National Library of Energy BETA

Sample records for mt sweetgrass mt

  1. Saving Mt. Fuji

    E-Print Network [OSTI]

    Hacker, Randi

    2013-09-12

    Broadcast Transcript: Mt. Fuji, or Fujisan is it is known here in Japan, has just been added to Unesco's World Heritage list as a cultural asset, honoring it for providing thousands of years of inspiration to artists, poets ...

  2. Pipeline MT Instructions Identification Number

    E-Print Network [OSTI]

    Hong, Don

    Pipeline MT Instructions Identification Number For identification purposes, you will be assigned a special identification number. M# You can activate your MT email, login to PipelineMT to register for classes or pay tuition and fees. Activating the MTSU Email and PipelineMT accounts: Visit the website

  3. Sweetgrass, MT Liquefied Natural Gas Exports to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan3 November 2013Additions (Million CubicYearCubic(Million,109 932

  4. Sweetgrass, MT Natural Gas Pipeline Imports From Canada (Million Cubic

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan3 November 2013Additions (MillionThousand Cubic Feet) Year

  5. Sweetgrass, MT Liquefied Natural Gas Exports (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Page WelcomeDecadeSumary(Million Cubic

  6. Sweetgrass, MT Liquefied Natural Gas Exports Price (Dollars per Thousand

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Page WelcomeDecadeSumary(Million

  7. Sweetgrass, MT Liquefied Natural Gas Exports Price (Dollars per Thousand

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Page WelcomeDecadeSumary(MillionCubic

  8. Sweetgrass, MT Liquefied Natural Gas Pipeline Exports to Canada (Dollars

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Page

  9. Sweetgrass, MT Liquefied Natural Gas Pipeline Exports to Canada (Dollars

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Pageper Thousand Cubic Feet) Year

  10. Sweetgrass, MT Liquefied Natural Gas Pipeline Exports to Canada (Million

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Pageper Thousand Cubic Feet)

  11. Sweetgrass, MT Natural Gas Pipeline Imports From Canada (Dollars per

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Pageper Thousand Cubic

  12. Sweetgrass, MT Natural Gas Pipeline Imports From Canada (Dollars per

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Pageper Thousand CubicThousand Cubic

  13. Sweetgrass, MT Natural Gas Pipeline Imports From Canada (Million Cubic

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Pageper Thousand CubicThousand

  14. Sweetgrass, MT Natural Gas Pipeline Imports From Canada (Million Cubic

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Pageper Thousand

  15. Mt. Baker Geothermal Project | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | OpenMt St HelensMt StMt.

  16. Mt Rainier Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | Open Energy(RECP)MtMt

  17. Developing Mt. Hope: The megawatt line

    SciTech Connect (OSTI)

    Rodzianko, P.; Fisher, F.S.

    1992-12-01

    After facing numerous obstacles, including opposition and competition, the Mt. Hope pumped-storage project in New Jersey has been licensed by FERC. That license will allow a former iron ore mine site to be used in producing a new resource-hydroelectricity. In early August 1992, after more than seven years of effort, the 2,000-MW Mt. Hope Waterpower Project was licensed by the Federal Energy Regulatory Commission (FERC). Getting the $1.8 billion pumped-storage project licensed was not an easy task. It involved 54 submittals to FERC, six public meetings, and costs of more than $12 million. Along the way, the project has withstood competing applications, community opposition, and legal battles. Getting a project of this magnitude off the ground is a challenge for even the most experienced developer. The effort was especially challenging for the Halecrest Company, a local family-owned and operated firm with no previous experience in hydroelectric development. When financing became tight, creative ways were found to raise seed capital for the project. When hydroelectric experience was needed, the company developed a world-class corporate team that carried Mt. Hope through the complexities of the licensing process and beyond. With license now in hand, the project developers are ready to move forward with negotiating power sales contracts and securing construction financing. The resulting project will be the second largest pumped-storage facility in the country-second only to the 2,100-MW Bath County project in Virginia. Mt. Hope will take six years to construct and is scheduled to be phased into operation beginning in 1999.

  18. Mt Rainier Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | Open Energy(RECP)Mt

  19. Mt Wheeler Power, Inc | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to: navigation,Mereg GmbHMontebalitoMt Princeton Hot Springs

  20. Marysville Mt Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville Mt Geothermal Area Jump to: navigation, search

  1. Mt Signal Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to: navigation, searchsource HistoryCharleston,Peak Utility Jump to:PosoMt

  2. Water Sampling At Mt Princeton Hot Springs Geothermal Area (Olson...

    Open Energy Info (EERE)

    Water Sampling At Mt Princeton Hot Springs Geothermal Area (Olson & Dellechaie, 1976) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water...

  3. Refraction Survey At Mt Princeton Hot Springs Geothermal Area...

    Open Energy Info (EERE)

    Refraction Survey At Mt Princeton Hot Springs Geothermal Area (Lamb, Et Al., 2012) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Refraction...

  4. 3D Mt Resistivity Imaging For Geothermal Resource Assessment...

    Open Energy Info (EERE)

    3D Mt Resistivity Imaging For Geothermal Resource Assessment And Environmental Mitigation At The Glass Mountain Kgra, California Jump to: navigation, search OpenEI Reference...

  5. Vertical Electrical Sounding Configurations At Mt Princeton Hot...

    Open Energy Info (EERE)

    Vertical Electrical Sounding Configurations At Mt Princeton Hot Springs Geothermal Area (Zohdy, Et Al., 1971) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home...

  6. Direct-Current Resistivity Survey At Mt Princeton Hot Springs...

    Open Energy Info (EERE)

    Direct-Current Resistivity Survey At Mt Princeton Hot Springs Area (Richards, Et Al., 2010) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity:...

  7. Geothermometry At Mt Princeton Hot Springs Geothermal Area (Pearl...

    Open Energy Info (EERE)

    Et Al., 1976) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Geothermometry At Mt Princeton Hot Springs Geothermal Area (Pearl, Et Al., 1976)...

  8. MT3DMS v5.3 Supplemental User's Guide

    E-Print Network [OSTI]

    Zheng, Chunmiao

    published by the U.S. Army Corps of Engineers (Zheng and Wang, 1999; available at http://hydro.geo.ua.edu/mt3d). Readers should refer to Zheng and Wang (1999) for complete information on the theoretical Tonkin, Henning Prommer, Chris Langevin, Ned Banta, Eileen Poeter, and Rui Ma in various aspects of MT3

  9. MOBILE INTERACTIVE VISITOR INFORMATION SERVICE: PUKAHA MT. BRUCE TRIAL RESULTS

    E-Print Network [OSTI]

    Zealand Tourism Research Institute Sept 2005 #12;New Zealand Tourism Research Institute September 2005 www Information Service (MIVIS) mobile phones to access audio information at Pukaha Mt Bruce (PMB) were collected and range of visitors using the MIVIS phones in the Pukaha Mt Bruce setting. #12;New Zealand Tourism

  10. WPA Omnibus Award MT Wind Power Outreach

    SciTech Connect (OSTI)

    Brian Spangler, Manager Energy Planning and Renewables

    2012-01-30

    The objective of this grant was to further the development of Montanaâ??s vast wind resources for small, medium, and large scale benefits to Montana and the nation. This was accomplished through collaborative work with wind industry representatives, state and local governments, the agricultural community, and interested citizens. Through these efforts MT Dept Environmental Quality (DEQ) was able to identify development barriers, educate and inform citizens, as well as to participate in regional and national dialogue that will spur the development of wind resources. The scope of DEQâ??s wind outreach effort evolved over the course of this agreement from the development of the Montana Wind Working Group and traditional outreach efforts, to the current focus on working with the stateâ??s university system to deliver a workforce trained to enter the wind industry.

  11. Chi tit mn hc mt bn kia.

    E-Print Network [OSTI]

    California at Davis, University of

    v xã hi, ý n môi trng và sáng to. "Th ô xe p ca Hoa K," Davis là mt cng ng a dng và nng ng chào ón, Phát �m và Nghe Trong Lãnh Vc Hc Tp, và các lãnh vc khác. Ngoài ra cng có nhiu c hi tham gia các t chc ti trng và phc v cng ng. Mun bit ngày tháng, hc phí và các chi tit khác, hãy n: www

  12. Recycling Lingware in a Multilingual MT System Steffen Leo Hansen

    E-Print Network [OSTI]

    Recycling Lingware in a Multilingual MT System Steffen Leo Hansen Manny Rayner David Carter Ivan (Rayner and Carter, 1997). The first is the most obvious: we start with a function- ing grammar

  13. Ground Gravity Survey At Mt Princeton Hot Springs Geothermal...

    Open Energy Info (EERE)

    lithologic distrubtions Notes Gravity low associated with Mt. Princeton Batholith; density contrast of -0.5 gcm3 of valley-fill sediments relative to batholith References J.E....

  14. NEAFS Y-mtDNA Workshop (Butler and Coble) November 1, 2006

    E-Print Network [OSTI]

    NEAFS Y-mtDNA Workshop (Butler and Coble) mtDNA November 1, 2006 http://www.cstl.nist.gov/biotech) mtDNA November 1, 2006 http://www.cstl.nist.gov/biotech/strbase/training.htm 2 Data Review-mtDNA Workshop (Butler and Coble) mtDNA November 1, 2006 http://www.cstl.nist.gov/biotech/strbase/training.htm 3

  15. Mt St Helens Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | OpenMt St HelensMt St

  16. Probing the lexicon in evaluating commercial MT systems Martin Volk

    E-Print Network [OSTI]

    for self evaluation consisted of technical, linguistic and ergonomic issues. As part of the linguisticProbing the lexicon in evaluating commercial MT systems Martin Volk University of Zurich Department Abstract In the past the evaluation of machine trans- lation systems has focused on single sys- tem

  17. (Have we found the Holy Grail?) Panel at MT-Summit 2003

    E-Print Network [OSTI]

    Wu, Dekai

    (Have we found the Holy Grail?) Panel at MT-Summit 2003 #12;The HKUST Leading Question Translation? If not, is the Holy Grail just around the corner? Translation Are we just about done? #12;Dekai Wu, MT

  18. Geothermal energy resource investigations at Mt. Spurr, Alaska

    SciTech Connect (OSTI)

    Turner, D.L.; Wescott, E.M. (eds.)

    1986-12-01

    Spurr volcano is a composite Quaternary cone of largely andesitic composition located on the west side of Cook Inlet about 80 miles west of Anchorage and about 40 miles from the Beluga electrical transmission line. Geologic mapping (Plate 1-1) shows that the present summit depression was produced by a Mt. St. Helens-type sector collapse, rather than by a caldera collapse. Geochronologic and previous tephrachronologic studies show that there has been an active magmatic system at Spurr volcano during the late Pleistocene-to-Holocene time interval that is of critical interest for geothermal energy resource assessment. Major effort was devoted to geochemical and geophysical surveys of the accessible area south of Mt. Spurr, in addition to geologic mapping and geochronologic studies. Many coincident mercury and helium anomalies were found, suggesting the presence of geothermal systems at depth. Extremely large electrical self-potential anomalies were also found, together with extensive zones of low resistivity discovered by our controlled-source audiomagnetotelluric survey. The juxtaposition of all of these different types of anomalies at certain areas on the south slope of Crater Peak indicates the presence of a geothermal system which should be accessible by drilling to about 2000 ft depth. It is also evident that there is a strong volcanic hazard to be evaluated in considering any development on the south side of Mt. Spurr. This hazardous situation may require angle drilling of production wells from safer areas and placement of power generation facilities at a considerable distance from hazardous areas.

  19. Mt St Helens Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | OpenMt St Helens

  20. MT Energie GmbH Co KG | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma,Information MHKMHK5 < MHKKemblaSolar Jump to:Industries Inc JumpMT

  1. RAPID/Roadmap/12-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevada <UtahMontanasourceWA-aCA-aMT-a <

  2. RAPID/Roadmap/15-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ | RoadmapCO-ceWA-eb <MT-a

  3. RAPID/Roadmap/17-MT-c | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ |a < RAPID‎CA-aHI-aaMT-c

  4. RAPID/Roadmap/18-MT-b | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ |a <-AK-b <CO-badMT-b

  5. RAPID/Roadmap/4-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎f <CA-aab <cdMT-a <

  6. RAPID/Roadmap/6-MT-d | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎fRAPID/Roadmap/6-CO-bacMT-d

  7. RAPID/Roadmap/6-MT-f | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎fRAPID/Roadmap/6-CO-bacMT-df

  8. City of Mt Pleasant, Utah (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler, Iowa (UtilityIowa Phone Number: (319) 385-2121City of Mt

  9. Mt Princeton Hot Springs Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to: navigation,Mereg GmbHMontebalitoMt Princeton Hot Springs Geothermal

  10. RAPID/Roadmap/14-MT-b | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-a <CA-cID-aMT-b <

  11. RAPID/Roadmap/14-MT-c | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-a <CA-cID-aMT-b

  12. RAPID/Roadmap/14-MT-d | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-a <CA-cID-aMT-bd

  13. RAPID/Roadmap/17-MT-d | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-ad-MT-d < RAPID‎ |

  14. RAPID/Roadmap/20-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-a < RAPID‎ |MT-a <

  15. RAPID/Roadmap/8-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-abFD-a < RAPID‎ID-eMT-a

  16. Micro-Earthquake At Marysville Mt Area (Blackwell) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville MtMedicalInformation 2-2005)1995) |Information

  17. HERO Ski Trip to Mt. Hood Meadows February

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (Journalvivo Low-Dose Lowï‚— WeUpdateScienceForTrip to Mt. Hood Meadows

  18. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    Strategies for Rural Communities. ” National Conference onallocation facing the rural community of Mt. Laguna? (EquityStrategies for Rural Communities. ” National Conference on

  19. DC Resistivity Survey (Dipole-Dipole Array) At Mt Princeton Hot...

    Open Energy Info (EERE)

    1971) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: DC Resistivity Survey (Dipole-Dipole Array) At Mt Princeton Hot Springs Geothermal Area...

  20. Visual Field Maps, Population Receptive Field Sizes, and Visual Field Coverage in the Human MT Complex

    E-Print Network [OSTI]

    Dumoulin, Serge O.

    of processing in human motion-selective cortex. I N T R O D U C T I O N Neuroimaging experiments localize human by additional experiments. Defining human MT based on stimulus selectivity means that the identificationVisual Field Maps, Population Receptive Field Sizes, and Visual Field Coverage in the Human MT

  1. Bitcoin Transaction Malleability and MtGox Christian Decker and Roger Wattenhofer

    E-Print Network [OSTI]

    Bitcoin Transaction Malleability and MtGox Christian Decker and Roger Wattenhofer ETH Zurich International Publishing Switzerland 2014 #12;314 C. Decker and R. Wattenhofer exchanges its monopoly slowly doubled the withdrawn bitcoins, once from the withdrawal and once on its account on MtGox. In this work we

  2. An assessment of regional climate trends and changes to the Mt. Jaya glaciers of Irian Jaya 

    E-Print Network [OSTI]

    Kincaid, Joni L.

    2007-09-17

    on the Mt. Jaya glaciers has been lacking since the early 1970s. Using IKONOS satellite images, the ice extents of the Mt. Jaya glaciers in 2000, 2002, 2003, 2004, and 2005 were mapped. The mapping indicates that the recessional trend which began in the mid...

  3. Mt. Etna tropospheric ash retrieval and sensitivity analysis using Moderate Resolution Imaging

    E-Print Network [OSTI]

    Oxford, University of

    Mt. Etna tropospheric ash retrieval and sensitivity analysis using Moderate Resolution Imaging.pugnaghi@unimore.it, gabriele.gangale@unimore.it Abstract. A retrieval of tropospheric volcanic ash from Mt Etna has been. In order to derive the ash plume optical thickness, the particle effective radius and the total mass

  4. A MT System from Turkmen to Turkish Employing Finite State and Statistical Methods

    E-Print Network [OSTI]

    Yanikoglu, Berrin

    between close language pairs can be relatively easier and can still benefit from simple(r) paradigms in MT with a disambiguation post-processing stage based on statistical language models. The very productive inflectionalA MT System from Turkmen to Turkish Employing Finite State and Statistical Methods A. Cüneyd TANTU

  5. MT3D: a 3 dimensional magnetotelluric modeling program (user's guide and documentation for Rev. 1)

    SciTech Connect (OSTI)

    Nutter, C.; Wannamaker, P.E.

    1980-11-01

    MT3D.REV1 is a non-interactive computer program written in FORTRAN to do 3-dimensional magnetotelluric modeling. A 3-D volume integral equation has been adapted to simulate the MT response of a 3D body in the earth. An integro-difference scheme has been incorporated to increase the accuracy. This is a user's guide for MT3D.REV1 on the University of Utah Research Institute's (UURI) PRIME 400 computer operating under PRIMOS IV, Rev. 17.

