important intermediary in the thorium based fuel cycle, its neutron reaction cross sections are key parameters in the modeling of future advanced reactor concepts.

G. Vladuca; F.-J. Hambsch; A. Tudora; S. Oberstedt; F. Tovesson; A. Oberstedt; D. Filipescu

2004-02-26T23:59:59.000Z

410

Determination of the mutagenic potential of individual and binary mixtures of polycyclic aromatic and nitroaromatic hydrocarbons  

E-Print Network [OSTI]

). iv Based on these pure results, fair binary mixtures were chosen; BAP/BEP, BAP/1NP, BAP/DMBA, and BEP/DMBA. For the mixtures? a mutagenic interaction ratio (MIR) was calculated. Using two doses of pure chemicals, boundaries between inhibitive.../Response Curve for BEP 21 5. 6 Dose/Response Curve for 1NP 5. 7. Dose/Response Curve for DMBA 5. 8. Dose/Response Curve for 2NF 5. 9. Dose/Response Curve for BA 5. 10. Dose/Response Curve for FA 5. 11. Dose/Response Curve for CH 22 24 25 26 27 29...

Keller, Tracie A

2012-06-07T23:59:59.000Z

411

Involvement of nuclear factor {kappa}B in platelet CD40 signaling  

SciTech Connect (OSTI)

Highlights: Black-Right-Pointing-Pointer sCD40L induces TRAF2 association to CD40 and NF-{kappa}B activation in platelets. Black-Right-Pointing-Pointer I{kappa}B{alpha} phosphorylation downstream of CD40L/CD40 signaling is independent of p38 MAPK phosphorylation. Black-Right-Pointing-Pointer I{kappa}B{alpha} is required for sCD40L-induced platelet activation and potentiation of aggregation. -- Abstract: CD40 ligand (CD40L) is a thrombo-inflammatory molecule that predicts cardiovascular events. Platelets constitute the major source of soluble CD40L (sCD40L), which has been shown to potentiate platelet activation and aggregation, in a CD40-dependent manner, via p38 mitogen activated protein kinase (MAPK) and Rac1 signaling. In many cells, the CD40L/CD40 dyad also induces activation of nuclear factor kappa B (NF-{kappa}B). Given that platelets contain NF-{kappa}B, we hypothesized that it may be involved in platelet CD40 signaling and function. In human platelets, sCD40L induces association of CD40 with its adaptor protein the tumor necrosis factor receptor associated factor 2 and triggers phosphorylation of I{kappa}B{alpha}, which are abolished by CD40L blockade. Inhibition of I{kappa}B{alpha} phosphorylation reverses sCD40L-induced I{kappa}B{alpha} phosphorylation without affecting p38 MAPK phosphorylation. On the other hand, inhibition of p38 MAPK phosphorylation has no effect on I{kappa}B{alpha} phosphorylation, indicating a divergence in the signaling pathway originating from CD40 upon its ligation. In functional studies, inhibition of I{kappa}B{alpha} phosphorylation reverses sCD40L-induced platelet activation and potentiation of platelet aggregation in response to a sub-threshold concentration of collagen. This study demonstrates that the sCD40L/CD40 axis triggers NF-{kappa}B activation in platelets. This signaling pathway plays a critical role in platelet activation and aggregation upon sCD40L stimulation and may represent an important target against thrombo-inflammatory disorders.

Hachem, Ahmed [Laboratory of Thrombosis and Hemostasis, Montreal Heart Institute, 5000 Belanger, Montreal, Quebec, Canada H1T 1C8 (Canada)] [Laboratory of Thrombosis and Hemostasis, Montreal Heart Institute, 5000 Belanger, Montreal, Quebec, Canada H1T 1C8 (Canada); Yacoub, Daniel [Laboratory of Thrombosis and Hemostasis, Montreal Heart Institute, 5000 Belanger, Montreal, Quebec, Canada H1T 1C8 (Canada) [Laboratory of Thrombosis and Hemostasis, Montreal Heart Institute, 5000 Belanger, Montreal, Quebec, Canada H1T 1C8 (Canada); Centre Hospitalier Universite de Montreal, 264 boul. Rene-Levesque est, Montreal, Quebec, Canada H2X 1P1 (Canada); Zaid, Younes [Laboratory of Thrombosis and Hemostasis, Montreal Heart Institute, 5000 Belanger, Montreal, Quebec, Canada H1T 1C8 (Canada)] [Laboratory of Thrombosis and Hemostasis, Montreal Heart Institute, 5000 Belanger, Montreal, Quebec, Canada H1T 1C8 (Canada); Mourad, Walid [Universite de Montreal, Department of Medicine, 2900 boul. Edouard-Montpetit, Montreal, Quebec, Canada H3T 1J4 (Canada) [Universite de Montreal, Department of Medicine, 2900 boul. Edouard-Montpetit, Montreal, Quebec, Canada H3T 1J4 (Canada); Centre Hospitalier Universite de Montreal, 264 boul. Rene-Levesque est, Montreal, Quebec, Canada H2X 1P1 (Canada); Merhi, Yahye, E-mail: yahye.merhi@icm-mhi.org [Laboratory of Thrombosis and Hemostasis, Montreal Heart Institute, 5000 Belanger, Montreal, Quebec, Canada H1T 1C8 (Canada) [Laboratory of Thrombosis and Hemostasis, Montreal Heart Institute, 5000 Belanger, Montreal, Quebec, Canada H1T 1C8 (Canada); Universite de Montreal, Department of Medicine, 2900 boul. Edouard-Montpetit, Montreal, Quebec, Canada H3T 1J4 (Canada)

2012-08-17T23:59:59.000Z

412

The behavior of a multidimensional rainfall model through an annual cycle in the Brazos Valley  

E-Print Network [OSTI]

rate of the storm is denoted by the parameter I. The number of bursts per storm ss identically and independently dkstrtbuted with a pa? eter nf v The depth assocsated wsth each burst is also identically and independently dkstributed with s, parameter... 01 min The density of cluster potential centers per rainband expressed in CPC's/km Range 0 01 to 0. 0001 into The rainfall intensity at the birth center and birth time of the raincell. In the exponential decay situation used in this model...

Koepsell, Royal Warren

1989-01-01T23:59:59.000Z

413

Baryon resonances coupled to Pion-Nucleon states in lattice QCD  

E-Print Network [OSTI]

In recent years the study of two particle systems on the lattice has led to excellent results in the meson sector of the QCD spectrum, however baryon resonances mostly remain unexplored. We present a study of pion-nucleon systems as decay product of baryon resonances in different channels, with special focus on the nucleon spectrum. We evaluate the correlation functions of single and multi particle interpolators. All the Wick contributions are explicitly computed and the consequences of reduced symmetries in moving frames are taken into account. We discuss the theoretical setup together with results for $n_f=2$ mass degenerate light quarks.

Verduci, Valentina

2014-01-01T23:59:59.000Z

414

REQUEST BY SIEMENS WESTINGHOUSE POWER CORPORATION FOR AN ADVANCE WAIVER OF DOMESTIC AND FOREIGN RIGHTS IN  

Broader source: Energy.gov (indexed) [DOE]

U5-30-Z002 04:U5pm Frorm-NlIIUNAL I Nf-NWCY L;CHNULULOY LABUKAI UKY -YI-U4L b4LL 1-411 r.uu6/uuJ U5-30-Z002 04:U5pm Frorm-NlIIUNAL I Nf-NWCY L;CHNULULOY LABUKAI UKY -YI-U4L b4LL 1-411 r.uu6/uuJ r -J Statement of Considerations REQUEST BY SIEMENS WESTINGHOUSE POWER CORPORATION FOR AN ADVANCE WAIVER OF DOMESTIC AND FOREIGN RIGHTS IN SUBJECT INVENTIONS MADE IN THE COURSE OF OR UNDER DEPARTMENT OF ENERGY CONTRACT NO. DE-AC26-98FT40355; DOE WAIVER DOCKET W(A)-98-009 [CH-0967] Siemens Westinghouse Power Corporation (hereinafter referred to as "SWPC"), has made a timely request for an advance waiver to worldwide rights in Subject Inventions made in the course of or under Department of Energy (DOE) Contract No. DE-AC26-98FT40355. The scope of the work calls for SWPC to perform a conceptual design and feasibility study of a High Efficiency Fossil-Fueled Power Plant (HEFPP) that incorporates a pressurized tubular solid oxide

415

Sandia National Laboratories: Z Pulsed Power Facility: How Does the Z  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

How Does the Z Machine Work? How Does the Z Machine Work? z-machine i Marx Bank Generator Marx Bank. Each Marx bank has sixty 2.6 μF capacitors (43 nF per Marx when erected) that are charged in parallel and discharged in series. When charged to 85 kV its output voltage is 5.1 MV, and stored energy is 20 MJ for all 36. (For a 90 kV charge it is 5.4 MV and 23 MJ.) When discharged, the peak current of each Marx is about 150 kA with a 1.5 μs time to peak. i Intermediate-Store Capacitor Intermediate-Store Water Capacitor. The output of each Marx is dumped into a 6.5-ft diameter, 10-ft long (24 nF, 3.8 Ω) coaxial cylinder filled with water. This cylinder sits in the oil tank and has polyurethane barriers on each end. It acts as a large capacitor that accumulates the energy from the Marx. When it reaches full voltage (5.1 to 5.4 MV) it is discharged

416

V-210: HP LaserJet Pro Printer Bug Lets Remote Users Access Data |  

Broader source: Energy.gov (indexed) [DOE]

V-210: HP LaserJet Pro Printer Bug Lets Remote Users Access Data V-210: HP LaserJet Pro Printer Bug Lets Remote Users Access Data V-210: HP LaserJet Pro Printer Bug Lets Remote Users Access Data August 3, 2013 - 2:37am Addthis PROBLEM: A vulnerability was reported in HP Printers. A remote user can obtain potentially sensitive information. PLATFORM: HP LaserJet Pro products ABSTRACT: A potential security vulnerability has been identified with certain HP LaserJet Pro printers. The vulnerability could be exploited remotely to gain unauthorized access to data. REFERENCE LINKS: SecurityTracker Alert ID 1028869 CVE-2013-4807 Vendor URL IMPACT ASSESSMENT: Medium DISCUSSION: The following models are affected: HP LaserJet Pro P1102w CE657A/CE658A HP LaserJet Pro P1606dn CE749A HP LaserJet Pro M1212nf MFP CE841A HP LaserJet Pro M1213nf MFP CE845A

417

Id1 expression promotes peripheral CD4{sup +} T cell proliferation and survival upon TCR activation without co-stimulation  

SciTech Connect (OSTI)

Highlights: •Id1 expression enables naïve T cell proliferation without anti-CD28 co-stimulation. •Id1 expression facilitates T cells survival when stimulated with anti-CD3. •Elevation of IL-2 production by Id1 contributes increased proliferation and survival. •Id1 potentiates NF-?B activation by anti-CD3 stimulation. -- Abstract: Although the role of E proteins in the thymocyte development is well documented, much less is known about their function in peripheral T cells. Here we demonstrated that CD4 promoter-driven transgenic expression of Id1, a naturally occurring dominant-negative inhibitor of E proteins, can substitute for the co-stimulatory signal delivered by CD28 to facilitate the proliferation and survival of naïve CD4{sup +} cells upon anti-CD3 stimulation. We next discovered that IL-2 production and NF-?B activity after anti-CD3 stimulation were significantly elevated in Id1-expressing cells, which may be, at least in part, responsible for the augmentation of their proliferation and survival. Taken together, results from this study suggest an important role of E and Id proteins in peripheral T cell activation. The ability of Id proteins to by-pass co-stimulatory signals to enable T cell activation has significant implications in regulating T cell immunity.

Liu, Chen; Jin, Rong [Department of Immunology, Peking University Health Science Center, Beijing (China)] [Department of Immunology, Peking University Health Science Center, Beijing (China); Wang, Hong-Cheng [Oklahoma Medical Research Foundation, Oklahoma City, OK (United States)] [Oklahoma Medical Research Foundation, Oklahoma City, OK (United States); Tang, Hui; Liu, Yuan-Feng; Qian, Xiao-Ping; Sun, Xiu-Yuan; Ge, Qing [Department of Immunology, Peking University Health Science Center, Beijing (China)] [Department of Immunology, Peking University Health Science Center, Beijing (China); Sun, Xiao-Hong, E-mail: sunx@omrf.org [Oklahoma Medical Research Foundation, Oklahoma City, OK (United States)] [Oklahoma Medical Research Foundation, Oklahoma City, OK (United States); Zhang, Yu, E-mail: zhangyu007@bjmu.edu.cn [Department of Immunology, Peking University Health Science Center, Beijing (China)] [Department of Immunology, Peking University Health Science Center, Beijing (China)

2013-06-21T23:59:59.000Z

418

Repulsive nature of optical potentials for high-energy heavy-ion scattering  

E-Print Network [OSTI]

The recent works by the present authors predicted that the real part of heavy-ion optical potentials changes its character from attraction to repulsion around the incident energy per nucleon E/A = 200 - 300 MeV on the basis of the complex G-matrix interaction and the double-folding model (DFM) and revealed that the three-body force plays an important role there. In the present paper, we have precisely analyzed the energy dependence of the calculated DFM potentials and its relation to the elastic-scattering angular distributions in detail in the case of the $^{12}$C + $^{12}$C system in the energy range of E/A = 100 - 400 MeV. The tensor force contributes substantially to the energy dependence of the real part of the DFM potentials and plays an important role to lower the attractive-to-repulsive transition energy. The nearside and farside (N/F) decomposition of the elastic-scattering amplitudes clarifies the close relation between the attractive-to-repulsive transition of the potentials and the characteristic evolution of the calculated angular distributions with the increase of the incident energy. Based on the present analysis, we propose experimental measurements of the predicted strong diffraction phenomena of the elastic-scattering angular distribution caused by the N/F interference around the attractive-to-repulsive transition energy together with the reduced diffractions below and above the transition energy.

