Powered by Deep Web Technologies
Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Pinhole Glasses Giuseppe Colicchia, Physics Education, Ludwig-Maximilians University, Munich, Germany  

E-Print Network [OSTI]

, Germany Martin Hopf, Physics Education, Ludwig-Maximilians University, University Munich, Germany Hartmut Wiesner, Physics Education, Ludwig-Maximilians University, University Munich, Germany Dean Zollman

Zollman, Dean

2

Munich, Germany: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 -Energieprojekte3 ClimateSpurr GeothermalCarmelAlum AreaMultitradeMunhall,Munich,

3

EASA Institute of Advanced Studies on Sustainability, Munich -Germany ResponseResponse  

E-Print Network [OSTI]

EASA Institute of Advanced Studies on Sustainability, Munich - Germany ResponseResponse ofof WaterClimate Change Peter A. Wilderer Munich, Germany L. A. Colding Lecture, DTU Lyngby, Denmark, 19-06-2007 #12;EASA Institute of Advanced Studies on Sustainability, Munich - Germany content some general thoughts WS&T ­ long

Mosegaard, Klaus

4

MHK Projects/Munich Germany SHP | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpIncMAK Technologies JumpLuangwa Zambia5.1719°,Crossing ProjectMunich

5

D.D.E. Long, A. Amer and R. Burns July 2002, Munich, Germany Group-Based Management of  

E-Print Network [OSTI]

© D.D.E. Long, A. Amer and R. Burns July 2002, Munich, Germany Group-Based Management, Germany Outline Motivation The Aggregating Cache Successor prediction and tracking Client Cache, Germany Motivation Improved client & server caching by grouping Reduced miss rates means fewer demand

Pâris, Jehan-François

7

In Proc. SPIE 4013-55, UV, Optical, and IR Space Telescopes and Instruments VI, Breckinridge & Jacobsen, eds., Munich, Germany, March 2000. Resolving Piston Ambiguities when Phasing a Segmented Mirror  

E-Print Network [OSTI]

& Jacobsen, eds., Munich, Germany, March 2000. Resolving Piston Ambiguities when Phasing a Segmented Mirror light is insensitive to segment piston errors that are a whole number of waves. If the wavefront sensing range of a wavefront sensor can be extended from on the order of ¢¡¤£ 2 in piston to several waves

Löfdahl, Mats

8

GE Global Research Europe in Munich, Germany  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc DocumentationP-SeriesFlickr Flickr Editor's note:ComputingFusion roadmapping aboutGDB GDB

9

Workshop on Distributed Cloud Computing Dresden, Germany  

E-Print Network [OSTI]

DCC 2013 Workshop on Distributed Cloud Computing Dresden, Germany December 9-12, 2013 (Submission Pan Hui, HKUST, Hong Kong Wolfgang Kellerer, TU Munich, Germany Ruben Montero, Uni Complutense de Waterloo, Canada Marco Canini, T-Labs & TU Berlin, Germany Paolo Costa, MSR & Imperial College, UK Xiaoming

Schmid, Stefan

10

HOTEL ACCOMMODATIONS SUMMER EUROPEAN ACADEMY 2014 Passau (Germany, Bavaria)  

E-Print Network [OSTI]

HOTEL ACCOMMODATIONS SUMMER EUROPEAN ACADEMY 2014 Passau (Germany, Bavaria): Hotel Weisser Hase: +49 851 9211 100 info@weisser-hase.de Munich (Germany, Bavaria): NH Deutscher Kaiser http://www.nh Germany Tel. +49 89 54 530 Email: nhdeutscherkaiser@nh-hotels.com Garmisch (Germany, Bavaria): Garmischer

Bermúdez, José Luis

11

Information visualization for in-car communication processes Michael Sedlmair, BMW Group Research and Technology, Germany, Michael.Sedlmair@bmw.de  

E-Print Network [OSTI]

Information visualization for in-car communication processes Michael Sedlmair, BMW Group Research and Technology, Germany, Michael.Sedlmair@bmw.de Supervisor: Andreas Butz, University of Munich, Germany, Andreas

12

Wolfgang Ketterle Education Pre-diploma (Vordiplom), Physics, University of Heidelberg, Germany, 1978  

E-Print Network [OSTI]

Wolfgang Ketterle Education · Pre-diploma (Vordiplom), Physics, University of Heidelberg, Germany, Germany, 1982. · Ph.D., Physics, Ludwig-Maximilians University of Munich and Max-Planck Institute for Quantum Optics, Garching, Germany, 1986. Employment 1982-88 Research assistant (1982-85) and staff

13

CURRICULUM VITAE -Werner Weber August 16 1945 born in Urach, state Baden/Wrttemberg, Germany  

E-Print Network [OSTI]

CURRICULUM VITAE - Werner Weber August 16 1945 born in Urach, state Baden/Württemberg, Germany June 20 1964 Graduation (Abitur) Allgäu-Gymnasium Kempten, Germany November 1 1964 Study of physics at Technische Universität to February 3 1970 Munich, Germany, Degree "Diplomphysiker" July 13 1972 Ph

Anders, Frithjof

14

DIS 2007, DIFF 8/SPIN 7, Munich, 18/04/07 Andreas Mussgiller  

E-Print Network [OSTI]

) Longitudinal Target Spin Asymmetry (LTSA) #12; The HERMES Spectrometer A. Mussgiller, DIS 2007, Munich, 18

15

Empathy abstracted : George Fuchs and the Munich Artists' Theater  

E-Print Network [OSTI]

Founded by the art critic Georg Fuchs and built by the architect Max Littmann in 1908, the Munich Artists' Theater is famous for its shallow "relief stage." Reworking the ideas of Friedrich Nietzsche and Richard Wagner in ...

Koss, Juliet, 1968-

2000-01-01T23:59:59.000Z

16

The Munich Re Programme: Evaluating the Economics of Climate Risks and Opportunities in the Insurance Sector  

E-Print Network [OSTI]

The Munich Re Programme: Evaluating the Economics of Climate Risks and Opportunities - Evaluating the economics of climate risks and opportunities in the insurance sector (funded by Munich Re://www.cccep.ac.uk. The Munich Re Programme is evaluating the economics of climate risks and opportunities in the insurance

Stevenson, Paul

17

Germany 2007  

E-Print Network [OSTI]

Some Pictures to Share with You - Trip to Berlin and Leipzig, Germany, April, 2007. Inside a Berlin subway station. The subway train has come.

18

China, March 2005 DAY 1: FLYING TO MUNICH & SHANGHAI  

E-Print Network [OSTI]

China, March 2005 DAY 1: FLYING TO MUNICH & SHANGHAI March 12. Saturday Waking up time: 8.30 am. I, lived one year in Beijing and told me lots of stuff about China, where to go, what to do, how in Namibia at Christmas, making me extremely jealous. DAY 2: FIRST DAY IN SHANGHAI, CHINA March 13. Sunday

California at Santa Cruz, University of

19

Good-bye, Germany!  

E-Print Network [OSTI]

1990. Kurthen, Hermann. Germany at the Crossroads: NationalLynn. Social Memory and Germanys Immigration Crisis: AGramling, Anton Kaes, eds. Germany in Transit: Migration,

Sollors, Werner

2004-01-01T23:59:59.000Z

20

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Engineering and Computer Science on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

and Economics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

22

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

23

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

24

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science and Mathematics on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

25

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

26

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

27

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science Mathematics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

28

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Health & Human Development on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

29

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

30

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

31

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

32

Zipping mechanism for force-generation by growing filament bundles  

E-Print Network [OSTI]

We investigate the force generation by polymerizing bundles of filaments, which form because of short-range attractive filament interactions. We show that bundles can generate forces by a zipping mechanism, which is not limited by buckling and operates in the fully buckled state. The critical zipping force, i.e. the maximal force that a bundle can generate, is given by the adhesive energy gained during bundle formation. For opposing forces larger than the critical zipping force, bundles undergo a force-induced unbinding transition. For larger bundles, the critical zipping force depends on the initial configuration of the bundles. Our results are corroborated by Monte Carlo simulations.

Torsten Kuehne; Reinhard Lipowsky; Jan Kierfeld

2011-03-02T23:59:59.000Z

33

ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperative JumpWilliamsonWoodsonCounty is aYoakumYuHange BatteryZim'sZipZone

34

REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY  

E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick

2009-04-06T23:59:59.000Z

35

Study in Germany / Work in Germany  

E-Print Network [OSTI]

Study in Germany / Work in Germany Opportunities Prof. Dr. Silke R. Falkner German Programme Coordinator silke.falkner@usask.ca Tel.: 966-5744 #12;Content I. Opportunities for Study in Germany II. German in Germany V. Term II courses #12;I.A. Study in Germany (Summer) 1. CSSG: Canadian Summer School in Germany

Peak, Derek

36

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

37

AMAST '96, July 1-5, 1996, Munich, Germany Formal Veri cation of Signal Programs  

E-Print Network [OSTI]

to a Power Transformer Station Controller? Michel Le Borgne, Herve Marchand, Eric Rutten IRISA / INRIA cation of the automatic circuit breaking control system of an electric power transformer station is double:protecting the components of the transformer itself, and minimizing the defect in the distribution

Paris-Sud XI, Universit de

38

--Proc. of ICASSP '97, Munich, Germany, April 1997 --CODE GENERATION BY USING INTEGER-CONTROLLED  

E-Print Network [OSTI]

represented by using the synchronous dataflow (SDF) model of computation [2]. In SDF graphs, each actor consumes and produces a constant number of tokens at every firing. The advantage of the SDF model-time scheduling properties of SDF but permit data-dependent execution, Boolean- controlled dataflow (BDF) [6, 7

39

Italy Communication in Milan Austria and Germany PR in Vienna and Munich  

E-Print Network [OSTI]

Summer 2015 Argentina Buenos Aires Brazil Curitiba China Shanghai England London Israel and Palestine Argentina Buenos Aires England London Short-term summer program: Milan Year-long UK Oxford Academic Year Corporate Communication, Information Policy and Governance, Media and Communication Mexico Universidad de

Lien, Jyh-Ming

40

NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER  

E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

The Munich Re Programme: Evaluating the Economics of Climate Risks and Opportunities in the Insurance Sector  

E-Print Network [OSTI]

The Munich Re Programme: Evaluating the Economics of Climate Risks and Opportunities Re Programme - Evaluating the economics of climate risks and opportunities in the insurance sector be found at: http://www.cccep.ac.uk. The Munich Re Programme is evaluating the economics of climate risks

Stevenson, Paul

42

Companies in Munich, employing Physicists General job databases  

E-Print Network [OSTI]

Meissner Bolte www.mbp.de Bain & Company Germany, Inc. www.bain.de Consultancies Booz Allen Hamilton GmbH www.boozallen.de Booz & Company www.booz.com Basycon Unternehmensberatung GmbH www

43

Paper presented at the 17th European Photovoltaic Solar Energy Conference, October 2001, Munich  

E-Print Network [OSTI]

Paper presented at the 17th European Photovoltaic Solar Energy Conference, October 2001, Munich Fraunhofer Institute for Solar Energy Systems ISE, 3 Enecolo AG, 4 University of Oldenburg, Department

Heinemann, Detlev

44

Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of

45

Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

46

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

47

Information on Germany Scholarship  

E-Print Network [OSTI]

Information on Germany Scholarship The whole future f or half the price. Germany Scholarship achieve great things at an early age ­ academically, in their family lives and for society. Germany join forces and give talented young people their full backing. With Germany Scholarship, the Federal

Hoffmeister, Thomas S.

48

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

49

Postcolonialism, Islam, and Contemporary Germany  

E-Print Network [OSTI]

1995] In Atlas of a Tropical Germany: Essays on Politics andMacmillan, 2005. Albrecht, Monika. Postcolonial Germany?and Migration into Germanys Colonial Past. Paper delivered

Albrecht, Monika

2011-01-01T23:59:59.000Z

50

A POWER SHAFT FOR THE MUNICH MP-TANDEM H. STEFFENS, L. ROHRER and S. J. SKORKA  

E-Print Network [OSTI]

000 rpm was chosen. The generators are excited by permanent magnets and show a soft voltage1583 A POWER SHAFT FOR THE MUNICH MP-TANDEM H. STEFFENS, L. ROHRER and S. J. SKORKA power shaft developed for the Munich MP-Tandem is described. The shaft transfers energy at a rate

Paris-Sud XI, Université de

51

Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes, PleaseAddrPagesZip

52

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.

53

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

54

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

55

A City Amputated, A Community Regenerated: Munich During and After the Allied Air War, 1939-1948  

E-Print Network [OSTI]

damaged and often completely severed Munich's connections to coal, electricity, and food. It uses eyewitness accounts and memoirs to analyze the impacts of these changes in peoples' lives. It combines the ideas and insights of military, urban...

Arnold, Tom

2012-05-31T23:59:59.000Z

56

Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

Name (last, first, middle initial) Date of birth Address City, State, ZIP/Postal code Province or less. 1. Proponents of cognitive enhancement--the use of "smart pills," deep brain stimulation

57

University of Bonn Bonn, Germany  

E-Print Network [OSTI]

University of Bonn Bonn, Germany studyabroad 2013|2014 Contact Information · UFIC Study Abroad, Germany, for a semester or a full academic year. Highlights · Students who have not completed at least two

Jawitz, James W.

58

Green Building Technological Approaches for Re-alization from an Investors Perspective based on the MUNICH RE Tower as an Example  

E-Print Network [OSTI]

The Development ?MUNICH RE TOWER? was built from 2001-2003 by MEAG MUNICH ERGO AssetManagement GmbH un-der the Management of Hubert Garzorz. In 1999 the architects Allmann Sattler Wappner won the first prize of the architectural competition and were assigned...

Garzorz, H.

2008-01-01T23:59:59.000Z

59

University of Bamberg Bamberg, Germany  

E-Print Network [OSTI]

University of Bamberg Bamberg, Germany About: The University of Bamberg (German: Otto-Friedrich-Universität Bamberg) in Bamberg, Germany, is simultaneously one of the oldest and one of the newest universities://www.uni-bamberg.de/?id=2697 FUN FACTS ABOUT BAMBERG The working week in Germany also includes Saturday. So, when looking

Duchowski, Andrew T.

60

HEIDELBERG, GERMANY, 9 May 2012  

E-Print Network [OSTI]

HEIDELBERG, GERMANY, 9 May 2012 ­ Fifty-five life scientists from Europe and around the world were Bovolenta Nicolao, Spain Jens C. Brüning, Germany Francesco Cecconi, Italy PRESS RELEASE EMBO welcomes 55, Italy Ulrike Gaul, Germany Pascal Genschik, France Urs Greber, Switzerland William A. Harris, UK Urs

Canet, Léonie

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY  

E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi

62

Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

63

Take Me Home: Determinants of Return Migration Among Germanys Elderly Immigrants  

E-Print Network [OSTI]

M. 2007. After Lifetime in Germany, Turks Still Alone andof Retirement Decisions in Germany in Jonathan Gruber andof Immigrants in Germany? : Evidence from a Longitudinal

Yahirun, Jenjira

2009-01-01T23:59:59.000Z

64

1synQPSK Univ. Paderborn, Germany; CeLight Israel; Photline, France; IPAG, Germany Univ. Paderborn, Germany  

E-Print Network [OSTI]

1synQPSK Univ. Paderborn, Germany; CeLight Israel; Photline, France; IPAG, Germany synQPSK Univ. Paderborn, Germany CeLight Israel Photline, France IPAG, Germany Contract 004631 in FP6 IST-2002 Phase Shift Keying Transmission #12;2synQPSK Univ. Paderborn, Germany; CeLight Israel; Photline, France

Noé, Reinhold

65

Checklist 1 Before your arrival in Germany  

E-Print Network [OSTI]

Checklist 1 Before your arrival in Germany Before you set off for Germany, begin by clarifying München and Germany in general? o Is my command of German adequate to make myself understood in Germany for your room, etc.) o Have I dealt with all the formalities for entry into Germany (passport, visa, etc

Kemper, Gregor

66

U.S. Department of Energy Public Stakeholder Meeting:  

Broader source: Energy.gov (indexed) [DOE]

Manager 1 Munich RE Munich RE reinsurance company with headquarter in Munich, Germany and worldwide spread subsidaries One of the leading reinsurances (based on net...

67

TRANSDUCERS '01 EUROSENSORS XV The 11th International Conference on Solid-State Sensors and Actuators, Munich, Germany, June 10 14, 2001  

E-Print Network [OSTI]

and Titanium with Electrophoretic Deposition Claus Marquordt and Mark G. Allen Georgia Institute of Technology that can be achieved, while unfavorable electrochemical properties make them difficult to electrodeposit). Thicker metallic films can be deposited by electrodeposition; however, due to the electrochemical

68

In Proc. SPIE 4007-105, Adaptive Optical Systems Technologies, Wizinowich, ed., Munich, Germany, March 2000. A Workstation Based Solar/Stellar Adaptive Optics System  

E-Print Network [OSTI]

adequate for a correlation tracker of solar granulation controlling a tip­tilt corrector. In 2000, March 2000. A Workstation Based Solar/Stellar Adaptive Optics System G¨oran B. Scharmera, Mark Shandb eighteen months. The Swedish Vacuum Solar Tower (SVST) uses off-the-shelf workstations for all aspects

Löfdahl, Mats

69

Copyright 2000 by ASME1 ASME paper 2000-GT-0253, ASME IGTI Turbo-Expo-2000, Munich, Germany, May 8-11, 2000.  

E-Print Network [OSTI]

TURBINE BLADE MATERIAL Zhen-Xue Han 1 Department of Mechanical and Aerospace Engineering The University-field and in the solid material of the structure thus automatically predicting correct magnitudes and distribution temperature of internally cooled gas turbine blade. This approach eliminates the need to specify hot surface

Dennis, Brian

70

ICC 2009 University of Germany Southampton  

E-Print Network [OSTI]

ICC 2009 University of Germany Southampton ICC2009 Germany Reduced-Rank Adaptive Least Bit Error;Outline ICC 2009 University of Germany Southampton Outline J Motivation; J Description of hybrid direct Conclusions. #12;Motivation ICC 2009 University of Germany Southampton Motivation ! UWB channels are highly

Chen, Sheng

71

Living in Germany. Studying at FAU.  

E-Print Network [OSTI]

Welcome. Living in Germany. Studying at FAU. www.fau.eu/international #12;Welcome. Living in Germany. Studying at FAU. 2 Welcome. Living in Germany. Studying at FAU. Contents Vice President`s welcome...................................................... 5 1. What you will find in this brochure .............................. 6 2. Welcome to Germany

Fiebig, Peter

72

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico:CommunityNorthwestInformation GreatersourceOhmsettZip

73

Bernhard Westrich, Universitt Stuttgart, Germany; Ulrich Frstner, TU Hamburg-Harburg, Hamburg, Germany (Eds.)  

E-Print Network [OSTI]

Bernhard Westrich, Universität Stuttgart, Germany; Ulrich Förstner, TU Hamburg- Harburg, Hamburg, Germany (Eds.) Sediment Dynamics and Pollutant Mobility in Rivers An Interdisciplinary Approach

Cirpka, Olaf Arie

74

Emigration and the Foundation of West Germany, 1933-1963  

E-Print Network [OSTI]

Gustav. The Canker of Germany. Trans. Norbert S. Maiman.Hauptstadtarchiv, Wiesbaden, Germany. Fraenkel, Martha,Frankfurt, Germany. Gurland, Arcadius, Personalakte.

Strote, Noah Benezra

2011-01-01T23:59:59.000Z

75

Welfare State Integration of Immigrants: the Case of Germany  

E-Print Network [OSTI]

of immigrant integration in Germany; the good performance ofImmigrants: the Case of Germany References Beauftragte derImmigrants: the Case of Germany Friedrich Heckmann Managing

Heckmann, Friedrich

2012-01-01T23:59:59.000Z

76

Review: German Film after Germany. Toward a Transnational Aesthetic  

E-Print Network [OSTI]

Halle. German Film After Germany. Toward a Transnationalof film production in Germany has changed rapidly. Thescale. German Film After Germany: Toward a Transnational

Theisen, Bianca

2011-01-01T23:59:59.000Z

77

Philosophy & Economics "Made in Germany"  

E-Print Network [OSTI]

Philosophy & Economics "Made in Germany" The Bachelor and Master Programmes at a Glance 2011 #12 course of studies in philosophy and economics. The aim is to provide a rigorous training for understanding complex social, economic, and political decision-making. · The philosophy curriculum is focused

Müller, Cord

78

Philosophy & Economics "Made in Germany"  

E-Print Network [OSTI]

Philosophy & Economics "Made in Germany" 10 Argumente für das Bachelor-Studiengang Philosophy & Economics 2011 www.pe.uni-bayreuth.de #12;1. P&E verbindet Philosophie und ?konomie, um Exper- tinnen und Zentrum steht die Verzahnung von philosophi- scher und ökonomischer Perspektive. 8. P&E bereitet für

Müller, Cord

79

Checklist 3 Before your departure from Germany  

E-Print Network [OSTI]

Checklist 3 Before your departure from Germany o It is in your hands to receive the transcripts at the Citizens' Bureau o Remember to cancel all agreements/contracts signed in Germany, such as: - with the bank

Kemper, Gregor

80

Checklist 2 The first days in Germany  

E-Print Network [OSTI]

Checklist 2 The first days in Germany Further information and explanations for the following points (former E111 or E128) or EHIC-Card to one of the social insurers in Germany. You will then be issued in Germany! Only when you have a permanent address you can register with the Citizens' Bureau (Bürgerbüro

Kemper, Gregor

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

INVITED SPEAKERS S. Albeverio (Bonn, Germany)  

E-Print Network [OSTI]

INVITED SPEAKERS S. Albeverio (Bonn, Germany) J. L. Bell (Western Ontario, Canada) V. Benci (PisaIntyre (Edinburgh, UK) T. Nakamura (Tsuda, Japan) H. Osswald (Muenchen, Germany) D.A. Ross (Hawaii, USA) M. Wolff (Tuebingen, Germany). NS2002 NONSTANDARD METHODS and applications in mathematics June 10-16, 2002 Pisa

Di Nasso, Mauro

82

>Why I decided to study in Germany ...  

E-Print Network [OSTI]

>Why I decided to study in Germany ... SIX STUDENTS TELL THEIR STORIES _______ PAGE 04 +/+/+/ STUDYING IN GERMANY /+/+/+ #12;What are the important ingredients for a successful start? The best possible preparation sounds like a good idea. That's why the magazine "Start ­ Studying in Germany" is providing some

Hellebrand, Sybille

83

famelab-germany.de FameLab Germany wird prsentiert von  

E-Print Network [OSTI]

famelab-germany.de FameLab Germany wird präsentiert von Du ... studierst oder arbeitest in den Wissenschaftskommunikation #12;Anmeldung & Videos famelab-germany.de Let's taLK science! FameLab-Vorentscheid 22. März Medien- und Kommuni- kationstraining 5. + 6. April Berlin Finale FameLab Germany: 10. Mai Bielefeld

Hamburg,.Universität

84

Global Imbalances: Is Germany the new China? A Skeptical View  

E-Print Network [OSTI]

Global Imbalances: Is Germany the new China? A Skepticalpatterns of China and Germany. We point out that China'srecent years resembles that of Germanys. Yet, an important

Aizenman, Joshua; Sengupta, Rajeswari

2010-01-01T23:59:59.000Z

85

2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.