  6. NEAFS Y-mtDNA Workshop (Butler and Coble) Markers, Core Loci, and Kits

    E-Print Network [OSTI]

    ) ­ Ann Gross (MN) ­ Jill Smerick (FBI) ­ Sam Baechtel (FBI) ­ Roger Frappier (CFS) ­ Phil Kinsey (OR now MT) ­ Gary Sims (CA DOJ) ­ George Carmody (retired) ­ Mike Adamowicz (CT) ­ Bruce Budowle (FBI

  7. TIME-VARIABLEFILTERING OF MtTLTI[CHANNELSIGNALS USING MULTIPLE WINDOWS COHERENCEAND THE WEYL TRANSFORM

    E-Print Network [OSTI]

    Sandsten, Maria

    TIME-VARIABLEFILTERING OF MtTLTI[CHANNELSIGNALS USING MULTIPLE WINDOWS COHERENCEAND THE WEYL between all channel pairs. Time-frequency coherence functions are estimated using the multiple window

  8. The Genetic Structure of the Kuwaiti Population: mtDNA Inter- and Intra-population Variation

    E-Print Network [OSTI]

    Theyab, Jasem; Al-Bustan, Suzanne; Crawford, Michael H.

    2012-08-01

    it to their neighboring populations. These subpopulations were tested for genetic homogeneity and shown to be heterogeneous. Restriction fragment length polymorphism (RFLP) and mtDNA sequencing analyses of HVRI were used to reconstruct the genetic structure of Kuwait...

  9. Implied motion activation in cortical area MT can be explained by visual low-level features

    E-Print Network [OSTI]

    Oram, Mike

    ForReview Only Implied motion activation in cortical area MT can be explained by visual low Neuroscience #12;ForReview Only 1 Implied motion activation in cortical area MT can be explained by visual low, The Netherlands Page 1 of 51 Jounal of Cognitive Neuroscience 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

  10. Experiment operations plan for the MT-4 experiment in the NRU reactor. [PWR

    SciTech Connect (OSTI)

    Russcher, G.E.; Wilson, C.L.; Parchen, L.J.; Marshall, R.K.; Hesson, G.M.; Webb, B.J.; Freshley, M.D.

    1983-06-01

    A series of thermal-hydraulic and cladding materials deformation experiments were conducted using light-water reactor fuel bundles as part of the Pacific Northwest Laboratory Loss-of-Coolant Accident (LOCA) Simulation Program. This report is the formal operations plan for MT-4 - the fourth materials deformation experiment conducted in the National Research Universal (NRU) reactor, Chalk River, Ontario, Canada. A major objective of MT-4 was to simulate a pressurized water reactor LOCA that could induce fuel rod cladding deformation and rupture due to a short-term adiabatic transient and a peak fuel cladding temperature of 1200K (1700/sup 0/F).

  11. Dr. Joseph A. Shaw Electrical & Computer Engineering Dept., Montana State University, Bozeman, MT 59717

    E-Print Network [OSTI]

    Lawrence, Rick L.

    Dr. Joseph A. Shaw Electrical & Computer Engineering Dept., Montana State University, Bozeman, MT M.S. Electrical Engineering University of Utah 1987 B.S. Electrical Engineering University of Alaska Experience: 2008 ­ present Professor ­ Electrical & Computer Engineering (ECE) Department, Montana State

  12. Synchronous Dependency Insertion Grammars A Grammar Formalism for Syntax Based Statistical MT

    E-Print Network [OSTI]

    Synchronous Dependency Insertion Grammars A Grammar Formalism for Syntax Based Statistical MT Yuan formalism specifically designed for syntax-based sta- tistical machine translation. The synchro- nous between lan- guages, which many other synchronous grammars are unable to model. A Depend- ency Insertion

  13. MONTANA OUTDOORS 3130 MARCH APRIL 2014 FWP.MT.GOV/MTOUTDOORS Why mountain bluebirds

    E-Print Network [OSTI]

    Duckworth, Renée

    MONTANA OUTDOORS 3130 MARCH APRIL 2014 FWP.MT.GOV/MTOUTDOORS TURF WAR TWIST Why mountain bluebirds are good for this species in western Montana valleys but don't benefit, in the long run, mountain bluebirds. Although mountain blue- birds also lost nesting sites, they had evolved to also use habitats at higher

  14. Intermountain GIS Conference. April 1923 2010, Bozeman, MT. Patrick Lawrence, Maxwell BD, Rew LJ

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    Intermountain GIS Conference. April 1923 2010, Bozeman, MT. Patrick Lawrence, Maxwell BD, Rew in the Python programming language, drawing on Python's builtin library, the RPy extension, ArcGIS geoprocessing and ArcGIS Server. As inputs, it accepts transect shapefiles, transect text files, or point

  15. MT3DMS, A Modular Three-Dimensional Multispecies Transport Model User Guide to the

    E-Print Network [OSTI]

    Zheng, Chunmiao

    .M. Cozzarelli, M.H. Lahvis, and B.A. Bekins. 1998. Ground water contamination by crude oil near Bemidji (LNAPL) contaminant through the unsaturated zone and the formation of an oil lens on the water tableMT3DMS, A Modular Three-Dimensional Multispecies Transport Model ­ User Guide to the Hydrocarbon

  16. Hybrid Rule-Based Example-Based MT: Feeding Apertium with Sub-sentential Translation Units

    E-Print Network [OSTI]

    Way, Andy

    Hybrid Rule-Based ­ Example-Based MT: Feeding Apertium with Sub-sentential Translation Units Felipe S´anchez-Mart´inez Mikel L. Forcada Andy Way Dept. Llenguatges i Sistemes Inform`atics Universitat University Dublin 9, Ireland {mforcada,away}@computing.dcu.ie Abstract This paper describes a hybrid machine

  17. Stress magnitude and its temporal variation at Mt. Asama Volcano, Japan, from seismic anisotropy and GPS

    E-Print Network [OSTI]

    Utrecht, Universiteit

    Stress magnitude and its temporal variation at Mt. Asama Volcano, Japan, from seismic anisotropy stress Japan The Earth's stress regime is fundamental to its physical processes, yet few methods can determine absolute stress, and measurements of temporal variations in stress are controversial. The Global

  18. Some Effects of Mt. St. Helens Volcanic Ash on Juvenile Salmon Smolts

    E-Print Network [OSTI]

    Some Effects of Mt. St. Helens Volcanic Ash on Juvenile Salmon Smolts TIMOTHY W. NEWCOMB and THOMAS. Helens, which was completely decimated with vol- canic ash and mud slides. Heavy sediment loads smolts were exposed to various concentrations ofairborne volcanic ash from the 18 May 1980 eruption

  19. High-latitude vegetation dynamics: 850 years of vegetation development on Mt Hekla, Iceland 

    E-Print Network [OSTI]

    Cutler, Nick

    2008-01-01

    on Mt Hekla in south-central Iceland. The chronosequence approach was used to infer 850 years of vegetation development from a suite of 14 lava flows (five of which had been disturbed by the deposition of volcanic tephra). The thesis is organised around...

  20. Geophys. 1. R. astr. Soc. (1987),89,7-18 MT and reflection: an essential combination

    E-Print Network [OSTI]

    Jones, Alan G.

    1987-01-01

    ) studies and seismic reflection profiles conducted. Unfortunately, over many more regions the seismic of the magnetotelluric (MT) technique as having a vertical resolution equivalent to the seismic refraction method, in almost every case, be made wherever a seismic reflection survey is undertaken. Examples are shown from

  1. Hazard assessment in geothermal exploration: The case of Mt. Parker, Southern Philippines

    SciTech Connect (OSTI)

    Delfin, F.G. Jr.; Salonga, N.D.; Bayon, F.E.B.

    1996-12-31

    Hazard assessment of the Mt. Parker geothermal prospect, conducted in parallel with the surface exploration from 1992 to 1994, was undertaken to determine the long-term suitability of the prospect for development. By comparison with other acidic magmatic-hydrothermal systems in the Philippines, the geochemical data indicated minimal input of acidic magmatic fluids into Mt. Parker`s hydrothermal system. This system was regarded to be a neutral-pH and high-enthalpy chloride reservoir with temperature of at least 200-250{degrees}C. These favorable geochemical indications contrasted sharply with the C-14 and volcanological data indicating a shallow magmatic body with a potential for future eruption. This hazard led PNOC EDC to discontinue the survey and abandon the prospect by late 1994. On September 6, 1995, a flashflood of non-volcanic origin from the caldera lake killed nearly 100 people on the volcano`s northwestern flank.

  2. Rock Sampling At Mt Ranier Area (Frank, 1995) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/ColoradoRemsenburg-Speonk, NewMichigan: Energy Resources JumpMt Ranier Area (Frank, 1995)

  3. EC305 Problem Set 1 1. Let x(t) = m(t) cos 2fct, where m(t) is a real lowpass signal with bandwidth W and

    E-Print Network [OSTI]

    Bhashyam, Srikrishna

    EC305 Problem Set 1 1. Let x(t) = m(t) cos 2fct, where m(t) is a real lowpass signal with bandwidth a bandpass signal x(t) = m1(t) cos 2fct - m2(t) sin 2fct. (a) Determine the in-phase and quadrature components of this signal when the local os- cillators used have a phase offset of , i.e., they are cos (2fct

  4. Tidally dominated depositional environment for the Mt. Simon Sandstone in central Illinois

    SciTech Connect (OSTI)

    Sargent, M.L.; Lasemi, Z. (Illinois State Geological Survey, Champaign, IL (United States))

    1993-03-01

    Several hundred feet of core from the upper part of the Mt. Simon in central Illinois have been examined macroscopically. Grain sizes and their systematics, bedding characteristics, sedimentary structures, and relationships among beds show that the upper Mt. Simon Sandstone is composed of a series of fining-upward cycles up to 10 m (30 feet) thick. A typical cycle consists, in ascending order, of a sandy subtidal facies, a mixed sand and mud intertidal-flat facies, and a muddy upper tidal-flat facies upward through the succession, the maximum and average grain size becomes progressively finer and the cycles thinner. The lower sandstone of each cycle contains beds that are massive to cross bedded and cross laminated; some beds show scoured reactivation surfaces. A few cycles contain a middle unit characterized by flaser and lenticular bedding and abundant mudcracks. Mudcracks also are common in the shale beds at the top of each cycle. Sedimentary structures such as reactivation surfaces, flaser and lenticular bedding, and mudcracks suggest that these cycles were deposited in peritidal environments. The presence of Skolithos in some cycles suggests very shallow marine conditions. The within-cycle upward fining is caused by regression or progradation that reflects a progressive decrease in current velocity from subtidal to intertidal parts of the tidal flat. Frequent flooding of the tidal flat resulted in repeated fining-upward cycles within the upper part of the Mt. Simon Sandstone.

  5. Application of Remote Sensing Technology and Ecological Modeling of Forest Carbon Stocks in Mt. Apo Natural Park, Philippines 

    E-Print Network [OSTI]

    Leal, Ligaya Rubas

    2015-01-23

    This dissertation work explored the application of remote sensing technology for the assessment of forest carbon storage in Mt. Apo Natural Park. Biomass estimation is traditionally conducted using destructive sampling with high levels...

  6. Sequence Stratigraphy and Detrital Zircon Geochronology of Middle-Late Ordovician Mt. Wilson Quartzite, British Columbia, Canada 

    E-Print Network [OSTI]

    Hutto, Andrew Paul

    2012-07-16

    STRATIGRAPHY AND DETRITAL ZIRCON GEOCHRONOLOGY OF MIDDLE-LATE ORDOVICIAN MT. WILSON QUARTZITE, BRITISH COLUMBIA CANADA A Thesis by ANDREW PAUL HUTTO Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment... of the requirements for the degree of MASTER OF SCIENCE May 2012 Major Subject: Geology Sequence Stratigraphy and Detrital Zircon Geochronology of Middle-Late Ordovician Mt. Wilson...

  7. Havre, MT Natural Gas Pipeline Imports From Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969CentralWellsMillion Cubic Feet) Havre, MT Natural Gas Pipeline

  8. MT1-MMP promotes cell growth and ERK activation through c-Src and paxillin in three-dimensional collagen matrix

    SciTech Connect (OSTI)

    Takino, Takahisa; Tsuge, Hisashi; Ozawa, Terumasa [Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192 (Japan)] [Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192 (Japan); Sato, Hiroshi, E-mail: vhsato@kenroku.kanazawa-u.ac.jp [Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192 (Japan)] [Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192 (Japan)

    2010-06-11

    Membrane-type 1 matrix metalloproteinase (MT1-MMP) is essential for tumor invasion and growth. We show here that MT1-MMP induces extracellular signal-regulated kinase (ERK) activation in cancer cells cultured in collagen gel, which is indispensable for their proliferation. Inhibition of MT1-MMP by MMP inhibitor or small interfering RNA suppressed activation of focal adhesion kinase (FAK) and ERK in MT1-MMP-expressing cancer cells, which resulted in up-regulation of p21{sup WAF1} and suppression of cell growth in collagen gel. Cell proliferation was also abrogated by the inhibitor against ERK pathway without affecting FAK phosphorylation. MT1-MMP and integrin {alpha}{sub v}{beta}{sub 3} were shown to be involved in c-Src activation, which induced FAK and ERK activation in collagen gel. These MT1-MMP-mediated signal transductions were paxillin dependent, as knockdown of paxillin reduced cell growth and ERK activation, and co-expression of MT1-MMP with paxillin induced ERK activation. The results suggest that MT1-MMP contributes to proliferation of cancer cells in the extracellular matrix by activating ERK through c-Src and paxillin.

  9. Uranium hydrogeochemical and stream sediment reconnaissance of the Mt. Hayes NTMS quadrangle, Alaska

    SciTech Connect (OSTI)

    Not Available

    1981-05-01

    Results of a hydrogeochemical and stream sediment reconnaissance of the Mt. Hayes quadrangle, Alaska, are presented. In addition to this abbreviated data release, more complete data are available to the public in machine-readable form. In this data release are location data, field analyses, and Laboratory analyses of several different sample media. For the sake of brevity, many field site observations have not been included in this volume. These data are, however, available on the magnetic tape. Appendices A to D describe the sample media and summarize the analytical results for each medium. The data were subsetted by one of the Los Alamos National Laboratory (LANL) sorting programs into groups of stream sediment, lake sediment, stream water, lake water, and ground water samples. For each group which contains a sufficient number of observations, statistical tables, tables of raw data, and 1:1000000 scale maps of pertinent elements have been included in this report.

  10. EIS-0092: Conversion to Coal, Holyoke Water Power Company, Mt. Tom Generating Station Unit 1 Holyoke, Hampden County, Massachusetts

    Broader source: Energy.gov [DOE]

    The Economic Regulatory Administration prepared this statement to assess the environmental impacts of prohibiting Unit 1 of the Mt. Tom Generation Station Unit 1 from using either natural gas or petroleum products as a primary energy source, which would result in the utility burning low-sulfur coal.

  11. The Mechanism of Inhibition of Antibody-based Inhibitors of Membrane-type Serine Protease 1 (MT-SP1)

    E-Print Network [OSTI]

    Craik, Charles S.

    The Mechanism of Inhibition of Antibody-based Inhibitors of Membrane-type Serine Protease 1 (MT-SP1, 600 16th St. Genentech Hall, San Francisco, CA 94143, USA The mechanisms of inhibition of two novel sc-SP1 at low pH, and is a standard mechanism inhibitor of the protease. The mechanisms of inhibition

  12. Applications of stable isotopes in hydrological studies of Mt. Apo geothermal field, Philippines

    SciTech Connect (OSTI)

    Salonga, N.D.; Aragon, G.M.; Nogara, J.B.; Sambrano, B.G.

    1996-12-31

    The local precipitation in Mt. Apo is depleted of heavy isotopes owing to high elevation and landward location of the field. Rainwaters infiltrate the shallow grounds, circulate in short distances with almost no interaction with the host bed rocks, and effuse in the surface as cold springs. Lakes and rivers are affected by surface evaporation while the acid SO{sub 4} springs are affected by both evaporation and steam-heating. Only the neutral-pH Cl springs have the signature of the deep thermal fluids. The parent fluids of the deep thermal brine contain Cl of 4,800 to 5,000 mg/kg, {delta}{sup 18}O of -4.62 to -4.13 {per_thousand} and {delta}{sup 2}H of -60.0 to -57.8 {per_thousand}. Inside the Sandawa Collapse, boiling of the parent fluids resulted in a two-phase reservoir with lighter isotope contents. The thermal fluids laterally flow towards the west where they are affected by cooling and mixing of cold waters. Deep water recharge has {delta}{sup 18}O of -10.00 {per_thousand} and {delta}{sup 2}H = -61.20 {per_thousand} which come from the upper slopes of Sandawa Collapse (1580-1700 mASL).