T. Furumoto; Y. Sakuragi; Y. Yamamoto

2010-10-08T23:59:59.000Z

419

Immunosuppressive effects of fisetin against dinitrofluorobenzene-induced atopic dermatitis-like symptoms in NC/Nga mice  

Science Journals Connector (OSTI)

Abstract Atopic dermatitis (AD) is a multifactorial chronic skin disorder that is increasing in prevalence globally. In NC/Nga mice, repetitive epicutaneous applications of 2-4-dinitrofluorobenzene (DNFB) induces AD-like clinical symptoms. Bioflanonol fisetin (3,7,3?,4?-tetrahydroxyflavone) is a dietary component found in plants, fruits and vegetables. Fisetin has various physiological effects that include anti-oxidation, anti-angiogenesis, anti-carcinogenesis and anti-inflammation. In this study, we investigated whether fisetin relieves AD-like clinical symptoms induced by repeated DNFB treatment in NC/Nga mice. Fisetin significantly inhibited infiltration of inflammatory cells including eosinophils, mast cells and CD4+ T and CD8+ T cells, and suppressed the expressions of cytokines and chemokines associated with dermal infiltrates in AD-like skin lesions. Total serum immunoglobulin E (IgE) levels and the ratio of phospho-NF-?B p65 to total NF-?B p65 were markedly reduced by fisetin. Fisetin also reduced the production of interferon-gamma and interleukin-4 by activated CD4+ T cells in a dose-dependent manner, whereas the anti-inflammatory cytokine, interleukin-10 was increased. These results implicate fisetin as a potential therapeutic for AD.

Gun-Dong Kim; Seung Eun Lee; Yong Seek Park; Dong-Hoon Shin; Gwi Gun Park; Cheung-Seog Park

2014-01-01T23:59:59.000Z

420

A novel PPAR{gamma} agonist, KR62776, suppresses RANKL-induced osteoclast differentiation and activity by inhibiting MAP kinase pathways  

SciTech Connect (OSTI)

We investigated the effects of a novel peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) agonist, KR62776, on osteoclast differentiation and function, and on the underlying signaling pathways. KR62776 markedly suppressed differentiation into osteoclasts in various osteoclast model systems, including bone marrow mononuclear (BMM) cells and a co-culture of calvarial osteoblasts and BMM cells. KR62776 suppressed the activation of tartrate-resistant acid phosphatase (TRAP) and the expression of genes associated with osteoclast differentiation, such as TRAP, dendritic cell-specific transmembrane protein (DC-STAMP), and osteoclast-associated receptor (OSCAR). Furthermore, KR62776 reduced resorption pit formation in osteoclasts, and down-regulated genes essential for osteoclast activity, such as Src and {alpha}v{beta}3 integrin. An analysis of a signaling pathway showed that KR62776 inhibited the receptor activator of nuclear factor-{kappa}B ligand (RANKL)-induced activation of p38 mitogen-activated protein kinase (p38MAPK), extracellular regulated kinase (ERK), c-Jun N-terminal kinase (JNK) and nuclear factor-{kappa}B (NF-{kappa}B). Together, these results demonstrate that KR62776 negatively affects osteoclast differentiation and activity by inhibiting the RANKL-induced activation of MAP kinases and NF-{kappa}B.

Park, Ju-Young [Skeletal Diseases Genome Research Center, Kyungpook National University Hospital, Daegu (Korea, Republic of); Department of Biochemistry, School of Medicine, Kyungpook National University, Daegu (Korea, Republic of); Bae, Myung-Ae; Cheon, Hyae Gyeong; Kim, Sung Soo [Center for Metabolic Syndrome Therapeutics, Korea Research Institute of Chemical Technology, Daejeon (Korea, Republic of); Hong, Jung-Min; Kim, Tae-Ho [Skeletal Diseases Genome Research Center, Kyungpook National University Hospital, Daegu (Korea, Republic of); Choi, Je-Yong [Skeletal Diseases Genome Research Center, Kyungpook National University Hospital, Daegu (Korea, Republic of); Department of Biochemistry, School of Medicine, Kyungpook National University, Daegu (Korea, Republic of); Kim, Sang-Hyun [Department of Pharmacology, School of Medicine, Kyungpook National University, Daegu (Korea, Republic of); Lim, Jiwon [Department of Oral Pathology, IHBR, School of Dentistry, Kyungpook National University, Daegu (Korea, Republic of); Choi, Chang-Hyuk [Department of Orthopaedic Surgery, School of Medicine, Catholic University of Daegu, Daegu (Korea, Republic of); Shin, Hong-In [Department of Oral Pathology, IHBR, School of Dentistry, Kyungpook National University, Daegu (Korea, Republic of); Kim, Shin-Yoon [Skeletal Diseases Genome Research Center, Kyungpook National University Hospital, Daegu (Korea, Republic of); Department of Orthopaedic Surgery, School of Medicine, Kyungpook National University, Daegu (Korea, Republic of)], E-mail: syukim@knu.ac.kr; Park, Eui Kyun [Skeletal Diseases Genome Research Center, Kyungpook National University Hospital, Daegu (Korea, Republic of); Department of Oral Pathology, IHBR, School of Dentistry, Kyungpook National University, Daegu (Korea, Republic of)], E-mail: epark@knu.ac.kr

2009-01-16T23:59:59.000Z

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Nepali Aawaz Volume 1, Issue 4, 9-22 November 2005  

E-Print Network [OSTI]

M 5'6\\sf/f lnO/x]sf] 5 . 8fo:kf]/faf6 rf8jf8 dfGg :jb]z kms]{sfx? klg cj ljbfjf/L eP/ cf–cfkm\\gf] sd{If]qlt/ nfUg yfn]sf 5g\\ . dfcf]jfbLsf] o'4lj/fdsf sf/0f zx/af6 bz}ltxf/ dfGg ufpFlt/ nfu]sfx? klg zx/lt/ kms{g] qmd hf/L 5 . z/b Ct'sf] ;'Gb/ a... 'b} hfFbf pgLx?sf] o; sdhf]/Laf6 kmfObf p7fpg ljb]zL zlQmsf] if8oGq z'? eO;s]sf] 5 . o;}n] d"nssf] lxtsf] nflu slQ klg l9nf] gu/L /fhf, bn / ljb|f

Shrestha, Kashish Das

422

Nepali Aawaz Volume 1, Issue 19, 7 December 2006  

E-Print Network [OSTI]

democratic failure can only be evaluated by reviewing historical, social and economic factors. Digital Himalaya klZrddf juL{o ;+3if{sf] gf/f lbP/ ;kmn ePsf dfcf]jfbLnfO{ k"j{df k|e'Tj hfpg klxNo}b]lv æhftLoÆ gf/f rsf{pFb} cPsf] ljb|f]xL /fO{–lnDa"x... O{eL ;+qmldtx?nfO{ Pslqt u/L d[To'sf] cft+s leq ;'Gb/ hLjgsf] vf]hL ul//x]sf5g\\ . @)%* ;fndf k'jf{~rn If]qd} klxnf] k6s cfkm'nfO{ PrcfO{eL ;+qm- dLt 3f]if0ff ub}{ ;+qmdLtx?sf] xs clwsf/sf] kIfdf cfjfh p7fpb} ;fj{hgLs ePsf g/]z eG5g æ;'?df ;+qmdLt eGbf dfgL;x...

Shrestha, Kashish Das

423

PPAR-{gamma} agonist protects against intestinal injury during necrotizing enterocolitis  

SciTech Connect (OSTI)

Necrotizing enterocolitis (NEC) remains a lethal condition for many premature infants. Peroxisome proliferator-activated receptor-{gamma} (PPAR-{gamma}), a member of the nuclear hormone receptor family, has been shown to play a protective role in cellular inflammatory responses; however, its role in NEC is not clearly defined. We sought to examine the expression of PPAR-{gamma} in the intestine using an ischemia-reperfusion (I/R) model of NEC, and to assess whether PPAR-{gamma} agonist treatment would ameliorate I/R-induced gut injury. Swiss-Webster mice were randomized to receive sham (control) or I/R injury to the gut induced by transient occlusion of superior mesenteric artery for 45 min with variable periods of reperfusion. I/R injury resulted in early induction of PPAR-{gamma} expression and activation of NF-{kappa}B in small intestine. Pretreatment with PPAR-{gamma} agonist, 15d-PGJ{sub 2}, attenuated intestinal NF-{kappa}B response and I/R-induced gut injury. Activation of PPAR-{gamma} demonstrated a protective effect on small bowel during I/R-induced gut injury.

Baregamian, Naira; Mourot, Joshua M.; Ballard, Amie R. [Department of Surgery, University of Texas Medical Branch, 301 University Boulevard, Galveston, TX 77555-0353 (United States); Evers, B. Mark [Department of Surgery, University of Texas Medical Branch, 301 University Boulevard, Galveston, TX 77555-0353 (United States); Sealy Center for Cancer Cell Biology, University of Texas Medical Branch, Galveston, TX 77555 (United States); Chung, Dai H. [Department of Surgery, University of Texas Medical Branch, 301 University Boulevard, Galveston, TX 77555-0353 (United States); Sealy Center for Cancer Cell Biology, University of Texas Medical Branch, Galveston, TX 77555 (United States)], E-mail: dhchung@utmb.edu

2009-02-06T23:59:59.000Z

424

Fabrication of PES nanofiltration membrane by simultaneous use of multi-walled carbon nanotube and surface graft polymerization method: Comparison of MWCNT and PAA modified MWCNT  

Science Journals Connector (OSTI)

Multi-walled carbon nanotubes (MWCNTs) were modified by in situ polymerization of acrylic acid (AA) in aqueous solution in the presence of potassium persulfate (KPS) as initiator and ethylene glycol (EG) as cross-linker to obtain stable grafted polyacrylic acid (PAA) on \\{MWCNTs\\} surface. Effects of raw MWCNT, PAA modified MWCNT and grafting efficiency of PAA on characteristics of nanocomposite polyethersulfone (PES) nanofiltration (NF) membranes were investigated. The results revealed that the existence of PAA modified \\{MWCNTs\\} (PAA-g-MWCNT) in the membrane matrix improves water flux and antifouling properties of NF membrane. The membranes containing 0.1 wt.% of modified \\{MWCNTs\\} showed highest Na2SO4 rejection due to functional groups of modified MWCNTs, which provides negatively charged surface. The graft polymerization of PAA on the mixed matrix membranes led to further hydrophilicity enhancement of prepared membranes. PAA grafting yield of PAA-g-MWCNT/PES membrane (37%) was significantly higher than that of raw MWCNT blended (29%) and bare PES (25%) membranes. The PAA grafted nanocomposite membrane exhibited high water flux (40 kg/m2 h at 0.4 MPa), superior antifouling properties and more efficient salt rejection revealing the success of simultaneous use of various modification methods. FTIR, AFM and FESEM techniques and contact angle measurements were successfully employed to verify the observations.

Parisa Daraei; Sayed Siavash Madaeni; Negin Ghaemi; Hossein Ahmadi Monfared; Mohammad Ali Khadivi

2013-01-01T23:59:59.000Z

425

Design and performance of a pulse transformer based on Fe-based nanocrystalline core  

Science Journals Connector (OSTI)

A dry-type pulse transformer based on Fe-based nanocrystalline core with a load of 0.88 nF output voltage of more than 65 kV and winding ratio of 46 is designed and constructed. The dynamic characteristics of Fe-based nanocrystalline core under the impulse with the pulse width of several microseconds were studied. The pulse width and incremental flux density have an important effect on the pulse permeability so the pulse permeability is measured under a certain pulse width and incremental flux density. The minimal volume of the toroidal pulse transformer core is determined by the coupling coefficient the capacitors of the resonant charging circuit incremental flux density and pulse permeability. The factors of the charging time ratio and energy transmission efficiency in the resonant charging circuit based on magnetic core-type pulse transformer are analyzed. Experimental results of the pulse transformer are in good agreement with the theoretical calculation. When the primary capacitor is 3.17 ?F and charge voltage is 1.8 kV a voltage across the secondary capacitor of 0.88 nF with peak value of 68.5 kV rise time (10%–90%) of 1.80 ?s is obtained.

Liu Yi; Feng Xibo; Fuchang Lin

2011-01-01T23:59:59.000Z

426

New calculation for the neutron-induced fission cross section of Pa233 between 1.0 and 3.0MeV  

Science Journals Connector (OSTI)

The Pa233(n,f) cross section, a key ingredient for fast reactors and accelerators driven systems, was measured recently with relatively good accuracy [F. Tovesson et al., Phys. Rev. Lett. 88, 062502 (2002)]. The results are at strong variance with accepted evaluations and an existing indirect experiment. This circumstance led us to perform a quite detailed and complete evaluation of the Pa233(n,f) cross section between 1.0 and 3.0MeV, where use of our newly developed routines for the parametrization of the nuclear surface and the calculation of deformation parameters and level densities (including low-energy discrete levels) were made. The results show good quantitative and excellent qualitative agreement with the experimental direct data obtained by Tovesson et al. [F. Tovesson et al., Phys. Rev. Lett. 88, 062502 (2002)]. Additionally, our methodology opens new possibilities for the analysis of subthreshold fission and above threshold second-chance fission for both Pa233 and its decay product U233, as well as other strategically important fissionable nuclides.

J. Mesa; J. D. T. Arruda-Neto; A. Deppman; V. P. Likhachev; M. V. Manso; C. E. Garcia; O. Rodriguez; F. Guzmán; F. Garcia

2003-11-20T23:59:59.000Z

427

Density effect on newly identified high-n Rydberg series of krypton by a resonantly enhanced multiphoton ionization method  

Science Journals Connector (OSTI)

Four even-parity atomic series corresponding to transitions from the 5s’[1/2]10 level to the (2P3/20)np,nf levels of krypton have been observed, using a resonant multistep two-color photoionization method. The energies of 7p’[3/2]1, 7p’[1/2]1, 7p’[3/2]2, 7p’[1/2]0, np[1/2]1, np[3/2]2, np[1/2]0, and nf[3/2]1,2 levels are determined and the principal quantum numbers are calculated for n up to 45, 32, 49, and 44, respectively. Strong spectral irregularities in intensity and position are analyzed with the help of Lu-Fano diagrams and multichannel quantum defect theory in the case of the most intense 5s’[1/2]10?np[1/2]0 series. Density shift rates have the constant value of -7.4(2)×10-19 cm-1/cm-3 for the s’?p high-n series members, outside regions where irregularities are observed, in agreement with existing doped krypton data. A close agreement with the Fermi model is obtained for these high-n members of regular series. Departure from this agreement is found for members whose excited levels are mixed with 7p’ states. A clear relationship between the p?p’ admixture and shift rate decrease, in regions of irregularities, is demonstrated.