86

Name Affiliation Country PI Prof. Dr. Gottfried Mann AIP Germany  

E-Print Network [OSTI]

Name Affiliation Country PI Prof. Dr. Gottfried Mann AIP Germany core members (project manager) Dr Sweden Germany ordinary members Frank Breitling Eoin Carley Dr. Harry Enke Dr. Norbert Jakowski Dr Germany Ireland Germany Germany UK Ireland Germany UK Ireland associated memb. Prof. Dr. John Brown Dr

87

Performing the Jewish body in contemporary Germany.  

E-Print Network [OSTI]

??The dissertation explores the work of Tanya Ury and Esther Dischereit as political interventional, contemporary, Jewish art in Germany. Ury and Dischereit analyze the power (more)

Brungs, Juliette

2013-01-01T23:59:59.000Z

88

Implementation of the control and data acquisition system for a small angle neutron scattering spectrometer according to the "Juelich-Munich standard"  

E-Print Network [OSTI]

In Forschungszentrum Juelich the control and data acquisition systems for several neutron spectrometers are being built. Because some of these spectrometers will be commissioned to the new research reactor FRM-II at the technical university of Munich, there was a joint effort with the instrumentation group of the FRM-II to establish the "Juelich-Munich standard", which is basically a collection of tools and devices which are used for the implementation of the spectrometers. This includes: Siemens S7 PLCs for all axis movement issues, PROFIBUS DP for the connection of slow control equipment in the front end, TACO Middleware running on PC-Systems with Linux, python for scripting and Qt for the implementation of GUIs. The paper describes the implementation the control and data acquisition system of the KWS-1, the first experiment built according to the above standard

H. Kleines; M. Drochner; H. Loevenich; M. Wagener; F. Suxdorf; F. -J. Kayser; K. Zwoll; L. Schaetzler; J. Heinen; M. Heiderich; D. Schwahn; J. Neuhaus; J. Krueger

2002-10-24T23:59:59.000Z

89

Fourth International Workshop on Termination Dagstuhl, Germany  

E-Print Network [OSTI]

Fourth International Workshop on Termination WST '99 Dagstuhl, Germany May 10­12, 1999 Abstracts #12; Fourth International Workshop on Termination WST '99 Dagstuhl, Germany May 10­12, 1999 Abstracts, The Netherlands) #12; Contents Hans Zantema The Termination Hierarchy for Term Rewriting

Giesl, Juergen

90

EUNIS 2009: AVAILABILITY AND CONTINUITY MANAGEMENT AT TECHNISCHE UNIVERSITT MNCHEN AND THE LEIBNIZ SUPERCOMPUTING CENTRE  

E-Print Network [OSTI]

, Garching n. Munich, D-85748 Germany, pluta@tum.de Keywords Availability and Continuity Management, ITIL

91

Requirements for a MDE System to Support Collaborative In-Car Communication Diagnostics  

E-Print Network [OSTI]

Sedlmair BMW Group Research and Technology Munich, Germany michael.sedlmair@bmw.de Dominikus Baur Media

92

UGA in Germany UGA has long maintained an extensive network of connections to Germany, sending numerous students and  

E-Print Network [OSTI]

UGA in Germany July 2012 UGA has long maintained an extensive network of connections to Germany of the best universities in Germany to develop critical research. Student Exchanges: UGA has longstanding on exchange to Germany for an immersive semester or year-long experience. In return, UGA has hosted

Hall, Daniel

93

Design of IT-Collaboration-Platforms with Fuzzy Logic Celine Laurent  

E-Print Network [OSTI]

University of Munich, Boltzmannstr. 3, 85748 Garching, GERMANY BMW Group, Petuelring 130, 80788 Munich distributed environments, with cross-enterprise engineering and, in the second place, the interdisciplinarity

94

International Family Business Succession Planning. Recent Developments in Germany and Spain  

E-Print Network [OSTI]

Tools of transmission in Germany 2.1. Power of attorney postas being unconstitutional. 33 Germany's Constitutional CourtRecent Developments in Germany and Spain Business Roland

Krause, Roland

2009-01-01T23:59:59.000Z

95

Times of the Event: On the Aesthetico-Political in West Germany and Austria circa 1968  

E-Print Network [OSTI]

and Consumer Culture. In West Germany under Construction:Cinema in Democratizing Germany: Reconstructing NationalHeritage: Video Art in Germany from 1963 to the Present.

Weiner, Andrew Stefan

2011-01-01T23:59:59.000Z

96

At the Nexus of Social Policy and Capital Markets: Pension Reform and Enterprise Governance in Germany  

E-Print Network [OSTI]

Company Pension Schemes in Germany, Monthly Report, March.2001. Pension Reform in Germany, draft chapter in R. Kentof Stakeholderism in Germany,forthcoming, Industrielle

Ziegler, J. Nicholas

2008-01-01T23:59:59.000Z

97

College/University: 1998 -2004 University of Kaiserslautern (Germany)  

E-Print Network [OSTI]

Education College/University: 1998 - 2004 University of Kaiserslautern (Germany) Diploma in Biology, billard, card-games, soccer, First name: Niels Last name: Heinz Date of birth: 07.02.1978 Country: Germany

Manstein, Dietmar J.

98

Interpolation Search for Point Cloud Intersection University of Paderborn, Germany  

E-Print Network [OSTI]

janklein@uni-paderborn.de Gabriel Zachmann University of Bonn, Germany zach@cs.uni-bonn.de ABSTRACT We

Zachmann, Gabriel

99

Wage adjustment, competitiveness and unemployment East Germany after unification  

E-Print Network [OSTI]

Wage adjustment, competitiveness and unemployment ­ East Germany after unification Werner Smolny years after unification large differences of the labor market situation in East and West Germany persist adjustment in East Germany and the resulting development of competitiveness and unemployment differentials

Pfeifer, Holger

100

Following Germany's Lead: Using International Monetary Linkages to Estimate  

E-Print Network [OSTI]

Following Germany's Lead: Using International Monetary Linkages to Estimate the Effect of Monetary to countries with the weakest economic ties to Germany. We thank participants at the 2004 NBER Summer Workshop (2001). 2 Many European countries followed Germany's lead in setting their monetary policy during our

Sadoulet, Elisabeth

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Germany Picks Up Scent of In Solving Naples's Trash Crisis  

E-Print Network [OSTI]

1 Germany Picks Up Scent of Profit In Solving Naples's Trash Crisis By STACY MEICHTRY and ALMUT incinerators across Germany that have recently cut deals with the Italian government to burn up to 200,000 tons in northern Germany charge between 150 and 250 ($237 to $394) to incinerate one ton of waste, estimates

Columbia University

102

Simplified Planning Regulations in Germany and the Effects of Landslides  

E-Print Network [OSTI]

Simplified Planning Regulations in Germany and the Effects of Landslides BODO DAMM Georg-August-University Go¨ ttingen, Department of Physical Geography, Go¨ ttingen, Germany (Received November 2005; revised¨ ttingen, Department of Physical Geography, Goldschmidtstra?e 5, D-37077 Go¨ ttingen, Germany. Email: bdamm

Damm, Bodo

103

Klaus Pawelzik1, 2* Centre for Cognitive Sciences, Germany  

E-Print Network [OSTI]

Klaus Pawelzik1, 2* 1 Centre for Cognitive Sciences, Germany 2 University of Bremen, Institute for Theoretical Physics, Germany Financial markets are believed to be efficient in incorporating available and Movement, Giessen, Germany, 19 May - 22 May, 2010. Presentation Type: Poster Presentation Topic: Posters

Kreiter, Andreas K.

104

Germany Inspires Innovation --Welcome to Europe's Leader in Science  

E-Print Network [OSTI]

Germany Inspires Innovation -- Welcome to Europe's Leader in Science #12;Welcome to the Land of Ideas Excellence in research and development Germany is the number one location for research in Europe. Germany's unique scientific tradi- tion and great variety of research offer ideal conditions--not only

Kersting, Kristian

105

March 29 31, 2012 University of Paderborn, Germany  

E-Print Network [OSTI]

Conference March 29 ­ 31, 2012 University of Paderborn, Germany Room B 3.231 supported by the DFG:30 | John Peters | Iowa, USA 03:30 | Gabriele Schabacher | Siegen, Germany 05:00 | Jana Mangold | Erfurt, Germany 06:00 | Menahem Blondheim | Elihu Katz | Jerusalem, Israel 09:30 | Grant David Bollmer | Chapel

Paderborn, Universität

106

HTST 413.02 Modern Germany: 1870-Present  

E-Print Network [OSTI]

HTST 413.02 Modern Germany: 1870-Present Summer 2012 MW 12:00-14:45 Instructor: Mikkel Dack Two - German history is anything but dull. Historically, Germany has been a country torn between the political and the Holocaust; Allied occupation; the division of Germany; the GDR and the German communist ideal

Habib, Ayman

107

GER 320 (Germany Today) Course Outcomes and Programmatic Alignment  

E-Print Network [OSTI]

1 GER 320 (Germany Today) Course Outcomes and Programmatic Alignment Students will be able, conduct presentations, and produce texts relevant to contemporary issues in Germany and the German-speaking countries Individual and small group presentations Final project on important issues in Germany 1a

Mayfield, John

108

DESY -August 7th 2007, Hamburg, Germany 1 Optically Stimulated  

E-Print Network [OSTI]

DESY - August 7th 2007, Hamburg, Germany 1 Optically Stimulated Luminescence Dosimetry Based on Sr, Germany 2 Why OSL ? A bit of History... 1950/1960: first suggestion of OSL as a dosimetry tool 80's years dosimetry system for RADECS Conference INTRODUCTION #12;DESY - August 7th 2007, Hamburg, Germany 3

109

23rd -25th September 2013 Berlin, Germany  

E-Print Network [OSTI]

23rd - 25th September 2013 Berlin, Germany Sustainable Global Conference on Manufacturing Berlin - Germany Tel.: +49 30 314-25117 Fax: +49 30 314-22759 E-Mail: gcsm@mf.tu-berlin.de Website: www" Germany, on 23rd - 25th September 2013. It will be hosted by Technische Universität Berlin. · Value

Berlin,Technische Universität

110

,,NeuroMorph" and ,,NeuroCount": automated tools for fast and objective acquisition of neuronal morphology and quantitative structural analysis MPI of Neurobiology, Group: Cortical Coulmn in silico, 82152 Munich, Germany  

E-Print Network [OSTI]

Staining / Imaging e.g. 1. NeuN/Gad67 / Confocal 2. NeuN / Widefield 3. Ca sensitive dye / 2 photon neuron volume, calculation of cell cluster probability, k-means clustering, large neuron correction --> 3

Andrzejak, Artur

111

Germany Geothermal Region | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation, searchGeaugaInformation MexicoLLC Jump to: navigation,Germany

112

Germany: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power BasicsGermany: Energy Resources Jump to: navigation, search Loading map...

113

15-16 October 2013, Nurnberg, Germany  

E-Print Network [OSTI]

Heating supply system lowtemperature: tw2 = 40...45 ° high temperature: tw2 = 80...100 ° water heater: tw2#12;15-16 October 2013, Nurnberg, Germany 2 Heat Pump Technology for Heating supply systems I,46·10-3 Expansion-compression work ratio ls / ls 0,367 0,103 0,076 0,044 Heating water temperatures (in/out), °C 40

Oak Ridge National Laboratory

114

Oc. 13, 2004Oc. 13, 2004 International Conference of Spatial CognitionInternational Conference of Spatial Cognition 2004, Frausenchiemsee, Germany2004, Frausenchiemsee, Germany  

E-Print Network [OSTI]

of Spatial Cognition 2004, Frausenchiemsee, Germany2004, Frausenchiemsee, Germany 11 Recognizing Variable & Informatics University of BremenUniversity of Bremen GermanyGermany #12;Oc. 13, 2004Oc. 13, 2004 International Conference of Spatial CognitionInternational Conference of Spatial Cognition 2004, Frausenchiemsee, Germany

Bremen, Universität

115

Arnstadt, Germany: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo Feng Bio Energy CoClimate ProjectsArnstadt, Germany:

116

Berlin, Germany: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo Feng Bio JumpVentures JumpGermany: Energy Resources Jump

117

Hannover, Germany: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power BasicsGermany: EnergyPower Finance Jump to:Information ofHannover,

118

Greenpeace Energy Germany | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat Jump to:Photon Place: Golden,GreenVoltsGreenpeace Energy Germany Jump to:

119

Dirichlet Enhanced Relational Learning Zhao Xu zhao.xu@campus.lmu.de  

E-Print Network [OSTI]

, University of Munich, Germany Volker Tresp volker.tresp@siemens.com Kai Yu kai.yu@siemens.com Corporate Technology, Siemens AG, Information and Communications, Munich, Germany Shipeng Yu spyu

Tresp, Volker

120

Contributions to the FEL2001 Conference, August 20-24, 2001 in Darmstadt, Germany  

E-Print Network [OSTI]

Contributions to the FEL2001 Conference, August 20-24, 2001 in Darmstadt, Germany October 2001¨ustefeld , (BESSY, Berlin, Germany), ¡ (DESY, Hamburg, Germany), ¢ (UCLA, Los Angeles, USA), £ (MBI, Berlin, Germany . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 V. Balandin, N. Golubeva, M. K¨orfer (DESY, Hamburg, Germany) Studies of Beam Optics

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Interregional Migration in Germany: Characteristics and Effects for Regions and Migrants  

E-Print Network [OSTI]

Interregional Migration in Germany: Characteristics and Effects for Regions and Migrants Christian of economic activity in East Germany initiated enormous migration flows from East to West Germany. People from East Germany moved towards West Germany, where wages are higher and em- ployment opportunities are more

Pfeifer, Holger

122

ASSIMILATION IN A NEW CONTEXT: THE ROLE OF ORIGIN AND NATIONALITY ON SECOND GENERATION EDUCATIONAL ATTAINMENT IN GERMANY  

E-Print Network [OSTI]

among "Labor Migrants" in Germany International Migrationfor labor migrants in Germany, International Migrationthe former Soviet Union to Germany: Background, trends and

Luthra, Renee Reichl

2008-01-01T23:59:59.000Z

123

Multilingual Development in Germany in the Crossfire of Ideology and Politics: Monolingual and Multilingual Expectations, Polylingual Practices  

E-Print Network [OSTI]

2008. MiGazin. Migration in Germany. Merkel sagt Ja zuW. Multilingual development in Germany in the crossfire ofand citizenship in Germany: discourses on integration and

Pfaff, Carol W.

2011-01-01T23:59:59.000Z

124

Sound in the interface to a mobile computer  

E-Print Network [OSTI]

Brewster,S.A. Human-Computer Interaction International '99 (Munich, Germany) pp 43-47 Lawrence Erlbaum Associates

Brewster, S.A.

125

TARGET VALUE PREDICTION FOR ONLINE OPTIMIZATION AT ENGINE TEST BEDS  

E-Print Network [OSTI]

/ Testing Methods, BMW Group, Munich, Germany Florian.Kloepper@bmw.de, Alexander.Vogel@bmw.de Keywords

Zell, Andreas

126

Alister John Miskimmon, University of Birmingham. RECASTING THE SECURITY BARGAINS: GERMANY, EUROPEAN SECURITY  

E-Print Network [OSTI]

Alister John Miskimmon, University of Birmingham. RECASTING THE SECURITY BARGAINS: GERMANY recent developments in European Union (EU) security policy and their implications for Germany's bilateral of a greater EU security capability has significantly affected Germany's bilateral relations with the USA

Sheldon, Nathan D.

127

Spring 2012 Ger 3501: Contemporary Germany "Environmental Debates--Food, Energy, Politics"  

E-Print Network [OSTI]

Spring 2012 Ger 3501: Contemporary Germany "Environmental Debates--Food, Energy, Politics" Course, interpret, and appreciate literary and multi-media texts related to contemporary Germany and environmental, and personal communications). Contemporary Germany/Global Environmental Topics Charlotte Melin, University

Amin, S. Massoud

128

Integrated modelling and assessment of regional groundwater resources in Germany and Benin, West Africa  

E-Print Network [OSTI]

1 Integrated modelling and assessment of regional groundwater resources in Germany and Benin, West.J.S. SONNEVELD [1] Institute of Hydraulic Engineering, Universitaet Stuttgart, Germany (Roland Conservation University of Bonn, Germany [3] Institute of Landscape Planning and Ecology, University

Cirpka, Olaf Arie

129

NCCR Trade Regulation Brown Bag Series Dr Franziska Humbert, Policy Advisor Corporate Social Responsibility, Oxfam Germany  

E-Print Network [OSTI]

Social Responsibility, Oxfam Germany International Constitutionalism and Child Labour Wednesday, 23, Policy Advisor Corporate Social Responsibility, Oxfam Germany. Abstract The postdoctoral thesis builds of the Speaker Franziska Humbert is a policy advisor on corporate social responsibility at Oxfam Germany

Richner, Heinz

130

Climate change effects on winter chill for fruit crops in Germany  

E-Print Network [OSTI]

chill for fruit crops in Germany Abstract To quantify thechange on fruit production in Germany, this study aimed atof typical winter chill in Germany around 2010, as well as

Luedeling, Eike; Blanke, Michael; Gebauer, Jens

2009-01-01T23:59:59.000Z

131

All one could desire British women remember life in post war Germany  

E-Print Network [OSTI]

of being British in Germany was not experienced in the sameremember life in post war Germany My PhD thesis attempts toof the British occupation of Germany which took place 1945-

Easingwood, Ruth

2007-01-01T23:59:59.000Z

132

Tax Morale after the Reunification of Germany: Results from a Quasi-Natural Experiment  

E-Print Network [OSTI]

Morale Development in Germany (1990, 1997, 1999) WEIGHTEDTable 8: Tax Morale in West Germany 1981 and 1990 WEIGHTED2005) Black Activities in Germany in 2001 and in 2004: A

Feld, Lars P.; Torgler, Benno

2007-01-01T23:59:59.000Z

133

Making and Unmaking Money: Economic Planning and the Collapse of East Germany  

E-Print Network [OSTI]

and the Collapse of East Germany Jonathan R. Zatlin BostonGermans were visiting West Germany a year, while around 35is permitted to travel to West Germany, and when he returns,

Zatlin, Jonathan R

2007-01-01T23:59:59.000Z

134

from the society: 7th International Conference of the IBS to be held in Bayreuth, Germany  

E-Print Network [OSTI]

1315March2013Gttingen,Germany 45August2013IBStobeheldinBayreuth, Germany The Internationalin northernBavaria,Germany,inearlyJanuary2015. The

Gavin, Daniel G.

2012-01-01T23:59:59.000Z

135

Moral Philosophy and the Origins of Modern Aesthetic Theory in Scotland and Germany  

E-Print Network [OSTI]

Stiftungen. Halle/Saale, Germany. BL British Library.Aufklrung. Halle/Saale, Germany, 9 Dezember 2009. Grunert,depravity of man. In both Germany and Scotland between the

Grote, Simon William

2010-01-01T23:59:59.000Z

136

E-Print Network 3.0 - assembly hamburg germany Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

hamburg germany Search Powered by Explorit Topic List Advanced Search Sample search results for: assembly hamburg germany Page: << < 1 2 3 4 5 > >> 1 Curriculum vitae Name: Arne...

137

GEA Refrigeration Technologies / GEA Refrigeration Germany GmbH Wolfgang Dietrich / Dr. Ole Fredrich  

E-Print Network [OSTI]

GEA Refrigeration Technologies / GEA Refrigeration Germany GmbH Wolfgang Dietrich / Dr. Ole Technologies3 Achema 2012 // heat pumps using ammonia Industrial demand on heat in Germany Heatdemandin

Oak Ridge National Laboratory

138

E-Print Network 3.0 - area germany final Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

germany final Search Powered by Explorit Topic List Advanced Search Sample search results for: area germany final Page: << < 1 2 3 4 5 > >> 1 Innovation Community Program Overview...

139

Broadband Wireless Internet Access in Public Transportation1 Andreas Roos, University of Applied Sciences Leipzig, 04277 Leipzig, Germany  

E-Print Network [OSTI]

Sciences Leipzig, 04277 Leipzig, Germany Nico Bayer, University of Applied Sciences Friedberg, 61169 Friedberg, Germany Dmitry Sivchenko, University of Applied Sciences Friedberg, 61169 Friedberg, Germany Michael Flegl, University of Applied Sciences Leipzig, 04277 Leipzig, Germany Profn. Dr. Sabine Wieland

Rakocevic, Veselin

140

Jan Hendrik Bruinier II Anna von Pippich Fabrizio Andreatta -Milan, Italy II Massimo Bertolini -Essen, Germany II Siegfried Bcherer -  

E-Print Network [OSTI]

Massimo Bertolini - Essen, Germany II Siegfried Böcherer - Mannheim, Germany II Thanasis Bouganis - Durham II Jay Jorgenson - New York, USA II Winfried Kohnen - Heidelberg, Germany II Jürg Kramer - Berlin, Germany II Siddarth Sankaran - Bonn, Germany II Maryna Viazovska - Bonn, Germany II Tonghai Yang - Madison

Haller-Dintelmann, Robert

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

The Mormons in Nazi Germany: History and Memory  

E-Print Network [OSTI]

of scholars at Brigham Young University. They feared that Hubener's example would incite Mormon youth to rebel against dictators abroad, hurt the church's relations with communist East Germany, and would offend recent German Mormon immigrants in Utah. A few...