  13. Four-year prospective study of the respiratory effects of volcanic ash from Mt. St. Helens

    SciTech Connect (OSTI)

    Buist, A.S.; Vollmer, W.M.; Johnson, L.R.; Bernstein, R.S.; McCamant, L.E.

    1986-04-01

    This report describes the 4-yr follow-up of 712 loggers exposed over an extended period to varying levels of fresh volcanic ash from the 1980 eruptions of Mt. St. Helens. Concerns related to the irritant effect the ash might have on the airways and also to its fibrogenic potential if exposures were intense and continued over many years. Our subjects were divided into 3 groups: high, low, and no exposure. Baseline testing was begun in June 1980, 1 month after the major eruption, and follow-up testing continued on an annual basis through 1984; 88% of the loggers have been tested at least 3 times. Analysis of lung function data showed that a significant, exposure-related decline in FEV1 occurred during the first year after the eruption. The decline was short-lived, however, and by 1984 the differences between exposure groups were no longer significant. Self-reported symptoms of cough, phlegm, and wheeze showed a similar pattern. No ash-related changes were seen in chest roentgenograms taken in 1980 and in 1984. Our findings are consistent with the hypothesis that the inhaled ash caused mucus hypersecretion and/or airway inflammation that reversed when the exposure levels decreased. The ash levels to which the loggers were exposed were low compared with permissible occupational levels for nuisance dusts, but generally higher than the total suspended particulate levels permissible in ambient air.

  14. CO2 flood tests on whole core samples of the Mt. Simon sandstone, Illinois Basin

    SciTech Connect (OSTI)

    O'Connor, William K.; Rush, Gilbert E.

    2005-09-01

    Geological sequestration of CO2, whether by enhanced oil recovery (EOR), coal-bed methane (CBM) recovery, or saline aquifer injection is a promising near-term sequestration methodology. While tremendous experience exists for EOR, and CBM recovery has been demonstrated in existing fields, saline aquifer injection studies have only recently been initiated. Studies evaluating the availability of saline aquifers suitable for CO2 injection show great potential, however, the long-term fate of the CO2 injected into these ancient aqueous systems is still uncertain. For the subject study, a series of laboratory-scale CO2 flood tests were conducted on whole core samples of the Mt. Simon sandstone from the Illinois Basin. By conducting these tests on whole core samples rather than crushed core, an evaluation of the impact of the CO2 flood on the rock mechanics properties as well as the geochemistry of the core and brine solution has been possible. This empirical data could provide a valuable resource for the validation of reservoir models under development for these engineered CO2 systems.

  15. Assignment 4 BS4a Actuarial Science Oxford MT 2011 IX A.4 Inflation, taxation and project appraisal

    E-Print Network [OSTI]

    Winkel, Matthias

    Assignment 4 ­ BS4a Actuarial Science ­ Oxford MT 2011 IX A.4 Inflation, taxation and project are indexed by reference to the value of a retail price index with a time lag of 8 months. The retail price index value in September 1996 was Q(-8/12) = 200 and in March 1997 was Q(-2/12) = 206. The issue price

  16. Dark Matter Particle Spectroscopy at the LHC: Generalizing M(T2) to Asymmetric Event Topologies

    SciTech Connect (OSTI)

    Konar, Partha; Kong, Kyoungchul; Matchev, Konstantin T.; Park, Myeonghun; /Florida U.

    2012-04-03

    We consider SUSY-like missing energy events at hadron colliders and critically examine the common assumption that the missing energy is the result of two identical missing particles. In order to experimentally test this hypothesis, we generalize the subsystem M{sub T2} variable to the case of asymmetric event topologies, where the two SUSY decay chains terminate in different 'children' particles. In this more general approach, the endpoint M{sub T2(max)} of the M{sub T2} distribution now gives the mass {tilde M}p({tilde M}{sub c}{sup (a)}, {tilde M}{sub c}{sup (b)}) of the parent particles as a function of two input children masses {tilde M}{sub c}{sup (a)} and {tilde M}{sub c}{sup (b)}. We propose two methods for an independent determination of the individual children masses M{sub c}{sup (a)} and M{sub c}{sup (b)}. First, in the presence of upstream transverse momentum PUTM the corresponding function {tilde M}p({tilde M}{sub c}{sup (a)}, {tilde M}{sub c}{sup (b)}, P{sub UTM}) is independent of P{sub UTM} at precisely the right values of the children masses. Second, the previously discussed MT2 'kink' is now generalized to a 'ridge' on the 2-dimensional surface {tilde M}p({tilde M}{sub c}{sup (a)}, {tilde M}{sub c}{sup (b)}). As we show in several examples, quite often there is a special point along that ridge which marks the true values of the children masses. Our results allow collider experiments to probe a multi-component dark matter sector directly and without any theoretical prejudice.

  17. Uranium hydrogeochemical and stream-sediment reconnaissance of the Mt. Michelson NTMS quadrangle, Alaska

    SciTech Connect (OSTI)

    Zinkl, R.J.; Shettel, D.L. Jr.; Langfeldt, S.L.; Hardy, L.C.; D'Andrea, R.F. Jr.

    1982-04-01

    This report presents results of a Hydrogeochemical and Stream Sediment Reconnaissance (HSSR) of the Mt. Michelson NTMS quadrangle, Alaska. In addition to this abbreviated data release, more complete data are available to the public in machine-readable form. These machine-readable data, as well as quarterly or semiannual program progress reports containing further information on the HSSR program in general, or on the Los Alamos National Laboratory (LANL) portion of the program in particular, are available from DOE's Technical Library at its Grand Junction Area Office. Presented in this data release are location data, field analyses, and laboratory analyses of several different sample media. For the sake of brevity, many field site observations have not been included in this volume; these data are, however, available on the magnetic tape. Appendices A and B describe the sample media and summarize the analytical results for each medium. The data have been subdivided by one of the Los Alamos National Laboratory sorting programs of Zinkl and others (1981a) into groups of stream-sediment and lake-sediment samples. For each group which contains a sufficient number of observations, statistical tables, tables of raw data, and 1:1,000,000 scale maps of pertinent elements have been included in this report. Also included are maps showing results of multivariate statistical analyses. Information on the field and analytical procedures used by the Los Alamos National Laboratory during sample collection and analysis may be found in any HSSR data release prepared by the Laboratory and will not be included in this report.

  18. MRI of the lung using hyperpolarized He-3 at very low magnetic field (3 mT)

    E-Print Network [OSTI]

    Bidinosti, C P; Tastevin, G; Vignaud, A; Nacher, P J

    2004-01-01

    Optical pumping of He-3 produces large (hyper) nuclear-spin polarizations independent of the magnetic resonance imaging (MRI) field strength. This allows lung MRI to be performed at reduced fields with many associated benefits, such as lower tissue susceptibility gradients and decreased power absorption rates. Here we present results of 2D imaging as well as accurate 1D gas diffusion mapping of the human lung using He-3 at very low field (3 mT). Furthermore, measurements of transverse relaxation in zero applied gradient are shown to accurately track pulmonary oxygen partial pressure, opening the way for novel imaging sequences.

  19. A polymorphism in metallothionein 1A (MT1A) is associated with cadmium-related excretion of urinary beta 2?microglobulin

    SciTech Connect (OSTI)

    Lei, Lijian; Department of Epidemiology, School of Public Health, Shanxi Medical University, Shanxi ; Chang, Xiuli; Rentschler, Gerda; Tian, Liting; Zhu, Guoying; Chen, Xiao; Jin, Taiyi; Broberg, Karin

    2012-12-15

    Objectives: Cadmium (Cd) toxicity of the kidney varies between individuals despite similar exposure levels. In humans Cd is mainly bound to metallothioneins (MT), which scavenge its toxic effects. Here we analyzed whether polymorphisms in MT genes MT1A and MT2A influence Cd-related kidney damage. Methods: In a cross-sectional study N = 512 volunteers were selected from three areas in South-Eastern China, which to varying degree were Cd-polluted from a smelter (control area [median Cd in urine U-Cd = 2.67 ?g/L], moderately [U-Cd = 4.23 ?g/L] and highly [U-Cd = 9.13 ?g/L] polluted areas). U-Cd and blood Cd (B-Cd) concentrations were measured by graphite-furnace atomic absorption spectrometry. MT1A rs11076161 (G/A), MT2A rs10636 (G/C) and MT2A rs28366003 (A/G) were determined by Taqman assays; urinary N-Acetyl-beta-(D)-Glucosaminidase (UNAG) by spectrometry, and urinary ?2-microglobulin (UB2M) by ELISA. Results: Higher B-Cd (natural log-transformed) with increasing number of MT1A rs11076161 A-alleles was found in the highly polluted group (p-value trend = 0.033; all p-values adjusted for age, sex, and smoking). In a linear model a significant interaction between rs11076161 genotype and B-Cd was found for UNAG (p = 0.001) and UB2M concentrations (p = 0.001). Carriers of the rs11076161 AA genotype showed steeper slopes for the associations between Cd in blood and natural log-transformed UB2M (? = 1.2, 95% CI 0.72–1.6) compared to GG carriers (? = 0.30, 95% CI 0.15–0.45). Also for UNAG (natural log-transformed) carriers of the AA genotype had steeper slopes (? = 0.55, 95% CI 0.27–0.84) compared to GG carriers (? = 0.018, 95% CI ? 0.79–0.11). Conclusions: MT1A rs11076161 was associated with B-Cd concentrations and Cd-induced kidney toxicity at high exposure levels. -- Highlights: ? Cadmium is toxic to the kidney but the susceptibility differs between individuals. ? The toxic effect of cadmium is scavenged by metallothioneins. ? A common variant of metallothionein 1A was genotyped in 512 cadmium exposed humans. ? Variant carriers of this polymorphism showed more kidney damage from cadmium. ? The frequency of these variants needs to be taken into account in risk assessment.

  20. LOCA simulation in the national research universal reactor program: postirradiation examination results for the third materials experiment (MT-3)

    SciTech Connect (OSTI)

    Rausch, W.N.

    1984-04-01

    A series of in-reactor experiments were conducted using full-length 32-rod pressurized water reactor (PWR) fuel bundles as part of the Loss-of-Coolant Accident (LOCA) Simulation Program. The third materials experiment (MT-3) was the sixth in the series of thermal-hydraulic and materials deformation/rutpure experiments conducted in the National Research Universal (NRU) reactor, Chalk River, Ontario, Canada. The main objective of the experiment was to evaluate ballooning and rupture during active two-phase cooling in the temperature range from 1400 to 1500/sup 0/F (1030 to 1090 K). The 12 test rods in the center of the 32-rod bundle were initially pressurized to 550 psi (3.8 MPa) to insure rupture in the correct temperature range. All 12 of the rods ruptured, with an average peak bundle strain of approx. 55%. The UKAEA also funded destructive postirradiation examination (PIE) of several of the ruptured rods from the MT-3 experiment. This report describes the work performed and presents the PIE results. Information obtained during the PIE included cladding thickness measurements metallography, and particle size analysis of the cracked and broken fuel pellets.

  1. Searches for supersymmetry using the MT2 variable in hadronic events produced in pp collisions at 8 TeV

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Khachatryan, V.

    2015-05-15

    Searches for supersymmetry (SUSY) are performed using a sample of hadronic events produced in 8 TeV pp collisions at the CERN LHC. The searches are based on the MT2 variable, which is a measure of the transverse momentum imbalance in an event. The data were collected with the CMS detector and correspond to an integrated luminosity of 19.5 fb?¹. Two related searches are performed. The first is an inclusive search based on signal regions defined by the value of the MT2 variable, the hadronic energy in the event, the jet multiplicity, and the number of jets identified as originating frommore »bottom quarks. The second is a search for a mass peak corresponding to a Higgs boson decaying to a bottom quark-antiquark pair, where the Higgs boson is produced as a decay product of a SUSY particle. For both searches, the principal backgrounds are evaluated with data control samples. No significant excess over the expected number of background events is observed, and exclusion limits on various SUSY models are derived.« less

  2. Soil Science Society of America Journal This work was presented at the 12th North American Forest Soils Conference, Whitefish, MT, 1620

    E-Print Network [OSTI]

    Martin, Timothy

    Soils Conference, Whitefish, MT, 16­20 June 2013, in the Production Systems for Biomass and Bioenergy silvicultural practices used, and when combined with suitable site preparation techniques and the deployment fourfold higher aboveground pine biomass than the C treatment (7.7 Mg ha-1); the untreated CF (17.9 Mg ha-1

  3. NEAFS Y-mtDNA Workshop (Butler and Coble) November 1, 2006 http://www.cstl.nist.gov/biotech/strbase/training.htm 1

    E-Print Network [OSTI]

    NEAFS Y-mtDNA Workshop (Butler and Coble) November 1, 2006 http://www.cstl.nist.gov/biotech textbook (now in its 2nd Edition) · STRBase website: http://www.cstl.nist.gov/biotech/strbase/ · Family: wife Terilynne and 6 children · Hobbies: reading and writing http://www.cstl.nist.gov/biotech

  4. Comment on ``A modified leapfrog scheme for shallow water equations'' by Wen-Yih Sun and Oliver M.T. Sun

    E-Print Network [OSTI]

    Williams, Paul

    Commentary Comment on ``A modified leapfrog scheme for shallow water equations'' by Wen-Yih Sun and Oliver M.T. Sun Paul D. Williams Department of Meteorology, University of Reading, UK a r t i c l e i n f integration of the shallow-water equa- tions using the leapfrog time-stepping scheme [Sun Wen-Yih, Sun Oliver

  5. Improvements in the M-T relation and mass function and the measured Omega_m through clusters evolution

    E-Print Network [OSTI]

    A. Del Popolo

    2003-09-05

    In this paper, I revisit the constraints obtained by several authors (Reichart et al. 1999; Eke et al. 1998; Henry 2000) on the estimated values of Omega_m, n and sigma_8 in the light of recent theoretical developments: 1) new theoretical mass functions (Sheth & Tormen 1999, Sheth, Mo & Tormen 1999, Del Popolo 2002b); 2) a more accurate mass-temperature relation, also determined for arbitrary Omega_m and Omega_{\\Lambda} (Voit 2000, Pierpaoli et al. 2001, Del Popolo 2002a). Firstly, using the quoted improvements, I re-derive an expression for the X-ray Luminosity Function (XLF), similarly to Reichart et al. (1999), and then I get some constraints to \\Omega_m and n, by using the ROSAT BCS and EMSS samples and maximum-likelihood analysis. Then I re-derive the X-ray Temperature Function (XTF), similarly to Henry (2000) and Eke et al. (1999), re-obtaining the constraints on Omega_m, n, sigma_8. Both in the case of the XLF and XTF, the changes in the mass function and M-T relation produces an increase in Omega_m of \\simeq 20% and similar results in sigma_8 and n.

  6. A Complete Solution Classification and Unified Algorithmic Treatment for the One- and Two-Step Asymmetric S-Transverse Mass (MT2) Event Scale Statistic

    E-Print Network [OSTI]

    Joel W. Walker

    2014-08-29

    The MT2 or "s-transverse mass" statistic was developed to associate a parent mass scale to a missing transverse energy signature, given that escaping particles are generally expected in pairs, while collider experiments are sensitive to just a single transverse momentum vector sum. This document focuses on the generalized extension of that statistic to asymmetric one- and two-step decay chains, with arbitrary child particle masses and upstream missing transverse momentum. It provides a unified theoretical formulation, complete solution classification, taxonomy of critical points, and technical algorithmic prescription for treatment of the MT2 event scale. An implementation of the described algorithm is available for download, and is also a deployable component of the author's selection cut software package AEACuS (Algorithmic Event Arbiter and Cut Selector). Appendices address combinatoric event assembly, algorithm validation, and a complete pseudocode.

  7. Probing the Mechanism of the Mycobacterium tuberculosis [beta]-Ketoacyl-Acyl Carrier Protein Synthase III mtFabH: Factors Influencing Catalysis and Substrate Specificity

    SciTech Connect (OSTI)

    Brown, Alistair K.; Sridharan, Sudharsan; Kremer, Laurent; Lindenberg, Sandra; Dover, Lynn G.; Sacchettini, James C.; Besra, Gurdyal S.