E. Audouard; P. Laporte; J.-L. Subtil; N. Damany; M. Pellarin

1990-06-01T23:59:59.000Z

428

New CYP1 genes in the frog Xenopus (Silurana) tropicalis: Induction patterns and effects of AHR agonists during development  

SciTech Connect (OSTI)

The Xenopus tropicalis genome shows a single gene in each of the four cytochrome P450 1 (CYP1) subfamilies that occur in vertebrates, designated as CYP1A, CYP1B1, CYP1C1, and CYP1D1. We cloned the cDNAs of these genes and examined their expression in untreated tadpoles and in tadpoles exposed to waterborne aryl hydrocarbon receptor agonists, 3,3',4,4',5-pentachlorobiphenyl (PCB126), {beta}-naphthoflavone ({beta}NF), or indigo. We also examined the effects of PCB126 on expression of genes involved in stress response, cell proliferation, thyroid homeostasis, and prostaglandin synthesis. PCB126 induced CYP1A, CYP1B1, and CYP1C1 but had little effect on CYP1D1 (77-, 1.7-, 4.6- and 1.4-fold induction versus the control, respectively). {beta}NF induced CYP1A and CYP1C1 (26- and 2.5-fold), while, under conditions used, indigo tended to induce only CYP1A (1.9-fold). The extent of CYP1 induction by PCB126 and {beta}NF was positively correlated to the number of putative dioxin response elements 0-20 kb upstream of the start codons. No morphological effect was observed in tadpoles exposed to 1 nM-10 {mu}M PCB126 at two days post-fertilization (dpf) and screened 20 days later. However, in 14-dpf tadpoles a slight up-regulation of the genes for PCNA, transthyretin, HSC70, Cu-Zn SOD, and Cox-2 was observed two days after exposure to 1 {mu}M PCB126. This study of the full suite of CYP1 genes in an amphibian species reveals gene- and AHR agonist-specific differences in response, as well as a much lower sensitivity to CYP1 induction and short-term toxicity by PCB126 compared with in fish larvae. The single genes in each CYP1 subfamily may make X. tropicalis a useful model for mechanistic studies of CYP1 functions.

Joensson, Maria E., E-mail: maria.jonsson@ebc.uu.se [Dept of Environmental Toxicology, Evolutionary Biology Centre, Uppsala University, Norbyvaegen 18A, 752 36 Uppsala (Sweden); Biology Department, Redfield 3-42 MS 32, Woods Hole Oceanographic Institution, Woods Hole, MA, 02543 (United States); Berg, Cecilia [Dept of Environmental Toxicology, Evolutionary Biology Centre, Uppsala University, Norbyvaegen 18A, 752 36 Uppsala (Sweden); Goldstone, Jared V.; Stegeman, John J. [Biology Department, Redfield 3-42 MS 32, Woods Hole Oceanographic Institution, Woods Hole, MA, 02543 (United States)

2011-01-15T23:59:59.000Z

429

Interaction of inflammatory and anti-inflammatory responses in microglia by Staphylococcus aureus-derived lipoteichoic acid  

SciTech Connect (OSTI)

We investigated the interaction between proinflammatory and inflammatory responses caused by Staphylococcus aureus-derived lipoteichoic acid (LTA) in primary cultured microglial cells and BV-2 microglia. LTA induced inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) protein levels increase in a concentration- and time-dependent manner. Meanwhile, LTA also increased nitric oxide (NO) and PGE{sub 2} production in microglia. Administration of TLR2 antagonist effectively inhibited LTA-induced NO, iNOS, and COX-2 expression. Moreover, treatment of cells with LTA caused a time-dependent activation of ERK, p38, JNK, as well as AKT. We also found that LTA-induced iNOS and COX-2 up-regulation were attenuated by p38, JNK, and PI3-kinase inhibitors. On the other hand, LTA-enhanced HO-1 expression was attenuated by p38 and PI3-kinase inhibitors. Treatment of cells with NF-?B and AP-1 inhibitors antagonized LTA-induced iNOS and COX-2 expression. However, only NF-?B inhibitors reduced LTA-induced HO-1 expression in microglia. Furthermore, stimulation of cells with LTA also activated I?B? phosphorylation, p65 phosphorylation at Ser{sup 536}, and c-Jun phosphorylation. Moreover, LTA-induced increases of ?B-DNA and AP-1-DNA binding activity were inhibited by p38, JNK, and PI3-kinase inhibitors. HO-1 activator CoPP IX dramatically reversed LTA-induced iNOS expression. Our results provided mechanisms linking LTA and inflammation/anti-inflammation, and indicated that LTA plays a regulatory role in microglia activation. - Highlights: • LTA causes an increase in iNOS, COX-2, and HO-1 expression in microglia. • LTA induces iNOS and COX-2 expression through TLR-2/NF-?B and AP-1 pathways. • HO-1 expression is regulated through p38, JNK, PI3K/AKT and AP-1 pathways. • Induced HO-1 reduces LTA-induced iNOS expression. • LTA plays a regulatory role on inflammatory/anti-inflammatory responses.

Huang, Bor-Ren [Department of Neurosurgery, Buddhist Tzu Chi General Hospital, Taichung Branch, Taichung, Taiwan (China); Institute of Clinical Medical Science, China Medical University, Taichung, Taiwan (China); Tsai, Cheng-Fang [Department of Biotechnology, Asia University, Taichung, Taiwan (China); Lin, Hsiao-Yun [Department of Life Sciences, National Chung Hsing University, Taichung, Taiwan (China); Tseng, Wen-Pei [Graduate Institute of Sports and Health, National Changhua University of Education, Changhua County, Taiwan (China); Huang, Shiang-Suo [Department of Pharmacology and Institute of Medicine, College of Medicine, Chung Shan Medical University, Taiwan (China); Wu, Chi-Rei [Graduate Institute of Chinese Pharmaceutical Sciences, College of Pharmacy, China Medical University, Taiwan (China); Lin, Chingju [Department of Physiology, School of Medicine, China Medical University, Taichung, Taiwan (China); Yeh, Wei-Lan [Cancer Research Center, Department of Medical Research, Changhua Christian Hospital, Changhua, Taiwan (China); Lu, Dah-Yuu, E-mail: dahyuu@mail.cmu.edu.tw [Graduate Institute of Neural and Cognitive Sciences, China Medical University, Taichung, Taiwan (China)

2013-05-15T23:59:59.000Z

430

Chronic occupational exposure to arsenic induces carcinogenic gene signaling networks and neoplastic transformation in human lung epithelial cells  

SciTech Connect (OSTI)

Chronic arsenic exposure remains a human health risk; however a clear mode of action to understand gene signaling-driven arsenic carcinogenesis is currently lacking. This study chronically exposed human lung epithelial BEAS-2B cells to low-dose arsenic trioxide to elucidate cancer promoting gene signaling networks associated with arsenic-transformed (B-As) cells. Following a 6 month exposure, exposed cells were assessed for enhanced cell proliferation, colony formation, invasion ability and in vivo tumor formation compared to control cell lines. Collected mRNA was subjected to whole genome expression microarray profiling followed by in silico Ingenuity Pathway Analysis (IPA) to identify lung carcinogenesis modes of action. B-As cells displayed significant increases in proliferation, colony formation and invasion ability compared to BEAS-2B cells. B-As injections into nude mice resulted in development of primary and secondary metastatic tumors. Arsenic exposure resulted in widespread up-regulation of genes associated with mitochondrial metabolism and increased reactive oxygen species protection suggesting mitochondrial dysfunction. Carcinogenic initiation via reactive oxygen species and epigenetic mechanisms was further supported by altered DNA repair, histone, and ROS-sensitive signaling. NF-?B, MAPK and NCOR1 signaling disrupted PPAR?/?-mediated lipid homeostasis. A ‘pro-cancer’ gene signaling network identified increased survival, proliferation, inflammation, metabolism, anti-apoptosis and mobility signaling. IPA-ranked signaling networks identified altered p21, EF1?, Akt, MAPK, and NF-?B signaling networks promoting genetic disorder, altered cell cycle, cancer and changes in nucleic acid and energy metabolism. In conclusion, transformed B-As cells with their whole genome expression profile provide an in vitro arsenic model for future lung cancer signaling research and data for chronic arsenic exposure risk assessment. Highlights: ? Chronic As{sub 2}O{sub 3} exposure to lung epithelial cells resulted in a cancer-like phenotype. ? Mice injected with arsenic transformed (B-As) cells displayed metastatic tumors. ? Microarray profiling revealed changes in mitochondrial metabolism and ROS response. ? p21, EF1?, Akt, MAPK, PPAR? and NF-?B networks promoted pro-cancer signaling. ? B-As cells represent a lung cancer model to explore As-associated carcinogenesis.

Stueckle, Todd A., E-mail: tstueckle@hsc.wvu.edu [Department of Basic Pharmaceutical Sciences, West Virginia University, Morgantown, WV 26506 (United States); Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Lu, Yongju, E-mail: yongju6@hotmail.com [Department of Basic Pharmaceutical Sciences, West Virginia University, Morgantown, WV 26506 (United States)] [Department of Basic Pharmaceutical Sciences, West Virginia University, Morgantown, WV 26506 (United States); Davis, Mary E., E-mail: mdavis@wvu.edu [Department of Physiology, West Virginia University, Morgantown, WV 26506 (United States); Wang, Liying, E-mail: lmw6@cdc.gov [Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States)] [Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Jiang, Bing-Hua, E-mail: bhjiang@jefferson.edu [Department of Pathology, Anatomy and Cell Biology, Thomas Jefferson University, Philadelphia, PA 19107 (United States)] [Department of Pathology, Anatomy and Cell Biology, Thomas Jefferson University, Philadelphia, PA 19107 (United States); Holaskova, Ida, E-mail: iholaskova@hsc.wvu.edu [Department of Microbiology, Immunology and Cell Biology, West Virginia University, Morgantown, WV 26506 (United States)] [Department of Microbiology, Immunology and Cell Biology, West Virginia University, Morgantown, WV 26506 (United States); Schafer, Rosana, E-mail: rschafer@hsc.wvu.edu [Department of Microbiology, Immunology and Cell Biology, West Virginia University, Morgantown, WV 26506 (United States)] [Department of Microbiology, Immunology and Cell Biology, West Virginia University, Morgantown, WV 26506 (United States); Barnett, John B., E-mail: jbarnett@hsc.wvu.edu [Department of Microbiology, Immunology and Cell Biology, West Virginia University, Morgantown, WV 26506 (United States); Rojanasakul, Yon, E-mail: yrojan@hsc.wvu.edu [Department of Basic Pharmaceutical Sciences, West Virginia University, Morgantown, WV 26506 (United States)] [Department of Basic Pharmaceutical Sciences, West Virginia University, Morgantown, WV 26506 (United States)

2012-06-01T23:59:59.000Z

431

Metformin inhibits inflammatory response via AMPK-PTEN pathway in vascular smooth muscle cells  

SciTech Connect (OSTI)

Highlights: Black-Right-Pointing-Pointer PTEN was induced by metformin and inhibited by compound C and AMPK siRNA. Black-Right-Pointing-Pointer Metformin suppressed TNF-{alpha}-induced COX-2 and iNOS mRNA expression. Black-Right-Pointing-Pointer Compound C and bpv (pic) increased iNOS and COX-2 protein expression. Black-Right-Pointing-Pointer NF-{kappa}B activation was restored by inhibiting AMPK and PTEN. Black-Right-Pointing-Pointer AMPK and PTEN regulated TNF-{alpha}-induced ROS production in VSMCs. -- Abstract: Atherosclerosis is a chronic inflammation of the coronary arteries. Vascular smooth muscle cells (VSMCs) stimulated by cytokines and chemokines accelerate the inflammatory response and migrate to the injured endothelium during the progression of atherosclerosis. Activation of AMP activated protein kinase (AMPK), a key sensor maintaining metabolic homeostasis, suppresses the inflammatory response. However, how AMPK regulates the inflammatory response is poorly understood. To identify the mechanism of this response, we focused on phosphatase and tensin homolog (PTEN), which is a negative regulator of inflammation. We investigated that activation of AMPK-induced PTEN expression and suppression of the inflammatory response through the AMPK-PTEN pathway in VSMCs. We treated with the well-known AMPK activator metformin to induce PTEN expression. PTEN was induced by metformin (2 mM) and inhibited by compound C (10 {mu}M) and AMPK siRNA. Tumor necrosis factor-alpha (TNF-{alpha}) was used to induce inflammation. The inflammatory response was confirmed by cyclooxygenase (COX)-2, inducible nitric oxide synthase (iNOS) expression, and activation of nuclear factor (NF)-{kappa}B. Metformin suppressed COX-2 and iNOS mRNA and protein expression dose dependently. Treatment with compound C and bpv (pic) in the presence of metformin, iNOS and COX-2 protein expression increased. NF-{kappa}B activation decreased in response to metformin and was restored by inhibiting AMPK and PTEN. Inhibiting AMPK and PTEN restored ROS levels stimulated with TNF-{alpha}. Taken together, PTEN could be a possible downstream regulator of AMPK, and the AMPK-PTEN pathway might be important in the regulation of the inflammatory response in VSMCs.