Nelson, David Conley 1953-

2012-10-24T23:59:59.000Z

142

LET THE SUN SHINE: OPTIMAL DEPLOYMENT OF PHOTOVOLTAICS IN GERMANY  

E-Print Network [OSTI]

/kWh, depending on its location as well as on the size and type of PV system used (EPIA Report, 2011). InvestmentLET THE SUN SHINE: OPTIMAL DEPLOYMENT OF PHOTOVOLTAICS IN GERMANY Anna CRETI Jérôme JOAUG Cahier n:chantal.poujouly@polytechnique.edu hal-00751743,version1-14Nov2012 #12;Let the sun shine: optimal deployment of photovoltaics in Germany

Paris-Sud XI, Université de

143

AIMS, Dresden, Germany, May 25-28, 2010 Higher Order Operator-Splitting Methods  

E-Print Network [OSTI]

AIMS, Dresden, Germany, May 25-28, 2010 Higher Order Operator-Splitting Methods based on Zassenhaus Univerist¨at zu Berlin, D- Berlin, Germany AIMS, Dresden, Germany, May 25-28, 2010 Gamze Tanoglu, J¨urgen Geiser Higher Order Operator-Splitting Methods #12;AIMS, Dresden, Germany, May 25-28, 2010 Outline 1

Geiser, Juergen

144

More Effective Aid, More Prestige Why Germany should europeanize its humanitarian  

E-Print Network [OSTI]

More Effective Aid, More Prestige Why Germany should europeanize its humanitarian assistance 04/04/2014 | Category: Humanitarian Intervention, Germany by Matteo Garavoglia If Germany would like to play a more profile. Royal Navy Media Archive, CC BY In the field of humanitarian assistance, Germany punches below

Boyer, Edmond

145

Landfills a thing of the past in Germany where advanced waste management By Evridiki Bersi -Kathimerini  

E-Print Network [OSTI]

Landfills a thing of the past in Germany where advanced waste management rules By Evridiki Bersi but that day has already come in Germany. On June 1, 2005, Germany imposed a ban on traditional garbage dumps, replacing them with one of the most advanced waste-management systems in the world. In the 1970s, Germany

Columbia University

146

Impacts of high energy prices on long-term energy-economic scenarios for Germany  

E-Print Network [OSTI]

Impacts of high energy prices on long-term energy-economic scenarios for Germany Volker Krey1 , Dag and Technology Evaluation (IEF-STE), 52425 Jülich, Germany 2) DIW Berlin, Königin-Luise-Str. 5, 14195 Berlin, Germany 3) ?ko-Institut, Novalisstr. 10, 10115 Berlin, Germany Abstract Prices of oil and other fossil

147

Edinburgh Research Explorer The SARS-Coronavirus-Host Interactome: Identification of  

E-Print Network [OSTI]

, Germany, 2 Institute of Virology, University of Bonn, Bonn, Germany, 3 Max-von-Pettenkofer Institute, Ludwig-Maximilians- University (LMU) Munich, Mu¨nchen, Germany, 4 DKFZ, Heidelberg, Germany, 5 Institute for Informatics, LMU Munich, Mu¨nchen, Germany, 6 Institute of Pharmacy and Molecular Biotechnology, Heidelberg

Millar, Andrew J.

148

Munich Center for Mathematical Philosophy  

E-Print Network [OSTI]

clear that p(WM) and p(WD) should remain unchanged in passing from p to q. So by JC, q(W) = (0, clear }, with u(rain) = 0.6, etc., along with the assumptions that rain => a muddy track, and clear

Wagner, Carl

149

Eigen Lecture Hall, MPIbpc, Am Fassberg 11 Dec 5-6 , 2014, Gttingen, GermanyDec 5-6 , 2014, Gttingen, Germany  

E-Print Network [OSTI]

Eigen Lecture Hall, MPIbpc, Am Fassberg 11 Dec 5-6 , 2014, Göttingen, GermanyDec 5-6 , 2014, Göttingen, Germany Membrane Biophysics Symposium Organizers: Stefan Hell, Tobias Moser, Walter Stühmer

Gollisch, Tim

150

Security Requirements for Management Systems using Mobile Agents H. Reiser G. Vogt  

E-Print Network [OSTI]

Security Requirements for Management Systems using Mobile Agents H. Reiser G. Vogt Munich Network Management Team Munich Network Management Team University of Munich, Germany Munich University of Technology and distributed management systems based on mobile agents have certain advantages over centralized and static

151

Denazification in the American Zone of Germany, 1945-1948  

E-Print Network [OSTI]

DENAEIFICATION IN THE AMERICAN 'ZONE OF GERMANY; 1945-1948 A Thesis RICHARD LEE MCHENRY, JR, Submitted to the Graduate College of Texas A&M University in partial fulfillment of the requirement for the degree of MASTER OF ARTS December 1982... Major Subject: History DENAZIFICATION IN THE AMERICAN ZONE OF GERMANY; 1945-1948 A Thesis by RICHARD LEE MCHENRY, JR, Approved as to style and content by: a ( hairma of ommittee p-~) f l (Member (Me er Head of Departmen December 1982...

McHenry, Richard Lee

1982-01-01T23:59:59.000Z

152

Industrial heat pumps in Germany -potentials, technological development  

E-Print Network [OSTI]

1 Industrial heat pumps in Germany - potentials, technological development and application examples of Energy (IER) Universität Stuttgart ACHEMA 2012 Application of industrial heat pumps Improving energy-efficiency of industrial processes 13. Juni 2012 #12;ACHEMA 2012 - Industrial heat pumps 21st June 2012 Types of Heat Pumps

Oak Ridge National Laboratory

153

Jos Reinoso Institute of Structural Analysis, Leibniz Universitt Hannover, Germany  

E-Print Network [OSTI]

in polycrystalline quasi-brittle Materials: Application to silicon wafers 05.11.2013 Crystal structure: diamond, Germany, 05.11.2013 Damage features in polycrystalline quasi-brittle Materials: Application to silicon wafers 05.11.2013 #12;Damage features in polycrystalline quasi-brittle Materials: Application to silicon

154

Ecient elasto-plastic simulation ICA, University of Stuttgart, Germany  

E-Print Network [OSTI]

E?cient elasto-plastic simulation C. Wieners ICA, University of Stuttgart, Germany Summary. In this paper we describe a method for the construction of radial re- turn algorithms to the plasticity models plasticity, the constitutive equations are determined by the free energy functional and a monotone function

Wieners, Christian

155

Fish Stocks Rainer Froese, IFM-GEOMAR, Kiel, Germany  

E-Print Network [OSTI]

Fish Stocks Rainer Froese, IFM-GEOMAR, Kiel, Germany Daniel Pauly, University of British Columbia and consisting of four elements (species names, location, time, and source). Catches The fish (or other aquatic organisms) of a given stock killed during a certain period by the operation of fishing gear. This definition

Pauly, Daniel

156

A survey of environmental needs and innovative technologies in Germany  

SciTech Connect (OSTI)

The International Technology Program (IT?), formerly the international Technology Exchange Program (ITEP), of the Department of Energy`s (DOE`s) Office of Environmental Restoration and Waste Management (EM) is responsible for promoting: (1) the import of innovative technologies to better address EM`s needs; and (2) the export of US services into foreign markets to enhance US competitiveness. Under this program: (1) the environmental restoration market in Germany was evaluated, including the description of the general types of environmental problems, the environmental regulations, and specific selected contaminated sites; and (2) potentially innovative environmental restoration technologies, either commercially available or under development in Germany, were identified, described and evaluated. It was found that: (1) the environmental restoration market in Germany is very large, on the order of several billion US dollars per year, with a significant portion possibly available to US businesses; and (2) a large number (54) of innovative environmental restoration technologies, which are either commercially available or under development in Germany, may have some benefit to the DOE EM program and should be considered for transfer to the US.

Voss, C.F.; Roberds, W.J. [Golder Associates, Inc., Redmond, WA (United States)

1995-05-01T23:59:59.000Z

157

Research in Germany seminar -IIT Madras The Deutscher Akademischer Austausch Dienst is the world`s largest  

E-Print Network [OSTI]

Research in Germany seminar -IIT Madras The Deutscher Akademischer Austausch Dienst is the world technical universities, 221 universities of applied sciences and 56 arts and science universities in Germany of German universities and research institutions and increase Germany's international competitiveness

Krishnapura, Nagendra

158

Policy Experimentation and the Search for Institutional Change: The Politics of Red-Green Reform in Germany  

E-Print Network [OSTI]

the first four years of Germany first Red-Green coalition.OF RED-GREEN REFORM IN GERMANY June 2006 J. Nicholas Zieglercoalition government in Germany between Social Democrats and

Ziegler, J. Nicholas; Leslie, John C.

2006-01-01T23:59:59.000Z

159

Another Turn of the Tide? World War II and the Writing of Military History in West Germany 1945-2005  

E-Print Network [OSTI]

Army industry and labor in Germany, 1914 1918 (Princeton/DVA 1979-2006; trans. Germany and the Second World War, ed.the past in contemporary Germany (Basingstoke, 2006). W.G.

Echternkamp, Joerg Jrg

2006-01-01T23:59:59.000Z

160

Radical Cosmopolitanism: W. E. B. Du Bois, Germany, and African American Pragmatist Visions for Twenty-First Century Europe  

E-Print Network [OSTI]

W. E. B. Du Bois, Germany, and African American PragmatistAmericans,Africa,andGermanyintheModern World. Ed. W.E.B. DuBoisinNaziGermany,1936. Amerikastudien/

Lenz, Gnter H.

2012-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Keynote speakers Susan E. Trumbore -Max-Planck-Institute for Biogeochemistry Jena, Germany  

E-Print Network [OSTI]

Keynote speakers Susan E. Trumbore - Max-Planck-Institute for Biogeochemistry Jena, Germany http for Landscape Biogeochemistry, Germany http://www.arthur-gessler.de/ PhillippeTortell, University of British

Daniel, Rosenfeld

162

E-Print Network 3.0 - altdorf se germany Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

altdorf se germany Search Powered by Explorit Topic List Advanced Search Sample search results for: altdorf se germany Page: << < 1 2 3 4 5 > >> 1 195Schweiz. Z.Forstwes. 156...

163

E-Print Network 3.0 - area west germany Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

germany Search Powered by Explorit Topic List Advanced Search Sample search results for: area west germany Page: << < 1 2 3 4 5 > >> 1 Invitation to the foreign students of Ulm...

164

E-Print Network 3.0 - aachen germany 15-17 Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

germany 15-17 Search Powered by Explorit Topic List Advanced Search Sample search results for: aachen germany 15-17 Page: << < 1 2 3 4 5 > >> 1 InvitationProgram Technology Watch...

165

Ernst-Moritz-Arndt-Universitt Greifswald (Germany) Information for 2014 / 2015  

E-Print Network [OSTI]

Ernst-Moritz-Arndt-Universität Greifswald (Germany) Information for 2014 / 2015 Full legal Name GREIFSWALD GERMANY Telephone (including country and area codes) + 49 3834 86 1116 Fax (including country

Greifswald, Ernst-Moritz-Arndt-Universität

166

Climate change effects on winter chill for fruit crops in Germany  

E-Print Network [OSTI]

Dormancy release in deciduous fruit trees. Hortic Rev 7:239effects on winter chill for fruit crops in Germany Abstracteffects of climate change on fruit production in Germany,

Luedeling, Eike; Blanke, Michael; Gebauer, Jens

2009-01-01T23:59:59.000Z

167

International Family Business Succession Planning. Recent Developments in Germany and Spain  

E-Print Network [OSTI]

4. Recents reforms in Spain 4.1. Family Protocols in theDevelopments in Germany and Spain Business Roland Krausein North America; 50% in Spain and 80 % in Germany. 8

Krause, Roland

2009-01-01T23:59:59.000Z

168

International monetary relations between the United States, France, and West Germany in the 1970s  

E-Print Network [OSTI]

and West Germany. Yet, the inability of France and the Federal Republic of Germany to form cohesive economic and monetary policies throughout international negotiations or within the European Community (EC), allowed American desires to dictate the path...

Rae, Michelle Frasher

2004-09-30T23:59:59.000Z

169

ESO, Karl-Schwarzschild-Str. 2, 85748 Garching bei Mnchen, Germany VERY LARGE TELESCOPE  

E-Print Network [OSTI]

ESO, Karl-Schwarzschild-Str. 2, 85748 Garching bei Mnchen, Germany VERY LARGE TELESCOPE.02.2014 2 of 19 ESO, Karl-Schwarzschild-Str. 2, 85748 Garching bei Mnchen, Germany CO.02.2014 3 of 19 ESO, Karl-Schwarzschild-Str. 2, 85748 Garching bei Mnchen, Germany CHANGE RECORD

Siebenmorgen, Ralf

170

College/University: 2004-2005: University Kiel, Germany, Institute of Pathology,  

E-Print Network [OSTI]

Education College/University: 2004-2005: University Kiel, Germany, Institute of Pathology, Clinical Genetics. 2000-2003: University Kiel, Graduate Student in Medicine. 1998-2000: University Halle, Germany: Matthias Last name: Christgen Date of birth: 27.01.1979 Country: Germany E-mail: Matthias

Manstein, Dietmar J.

171

Media Transatlantic IV March 29 31, 2012, University of Paderborn, Germany  

E-Print Network [OSTI]

Media Transatlantic IV March 29 ­ 31, 2012, University of Paderborn, Germany Traffic Aiming to bring together media scholars from the United States, Canada, and Germany, the conference continues Schabacher (University of Siegen, Germany): Traffic as 'Dirt Experience'. Harold Innis' Tracing of Media. 04

Paderborn, Universität

172

Living and working in Germany A guide for international scientists at Max Planck Institutes  

E-Print Network [OSTI]

Living and working in Germany A guide for international scientists at Max Planck Institutes #12 and the hospitality in your town. You will quickly find that Germany is a country of many facets ­ a country Planck Society is Germany's most successful scientific or- ganisation in basic research. Max Planck

173

The Max Planck Society At home in Germany -present throughout the world  

E-Print Network [OSTI]

1 The Max Planck Society At home in Germany - present throughout the world Internationalisation ­ the Max Planck Society's role in safeguarding Germany's future Cooperation across national borders is one the internationalisation of science, both on its own behalf and also on behalf of Germany as a research location. To do

174

Determinants and Income Effects of Commuting and Migration An empirical analysis for Germany after Unification  

E-Print Network [OSTI]

Determinants and Income Effects of Commuting and Migration An empirical analysis for Germany after differentials between East and West Germany led to massive commuting and migration flows. In this paper we: Human capital and income, Germany, commuting, migration, GSOEP JEL No.: J31, J61, O15 Address: Institute

Pfeifer, Holger

175

ICT Conference on Energetic Materials June 24-27, 2008 Karlsruhe, Germany  

E-Print Network [OSTI]

39th ICT Conference on Energetic Materials June 24-27, 2008 Karlsruhe, Germany 1 Detonation of Meta on Energetic Materials June 24-27, 2008 Karlsruhe, Germany 2 The smallest meta-stable carbon cluster found-27, 2008 Karlsruhe, Germany 3 accumulated energy is released upon fission of the boat ensemble

Geddes, Cameron Guy Robinson

176

CLIMATOLOGY OF VERTICAL AIR MOTION DURING RAINFALL IN NIAMEY, NIGER AND BLACK FOREST, GERMANY USING AN  

E-Print Network [OSTI]

CLIMATOLOGY OF VERTICAL AIR MOTION DURING RAINFALL IN NIAMEY, NIGER AND BLACK FOREST, GERMANY USING in Niamey, Niger and eight months in Germany's Black Forest. The AMF includes a vertically pointing 95 GHz of the orographically influenced precipitation in Germany's mountains. __________ NOTICE: This manuscript has been

177

(Re)discovering the Social Responsibility of Business in Germany Ariane Berthoin Antal  

E-Print Network [OSTI]

1 (Re)discovering the Social Responsibility of Business in Germany Ariane Berthoin Antal Professor The concept of corporate social responsibility (CSR) is a relatively recent addition to the agenda in Germany agreements. But the past decade has seen significant changes in Germany, challenging established ways

Paris-Sud XI, Université de

178

The Younger Dryas cooling in northeast Germany: summer temperature and environmental changes in  

E-Print Network [OSTI]

The Younger Dryas cooling in northeast Germany: summer temperature and environmental changes, Germany Received 9 December 2011; Revised 7 March 2012; Accepted 9 March 2012 ABSTRACT: A lake sediment record from the Friedla¨nder Grobe Wiese in northeast Germany was studied to reconstruct summer

Bern, Universität

179

April 30 May 2, 2008 SAGT 2008, Paderborn, Germany 1 Facets of the  

E-Print Network [OSTI]

April 30 ­ May 2, 2008 SAGT 2008, Paderborn, Germany 1 Facets of the Fully Mixed Nash Equilibrium Conjecture Rainer Feldmann University of Paderborn, Germany Marios Mavronicolas University of Cyprus, Cyprus Andreas Pieris University of Oxford, UK #12;April 30 ­ May 2, 2008 SAGT 2008, Paderborn, Germany 2

Mavronicolas, Marios

180

Nuremberg, Germany, 27-29 March 2001 International Congress for Particle Technology  

E-Print Network [OSTI]

- 1 - Nuremberg, Germany, 27-29 March 2001 International Congress for Particle Technology Christian 55128 Mainz Germany Email: jonas@mpip-mainz.mpg.de Abstract Session: Headline 17: Nanoscale Materials in a sub-monolayer on a cationic square. #12;- 2 - Nuremberg, Germany, 27-29 March 2001 International

Jonas, Ulrich - Institute of Electronic Structure and Laser, Foundation for Research and Technology

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

15 17 June 2011, T-Labs Berlin Germany Innovative Internet  

E-Print Network [OSTI]

15 ­ 17 June 2011, T-Labs Berlin Germany Innovative Internet Community Systems Welcome to the 11th Berlin/Germany, 15 ­ 17 June 2011 OrgTeam Deutsche Telekom Laboratories & Technische Universität Berlin #12;15 ­ 17 June 2011, T-Labs Berlin Germany Innovative Internet Community Systems Opening Session I2

Rossak, Wilhelm R.

182

Monday, March 27th Opening Remarks: Sybille Hellebrand; Paderborn University, Germany  

E-Print Network [OSTI]

Monday, March 27th Opening Remarks: Sybille Hellebrand; Paderborn University, Germany 18 Hellebrand; Paderborn University, Germany Fault Model Driven Functional Test for PowerPC Microprocessor Processor Christian Zöllin; Stuttgart University, Germany Testability Features of a 45nm Processor Design

Hellebrand, Sybille

183

The political system of Germany Das politische System DeutschlandsRalph Schneider  

E-Print Network [OSTI]

The political system of Germany Das politische System DeutschlandsRalph Schneider ASSIST-Meeting | 17.06.08 #12;ASSIST-Meeting 17.06.08 | Ralph Schneider: The political system of GermanySeite 2 Federal Republic of Germany Bundesrepublik Deutschland Basic information Democratic and social federal

Pfeifer, Holger

184

Country Profile -Germany What are my chances of getting a job?  

E-Print Network [OSTI]

1 Country Profile - Germany Job market What are my chances of getting a job? New graduates from the UK rarely secure work at a professional level in Germany, except teaching English as a foreign. How to improve your chances: you are more likely to secure graduate-level work in Germany if you first

Banaji,. Murad

185

Why Are Residential PV Prices in Germany So Much Lower Than in the United States?  

E-Print Network [OSTI]

Why Are Residential PV Prices in Germany So Much Lower Than in the United States? A Scoping is significantly lower in Germany than in the U.S., due primarily to differences in "soft" costs ­ But relatively consultant data relevant to the cost structure of residential PV in Germany · Focus is the pre

186

published in 1984 in West Germany and later released in a bilingual Ger-  

E-Print Network [OSTI]

published in 1984 in West Germany and later released in a bilingual Ger- man-English edition- grated to West Germany. In her next novel, Reisende auf einem Bein (1989; Traveling on One Leg, 1998 in Romania by starting a new life as an émigré in Germany. In her next novel, Heute wär ich mir lieber nicht

Berry, R. Stephen

187

TENDER: Grants for Partizipation University of Siegen (Germany) and Qafqaz University (Azerbaijan)  

E-Print Network [OSTI]

for Partizipation University of Siegen (Germany) and Qafqaz University (Azerbaijan) International Summer School "Security Issues in the South Caucasus and Central Asia" at Siegen (Germany) from August 12th with participants from Azerbaijan, Georgia, Germany and Kazakhstan will focus on security issues arising from

Siegen, Universität

188

Operational costs induced by fluctuating wind power production in Germany and Scandinavia  

E-Print Network [OSTI]

Operational costs induced by fluctuating wind power production in Germany and Scandinavia Peter Christoph Weber, Chair of Energy Management, University Duisburg-Essen, Germany Rüdiger Barth & Heike Brand, Institute of Energy Economics and the Rational Use of Energy, University of Stuttgart, Germany Abstract

189

CCMM 2000, Bayreuth, Germany September 19 1 Design and Synthesis of an FLC Conglomerate  

E-Print Network [OSTI]

CCMM 2000, Bayreuth, Germany · September 19 1 Design and Synthesis of an FLC Conglomerate Composed Research Center University of Colorado at Boulder #12;CCMM 2000, Bayreuth, Germany · September 19 2 Sm · Rel Polarity #12;CCMM 2000, Bayreuth, Germany · September 19 3 SmCSPF (Ferroelectric Conglomerate) Sm

Walba, David

190

Contributions to the FEL'99 Conference, August 23-28, 1999 in Hamburg, Germany  

E-Print Network [OSTI]

Contributions to the FEL'99 Conference, August 23-28, 1999 in Hamburg, Germany TESLA FEL-Report 1999-07 #12;Contents M. Dohlus, A. Kabel, T.Limberg DESY, Germany Coherent Effects of a Macrobunch, Germany Efficient Field Calculation of 3D Bunches on General Trajectories

191

Cyclical adjustment, capital-labor substitution and total factor productivity convergence East Germany after unification  

E-Print Network [OSTI]

Germany after unification Werner Smolny, University of Ulm June 22, 2011 Abstract Despite rapid economic of Ulm 89069 Ulm, GERMANY Tel.: (49) 731 50 24260, Fax: (49) 731 50 24262 e-mail: Werner.Smolny@uni-ulm.de This paper is part of the research projects "Productivity adjustment in East Germany"and "Investment in East

Pfeifer, Holger

192

NETHERLANDS AND GERMANY: DAIRY GOAT PRODUCTS June 15 -June 18, 2009  

E-Print Network [OSTI]

NETHERLANDS AND GERMANY: DAIRY GOAT PRODUCTS June 15 - June 18, 2009 Written by Clara Hedrich-890-3014 babcock@cals.wisc.edu http://babcock.cals.wisc.edu ISBN 978-1-59251-121-3 #12;Netherlands and Germany cheese produced in the region of Germany where the Hedrich family originated and possibly use it in our

Wisconsin at Madison, University of

193

The event is free and open to the public "Germany in Europe" Campus Weeks  

E-Print Network [OSTI]

The event is free and open to the public "Germany in Europe" Campus Weeks German Embassy and German Educator Seattle, WA and Cologne, Germany Marcel Machill Professor of Journalism and International Media Systems University of Leipzig, Germany Randy Smith, Co-director, MU Center for the Digital Globe Donald W

Missouri-Columbia, University of

194

Hitzler & Vrandecic PPSWR05 Dagstuhl, Germany September 2005 AIFBKnowledgeWeb  

E-Print Network [OSTI]

Hitzler & Vrandecic PPSWR05 Dagstuhl, Germany September 2005 Slide 1 AIFBKnowledgeWeb Faster OWL Using Split Programs Pascal Hitzler Denny Vrandecic AIFB, University of Karlsruhe, Germany SCREECH #12;Hitzler & Vrandecic PPSWR05 Dagstuhl, Germany September 2005 Slide 2 AIFBKnowledgeWeb Problem

Hitzler, Pascal

195

Downburst-producing thunderstorms in southern Germany: Radar analysis and predictability  

E-Print Network [OSTI]

Downburst-producing thunderstorms in southern Germany: Radar analysis and predictability Nikolai der Atmosphäre, Oberpfaffenhofen, 82234 Wessling, Germany b European Severe Storms Laboratory (ESSL), Münchner Str. 20, 82234 Wessling, Germany a r t i c l e i n f o a b s t r a c t Article history: Received

196

Hitzler Neural-Symbolic Integration Osnabrck Germany November 2007 Neural-Symbolic Integration  

E-Print Network [OSTI]

Hitzler Neural-Symbolic Integration Osnabrück Germany November 2007 1/49 AIFBAIFB Neural-Symbolic Integration PD Dr. Pascal Hitzler AIFB, Universität Karlsruhe Osnabrück, Germany, November 2007 #12;Hitzler Neural-Symbolic Integration Osnabrück Germany November 2007 2/49 AIFBAIFB PD Dr. Pascal Hitzler

Hitzler, Pascal

197

Curriculum vitae 1989 -1992 Student of Biochemistry, University of Hanover, Germany  

E-Print Network [OSTI]

Curriculum vitae 1989 - 1992 Student of Biochemistry, University of Hanover, Germany 1989 - 1995, Professor Karl-Josef Dietz, University of Bielefeld, Germany 2000 - 2006 Leader of an Independently Funded-Golm, Germany Biofuture Prize, German Federal Ministry of Education and Research 07/2006 Habilitation

Gerwert, Klaus

198

August 2014 Subject: Research in Germany-Information Seminar for Young Researchers  

E-Print Network [OSTI]

26th August 2014 Subject: Research in Germany- Information Seminar for Young Researchers Warm-doctoral candidates as well as young academics interested in a research stay in Germany, towards initiating & strengthening research co operations with Germany. Date: 20th September 2014 Venue: IC & SR Auditorium, IIT

Krishnapura, Nagendra

199

The 32nd International Electric Propulsion Conference, Wiesbaden, Germany September 11 15, 2011  

E-Print Network [OSTI]

The 32nd International Electric Propulsion Conference, Wiesbaden, Germany September 11 ­ 15, 2011 1 Electric Propulsion Conference, Wiesbaden · Germany September 11 ­ 15, 2011 K. Matyash1 , Max-Planck-Institut für Plasmaphysik, EURATOM Association, Greifswald, D-17491, Germany R. Schneider2 , Greifswald

200

R E S U M E Renewable Energy for Sustainable Development of Indonesia and Germany  

E-Print Network [OSTI]

R E S U M E Renewable Energy for Sustainable Development of Indonesia and Germany (RESDIG Republic of Germany, German Alumni in Surabaya with supports from DAAD, GIZ and Goethe Institute. Through the cooperation and share experiences between Indonesia and Germany in renewable and sustainable

Peinke, Joachim

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Wolfram Hoefer, Dr.-Ing. Assistant Professor Department of Landscape Architecture  

E-Print Network [OSTI]

-09 Design development for the outdoor exhibition Earth from Above at Battery Park City, NYC. Co-PI design" (Munich Green), City of Munich 2003 House Garden (Speyer, Germany), private client 2001 Part time free

Goodman, Robert M.