    2010-11-30

    Mycolic acids are the dominant feature of the Mycobacterium tuberculosis cell wall. These {alpha}-alkyl, {beta}-hydroxy fatty acids are formed by the condensation of two fatty acids, a long meromycolic acid and a shorter C{sub 24}-C{sub 26} fatty acid. The component fatty acids are produced via a combination of type I and II fatty acid synthases (FAS) with FAS-I products being elongated by FAS-II toward meromycolic acids. The {beta}-ketoacyl-acyl carrier protein (ACP) synthase III encoded by mtfabH (mtFabH) links FAS-I and FAS-II, catalyzing the condensation of FAS-I-derived acyl-CoAs with malonyl-acyl carrier protein (ACP). The acyl-CoA chain length specificity of mtFabH was assessed in vitro; the enzyme extended longer, physiologically relevant acyl-CoA primers when paired with AcpM, its natural partner, than with Escherichia coli ACP. The ability of the enzyme to use E. coli ACP suggests that a similar mode of binding is likely with both ACPs, yet it is clear that unique factors inherent to AcpM modulate the substrate specificity of mtFabH. Mutation of proposed key mtFabH residues was used to define their catalytic roles. Substitution of supposed acyl-CoA binding residues reduced transacylation, with double substitutions totally abrogating activity. Mutation of Arg{sup 46} revealed its more critical role in malonyl-AcpM decarboxylation than in the acyl-CoA binding role. Interestingly, this effect was suppressed intragenically by Arg{sup 161} {yields} Ala substitution. Our structural studies suggested that His{sup 258}, previously implicated in malonyl-ACP decarboxylation, also acts as an anchor point for a network of water molecules that we propose promotes deprotonation and transacylation of Cys{sup 122}.

  8. Structural and tectonic implications of pre-Mt. Simon strata -- or a lack of such -- in the western part of the Illinois basin

    SciTech Connect (OSTI)

    Sargent, M.L. (Illinois State Geological Survey, Champaign, IL (United States))

    1993-03-01

    The discovery of a pre-Mt. Simon lithic arenite (arkose) in southwestern Ohio has lead to reevaluation of many basement tests in the region. Several boreholes in adjacent states have been reexamined by others and are now believed to bottom in the Middle Run Formation. Seismic-reflection sections in western Ohio and Indiana have indicated pre-Mt. Simon basins filled with layered rocks that are interpreted to be Middle Run, however, the pre-Mt. Simon basins and east of Illinois. Samples from Illinois basement tests were reexamined to determine whether they had encountered similar strata. All reported crystalline-basement tests in Illinois show diagnostic igneous textures and mineralogical associations. Coarsely crystalline samples in cores show intergrown subhedral grains of quartz, microcline, and sodic plagioclase. Medium-crystalline rocks in cuttings samples show numerous examples of micrographic intergrowths of quartz and K-feldspar. This texture cannot be authigenically grown in a sediment and probably could not have survived a single cycle of erosion and deposition. Aphanitic rocks show porphyritic and spherulitic textures that are distinctly igneous and would be destroyed by weathering. Substantial relief on the Precambrian crystalline surface in Illinois is postulated for major structural features like the LaSalle Anticlinorium, the Sparta Shelf, the Ste. Genevieve Fault zone, etc. Paleotopographic relief up to 300 m (1,000 feet) is documented from drilling on the western flank of the basin.

  9. Littleton Mt. Washington

    E-Print Network [OSTI]

    Pringle, James "Jamie"

    · Across New Hampshire IN TRAVELING NEW HAMPSHIRE HIGHWAYS AND BACK ROADS, you'll discover New Hampshire, Keene Nashua Community College, Nashua BAE Systems of N.A., Nashua University of New Hampshire, Durham Great Bay Community College, Portsmouth New Hampshire Space grant Consortium 1 23 4 56 7 8 9 10 11 12 13

  10. versity (MT Assistant o

    E-Print Network [OSTI]

    discipline um vitae, s and contac electronica cmsearch@ 2011, an trategic Fac nitiative ates are en rsities

  11. Quantifying Uncertainty in Chemical Systems Modeling M.T. Reagan1, H.N. Najm1, P.P. Pebay1, O.M. Knio2 and R.G. Ghanem2

    E-Print Network [OSTI]

    Frey, Pascal

    Quantifying Uncertainty in Chemical Systems Modeling M.T. Reagan1, H.N. Najm1, P.P. P´ebay1, O The Johns Hopkins University, Baltimore, MD 21218, USA Abstract. This study compares two techniques of Chemical Kinetics 1. Introduction Chemical kinetics computations require the specification of a number

  12. A new A&P Food Market in Mt. Kisco, New York, is enjoying annual energy cost savings of nearly $130,000 with the installation of an integrated microturbine power system

    E-Print Network [OSTI]

    Pennycook, Steve

    Background A new A&P Food Market in Mt. Kisco, New York, is enjoying annual energy cost savings, heating and power solutions, was installed in 2005 in the 57,000- square-foot facility. The New York supermarket was the first U.S. customer to take delivery of the new system. The PureComfort system is designed

  13. Visualizing the Surface Infrastructure Used to Move 2 MtCO2/year from the Dakota Gasification Company to the Weyburn CO2 Enhanced Oil Recovery Project: Version of July 1, 2009

    SciTech Connect (OSTI)

    Dooley, James J.

    2009-07-09

    Google Earth Pro has been employed to create an interactive flyover of the world’s largest operational carbon dioxide capture and storage project. The visualization focuses on the transport and storage of 2 MtCO2/year which is captured from the Dakota Gasification Facility (Beula, North Dakota) and transported 205 miles and injected into the Weyburn oil field in Southeastern Saskatchewan.

  14. Study on the reduction of atmospheric mercury emissions from mine waste enriched soils through native grass cover in the Mt. Amiata region of Italy

    SciTech Connect (OSTI)

    Fantozzi, L., E-mail: l.fantozzi@iia.cnr.it [CNR-Institute of Atmospheric Pollution Research, c/o: UNICAL-Polifunzionale, 87036 Rende (Italy); Ferrara, R., E-mail: romano.ferrara@pi.ibf.cnr.it [CNR-Institute of Biophysics, San Cataldo Research Area, Via G. Moruzzi 1, 56124 Pisa (Italy); Dini, F., E-mail: fdiniprotisti@gmail.com [University of Pisa, Department of Biology, Via A. Volta 4, 56126 Pisa (Italy); Tamburello, L., E-mail: ltamburello@biologia.unipi.it [University of Pisa, Department of Biology, Via Derna 1, I-56126 Pisa (Italy); Pirrone, N.; Sprovieri, F. [CNR-Institute of Atmospheric Pollution Research, c/o: UNICAL-Polifunzionale, 87036 Rende (Italy)] [CNR-Institute of Atmospheric Pollution Research, c/o: UNICAL-Polifunzionale, 87036 Rende (Italy)

    2013-08-15

    Atmospheric mercury emissions from mine-waste enriched soils were measured in order to compare the mercury fluxes of bare soils with those from other soils covered by native grasses. Our research was conducted near Mt. Amiata in central Italy, an area that was one of the largest and most productive mining centers in Europe up into the 1980s. To determine in situ mercury emissions, we used a Plexiglas flux chamber connected to a portable mercury analyzer (Lumex RA-915+). This allowed us to detect, in real time, the mercury vapor in the air, and to correlate this with the meteorological parameters that we examined (solar radiation, soil temperature, and humidity). The highest mercury flux values (8000 ng m{sup ?2} h{sup ?1}) were observed on bare soils during the hours of maximum insulation, while lower values (250 ng m{sup ?2} h{sup ?1}) were observed on soils covered by native grasses. Our results indicate that two main environmental variables affect mercury emission: solar radiation intensity and soil temperature. The presence of native vegetation, which can shield soil surfaces from incident light, reduced mercury emissions, a result that we attribute to a drop in the efficiency of mercury photoreduction processes rather than to decreases in soil temperature. This finding is consistent with decreases in mercury flux values down to 3500 ng m{sup ?2} h{sup ?1}, which occurred under cloudy conditions despite high soil temperatures. Moreover, when the soil temperature was 28 °C and the vegetation was removed from the experimental site, mercury emissions increased almost four-fold. This increase occurred almost immediately after the grasses were cut, and was approximately eight-fold after 20 h. Thus, this study demonstrates that enhancing wild vegetation cover could be an inexpensive and effective approach in fostering a natural, self-renewing reduction of mercury emissions from mercury-contaminated soils. -- Highlights: ? Mercury air/surface exchange from grass covered soil is different from bare soil. ? Light enhances mercury emissions and is the main parameter driving the process. ? The presence of wild vegetation covering the soil reduces mercury emission. ? Vegetative covers could be a solution to reduce atmospheric mercury pollution.

  15. Pukaha Mt Bruce Capability Building Project

    E-Print Network [OSTI]

    : _________________________________________________ ISO ID: ____________________________ Department: ___________________________________________ Office Reports Applicant Certification Access privileges are issued to staff members with the understanding

  16. Why Mt Etna? C. Doglioni,1

    E-Print Network [OSTI]

    between these two approaches: (i) evo- lution and dip of the foreland mono- cline are used in Doglioni et

  17. Mt Ranier Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | Open

  18. Marysville Mt Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma,InformationIllinois:Martin, Michigan:

  19. Babb, MT Natural Gas Export to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease

  20. Babb, MT Natural Gas Export to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease0 0 20 0 0 122 1996-2014

  1. Havre, MT Natural Gas Exports to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan Feb Mar Apr MayYear Jan FebMississippi119,456 111,949HOW TO

  2. Havre, MT Natural Gas Exports to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan Feb Mar Apr MayYear Jan FebMississippi119,456 111,949HOW TO2,504

  3. Controlled Source Audio MT | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (Utility Company)| Open(Evans, EtInformation Control of Well KS-8 inSource

  4. Mt Peak Utility | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to: navigation, searchsource HistoryCharleston,Peak Utility Jump to:

  5. Mt Poso Cogeneration | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to: navigation, searchsource HistoryCharleston,Peak Utility Jump to:Poso

  6. Category:Billings, MT | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButte County,Camilla, Georgia: Energy014771°,North Dakota:Bonn |NJ

  7. 2.8 Mt5.6 Mt Turning over a New Leaf

    E-Print Network [OSTI]

    to local communities and other stewards of our natural resources. Forest Trends analyzes strategic market natural ecosystems, which provide life-sustaining processes, by promoting incentives stemming from a broad 19th Street, NW 4th floor Washington, DC 20036 info@ecosystemmarketplace.com www

  8. Vertical Electrical Sounding Configurations At Mt Princeton Hot Springs

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, NewArkansas:Standards Jump to:VernonWisconsin:Labs LLP

  9. Integrated Dense Array and Transect MT Surveying at Dixie Valley...

    Open Energy Info (EERE)

    Dixie Valley Geothermal Area, Nevada- Structural Controls, Hydrothermal Alteration and Deep Fluid Sources Jump to: navigation, search OpenEI Reference LibraryAdd to library...

  10. Improving Machine Tool Interoperability Using Standardized Interface Protocols: MT Connect

    E-Print Network [OSTI]

    Vijayaraghavan, Athulan; Sobel, Will; Fox, Armando; Dornfeld, David; Warndorf, Paul

    2008-01-01

    23-26, 2008 IMPROVING MACHINE TOOL INTEROPERABILITY USINGMTConnect TM data from a machine tool for process planningpotential of improved machine-tool interoperability through

  11. Compound and Elemental Analysis At Mt St Helens Area (Shevenell...

    Open Energy Info (EERE)

    Date Usefulness not indicated DOE-funding Unknown References L. Shevenell, F. Goff (2000) Temporal Geochemical Variations In Volatile Emissions From Mount St Helens, Usa,...

  12. Northwest Distributed/Community Wind Workgroup Meeting- MT

    Broader source: Energy.gov [DOE]

    The Northwest Wind Resource and Action Center, which is partially funded by the U.S. Department of Energy, will facilitate a workgroup meeting for stakeholders involved in the distributed and...

  13. Thermal Gradient Holes At Mt Princeton Hot Springs Geothermal...

    Open Energy Info (EERE)

    the area References J. Held, F. Henderson (2012) New developments in Colorado geothermal energy projects Additional References Retrieved from "http:en.openei.orgw...

  14. Deriving Semantic Knowledge from Descriptive Texts using an MT System

    E-Print Network [OSTI]

    Spirtes, Peter

    , instantiating concepts in an upper model for the electric power domain. In an extension of the basic system, we statements for entry into the Ontology Works electrical power factbase [9]. The system was extended to allow and textual description for a model of the North­ west electric power grid [10]. A set of texts were written

  15. Improving Machine Tool Interoperability Using Standardized Interface Protocols: MT Connect

    E-Print Network [OSTI]

    Vijayaraghavan, Athulan; Sobel, Will; Fox, Armando; Dornfeld, David; Warndorf, Paul

    2008-01-01

    interoperability enabled by MTConnect TM can provide the mechanism for process and system monitoring and optimization with respect to energy and

  16. Analysis of borehole temperature data from the Mt. Princeton...

    Open Energy Info (EERE)

    Colorado (abstract only) Author P. Morgan Conference AAPG Rocky Mountain Meeting; Salt Lake County, Utah; 10811 Published AAPG Rocky Mountain Meeting, 2013 DOI Not Provided...

  17. Urdu Localization Project: Lexicon, MT and TTS (ULP) Sarmad HUSSAIN

    E-Print Network [OSTI]

    , Pakistan sarmad.hussain@nu.edu.pk Abstract Pakistan has a population of 140 million speaking more than 56, also the national language of Pakistan. Being a developing population, Pakistani people need access-10% of these people are familiar with English. Therefore, Government of Pakistan has embarked on a project which

  18. School of Mathematics and Statistics MT5824 Topics in Groups

    E-Print Network [OSTI]

    St Andrews, University of

    .] Deduce that GpG (G). Use the previous question to show that (G) = GpG. Show that G can be generated

  19. Compound and Elemental Analysis At Mt St Helens Area (Shevenell...

    Open Energy Info (EERE)

    not indicated DOE-funding Unknown References Lisa Shevenell, Fraser Goff (1995) Evolution Of Hydrothermal Waters At Mount St Helens, Washington, Usa Additional References...

  20. Todd J. Kaiser Montana State University, Bozeman, MT

    E-Print Network [OSTI]

    Kaiser, Todd J.

    and Actuators Workshop, pp 85-88, June 2000. E. Selected Invited Presentations · "Solar Cell Basics for Teachers Square Cambridge, MA 02139 C. Selected Journal Publications · "A Wireless Sensor Interrogation Design for Passive Resonant Frequency Sensors using Frequency Modulation Spectroscopy," Brian Peterson, Andrew Olson

  1. DLT -AN INDUSTRIAL R & D PROJECT FOR MULTILINGUAL MT

    E-Print Network [OSTI]

    by an ophthalmo-logist towards the end of the nineteenth century) is not usually considered a respectable object-term development and maintenance of a complex translation and world knowledge system is a task that can only

  2. *MT 4S1SGOO ^ Ris-M-2672

    E-Print Network [OSTI]

    . APPLICATIONS OF NEUTRON RADIOGRAPHY 14 7.1. Nuclear industry 16 Nuclear fuel 16 General 23 7.2. Industrial of application of neutron radiography in industry and the nuclear field. October 1987 Risø National Laboratory 26 Real-time 26 Engine fluids 26 7.3. Non-industrial applications 27 Biology, medicine and dentistry

  3. Extrinsic Evaluation of Patent MT: Review and Commentary

    E-Print Network [OSTI]

    Oard, Doug

    ." The National Institute of Informatics (NII) Testbeds and Community for Information Access Research (NTCIR these tasks into three broad categories (expressed here using specific examples of languages and sources College Park, MD 20742 USA oard@umd.edu Noriko Kando National Institute of Informatics Tokyo, Japan kando

  4. Seismicity induced by seasonal groundwater recharge at Mt. Hood, Oregon

    E-Print Network [OSTI]

    Manga, Michael

    and narrow-width pore-fluid pressure signal. Time delays between this seasonal groundwater recharge-fluid pressure fraction, PP/P0W0.1, of the applied near-surface pore-fluid pressure perturbation, P0W0.1 MPa Elsevier B.V. All rights reserved. Keywords: hydroseismicity; groundwater; pore-£uid pressure; permeability

  5. Statistical Theory MT 2009 Problems 1: Solution sketches

    E-Print Network [OSTI]

    Reinert, Gesine

    =1 Xi and put T = X 1 n-1 n i=1(Xi - X)2 . Show that T is an ancillary statistic. What does this say the distribution of T does not depend on neither; it is an ancillary statistic. Thus a t-test based on exponential of A is independent of (so A is an ancillary statistic). c) Show that any value in the interval x(n) - 1 2 , x(1) + 1

  6. Self Potential At Mt Princeton Hot Springs Geothermal Area (Richards...

    Open Energy Info (EERE)

    2008 - 2010 Usefulness useful DOE-funding Unknown Exploration Basis Determination of groundwater flux patterns Notes Researchers collected 2700 SP measurements. Equilibrium...