Kim, Sun Ae [Department of Pharmacology, Aging-Associated Vascular Disease Research Center, College of Medicine, Yeungnam University, Daegu 705-717 (Korea, Republic of)] [Department of Pharmacology, Aging-Associated Vascular Disease Research Center, College of Medicine, Yeungnam University, Daegu 705-717 (Korea, Republic of); Choi, Hyoung Chul, E-mail: hcchoi@med.yu.ac.kr [Department of Pharmacology, Aging-Associated Vascular Disease Research Center, College of Medicine, Yeungnam University, Daegu 705-717 (Korea, Republic of)

2012-09-07T23:59:59.000Z

432

Activation of oxidative stress-responsive signaling pathways in early splenotoxic response of aniline  

SciTech Connect (OSTI)

Aniline exposure causes toxicity to the spleen, which leads to a variety of sarcomas, and fibrosis appears to be an important preneoplastic lesion. However, early molecular mechanisms in aniline-induced toxicity to the spleen are not known. Previously, we have shown that aniline exposure results in iron overload and induction of oxidative stress in the spleen, which can cause transcriptional upregulation of fibrogenic/inflammatory cytokines via activation of oxidative stress (OS)-responsive signaling pathways. To test this mechanism, male SD rats were treated with aniline (1mmol/kg/day via gavage) for 7days, an experimental condition that precedes the appearance of fibrosis. Significant increases in both NF-{kappa}B and AP-1 binding activity was observed in the nuclear extracts of splenocytes from aniline-treated rats as determined by ELISAs, and supported by Western blot data showing increases in p-I{kappa}B{alpha}, p-p65 and p-c-Jun. To understand the upstream signaling events which could account for the activation of NF-{kappa}B and AP-1, phosphorylation patterns of I{kappa}B kinases (IKK{alpha} and IKK{beta}) and mitogen-activated protein kinases (MAPKs) were pursued. Our data showed remarkable increases in both p-IKK{alpha} and p-IKK{beta} in the splenocytes from aniline-treated rats, suggesting their role in the phosphorylation of both I{kappa}B{alpha} and p65 subunits. Furthermore, aniline exposure led to activation of all three classes of MAPKs, as evident from increased phosphorylation of extracellular-signal-regulated kinase (ERK1/2), c-Jun N-terminal kinase (JNK1/2) and p38 MAPKs, which could potentially contribute to the observed activation of both AP-1 and NF-{kappa}B. Activation of upstream signaling molecules was also associated with simultaneous increases in gene transcription of cytokines IL-1, IL-6 and TNF-{alpha}. The observed sequence of events following aniline exposure could initiate a fibrogenic and/or tumorigenic response in the spleen.

Wang Jianling; Wang Gangduo; Ansari, G.A.S. [Department of Pathology, University of Texas Medical Branch, Galveston, TX 77555-0438 (United States); Khan, M. Firoze [Department of Pathology, University of Texas Medical Branch, Galveston, TX 77555-0438 (United States)], E-mail: mfkhan@utmb.edu

2008-07-15T23:59:59.000Z

433

U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Broader source: Energy.gov (indexed) [DOE]

mail mail u.s. Department of Energy Categorical Exclusion Determination Form Proposed Action Title: Notice of Proposed Rulemaking (NOPR) for Energy Conservation Standards for Commercial Refrigeration Equipment (RIN: 1904-AC19) Program or Field Office: EERE - Buildings Technology Program Location(s) (City/County/State): NfA Proposed Action Description: DOE proposes to adopt amended energy conservation standards for commercial refrigeration equipment. The proposed standards consist of maximum daily energy consumption (MDEC) values as a function of either refrigerated volume or total display area (IDA). DOE proposes that the standards covered in this NQPR, if adopted, would apply to all equipment listed in Table 1.1 of the NOPR and manufactured in, or imported

434

TO: FILE SITE  

Office of Legacy Management (LM)

c)&a sw&?u da r/dwl&e c)&a sw&?u da r/dwl&e ALTERNATE NAME: NAME: --------------------------------------- CITY: 79lA% lo -------------------------- STATE: TYPE OF OPERATION -------------_--_ D Research & Development 0 Production scale tasting ench Scale Process 0 Theoretical Studies 0 Sample & Analysis 0 Facility Typo * Manuf actul 0 Universijt 0 Reaearcti I 0 Governmfn Cl Other ---. 0 Production p Disposal/Staraqe cwQ @oa&' y, a( L:& 0 Prime 0 Subcontract& cl Other i nf ormi 0 Purchase Order + fixed fed, time & mat&: I ---------____ I Contract/Purchase Order # ---------____ I -----------------------------. CONTRACTING PERIOD: -~~----___----_--_ ----------------------------------. OWNERSHiP: AK/PIED AECMED GOVT GOUT CON: !%!E!? EASE!? o_w!!!z? LESE!?

435

Low Dose Radiation Research Program: Gregory A. Kimmel  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Gregory A. Kimmel Gregory A. Kimmel Pacific Northwest National Laboratory Past Project A Novel Spatially Resolved Cell Irradiator to Study Bystander and Adaptive Responses to Low-LET Radiation. Technical Abstracts 2002 Workshop: Spatially Resolved Single Cell Irradiator to Study Bystander Responses to Low LET Radiation. Resat, M.S., Kimmel, G.A., Miller, J.H., McDonald, J.C., Murphy, M.K., Strom, D.J., Thrall, B.D., and Colson, S.D. 2001 Workshop: Spatially Resolved Single Cell Irradiator to Study Bystander Responses to Low LET Radiation. Resat, M.S., Kimmel, G.A., Miller, J.H., McDonald, J.C., Murphy, M.K., Strom, D.J., Thrall, B.D., Metting, N.F., and Colson, S.D 1999 Workshop: A Novel, Spatially Resolved Cell Irradiator to Study Bystander and Adaptive Responses to Low-LET Radiation.

436

U.S. Department of Energy Categorical Exclusion Determination Form  

Broader source: Energy.gov (indexed) [DOE]

Electrochemical Fluorination in Molten Fluoride Salts Electrochemical Fluorination in Molten Fluoride Salts Savannah River Site Aiken/Aiken/South Carolina This EEC covers activities in C105/110 related to development of an electrochemical fluorination process to separate selected metals (non- RCRA) from depleted uranium. The goal of the process is to convert depleted uranium metal (U) to gaseous uranium hexafluoride (UF6) that can be easily separated from solution while other metallic constituents remain as metals or are converted to non-volatile fluoride salts. The electrochemical fluorination process will be conducted in molten fluoride eutectic salts at temperatures above 300°C. The electrochemical fluorination process will be carried out using the fluorinating agents such as NF3, XeF2, and F2. Additional inert gases or vacuum may be used in

437

The Mycorrhizal Fungus, Sebacina  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Mycorrhizal Mycorrhizal Fungus, Sebacina vermifera, Enhances Seed Germination and Biomass Production in Switchgrass (Panicum virgatum L) Sita R. Ghimire & Nikki D. Charlton & Kelly D. Craven Published online: 16 April 2009 # Springer Science + Business Media, LLC. 2009 Abstract Seed dormancy and slow seedling establishment are two major concerns in switchgrass (Panicum virgatum L.) production, often resulting in a poor stand with reduced productivity. Studies were conducted to investigate the stability of artificial associations between switchgrass and the ectomycorrhizal fungus, Sebacina vermifera, and to evaluate the potential benefits of this novel association in seed germination and biomass production. All six strains of S. vermifera tested had a high frequency of colonization on switchgrass roots of a synthetic cultivar NF/GA-993. The positive effects of the associations

438

Low Dose Radiation Research Program: Adaptive Response of Mouse Skin  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Adaptive Response of Mouse Skin Epithelial Cells to Low Dose Adaptive Response of Mouse Skin Epithelial Cells to Low Dose Ionizing Radiation: Induction of NF-κB, MnSOD, 14-3-3ζ and Cyclin B1 Authors: Jian Jian Li, Kazi M. Ahmed, Ming Fan, Shaozhong Dong, Douglas R. Spitz, and Cheng-Rong Yu Institutions: Division of Molecular Radiobiology, Purdue University School of Health Sciences, West Lafayette, Indiana; Free Radical and Radiation Biology Program, Department of Radiation Oncology, Holden Comprehensive Cancer Center, The University of Iowa, Iowa City, Iowa; Molecular Immunology Section, Laboratory of Immunology, National Eye Institute, National Institutes of Health, Bethesda, Maryland Gene expression profiles demonstrate that a group of key stress-responsive genes are associated with radiation exposure and may contribute to cellular

439

Microsoft PowerPoint - Low Dose Update Metting 6 Dec 2012  

Broader source: Energy.gov (indexed) [DOE]

Low Dose DOE's Low Dose Low Dose DOE's Low Dose R di ti R h R di ti R h Radiation Research Radiation Research Program Program g g NF Metting, Sc.D., Program Manager Nuclear Energy Advisory Committee Meeting Nuclear Energy Advisory Committee Meeting L'Enfant Plaza Hotel L'Enfant Plaza Hotel 6 December 2012 Office of Science Office of Biological and Environmental Research DOE's Low Dose Program: DOE s Low Dose Program: Is unique within the U.S. government in focusing on low dose biological research aimed at informing current and future g g national radiation risk policy for the public and the workplace * DOE focuses on worker and public safety from very low dose x- and p y y gamma-ray exposures encountered in energy production and environmental cleanup In contrast: In contrast: * NASA focuses on astronaut safety from high energy particulate radiation

440

Climate VISION: Private Sector Initiatives: Semiconductors  

Office of Scientific and Technical Information (OSTI)

Letters of Intent/Agreements Letters of Intent/Agreements The U.S. semiconductor industry, represented by the members of the Environmental Protection Agency's PFC Reduction/Climate Partnership for the Semiconductor Industry, has committed to reduce absolute perfluorocompound (PFC) emissions by 10% below the 1995 baseline level by the year 2010. Perfluorocompounds include the most potent and long-lived greenhouse gases such as perfluorocarbons (e.g., CF4, C2F6, C3F8), trifluoromethane (CHF3), nitrogen trifluoride (NF3), and sulfur hexafluoride (SF6). The Environmental Protection Agency's (EPA) voluntary semiconductor industry partnership was developed collaboratively with the Semiconductor Industry Association (SIA). EPA, SIA, and the Partner companies (listed below) are working to reduce industry greenhouse gas (GHG) emissions. EPA's

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

table5.1_02  

U.S. Energy Information Administration (EIA) Indexed Site

End Uses of Fuel Consumption, 2002; End Uses of Fuel Consumption, 2002; Level: National Data; Row: End Uses within NAICS Codes; Column: Energy Sources, including Net Electricity; Unit: Physical Units or Btu. Distillate Fuel Oil Coal Net Residual and Natural LPG and (excluding Coal RSE NAICS Total Electricity(b) Fuel Oil Diesel Fuel(c) Gas(d) NGL(e) Coke and Breeze) Other(f) Row Code(a) End Use (trillion Btu) (million kWh) (million bbl) (million bbl) (billion cu ft) (million bbl) (million short tons) (trillion Btu) Factors Total United States 311 - 339 ALL MANUFACTURING INDUSTRIES RSE Column Factors: 0.3 1 1 2.4 1.1 1.4 1 NF TOTAL FUEL CONSUMPTION 16,273 832,257 33 24 5,641 26 53 6,006 3.4 Indirect Uses-Boiler Fuel -- 3,540 20 6

442

eCopy, Inc.  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

submitted manuscript has ooen authored submitted manuscript has ooen authored )y a contr"I"'!N nf the U. S. Government unoer contract No. W-31-109-ENG-38. Accordingly, the U. S. Government retains a nonexclusive, royalty-free license to publish lli r reproduce the published form of this contribution, or allow others to do so, for U. S. Government purposes. LS-183 DIFFERENCE RESONANCE STUDY ON THE ELECTRON STORAGE RING ALADDIN AT SRC* J. Liu APS, Argonne National Laboratory and Dept. of Physics, University of Wisconsin-Madison E. Crosbie, L. Teng, J. Bridges APS, Argonne National Laboratory Argonne, IL 60439, USA K. Symon Dept. of Physics University of Wisconsin-Madison W. Trzeciak Synchrotron Radiation Center, Stoughton, 'VI 53589, USA Abstract \Ve have studied the third-order betatron difference resonance on the elec-

443

. DEPART.MENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEP.-\. DE  

Broader source: Energy.gov (indexed) [DOE]

DEPART.MENT OF ENERGY DEPART.MENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEP.-\. DE TERIvllNATION Page 1 of2 RECIPIENT:Delaware State Energy Office STATE: DE PROJECT TITLE: EECBG Subgrant: Lums Pond State Park Natural Gas Conversion Funding Opportunity Announcement Numbl'r DE-FOA-0000013 Procurement Instrument Number DE-EE-0000775 NF.PA Control Number GFO-00OO775-002 cm Number o Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451_IA), 1 have made the following determination: cx, EA, EIS APPENDIX ANI) NUMBER: lkscription: 82.5 Safety and environmental improvements of a facility, including replacement and upgrade of facility components. that do not result in a significant change in the expected useful life, design capacity, or function of the facility and during which

444

I"  

Office of Legacy Management (LM)

.., ..6'"w' .., ..6'"w' I, . v -+"+.~ f, :. 6 ~,i.//bJc-iC ' ; 1-i -5' ; i - *> i-i> I ii I-t t n,.,4 ( .I , f ' .I f x c . : ' . ,"", ' C.--c rn ' 2. I _ i ' L :_ ;) --lr>[-0-t. ' I" c j-j! : , :- ) L (, 3 uTALL.URCICAL PROJECT FOmc W-73 The University of Chicago Chicago, Illinois s docurrient consists of--.TL,y. es and ._______ C? . _ - _ _ ._.__ d..nf ______ &?copiesl fig ____________________-----. 2 Series_.. re%~~IC~ 0~ T~WINATI~N OF SUBCONTRACT _ _____ Contract No. 7401-37-146 To: Quality Hardware & Machine Corp. , Subcontractor 5849 N. Ravenswood Ave. (Attn: L. S. Laystrom ) . Chiw Tlllnnin / &xx Gentlemen: You are hereby notified that by reason of normal expiration, a certain subcontract between you and The University of Chic&go

445

TITLE  

Office of Legacy Management (LM)

CULTURAL RESOURCES STUDY CULTURAL RESOURCES STUDY BACKQROUND RESEARCH REPORT Off-NfS Cukural Rasowcmr Studks: Background Research for Project Shot11 Prepared by Maureen King Alvin R. McLane and William Gray Johnson MAY 1993 DESERT RESEARCH INSTITUTE CULTURAL RESOURCES STUDY BACKGROUND RESEARCH REPORT Off-NTS Cultural Resources Studies: Background Research for Project Shoal Prepared by Maureen King Alvin R. McLane and William Gray Johnson Prepared for the U.S. Department of Energy Nevada Field Office Las Vegas, Nevada This document is UNCLASSIFIED Derivative , , ::/>.: ; , . / I : Classifier - & ? " A . + - = / . /.. Desert Research Institute ate.:^^:,'& MAY 1993 The work upon which this report is based was supporred by the U.S. Department of h e r g y under Contract #DE-AC08-90NV10845