202

Yngve Kristoffersen, University of Bergen, Allegaten 41, Bergen, 5007 Norway, yngve.kristoffersen@geo.uib.no Coen Hofstede, AWI, Bremerhaven, Germany  

E-Print Network [OSTI]

.kristoffersen@geo.uib.no Coen Hofstede, AWI, Bremerhaven, Germany Olaf Eisen, AWI, Bremerhaven, Germany Lomonosov Canada Basin Coen Hofstede, AWI, Bremerhaven, Germany Olaf Eisen, AWI, Bremerhaven, Germany Richard Blenkner, Dept

Kristoffersen, Yngve

203

World Renewable Energy Congress VII, Cologne, Germany, 29 June -5 July, 2002 SOLAR RESOURCE ASSESSMENT AND SITE EVALUATION  

E-Print Network [OSTI]

World Renewable Energy Congress VII, Cologne, Germany, 29 June - 5 July, 2002 SOLAR RESOURCE, Germany ** German Aerospace Center (DLR), Institute of Atmospheric Physics, Oberpfaffenhofen, Germany VII, Cologne, Germany, 29 June - 5 July, 2002 and diffuse irradiance model of Dumortier [5]. Both use

Heinemann, Detlev

204

Bundestag elections 2009: The political system of Germany Bundestagswahl 2009: Das politische System DeutschlandsRalph Schneider  

E-Print Network [OSTI]

Bundestag elections 2009: The political system of Germany Bundestagswahl 2009: Das politische Schneider: The political system of GermanySeite 2 Federal Republic of Germany Bundesrepublik Deutschland.09.09 | Ralph Schneider: The political system of GermanySeite 3 Administrative organisation

Pfeifer, Holger

205

Groups and Model TheoryGroups and Model TheoryGroups and Model TheoryGroups and Model Theory "Die Wolfsburg", Mlheim a.d.Ruhr, Germany"Die Wolfsburg", Mlheim a.d.Ruhr, Germany"Die Wolfsburg", Mlheim a.d.Ruhr, Germany"Die Wolfsburg", Mlheim a.d.Ruhr, Germa  

E-Print Network [OSTI]

Wolfsburg", Mülheim a.d.Ruhr, Germany"Die Wolfsburg", Mülheim a.d.Ruhr, Germany"Die Wolfsburg", Mülheim a.d.Ruhr, Germany"Die Wolfsburg", Mülheim a.d.Ruhr, Germany May 30May 30May 30May 30--------June 3, 2011June 3, 2011

Tent, Katrin

206

Multi-Output Regularized Projection Kai Yu Shipeng Yu Volker Tresp  

E-Print Network [OSTI]

for Computer Science Corporate Technology Siemens AG, Germany University of Munich, Germany Siemens AG, Germany kai.yu@siemens.com spyu@dbs.informatik.uni-muenchen.de volker.tresp@siemens.com Abstract

Tresp, Volker

207

Westport Germany GmbH | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperative Jump to: navigation,WesternWestley,2009294°,8908021°,Westport Germany

208

Page 1 of 4 Postfach 10 10 62 -80084 Mnchen, Germany  

E-Print Network [OSTI]

Page 1 of 4 Postfach 10 10 62 - 80084 München, Germany Telefon: +49 89 2108-0 Fax: +49 89 2108-1111 Internet: http://www.mpfp.mpg.de Jean-Paul-Stra?e 12 - 53173 Bonn, Germany Telefon: +49 228 833-0 Fax: +49 themselves in Germany or which should be developed further. The 2014 Max Planck Research Award

209

CS 2011, 15 17 June 2011, T-Labs Berlin Germany Innovative Internet  

E-Print Network [OSTI]

11th I2 CS 2011, 15 ­ 17 June 2011, T-Labs Berlin Germany Innovative Internet Community Systems I2, 15 ­ 17 June 2011, T-Labs Berlin Germany Pre-Conference Events Tuesday: Informal Welcome Reception Wednesday morning: Gro?er Tiergarten Jogging #12;11th I2 CS 2011, 15 ­ 17 June 2011, T-Labs Berlin Germany

Rossak, Wilhelm R.

210

Xenophobia in a United Germany : a unique post-reunification phenomenon?.  

E-Print Network [OSTI]

??In the years immediately following the 1990 reunification of Germany, an increase in anti-foreigner violence threatened the stability of reunification efforts and exacerbated tensions between (more)

Carden, Alison Elizabeth

2010-01-01T23:59:59.000Z

211

The Implementation of Environmental Education in elementary schools A Comparative Study between Sweden and Germany .  

E-Print Network [OSTI]

??The investigation on Environmental Education (EE) and its implementation in elementary schools in the EU-member states Germany and Sweden was done through field theoretical studies (more)

Radeiski, Jenny

2009-01-01T23:59:59.000Z

212

Fiftieth CCR reformer goes on stream in Germany  

SciTech Connect (OSTI)

The fiftieth continuous catalytic reformer built since this technology was introduced by UOP Process Division in 1971 has gone on stream in West Germany. The 21,300-b/sd unit is in Deutsche Shell AG's Godorf refinery. It is the sixth such unit put in service by Shell International. Others are in refineries at Harburg, West Germany; Shellhaven, England; Palau Bokum, Singapore; Pernis, Netherlands; and Geelong, Australia. CCR units operate at much higher severity than older reforming units. Severity is a function of higher octane, lower pressure, and feedstock. The operating severity or catalyst deactivation rate may be 20 times that of high pressure, low octane units. Continuous catalyst regeneration is then the key for maintaining long-term operations at steady state conditions. To facilitate continuous catalyst regeneration, the three reactors are stacked. This design permits the catalyst to move in essentially plug flow through the reactors at a rate determined by the rate of catalyst withdrawal to the regeneration section.

Not Available

1985-03-18T23:59:59.000Z

213

GE Technology to Help Canada Province Meet Growing Energy Needs  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

funding and collaboration models at its European Global Research Center near Munich, Germany. Mark Little, GE's Senior Vice President and Chief Technology Officer, and thought...

214

18.5 Million in New Research Program Funding Announced, GE...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

funding and collaboration models at its European Global Research Center near Munich, Germany. Mark Little, GE's Senior Vice President and Chief Technology Officer, and thought...

215

356.ps - Optimization Online  

E-Print Network [OSTI]

P. Bauer. Siemens AG, Corporate Research and Development. ZT SE 4. 81730 Munich, Germany. Petra.Bauer@mchp.siemens.de. J. T. Linderoth. Axioma, Inc.

216

International workshop Dzyaloshinskii-Moriya Interaction and Exotic Spin Structures  

E-Print Network [OSTI]

single crystal» 10.00 ­ 10.20 Sven-Arne Siegfried Helmholtz-Zentrum Geesthacht, Munich, Germany «Small

Titov, Anatoly

217

Hierarchical Interfacebased Supervisory Control Part I: Serial Case  

E-Print Network [OSTI]

.A. Brandin is with Siemens Corporate Technology, Munich, Germany. Email: bertil.brandin@siemens.com W potentially significant savings in computational effort. Additionally, the development of clean interfaces

Smith, Spencer

218

Vehicular Wireless Networks: What should the future hold?  

E-Print Network [OSTI]

/11/2011 - - p 6Jrme Hrri IEEE WiVEC 2011 - Panel Source: Oliver Klemp, BMW R&D, Munich, Germany, Oliver.Klemp@bmw

Gesbert, David

219

ESO, Karl-Schwarzschild-Str. 2, 85748 Garching bei Mnchen, Germany Data Management and Operations Division  

E-Print Network [OSTI]

ESO, Karl-Schwarzschild-Str. 2, 85748 Garching bei Mnchen, Germany Data Management and Operations-Schwarzschild-Str. 2, 85748 Garching bei Mnchen, Germany CHANGE RECORD ISSUE DATE SECTION/PARA. AFFECTED REASON Phase 3 Workshop, ESO Garching, 30.11.2010. 2 07.03.2011 3, 4.11, 4.12 Added All Figures updated #12;ESO

Liske, Jochen

220

ESO, Karl-Schwarzschild-Str. 2, 85748 Garching bei Mnchen, Germany Data Management and Operations Division  

E-Print Network [OSTI]

ESO, Karl-Schwarzschild-Str. 2, 85748 Garching bei Mnchen, Germany Data Management and Operations-Schwarzschild-Str. 2, 85748 Garching bei Mnchen, Germany CHANGE RECORD ISSUE DATE SECTION/PARA. AFFECTED REASON Workshop, ESO Garching, 30.11.2010. 2 07.03.2011 2.1 Keyword ASSOMi added. 3.2.1, 3.2.2 NJITTER, DIT, NDIT

Liske, Jochen

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Consumption, Social Capital, and the 'Industrious Revolution' in Early Modern Germany  

E-Print Network [OSTI]

Consumption, Social Capital, and the Industrious Revolution in Early Modern Germany SHEILAGH OGILVIE Faculty of Economics, University of Cambridge Acknowledgements: I am grateful to Marco Belfanti, Andr... ; labour; discrimination; gender; Germany 1 Expanding market consumption is widely ascribed a key role in European economic growth before industrialization. A Consumer Revolution between 1650 and 1800 is thought to have seen the middle classes...

Ogilvie, Sheilagh

222

Fachbereich Informatik der Universitat Hamburg Vogt-Kolln-Str. 30 D-22527 Hamburg / Germany  

E-Print Network [OSTI]

Fachbereich Informatik der Universit¨at Hamburg Vogt-K¨olln-Str. 30 D-22527 Hamburg / Germany¨oller University of Hamburg, Computer Science Department, Vogt-K¨olln-Str. 30, 22527 Hamburg, Germany http2000), Fausto Giunchiglia and Bart Selman (eds), Breckenridge, Colorado, USA, 12-15 April 2000. 1

Hamburg,.Universität

223

Proposals in for Czech firms; cooperation likely with eastern Germany  

SciTech Connect (OSTI)

Two Western groups - Shell and a consortium made up of Agip, Conoco, and Total - have offered to buy the refining operations of Chemopetrol Litvinov and Kaucuk Kralupy, both in the Czech republic. Meanwhile, Amoco, Neste, and PCD are looking at the possibility of acquiring some of the plastics plants at Litvinov. Amoco is interested in the polypropylene operations, Neste in polyethylene, and PCD in both. The two Czech firms are included in the second wave of privatization, which will begin in midyear. So far, there have been no offers for the 80,000-m.t./year polystyrene and 60,000-m.t./year styrene butadiene rubber operations belonging to Kralupy, although Atochem representatives recently visited the plants. Litvinov is carrying out revamping operations at its core unit, a 12-year-old, 450,000-m.t./year ethylene plant. The plant, currently running at 400,000 m.t./year, supplies downstream plants, Neratovice, and sells on the export markets. An existing ethylene pipeline between Litvinov and Bohlen in eastern Germany, which used to supply an average 100,000 m.t./year of ethylene to Bohen in exchange for naphtha, is virtually unused. One proposal involves reactivating this exchange to secure ethylene feedstock for plants in eastern Germany. According to some sources, a preliminary decision has been made to shut down the 100,000-m.t./year ethylene plant at Leuna and possibly to expand the Bohlen cracker by 100,000 m.t./year, to 400,000 m.t./year by the late 1990s.

Alperowicz, N.

1993-02-10T23:59:59.000Z

224

Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter

225

Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

226

Immigration Policy, Labor Market Regulation and the Welfare State: A Comprehensive Look at Immigrant Labor Market Integration in Germany, Great Britain, the United States and Canada  

E-Print Network [OSTI]

and the Welfare State in Germany and the United States:of Male Immigrants in Germany, European Sociological Review:in the United States and Germany. New York: Berghahn Books;

2008-01-01T23:59:59.000Z

227

Does the market value R&D investment by European firms? Evidence from a panel of manufacturing firms in France, Germany, and Italy  

E-Print Network [OSTI]

in Belgium, France, Germany and the UK: a comparison usingR&D and productivity in Germany and the United Kingdom. CEPcontrol: a study of France, Germany and the UK. Economic

Hall, Bronwyn H.; Oriani, R

2006-01-01T23:59:59.000Z

228

Jewish "Shtetls" in Postwar Germany: An Analysis of Interactions Among Jewish Displaced Persons, Germans, and Americans Between 1945 and 1957 in Bavaria  

E-Print Network [OSTI]

Middleton, Drew. "Into Germany with the First Army." NewJews in Post-Holocaust Germany, 1945-1953. Cambridge, UK ;in Post- World War II Germany. Evanston, Ill. : Northwestern

Crago-Schneider, Kierra Mikaila

2013-01-01T23:59:59.000Z

229

Changing Ethnic Identities in Post-National Germany: A Study of Turkish-German Literature, Politics, and Society  

E-Print Network [OSTI]

1 Changing Ethnic Identities in Post-National Germany: A Study of Turkish-German Literature-Muslim immigrant communities in Germany. Women belonging to highly conservative Muslim families were murdered (The Foreign Bride), which details the practice of trafficking under-age Turkish brides to Germany

New Hampshire, University of

230

Wegelerstrae 6 53115 Bonn Germany phone +49 228 73-3427 fax +49 228 73-7527  

E-Print Network [OSTI]

Wegelerstraÿe 6 53115 Bonn Germany phone +49 228 73-3427 fax +49 228 73-7527 www Simulation, Universität Bonn, 53115 Bonn, Germany; Correspond with chernov@hcm.uni-bonn.de #12;#12;Noname Simulation, University of Bonn Endenicher Allee 60, 53115 Bonn, Germany Tel.: +49-228-7362246 Fax: +49

Bartels, Soeren

231

IAD Scientific Assembly 2013, Potsdam, Germany, Sept 1-6, 2013 On the capability of non-dedocated GPS-  

E-Print Network [OSTI]

IAD Scientific Assembly 2013, Potsdam, Germany, Sept 1-6, 2013 On the capability of non Geodesy, Graz University of Technology, Austria #12;IAD Scientific Assembly 2013, Potsdam, Germany, Sept 1-5 year data gap (?) year #12;IAD Scientific Assembly 2013, Potsdam, Germany, Sept 1-6, 2013 high-low SST

Stuttgart, Universität

232

Wage differentials between East and West Germany Are they related to the location or to the people?  

E-Print Network [OSTI]

Wage differentials between East and West Germany Are they related to the location or to the people help from the Federal Government large wage differences between East and West Germany still persist. We their income in both, East and West Germany, the effect of the location can be identified. The results indicate

Pfeifer, Holger

233

Max Planck Institute for Biological Cybernetics, Tbingen, Germany VSS 2002, #18.3 ID501 Spatial updating in virtual environments  

E-Print Network [OSTI]

Max Planck Institute for Biological Cybernetics, Tübingen, Germany VSS 2002, #18.3 ID501 Spatial: What are vestibular cues good for? MPI for Biological Cybernetics, Germany 2 "Voluntary" vs Cybernetics, Germany 3 Methods - Setup · Vestibular stimuli: 6 dof Motion Platform · Visual stimuli: LCD video

234

Literaturlenz: Reading with Authors from Germany, Switzerland, and Austria Reading with Larissa Boehning, Monica Cantieni, and Linda Stift  

E-Print Network [OSTI]

Literaturlenz: Reading with Authors from Germany, Switzerland, and Austria Reading with Larissa.m. Each year Literaturlenz brings authors from Germany, Switzerland, and Austria to the UW Campus. Each Boehning from Germany, Monica Cantieni from Switzerland, and Linda Stift of Austria. The readings

Sheridan, Jennifer

235

Presented at the 21th European Photovoltaic Solar Energy Conference, Dresden, Germany, 4-8 September 2006  

E-Print Network [OSTI]

Presented at the 21th European Photovoltaic Solar Energy Conference, Dresden, Germany, 4 SonnenStrom AG, Schillerstr. 1/6, 89077 Ulm, Germany V.M. Fthenakis, vmf@bnl.gov, Phone +1 631 344 2830 in Western-Europe (mainly Germany) and designed as described in section 3. Data on material quantities were

236

Apprentice pay in Britain, Germany, and Switzerland: institutions, market forces and market power  

E-Print Network [OSTI]

The pay of metalworking apprentices is high in Britain, middling in Germany and low in Switzerland. We analyse these differences using fieldwork evidence and survey data, drawing on both economic and institutionalist theories. Several institutional...

Ryan, Paul; Backes-Gellner, Uschi; Teuber, Silvia; Wagner, Karin

2013-07-29T23:59:59.000Z

237

System transferability of public hospital facility management between Germany and Iran.  

E-Print Network [OSTI]

??The subject of this PhD-thesis is the transferability of Facility Management (FM) by using the example of hospitals in Germany and Iran. The intention is (more)

Banedj-Schafii, Mandana

2009-01-01T23:59:59.000Z

238

The contemporary International Building Exhibition (IBA) : innovative regeneration strategies in Germany  

E-Print Network [OSTI]

The Internationale Bauausstellung or International Building Exhibition (IBA) is a planning methodology implemented over the course of the 20th century and into the 21st century in Germany. The IBA is unique and characterized ...

Shay, Alice (Alice Ann)

2012-01-01T23:59:59.000Z

239

Disparities in nuclear power plant performance in the United States and the Federal Republic of Germany  

E-Print Network [OSTI]

This report presents data comparing the performance of light water reactors in the United States and the Federal Republic of Germany (FRG). The comparisons are made for the years 1980-1983 and include 21 Westinghouse ...

Hansen, Kent F.

1984-01-01T23:59:59.000Z

240

say Andr Schirmeisen of the University of Mnster, Germany, and his colleagues.  

E-Print Network [OSTI]

burning in Thailand and Indonesia dropped steeply across the 50-kilometre-wide boundary. They conclude for Coal Research in Mülheim an der Ruhr, Germany. Specifically, a liquid made of an alkylmethylimidazolium

Cai, Long

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Feminist Cross-cultural Research: Observations from a Research Project in Germany  

E-Print Network [OSTI]

Recent research indicates that the rapid imposition of West German structures (policy, economy, culture) on East Germany caused economic hardships and personal insecurities which Ieave many East German women feeling vulnerable. This essay depicts...

Adler, Marina A.

1997-04-01T23:59:59.000Z

242

A comparative study of the diffusion of antihypertensive and antidepressant medications in Germany in Japan  

E-Print Network [OSTI]

This thesis analyzes and compares the diffusion of antihypertensive and antidepressant medications in Germany and Japan during the time period of 1992 and 2003. The antihypertensive medications are classified as new, middle ...

Cui, Ling, 1978-

2005-01-01T23:59:59.000Z

243

Why Are Resiential PV Prices in Germany So Much Lower Than in the United States?  

Broader source: Energy.gov [DOE]

The U.S. Department of Energy (DOE) SunShot Initiative, in conjunction with the Lawrence Berkeley National Laboratory (LBNL) discusses the installed price of residential PV being significantly lower in Germany than in the United States.

244

Energy-Optimised Building- Experience and Future Perspectives from a Demonstration Programme in Germany  

E-Print Network [OSTI]

energy savings of 50% and more compared to current practice in Germany, without exceeding conventional investment costs. A number of these projects have been awarded architectural prizes. This paper summarises key findings and explains the strategies...

Hans, O.; Voss, K.; Wagner, A.; Gossner, H.; Grunewald, J.; Petzold, H.; Herkel, S.; Pfafferott, J.; Lehmann, D.; Neumann, C.

245

Kinaesthetic impulses : aesthetic experience, bodily knowledge, and pedagogical practices in Germany, 1871-1918  

E-Print Network [OSTI]

This dissertation studies a moment of transition in German aesthetics in the late nineteenth century. Starting in the 1870s, groups of artists, architects, historians, critics, connoisseurs, and museum officials in Germany ...

elik, Zeynep, Ph. D. Massachusetts Institute of Technology

2007-01-01T23:59:59.000Z

246

Builders of a Nation: Womens Experiences in Postwar Germany  

E-Print Network [OSTI]

?? 45 Builders of a Nation: Womens Experiences in Postwar Germany Barbara Brennan The German women who survived the Second World War are often characterized by the familiar images of long lines of women digging the country out from... underneath the rubble. However, their contributions to the rebuilding of Germany reach much further than the act of physically rebuilding the country. The sacrifices required of them for the survival their families and themselves were tremendous...

Brennan, Barbara

2011-04-01T23:59:59.000Z

247

A Review of "Poetry and Parental Bereavement in Early Modern Lutheran Germany" by Anna Linton  

E-Print Network [OSTI]

204 seventeenth-century news Anna Linton. Poetry and Parental Bereavement in Early Modern Lutheran Germany. Oxford: Oxford University Press, 2008. xvi + 319 pp. $110.00. Review by susan r. boettcher, university of texas at austin. Anna Linton... among Lutheran authors in early modern Germany. As sources, she uses sixteenth- and seventeenth-century commemorative poetry, books of consolation, and funeral publications found at the Herzog August Bibliothek in Wolfenb...