  7. DC Resistivity Survey (Wenner Array) At Mt Princeton Hot Springs...

    Open Energy Info (EERE)

    2008 - 2010 Usefulness useful DOE-funding Unknown Exploration Basis Determination of groundwater flux patterns Notes Researchers measured DC resistivity and produced 12 resistivity...

  8. Graduate Student Handbook The Graduate Group in Molecular Toxicology (MT)

    E-Print Network [OSTI]

    (Stat 2, 20) 1 Semester Mathematics Differential and Integral Calculus (Math 1A) 1 Semester Chemistry and Microbial Biology, Chemistry, Public Health, Environmental Science and Policy Management, Integrative in the core courses. Research units (NST 299) are not calculated into this GPA requirement. To receive

  9. 2323 University Way, Suite 239 Bozeman, MT 59717

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    is accomplished through exposure and penetration of the contaminated material by superheated steam for an adequate through autoclaving. After sterilization in a steam autoclave, these materials are considered non amount of time. Because steam will not penetrate a sealed plastic autoclave bag, bags containing dry

  10. MSc Programme In the programme, MT engineers acquire a thorough

    E-Print Network [OSTI]

    Langendoen, Koen

    . Research within the Marine Technology group focuses on ship hydromechanics, shipbuilding and design, safety of new ones. · Ship Production is concerned in particular with the management of shipbuilding projects

  11. Ground Gravity Survey At Marysville Mt Area (Blackwell) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainableGlynn County,Solar Jump to:ResourcesGriggsOpen| OpenAl., 1979)Al., 2003)

  12. Ground Magnetics At Marysville Mt Area (Blackwell) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainableGlynn County,Solar JumpInformation Crump's Hot Springs Area (DOE

  13. File:INL-geothermal-mt.pdf | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New Pages Recent Changes AllApschem.pdfgasp 03.pdf JumpGerak.pdf Jump to:hi.pdf Jump

  14. Data Acquisition-Manipulation At Marysville Mt Area (Blackwell) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (UtilityInstruments Inc JumpIowa: EnergyDarkEnergy InformationEnergy

  15. Mt Carmel Public Utility Co | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | Open Energy(RECP)

  16. RAPID/Roadmap/1-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevada <UtahMontanasource History

  17. RAPID/Roadmap/11-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevada <UtahMontanasourceWA-a <aa <

  18. RAPID/Roadmap/11-MT-b | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevada <UtahMontanasourceWA-a <aa <b <

  19. RAPID/Roadmap/13-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ | Roadmap Jumpf <ID-a

  20. RAPID/Roadmap/14-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ | RoadmapCO-c

  1. RAPID/Roadmap/14-MT-e | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ | RoadmapCO-ce < RAPID‎

  2. RAPID/Roadmap/17-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ |a < RAPID‎CA-aHI-aa

  3. RAPID/Roadmap/18-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ |a <-AK-b <CO-bad

  4. RAPID/Roadmap/19-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎f < RAPID‎ |

  5. RAPID/Roadmap/3-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎f <CA-aa <dFD-pca <

  6. RAPID/Roadmap/3-MT-b | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎f <CA-aa <dFD-pca <b

  7. RAPID/Roadmap/6-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎fRAPID/Roadmap/6-CO-bac <a

  8. RAPID/Roadmap/6-MT-b | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎fRAPID/Roadmap/6-CO-bac <ab

  9. RAPID/Roadmap/6-MT-c | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎fRAPID/Roadmap/6-CO-bac

  10. RAPID/Roadmap/7-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa <NV-b < RAPID‎ |ahn

  11. Whitlash, MT Natural Gas Imports by Pipeline from Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan3Additions (Million CubicYearSeparation9,195 7,707 7,062 6,571

  12. 2007-mt-elbert | netl.doe.gov

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPONe β+-Decay EvaluatedThe6 Feature2007 News7

  13. Port of Morgan, MT Natural Gas Exports to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan FebCubic Feet)PricePricethethePrice4)402 424 265 257485,026

  14. Port of Morgan, MT Natural Gas Exports to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan FebCubic Feet)PricePricethethePrice4)402 424 265

  15. Babb, MT Liquefied Natural Gas Exports (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease Separation A4.98

  16. City of Mt Pleasant, Iowa (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler, Iowa (UtilityIowa Phone Number: (319) 385-2121 Website:

  17. City of Mt Pleasant, Tennessee (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler, Iowa (UtilityIowa Phone Number: (319) 385-2121

  18. Village of Mt Horeb, Wisconsin (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop IncIowa (Utility Company)Idaho) Jump to:NewVermont (Utility Company) Jump

  19. RAPID/Roadmap/11-MT-c | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report Url

  20. RAPID/Roadmap/17-MT-b | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-ad

  1. RAPID/Roadmap/3-MT-c | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-a <CA-a <HI-ec <

  2. RAPID/Roadmap/3-MT-d | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-a <CA-a <HI-ec <d

  3. RAPID/Roadmap/3-MT-e | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-a <CA-a <HI-ec <de

  4. RAPID/Roadmap/3-MT-f | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-a <CA-a <HI-ec <def

  5. RAPID/Roadmap/5-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-a <CA-ae

  6. RAPID/Roadmap/6-MT-e | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-ab < RAPID‎ |c <dee

  7. RAPID/Roadmap/9-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-abFD-a <aAK-a

  8. Mt. Wachusett Community College Makes Huge Investment in Wind Power |

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nAand DOEDepartment of Energy Motion to Mr. Daniel CohenJUN 1 1 20133

  9. BWXT Pantex, LLC Route 726, Mt. Athos Road

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia National 1 PAGE 1 OF2Guidance to the RevisedEIS 9B.

  10. BWXT Pantex, LLC Route 726, Mt. Athos Road

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia National 1 PAGE 1 OF2Guidance to the RevisedEIS 9B.I I .

  11. BWXT Pantex, LLC Route 726, Mt. Athos Road

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia National 1 PAGE 1 OF2Guidance to the RevisedEIS 9B.I I

  12. BWXT Pantex, LLC Route 726, Mt. Athos Road

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia National 1 PAGE 1 OF2Guidance to the RevisedEIS 9B.I I

  13. BWXT Pantex, LLC Route 726, Mt. Athos Road

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia National 1 PAGE 1 OF2Guidance to the RevisedEIS 9B.I II

  14. BWXT Pantex, LLC Route 726, Mt. Athos Road Lynchburg, V

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia National 1 PAGE 1 OF2Guidance to the RevisedEIS 9B.I IIV

  15. Field Mapping At Marysville Mt Area (Blackwell) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePowerEdisto ElectricMonaster And Coolbaugh, 2007)

  16. Magnetotelluric Techniques At Mt Princeton Hot Springs Geothermal Area

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenarios Towards 2050EnermarGeneration Jump to:New(Held & Henderson,

  17. Mt Wheeler Power, Inc (Utah) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to: navigation, searchsource HistoryCharleston,Peak Utility Jump

  18. Mt. Edgecumbe High School Wind Project | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to: navigation, searchsource HistoryCharleston,Peak Utility JumpEdgecumbe

  19. 3D Mt Resistivity Imaging For Geothermal Resource Assessment And

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop IncIowa (UtilityMichigan)data bookresult9) Jump to:13:28-07:00

  20. Key China Energy Statistics 2011

    E-Print Network [OSTI]

    Levine, Mark

    2013-01-01

    kerosene, diesel oil, fuel oil, LPG, refinery gas and otherMt Diesel Oil Mt Fuel Oil Mt LPG Mt Refinery Gas Mt Other

  1. Key China Energy Statistics 2012

    E-Print Network [OSTI]

    Levine, Mark

    2013-01-01

    kerosene, diesel oil, fuel oil, LPG, refinery gas and otherMt Diesel Oil Mt Fuel Oil Mt LPG Mt Refinery Gas Mt Other

  2. C;\\u U ,RAI Y Mt. PI OJ 1, Mich.

    E-Print Network [OSTI]

    /3 cup salad dressing 2 ta blespoons chopped onion 1 tea poon salt Pepper to season Salad greens Dram he Oll off he tuna Brea. the tuna in 0 large pieces. ix every- thing together except he salad greens. Pu the una-po a 0 salad in the refrigera or until cold Serve he una-potato salad on the so ad greens #12

  3. Www.deq.mt.gov/MFS/LawRules/Circular2 | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEtGeorgia:Illinois:Wizard Power

  4. Thermal And-Or Near Infrared At Marysville Mt Area (Blackwell) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013) |InformationThe2009) | Open Energy2008) | Open EnergyEnergy

  5. Thermal And-Or Near Infrared At Mt Ranier Area (Frank, 1995) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013) |InformationThe2009) | Open Energy2008) | Open

  6. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    incentivizing unbridled water extraction, this situation ledhow much individual water extraction practices impact theexcessive groundwater extraction Water Scarcity and Ac- cess

  7. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    103–113 18 Freeman, Strategic Management: A StakeholderFreeman, R. Edward. Strategic Management: A StakeholderCommander. 39,40 Freeman Strategic Management: A Stakeholder

  8. In-situ aircraft observations of the 2000 Mt. Hekla volcanic cloud: Composition and chemical

    E-Print Network [OSTI]

    Lee, Shan-Hu

    to sulfuric acid was broadly consistent with changing OH concentrations at the time of the vernal equinox

  9. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    of Fire and Invasive Alien Plant Management Practices in of Fire and Invasive Alien Plant Management Practices in of Fire and Invasive Alien Plant Management Practices in 

  10. mtDNA Variation in Caste Populations of Andhra Pradesh, India.

    E-Print Network [OSTI]

    Bamshad, Michael; Fraley, Alexander E.; Crawford, Michael H.; Cann, Rebecca L.; Busi, Baskara R.; Naidu, J. M.; Jorde, Lynn B.

    1996-01-01

    Various anthropological analyses have documented extensive regional variation among populations on the subcontinent of India using morphological, protein, blood group, and nuclear DNA polymorphisms. These patterns are the product of complex...

  11. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    11 California State Water Resources Control Board, The WaterSan Diego Regional Water Quality Control Board, “Watershed73 California State Water Resources Control Board, The Water

  12. Montana Weed Control Association Annual Meeting. January 11th 2011, Great Falls, MT.

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    Seed movement by vehicles: how many, how far, and under what conditions? Movement of seeds by vehicles is generally thought to increase the spread of invasive plant species, but few studies have vehicles when driven a range of distances on different surfaces (asphalt, unpaved and offroad) under wet

  13. LETTERS TO THE EDITOR Two years ago at the MT Summit held in Hakone, Japan,

    E-Print Network [OSTI]

    is based on the Arthur D. Little (ADL) study of the production experience with the Georgetown Russian). Finally, it was suggested that there were better ways for the federal government to spend these R & D

  14. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    Libecap, Gary D. Rescuing Water Markets: Lessons from OwensWest and Its Disappearing Water, Revised Edition. Revised. (Thomas. “Estimating Water Requirements for Firefighting

  15. A Demonstration Project for Capturing Geothermal Energy from Mine Waters beneath Butte, MT

    Broader source: Energy.gov [DOE]

    Project objectives. Demonstrate performance of heat pumps in a large HVAC system in a heating-dominated climate.

  16. Istituzioni di Matematiche I (CH-CI-MT) ________________________________V_IIIo_foglio_di_esercizi______________________*

    E-Print Network [OSTI]

    Candilera, Maurizio

    flesso e B quello a tangente parallela all'asse delle ordinate, si determini il* * volume del solido ottenuto dalla rotazione della regione finita di piano compresa tra l'arco AB, la retta OA e l* *'asse delle ascisse, di un intero giro attorno alla asse medesimo. ESERCIZIO 4. Si disegni nel piano

  17. The CAFE experiment : a joint seismic and MT investigation of the Cascadia subduction system

    E-Print Network [OSTI]

    McGary, R. Shane

    2013-01-01

    In this thesis we present results from inversion of data using dense arrays of collocated seismic and magnetotelluric stations located in the Cascadia subduction zone region of central Washington. In the migrated seismic ...

  18. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    1: Climate Change and the Energy Crisis. (2008). Getting Our1: Climate Change and the Energy Crisis. (2008). http://

  19. IDBA-MT: De novo Assembler for Metatranscriptomic Data generated from Next-Generating Sequencing Technology

    E-Print Network [OSTI]

    Chin, Francis Y.L.

    Parkinson Biochemistry & Molecular and Medical Genetics University of Toronto, 27 King's College Circle, Toronto, Ontario, Canada M5S 1A1 Email: john.parkinson@utoronto.ca Telephone: 416-813-5746 Francis Y of microbes in human gut was found to be related to common diseases such as Inflammatory Bowel Disease (IBD

  20. Hawaiian Hot-spot Swell Structure from Seafloor MT Sounding Steven Constable

    E-Print Network [OSTI]

    Key, Kerry

    on the hotspot (Cough, 1979; Detrick and Crough, 1978); (ii) compositional underplating of depleted mantle

  1. NEAFS Y-mtDNA Workshop (Butler and Coble) November 1, 2006

    E-Print Network [OSTI]

    Human Genome The Human Genome Nuclear DNA 3 billion bp High Power Of Discrimination Mitochondrial DNA 16 11 12 13 14 15 16 17 18 19 20 21 22 X Y Sex- chromosomes Autosomes 3.2 billion bp Nuclear DNA), and use a genetic code for amino acids different that the nuclear DNA. · New mitochondria are formed

  2. The Investigation on Fibrous Veins and Their Host from Mt. Ida, Ouachita Mountains, Arkansas 

    E-Print Network [OSTI]

    Chung, Jae Won

    2004-09-30

    , the ?13C and ?18O compositions of the host lithologies range from 1.5 to -3.0 per mil and 7.5 to -14.0 per mil (VPDB), respectively. By contrast, the ?18O composition of the veins is remarkably constant (-13.5 per mil) among veins of starkly different...

  3. Compound Nouns in a Unification-Based MT System Pierrette Bouillon Katharina Boesefeldt

    E-Print Network [OSTI]

    of the texts involved in order to translate compounds efficientlyand correctly. We first give a brief overview

  4. MT3522 Knot Theory Solutions 4 1. (i) The closure of 2

    E-Print Network [OSTI]

    Walker, Grant

    molecule. O 1 :unknot O 2 :split unlink or opposite matched M 1 :pos trefoil M 2 :pos Hopf link or 3 #12; or opposite O 1 O 2 :pos trefoil :pos Hopf link :unknot or matched M 2 :split unlink M 1 opposite 2 or O 1 O

  5. m)T7(T^/f^\\ \\ / Riso-R-430 The Geochemistry

    E-Print Network [OSTI]

    -LEVEL HASTE 22 Uranium 31 Neptunium 35 Plutonium 38 Americium 41 CHEMISTRY OF TECHNETIUM 44 ADSORPTION, stability-diagrams for the transuranium elements from uranium to americium under diverse conditions have GROUNDWATER COMPOSITIONS 7 COMPLEX CHEMISTRY 12 CRITICAL ANION CONCENTRATION IN GROUND WATERS 17 THE CHEMISTRY

  6. mtAndroid Aplicao Mvel Android de Apoio a Percursos Pedestres Outdoor

    E-Print Network [OSTI]

    da Silva, Alberto Rodrigues

    às capacidades de um Smartphone e das tecnologias disponíveis no meio envolvente. Além das principais técnicas e tecnologias de localização existentes

  7. On the stability of the Earth's radiative energy balance: Response to the Mt. Pinatubo eruption

    E-Print Network [OSTI]

    short wave energy into the outgoing long wave energy stream, it is of interest to understand how and why

  8. Building America Case Study: Lancaster County Career and Technology Center Green Home 3, Mt Joy, Pennsylvania

    SciTech Connect (OSTI)

    Not Available

    2014-12-01

    Transitioning from standard light frame to a thermal mass wall system in a high performance home will require a higher level of design integration with the mechanical systems. The much higher mass in the ICF wall influences heat transfer through the wall and affects how the heating and cooling system responds to changing outdoor conditions. This is even more important for efficient, low-load homes with efficient heat pump systems in colder climates where the heating and cooling peak loads are significantly different from standard construction.This report analyzes a range of design features and component performance estimates in an effort to select practical, cost-effective solutions for high performance homes in a cold climate. Of primary interest is the influence of the ICF walls on developing an effective air sealing strategy and selecting an appropriate heating and cooling equipment type and capacity. The domestic water heating system is analyzed for costs and savings to investigate options for higher efficiency electric water heating. A method to ensure mechanical ventilation air flows is examined. The final solution package includes high-R mass walls, very low infiltration rates, multi-stage heat pump heating, solar thermal domestic hot water system, and energy recovery ventilation. This solution package can be used for homes to exceed 2012 International Energy Conservation Code requirements throughout all climate zones and achieves the DOE Challenge Home certification.