446

OAK RIDGE NATIONAL LABORATORY RESULTS OF RADIOLOGICAL  

Office of Legacy Management (LM)

2 7% 2 7% d &y / 7 ORNL/TM- 10076 OAK RIDGE NATIONAL LABORATORY RESULTS OF RADIOLOGICAL ~-T-m -~=- -~ w-~- -"" * ,<.~- ~w&$UREMENTs: TAKEN IN THE NIAGARA FALLS, NEW YORK, AREA (NF002) J. K. Williams B. A. Berven ~.~~;:;-~~~ ~. -,' - ~~ 7, OPERATED BY MARTIN MARIDTA ENERGY SYSTEMS, INC, FOR THE UNITED STATES DEPARTMENT OF ENERGY --... ORNL/TM-10076 HEALTH AND SAFETY RESEARCH DIVISION Nuclear and Chemical Waste Programs (Activity No. AH 10 05 00 0; ONLWCOI) RESULTS OF RADIOLOGICAL MEASUREMENTS TAKEN IN THE NIAGARA FALLS, NEW YORK, AREA (NFOO2) J. K. Williams* and B. A. Berven *Biology Division Date Published November 1986 Investigation Team B. A. Berven - RASA Program Manager W. D. Cottrell - FUSRAP Project Director W. H. Shinpaugh - Field Survey Supervisor

447

ABORATOtiY  

Office of Legacy Management (LM)

ABORATOtiY ABORATOtiY ., . . . .' _ RESULTS OF THE RADIOLOGICAi SURVEY AT SUMITOMO MACHINERY CORPORATION OF AMERICA, 7 MALCOLM AVENUE, TETERBORO;NEW JERSEY (TJoo~) R. D. Foley L. M. Floyd Printed in the United States of America. Available from National Technical ' Information Serwce U.S. Department of Commerce 5265 Port Royal Road, Springfield, Virginia 22161 NTIS price codes-Printed Copy:A03 Microfiche A01 This report was prepared as an aCCo"nf of Work sponsored by an agency 01 Ihe UnifedStalesGovernment.NeithertheUniledStatesGovernmentnoranyagency thereof. nor any of their employees. makes any warranty. express or implied. or a~wrne~ any legal liability or responsibility for the accuracy. completeness. or urelulnesr of any inlormation. apparatus. product. or process disclosed. or

448

EIS-0350-S1: DOE Notice of Availability of the Draft Supplemental  

Broader source: Energy.gov (indexed) [DOE]

-S1: DOE Notice of Availability of the Draft Supplemental -S1: DOE Notice of Availability of the Draft Supplemental Environmental Impact Statement and Notice of Public Hearings EIS-0350-S1: DOE Notice of Availability of the Draft Supplemental Environmental Impact Statement and Notice of Public Hearings Nuclear Facility Portion of the Chemistry and Metallurgy Research Building Replacement Project NNSA, a semiautonomous agency within DOE, proposes to complete the Chemistry and Metallurgy Research Building Replacement (CMRR) Project at Los Alamos National Laboratory (LANL) by constructing the nuclear facility portion (CMRR-NF) of the CMRR Project to provide the analytical chemistry and materials characterization capabilities currently or previously performed in the existing Chemistry and Metallurgy Research (CMR) Building.

449

Victory Electric Coop Assn Inc | Open Energy Information  

Open Energy Info (EERE)

Electric Coop Assn Inc Electric Coop Assn Inc Jump to: navigation, search Name Victory Electric Coop Assn Inc Place Kansas Utility Id 19820 Utility Location Yes Ownership C NERC Location SPP NERC SPP Yes RTO SPP Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png AE-11 All Electric Service Residential B-11 Small Commercial Service Multi-Phase Industrial B-11 Small Commercial Service Single Phase Commercial DS-11 Domestic Service Residential EDR-04 Economic Development Rider EDR-NF-04 Economic Development Rider No Facilities Charge I-11 Irrigation Service I-B-11 Irrigation Service Center Pivot Drives and Reuse Pumps

450

RECiPIENT:Hidaigo County u.s. DEPARTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER  

Broader source: Energy.gov (indexed) [DOE]

RECiPIENT:Hidaigo County RECiPIENT:Hidaigo County u.s. DEPARTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION PROJ ECT TITLE: County of Hidalgo Tx - Solar Lights for Colonias ARRA·EECBG (S ) Page 1 of2 STATE : TX .'undlng Opportunity Announcement Number DE-FQAOOOO013 Procurement Instrument Number DE-EE0000912 NF.PA Control Number em Number o Based on my review orlhe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4SI.IA), I have made the follo"" ing determination: ex, EA. EIS APPENDIX AND NUMBER: Description: 6 5.1 Actions to conserve energy. demonstrate potential energy conservation , and promote energy--efficJency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve finanCial and technical

451

U.S. Department of Energy Categorical Exclusion Determination Form  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Electrochemical Fluorination in Molten Fluoride Salts Electrochemical Fluorination in Molten Fluoride Salts Savannah River Site Aiken/Aiken/South Carolina This EEC covers activities in C105/110 related to development of an electrochemical fluorination process to separate selected metals (non- RCRA) from depleted uranium. The goal of the process is to convert depleted uranium metal (U) to gaseous uranium hexafluoride (UF6) that can be easily separated from solution while other metallic constituents remain as metals or are converted to non-volatile fluoride salts. The electrochemical fluorination process will be conducted in molten fluoride eutectic salts at temperatures above 300°C. The electrochemical fluorination process will be carried out using the fluorinating agents such as NF3, XeF2, and F2. Additional inert gases or vacuum may be used in

452

u.s. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION  

Broader source: Energy.gov (indexed) [DOE]

REClPIENT:Optony Inc. REClPIENT:Optony Inc. PROJECf Southwest Solar Transformation Initiative TITLE: Page 1 of2 STATE: CA Funding Opportunity Announcement Number Procuremrnt Instrument Number NEPA Control Number CID Number DOE·FQA.Q()()()549 DE-EEOOO5682 GF0-0005682-OO1 0 Based on my review of the information concerning the proposw action, as NEPA Compliance Offic:er (authorized under DOE Order 451.IA),1 have made the follOwing determination : ex, EA, [IS APPENDIX AND NUMBER: Ocscription : A11 Technical advice a nd as s istance to organizations Technical advice and planning assistance to international, national, state, and local organizabons A91nf ormation gathering. analysis, and dissemination Informabon gathenng (indudlng, but not limited 10, literature surveys, inventories, site VISits, and audits), data analysis

453

gropuUCSB2013-07-30_Webinar.ppt  

Broader source: Energy.gov (indexed) [DOE]

Characterization of a Larger Scale NFA Heat: FCRD-NFA1 UCSB Performers: G. R. Odette, N. J. Cunningham, Y. Wu, E. T. Yamamoto Primary Collaborators D. T. Hoelzer (ORNL), S. A. Maloy (LANL) 7/31/13 Primary UCSB Sponsor DOE Office of Nuclear Energy NEUP and LANL Secondary Sponsor DOE Office of Fusion Energy Sciences (irradiation studies) * Systematic development of 'best practice" alloy design processing path for larger heat of 14YWT NFA - FCRD NFA1 * Guided by step by step characterization at UCSB and collaborators using state of the art SANS, APT and TEM techniques - including NF phase and OR * Determined critical parameters - milling time, consolidation temperature, O-level, post consolidation deformation processing * ORNL produced PM2 as the final precursor alloy

454

Microsoft PowerPoint - Dose Ranges 24Jan 05.ppt  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

20 40 60 20 40 60 80 100 rem NRC Dose Limit for Public 100 mrem/yr = 1 mSv/yr (DOE, ICRP, NCRP) ANSI standard N43.17 Personnel scanner, max = 25 mrem/yr Cleanup criteria for site decommissioning/ license termination 25 mrem/yr NCRP "Negligible Dose" Medical Diagnostics (A-J) A C D E G B Temporary "Special Case" annual Public Limit (NRC, DOE) NRC Dose Limit for Workers = 5 rem/yr = 50 mSv/yr Cancer Epidemiology Life Span Study (A-bomb survivors) ( Chart compiled by NF Metting, Office of Science DOE/BER; 24Jan2005,"Orders of Magnitude") Absorbed dose: 100 rad = 1 Gray Dose equivalent: 100 rem = 1 Sievert 100 mrem = 1 mSv (1 rem = 1 rad for x- and gamma- rays) Estimated dose for

455

NVN-078688 | Open Energy Information  

Open Energy Info (EERE)

8688 8688 Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home BLM Geothermal Case: NVN-078688 Case Data Survey Type Unsurveyed - uprotracted Case Status Authorized Case Type GEO_LEASE_NONCOMPETITI Total Acreage 2525 Bid Price/Acre Managing Field Office none provided Surface Manager TOIYABE NF Lessee 1 REESE RIVER GEO POWER LLC Lessee 2 none provided Effective Date 10/1/2004 Expire Date Held By Production (HBP) HBP Date RoyaltyRate Most Recent Action EFFECTIVE DATE Most Recent Action Date 10/1/2004 Location Information Geothermal Resource Area Meridian 21 State(s) Nevada Township 0230N Range 0430E Section 3 Aliquot nw,s2 Retrieved from "http://en.openei.org/w/index.php?title=NVN-078688&oldid=661594" Category: BLM Geothermal Case What links here

456

Federal Utility Partnership Working Group - Utility Interconnection Panel  

Broader source: Energy.gov (indexed) [DOE]

WORKING GROUP - Utility Interconnection Panel M. Renee Jewell, Program/Energy Manager, & Contracting Officer, Forest Service (reneejewell@fs.fed.us) SCENARIO: Fed Agencies had Solar PV Projects To Connect with Utility in California * United States (US) Forest Service (FS) - 1 small Solar Photovoltaic (PV) project; and - 1 small Renewable project (Solar PV) exporting energy to grid. * U.S. National Park Service (NPS) - 24 Small Solar Photovoltaic projects. * U.S. Dept. of Veterans Affairs (VA) - 6 Renewable generation projects of different sizes. FS Region 5 (California) - Solar Photovoltaic Installations Solar PV Project @ Mono Lake Visitor Center (Inyo NF) Solar PV Project (net exporter) @ San Dimas Technology and Development Center SITUATION - Utility Wanted Feds to Sign Its

457

RECIPIENT:Semprius  

Broader source: Energy.gov (indexed) [DOE]

Semprius Semprius u.s. DEPARTr-IEN T OF ENERGY EERE PROJECT MAN AGEMEN T CENT ER NEPA DETERMINATION Page 1 of2 STATE: NC PROJECT TITLE: SAl Incubator - Semprius - Massively Parallel Microcell-based Module Array; NREl Tracking No. 09- 036a Funding Opportunity Announcement Number Procur~mtnt Instrument Number NEPA Control Number elD Number NREL-09-036a G010337 Based on my review of the information concuning the proposed action, as Nf:PA Compliance Officer (authorized undcr DOE Order 45 I. IA), I have made the following determination: ex, EA, EIS APPENDIX ANI) NUMBER: Description: 83.6 Siting, construction (or modification), operation, and decommissioning of facilities for indoor bench-scale research projects and conventional laboratory operations (for example, preparation of chemical standards and sample analysis);

458

Visions for Data Management and Remote Collaboration on ITER  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Transport And Density Peaking At Low Transport And Density Peaking At Low Collisionality On Alcator C-Mod 49 th Annual Meeting of APS - DPP Orlando, 11/14/2007 M. Greenwald, J.W. Hughes, D. Mikkelsen, J. Terry, Alcator Group C. Angioni, H. Weisen M. Greenwald, et al., APS-DPP November 2007 Particle Transport and Density Profiles ● We want to be able to predict density profile - Better fusion performance with moderate density peaking - Effects on stability, divertor operation etc. ● Results from ASDEX (Angioni et al., PRL 2003), JET (H. Weisen, et al., NF 2005) show increase in density peaking at low ν* for H-mode plasmas. - Central fueling (NBI) can play an important role as well. ● Scales to ITER (with weak fueling): n e (0)/ ~ 1.4-1.5 ● In this talk, we'll also look at an additional effect: the role of safety factor

459

NVN-079306 | Open Energy Information  

Open Energy Info (EERE)

6 6 Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home BLM Geothermal Case: NVN-079306 Case Data Survey Type B Case Status Authorized Case Type GEO_LSE_NONCOMP_PRE_2005 Total Acreage 2140.53 Bid Price/Acre Managing Field Office none provided Surface Manager TOIYABE NF Lessee 1 GRADIENT RESOURCES INC Lessee 2 none provided Effective Date 7/1/2006 Expire Date Held By Production (HBP) HBP Date RoyaltyRate 10% - 5% - 5% Most Recent Action RLTY RATE -10%- Most Recent Action Date 7/1/2006 Location Information Geothermal Resource Area Meridian 21 State(s) Nevada Township 0270N Range 0320E Section 2 Aliquot nenesw,w2w2sw Retrieved from "http://en.openei.org/w/index.php?title=NVN-079306&oldid=665211" Category: BLM Geothermal Case What links here

460

REGISTRATION LIST P PR RE ES SO OL LI IC CI IT TA AT TI IO ON  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

REGISTRATION LIST REGISTRATION LIST P PR RE ES SO OL LI IC CI IT TA AT TI IO ON N C CO ON NF FE ER RE EN NC CE E August 9, 2011 Holiday Inn Capitol  550 C Street, SW  Washington, DC 20024 Page 1 of 9 Instructions: (iii) Please indicate (by checking the appropriate box) whether the organization you represent is a large business, small business, or not a business. (iv) Please indicate (by checking the appropriate box) whether your name or the name of your organization may be released on the NNSA website as an attendee of this conference. (v) Please provide an email address if you would like it to be released on the NNSA website. An email address cannot be released if you select neither in column (iv). Name Organization Name Large/Small (iii) Release Attendance? (iv) Email (to release)

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Dissipative Cryogenic Filters with Zero DC Resistance  

SciTech Connect (OSTI)

The authors designed, implemented and tested cryogenic RF filters with zero DC resistance, based on wires with a superconducting core inside a resistive sheath. The superconducting core allows low frequency currents to pass with negligible dissipation. Signals above the cutoff frequency are dissipated in the resistive part due to their small skin depth. The filters consist of twisted wire pairs shielded with copper tape. Above approximately 1 GHz, the attenuation is exponential in {radical}{omega}, as typical for skin depth based RF filters. By using additional capacitors of 10 nF per line, an attenuation of at least 45 dB above 10 MHz can be obtained. Thus, one single filter stage kept at mixing chamber temperature in a dilution refrigerator is sufficient to attenuate room temperature black body radiation to levels corresponding to 10 mK above about 10 MHz.