Boettcher, Susan R.

2009-01-01T23:59:59.000Z

248

MSE -Munich School of Engineering Boltzmannstr. 17  

E-Print Network [OSTI]

Kiani, Institute of Automatic Control Engineering Smart Wind Turbine Rotor Blades Liuz da Rocha and Energy Conversion Dye Sensitized and Hybrid Photovoltaics Monika Rawolle, Chair of Functional Materials 1 Oberhofer, Institute of Theoretical Chemistry Game Theory Approach for Interactive Wind Farm Control Arman

Cengarle, Mara Victoria

249

Bernhard Grimm, Humboldt University, Berlin, Germany; Robert J. Porra, CSIRO Plant Industry, Canberra, ACT, Australia; Wolfhart Rdiger, Mnchen University, Mnchen, Germany; Hugo  

E-Print Network [OSTI]

interest in solar energy, this collection on the chlorophylls is most timely, covering the latest aspects the biological process of photosynthesis to include such topics as solar energy conversion, environmental science, Canberra, ACT, Australia; Wolfhart Rüdiger, München University, München, Germany; Hugo Scheer, München

Govindjee "Gov"

250

UNCCD Office location: UNCCD, Hermann-Ehlers-Str. 10, D -53113 Bonn, Germany Postal address: P.O. Box 260129, D -53153 Bonn, Germany  

E-Print Network [OSTI]

threaten the processes that sustain the global ecosphere and life on earth. 2. The United Nations.O. Box 260129, D - 53153 Bonn, Germany Achieving global sustainability through effective sustainable land.......................................................................................................................... 3 II. Achieving global sustainability through effective sustainable land management

Franz, Sven Oliver

251

An Analysis of Tensor Models for Learning on Structured Data  

E-Print Network [OSTI]

Ludwig Maximilian University, Oettingenstr. 67, Munich, Germany nickel@dbs.ifi.lmu.de 2 Siemens AG, Corporate Technology, Otto-Hahn-Ring 6, Munich, Germany volker.tresp@siemens.com Abstract. While tensor, which transforms relational data into feature-based representations, has been considered as a mean

Tresp, Volker

252

Future Internet 2011, 3, 14-30; doi:10.3390/3010014 OPEN ACCESS  

E-Print Network [OSTI]

¨unchen, 80333 Munich, Germany; E-Mail: joerg.eberspaecher@tum.de 2 Institute for Media Technology, Technische Universit¨at M¨unchen, 80333 Munich, Germany; E-Mails: michael.eichhorn@tum.de (M.E.); martin is to anchor the security functionality in the network layer to provide a clean and consistent approach for all

Steinbach, Eckehard

253

Empowering Materiality: Inspiring the Design of Tangible Interactions  

E-Print Network [OSTI]

Empowering Materiality: Inspiring the Design of Tangible Interactions Magdalena Schmid BMW AG Knorrstr. 147, Munich, Germany Magdalena.Schmid@bmw.de +49 89 382 60947 Sonja Rmelin BMW Research and Technology Hanauerstr. 46, Munich, Germany Sonja.Ruemelin@bmw.de +49 89 382 51985 Hendrik Richter University

254

A Criteria Catalog Based Methodology for Analyzing Service Management Processes  

E-Print Network [OSTI]

, Dep. of Informatics, D-80538 Munich, Germany {brenner radisic}@informatik.uni muenchen.de BMW Group, User Service Center, D-80788 Munich, Germany martina.schollmeyer@bmw.de In: Feridun, M., P. Kropf, and the experiences regarding its application for evaluating the User Service Center of the BMW Group are described. 1

255

User-centered Development of a Visual Exploration System for In-Car Communication  

E-Print Network [OSTI]

, Benjamin Kunze, Wolfgang Hintermaier, and Andreas Butz BMW Group Research and Technology, Munich, Germany Media Informatics Group, University of Munich, Germany {michael.sedlmair,benjamin.kunze,wolfgang.hintermaier}@bmw, industrial environment for the diagnosis of in-car communication. The fact that this is a true expert domain

256

CURRICULUM VITAE Svante Pbo  

E-Print Network [OSTI]

of Munich, Germany. 1997- Director, Max-Planck-Institute for Evolutionary Anthropology, Leipzig, Germany. 1999- Honorary Professor of Genetics and Evolutionary Biology, University of Leipzig, Germany. 2003 Lecture, Heidelberg, Germany. 1998 Member, Academia Europaea. Max Delbrück Medal, Berlin, Germany. 1999

Pääbo, Svante

257

An Exploration of the Effects of Language on the Orchestral Trombone Sound in France, Germany, and the United States.  

E-Print Network [OSTI]

??The orchestral trombone sound of France, Germany, and the United States was analyzed through the lens of language. A thorough investigation of the characteristic sounds (more)

Mounger, Christine

2012-01-01T23:59:59.000Z

258

Greater flexibility, greater growth: A comparative study of labor and capitalist models in Japan, Germany, and the United States.  

E-Print Network [OSTI]

??After the end of the Second World War, three major economic powers emerged. Japan in Asia, Germany in Europe, and the United States in North (more)

Thompson, Jay Arthur

2007-01-01T23:59:59.000Z

259

Comparing Germany's and California's Interconnection Processes for PV Systems (White Paper)  

SciTech Connect (OSTI)

Establishing interconnection to the grid is a recognized barrier to the deployment of distributed energy generation. This report compares interconnection processes for photovoltaic projects in California and Germany. This report summarizes the steps of the interconnection process for developers and utilities, the average length of time utilities take to process applications, and paperwork required of project developers. Based on a review of the available literature, this report finds that while the interconnection procedures and timelines are similar in California and Germany, differences in the legal and regulatory frameworks are substantial.

Tweedie, A.; Doris, E.

2011-07-01T23:59:59.000Z

260

17th European Biomass Conference and Exhibition 2009, Hamburg, Germany Lignocellulosic Ethanol: The Path to Market  

E-Print Network [OSTI]

17th European Biomass Conference and Exhibition 2009, Hamburg, Germany Lignocellulosic Ethanol of transport fuels from biomass is essential if the EU aspiration to substitute 10% of transport fuels investment in R&D in the US, Europe and Asia. The production of ethanol from lignocellulosic biomass

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

http://www.jstor.org Antiminority Riots in Unified Germany: Cultural Conflicts and Mischanneled Political  

E-Print Network [OSTI]

Political Participation Author(s): Roger Karapin Source: Comparative Politics, Vol. 34, No. 2, (Jan., 2002), pp. 147-167 Published by: Ph.D. Program in Political Science of the City University of New York@jstor.org. #12;Antiminority Riots in Unified Germany CulturalConflictsandMischanneledPoliticalParticipation Roger

Qiu, Weigang

262

Ina Lauth, Fraunhofer AIS, St. Augustin, Germany KDNet (NOE) , KDubiq (CA) and Beyond  

E-Print Network [OSTI]

1 Ina Lauth, Fraunhofer AIS, St. Augustin, Germany KDNet (NOE) , KDubiq (CA) and Beyond Codrina Lauth Fraunhofer AIS, Sankt Augustin and Institute for Computer Science III, University Bonn #12;2Lastname Outline Fraunhofer AIS and University Bonn will host ICML/ILP 2005 7-13 August 2005 EU Projects

Baeza-Yates, Ricardo

263

International Conference on Wood-based Bioenergy LIGNA+Hannover, Germany, 17-18 May 2007  

E-Print Network [OSTI]

International Conference on Wood-based Bioenergy LIGNA+Hannover, Germany, 17-18 May 2007 Photo: NTC Marketing Specialist and Sebastian Hetsch, Consultant Food and Agricultural Organization & UN Economic Commission for Europe Geneva, Switzerland #12;International Conference on Wood-based Bioenergy LIGNA

264

Fachbereich Informatik der Universitat Hamburg VogtKollnStr. 30 D22527 Hamburg / Germany  

E-Print Network [OSTI]

Fachbereich Informatik der Universit?at Hamburg Vogt­K?olln­Str. 30 #6; D­22527 Hamburg / Germany M?oller University of Hamburg, Computer Science Department, Vogt­K?olln­Str. 30, 22527 Hamburg Selman (eds), Breckenridge, Colorado, USA, 12­15 April 2000. 1 Introduction Experiences with concept

Haarslev, Volker

265

The Role of the Green Party in Germany's Renewable Energy Policy  

E-Print Network [OSTI]

The Role of the Green Party in Germany's Renewable Energy Policy A Healthy Serving of Greens power, increasing reliance on renewable energy Renewable Energy Sources Act of 2000 and 2004 -provided grid access and stable prices for renewables Market Liberalization with the Energy Supply Act of 1998

New Hampshire, University of

266

Proceedings of Workshop on Uranium Production Environmental Restoration: An exchange between the United States and Germany  

SciTech Connect (OSTI)

Scientists, engineers, elected officials, and industry regulators from the United, States and Germany met in Albuquerque, New Mexico, August 16--20, 1993, in the first joint international workshop to discuss uranium tailings remediation. Entitled ``Workshop on Uranium Production Environmental Restoration: An Exchange between the US and Germany,`` the meeting was hosted by the US Department of Energy`s (DOE) Uranium Mill Tailings Remedial Action (UMTRA) Project. The goal of the workshop was to further understanding and communication on the uranium tailings cleanup projects in the US and Germany. Many communities around the world are faced with an environmental legacy -- enormous quantities of hazardous and low-level radioactive materials from the production of uranium used for energy and nuclear weapons. In 1978, the US Congress passed the Uranium Mill Tailings Radiation Control Act. Title I of the law established a program to assess the tailings at inactive uranium processing sites and provide a means for joint federal and state funding of the cleanup efforts at sites where all or substantially all of the uranium was produced for sale to a federal agency. The UMTRA Project is responsible for the cleanup of 24 sites in 10 states. Germany is facing nearly identical uranium cleanup problems and has established a cleanup project. At the workshop, participants had an opportunity to interact with a broad cross section of the environmental restoration and waste disposal community, discuss common concerns and problems, and develop a broader understanding of the issues. Abstracts are catalogued individually for the data base.

Not Available

1993-12-31T23:59:59.000Z

267

Max-Planck-Institute for Meteorology, Hamburg, Germany Swedish Meteorological and Hydrological Institute, Norrkoping, Sweden  

E-Print Network [OSTI]

Institute, Norrko?ping, Sweden 3 Finnish Meteorological Institute, Helsinki, Finland 4 Rossby Centre, Norrko?ping, Sweden 5 German Weather Service, Offenbach, Germany 6 Institute for Marine Research, University of Kiel, Sweden A comprehensive model inter-comparison study investigating the water budget during the BALTEX

Lindau, Ralf

268

THE CRYOGENIC SYSTEM OF TESLA S. Wolff, DESY, Notkestr. 85, 22607 Hamburg, Germany  

E-Print Network [OSTI]

THE CRYOGENIC SYSTEM OF TESLA S. Wolff, DESY, Notkestr. 85, 22607 Hamburg, Germany for the TESLA collaboration Abstract TESLA, a 33 km long 500 GeV centre-of-mass energy superconducting linear collider The 33 km long e+ e- linear collider TESLA (Tera eV Energy Superconductiong Linear Accelerator) with 500

269

OPERATIONAL EXPERIENCE WITH THE TEST FACILITIES FOR TESLA H. Weise, DESY, Hamburg, Germany  

E-Print Network [OSTI]

OPERATIONAL EXPERIENCE WITH THE TEST FACILITIES FOR TESLA H. Weise, DESY, Hamburg, Germany Abstract The TESLA superconducting electron-positron linear collider with an integrated X-ray laser laboratory government in matters of science. In preparation of this, the TESLA Test Facility was set up at DESY. More

270

Reinforcement Learning to Adjust Robot Movements to New Situations MPI Tbingen, Germany  

E-Print Network [OSTI]

, namely a kernelized version of the reward-weighted regres- sion. We show two robot applications and Peters, 2010], and even in tasks with potential industrial applications [Urbanek et al., 2004Reinforcement Learning to Adjust Robot Movements to New Situations Jens Kober MPI Tübingen, Germany

271

Multidecadal solar radiation trends in the United States and Germany and direct tropospheric aerosol forcing  

E-Print Network [OSTI]

Multidecadal solar radiation trends in the United States and Germany and direct tropospheric, the positive trend is almost equal. We attained these results by scrutinizing clear-sky global solar radiation ratio of solar radiation were used for constraining the observed trends. Increased absorption

272

SUPERCONDUCTING RF STRUCTURES TEST FACILITIES AND H. Weise, Deutsches Elektronen-Synchrotron, Hamburg, Germany  

E-Print Network [OSTI]

-Synchrotron, Hamburg, Germany for the TESLA Collaboration Abstract The design of the TESLA superconducting electron than 16 thousand hours of operation demonstrated this technology. Results of single cavity tests followed by drying in a class 100 clean room; annealing at 800°C in an Ultra High Vacuum oven to relieve

273

Christian Schuster received the Diploma degree in physics from the University of Konstanz, Germany, in 1996, and the Ph. D. degree in electrical engineering from the Swiss Federal  

E-Print Network [OSTI]

Christian Schuster received the Diploma degree in physics from the University of Konstanz, Germany of Electromagnetic Theory at the Hamburg University of Technology (TUHH), Germany. Prior to that he was with the IBM

Garmestani, Hamid

274
275

Hamburg, Germany's second largest city, is home to two of the most important urban development areas in Europe: HafenCity  

E-Print Network [OSTI]

Hamburg, Germany's second largest city, is home to two of the most important urban development for ecological sustainability and mixed use development along the Elbe River in Hamburg, Germany e m b e r 1 5 , 9 a m ­ 1 2 : 30 p m The City of Hamburg, Germany is a city-state. Like Washington

District of Columbia, University of the

276

Julian Ollesch received his Ph.D. with highest honours in 2006 of the Ruhr-University Bochum, Germany. In 2007, he joined Stanley Prusiners Institute for  

E-Print Network [OSTI]

, Germany. In 2007, he joined Stanley Prusiners Institute for Neurodegenerative Diseases in San Francisco's dementia at Marcus Fändrich's group in Halle/Saale, Germany. In 2010, he joined the Protein research Unit Ruhr within Europe, PURE at the Biophysics Department of the Ruhr- University Bochum, Germany. Margot

Gerwert, Klaus

277

College of Engineering Study Abroad: Germany Blog Welcome to the blog of Stephanie Berger, Sophomore, Biological Systems Engineering major at UNL. She  

E-Print Network [OSTI]

College of Engineering Study Abroad: Germany Blog Welcome to the blog of Stephanie Berger internship in Germany through the DAAD/RISE program. Monday, August 3, 2009 Last week was my last week Germany for a little over a week before I head back to the U.S.! Since I got this scholarship through

Farritor, Shane

278

Are there signs of acidification reversal in freshwaters of the low mountain ranges in Germany? Hydrology and Earth System Sciences, 5(3), 367378 (2001) EGS  

E-Print Network [OSTI]

Are there signs of acidification reversal in freshwaters of the low mountain ranges in Germany? 367 in freshwaters of the low mountain ranges in Germany? C. Alewell1 , M. Armbruster2 , J. Bittersohl3 , C.D. Evans4 of Bayreuth, D-95440 Bayreuth, Germany 2 Institute of Soil Science, Technical University of Dresden, D-01735

Paris-Sud XI, Université de

279

Strategies for Orchard Irrigation in South-Western Germany under the Limitation of Meeting Instream Flow Requirements of the Used Stream  

E-Print Network [OSTI]

1 Strategies for Orchard Irrigation in South-Western Germany under the Limitation of Meeting Stuttgart, Institut fuer Wasserbau, Germany www.iws.uni-stuttgart.de Condensed abstract: In South-Western Germany, orchard-irrigation farming may endanger the ecological con- ditions of streams used for supplying

Cirpka, Olaf Arie

280

G. Vlad et al. 10th IAEA TM on Energetic Particles -Kloster Seeon, Germany, 8-10/10/2007 1 Particle Simulations of Alfvn Modes  

E-Print Network [OSTI]

G. Vlad et al. 10th IAEA TM on Energetic Particles - Kloster Seeon, Germany, 8-10/10/2007 1 - Kloster Seeon, Germany, 8-10/10/2007 2 Outline · Introduction · Experimental observations · The HMGC code sensitivity) · Conclusions #12;G. Vlad et al. 10th IAEA TM on Energetic Particles - Kloster Seeon, Germany, 8

Vlad, Gregorio

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Research position in maternity at Hannover Medical School, Hannover Medical School is one of the leading medical universities in Germany with  

E-Print Network [OSTI]

Research position in maternity at Hannover Medical School, Germany Hannover Medical School is one of the leading medical universities in Germany with excellent results in health care, research, education. In 2009, the only MSc Midwifery Programme in Germany was launched as part of the European Master

Manstein, Dietmar J.

282

FLEGT Asia, Baseline Study 1, China: Overview of Forest Law Enforcement, Governance and Trade, June 2011 This Action is funded by the European Union and Governments of Finland, France, Germany, the Netherlands and the United Kingdom.  

E-Print Network [OSTI]

, June 2011 This Action is funded by the European Union and Governments of Finland, France, Germany of Finland, France, Germany, the Netherlands and the United Kingdom. www

283

think forward OrderNumberDOC-P80-EXS026V12007BrukerAXSGmbH.PrintedinGermany.  

E-Print Network [OSTI]

AXSGmbH.PrintedinGermany. Proportional and Scintillation Counter Proportional counter for light elements Scintillation counter for heavyYour Command Wavelength dispersive X-ray fluorescence spectrometry offers: Multi element analysis from Be to U

Wells, Mathew G. - Department of Physical and Environmental Sciences, University of Toronto

284

Using Vehicle Taxes to Reduce Carbon Dioxide Emissions Rates of New Passenger Vehicles: Evidence from France, Germany, and Sweden  

E-Print Network [OSTI]

France, Germany, and Sweden link vehicle taxes to the carbon dioxide (CO2) emissions rates of passenger vehicles. Based on new vehicle registration data from 20052010, a vehicles tax is negatively correlated with its ...

Klier, Thomas

285

Does it take one or two to tango? : language skills, physical appearance, and immigrant integration in Germany  

E-Print Network [OSTI]

Breaking with a long-held political stance that Germany is, despite a sizeable share of permanent immigrant residents, not a country of immigration, the German legislature has drawn up a new immigration law, which entered ...

Wickboldt, Anne-Katrin, 1970-

2008-01-01T23:59:59.000Z

286

Corporate governance under stress : an institutional perspective on the transformation of corporate governance in France and Germany  

E-Print Network [OSTI]

This work contributes to the study of comparative political economy by examining the impact of financial deregulation on corporate governance in the two main continental European economies, France and Germany. It investigates ...

Goyer, Michel, 1964-

2004-01-01T23:59:59.000Z

287

Nitrogen cycle of the Baltic Sea from an isotopic perspective Baltic Sea Research Institute-Warnemunde (IOW), Rostock, Germany  

E-Print Network [OSTI]

Nitrogen cycle of the Baltic Sea from an isotopic perspective M. Voss Baltic Sea Research Institute-Warnemu¨nde, Hamburg, Germany S. Hille, T. Neumann, and J. W. Dippner Baltic Sea Research Institute-Warnemu¨nde (IOW

Dippner, Joachim W.

288

American Suppliers: The Role of Americans in the Perpetuation and Maintenance of the Postwar Black Market in Germany  

E-Print Network [OSTI]

Americans are curiously absent from the literature as forces in the black market prevailing in Germany after World War II. Aside from Rundell's study of failed currency control policy during the Second World War and the subsequent occupations...

Fasulo, Micheal

2012-02-14T23:59:59.000Z

289

Cross-border transfer of climate change mitigation technologies : the case of wind energy from Denmark and Germany to India  

E-Print Network [OSTI]

This research investigated the causal factors and processes of international development and diffusion of wind energy technology by examining private sector cross-border technology transfer from Denmark and Germany to India ...

Mizuno, Emi, Ph. D. Massachusetts Institute of Technology

2007-01-01T23:59:59.000Z

290

A review of "Patterned Lives: The Lutheran Funeral Biography in Early Modern Germany" by Cornelia Niekus Moore  

E-Print Network [OSTI]

Germany. Wolfenb?tteler Forschungen 111. Wiesbaden: Harrassowitz, 2006. 403 pp. Review by AMY NELSON BURNETT, UNIVERSITY OF NEBRASKA-LINCOLN To those unfamiliar with the Lutheran funeral work, a book devoted to the biographies that were an important... about early modern Germany, but rather to discuss the genre as a whole, describing its origin, development and demise over the course of two centu- ries. The book is clearly structured around this goal. After an opening chapter that introduces...

Burnett, Amy Nelson

2007-01-01T23:59:59.000Z

291

Observation of a German farm family: their culture and values, and aspects of beginning a career in agriculture in Germany  

E-Print Network [OSTI]

OBSERVATION OF A GERMAN FARM FAMILY, THEIR CULTURE AND VALUFS, AND ASPECTS OF BEGINNING A CARFER IN AGRICULTURE IN GERMANY A PROFESSIONAL PAPER BEVERLY ANN BIANCI 11 Submitted to the College of Agriculture and Life Sciences of Texas ASM... OF BEGINNING A CAREER IN GERMANY IN AGRICULTURE A Professional Paper By BEVERLY ANN BIANCHI Approved as to style and content by: Jones E. Christlansen (Chair of Committee) Don R. Herring (Committee Member) Barbara J. Gastel (Committee Member...

Bianchi, Beverly Ann

1993-01-01T23:59:59.000Z

292

Electron effective mass and nonparabolicity in Ga 0.47In 0.53As/InP quantum wells Physik-Department E16, Technische Universitat Munchen, James-Franck-Strasse, 85747 Garching, Germany  

E-Print Network [OSTI]

-Department E16, Technische Universita¨t Mu¨nchen, James-Franck-Strasse, 85747 Garching, Germany R. Winkler Institut fu¨r Theoretische Physik, Universita¨t Regensburg, 93040 Regensburg, Germany M. Drechsler and B. K, Germany U. Ro¨ssler Institut fu¨r Theoretische Physik, Universita¨t Regensburg, 93040 Regensburg, Germany

Wetzel, Christian M.

293

Property:Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerType Jump to: navigation,References Jump to:Business01 +

294

Brine migration test report: Asse Salt Mine, Federal Republic of Germany: Technical report  

SciTech Connect (OSTI)

This report presents a summary of Brine Migration Tests which were undertaken at the Asse mine of the Federal Republic of Germany (FRG) under a bilateral US/FRG agreement. This experiment simulates a nuclear waste repository at the 800-m (2624-ft) level of the Asse salt mine in the Federal Republic of Germany. This report describes the Asse salt mine, the test equipment, and the pretest properties of the salt in the mine and in the vicinity of the test area. Also included are selected test data (for the first 28 months of operation) on the following: brine migration rates, thermomechaical behavior of the salt (including room closure, stress reading, and thermal profiles), borehole gas pressures, and borehole gas analyses. In addition to field data, laboratory analyses of pretest salt properties are included in this report. The operational phase of these experiments was completed on October 4, 1985, with the commencement of cooldown and the start of posttest activities. 7 refs., 68 figs., 48 tabs.