  9. J. Geomag. Geoelectr., 49, 727-737, 1997 Introduction to MT.,.DIW2 Special Issue

    E-Print Network [OSTI]

    Jones, Alan G.

    line, with 300 m dipoles. In-line electric fields only were recorded on this line. The four full 5, Downing Street, Cambridge, England, CB2 9EQ 1. Introduction The second Magnetotelluric Data Interpretation

  10. ATH 1300/1600 M-MT MAGLEV HYBRID TURBOMOLECULAR PUMPS

    E-Print Network [OSTI]

    Wager, John F.

    ). In Europe, AVTF-France headquarters and three of its subsidiaries, Alcatel Hochvakuumtechnik (Germany, Research and development, High energy physics, Space simulation, Accelerators. ADVANTAGES: High throughput of experience in the field of turbomolecular pump design. In order to ensure the best possible performance

  11. AMTA 2006 Overview of Statistical MT 1 An Overview of Statistical

    E-Print Network [OSTI]

    Smith, David A.

    , govt documents (~30M words) ... Serbian KhmerChechen {... ... { Bible/Koran/ Book of Mormon/ Dianetics

  12. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    of R: A Language and Environment for Statistical ComputingR Development Core Team. R: A language and environment for statistical

  13. Manual for Development of a Transient MODFLOW/MT3DMS/SEAWAT Simulation

    E-Print Network [OSTI]

    Barrash, Warren

    . The results of this model run are compared to the observed data in an effort to correctly identify...................................................................................... 19 Creating River Coverage........................................................................................... 20 Creating the River Arcs

  14. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    rain gardens, soil amendments, permeable pavements, and infiltration devices could offer potential solutions to problems of water

  15. Bern, 28. Januar 2015 / MT Weisung: Wechselkurs fr das Budgetieren neuer EU Grants

    E-Print Network [OSTI]

    Sola, Rolf Haenni

    Forschung Prof. Dr. Christian Leumann Vizerektor Hochschulstrasse 4 CH-3012 Bern Tel. +41 031 631 43 55 Christian.leumann@rektorat.unibe.ch www.rektorat.unibe.ch Vizerektorat, Hochschulstrasse 4, CH-3012 Bern #12;

  16. Bern, 28 January 2015 / MT Directive: Exchange rate for budgeting new EU grants

    E-Print Network [OSTI]

    Richner, Heinz

    -Rectorate Research Prof. Dr. Christian Leumann Vizerektor Hochschulstrasse 4 CH-3012 Bern Tel. +41 031 631 43 55 Christian.leumann@rektorat.unibe.ch www.rektorat.unibe.ch Vice-Rectorate, Hochschulstrasse 4, CH-3012 Bern

  17. Altered Mitochondrial Retrograde Signaling in Response to mtDNA Depletion or a Ketogenic Diet

    E-Print Network [OSTI]

    Selfridge, Jennifer Eva

    2012-12-31

    pathways and general neuronal dependence on anaerobic metabolism. Specifically, the electron transport chain function is reduced both systemically and in brains of individuals affected by Alzheimer's disease, amyotrophic lateral sclerosis, and Parkinson...

  18. Testing neural mechanisms that may underlie spatiotopic processing in area MT

    E-Print Network [OSTI]

    Ong, Wei Song

    2012-01-01

    Hence if motion processing occurs in retinal coordinates, wethat show motion processing do so in retinal coordinates, wein retinal coordinates, can have spatiotopic processing. In

  19. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    various small-scale water suppliers, the San Diego CountyDepartment, major water suppliers for the region (e.g. Mounttries to work with suppliers Acknowledges that infrastruc-

  20. NAT'L INST. OF STAND & TECH \\lllDb 2527MT

    E-Print Network [OSTI]

    standards used in science, engineering, manufacturing, commerce, industry, and education with the standards of Standards and Technology Technology Administration U.S. Department of Commerce PUBLICATIONS jri5A CENTENNIAL #12;rhe National Institute of Standards and Technology was established in 1988 by Congress

  1. Overview of physical oceanographic measurements taken during the Mt. Mitchell Cruise to the ROPME Sea Area

    SciTech Connect (OSTI)

    Reynolds, R.M.

    1993-03-31

    The ROPME Sea Area (RSA) is one of the most important commercial waterways in the world. However, the number of direct oceanographic observations is small. An international program to study the effect of the Iraqi oil spill on the environment was sponsored by the ROPME, the Intergovernmental Oceanographic Commission, and the National Oceanic and Atmospheric Administration (NOAA).

  2. Geothermal Literature Review At Mt Ranier Area (Frank, 1995) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainable UrbanKentucky:Bore Technologies IncEnergy2002) | Open1957)

  3. Geothermometry At Mt St Helens Area (Shevenell & Goff, 1995) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainable UrbanKentucky:Bore TechnologiesAssessmentOpenFishOpen Energy1976)

  4. Direct-Current Resistivity Survey At Marysville Mt Area (Blackwell) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (UtilityInstrumentsArea (DOE GTP) JumpDillard(Kauahikaua &

  5. Direct-Current Resistivity Survey At Mt Princeton Hot Springs Area

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (UtilityInstrumentsArea (DOE GTP) JumpDillard(Kauahikaua &1986) |

  6. Self Potential At Mt St Helens Area (Bedrosian, Et Al., 2007) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/ColoradoRemsenburg-Speonk,SageScheucoSedco Hills,Information HualalaiInformation St

  7. Isotopic Analysis At Mt St Helens Area (Shevenell & Goff, 1995) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas: Energy ResourcesOrder at 8, 13RenewableIremInformation Goff, Et Al.,2002) |

  8. Isotopic Analysis At Mt St Helens Area (Shevenell & Goff, 2000) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas: Energy ResourcesOrder at 8, 13RenewableIremInformation Goff, Et Al.,2002)

  9. Refraction Survey At Mt Princeton Hot Springs Geothermal Area (Lamb, Et

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/WaterEnergyRedfield1989) Jump to:| Open1979) |Al., 2012) |

  10. Whitlash, MT Natural Gas Pipeline Imports From Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan3Additions (Million CubicYearSeparation9,195 7,707

  11. Babb, MT Natural Gas Pipeline Exports to Canada (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames City of",6,1,"OmahaEnergy Sources and End Uses Topics: Energy Sources and End Uses End-UseA 6 JWithdrawalsYear JanYear Jan Feb Mar

  12. Babb, MT Natural Gas Pipeline Imports From Canada (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames City of",6,1,"OmahaEnergy Sources and End Uses Topics: Energy Sources and End Uses End-UseA 6 JWithdrawalsYear JanYear JanYear Jan

  13. Havre, MT Natural Gas Pipeline Exports to Canada (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear, ElectricRhodeFeet)Cubic Feet)Cubic Feet) Year JanYear

  14. Port of Del Bonita, MT Natural Gas Imports by Pipeline from Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan FebCubic Feet)PricePricethethePrice4)402 424 265 257 241 200

  15. Port of Del Bonita, MT Natural Gas Pipeline Imports From Canada (Million

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan FebCubic Feet)PricePricethethePrice4)402 424 265 257

  16. Port of Morgan, MT Natural Gas Pipeline Exports to Canada (Million Cubic

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan FebCubic Feet)PricePricethethePrice4)402 424

  17. Port of Morgan, MT Natural Gas Pipeline Imports From Canada (Million Cubic

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan FebCubic Feet)PricePricethethePrice4)402 424ThousandFeet)

  18. Havre, MT Natural Gas Pipeline Exports to Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969CentralWells

  19. Babb, MT Natural Gas Pipeline Exports to Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969 1.979Coal4 Arizona - NaturalYear JanProfile

  20. Babb, MT Natural Gas Pipeline Imports From Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969 1.979Coal4 Arizona - NaturalYear JanProfileDecade Year-0 Year-1

  1. Babb, MT Liquefied Natural Gas Exports Price (Dollars per Thousand Cubic

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease Separation

  2. Babb, MT Liquefied Natural Gas Exports to Canada (Dollars per Thousand

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease SeparationCubic

  3. Babb, MT Liquefied Natural Gas Exports to Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease SeparationCubicMillion

  4. Babb, MT Natural Gas Pipeline Exports to Canada (Dollars per Thousand Cubic

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease0 0 20 0 0 122

  5. Babb, MT Natural Gas Pipeline Exports to Canada (Dollars per Thousand Cubic

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease0 0 20 0 0 122Feet) Year

  6. Babb, MT Natural Gas Pipeline Exports to Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease0 0 20 0 0 122Feet)

  7. Babb, MT Natural Gas Pipeline Imports From Canada (Dollars per Thousand

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease0 0 20 0 0 122Feet)Cubic

  8. Babb, MT Natural Gas Pipeline Imports From Canada (Dollars per Thousand

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease0 0 20 0 0

  9. Babb, MT Natural Gas Pipeline Imports From Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease0 0 20 0 0Year Jan Feb Mar

  10. Havre, MT Natural Gas Pipeline Exports to Canada (Dollars per Thousand

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan Feb Mar Apr MayYear Jan FebMississippi119,456 111,949HOW

  11. Havre, MT Natural Gas Pipeline Exports to Canada (Dollars per Thousand

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan Feb Mar Apr MayYear Jan FebMississippi119,456 111,949HOWCubic

  12. Havre, MT Natural Gas Pipeline Exports to Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan Feb Mar Apr MayYear Jan FebMississippi119,456 111,949HOWCubicYear

  13. Havre, MT Natural Gas Pipeline Imports From Canada (Dollars per Thousand

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan Feb Mar Apr MayYear Jan FebMississippi119,456

  14. Self Potential At Mt Princeton Hot Springs Geothermal Area (Richards, Et

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-bRenewableSMUDSectional Modelof the

  15. Thermal Gradient Holes At Mt Princeton Hot Springs Geothermal Area (Held &

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJ AutomationTexas/WindEnergyOpen EnergyInformation Mcgee

  16. Water Sampling At Mt Princeton Hot Springs Geothermal Area (Olson &

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJThinWarsaw, Poland: EnergyPageEnergyDellechaie, 1976) | Open Energy

  17. Water Sampling At Mt Ranier Area (Frank, 1995) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJThinWarsaw, Poland: EnergyPageEnergyDellechaie, 1976) | Open

  18. Water Sampling At Mt St Helens Area (Shevenell & Goff, 1995) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJThinWarsaw, Poland: EnergyPageEnergyDellechaie, 1976) |

  19. 3-D Density Model Of Mt Etna Volcano (Southern Italy) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAand Dalton Jump to:Wylie,Information Skord, Et15: Leases7

  20. A Large Self-Potential Anomaly And Its Changes On The Quiet Mt Fuji, Japan

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAand Dalton JumpProgram | OpenEnergyEvaluation | Open

  1. A Portable Elf-Mt System For Shallow Resistivity Sounding | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAand Dalton JumpProgram | OpenEnergyEvaluation |Island,ApproachSteam|

  2. Analysis of borehole temperature data from the Mt. Princeton Hot Springs

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAandAmminex A S Jump to: navigation,Inof Ground Source Heat Pumparea,

  3. Aeromagnetic Survey At Mt Princeton Hot Springs Geothermal Area (Case, Et

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAand DaltonSolar EnergyAerodyn Energiesysteme GmbHOpenAl., 1984) | Open

  4. Aeromagnetic Survey At Mt St Helens Area (Towle, 1983) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAand DaltonSolar EnergyAerodyn Energiesysteme GmbHOpenAl., 1984) |

  5. Controlled Source Audio MT At Mccoy Geothermal Area (DOE GTP) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (Utility Company)| Open(Evans, EtInformation Control of Well KS-8 in

  6. DC Resistivity Survey (Wenner Array) At Mt Princeton Hot Springs Geothermal

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (UtilityInstruments Inc Jump to: navigation,(RECP) in Jump to: navigation,Area

  7. ASC_RdMap7.7.55.10_MT.indd

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReporteeo | National Nuclear Securityhr |oft5 DecemberACADEMICon

  8. Geothermometry At Mt Princeton Hot Springs Geothermal Area (Pearl, Et Al.,

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource History View New Pages RecentPlant < Geothermal(Redirected

  9. Ground Gravity Survey At Mt Princeton Hot Springs Geothermal Area (Case, Et

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource History View New PagesInformationEnergy Information 2)EnergyAl., 1984) |

  10. Integrated Dense Array and Transect MT Surveying at Dixie Valley Geothermal

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource History View NewGuam:on OpeneiAlbanian Centre for EnergyTorcuato Di TellaIntech

  11. Compound and Elemental Analysis At Mt St Helens Area (Shevenell & Goff,

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower Ventures JumpCommercial Jump(Thompson, 1985) | Open1995) | Open Energy

  12. Compound and Elemental Analysis At Mt St Helens Area (Shevenell & Goff,

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower Ventures JumpCommercial Jump(Thompson, 1985) | Open1995) | Open

  13. Controlled Source Audio MT At Cove Fort Area - Liquid (Combs 2006) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower Ventures JumpCommercialRenewableGlobal L P Jump to: navigation,Energy

  14. Controlled Source Audio MT At Pilgrim Hot Springs Area (DOE GTP) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower Ventures JumpCommercialRenewableGlobal L P Jump to:

  15. Controlled Source Audio MT At Roosevelt Hot Springs Area (Combs 2006) |

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower Ventures JumpCommercialRenewableGlobal L P Jump to:Open Energy

  16. DC Resistivity Survey (Dipole-Dipole Array) At Mt Princeton Hot Springs

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower VenturesInformation9) Wind Farm JumpAlum|Cyclone PowerD1

  17. Building America Case Study: Lancaster County Career and Technology Center Green Home 3, Mt Joy, Pennsylvania

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l De p u t y A s s i s t a n t S e c r e t a r y J uF EERE

  18. EM SSAB NATIONAL CHAIRS MEETING Deer Creek State Park, Mt. Sterling, Ohio

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum Based|DepartmentStatementof EnergyQuality AssuranceTop Line8,26,SeptemberEM

  19. Basin Play State(s) Production Reserves Williston Bakken ND, MT, SD

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming Dry NaturalPrices1 Table 1.101 (Million Short6RU Ntight oil plays:

  20. Port of Del Bonita, MT Natural Gas Pipeline Imports From Canada (Dollars

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year Janper Thousand Cubic

  1. Port of Del Bonita, MT Natural Gas Pipeline Imports From Canada (Dollars

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year Janper Thousand Cubicper

  2. Port of Del Bonita, MT Natural Gas Pipeline Imports From Canada (Million

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year Janper Thousand

  3. Port of Del Bonita, MT Natural Gas Pipeline Imports From Canada (Million

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year Janper ThousandCubic

  4. Port of Morgan, MT Natural Gas Pipeline Exports to Canada (Dollars per

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year Janper

  5. Port of Morgan, MT Natural Gas Pipeline Exports to Canada (Dollars per

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year JanperThousand Cubic

  6. Port of Morgan, MT Natural Gas Pipeline Exports to Canada (Million Cubic

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year JanperThousand

  7. Port of Morgan, MT Natural Gas Pipeline Exports to Canada (Million Cubic

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year JanperThousandFeet)

  8. Port of Morgan, MT Natural Gas Pipeline Imports From Canada (Dollars per

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year

  9. Port of Morgan, MT Natural Gas Pipeline Imports From Canada (Dollars per

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) YearThousand Cubic Feet)

  10. Port of Morgan, MT Natural Gas Pipeline Imports From Canada (Million Cubic

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) YearThousand Cubic

  11. Port of Morgan, MT Natural Gas Pipeline Imports From Canada (Million Cubic

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) YearThousand CubicFeet)

  12. Whitlash, MT Natural Gas Pipeline Imports From Canada (Dollars per Thousand

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal,Demand Module of6,090 7,163 10,532 14,881 23,209DecadeFeet)0 0 1 1Cubic

  13. Whitlash, MT Natural Gas Pipeline Imports From Canada (Dollars per Thousand

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal,Demand Module of6,090 7,163 10,532 14,881 23,209DecadeFeet)0 0 1

  14. Whitlash, MT Natural Gas Pipeline Imports From Canada (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal,Demand Module of6,090 7,163 10,532 14,881 23,209DecadeFeet)0 0 1Decade

  15. Whitlash, MT Natural Gas Pipeline Imports From Canada (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal,Demand Module of6,090 7,163 10,532 14,881 23,209DecadeFeet)0 0

  16. Assessment of China's Energy-Saving and Emission-Reduction Accomplishments and Opportunities During the 11th Five Year Plan

    E-Print Network [OSTI]

    Levine, Mark D.