Bluhm, Hendrik; Moler, Kathryn A.; /Stanford U., Appl. Phys. Dept

2008-04-22T23:59:59.000Z

462

An acoustic numerical analysis of single rotation torpedo propeller  

E-Print Network [OSTI]

&vers&ty C'hatrman of Adv&sorv C'ummittee Dr Kenneth D Ivnrkan 5 numerical study of the acoust&c field asscsciated ivith a t?rped& pr &!&cll&-r hav&ng fnur blades i&as accomplished thr&?&gh the application nf Su& ci method The Succi acnustic analvsi ivas m... I-d&g&t se?es air!'n&1 data ba. e to calculate the lift and &&rag f ir each blade segment, These values vere then converted ti thrust and torque radial distr&butinns. Alsn a rav tracing techniq?e ivas inc&tip&i&at&. c! int& tlic Succi numencal...

Kim, Soo Yong

1989-01-01T23:59:59.000Z

463

100 Area D4 Project Building Completion Report - July 2007 to December 2008  

SciTech Connect (OSTI)

This report documents the decontamination, decommissioning, and demolition of the 105-NB, 163-N, 183-N, 183-NA, 183-NB, 183-NC, 184-N, 184-NA, 184-NB, 184-NC, 184-ND, 184-NE, 184-NF, 1312-N, 1330-N, 1705-N, 1705-NA, 1706-N, 1712-N, 1714-N, 1714-NA, 1714-NB, 1802-N, MO-050, MO-055, MO-358, MO-390, MO-900, MO-911, and MO-950 facilities in the 100 Area of the Hanford Site. The D4 activities for these facilities include utility disconnection, planning, characterization, engineering, removal of hazardous and radiological contaminated materials, equipment removal, decommissioning, deactivation, decontamination, demolition of the structure, and removal of the remaining slabs.

M. T. Stankovich

2009-04-15T23:59:59.000Z

464

RECENT PROGRESS TOWARD A MUON RECIRCULATING LINEAR ACCELERATOR  

SciTech Connect (OSTI)

Both Neutrino Factories (NF) and Muon Colliders (MC) require very rapid acceleration due to the short lifetime of muons. After a capture and bunching section, a linac raises the energy to about 900 MeV, and is followed by one or more Recirculating Linear Accelerators (RLA), possibly followed by a Rapid Cycling Synchnotron (RCS) or Fixed-Field Alternating Gradient (FFAG) ring. A RLA reuses the expensive RF linac section for a number of passes at the price of having to deal with different energies within the same linac. Various techniques including pulsed focusing quadruopoles, beta frequency beating, and multipass arcs have been investigated via simulations to improve the performance and reduce the cost of such RLAs.

Slawomir Bogacz, Vasiliy Morozov, Yves Roblin, Kevin Beard

2012-07-01T23:59:59.000Z

465

Cantor sets and their relation to upper semi-continuous collections  

E-Print Network [OSTI]

~tl Df' ttt 2. 2. 1. Gt d p ttt felt 1 p * X if G is a collection of subsets of X such that each point of X belongs to one and only one set of G. D ft ltl 2. 2. 2. G 1 nf * 1- tt ~d'tt of a topological space X if G is a decomposition of X and if gtG... and g&U open in X, then there exists V open in X such that gt V CU and if htG and h AV$42 then hCU. Throughout this paper we let f be a continuous function from the Cantor set C onto a T space X. Whyburn $8] proved if we let G 2 -1 (f (x): xt...

Granberry, Verland Lee

1977-01-01T23:59:59.000Z

466

Electrostatic potential variation on the flux surface and its impact on impurity transport  

E-Print Network [OSTI]

The particle transport of impurities in magnetically confined plasmas under some conditions does not find, neither quantitatively nor qualitatively, a satisfactory theory-based explanation. This compromise the successful realization of thermo-nuclear fusion for energy production since its accumulation is known to be one of the causes that leads to the plasma breakdown. In standard reactor-relevant conditions this accumulation is in most stellarators intrinsic to the lack of toroidal symmetry, that leads to the neoclassical electric field to point radially inwards. This statement, that the standard theory allows to formulate, has been contradicted by some experiments that showed weaker or no accumulation under such conditions \\cite{Ida_pop_16_056111_2009, Yoshinuma_nf_49_062002_2009}. The charge state of the impurities makes its transport more sensitive to the electric fields. Thus, the short length scale turbulent electrostatic potential or its long wave-length variation on the flux surface $\\Phi_{1}$ -- that...

García-Regaña, J M; Turkin, Y; Kleiber, R; Helander, P; Maaßberg, H; Alonso, J A; Velasco, J L

2015-01-01T23:59:59.000Z

467

Method for studying a sample of material using a heavy ion induced mass spectrometer source  

DOE Patents [OSTI]

A heavy ion generator is used with a plasma desorption mass spectrometer to provide an appropriate neutron flux in the direction of a fissionable material in order to desorb and ionize large molecules from the material for mass analysis. The heavy ion generator comprises a fissionable material having a high n,f reaction cross section. The heavy ion generator also comprises a pulsed neutron generator that is used to bombard the fissionable material with pulses of neutrons, thereby causing heavy ions to be emitted from the fissionable material. These heavy ions impinge on a material, thereby causing ions to desorb off that material. The ions desorbed off the material pass through a time-of-flight mass analyzer, wherein ions can be measured with masses greater than 25,000 amu.

Fries, David P. (St. Petersburg, FL); Browning, James F. (Palm Harbour, FL)

1999-01-01T23:59:59.000Z

468

System for studying a sample of material using a heavy ion induced mass spectrometer source  

DOE Patents [OSTI]

A heavy ion generator is used with a plasma desorption mass spectrometer to provide an appropriate neutron flux in the direction of a fissionable material in order to desorb and ionize large molecules from the material for mass analysis. The heavy ion generator comprises a fissionable material having a high n,f reaction cross section. The heavy ion generator also comprises a pulsed neutron generator that is used to bombard the fissionable material with pulses of neutrons, thereby causing heavy ions to be emitted from the fissionable material. These heavy ions impinge on a material, thereby causing ions to desorb off that material. The ions desorbed off the material pass through a time-of-flight mass analyzer, wherein ions can be measured with masses greater than 25,000 amu.

Fries, David P. (St. Petersburg, FL); Browning, James F. (Palm Harbour, FL)

1998-01-01T23:59:59.000Z

469

Pulse charging device  

SciTech Connect (OSTI)

This paper describes a device for pulse charging of capacitor storage devices of high-power nanosecond generators. The charging voltage reaches 30 kV, the charged capacitance is 2-100 nF, the charging time is 5-10 usec, the pulse frequency reaches 10 kHz, and the average power of the device is 15 kW. The device uses two-section oscillatory charging of the capacitors from a dc supply through high-speed thyristors and a pulse transformer. The described device is intended for use as part of a test bench for high-power nanosecond pulse generators for pumping gas lasers and their components.

Butakov, L.D.; Dubich, V.K.; Lashuk, N.A.; Shubkin, N.G.; Vizir', V.A.

1986-03-01T23:59:59.000Z

470

The development of a rod-coil redox polymer composed of biphenyl esters and poly (4-vinylpyridine)  

E-Print Network [OSTI]

such as dichloromethane. Cleavage of the protecting group is usually accomplished by acids or by a fluoride ion (Bu4N'F, KF or aqueous HF in CHsCN). Base Me)Sicl + ~ SM [Hct 0 R H I es 3. 2. 2. 1 Reagents. Ether, 4-hydroxy-4-biphenyl carboxylic acid, petroleum ether... CHs CH3 CHs I C ? OH + HO y y y y C ? 0 ? Si ? C ? CH CHs CHs 0 0 CHs CH3 CHs II I I C ? 0 y g y y C ? 0 ? SI ? C ? CH CHs CHs DiPC DPTS Figure 3-3. The chemical reaction of room temperature esterification. The coil, with the carboxylic...

DeCormier, Amy Urbanowicz

2012-06-07T23:59:59.000Z

471

Newer method for analyzing naphthenic acids in petroleum  

SciTech Connect (OSTI)

The naphthenic acids in petroleum are considered a class of biological markers. Their potential use in source correlation and as indicator of biodegradation have been reported in the past. Their presence in waste water at refineries may also cause corrosion problems and fish toxicity. Due to their highly complicated nature, detailed characterization of the acids has been difficult and time consuming. This talk will describe a relatively simple approach in characterizing the acids based on their group types. The acids were first separated from petroleum followed by mass spectrometric determinations. Two newer methods were developed to analyze the acid components, namely Chemical Ionization with NF{sub 3} as reagent gas and negative ion Fast Atom Bombardment. The geochemical interpretation based on acid distribution will be demonstrated with a set of well understood crude oil samples.

Fan, T.P. (Shell Development Co., Houston, TX (United States))

1990-08-01T23:59:59.000Z

472

Depositional environments of the Kodiak Shelf, Alaska  

E-Print Network [OSTI]

of these envfronments are created by the bathymetry of tfii s!iel f affec+ing the flow of the shelf waters. Sediment in the re!ighs is characterized by high asti and forami- rifera content, higi poros Ity and low bu', k densi ty. The fine-i;i a in natiif e i i' 'I... and clay. The f'ine-g; ain nature nf tive sed'me!&t of the surf'icfal deposits suogests that. they al e lovi ene!"gy ivii Gniilents, The negative ". opography shelters t'tie sediment in the d pressions from erosion. Iv ACKi'lOWLEDGMENTS The wr1ter...

Burbach, Stuart Peter

2012-06-07T23:59:59.000Z

473

Nuclear forces in the parity odd sector and the LS forces  

E-Print Network [OSTI]

In this paper, we report our first attempt at determining NN potentials in the parity odd sector including the spin-orbit force in lattice QCD, employing the method to extract successfully parity even NN potentials from Nambu-Bethe-Salpeter (NBS) wave functions through the Schr\\"odinger equation. Using Nf = 2 CP-PACS gauge configurations on a 16^3 x 32 lattice at a = 0.16 fm and m_\\pi \\cong 1.1 GeV, we calculate central, tensor and spin-orbit potentials in the parity odd sector. Although statistical errors are still large, we observe that the qualitative features of these potentials roughly agree with those of phenomenological potentials.

Keiko Murano; for the HALQCD Collaboration

2011-12-09T23:59:59.000Z

474

Cutoff effects on lattice nuclear forces  

E-Print Network [OSTI]

We present a lattice QCD study for the cutoff effects on nuclear forces. Two-nucleon forces are determined from Nambu-Bethe-Salpeter (NBS) wave functions using the HAL QCD method. Lattice QCD simulations are performed employing N_f = 2 clover fermion configurations at three lattice spacings of a = 0.108, 0.156, 0.215 fm on a fixed physical volume of L^3 x T = (2.5 fm)^3 x 5 fm with a large quark mass corresponding to m_\\pi = 1.1 GeV. We observe that while the discretization artifact appears at the short range part of potentials, it is suppressed at the long distance region. The cutoff dependence of the phase shifts and scattering length is also presented.

Takumi Doi; for HAL QCD Collaboration

2013-11-12T23:59:59.000Z

475

Use of Treated Municipal Wastewater as Power Plant Cooling System Makeup Water: Tertiary Treatment versus Expanded Chemical Regimen for Recirculating Water Quality Management  

SciTech Connect (OSTI)

Treated municipal wastewater is a common, widely available alternative source of cooling water for thermoelectric power plants across the U.S. However, the biodegradable organic matter, ammonia-nitrogen, carbonate and phosphates in the treated wastewater pose challenges with respect to enhanced biofouling, corrosion, and scaling, respectively. The overall objective of this study was to evaluate the benefits and life cycle costs of implementing tertiary treatment of secondary treated municipal wastewater prior to use in recirculating cooling systems. The study comprised bench- and pilot-scale experimental studies with three different tertiary treated municipal wastewaters, and life cycle costing and environmental analyses of various tertiary treatment schemes. Sustainability factors and metrics for reuse of treated wastewater in power plant cooling systems were also evaluated. The three tertiary treated wastewaters studied were: secondary treated municipal wastewater subjected to acid addition for pH control (MWW_pH); secondary treated municipal wastewater subjected to nitrification and sand filtration (MWW_NF); and secondary treated municipal wastewater subjected nitrification, sand filtration, and GAC adsorption (MWW_NFG). Tertiary treatment was determined to be essential to achieve appropriate corrosion, scaling, and biofouling control for use of secondary treated municipal wastewater in power plant cooling systems. The ability to control scaling, in particular, was found to be significantly enhanced with tertiary treated wastewater compared to secondary treated wastewater. MWW_pH treated water (adjustment to pH 7.8) was effective in reducing scale formation, but increased corrosion and the amount of biocide required to achieve appropriate biofouling control. Corrosion could be adequately controlled with tolytriazole addition (4-5 ppm TTA), however, which was the case for all of the tertiary treated waters. For MWW_NF treated water, the removal of ammonia by nitrification helped to reduce the corrosivity and biocide demand. Also, the lower pH and alkalinity resulting from nitrification reduced the scaling to an acceptable level, without the addition of anti-scalant chemicals. Additional GAC adsorption treatment, MWW_NFG, yielded no net benefit. Removal of organic matter resulted in pitting corrosion in copper and cupronickel alloys. Negligible improvement was observed in scaling control and biofouling control. For all of the tertiary treatments, biofouling control was achievable, and most effectively with pre-formed monochloramine (2-3 ppm) in comparison with NaOCl and ClO2. Life cycle cost (LCC) analyses were performed for the tertiary treatment systems studied experimentally and for several other treatment options. A public domain conceptual costing tool (LC3 model) was developed for this purpose. MWW_SF (lime softening and sand filtration) and MWW_NF were the most cost-effective treatment options among the tertiary treatment alternatives considered because of the higher effluent quality with moderate infrastructure costs and the relatively low doses of conditioning chemicals required. Life cycle inventory (LCI) analysis along with integration of external costs of emissions with direct costs was performed to evaluate relative emissions to the environment and external costs associated with construction and operation of tertiary treatment alternatives. Integrated LCI and LCC analysis indicated that three-tiered treatment alternatives such as MWW_NSF and MWW_NFG, with regular chemical addition for treatment and conditioning and/or regeneration, tend to increase the impact costs and in turn the overall costs of tertiary treatment. River water supply and MWW_F alternatives with a single step of tertiary treatment were associated with lower impact costs, but the contribution of impact costs to overall annual costs was higher than all other treatment alternatives. MWW_NF and MWW_SF alternatives exhibited moderate external impact costs with moderate infrastructure and chemical conditioner dosing, which makes them (especially

David Dzombak; Radisav Vidic; Amy Landis

2012-06-30T23:59:59.000Z

476

Outline for a course in oil production accounting  

E-Print Network [OSTI]

susbbtug tools 3Rb4rQ3. tcols 33&fXioe farniture. aud fixtures 3~orb in progress (k, FQ or fob order) ledger 3~rk tu progress (aaae ~aunt ~ as fer Produoing Properties eroept Lease hold Ces~ll, 61 aud Material Lose aud M guataeut 311. ZQ 3~tangible.../o l ?See/ Depar fin?n CasA ge conds /ler oun f?nip A'?comb 7ax +econ?/a Di oynbufron Geoloq ical Deparfrn?nf Insurance A?co rnCt Vouc/?ers Paya b/e, @racy? Lease Deparfm ac fsib'e /n fereof isce/lance s iO/ao??ri'a / ?or/ /lccoun frnr...