Coyle, A.J.; Eckert, J.; Kalia, H.

1987-01-01T23:59:59.000Z

295

Detection of $^{133}$Xe from the Fukushima nuclear power plant in the upper troposphere above Germany  

E-Print Network [OSTI]

After the accident in the Japanese Fukushima Dai-ichi nuclear power plant in March 2011 large amounts of radioactivity were released and distributed in the atmosphere. Among them were also radioactive noble gas isotopes which can be used as tracers to test global atmospheric circulation models. This work presents unique measurements of the radionuclide $^{133}$Xe from Fukushima in the upper troposphere above Germany. The measurements involve air sampling in a research jet aircraft followed by chromatographic xenon extraction and ultra-low background gas counting with miniaturized proportional counters. With this technique a detection limit of the order of 100 $^{133}$Xe atoms in litre-scale air samples (corresponding to about 100 mBq/m$^3$) is achievable. Our results provide proof that the $^{133}$Xe-rich ground level air layer from Fukushima was lifted up to the tropopause and distributed hemispherically. Moreover, comparisons with ground level air measurements indicate that the arrival of the radioactive plume at high altitude over Germany occurred several days before the ground level plume.

Hardy Simgen; Frank Arnold; Heinfried Aufmhoff; Robert Baumann; Florian Kaether; Sebastian Lindemann; Ludwig Rauch; Hans Schlager; Clemens Schlosser; Ulrich Schumann

2014-12-05T23:59:59.000Z

296

Feasibility of an Aeronautical Mobile Ad Hoc Network Over the North Atlantic Corridor  

E-Print Network [OSTI]

Aerospace Center (DLR), Munich, Germany Email: {Daniel attractive scenario, the North Atlantic Corridor, and use realistic flight data to extract statistics about. INTRODUCTION Today's civil aviation airliners are typically equipped with a set of data communications

Schindelhauer, Christian

297

ASC eNews Quarterly Newsletter  

National Nuclear Security Administration (NNSA)

Non-Uniform Density," Twenty-Eighth Int. Conf. on Supercomputing (ICS 2014), Munich, Germany, LLNL-CONF-648577, June 10-13. Rountree, B., T. Gamblin, B.R. de Supinski, M. Schulz,...

298

Multi-Label Informed Latent Semantic Indexing , Shipeng Yu  

E-Print Network [OSTI]

Multi-Label Informed Latent Semantic Indexing Kai Yu , Shipeng Yu , Volker Tresp Siemens AG, University of Munich, Germany kai.yu@siemens.com, volker.tresp@siemens.com, spyu

Tresp, Volker

299

TC-STAR: Evaluation Plan for Voice Conversion Technology David Sundermann1,2  

E-Print Network [OSTI]

-mail: {suendermann, antonio, hduxans}@gps.tsc.upc.edu 2 Siemens AG, 81739 Munich, Germany, e-mail: harald.hoege@siemens transform vocal tract and excita- tion [8], whereas some approaches aim at transforming the speaker

Suendermann, David

300

8, 68456901, 2008 Aerosol optical  

E-Print Network [OSTI]

of solar radiation by atmospheric aerosols is a key el- ement of the Earth's radiative energy balance, Germany 2 Helmholtz Center Munich, German Research Center for Environmental Health, Institute

Paris-Sud XI, Université de

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

E-Print Network 3.0 - aniko navai skorka Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

SKORKA Summary: THE EUROPEAN MP-TANDEMS S. J. SKORKA University of Munich, 8046 Garching, Germany Rsum. 2014... (1973) 197. 3 ASSMANN W., MNZER H., ROHRER L. and SKORKA S....

302

Transportation Energy and Alternatives  

E-Print Network [OSTI]

Station in Indonesia Hydrogen refueling in Munich, Germany "You will never see widespread use of the fuel fuels" Potentially used for Transportation · Biogas (primarily for onsite electrical generation) LFG

Handy, Susan L.

303

THE TUM+TUT+KUL APPROACH TO THE 2ND CHIME CHALLENGE: MULTI-STREAM ASR EXPLOITING BLSTM NETWORKS AND SPARSE NMF  

E-Print Network [OSTI]

of Technology, Finland 3 Department ESAT, KU Leuven, Belgium 4 BMW Group, Munich, Germany geiger@tum.de ABSTRACT environments with interfering noise sources is typically addressed by a combination of front-end enhancement

Kuehnlenz, Kolja

304

Analysis, Optimization, and Implementation of Low-Interference Wireless Multicarrier Systems  

E-Print Network [OSTI]

25/389, A-1040 Vienna, Austria b BMW Group Research and Technology, D-80992 Munich, Germany c Institute of Biomathematics and Biometry, GSF--National Research Center for Environment and Health D-85764

Feichtinger, Hans Georg

305

CW Operation of the TTF-III Input Coupler J. Knobloch, W. Anders, M. Martin and M. Schuster, BESSY GmbH, Berlin, Germany  

E-Print Network [OSTI]

GmbH, Berlin, Germany S. Bauer and M. Pekeler, ACCEL Instruments, Bergisch-Gladbach, Germany S at the 2005 Particle Accelerator Conference, Knoxville, TN Abstract Several newly proposed superconducting aspects may limit the coupler operation. To resolve this question, ACCEL Instruments, BESSY, Cornell, DESY

306

Detection of $^{133}$Xe from the Fukushima nuclear power plant in the upper troposphere above Germany  

E-Print Network [OSTI]

After the accident in the Japanese Fukushima Dai-ichi nuclear power plant in March 2011 large amounts of radioactivity were released and distributed in the atmosphere. Among them were also radioactive noble gas isotopes which can be used as tracers to probe global atmospheric circulation models. This work presents unique measurements of the radionuclide $^{133}$Xe from Fukushima in the upper troposphere above Germany. The measurements involve air sampling in a research jet aircraft followed by chromatographic xenon extraction and ultra-low background gas counting with miniaturized proportional counters. With this technique a detection limit of the order of 100 $^{133}$Xe atoms in liter-scale air samples (corresponding to about 100 mBq/m$^3$) is achievable. Our results proof that the $^{133}$Xe-rich ground level air layer from Fukushima was lifted up to the tropopause and distributed hemispherically. Moreover, comparisons with ground level air measurements indicate that the arrival of the radioactive plume in ...

Simgen, Hardy; Aufmhoff, Heinfried; Baumann, Robert; Kaether, Florian; Lindemann, Sebastian; Rauch, Ludwig; Schlager, Hans; Schlosser, Clemens; Schumann, Ulrich

2013-01-01T23:59:59.000Z

307

Fiver years of uranium mine and mill decommissioning in Germany: Progress of the Wismut environmental remediation project  

SciTech Connect (OSTI)

With the end of the Cold War and the fall of the iron curtain Germany inherited in 1990 by its reunification the legacy of 45 years of unrestricted, intensive uranium mining in the eastern part of Germany. The environmental damages and risks related to widespread soil and groundwater contamination, caused by huge tailings ponds and numerous waste rock piles in one of Germany`s most densely populated areas, made it necessary to implement one of the world`s largest environmental clean-up programs. 13 billion German Marks (8.7 billion US-$) will be spent within approx. 20 years for decommissioning and environmental restoration efforts. Five years after the start-up of the Wismut project considerable results have been achieved. Conceptual work, even regarding technically difficult issues of the program, is far advanced, and about one third of the physical work program has been completed. At the former mining and milling locations significant improvements of the environmental situation have been achieved. The further on-schedule progress of the Wismut program is an important prerequisite for the socio-economical development in the former uranium mining districts.

Mager, D. [German Federal Ministry of Economics, Bonn (Germany)

1996-12-31T23:59:59.000Z

308

International Europhysics Conference on High Energy Physics EPS, July 17th-23rd 2003 in Aachen, Germany  

E-Print Network [OSTI]

International Europhysics Conference on High Energy Physics EPS, July 17th-23rd 2003 in Aachen, Germany General Search for New Phenomena in ep Scattering at HERA M. Wessels I. Physikalisches Institut lepton and multi-lepton events Have we missed something? General Search for New Phenomena in ep

309

A Top-down and Bottom-up look at Emissions Abatement in Germany in response to the EU ETS  

E-Print Network [OSTI]

This paper uses top-down trend analysis and a bottom-up power sector model to define upper and lower boundaries on abatement in Germany in the first phase of the EU Emissions Trading Scheme (2005-2007). Long-term trend ...

Feilhauer, Stephan M. (Stephan Marvin)

2008-01-01T23:59:59.000Z

310

Proceedings of the XVI International Conference on Thermoelectrics, Dresden, Germany, August 26-29, 1997 Skutterudites: An Update  

E-Print Network [OSTI]

be meaningful for near room temperature applications [1], thermoelectric power generators which could operate technologies. This is true in particular for high power (over 200 W) automobile waste heat recovery and spaceProceedings of the XVI International Conference on Thermoelectrics, Dresden, Germany, August 26

311

Wind-Power Development in Germany and the U.S.: Multiple Streams, Advocacy Coalitions, and Turning Points  

E-Print Network [OSTI]

Wind-Power Development in Germany and the U.S.: Multiple Streams, Advocacy Coalitions, and Turning). Of the various forms of renewable energy, wind-generated electricity has a unique set of advantages, which make especially large. Wind power produces relatively low levels of environmental damage over its life cycle (like

Qiu, Weigang

312

Bernhard Grimm, Humboldt University, Berlin, Germany; Robert J. Porra, CSIRO Plant Industry, Canberra, ACT, Australia; Wolfhart Rdiger, Mnchen University, Mnchen,  

E-Print Network [OSTI]

interest in solar energy, this collection on the chlorophylls is most timely, covering the latest aspects the biological process of photosynthesis to include such topics as solar energy conversion, environmental science, Canberra, ACT, Australia; Wolfhart Rüdiger, München University, München, Germany; Hugo Scheer, München

Govindjee "Gov"

313

3rd Workshop on System-level Virtualization for High Performance Computing (HPCVirt) 2009, Nuremberg, Germany, March 30, 2009  

E-Print Network [OSTI]

3rd Workshop on System-level Virtualization for High Performance Computing (HPCVirt) 2009 for High Performance Computing (HPCVirt) 2009, Nuremberg, Germany, March 30, 2009 Outline · Background work #12;3/193rd Workshop on System-level Virtualization for High Performance Computing (HPCVirt) 2009

Engelmann, Christian

314

Power MEMS 2007, Nov. 28-29, 2007, Freiburg, Germany Fig. 1: Micro quartz combustor. (a) Schematic,  

E-Print Network [OSTI]

Power MEMS 2007, Nov. 28-29, 2007, Freiburg, Germany 265 Fig. 1: Micro quartz combustor. (a, 1.0 mm, and 1.5 mm. FLAME PROPAGATION AND QUENCHING IN ULTRA-THIN QUARTZ COMBUSTORS Yong Fan, Yuji and analysis of premixed CH4/Air flame propagation and quenching in three quartz combustors with chamber depth

Kasagi, Nobuhide

315

X-th International Workshop on Optimization and Inverse Problems in Electromagnetism September 14 17, 2008, Ilmenau, GERMANY  

E-Print Network [OSTI]

­ 17, 2008, Ilmenau, GERMANY Optimal sizing of PV based multi-source system for household application T-source system at supply side, and an optimal supply and demand co-management. A sizing and multi with a project aiming to increase the value of photovoltaic production for residential application; the main

Boyer, Edmond

316

Multi-Decadal Solar Radiation Trends in the United States and Germany and Direct Tropospheric Aerosol Forcing  

E-Print Network [OSTI]

Multi-Decadal Solar Radiation Trends in the United States and Germany and Direct Tropospheric.S. the strengthening is almost equal. We attained these results by scrutinizing clear sky global solar radiation of solar radiation were used for constraining the observed trends. Increased absorption and declined light

317

7th Int. Conference on Business Process Management (BPM`09) 7-10 September 2009, Ulm, Germany  

E-Print Network [OSTI]

7th Int. Conference on Business Process Management (BPM`09) 7-10 September 2009, Ulm, Germany www.bpm2009.org Keynote Speaker A.-W. Scheer BPM 3.0 Founder of IDS Scheer, President of Bitkom, Vice on Reference Modelling ER-BPM'09 - 1st International Workshop on Empirical Research in Business Process BPD'09

Pfeifer, Holger

318

7th Int. Conference on Business Process Management (BPM`09) 7-10 September 2009, Ulm, Germany  

E-Print Network [OSTI]

7th Int. Conference on Business Process Management (BPM`09) 7-10 September 2009, Ulm, Germany www.bpm2009.org #12;General Information BPM`09 is the seventh international conference in a series and tracks for workshops, tutorials, panels and demos. The BPM`09 has the EMISA`09 as co-located conference

Ulm, Universität

319

T-Mobile Germany launches mobile social web services on web'n'walk Feb 12, 2008  

E-Print Network [OSTI]

T-Mobile Germany launches mobile social web services on web'n'walk portal Feb 12, 2008 · Agreements by companies of the Deutsche Telekom group by end of 2007. The common technology platform is based on GSM documents like reports, invoices, statements and others on the fly. Fully integrated clean-up processes also

Deutschmann, Rainer

320

The Disarmament School: US Policy for the Disarmament and Demobilization of the Germany Army, November-December 1944  

E-Print Network [OSTI]

Military Tradition. This demilitarization of Germany was the chief goal of victory and means of ensuring lasting peace in Europe. In November and December of 1944, the US Army hosted the Disarmament School, a series of lectures by experts in the field...

Wilkerson, Joseph Jr

2009-08-11T23:59:59.000Z

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

European Conference on the Mathematics of Oil Recovery --Freiberg, Germany, 3 -6 September 2002 Prediction under Uncertainty in Reservoir  

E-Print Network [OSTI]

1 8 th European Conference on the Mathematics of Oil Recovery -- Freiberg, Germany, 3 - 6 September 2002 Prediction under Uncertainty in Reservoir Modeling Mike Christie1 , Sam Subbey1 , Malcolm of Advanced Studies, Australian Nat. University, Canberra, ACT 0200, Australia Abstract Reservoir simulation

Sambridge, Malcolm

322

Aiming to bring together media scholars from the United States, Canada, and Germany, the conference continues a series of symposia that began in 2007. After ,,Re-Reading McLuhan. An International Conference on Media and  

E-Print Network [OSTI]

Aiming to bring together media scholars from the United States, Canada, and Germany, the conference of Paderborn, Germany Concept and Organisation: Hannelore Bublitz, Irina Kaldrack, Theo Röhle, Hartmut Winkler March 29 ­ 31, 2012 University of Paderborn, Germany Room B 3.231 #12;02:00 | Start / Introduction 02

Paderborn, Universität

323

Prof. Dr. Uwe Holtz Universitt Bonn Am Hofgarten 15D -53113 Bonn UHoltz@aol.com www.uni-bonn.de/~uholtz1 OECD (Hg.): DAC Peer Review Germany, Paris 2006.4  

E-Print Network [OSTI]

.uni-bonn.de/~uholtz1 6.4.072 3 OECD (Hg.): DAC Peer Review Germany, Paris 2006.4 (www.oecd.org/dataoecd/54 of poorer countries but need for greater strategic selectivity8 9 Germany has never stated a preference in favor of specific groups of countries. Germany admits10 that poorest countries need donors' full support

Franz, Sven Oliver

324

Work & Life at Munich | GE Global Research  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched FerromagnetismWaste and MaterialsWenjun1 Table 1.14 Sales of4) Monthly EnergyP FWork

325

Mepsolar AG aka Munich Energy Partners | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpIncMAKGalwayHydrothermalMcFarland isDiscoveries(2006)Mepsolar AG aka

326

Advanced Technology & Discovery at Munich | GE Global Research  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth (AOD)ProductssondeadjustsondeadjustAbout the BuildingInnovation PortalScience of

327

Risk based optimization procedures applied to the remediation of uranium mining and milling sites in Germany  

SciTech Connect (OSTI)

The remediation of former uranium mining and milling sites in the Eastern part of Germany represents a major environmental challenge. Due to the size and complexity of the sites and the significance of current and potential long term environmental impacts, effective approaches are required for the planning, implementation and regulatory control of reclamation measures. These have to ensure adequate protection for the people and the environment taking into account the long term nature of the hazards and the technical and economical constraints. The German regulatory framework is based upon ICRP principles of dose limitation, justification and optimization (ALARA). Application of these criteria requires as a first step the assessment of prevailing exposures and their potential long term evolution for each site. These risk assessments are based upon site characterization studies and the modelling of contaminant transfer to the environment and to man. Evaluation of the prevailing and potential future risks leads to the identification of remediation necessities. The subsequent planning of remediation measures is highly site specific and relies on the identification of possible reclamation options and their capability to reduce real risks to acceptable levels. The selection of the reclamation measures which will actually be implemented is performed within an optimization process involving assessments of possible risk reduction, technological feasibility, costs, long term stability, continuing requirements for long term active or passive institutional control and public acceptance.

Goldammer, W.; Barthel, R. [Brenk Systemplanung, Aachen (Germany)

1994-12-31T23:59:59.000Z

328

The evolution of the break preclusion concept for nuclear power plants in Germany  

SciTech Connect (OSTI)

In the updating of the Guidelines for PWR`s of the {open_quotes}Reaktor-Sicherheitskommission{close_quotes} (RSK) in 1981 the requirements on the design have been changed with respect to the postulated leaks and breaks in the primary pressure boundary. The major change was a revision in the requirements for pipe whip protection. As a logical consequence of the {open_quotes}concept of basic safety{close_quotes} a guillotine type break or any other break type resulting in a large opening is not postulated any longer for the calculation of reaction and jet forces. As an upper limit for a leak an area of 0, 1 A (A = open cross section of the pipe) is postulated. This decision was based on a general assessment of the present PWR system design in Germany. Since then a number of piping systems have been requalified in the older nuclear power plants to comply with the break preclusion concept. Also a number of extensions of the concept have been developed to cover also leak-assumptions for branch pipes. Furthermore due considerations have been given to other aspects which could contribute to a leak development in the primary circuit, like vessel penetrations, manhole covers, flanges, etc. Now the break preclusion concept originally applied to the main piping has been developed into an integrated concept for the whole pressure boundary within the containment and will be applied also in the periodic safety review of present nuclear power plants.

Schulz, H. [Gesellschaft fuer Anlagen- und Reaktorsicherheit, Koeln (Germany)

1997-04-01T23:59:59.000Z

329

Reply to Guy et al.: Support for a bottleneck in the 2011 Escherichia coli O104:H4 outbreak in Germany  

E-Print Network [OSTI]

In our paper (1), we analyzed isolates from the Escherichia coli O104:H4 outbreaks in Germany and France in May to July 2011. We concluded that, although the German outbreak was larger, the German isolates represent a clade ...

Grad, Y. H.

330

A review of "Self-Defense and Religious Strife in Early Modern Europe. England and Germany 1530-1630." by Robert von Friedeburg  

E-Print Network [OSTI]

. Self-Defense and Religious Strife in Early Modern Europe. England and Germany 1530-1630. Aldershot: Ashgate, 2002. xii + 278 pp. $99.95. Review by PAUL M. DOVER, KENNESAW STATE UNIVERSITY. With the advent of the religious controversies..., strong governmental authority, and a rigid social hierarchy, active resistance raised many dilemmas. It exercised the minds of intellectuals and common- ers alike in both Germany and the British Isles in the early modern period. Open resistance...

Paul M. Dover

2006-01-01T23:59:59.000Z

331

Heavy-metal contamination on training ranges at the Grafenwoehr Training Area, Germany  

SciTech Connect (OSTI)

Large quantities of lead and other heavy metals are deposited in the environment of weapons ranges during training exercises. This study was conducted to determine the type, degree, and extent of heavy-metal contamination on selected handgun, rifle, and hand-grenade ranges at Grafenwoehr Training Area, Germany. Soil, vegetation, and surface-water samples were collected and analyzed using the inductively-coupled plasma atomic-emission spectroscopy (ICP-AES) method and the toxic characterization leaching procedure (TCLP). The ICP-AES results show that above-normal levels of lead and copper are in the surface soil at the handgun range, high concentrations of lead and copper are in the berm and soil surface at the rifle range, and elevated levels of cadmium and above-normal concentrations of arsenic, copper, and zinc are present in the surface soil at the hand-grenade range. The TCLP results show that surface soils can be considered hazardous waste because of lead content at the rifle range and because of cadmium concentration at the hand-grenade range. Vegetation at the handgun and rifle ranges has above-normal concentrations of lead. At the hand-grenade range, both vegetation and surface water have high levels of cadmium. A hand-held X-ray fluorescence (XRF) spectrum analyzer was used to measure lead concentrations in soils in a field test of the method. Comparison of XRF readings with ICP-AES results for lead indicate that the accuracy and precision of the hand-held XRF unit must improve before the unit can be used as more than a screening tool. Results of this study show that heavy-metal contamination at all three ranges is limited to the surface soil; heavy metals are not being leached into the soil profile or transported into adjacent areas.

Zellmer, S.D.; Schneider, J.F.

1993-05-01T23:59:59.000Z

332

in: Rauterberg, M. (ed.): Proceedings of the Third International Conference on Educational Computing (ICEC 2004), September 1-3, 2004, Eindhoven, NL, Springer, LNCS, pp. 80-89  

E-Print Network [OSTI]

, Christian Henneke2 , Kanan Al-Zubaidi1 , Gunnar Stevens1 1 Institute for Information Systems, University of Munich, Germany efm@sportkreativwerkstatt.de, christian.henneke@web.de 3 Fraunhofer Institute for Applied Information Technology (FhG-FIT), Schloss Birlinghoven, Sankt Augustin, Germany volker.wulf@fit.fraunhofer

333

Using a Bayesian Network in the ProdFLOWTM Stefan Wagner  

E-Print Network [OSTI]

unchen Garching b. Munchen, Germany wagnerst@in.tum.de Melanie Ruhe Siemens AG Munich, Germany melanie.ruhe@siemens- ment organisations created by the research department of the Siemens AG. Its core are organisation to be adapted to the characteristics of R&D. In the research department of the Siemens AG a new approach

334

BioMed Central Page 1 of 14  

E-Print Network [OSTI]

, Germany, 2Siemens AG, Corporate Technology, Information and Communications, Otto-Hahn-Ring 6, 81739 Munich, Germany and 3Integrated Data Systems Department, Siemens Corporate Research, 755 College Road East* - mathaeus.dejori@siemens.com; Martin Stetter - stetter@siemens.com; Volker Tresp - volker.tresp@siemens

Tresp, Volker

335

Can Clone Detection Support Test Comprehension?  