    2010-01-01

    calcium carbide, coking, cement, coal, plate glass, pulp andcarbide 2 Mt Coking 80 Mt Cement 250 Mt Coal mining (

  17. Montana/Geothermal | Open Energy Information

    Open Energy Info (EERE)

    14-MT-b: MPDES Permit 14-MT-c: Underground Injection Control Permit 14-MT-d: 401 Water Quality Certification 14-MT-e: Groundwater Pollution Control System 15-MT-a: Air...

  18. Universite d'Orleans Premier semestre, annee 2006/2007 Departement de Mathematiques Licence Physique-Chimie MT21

    E-Print Network [OSTI]

    d'Orléans, Université

    , = bvm0 , = cw forment une base orthonorm´ee de R3. (d) On donne A = (1, 3, 4). D´eterminer les coordonn

  19. A new deep branch of eurasian mtDNA macrohaplogroup M reveals additional complexity regarding the settlement of Madagascar

    E-Print Network [OSTI]

    Ricaut, Francois-X.; Razafindrazaka, Harilanto; Cox, Murray P.; Dugoujon, Jean-M.; Guitard, Evelyne; Sambo, Clement; Mormina, Maru; Mirazon-Lahr, Marta; Ludes, Bertrand; Crubezy, Eric

    2009-12-14

    highlanders (n = 266). Complete mitochondrial DNA genome sequences reveal several unresolved lineages, and a new, deep branch of the out-of-Africa founder clade M has been identified. This new haplogroup, M23, has a limited global distribution...

  20. Structural Studies and Evaluation of Inhibitors of Mycobacterium tuberculosis H37Rv Shikimate Dehydrogenase (MtSDH) 

    E-Print Network [OSTI]

    Lalgondar, Mallikarjun

    2014-03-21

    - (trifluoromethyl)phenyl)- 2H-tetrazol-2- yl)butanenitrile 8 EN:T5232146 1-(1H-benzo[d]imidazol-2- yl)-3-(3,4- dichlorophenyl)urea 11 EN:T5690368 2-(1,1-dioxido-2H- naphtho[1,8-cd]isothiazol- 2-yl)-N-(5-methylthiazol-2- yl)acetamide 6 2...

  1. Reply to the discussion of: "Carbonatites in a subduction system: The Pleistocene alvikites from Mt. Vulture (Southern Italy)" by

    E-Print Network [OSTI]

    Pisa, Via S.Maria 53, I-56126 Pisa, Italy b Istituto di Geoscienze e Georisorse, C.N.R., Via Moruzzi 1, I-56124 Pisa, Italy c Dipartimento di Scienze della Terra, Università "La Sapienza", P.le A. Moro 5 Georisorse, C.N.R., Via Moruzzi 1, I-56124 Pisa, Italy. Tel.: +39 50 2215700; fax: +39 50 2215800. E

  2. Sources and photochemistry of volatile organic compounds in the remote atmosphere of western China: results from the Mt. Waliguan Observatory

    E-Print Network [OSTI]

    2013-01-01

    sites a . Waliguan b Species Ethane Propane n-butanei-butane n-pentane i-pentane Ethene Propene Isoprene EthyneNorth b CO Ethane Propane n-butane i-butane Ethyne Benzene

  3. VA VT CT RI MT WY CO ID UT OR NV CA AZ NM WA TN WV NC AR OK

    Broader source: Energy.gov (indexed) [DOE]

    2 1 Locations of Smart Grid Demonstration and Large-Scale Energy Storage Projects NH 32 Awards Support Projects in 24 States 6 11 MA...

  4. Learning of Linear Ordering Problems and its Application to J-E Patent Translation in NTCIR-9 PatentMT

    E-Print Network [OSTI]

    Duh, Kevin

    PROBLEM BASED REORDERING Tromble and Eisner (2009) [16] proposed a word-level re- ordering model based

  5. A Trans-Amazonian Screening of mtDNA Reveals Deep Intraspecific Divergence in Forest Birds and Suggests a

    E-Print Network [OSTI]

    Karubian, Jordan

    and prioritizing taxa for species discovery. Citation: Mila´ B, Tavares ES, Mun~oz Saldan~a A, Karubian J, Smith TB

  6. Peptide aptamers as new tools to modulate clathrin-mediated internalisation - inhibition of MT1-MMP internalisation

    E-Print Network [OSTI]

    Wickramasinghe, Rochana D; Ko Ferrigno, Paul; Roghi, Christian

    2010-07-23

    . Oncogene 1999, 18:4357-4363. 12. Bottger A, Bottger V, Sparks A, Liu WL, Howard SF, Lane DP: Design of a synthetic Mdm2-binding mini protein that activates the p53 response in vivo. Curr Biol 1997, 7:860-869. 13. Nouvion AL, Thibaut J, Lohez OD, Venet S...

  7. Hillebrand 1 A comparison of tectonics of the eastern Sierra Nevada, CA in the vicinity of Mt. Whitney and

    E-Print Network [OSTI]

    Shuster, David L.

    thought to show a low Cenozoic geothermal gradient of ~6 °C/km, but (U-T)/He data from House et al. (1997) shows that a moderate geotherm of ~25 °C/km is required for their age-elevation profile. Brady et al

  8. 4 p-p.S.DEPARTI\\.IE:MT OF AGRICULTURE '%CY!P. 0,EOX 245.BERKELEY. CALIFORNIA 94701

    E-Print Network [OSTI]

    -pine, rosegum eucalypbs, and Amm- manit eucalyptus. Sevexd other species have good reforestatio.7 Callitvis end- Iicheri (calcauata) + 176.1 Eucalyptus deglupl-a -+ 176.1 Eucalyptus p n d i s + 176-pine Callitvis endkicheri (calcarataj rosegum eucalyptus ficalyptus gandis fill ex Majiden Ammmanit eucdyptus

  9. This article was downloaded by:[Mt Sinai School of Medicine, Levy Library] On: 21 March 2008

    E-Print Network [OSTI]

    Shelley, Michael

    reproduction, re-distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form ) Liquid crystal drops dispersed in a continuous phase of silicone oil are generated with a narrow

  10. LIZARD CHEMICAL SIGNALS Around Mt Isa. A Guide to the Flora and Fauna, Pair-bonding in chameleons. Naturwissenschaften

    E-Print Network [OSTI]

    Macedonia, Joseph

    and Coloration in the JamaicanRadiation of Anolis Lizards JOSEPH M. MACEDONIA,~,~SARAHJAMES,' W. WITTLE

  11. Predicting and validating the tracking of a Volcanic Ash Cloud during the 2006 Eruption of Mt. Augustine Volcano

    SciTech Connect (OSTI)

    Webley, Peter W.; Atkinson, D.; Collins, Richard L.; Dean, K.; Fochesatto, J.; Sassen, Kenneth; Cahill, Catherine F.; Prata, A.; Flynn, Connor J.; Mizutani, K.

    2008-11-01

    On 11 January 2006, Mount Augustine volcano in southern Alaska began erupting after 20-year repose. The Anchorage Forecast Office of the National Weather Service (NWS) issued an advisory on 28 January for Kodiak City. On 31 January, Alaska Airlines cancelled all flights to and from Anchorage after multiple advisories from the NWS for Anchorage and the surrounding region. The Alaska Volcano Observatory (AVO) had reported the onset of the continuous eruption. AVO monitors the approximately 100 active volcanoes in the Northern Pacific. Ash clouds from these volcanoes can cause serious damage to an aircraft and pose a serious threat to the local communities, and to transcontinental air traffic throughout the Arctic and sub-Arctic region. Within AVO, a dispersion model has been developed to track the dispersion of volcanic ash clouds. The model, Puff, was used operational by AVO during the Augustine eruptive period. Here, we examine the dispersion of a volcanic ash cloud from Mount Augustine across Alaska from 29 January through the 2 February 2006. We present the synoptic meteorology, the Puff predictions, and measurements from aerosol samplers, laser radar (or lidar) systems, and satellites. UAF aerosol samplers revealed the presence of volcanic aerosols at the surface at sites where Puff predicted the ash clouds movement. Remote sensing satellite data showed the development of the ash cloud in close proximity to the volcano and a sulfur-dioxide cloud further from the volcano consistent with the Puff predictions. Lidars showed the presence of volcanic aerosol with consistent characteristics aloft over Alaska and were capable of detecting the aerosol, even in the presence of scattered clouds and where the cloud is too thin/disperse to be detected by remote sensing satellite data. The lidar measurements revealed the different trajectories of ash consistent with the Puff predictions. Dispersion models provide a forecast of volcanic ash cloud movement that might be undetectable by any other means but are still a significant hazard. Validation is the key to assessing the accuracy of any future predictions. The study highlights the use of multiple and complementary observations used in detecting the trajectory ash cloud, both at the surface and aloft within the atmosphere.

  12. VA VT CT RI MT WY CO ID UT OR NV CA AZ NM WA TN WV NC AR OK

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About1996HowFOAShowing YouNeedofDepartment ofDeploymentDepartmentService2 1

  13. VA VT CT RI MT WY CO ID UT OR NV CA AZ NM WA TN WV NC AR OK

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About1996HowFOAShowing YouNeedofDepartment ofDeploymentDepartmentService2 1 2 1

  14. VA VT CT RI MT WY CO ID UT OR NV CA AZ NM WA TN WV NC AR OK

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About1996HowFOAShowing YouNeedofDepartment ofDeploymentDepartmentService2 1 2 1 7

  15. Key China Energy Statistics 2011

    E-Print Network [OSTI]

    Levine, Mark

    2013-01-01

    Others Total Oil Refining by Product (1985-2009) AAGR MtceProduction by Product Shares Diesel Oil Fuel Oil GasolineProducts Mt Petroleum Products Mt Crude Oil Mt Gasoline Mt

  16. FRAMES-2.0 Software System: Linking to the Groundwater Modeling System (GMS) RT3D and MT3DMS Models

    SciTech Connect (OSTI)

    Whelan, Gene; Castleton, Karl J.; Pelton, Mitch A.

    2007-08-08

    Linkages to the Groundwater Modeling System have been developed at Pacific Northwest National Laboratory to enable the Nuclear Regulatory Commission (NRC) to more realistically assess the risk to the public of radioactive contaminants at NRC-licensed sites. Common software tools presently in use are limited in that they cannot assess contaminant migration through complex natural environments. The purpose of this initiative is to provide NRC with a licensing safety-analysis tool with sufficient power, flexibility, and utility that it can serve as the primary software platform for analyzing the hazards associated with licensing actions at those “complex” sites at which the traditional tools are inappropriate. As a tool designed to realistically approximate prospective doses to the public, this initiative addresses NRC’s safety-performance goal by confirming that licensing actions do not result in undue risk to the public.

  17. The Response to Coherent Motion Coherent motion, i.e., c = 1, is usually the strongest stimulus for the MT neurons

    E-Print Network [OSTI]

    Bair, Wyeth

    for estimating the variability of the spike trains. A renewed interest in spike train variability (Softky and a sustained period. The transient period can be highly variable, but is marked by adaptation which leads. This is not accounted for by the slow, steady adaptation (presumably due to potassium currents) 1 At c = -1, the firing

  18. Investigating the Prehistory of Tungusic Peoples of Siberia and the Amur-Ussuri Region with Complete mtDNA Genome Sequences and Y-chromosomal Markers

    E-Print Network [OSTI]

    Duggan, Ana T.; Whitten, Mark; Wiebe, Victor; Crawford, Michael H.; Butthof, Anne; Spitsyn, Victor A.; Markarov, Sergey; Novgorodov, Innokentiy; Osakovsky, Vladimir; Pakendorf, Brigitte

    2013-12-12

    ]. Other Tungusic-speaking groups are settled to the southeast of the Evenks and Evens, along the lower Amur and Ussuri rivers, as well as on Sakhalin island. These include the linguistically closely related Negidal, whose North Tungusic language shows...]. Other Tungusic-speaking groups are settled to the southeast of the Evenks and Evens, along the lower Amur and Ussuri rivers, as well as on Sakhalin island. These include the linguistically closely related Negidal, whose North Tungusic language shows...

  19. Nuclear and mtDNA lineage diversity in wild and cultured Pacific lion-paw scallop, Nodipecten subnodosus (Baja California Peninsula, Mexico)

    E-Print Network [OSTI]

    Petersen, Jessica L.; Ibarra, Ana Maria; May, Bernie

    2010-01-01

    in panmixia. The proportion of variation explained betweensigni?cant proportion of the variation (3.8%) is explained

  20. Seven Bridges Genomics 625 Mt. Auburn St., Cambridge, MA 02138 www.sbgenomics.com www.twitter.com/sbgenomics team@sbgenomics.com

    E-Print Network [OSTI]

    Kay, Mark A.

    pipeline have been replaced my new versions since the original publication. This webinar will first provide min Abstract Several pipelines have emerged as solutions for SNP and Indel detection in raw next-generation sequencing (NGS) data. In addition to this "standard" variant detection performed by many pipelines, the Huge

  1. Repair of DNA double strand breaks and radiosensitivity: modulation of DNA repair and radiosensitivity by microRNA-335 and mtPAP

    E-Print Network [OSTI]

    Martin, Nathan

    2014-01-01

    DDR by at least three mechanisms: 1) maintaining ROS homeostasis, 2) mediating apoptotic signals, and 3) producing energy

  2. Full story from the April 2010 issue CENTER FOR INVASIVE PLANT MANAGEMENT | Montana State University | PO Box 173120 Bozeman, MT 59717

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    .weedcenter.org | email: weedcenter@montana.edu Seed Dispersal by Vehicles By Dr. Lisa Rew and Fredric Pollnac1 If you have ever driven your vehicle off-road or on an unpaved road surface, chances are that you have played vehicle only moved a few seeds of this invasive species a short distance, natural events such as wind

  3. Eruptive history and petrochemistry of the Bulusan volcanic complex: Implications for the hydrothermal system and volcanic hazards of Mt. Bulusan, Philippines

    SciTech Connect (OSTI)

    Delfin, F.G. Jr.; Panem, C.C.; Defant, M.J.

    1993-10-01

    Two contrasting conceptual models of the postcaldera magmatic system of the Bulusan volcanic complex are constructed on the basis of a synthesis of volcanological, petrochemical, and petrologic data. These models predict that hydrothermal convection below the complex will occur either in discrete, structurally-focused zones or over a much broader area. Both models, however, agree that hydrothermal fluids at depth will be highly acidic and volcanic-related. Future ash-fall eruptions and mudflows are likely to affect the area previously chosen for possible drilling. Such risks, combined with the expected acidic character of the hydrothermal system, argue against drilling into this system.

  4. Response of chickpea cultivars and pea to irrigation and planting rates. Grant Jackson and John Miller, Western Triangle Ag. Research Center, Conrad, MT 59425;

    E-Print Network [OSTI]

    Lawrence, Rick L.

    irrigation water demand conflicts between the two crops. In addition, little or no planting or harvest irrigation water data are summarized in Table 1. Pre-plant and post-harvest soil water was determined, and after harvest, each plot was sampled to determine soil water content. Soil water use (in inches

  5. INSTITUTE OF PHYSICS PUBLISHING MEASUREMENT SCIENCE AND TECHNOLOGY Meas. Sci. Technol. 12 (2001) 13651370 www.iop.org/Journals/mt PII: S0957-0233(01)20787-5

    E-Print Network [OSTI]

    Zhang, YuMing

    2001-01-01

    plasma arc welding achieves much deeper penetration than do all other existing arc welding processes. Because of its ability to penetrate thicker material, the control of the keyhole in plasma arc welding of the plasma cloud generated during keyhole plasma arc welding. It is found that the plasma cloud, which

  6. Phylogenetic Resolution with mtDNA D-loop vs. HVS 1: Methodological Approaches in Anthropological Genetics Utilizing Four Siberian Populations

    E-Print Network [OSTI]

    Johnson, Stephen Michael

    2013-08-31

    thank the indigenous people of the various Siberian populations that participated in this study, for without them, none of this research would be possible. Thank you, as well, to Dr. Larissa Nichols for her collaboration in collecting the Yakut...) Collected by Al ai Altai Mountains (Mendur-Sokon) 101 Dr. Michael Crawford Ev nki Evenkia 53 Dr. Michael Crawford Udegey Gvasyugi 41 Dr. Rem Sukernick Yaku (Ck) Cheriktey 34 Dr. Larissa Nichols Yak t(D ) Dalyr 66 Dr. Larissa Nichols Yakut(De) Debdirge...

  7. 554 J. Am. Chem. SOC.1993, 115, 554-562 161.12, 163.64;MS 248 (Mt +2), 246 (M+), 155, 126,84 (base peak).