White, Eugene Marshall, Jr

1948-01-01T23:59:59.000Z

477

I=1/2 low-lying mesons in lattice QCD  

E-Print Network [OSTI]

Using conventional constituent-quark model, $I=1/2$ scalar $\\kappa$, vector $K^\\ast(892)$, and axial vector $K_1$ mesons are studied in the asqtad-improved staggered fermion with the wall-source and point-sink interpolators. The mass ratio of $m_{\\kappa}/m_{K^\\ast(892)}$ is numerically confirmed to vary apparently with quark mass, and the experimental ordering $m_{K^\\ast(892)} > m_{\\kappa}$ is elegantly hold when the light $u/d$ quark masses are sufficiently small, while the valence strange quarks are fixed to its physical values. We also get reasonable signals for $K_1$ meson suggested by SCALAR Collaboration from lattice QCD. The computations are conducted with the MILC $N_f=3$ flavor gauge configurations at three lattice spacings: $a\\approx 0.15$, $0.12$, and $0.09$ fm.

Fu, Ziwen

2014-01-01T23:59:59.000Z

478

Nanotechnology in water treatment: an emerging trend  

Science Journals Connector (OSTI)

With advances in nanotechnology, different types of nanomaterial are emerging for applications in water purification and water treatment devices owing to their effectiveness against both chemical and biological contaminants. This paper discusses the application of nanoscale materials that are being evaluated or developed as functional materials for water treatment, e.g. nanomembranes (nanocomposite RO and NF and carbon nanotubes), metal nanoparticles, nanoadsorbents, magnetic nanoparticles, bioactive nanoparticles, carbonaceous nanomaterials, zeolites, dendrimers and nanofibres. Nanomaterials are intrinsically better in terms of performance than other substances used in water treatment because of their high surface area (surface/volume ratio). Owing to these characteristics, these may be used in future at large scale for water purification.

Hiren D. Raval; Jaydev M. Gohil

2010-01-01T23:59:59.000Z

479

Nepali Aawaz Volume 1, Issue 14, 10 May 2006  

E-Print Network [OSTI]

Qm ^) xhf/ lnP/ k7fPsf df]/ªsf oL tLg hgf b'O{ dlxgfb]lv stf/df cnkq k/]sf x'g\\ . pgLx?nfO{ vfg / a:g ;d]t sl7g ePsf] 5 . United we stand snfsf/x?sf] lab]z df]x 1974 AD: On Air bnfnn] em'SofP/ stf/df g]kfnL cnkq 21 » #25; Nepali Aawaz... achieved something through this revolution.” - Prem#25;Shrestha, Abukhaireni, Tanahun, in a letter to the editor of Kantipur. “ ut d+l;/ & ut] ;ft /fhg}lts bn tyf xfd|f] kf6L{aLr ;DkGg !@–a'Fb] P]ltxfl;s ;dembf/Lk|lt k"0f{ k|lta4 x'Fb} ;+ljwfg...

Shrestha, Kashish Das

480

Design, Syntheses, and Evaluation of Lipopolyamines as Anti-Endotoxin Agents  

E-Print Network [OSTI]

LiOH – lithium hydroxide LPS – lipopolysaccaharide LBP – lPS binding protein m - multiplet mg - milligram MeOH – methanol ng – nanogram nM – nanomolar 13 NF?B - nuclear factor-kappa B NMR – nuclear magnetic resonance NO – nitric oxide p38... (excess), MeOH, rt, 12h. b. (i)C 16 H 33 NH 2 (excess), Pd(OH) 2 /C, H 2 , 60 psi; (ii) Boc 2 O(excess),MeOH,rt,12h.c.(i)LiOH,THF:MeOH(3:1),r.t,30min;(i)DMAP,DCC,1,4- diaminobutane, MeOH, r.t, 15 h. d. CF 3 CO 2 H (excess), rt. •4CF 3 CO 2 H 7 3 4 5 6 O...

Shrestha, Anurupa

2007-12-19T23:59:59.000Z

Note: This page contains sample records for the topic "nf nf nf" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

A small unperturbing probe for the measurement and mapping of electric fields at extremely low frequencies  

E-Print Network [OSTI]

rom LP2 ) R3 300kII nA 741 3 6 + Al 2 4 LS600 o Axis elector I Prom . . LP1 I I I I I I I I I Ql MEM55 4C Rl CA Cl 82 pF I R2 100 k 0 I I I I I R4 1MC I I I I I ~Electrostatic shield C3 ~ 7 IJ R5 20MD C2... to Integrators R33 1M0 R30 340 RA 7 nA741 3 6 + A4 2 LED1 FLV110 Q] 9 LS600 Q20 LS600 From LP3 9. 8V To 22 R29 200 kg R32 1MG R31 340k 0 R34 1k 0 010 5 nF Q21 MPS6555 Fig. 17 . Axis selector, optoelectronic converter and hattery switching...

Shrekenhamer, Abraham

2012-06-07T23:59:59.000Z

482

Synthesis of rare gas-halide mixtures resulting in efficient XeF(C. -->. A) laser oscillation  

SciTech Connect (OSTI)

Significantly improved XeF(C..-->..A) laser performance has been achieved using electron beam excitation of complex, multicomponent gas mixtures specifically tailored so as to reduce medium transient absorption in the blue-green region. Use of Ar and Kr together as the effective rare gas buffer-energy transfer species, along with a combination of NF/sub 3/ and F/sub 2/ to produce the desired F-donor molecule characteristics, has permitted synthesis of near optimum medium properties for which XeF(C) is produced efficiently while transient absorption is minimized. With this technique we have achieved laser pulse energy density and intrinsic efficiency of 2.2 +- 0.3 J/l and approx.1.5%, respectively, values that are comparable to those of the B..-->..X rare gas-halide lasers.

Nighan, W.L.; Tittel, F.K.; Wilson W.L. Jr.; Nishida, N.; Zhu, Y.; Sauerbrey, R.

1984-11-01T23:59:59.000Z

483

Recirculating Linac Accelerators For Future Muon Facilities  

SciTech Connect (OSTI)

Neutrino Factories (NF) and Muon Colliders (MC) require rapid acceleration of shortlived muons to multi-GeV and TeV energies. A Recirculating Linear Accelerator (RLA) that uses superconducting RF structures can provide exceptionally fast and economical acceleration to the extent that the focusing range of the RLA quadrupoles allows each muon to pass several times through each high-gradient cavity. A new concept of rapidly changing the strength of the RLA focusing quadrupoles as the muons gain energy is being developed to increase the number of passes that each muon will make in the RF cavities, leading to greater cost effectiveness. We discuss the optics and technical requirements for RLA designs, using RF cavities capable of simultaneous acceleration of both m+ and m- species. The design will include the optics for the multi-pass linac and droplet-shaped return arcs.

Yves Roblin, Alex Bogacz, Vasiliy Morozov, Kevin Beard

2012-04-01T23:59:59.000Z

484

The strange and charm quark contributions to the anomalous magnetic moment (g -2) of the muon from current-current correlators  

E-Print Network [OSTI]

We describe a new technique (presented in arXiv:1403.1778) to determine the contribution to the anomalous magnetic moment (g-2) of the muon coming from the hadronic vacuum polarisation using lattice QCD. Our method uses Pad\\'{e} approximants to reconstruct the Adler function from its derivatives at $q^2=0$. These are obtained simply and accurately from time-moments of the vector current-current correlator at zero spatial momentum. We test the method using strange quark correlators calculated on MILC Collaboration's $n_f$ = 2+1+1 HISQ ensembles at multiple values of the lattice spacing, multiple volumes and multiple light sea quark masses (including physical pion mass configurations).

Chakraborty, Bipasha; Donald, Gordon; Dowdall, Rachel; de Oliveira, Pedro Gonçalves; Koponen, Jonna; Lepage, G Peter; Teubner, T

2014-01-01T23:59:59.000Z

485

The strange and charm quark contributions to the anomalous magnetic moment (g -2) of the muon from current-current correlators  

E-Print Network [OSTI]

We describe a new technique (presented in arXiv:1403.1778) to determine the contribution to the anomalous magnetic moment (g-2) of the muon coming from the hadronic vacuum polarisation using lattice QCD. Our method uses Pad\\'{e} approximants to reconstruct the Adler function from its derivatives at $q^2=0$. These are obtained simply and accurately from time-moments of the vector current-current correlator at zero spatial momentum. We test the method using strange quark correlators calculated on MILC Collaboration's $n_f$ = 2+1+1 HISQ ensembles at multiple values of the lattice spacing, multiple volumes and multiple light sea quark masses (including physical pion mass configurations).

Bipasha Chakraborty; Christine Davies; Gordon Donald; Rachel Dowdall; Pedro Gonçalves de Oliveira; Jonna Koponen; G. Peter Lepage; T. Teubner

2014-10-30T23:59:59.000Z

486

The effect of hydrogen sulfide on straight-run gasoline during storage  

E-Print Network [OSTI]

AORICULTURAL AND MECHANICAL COLLEOE OF TEXAS COLLEGE STATION. TEXAS DEPARTMENT CP CHEMISTRY ANC CHEMICAL ENOINEERINO k+ fg QLU, er XSS4 l 5, . f ~ t ~ II%& '~ NF14eSC %%Sf, Oa 1S CL+koS4 . '45 gg%444440 %Et ~fv@8&l !a . s Thc~ for ". 4...~ ~y holptvL ~~hices 6mLag %ho e&eaduet of t: ha e~~g, ae6 4a &'~tet &i G~ '~ he &to 'a~lssbis ce%4teieae ts the yesyara@na of this eae~iy4~ X448741NA XOA o ~ o ~ e e o ~ ~ e ~ ~ e ~ ~ ~ o o ~ ~ ~ o ~ o X e %44Clem'4 o e ~ e e ~ e ~ ~ o e e...

Miller, Alvin Junius

2012-06-07T23:59:59.000Z

487

Measurement of the neutron F2 structure function via spectator tagging with CLAS  

DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

We report on the first measurement of the F2 structure function of the neutron from semi-inclusive scattering of electrons from deuterium, with low-momentum protons detected in the backward hemisphere. Restricting the momentum of the spectator protons to ? 100 degrees relative to the momentum transfer allows an interpretation of the process in terms of scattering from nearly on-shell neutrons. The F2n data collected cover the nucleon resonance and deep-inelastic regions over a wide range of x for 0.65 2 2, with uncertainties from nuclear corrections estimated to be less than a few percent. These measurements provide the first determination of the neutron to proton structure function ratio F2n/F2p at 0.2 ?< x ?< 0.8, essentially free of nuclear corrections.