E-Print Network [OSTI]

Can Clone Detection Support Test Comprehension? Benedikt Hauptmann, Maximilian Junker, Sebastian¨unchen, Germany Rudolf Vaas Munich Re Group M¨unchen, Germany Abstract--Tests are central artifacts of software systems. Therefore, understanding tests is essential for activities such as maintenance, test automation

336

Voice Conversion Using Exclusively Unaligned Training Data David Sundermann, Antonio Bonafonte  

E-Print Network [OSTI]

, Spain {suendermann,antonio}@gps.tsc.upc.es Harald H¨oge Siemens AG Corporate Technology 81739 Munich, Germany harald.hoege@siemens.com Hermann Ney RWTH Aachen Computer Science Department 52056 Aachen, Germany framework based on lin- ear transformation of the spectral envelope. Experimental results are reported

Suendermann, David

337

Supervised Probabilistic Principal Component Analysis Shipeng Yu1,2  

E-Print Network [OSTI]

Siemens AG, Corporate Technology, Information and Communications, Munich, Germany 3 MPI for Biological Cybernetics, T¨ubingen, Germany spyu@dbs.ifi.lmu.de, kai.yu@siemens.com, volker.tresp@siemens.com, kriegel transformation or document in- dexing, is of great importance and has been extensively stud- Permission to make

Tresp, Volker

338

Supervised Probabilistic Principal Component Analysis Shipeng Yu1,2  

E-Print Network [OSTI]

Siemens AG, Corporate Technology, Information and Communications, Munich, Germany 3 MPI for Biological Cybernetics, T¨ubingen, Germany spyu@dbs.ifi.lmu.de, kai.yu@siemens.com, volker.tresp@siemens.com, kriegel-59593-339-5/06/0008 ...$5.00. which is also called feature transformation or document in- dexing, is of great importance

Kriegel, Hans-Peter

339

TIME DOMAIN VOCAL TRACT LENGTH NORMALIZATION David Sundermann, Antonio Bonafonte  

E-Print Network [OSTI]

Science Department Ahornstr. 55, 52056 Aachen, Germany ney@cs.rwth-aachen.de Harald H¨oge Siemens AG Corporate Technology Otto-Hahn-Ring 6, 81739 Munich, Germany harald.hoege@siemens.com ABSTRACT Recently (mapping of several speakers to a certain individual) but the other direction (transforming a standard

Suendermann, David

340

AUTOSAR Appropriates Functional Safety and Multi-core Exploitation  

E-Print Network [OSTI]

Zalman2 1 DENSO AUTOMOTIVE Deutschland GmbH Eching, Germany 2 Infineon Technologies AG Automotive Electronics Munich, Germany Abstract. The main subject of this presentation is the connection be- tween-core architectures are influencing the automotive related software implementations and have relevance in both

Boyer, Edmond

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Dynamic Decentralized Area Partitioning for Cooperating Cleaning Robots Markus Jager Bernhard Nebel  

E-Print Network [OSTI]

Dynamic Decentralized Area Partitioning for Cooperating Cleaning Robots Markus J¨ager Bernhard Nebel Corporate Technology Institut f¨ur Informatik Siemens AG Albert-Ludwigs-Universit¨at 81730 Munich, Germany 79100 Freiburg, Germany markus.jaeger@mchp.siemens.de nebel@informatik.uni-freiburg.de Abstract

Nebel, Bernhard

342

INSTITUTE OF PHYSICS PUBLISHING JOURNAL OF PHYSICS: CONDENSED MATTER J. Phys.: Condens. Matter 14 (2002) 62336261 PII: S0953-8984(02)36146-0  

E-Print Network [OSTI]

Technologies AG, Corporate Research, Otto-Hahn-Ring 6, D-81730 Munich, Germany. 0953 Institut f¨ur Str¨omungsforschung, Bunsenstra?e 10, D-37073 G¨ottingen, Germany Received 23 April 2002 for scattering from clean, well-ordered surfaces, particularlyusinghelium

Manson, Joseph R.

343

HLW Return from France to Germany - 15 Years of Experience in Public Acceptance and Technical Aspects - 12149  

SciTech Connect (OSTI)

Since in 1984 the national reprocessing concept was abandoned the reprocessing abroad was the only existing disposal route until 1994. With the amendment of the Atomic Energy Act in 2001 spent fuel management changed completely since from 1 June 2005 any delivery of spent fuel to reprocessing plants was prohibited and the direct disposal of spent fuel became mandatory. Until 2005 the total amount of spent fuel to be reprocessed abroad added up to 6080 t HM, 5309 t HM thereof in France. The waste generated from reprocessing - alternatively an equivalent amount of radioactive material - has to be returned to the country of origin according to the commercial contracts signed between the German utilities and COGEMA, now AREVA NC, in France and BNFL, now INS in UK. In addition the German and the French government exchanged notes with the obligation of both sides to enable and support the return of reprocessing residues or equivalents to Germany. The return of high active vitrified waste from La Hague to the interim storage facility at Gorleben was demanding from the technical view i. e. the cask design and the transport. Unfortunately the Gorleben area served as a target for nuclear opponents from the first transport in 1996 to the latest one in 2011. The protection against sabotage of the railway lines and mass protests needed highly improved security measures. In France and Germany special working forces and projects have been set up to cope with this extraordinary situation. A complex transport organization was established to involve all parties in line with the German and French requirements during transport. The last transport of vitrified residues from France has been completed successfully so far thus confirming the efficiency of the applied measures. Over 15 years there was and still is worldwide no comparable situation it is still unique. Summing up, the exceptional project handling challenge that resulted from the continuous anti-nuclear civil disobedience in Germany over the whole 15-year long project running time could be faced efficiently. It has to be concluded that despite of all problems the anti-nuclear activities have caused so far, all transports of vitrified HLW have always been completed successfully by adapting the commonly established safety, security and public acceptance measures to the special conditions and needs in Germany and coordinating the activities of all parties involved but at the expense of high costs for industry and government and a challenging operational complexity. Apart from an anticipatory project planning a good communication between all involved industrial parties and the French and the German government was the key to the effective management of such shipments and to minimize the radiological, economic, environmental, public and political impact. The future will show how efficiently the gained experience can be used for further return projects which are to be realized since no reprocessed waste has yet been returned from UK and neither the medium-level nor the low-level radioactive waste has been transferred from France to Germany. (author)

Graf, Wilhelm [GNS Gesellschaft fuer Nuklear-Service mbH, 45127 Essen (Germany)

2012-07-01T23:59:59.000Z

344

24th European Photovoltaic Solar Energy Conference, Hamburg, Germany, Sept. 2009 HIGLY PREDICTIVE MODELLING OF ENTIRE SI SOLAR CELLS FOR INDUSTRIAL APPLICATIONS  

E-Print Network [OSTI]

On leave from: Institute for Solar Energy Systems, Sun Yat-Sen University, 510006, Guangzhou, China24th European Photovoltaic Solar Energy Conference, Hamburg, Germany, Sept. 2009 1 HIGLY PREDICTIVE MODELLING OF ENTIRE SI SOLAR CELLS FOR INDUSTRIAL APPLICATIONS P.P. Altermatt,1,2 S. Steingrube,1,2 Y. Yang

345

3rd Work. for Young Researchers on Human-Friendly Robotics, Oct. 2010, Tubingen, Germany Towards Bilateral Teleoperation of Multi-Robot Systems  

E-Print Network [OSTI]

. For instance, robots are expected to relieve us from monotonous and physically demanding work in industrial.g., telepresence applications where the human operator capabilities are mediated/magnified by the remote robots3rd Work. for Young Researchers on Human-Friendly Robotics, Oct. 2010, T¨ubingen, Germany Towards

346

2004 35thAnnual IEEE Power Electronics SpecialistsConference Aachen, Germany. 2004 Digital Controller Design for Electronic Ballasts with Phase Control  

E-Print Network [OSTI]

2004 35thAnnual IEEE Power Electronics SpecialistsConference Aachen, Germany. 2004 Digital Controller Design for Electronic Ballasts with Phase Control Yan Yin and Regan Zane Colorado Power Electronics Center University of Colorado at Boulder Boulder, CO 80309-0425 yiny@colorado.edu, zane

347

I.N. Sviatoslavsky, M.E. Sawan, E.A. Mogahed, University of Wisconsin S. Malang, Fusion Nuclear Technology Consulting, Germany  

E-Print Network [OSTI]

Technology Consulting, Germany C.P.C. Wong, M. Friend, General Atomics S. Majumdar, Argonne National Blanket 681C 616 C Mixer He 480C 660 C HX 500 C 500C Outboard to turbine 681C 500 C586 C 681C

348

Economic Life Cycle Assessment as element of sustainability certification a key success factor moving beyond Life Cycle Costing  

E-Print Network [OSTI]

Target topic: achieving sustainability, saving energy, and improving occupant comfort? Lead Author Wolfram Trinius, PhD, Ingenieurb?ro Trinius, Hamburg, Germany and University of Gavle, Sweden Co Authors Harry Hirsch, HH Consulting, Baden... Baden, Germany Simone Lakenbrink, DU Diederichs Project Management, Munich, Germany Title Economic Life Cycle Assessment as element of sustainability certification ? a key success factor moving beyond Life Cycle Costing The move from...

Trinius, W.; Hirsch, H.

349

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

of Texas Congress Avenue Austin Texas http www biodieselcoalitionoftexas org Texas Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www...

350

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

351

Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

www ecn nl home Energy Technology Data Exchange Energy Technology Data Exchange P O Box Oak Ridge Tennessee http www etde org home html Energy Environment and Development Network...

352

Name Name Address Place Zip Category Sector Telephone number...  

Open Energy Info (EERE)

Laboratory Inc Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large...

353

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Solar Wisconsin based based company that makes both...

354

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

CECO Environmental Corp CECO Environmental Corp Cincinnati Ohio Services Provider of air pollution control products and services CEEG NanJing New Energy CEEG NanJing New...

355

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

356

Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A

2007-01-01T23:59:59.000Z

357

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons Coop,

358

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons

359

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerConsSolar

360

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energy

362

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energys

363

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar

364

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png Roadmap

365

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png RoadmapCambridge Energy

366

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)Columbus

367

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom Efficiency

368

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLC

369

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLCe

370

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom

371

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg A

372

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg

373

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den BergAG

374

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den

375

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan denAFS

376

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan

377

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners ANV

378

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners

379

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Arava Power...

380

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Thessaloniki Greece Renewable Energy Solar Water Heaters Solar Collector Hot water Tanks http www mevaconh gr MGE UPS SYSTEMS Inc MGE UPS SYSTEMS Inc Costa Mesa California...

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

382

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Apros Solar Apros...

383

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU Institute

384

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU

385

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:

386

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center for

387

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center

388

Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBus Jump to:NSTAR

389

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:

390

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington Second

391

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington

392

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:WashingtonTIER

393

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump

394

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A123

395

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A1230

396

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation American

397

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation

398

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <FoundationFund

399

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives

400

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California Coast

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California

402

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum CaliforniaCompany

403

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz Limited

404

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz

405

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo Avenue

406

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo

407

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexas

408

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

409

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

410

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasIncA1

411

Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes,Phone"AEP

412

Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County,ContAddr2 Jump to: navigation, search Property

413

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal CapacityRenewable

414

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal

415

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution Name

416

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution

417

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled

418

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalledResearch Caltech Center for

419

Atmospheric Radiation Measurement (ARM) Data from Black Forest Germany for the Convective and Orographically Induced Precipitation Study (COPS)  

DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

The primary goal of the ARM Program is to improve the treatment of cloud and radiation physics in global climate models in order to improve the climate simulation capabilities of these models. ARM maintains four major, permanent sites for data collection and deploys the ARM Mobile Facility (AMF) to other sites as determined. In 2007 the AMF operated in the Black Forest region of Germany as part of the Convective and Orographically Induced Precipitation Study (COPS). Scientists studied rainfall resulting from atmospheric uplift (convection) in mountainous terrain, otherwise known as orographic precipitation. This was part of a six -year duration of the German Quantitative Precipitation Forecasting (QPF) Program. COPS was endorsed as a Research and Development Project by the World Weather Research Program. This program was established by the World Meteorological Organization to develop improved and cost-effective forecasting techniques, with an emphasis on high-impact weather. A large collection of data plots based on data streams from specific instruments used at Black Forest are available via a link from ARM's Black Forest site information page. Users will be requested to create a password, but the plots and the data files in the ARM Archive are free for viewing and downloading.

420

Factors affecting lead, cadmium, and arsenic levels in house dust in a smelter town in eastern Germany  

SciTech Connect (OSTI)

Hettstedt, a city in eastern Germany with a long history of mining and smelting of nonferrous ores, has several industrial sources of heavy metals. The indoor exposure to metals of children (5 to 14 years old) in the Hettstedt area was assessed by measuring the levels of lead, cadmium, and arsenic contamination in sedimented house dust. Factors which influence the dust loading rate and the surface loading rates of these contaminants in house dust were investigated. The geometric mean of the dust loading rate was 8.9 mg/m[sup 2] day. The geometric means of surface loading rates were 1.14, 0.024, and 0.023 [micro]g/m[sup 2] day for lead, cadmium, and arsenic, respectively. Factors that were significantly associated with surface loading rates included the city area of residence, automobile traffic near home, parent with occupational exposure to heavy metals, type of heating, housing characteristics, whether child's home is damp, number of persons living in the child's home,and parents' education. The most significant of these factors was the city area of residence, which reflects the distance from the metal sources; this factor accounted for about half of the variances explained by the regression models.

Meyer, I.; Heinrich, J. (GSF-Forschungszentrum fuer Umwelt und Gesundheit, Neuherberg (Germany). Inst. fuer Epidemiologie); Lippold, U. (Inst. fuer Wasser-, Boden- und Lufthygiene des Umweltbundesamtes Berlin (Germany))

1999-07-01T23:59:59.000Z

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

EA-1977: Acceptance and Disposition of Used Nuclear Fuel Containing U.S.-Origin Highly Enriched Uranium from the Federal Republic of Germany  

Broader source: Energy.gov [DOE]

This environmental assessment (EA) will evaluate the potential environmental impacts of a DOE proposal to accept used nuclear fuel from the Federal Republic of Germany at DOEs Savannah River Site (SRS) for processing and disposition. This used nuclear fuel is composed of kernels containing thorium and U.S.-origin highly enriched uranium (HEU) embedded in small graphite spheres that were irradiated in nuclear reactors used for research and development purposes.

422

Federal Republic of Germany  

E-Print Network [OSTI]

Business process re-engineering is becoming a main focus in todays efforts to overcome problems and deficits in the automotive and aerospace industries (e.g., integration in international markets, product complexity, increasing number of product variants, reduction in product development time and cost). In this paper, we investigate the steps needed to apply virtual reality (VR) for virtual prototyping (VP) to verify assembly and maintenance processes. After a review of todays business process in vehicle prototyping, we discuss CAD-VR data integration and identify new requirements for design quality. We present several new interaction paradigms so that engineers and designers can experiment naturally with the prototype. Finally, some results of a user survey performed at BMW are presented, showing the acceptance and feasability of VP and the paradigms implemented for our key process. The results show that VR will play an important role for VP in the near future.

Antonino Gomes De S; Gabriel Zachmann

423

Made in Germany  

SciTech Connect (OSTI)

This supplement was prepared in collaboration with the Association of German Mining Machine Manufacturers within VDMA to give an overview of German manufacturers' contribution to the coal industry. It has 18 short papers and a VDMA vendor matrix and directory. Papers include details of MAN Takraf's surface mining equipment, hydraulic shovels and excavators from Komatsu, Liebherr and Terex O & K, Siemens motors and electric control technology in trucks, shovels etc., new technology from DBT, IBS and Wirth, and low emission engines and drives from Deutz and DaimlerCrysler. 2 figs.

NONE

2005-09-01T23:59:59.000Z

424

Evaluation of the utilities energy monitoring and control system installed at the US Army, Europe, Pirmasens and 97th Base Support Battalion, Germany  

SciTech Connect (OSTI)

Authorized under an interagency agreements between the US Department of Energy and the US Army, evaluation of the utilities energy monitoring and control system (UEMCSs) operating at selected US Army installations in Heidelberg, Goeppingen, Pirmasens, and Baumholder, Germany, is nearing completion. This report specifically presents the results of the evaluation of the UEMCS installed at USAREUR, 21st Theater Army Area Command (TAACOM), Pirmasens and 97th Base Support Battalion, which is operated by the Directorate of Engineering and Housing (DEH) Utilities Division. The Oak Ridge National Laboratory (ORNL) was selected by Headquarters, USAREUR, Facilities Engineering Division, Utilities and Energy Branch in Heidelberg to evaluated the overall effectiveness and energy efficiency of UEMCSs at four US Army installations in Germany. The third of these systems to be evaluated, which is the scope of this report, is the UEMCS installed at Pirmasens. This evaluation relies upon existing data and information and does not involve introducing metering and instrumentation for the purpose of measuring installation energy use. The primary purpose of this evaluation is to take an in-depth look at the overall performance and effectiveness of the UEMCS installed at Pirmasens to see if it is achieving its operational objectives by resulting in energy and cost savings.

Broders, M.A.; McConnell, B.W.

1992-01-01T23:59:59.000Z

425

Type-Based Termination of Functional Programs Andreas Abel  

E-Print Network [OSTI]

Type-Based Termination of Functional Programs Andreas Abel Department of Computer Science Ludwig Timmendorfer Strand, Germany Andreas Abel (LMU Munich) Type-Based Termination KPS'07 1 / 21 #12;Introduction Termination Question: Will the run of a program eventually halt? Undecidable for Turing-complete programming

Abel, Andreas

426

Using the ProdFLOWTM Approach to Address the Myth  

E-Print Network [OSTI]

Siemens AG Otto-Hahn-Ring 6 81730 Munich, Germany melanie.ruhe@siemens.com Stefan Wagner Technische of the Siemens AG the new approach ProdFLOWTM* for the analysis and management of a research & development or * ProdFLOW is a registered Trademark of the Siemens AG. Permission to make digital or hard copies of all

427

Implementing Safety-Critical Systems in Prolog: Experiences from the R & D at Siemens  

E-Print Network [OSTI]

at Siemens Karl Stroetmann, Thomas Glass, and Martin M"uller Siemens AG, Corporate Research and Development, D-81730 Munich, Germany E-mail: Karl.Stroetmann@zfe.siemens Research and Development of Siemens. During this time we have been able* * to recognize the main pros

Stroetmann, Karl

428

Removing Redundancy and Inconsistency in Memory-Based Collaborative Filtering  

E-Print Network [OSTI]

Removing Redundancy and Inconsistency in Memory- Based Collaborative Filtering Kai Yu Siemens AG, Corporate Technology & University of Munich, Germany kai.yu.external@mchp.siemens. de Xiaowei Xu Information Science Department University of Arkansas at Little Rock xwxu@ualr.edu Anton Schwaighofer Siemens AG

Tresp, Volker

429

Statistical modeling of medical indexing processes for biomedical knowledge information discovery from text  

E-Print Network [OSTI]

Munich, Germany bundschu@dbs.ifi.lmu.de Mathaeus Dejori Integrated Data Systems Dep. Siemens Corporate Research 755 College Road East Princeton, NJ 08540, USA mathaeus.dejori@siemens.com Shipeng Yu CAD & Knowledge Solutions Siemens Medical Solutions 51 Valley Stream Parkway Malvern, PA 19355, USA shipeng.yu@siemens

Tresp, Volker

430

Active Learning via Transductive Experimental Design Kai Yu kai.yu@siemens.com  

E-Print Network [OSTI]

Active Learning via Transductive Experimental Design Kai Yu kai.yu@siemens.com Siemens, Corporate Technology, Otto-Hahn-Ring 6, Munich 81739, Germany Jinbo Bi jinbo.bi@siemens.com Siemens, Medical Solutions, 51 Valley Stream Parkway, Malvern PA 19355, USA Volker Tresp volker.tresp@siemens.com Siemens

Tresp, Volker

431

Robust Multi-Task Learning with t-Processes shipeng.yu@siemens.com  

E-Print Network [OSTI]

Robust Multi-Task Learning with t-Processes Shipeng Yu shipeng.yu@siemens.com CAD and Knowledge Solutions, Siemens Medical Solutions, Malvern, PA 19355, USA Volker Tresp volker.tresp@siemens.com Corporate Technology, Siemens AG, Munich 81730, Germany Kai Yu kyu@sv.nec-labs.com NEC Laboratories America, Cupertino

Tresp, Volker

432

A STUDY ON RESIDUAL PREDICTION TECHNIQUES FOR VOICE CONVERSION David Sundermann, Antonio Bonafonte  

E-Print Network [OSTI]

¨oge Siemens AG Corporate Technology Otto-Hahn-Ring 6, 81739 Munich, Germany harald.hoege@siemens.com ABSTRACT technique is the ap- plication of a linear transformation to the spectra of speech frames [3]. The transformation parameters are estimated us- ing a Gaussian mixture model to describe the characteristics

Suendermann, David

433

A First Step Towards Text-Independent Voice Conversion David Sundermann, Antonio Bonafonte  

E-Print Network [OSTI]

¨oge Siemens AG Corporate Technology Otto-Hahn-Ring 6, 81739 Munich, Germany harald.hoege@siemens.com Abstract conversion framework based on linear transformation of the spectral envelope. Experimental re- sults, this algorithm is embedded into a well-studied voice conversion frame- work based on linear transformation

Suendermann, David

434

RESIDUAL PREDICTION BASED ON UNIT SELECTION David Sundermann1,2,3  

E-Print Network [OSTI]

Bonafonte2 , Hermann Ney4 , Alan W Black5 1 Siemens Corporate Technology, Munich, Germany 2 Universitat@suendermann.com, harald.hoege@siemens.com, antonio.bonafonte@upc.edu, ney@cs.rwth-aachen.de, awb@cs.cmu.edu ABSTRACT based on lin- ear transformation or hidden Markov model-based speech synthesis. Our voice conversion

Black, Alan W

435

RESIDUAL PREDICTION BASED ON UNIT SELECTION David Sundermann1,2  

E-Print Network [OSTI]

Bonafonte2 , Hermann Ney3 , Alan W Black4 1 Siemens Corporate Technology, Munich, Germany 2 Universitat Carnegie Mellon University, Pittsburgh, USA david@suendermann.com, harald.hoege@siemens.com, antonio tech- niques that can be applied to voice conversion based on lin- ear transformation or hidden Markov

Suendermann, David

436

RESIDUAL PREDICTION David Sundermann1,2,3  

E-Print Network [OSTI]

Siemens AG, Munich, Germany 2 Universitat Polit`ecnica de Catalunya, Barcelona, Spain 3 University of Southern California, Los Angeles, USA david@suendermann.com, harald.hoege@siemens.com, {antonio, hduxans. Often, when generating (speech synthe- sis) or transforming (voice conversion) speech using one

Suendermann, David

437

VTLN-BASED CROSS-LANGUAGE VOICE CONVERSION David Sundermann, Hermann Ney  

E-Print Network [OSTI]

,ney}@cs.rwth-aachen.de Harald H¨oge Siemens AG Corporate Technology Otto-Hahn-Ring 6, 81739 Munich, Germany harald.hoege@siemens-pass transform [12]. The greater the parameter number is, the more carefully we must deal with their practical

Suendermann, David

438

Spectral Decision Diagrams Using Graph Transformations Mitchell Thornton Rolf Drechsler  

E-Print Network [OSTI]

Spectral Decision Diagrams Using Graph Transformations #3; Mitchell Thornton Rolf Drechsler Department of Electrical and Computer Engineering Siemens AG Mississippi State University Corporate Technology Mississippi State, MS 39762 81730 Munich, Germany mitch@ece.msstate.edu rolf.drechsler@mchp.siemens

Thornton, Mitchell

439

G. Chastek (Ed.): SPLC2 2002, LNCS 2379, pp. 4959, 2002. Springer-Verlag Berlin Heidelberg 2002  

E-Print Network [OSTI]

Northrop 7 , Michael Stark 8 , and David M.Weiss 9 1 Siemens AG, Otto Hahn Ring 6, D-81730 Munich, Germany Guenter.W.Boeckle@mchp.siemens.de 2 Telvent, C/ Tamarguillo 29, 41006 Sevilla, Spain jesus Böckle et al. 2 The Task Transforming an organization to create products as members of a product family

Leite, Julio Cesar Sampaio do Prado

440

Frequency Domain vs. Time Domain VTLN David Sundermann, Antonio Bonafonte  

E-Print Network [OSTI]

,antonio}@gps.tsc.upc.es Harald H¨oge Siemens AG Corporate Technology 81739 Munich, Germany harald.hoege@siemens.com Hermann Ney to a certain individual) but the other direc- tion (transforming a standard speaker to sev- eral well and Stella, 1986). The application of FD-VTLN to speech synthe- sis requires the transformation from time

Suendermann, David

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Minimum Mean Squared Error Interference Alignment  

E-Print Network [OSTI]

maximize sum utility, due to the associated loss in degrees of freedom. One approach to distributedunchen, 80290 Munich, Germany Email: {dschmidt,utschick}@tum.de Department of Electrical Engineering utility, where the utility depends on rate or SINR, a weighted sum MSE objective is used to compute

Kuzmanovic, Aleksandar

442

How ISO-Standards Affect Graphic-Arts Work  

E-Print Network [OSTI]

How ISO-Standards Affect Graphic-Arts Work Andreas Kraushaar Head, Prepress Division Fogra Munich, Germany 4pm, Wed., Jan. 10, 2007 Auditorium of the Center for Imaging Science ISO TC 130 (graphic. Important standards with respect to the printing industry such as the ISO 2846 and ISO 12647-X

Zanibbi, Richard

443

Meeting the Design Challenges of nano-CMOS Electronics  

E-Print Network [OSTI]

Millar,C. Asenov,A. Roy,G. Roy,S. Cumming,D. Berry,D. Pickles,S. Furber,S. Murray,A. Tyrrell,A. Zwolinski,M. Sinnott,R.O. Proceedings of Design Automation and Test in Europe: Workshop on Impact of Process Variability on Design and Test, Munich, Germany, March 2008.

Millar, C.; Asenov, A.; Roy, G.; Roy, S.; Cumming, D.; Berry, D.; Pickles, S.; Furber, S.; Murray, A.; Tyrrell, A.; Zwolinski, M.; Sinnott, R.O.

444

Patent family data and statistics at the European Patent Office Peter Hingley1  

E-Print Network [OSTI]

1 Patent family data and statistics at the European Patent Office Peter Hingley1 and Walter G. Park2 1 Controlling Office, European Patent Office, Erhardtstrasse 27, D-80331 Munich, Germany. phingley Patent Office (EPO) a comprehensive data file called PRI is maintained of patent families. The file

Lansky, Joshua

445

Cardiac and Thoracic-Abdominal Surgery A robotic system providing force feedback and automation  

E-Print Network [OSTI]

Surgery, German Heart Center Munich, Germany Abstract We have developed an experimental system for robotic allow a human expert to tie knots comfortably and cleanly, and, therefore, generate useful training and Technology has developed a mi- cro-telerobot system that also provides force feedback [3]. In Ger- many two

446

Process Improvement in Large-Scale Industrial Environments Based on SCM  

E-Print Network [OSTI]

Garching Karlheinz Raith BMW AG Sapporobogen 6-8 Germany 80788 Munich Abstract Process improvement manufacturer BMW has recog- nized the importance of software development for both, its products and its internal information man- agement, several years ago. BMW participates in several initiatives to introduce

447

Requirements for a MDE System to Support Collaborative In-Car Communication Diagnostics  

E-Print Network [OSTI]

Sedlmair BMW Group Research and Technology Munich, Germany michael.sedlmair@bmw.de Dominikus Baur Media processes. In this paper, we present results of our studies on current working behaviour and environments and software support in single user environments, co-located collaborative environments lack specific software

Isenberg, Petra

448

Free-hand Pointing for Identification and Interaction with Distant Objects  

E-Print Network [OSTI]

,2 , Chadly Marouane 2 , Andreas Butz 2 1 BMW Group Research and Technology, Munich, Germany 2 University interaction with the environment and enables meaningful new applications. Figure 1. In this paper, we present in the environment. 2. RELATED WORK 2.1 Gestural interaction in cars The use of gestural interfaces for in

449

Virtual Reality as a Tool for Verification of Assembly and Maintenance  

E-Print Network [OSTI]

S??a BMW AG, Geometrical Integration, CAD/CAM, 80788 Munich, Federal Republic of Germany, email: antonino.gomesdesa@bmw.de Gabriel Zachmann Fraunhofer Institute for Computer Graphics, Rundeturmstra?e 6 that VR will play an important role for VP in the near future. Key words: Virtual environments, virtual

Zachmann, Gabriel

450

European Photovoltaic Solar Energy Conference, Frankfurt, Germany, 24-28 September 2012, 2AO.2.4 HIGH EFFICIENCY BACK-CONTACT BACK-JUNCTION SILICON SOLAR CELLS WITH CELL  

E-Print Network [OSTI]

27th European Photovoltaic Solar Energy Conference, Frankfurt, Germany, 24-28 September 2012, 2AO.2 cost of energy in photovoltaics can be achieved by increasing the conversion efficiency as well into the surface of a thick silicon wafer. After sintering at 1100 °C in hydrogen atmosphere silicon is grown

451

27th European Photovoltaic Solar Energy Conference, Frankfurt, Germany, 24-28 September 2012, 2AO.1.5 IMPACT OF THE REAR SURFACE ROUGHNESS ON INDUSTRIAL-TYPE PERC SOLAR CELLS  

E-Print Network [OSTI]

-generation industrial solar cells as stated in the International Technology Roadmap [3]. An industrial PERC process flow27th European Photovoltaic Solar Energy Conference, Frankfurt, Germany, 24-28 September 2012, 2AO.1.5 IMPACT OF THE REAR SURFACE ROUGHNESS ON INDUSTRIAL-TYPE PERC SOLAR CELLS C.Kranz1 , S. Wyczanowski1 , S

452

Energy Saving Concept for 1,000 Buildings of the 'Landeshauptstadt Munchen' (Capital City of Munich)  

E-Print Network [OSTI]

). The municipal buildings' CO2-emissions in conjunction with heating supply has been decreased by 20 % already from 1987 to 2000. In a project unique of scale till now, 1,000 buildings - corresponding to about 50 % of the entire municipal building stock - have...

Baumann, O.; Domke, M.

2006-01-01T23:59:59.000Z

453

AXIONS AND OTHER SIMILAR PARTICLES Revised March 2012 by G.G. Raffelt (MPI Physics, Munich)  

E-Print Network [OSTI]

bosons is that their coupling to Standard-Model particles is suppressed by the energy scale symmetry-breaking scale vweak = ( 2GF)-1/2 = 247 GeV. However, the associated "standard" and "variant, fA is the quantity that enters all low-energy phenomena [7]. Non- perturbative effects induce

454

Presented at the 17th EC PVSEC Munich October 2001 Paper OA9.3  

E-Print Network [OSTI]

degradation. Thin film solar cells have the potential for low cost production on flexible substrates, high specific power (1.5 - 3 kW/kg) and stable performance [1]. Investigation of the thin film solar cell Si and III-V cells made of mono-crystalline materials. Not only the beginning of lifetime efficiency

Romeo, Alessandro

455

Press releases You have access to the database of Munich Re press releases since 1996.  

E-Print Network [OSTI]

and business opportunities Economic impacts of climate change on the BRIC states (Brazil, Russia, India, China and Political Science (LSE) to substantially advance research into the economic consequences of climate change. The five-year cooperation agreement with the LSE's newly established Centre for Climate Change Economics

Stevenson, Paul

456

Munich RE - Green Tech Solutions - strong headline e.g. Strong Partner in Risk Solutions  

Energy Savers [EERE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector General Office0-72.pdfGeorgeDoesn't32Department ofMoving Away

457

Evaluation of the utility and energy monitoring and control system installed at the US Army, Europe, 409th Base Support Battalion, Military Community at Grafenwoehr, Germany  

SciTech Connect (OSTI)

Under the provisions of Interagency Agreement DOE 1938-B090-A1 between the US Department of Energy (DOE) and the US Army Europe (USAREUR), Martin Marietta Energy Systems, Inc., is providing technical assistance to USAREUR in the areas of computer science, information engineering, energy studies, and engineering and systems development. One of the initial projects authorized under this interagency agreement is the evaluation of utility and energy monitoring and control systems (UEMCSs) installed at selected US Army installations in Europe. This report is an evaluation of the overall energy-conservation effectiveness and use of the UEMCS at the 409th Base Support Battalion located in Grafenwoehr, Germany. The 409th Base Support Battalion is a large USAREUR military training facility that comprises a large training area, leased housing, the main post area, and the camp areas that include Camps Aachen, Algier, Normandy, Cheb, and Kasserine. All of these facilities are consumers of electrical and thermal energy. However, only buildings and facilities in the main post area and Camps Aachen, Algier, and Normandy are under the control of the UEMCS. The focus of this evaluation report is on these specific areas. Recommendations to further increase energy and cost savings and to improve operation of the UEMCS are proposed.

Broders, M.A.; Ruppel, F.R.

1993-05-01T23:59:59.000Z

458

Possibilities and limitations of life cycle assessment (LCA) in the development of waste utilization systems - Applied examples for a region in Northern Germany  

SciTech Connect (OSTI)

Against the background of increasing concerns about climate change, the reduction of greenhouse gas emissions has become an integral part of processes in both the waste management and the energy industries. This is reflected in the development of new waste treatment concepts, in which domestic and commercial waste is treated with the aim of utilizing its energy content, while at the same time recycling as much of its material content as possible. Life cycle assessment (LCA) represents a method of assessing the environmental relevance of a waste management system, the basis of which is a material flow analysis of the system in question. GHG emissions from different options for thermal treatment and energy recovery from waste as applied to a region in Northern Germany have been analyzed by the LCA approach and an indicative LCA, which only considers those emissions resulting from operating stages of the system. Operating stages have the main share of emissions compared to pre-processing stages. Results show that through specific separation of waste material flows and highly efficient energy recovery, thermal treatment and energy generation from waste can be optimized resulting in reduction of emissions of greenhouse gases. There are also other areas of waste utilization, currently given little attention, such as the solar drying of sewage sludge, which can considerably contribute to the reduction of greenhouse gas emissions.

Wittmaier, M. [Institute for Recycling and Environmental Protection at Bremen University of Applied Sciences GmbH, Neustadtswall 30, 28199 Bremen (Germany)], E-mail: wittmaier@hs-bremen.de; Langer, S.; Sawilla, B. [Institute for Recycling and Environmental Protection at Bremen University of Applied Sciences GmbH, Neustadtswall 30, 28199 Bremen (Germany)

2009-05-15T23:59:59.000Z

459

LD Didactic GmbH . Leyboldstrasse 1 . D-50354 Huerth / Germany . Phone: (02233) 604-0 . Fax: (02233) 604-222 . e-mail: info@ld-didactic.de Kinetic theory of gases  

E-Print Network [OSTI]

LD LD Didactic GmbH . Leyboldstrasse 1 . D-50354 Huerth / Germany . Phone: (02233) 604-0 . Fax: (02233) 604-222 . e-mail: info@ld-didactic.de P2.5.3.1 Physics Leaflets Heat Kinetic theory of gases of degrees of freedom of the gas molecules: Rf 2 1 CV = (VI) ©by LD Didactic GmbH Printed in the Federal

Allen, Roland E.

460

Wegelerstrae # . ##### Bonn . Germany phone +## ### ###### . fax +## ### ######  

E-Print Network [OSTI]

.1 Equilibrated Systems 45 3.1.1 Carbon Nanotubes 45 3.1.2 Polyethylene Matrices 47 3.1.3 Composites 47 3 [7]. Due to these properties, carbon nanotubes can be used to reinforce polymer composites. Here in the materials research community. Meanwhile, some nanotube composite materials have been characterized experi

Ferrari, Patrik L.

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Perseus (Germany) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange CountyPennsylvania/Geothermal

462

AMF Deployment, Black Forest, Germany  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert SouthwestTechnologies |November 2011Astudies smartHistory:CONTR.l\CT

463

Immosolar Germany | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation,Ohio:GreerHiCalifornia:ISI SolarIdanha,Information Jump

464

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

465

Functional genomics analysis of the arabidopsis ABI5 bZIP transcription factor  

E-Print Network [OSTI]

results correlated best with qRT-PCR validation data for selected genes. A small number of genes including AtCOR413 pm-1 showed a consistent expression pattern across the three platforms. A robust ABRE cis-regulatory element was identified in the promoter...

Hur, Jung-Im

2009-05-15T23:59:59.000Z

466

Address State: Zip: All participants: please complete the form below and return it to  

E-Print Network [OSTI]

to UCDEA Contact the Retiree Center via e-mail: retireecenter@ucdavis.edu or telephone: (530) 752-5182

Schladow, S. Geoffrey

467

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

468

A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-

2005-01-01T23:59:59.000Z

469

LAST NAME: FIRST NAME: M.I.: MAILING ADDRESS: CITY: STATE: ZIP  

E-Print Network [OSTI]

AND ISI S INFORMATION ORIGINAL ISIS TRANSACTION NUMBER: ______________ AMOUNT CREDITED TO ISIS: $______________ NEW ISIS TRANSACTION NUMBER: ______________ REFUND DUE CUSTOMER: $______________ DATE PROCESSED IN ISIS: Distribution: White-Accounting Yellow-Customer CREDIT STUDENT (ISIS) ACCOUNT REFUND (CHECK

Tsien, Roger Y.

470

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

water heating systems in the Tri-cities and surrounding area 2382 Solar Heating equipment installation, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power generation in irrigation canals 2211 Electric power generation, transmission and distribution Columbia Basin

471

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

is the premier provider of residential and commercial solar thermal water heating systems in the Tri, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power-cities and surrounding area 2382 Solar Heating equipment installation Air Liquide America Corp 1902 231808 E Sr 397

472

3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)

473

Phosphorylation of the Parsley bZIP Transcription Factor CPRF2 Is Regulated by Light*  

E-Print Network [OSTI]

in response to light, we analyzed the common plant regulatory factor 2 (CPRF2) from parsley (Petroselinum

Schfer, Eberhard

474

Determining protein interaction specificity of native and designed bZIP family transcription factors  

E-Print Network [OSTI]

Protein-protein interactions are important for almost all cellular functions. Knowing which proteins interact with one another is important for understanding protein function as well as for being able to disrupt their ...

Reinke, Aaron W

2012-01-01T23:59:59.000Z

475

Quick Start The various sample data files after expansion (use Zip)  

E-Print Network [OSTI]

library (49 signature files and 1 library list file, all in ASCII, 300 KB). Duncan Knob.sdf Lidar full wave form SDF file (60 MB). Duncan Knob.idx Required index file for Duncan Knob.sdf (4.5 MB). sbet_mission 1.out Smoothed Best Estimate of Trajectory file. Needed for Duncan Knob.sdf (98 MB). Immediate

476

Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department of  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L d F SSalesOE0000652GrowE-mail on August

477

Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climateJuno Beach,October,LighthouseInformationLongwood is

478

Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico: EnergyMithun JumpMuscoy,Jump9 Case Data Survey Type LotNYSERDAZip

479

State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-g GrantAtlas (PACA RegionSpringview IISt.StarlightSystem

480

Do we get actual vendor name while we searched with zip code? | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has TypeGeothermal Area JumpSix Well Flow

Note: This page contains sample records for the topic "munich germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen1Model | OpenCDWR) Jump

482

Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo

483

MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY  

E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.

484

Graduate School of Systemic Neurosciences (GSN-LMU) Associated with "Munich Center for Neuroscience -Brain & Mind" and  

E-Print Network [OSTI]

forms, which you can download from the GSN M.Sc. thesis forms website: http://www.gsn.uni-muenchen.de/download/st_forms_che forms and checklists website: http://www.gsn practice in completing a literature search, producing informative figures from raw data, writing reports

Kersting, Roland

485

Algorithms and Applications for Spatial Data Mining Martin Ester, Hans-Peter Kriegel, Jrg Sander (University of Munich)  

E-Print Network [OSTI]

- 1 - Algorithms and Applications for Spatial Data Mining Martin Ester, Hans-Peter Kriegel, Jörg) for an overview of spatial data mining). Finding implicit reg- ularities, rules or patterns hidden in spatial for spatial data is more complex than for relational data. This applies to both the efficiency of algorithms

Kriegel, Hans-Peter

486

Promoting sustainable transportation through the integration of cycling with public transit : lessons from Copenhagen and Munich for Singapore  

E-Print Network [OSTI]

Sustainable modes of transportation like cycling and public transit are always desired, but trying to achieve a mode shift from the automobile to cycling and public transit can be quite a challenge because cycling and ...

Lee, Eugene Siong Aun

2010-01-01T23:59:59.000Z

487

Requirements of Cask-Storage and Cask-Transport Licensing According to IAEA 1996 Rules for On-Site Storage of Spent Fuel in Germany - From the Utility's Point of View  

SciTech Connect (OSTI)

As agreed between the German government and the utilities in 2001, all spent fuel assemblies (FAs) are now stored inside spent-fuel casks in on-site storage buildings. With the cask being the only route of FA disposal, cask licensing has become vital not only for cask vendors, but also for the utilities. Recently, the German authorities have taken the switch from the IAEA 1985 to the IAEA 1996 rules as the basis of the cask transport license as an opportunity to open new areas of discussion. One example is the behavior of the fuel assemblies inside the cask during and after the most harmful design accidents. Radiation-induced embrittlement of high-burn-up fuel rods (55-65 GWd/tHM FA-avg.) may cause failure of fuel rods after the 9 m drop. If one conservatively assumes the leak-tight cask to be flooded with water and if one conservatively considers at the same time the fuel released from the high-burn-up rods to be fresh fuel, one can construct a situation with questionable criticality safety. Because of these and similar considerations, the cask licensing procedure in Germany has become difficult and slow. As a result, the German utilities can not reach the FA burn-up levels granted in their operating licenses, as there is no cask type licensed that would suffice. Cask vendors, fuel vendors and utilities must work together to solve this problem. (authors)

Schmidt, Paul; Schmidt, Konrad [EnKK, Obrigheim (Germany); Geiser, Heinz [GNS, Essen (Germany); Schmidt, Paul [EnBW Kernkraft GmbH, KKP-UP, Rheinschanzinsel, 76661 Philippsburg (Germany)

2007-07-01T23:59:59.000Z

488

Page 1 of 3 Bonn, Germany  

E-Print Network [OSTI]

such as water and land degradation. Particularly, the section looks at remedial measures, resources availability explore how knowledge on mitigation and adaptation is produced, shared, maintained, and used (or not used

Ferrari, Patrik L.

489

OMV studies ethylene expansion in Germany  

SciTech Connect (OSTI)

OMV(Vienna) is evaluating plans to debottleneck its ethylene plant at Burghausen from 310,000 m.t./year to at least 400,000 m.t./year. Senior v.p. Jochen Berger says OMV is studying the limits to which the cracker can be expanded. {open_quotes}We`re pretty sure we can go to 400,000 m.t./year, but in two months we`ll have a better idea,{close_quotes} says Berger. The expansion will also depend on the future requirements of downstream operations at the Burghausen site, which include OMV plastics subsidiary PCD`s high-density polyethylene and polypropylene units and the vinyl chloride monomer and polyvinyl chloride units operated by Hoechst-Wacker joint venture Vinnolit.

NONE

1996-10-23T23:59:59.000Z

490

Hamburg, Germany: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation,Ohio:Greer County is a countyon State0933482°, -90.0187164°Hamburg,

491

Bonn, Germany: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectricEnergyCTBarre BiomassTHIS PAGE ISJumpSphereBonita Springs, Florida:Bonn,

492

GE Wind Energy Germany | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpen EnergyBoard" form. To create aGA SNC Solar JumpGC

493

Wilhelmshaven, Germany: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop,SaveWhiskey Flats Geothermal Area Jump to:Coop IncElectric

494

Cologne, Germany: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,Information Feed Jump to:ElectricCollegiateCologne,

495

Enex Power Germany | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump37. It isInformation Contracts (ESPC)EnergyWorks NorthEnernocEnersol

496

Visit of the Federal President of Germany  

ScienceCinema (OSTI)

Le D.G. H.Schopper a le plaisir de souhaiter la bienvenue au prsident de la Rpublique fdrale allemande, Richard von Weizscker (prsident fderale de 1984-1994). C'est la premire visite d'un prsident allemand dans l'histoire du Cern.

None

2011-04-25T23:59:59.000Z

497

ADDRESS: STATE: ZIP: Please complete the appropriate section of this form along with your check made payable to UC Regents.  

E-Print Network [OSTI]

@ucdavis.edu or telephone: (530) 752-5182 No tickets will be sent. You will receive a reminder via e-mail prior to the event

Thomases, Becca

498

Name AKA_FKA Contract # Start Date End Date Contract Scope City State Zip Phone Site Last Review  

E-Print Network [OSTI]

experience Fossil OR 97830 541.763.2725 3 Ashland Pediatrics AFF-2009-1389 04/15/2010 06/30/2015 Nursing students clinical learning experience Ashland OR 97520 541.482.8114 1 Ashland School District #5 AFF-2012-0933 07/01/2012 06/30/2017 Nursing students clinical learning experience Ashland OR 97520 541.482.8771 6

Chapman, Michael S.

499

Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5GCGCGCCCATGGGCCCTGCCACCACCCGA3 (forward primer with NcoI restriction site), 5GCGCGCCATATGCCTGCCACCACCCGAGGG3 (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne

2010-05-31T23:59:59.000Z

500

Support for U.S. Participants at the 15th International Congress on Catalysis  

SciTech Connect (OSTI)

The grant was used to partially assist the travel expenses of U.S. academic scientists to attend the 15th International Congress on Catalysis. The conference was held in Munich, Germany from July 1-6, 2012. The importance of the International Congress was to bring together the international community of faculty members who participate in catalysis research, and to share information that would lead to further developments and directions in the field of study. Graduate students and Post Docs were invited to apply for travel assistance based on criteria established by the North American Catalysis Society (NACS) and the local Catalysis Clubs.

Wachs, Israel E.

2013-08-05T23:59:59.000Z