Baillie, N; Zhang, J; Bosted, P; Bultmann, S; Christy, M E; Fenker, H; Griffioen, K A; Keppel, C E; Kuhn, S E; Melnitchouk, W; Tvaskis, V; Adhikari, K P; Adikaram, D; Aghasyan, M; Amaryan, M J; Anghinolfini, M; Arrington, J; Avakian, H; Baghdasaryan, H; Battaglieri, M; Biselli, A A; Branford, D; Briscoe, W J; Brooks, W K; Burkert, V D; Carman, D S; Celentano, A; Chandavar, S; Charles, G; Cole, P L; Contalbrigo, M; Crede, V; D' Angelo, A; Daniel, A; Dashyan, N; De Vita, R; De Sanctis, E; Deur, A; Dey, B; Djalali, C; Dodge, G; Domingo, J; Doughty, D; Dupre, R; Dutta, D; Ent, R; Egiyan, H; El Alaoui, A; El Fassi, L; Elouadrhiri, L; Eugenio, P; Fedotov, G; Fegan, S; Fradi, A; Gabrielyan, M Y; Gevorgyan, N; Gilfoyle, G P; Giovanetti, K L; Girod, F X; Gohn, W; Golovatch, E; Gothe, R W; Graham, L; Guegan, B; Guidal, M; Guler, N; Guo, L; Hafidi, K; Heddle, D; Hicks, K; Holtrop, M; Hungerford, E; Hyde, C E; Ilieva, Y; Ireland, D G; Ispiryan, M; Isupov, E L; Jawalkar, S S; Jo, H S; Kalantarians, N; Khandaker, M; Khetarpal, P; Kim, A; Kim, W; King, P M; Klein, A; Klein, F J; Klimenko, A; Kubarovsky, V; Kuleshov, S V; Kvaltine, N D; Livingston, K; Lu, H Y; MacGregor, I.J. D; Mao, Y; Markov, N; McKinnon, B; Mineeva, T; Morrison, B; Moutarde, H; Munevar, E; Nadel-Turonski, P; Ni, A; Niccolai, S; Niculescu, I; Niculescu, G; Osipenko, M; Ostrovidov, A I; Pappalardo, L; Park, K; Park, S; Pasyuk, E; Anefalos Pereira, S; Pisano, S; Pozdniakov, S; Price, J W; Procureur, S; Prok, Y; Protopopescu, D; Raue, B A; Ricco, G; Rimal, D; Ripani, M; Rosner, G; Rossi, P; Sabatie, F; Saini, M S; Salgado, C; Schott, D; Schumacher, R A; Seder, E; Sharabian, Y G; Sober, D I; Sokhan, D; Stepanyan, S; Stepanyan, S S; Stoler, P; Strauch, S; Taiuti, M; Tang, W; Ungaro, M; Vineyard, M F; Voutier, E; Watts, D P; Weinstein, L B; Weygand, D P; Wood, M H; Zana, L

2012-04-06T23:59:59.000Z

488

The World of Dark Shadows Issue 14  

E-Print Network [OSTI]

-Liltz and Li nd a d oo js. Friday, ,;ept embcr 50•••Th !' con v'Jllt ion officially began a t 1: 00. Barb , ~eC;GY .~ ree n ~ l1d ~ h :d iJ L 'ead y spe n t the mornin u setting up the ex hibi t roolD, we were waitinG in l i n e to b e regi ste red , while... !:J:lA D0'". :;()' .t:be WORLDoFMRK StUlOOWS it: I :., o~e n a w... il~ ";1 .':", -::''] :':; :} U l.C :JIl ( :': ·I .~ t £!t · wfJ ek '?nri ., ' ?b 'Nf1 ~n t in :r'H; .\\ j enTtigr:liTI l'u ., ll cn d or;. Ei muTiti:l.O-l\\aiz lntJ/ IJr 101...

Multiple Contributors

1977-01-01T23:59:59.000Z

489

Triton Electric Form Factor at Low-Energies  

E-Print Network [OSTI]

Making use of the Effective Field Theory(EFT) expansion recently developed by the authors, we compute the charge form factor of triton up to next-to-next-to-leading order (N$^2$LO). The three-nucleon forces(3NF) is required for renormalization of the three-nucleon system and it effects are predicted for process and is qualitatively supported by available experimental data. We also show that, by including higher order corrections, the calculated charge form factor and charge radius of $^3$H are in satisfactory agreement with the experimental data and the realistic Argonne $v_{18}$ two-nucleon and Urbana IX potential models calculations. This method makes possible a high precision few-body calculations in nuclear physics. Our result converges order by order in low energy expansion and also cut-off independent.

H. Sadeghi

2009-08-14T23:59:59.000Z

490

A digital autopilot simulator and advisory system for detecting off-nominal behavior  

E-Print Network [OSTI]

]rii = ikf (2. 1) where, [I], rII, and M are the inertia matrix, the body angular velocity vector, and the external torque vector, respectively. [rII] is the angular velocity vector cross product operator given by [CI3] = rI73 ? rI7 2 ? CI2 Cri 3... differential equations (2. 3) can be written as P(t+ht) = P(t) + R(t) ? D'P(t) ? D'R(t)/3+ D'P(t)/6 (2. 7) where, D' =[(clz ? f23 )'+(rII ? f33 ) +(f33 ? w ) ]2tt 0 I( I f l)PI ( 2 nf 2)P2 (~3 f 3)P3] ztt r 2' alt r I I( I fl)?) ( 2 fz)lz ( 3 fz...

Bae, Han-Wook

2012-06-07T23:59:59.000Z

491

A plasma focus driven by a capacitor bank of tens of joules  

Science Journals Connector (OSTI)

As a first step in the design of a repetitive pulsed neutrongenerator a very small plasma-focus device has been designed and constructed. The system operates at low energy (160 nF capacitor bank 65 nH 20–40 kV and ?32–128 J). The design of the electrode was assisted by a computermodel of Mather plasma focus. A single-frame image convertercamera (5 ns exposure) was used to obtain plasma images in the visible range. The umbrellalike current sheath running over the end of the coaxial electrodes and the pinch after the radial collapse can be clearly observed in the photographs. The observations are similar to the results obtained with devices operating at energies several orders of magnitude higher. The calculations indicate that yields of 10 4 –10 5 neutrons per shot are expected with discharges in deuterium.

Patricio Silva; Leopoldo Soto; José Moreno; Gustavo Sylvester; Marcelo Zambra; Luis Altamirano; Horacio Bruzzone; Alejandro Clausse; César Moreno

2002-01-01T23:59:59.000Z

492

Selective Sorption of Actinides by Titania Nanoparticles Covalently Functionalized with Simple Organic Ligands  

Science Journals Connector (OSTI)

For TiO2-NF, sorption of all the metal cations increased with pH, except for Cs, which was not substantially sorbed at any pH. ... TiO2-NH2 can also be considered complementary to U/TEVA, a commercially available uranium sorbent consisting of 40 % diamyl amyl phosphonate impregnated in Amberchrom-CG (acrylic ester) resin, which effectively and selectively sorbs U from >1 M acidic solutions. ... Both the amine and phosphate functionalized titania nanoparticles were able to selectively sorb uranium at low pH in a competitive environment, making this study the first reported example of organically functionalized titania based sorbents for the selective sorption of uranium from solution. ...

Jessica Veliscek-Carolan; Katrina A. Jolliffe; Tracey L. Hanley

2013-11-01T23:59:59.000Z

493

The Polyakov loop and the hadron resonance gas model  

E-Print Network [OSTI]

The Polyakov loop has been used repeatedly as an order parameter in the deconfinement phase transition in QCD. We argue that, in the confined phase, its expectation value can be represented in terms of hadronic states, similarly to the hadron resonance gas model for the pressure. Specifically, L(T) \\approx 1/2\\sum_\\alpha g_\\alpha \\,e^(-\\Delta_\\alpha/T), where g_\\alpha are the degeneracies and \\Delta_\\alpha are the masses of hadrons with exactly one heavy quark (the mass of the heavy quark itself being subtracted). We show that this approximate sum rule gives a fair description of available lattice data with N_f=2+1 for temperatures in the range 150MeVmodels. For temperatures below 150MeV different lattice results disagree. One set of data can be described if exotic hadrons are present in the QCD spectrum while other sets do not require such states.

E. Megias; E. Ruiz Arriola; L. L. Salcedo

2012-04-11T23:59:59.000Z

494

U.S. DEPARThIENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION  

Broader source: Energy.gov (indexed) [DOE]

:. :. U.S. DEPARThIENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION RECIPIENT:Kansas Corporation Commission PROJECT TITLE: Multi-Family Housing Weatherizallon Page \ of2 STATE: KS Funding Opponunlty Announcement Number DE-FOA-OOOOO52 Procurement Instrument Number NF.PA Control Number CID Number DE-EEOOOOO132 GF0-0000132-006 0 Based on my review oflhe information concuning the proposed action, as NEPA Compliance Officer (aulhori7.ed under DOE Order 4SI.IA), I bave made the (allowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Action s 10 conserve energy, demonstrate potential energy conservation , and promote energy-efficiency that do not increase the indoor ooncenlrallQns of potentially harmful substances. These actions may involve financial and technical

495

S:\VM3\RX97\TBL_LIST.WPD [PFP#201331587]  

U.S. Energy Information Administration (EIA) Indexed Site

Million U.S. Households, 1997 Usage Indicators RSE Column Factor: Total Four Most Populated States RSE Row Factors New York California Texas Florida 0.4 1.2 1.1 1.3 1.5 Total .............................................................. 101.5 6.8 11.5 7.0 5.9 NF Weekday Home Activities Home Used for Business Yes ............................................................ 7.4 0.5 0.9 0.4 0.4 13.5 No .............................................................. 94.1 6.3 10.6 6.5 5.6 2.2 Energy-Intensive Activity Yes ............................................................ 2.4 Q 0.4 0.1 Q 26.0 No .............................................................. 99.1 6.7 11.1 6.8 5.8 1.5 Someone Home All Day Yes ............................................................

496

table5.3_02  

U.S. Energy Information Administration (EIA) Indexed Site

3 End Uses of Fuel Consumption, 2002; 3 End Uses of Fuel Consumption, 2002; Level: National Data; Row: End Uses within NAICS Codes; Column: Energy Sources, including Net Demand for Electricity; Unit: Physical Units or Btu. Distillate Net Demand Fuel Oil Coal for Residual and Natural LPG and (excluding Coal RSE NAICS Electricity(b) Fuel Oil Diesel Fuel(c) Gas(d) NGL(e) Coke and Breeze) Row Code(a) End Use (million kWh) (million bbl) (million bbl) (billion cu ft) (million bbl) (million short tons) Factors Total United States 311 - 339 ALL MANUFACTURING INDUSTRIES RSE Column Factors: NF 1 2.4 1.1 1.4 1 TOTAL FUEL CONSUMPTION 966,231 33 24 5,641 26 53 3.4 Indirect Uses-Boiler Fuel 6,714 20 6 2,105 2 35 5.3 Conventional Boiler Use

497

Hybrid skew scattering regime of the anomalous Hall effect in Rashba systems: Unifying Keldysh, Boltzmann, and Kubo formalisms RID B-3617-2008  

E-Print Network [OSTI]

;2#3;#2;2 d#11;2#3;nF #1;#16;y+?#16;x?+ ? #16;y?+#16;x+?#2;#1;A+ ? A?#2;4#12;2 #1;7#2; =E e2 4#3;#14;1 ? h#12; ? ? #4;1 ? h#12;+#7; #1;#11;F ? h#2;#15; , #1;8#2; where #12;#17;=#12;#1;#4;k#17;#2;2+h2 and k#17;2 =2m#1;#11;F#19;#12;#17;#2; describe Fermi... vectors for the lower/upper chiral bands. The intrinsic solution Eq. #1;6#2; contains both the contribu- tion at the Fermi level and from the Fermi sea, often referred to as #6;xy II conductivity within the Kubo-Streda formalism. Our next aim...

Kovalev, Alexey A.; Vyborny, Karel; Sinova, Jairo.

2008-01-01T23:59:59.000Z

498

Neutrino-electron scattering in a magnetic field with allowance for polarizations of electrons  

SciTech Connect (OSTI)

We present an analytic formula for differential cross section (DCS) of neutrino-electron scattering (NES) in a magnetic field (MF) with allowance for longitudinal polarizations of initial and final electrons (IAFE). The DCS of NES in a MF is sensitive to the spin variable of the IAFE and to the direction of the incident and scattered neutrinos (IASN) momenta. Spin asymmetries and field effects in NES in a MF enable us to use initial electrons having a left-hand circular polarization (LHCP) as polarized electron targets in detectors for detection of low-energy neutrinos or relic neutrinos and for distinguishing neutrino flavor (NF). In general, gas consisting of only electrons having a LHCP and gas consisting of only electrons having a right-hand circular polarization (RHCP) are heated by neutrinos asymmetrically. The asymmetry of heating (AH) is sensitive to NF, MF strength, energies (Landau quantum numbers and third components of the momenta) of IAFE, final electron chemical potential, the final temperature of gas consisting of only electrons having a LHCP (RHCP), polar angles of IASN momenta, the difference between the azimuthal angles of IASN momenta, the angle {phi}, and IASN energies. In the heating process of electrons by neutrinos the dominant role belongs to electron neutrinos compared with the contribution of muon (tauon) neutrinos. Electrons having a LHCP in NES in a MF are heated by {nu}{sub e} and {nu}{sub {mu}}({nu}{sub {tau}}) unequally when both the IASN fly along or against the MF direction. For magnetars and neutrinos of 1 MeV energy, within the considered kinematics, the AH in an electron neutrino-electron scattering is 2.23 times that in a muon neutrino-electron scattering or in a tauon neutrino-electron scattering.

Guseinov, V. A. [Department of General and Theoretical Physics, Nakhchivan State University, AZ 7000, Nakhchivan (Azerbaijan); Laboratory of Physical Research, Nakhchivan Division of Azerbaijan National Academy of Sciences, AZ 7000, Nakhchivan (Azerbaijan); Jafarov, I. G. [Department of Theoretical Physics and Astrophysics, Azerbaijan State Pedagogical University, Baku (Azerbaijan); Gasimova, R. E. [Department of General and Theoretical Physics, Nakhchivan State University, AZ 7000, Nakhchivan (Azerbaijan)

2007-04-01T23:59:59.000Z

499

The Muon Accelerator Program  

SciTech Connect (OSTI)

Multi-TeV Muon Colliders and high intensity Neutrino Factories have captured the imagination of the particle physics community. These new types of facility both require an advanced muon source capable of producing O(10{sup 21}) muons per year. The muons must be captured within bunches, and their phase space manipulated so that they fit within the acceptance of an accelerator. In a Neutrino Factory (NF), muons from this 'front end' are accelerated to a few GeV or a few tens of GeV, and then injected into a storage ring with long straight sections. Muon decays in the straight sections produce an intense neutrino beam. In a Muon Collider (MC) the muons must be cooled by a factor O(10{sup 6}) to produce beams that are sufficiently bright to give high luminosity in the collider. Bunches of positive and negative muons are then accelerated to high energy, and injected in opposite directions into a collider ring in which they collide at one or more interaction points. Over the last decade our understanding of the concepts and technologies needed for Muon Colliders and Neutrino Factories has advanced, and it is now believed that, within a few years, with a well focused R&D effort (i) a Neutrino Factory could be proposed, and (ii) enough could be known about the technologies needed for a Muon Collider to assess the feasibility and cost of this new type of facility, and to make a detailed plan for the remaining R&D. Although these next NF and MC steps are achievable, they are also ambitious, and will require an efficient and dedicated organization to accomplish the desired goals with limited resources. The Muon Accelerator Program (MAP) has recently been created to propose and execute this R&D program.

Geer, Steve; /Fermilab; Zisman, Mike; /LBL, Berkeley