    E-Print Network [OSTI]

    Jones, William D.

    peak). HRMS Calcd for C8Hl,N202Br:246.00039. Found: 246.0001. 3-[3-[[2-(Trimethylsilyl procedure as used for the synthesis of compound 32 and obtained as a colorless oil (32%) alone with 221 (8

  8. The Journal of Neuroscience, May 1994, 14(5): 2870-2892 Power Spectrum Analysis of Bursting Cells in Area MT in the

    E-Print Network [OSTI]

    Koch, Christof

    The Journal of Neuroscience, May 1994, 14(5): 2870-2892 Power Spectrum Analysis of Bursting CellsSI distribution and the power spectrum of the vast majority of bursting cells are compatible with the notion, 1992) as well as via bursting cells (Cattaneo et al., 1981 a; Bonds, 1992). We investigate the temporal

  9. The Journal of Neuroscience, May 1994, 74(5): 2870-2892 Power Spectrum Analysis of Bursting Cells in Area MT in the

    E-Print Network [OSTI]

    Newsome, William

    The Journal of Neuroscience, May 1994, 74(5): 2870-2892 Power Spectrum Analysis of Bursting Cells distribution and the power spectrum of the vast majority of bursting cells are compatible with the notion, 1992) as well as via bursting cells (Cattaneo et al., 1981 a; Bonds, 1992). We investigate the temporal

  10. Systematic implications of mtDNA sequence variation in a deer mouse species endemic to islands in the Gulf of California 

    E-Print Network [OSTI]

    Moore, Ashli Francille

    2013-02-22

    whole (Carleton 1989). Of the more than 50 species of Peromyscus, none is more widely distributed nor intensively studied than is P. maniculatus and the closely related species in the P. maniculatus species group. The monophyly of the P. maniculatus... group and the systematic relationships of its major taxa (P. maniculatus, P. polionotus, and P. melanotis) are well supported by morphologic, cytogenetic and molecular data (reviewed by Carleton 1989). Within this group, however, the phylogenetic...

  11. Submitted to MT-15, Fifteenth International Conference on Magnet Technology, Beijing, China, October 20-24, 1997. Coldmass for LHC Dipole Insertion Magnets*

    E-Print Network [OSTI]

    Ohta, Shigemi

    designed with 2-in-1 coldmasses. In the design presented here, all magnets would be 2-in-1 type coldmasses and the expected field quality in 2-in-1 dipole magnets. A unique feature of this coldmass design is the use design and allows the LHC main dipole cryostat, post, etc., to be used in these magnets. The pro- posed

  12. Multiscale computational models of transmural heterogeneities and ventricular arrhythmogenesis

    E-Print Network [OSTI]

    Flaim, Sarah N.

    2006-01-01

    G, Keating MT, Towbin JA, Beggs AH, Brink P, Wilde AAM,G, Keating MT, Towbin JA, Beggs AH, Brink P, Wilde AA,G, Keating MT, Towbin JA, Beggs AH, Brink P, Wilde AA,

  13. Key China Energy Statistics 2011

    E-Print Network [OSTI]

    Levine, Mark

    2013-01-01

    and derived fuels (coke, coke oven gas, and other cokingMt Briquettes Mt Coke Mt Coke Oven Gas Billion m 3 Other GasCoal Gas not Coke Other Total Oven Gas Coke Source Products

  14. Key China Energy Statistics 2012

    E-Print Network [OSTI]

    Levine, Mark

    2013-01-01

    and derived fuels (coke, coke oven gas, and other cokingMt Briquettes Mt Coke Mt Coke Oven Gas Billion m 3 Other GasCoal Gas not Coke Other Total Oven Gas Coke Source Products

  15. Key China Energy Statistics 2012

    E-Print Network [OSTI]

    Levine, Mark

    2013-01-01

    239 Mt World's Oil Consumption (2010) US China Japan IndiaKorea Canada Other Total World Oil Consumption: 4,028 MtTotal China Oil Consumption: 445 Mt Natural Gas Production

  16. Multiterminal Video Coding: From Theory to Application 

    E-Print Network [OSTI]

    Zhang, Yifu

    2012-10-19

    Multiterminal (MT) video coding is a practical application of the MT source coding theory. For MT source coding theory, two problems associated with achievable rate regions are well investigated into in this thesis: a new ...

  17. Optimal investment and scheduling of distributed energy resources with uncertainty in electric vehicles driving schedules

    E-Print Network [OSTI]

    Cardoso, Goncalo

    2014-01-01

    ICE – internal combustion engine, GT – gas turbine, MT –internal combustion engines, micro- and gas-turbines, fuelcombustion engines (ICE), micro- turbines (MT), gas turbines (

  18. Optimizing Distributed Energy Resources and Building Retrofits with the Strategic DER-CAModel

    E-Print Network [OSTI]

    Stadler, Michael

    2014-01-01

    internal combustion engine, GT – gas Turbine, MT – micro-combustion engines (ICE), micro turbines (MT), fuel cells (FC), and gas turbines (

  19. International Best Practices for Pre-Processing and Co-Processing Municipal Solid Waste and Sewage Sludge in the Cement Industry

    E-Print Network [OSTI]

    Hasanbeigi, Ali

    2013-01-01

    centrifuges, anaerobic digesters, and sludge dryers. In+Sludge Drier (SD) MS+MT+Anaerobic digester (AD) MS+MT+AD+DC

  20. Regional Analysis of Building Distributed Energy Costs and CO2 Abatement: A U.S. - China Comparison

    E-Print Network [OSTI]

    Mendes, Goncalo

    2014-01-01

    Energy use intensity; FC – Fuel cell; FCT - Fundação para amicroturbines (MT), fuel cells (FC) and various renewablemicroturbines (MT) and fuel cells (FC) over the last decade,

  1. Full-waveform Based Microseismic Source Mechanism Studies in the Barnett Shale: Linking Microseismicity to Reservoir Geomechanics

    E-Print Network [OSTI]

    Song, Fuxian

    2013-01-01

    Microseismic moment tensor (MT) contains important information on the reservoir and fracturing mechanisms. Difficulties arise when attempting to retrieve complete MT with conventional amplitude inversion methods if only ...

  2. Lina Galtieri: Top Mass Measurements. Aspen2010, January 17-23 1 Precision Top Mass Measurement

    E-Print Network [OSTI]

    Galtieri, Lina

    for each mt value Maximize the likelihood for the entire sample. Examples of variables used: mt after measured quantities Incoming partons parton level quantities normalization acceptance Transfer functions

  3. Key China Energy Statistics 2012

    E-Print Network [OSTI]

    Levine, Mark

    2013-01-01

    Exports : 19 Mt China's Coal Imports (2010) Indonesia Australia Vietnam Mongolia RussiaExports: 3 Mt China's Crude Oil Imports (2010) Saudi Arabia Angola Iran Oman Russia

  4. Electrical Performance of a String of Magnets Representing a Half-cell of the LHC Machine

    E-Print Network [OSTI]

    Rodriguez-Mateos, F.

    2011-01-01

    at Magnet Technology (MT-14), Tampere, Finland, June 11-16,at Magnet Technology (MT-14), Tampere, Finland, June 11- 16,

  5. Assessment of China's Energy-Saving and Emission-Reduction Accomplishments and Opportunities During the 11th Five Year Plan

    E-Print Network [OSTI]

    Levine, Mark D.

    2010-01-01

    Target Coal mining (production) Mt Cement Mt Iron-making Mtiron and steel, petroleum and petrochemicals, chemicals, electric power generation, non-ferrous metals, coal mining,

  6. Dutch 1.90% Arabic, French 4.5%

    E-Print Network [OSTI]

    translation. Many researchers criticize the MT- based CLIR approach. The reason for their criti- cism mostly

  7. This is archived information. Please visit http://maths.manchester.ac.uk for current course unit information. General Information

    E-Print Network [OSTI]

    Sidorov, Nikita

    This is archived information. Please visit http://maths.manchester.ac.uk for current course unit information. General Information Title: Algebraic Structures 1 Unit code: MATH20201 Credit rating: 10 Level: 2 Pre-requisite units: MT1101 or MT1111, MT1202 or MT1212 Co-requisite units: School

  8. Company Presentation Company Presentation

    E-Print Network [OSTI]

    Anand, Mahesh

    %) Antares Benevento, Italy (57%) * 30 % Apollo Capital Partners GmbH, Munich MT Mecatronica Limitada

  9. A new hardware-software coil positioning system for interleaved TMS/fMRI: A motor cortex stimulation study , K. Uludag1

    E-Print Network [OSTI]

    muscle (the "Motor Threshold", MT) was determined using electromyographical recordings. Interleaved TMS

  10. Proceedings of the 4th International Workshop on Computational Terminology, pages 1121, Dublin, Ireland, August 23 2014.

    E-Print Network [OSTI]

    , information techology, or aerospace. While in theory statistical MT approaches need only parallel corpora

  11. Environmental Surveillance 5-1 5. Environmental Surveillance

    E-Print Network [OSTI]

    Pennycook, Steve

    at MT1 and MT7 at the ETTP and at MT2 at ORNL; solar radiation is measured at MT2. Data from the towers. External radiation is also measured. Samples are analyzed for chemical content and for the presence of radioisotopes. Data collected from environmental surveillance activities are used to demonstrate compliance

  12. [MT91] W. Marek and M. Truszczynski. Autoepistemic logic. Journal of the ACM, 1991. [Rei80] R. Reiter. A logic for default reasoning. Arti cial Intelligence, 13:81{132, 1980.

    E-Print Network [OSTI]

    Marek, Victor W.

    (fpg)): From Corollary 6.4, it follows that it is enough to check whether p 2 CnN(I [f:Lq;:L:Lpg): To resolve: a for Lq and b for Lp. Theory I [ f:Lq;:L:Lpg can be now replaced by I0 = fLq ! a;:Lq ! :a;Lp ! b;:Lp ! :b as I[f:Lq;:L:Lpg. Finally, using Proposition 5.3 and the de#12;nition of the operator B we establish

  13. Proceedings of the 8th Brazilian Symposium in Information and Human Language Technology, pages 194198, Cuiaba, MT, Brazil, October 2426, 2011. c 2011 Sociedade Brasileira de Computac~ao

    E-Print Network [OSTI]

    composição e descrição de um corpus sobre o terremoto do Haiti em 2010 com apoio do pacote Natural Language Toolkit (NLTK). 1. Introdução O terremoto ocorrido no Haiti em 12 de janeiro de 2010 demonstra

  14. SERDP 2008 Partners in Environmental Technology Symposium and Technical Workshop December 24th Lisa J. Rew, Fred Pollnac, Tyler Brummer, Montana State University, Bozeman, MT; and Dr. Hal Balbach,

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    types of vehicles Nonindigenous plant species (NIS) are a globalscale problem that threatens decades. Vehicles are often considered key agents in the dispersal of NIS propagules, both along roads) have been observed on vehicles, but the number of studies is limited. Transporting equipment, materiel

  15. Proceedings of the 8th Brazilian Symposium in Information and Human Language Technology, pages 107114, Cuiaba, MT, Brazil, October 2426, 2011. c 2011 Sociedade Brasileira de Computac~ao

    E-Print Network [OSTI]

    Sistema para Melhorar a Usabilidade de um Gerenciador de Correio Eletr^onico Baseado em Reconhecimento de.santos@itec.ufpa.br Resumo. O tempo investido em lidar com correio eletr^onico tem crescido para a maioria dos usu´arios de interface aural ´e o que gerencia correio eletr^onico. O envio e recebimento de mensagens por meio da In

  16. ONLINE DATA SUPPLEMENT 1. Specimen voucher information and GenBank accession numbers for 63 mtSSU and 62 nuLSU sequences included in this study. Sequences in

    E-Print Network [OSTI]

    Lutzoni, François M.

    , Gilenstam 2603a (UPS) AY661673 AY661683 Cryptodiscus gloeocapsa Czech Republic, 16-02-2002 Palice (herb

  17. Proceedings of the 8th Brazilian Symposium in Information and Human Language Technology, pages 154158, Cuiaba, MT, Brazil, October 2426, 2011. c 2011 Sociedade Brasileira de Computac~ao

    E-Print Network [OSTI]

    possível a anotação fonética de pequenos ou grandes corpora por meio da aplicação de um conjunto fixo e lexicógrafos, nosso principal público-alvo, poderão de

  18. Rough order of magnitude cost estimate for immobilization of 18.2 MT of plutonium using existing facilities at the Savannah River site: alternatives 3A/5A/6A/6B/7A/9A

    SciTech Connect (OSTI)

    DiSabatino, A., LLNL

    1998-06-01

    The purpose of this Cost Estimate Report is to identify preliminary capital and operating costs for a facility to immobilize 18.2 metric tons (nominal) of plutonium using ceramic in a new facility at Savannah River Site (SRS).

  19. An ancient origin for the enigmatic Flat-Headed Frogs (Bombinatoridae: Barbourula) from the islands of Southeast Asia.

    E-Print Network [OSTI]

    Brown, Rafe M.

    2010-01-01

    published data (e.g., [18,19]). All primer details are provided in Table 1. The PCR conditions used were standard and the thermal cycle profile was as follows: 94uC (3 min; 35 cycles of 94uC (30 s), 50uC [for mt genes] or 55uC [for nuc genes] (30 s), 72uC (1... AAAAAGCTTCAAACTGGGATTAGATACCCCACTAT [96] 16SH mt 39 r GCTAGACCATKATGCAAAAGGTA [97] 12SM mt 59 R GGCAAGTCGTAACATGGTAAG [98] 16SA mt 39 r ATGTTTTTGGTAAACAGGCG [99] 16SC mt 59 R GTRGGCCTAAAAGCAGCCAC [98] 16SD mt 39 r CTCCGGTCTGAACTCAGATCACGTAG [98] CXCR4-G nuc 59 R AGCAACAGTGGAARAANGC...

  20. An Ancient Origin for the Enigmatic Flat-Headed Frogs (Bombinatoridae: Barbourula) from the Islands of Southeast Asia

    E-Print Network [OSTI]

    Blackburn, David C.; Bickford, David P.; Diesmos, Arvin C.; Iskandar, Djoko T; Brown, Rafe M.

    2010-08-09

    published data (e.g., [18,19]). All primer details are provided in Table 1. The PCR conditions used were standard and the thermal cycle profile was as follows: 94uC (3 min; 35 cycles of 94uC (30 s), 50uC [for mt genes] or 55uC [for nuc genes] (30 s), 72uC (1... AAAAAGCTTCAAACTGGGATTAGATACCCCACTAT [96] 16SH mt 39 r GCTAGACCATKATGCAAAAGGTA [97] 12SM mt 59 R GGCAAGTCGTAACATGGTAAG [98] 16SA mt 39 r ATGTTTTTGGTAAACAGGCG [99] 16SC mt 59 R GTRGGCCTAAAAGCAGCCAC [98] 16SD mt 39 r CTCCGGTCTGAACTCAGATCACGTAG [98] CXCR4-G nuc 59 R AGCAACAGTGGAARAANGC...

  1. Beyond Sweetgrass: The Life and Art of Jaune Quick-to-See Smith

    E-Print Network [OSTI]

    Murphy, Joni Lisa

    2008-10-27

    , on the Flathead Reservation of her birth. This group?s exhibitions traveled to New York and Washington D.C. with the assistance of Seneca artist Peter Jemison and Muscogee /Creek sculptor 39 Jaune Quick... 42 Peter Jemison is an artist of Seneca descent from the Huron clan. He is known for art and film. Retha Gambaro is a Muscogee-Creek sculptor who works in primarily in limestone and bronze. She also makes Native shields and medicine wheels, a skill...

  2. Intersecting Fault Trends and Crustal-Scale Fluid Pathways Below...

    Open Energy Info (EERE)

    Dixie Valley geothermal system and has under-gone 3D inversion analysis. Part of the motivation for the MT study was the observation in earlier 2D MT transect data of a...

  3. Raft River Idaho Magnetotelluric Data

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Gregory Nash

    2015-05-13

    Raw magnetotelluric (MT) data covering the geothermal system at Raft River, Idaho. The data was acquired by Quantec Geoscience. This is a zipped file containing .edi raw MT data files.

  4. China Energy Databook - Rev. 4

    E-Print Network [OSTI]

    Sinton Editor, J.E.

    2010-01-01

    TWh) Heating U (TJ) Kerosene (Mt) LPG (Mt) I.I Electricity fm3) 2. Mtce Year t K Coal* LPG Natural Gas Town Gas ¥ TotalIncludes refinery gas, LPG, various petroleum and coking

  5. Volatilizable Biogenic Organic Compounds (VBOCs) with two dimensional Gas Chromatography-Time of Flight Mass Spectrometry (GC × GC-TOFMS): sampling methods, VBOC complexity, and chromatographic retention data

    E-Print Network [OSTI]

    2012-01-01

    4 isoprene toluene- d 8 OxMT FB BFB ST MT t 1 (s) ? primarycedrene camphor linalool BFB t 1 (s) ? primary retentiontoluene-d8, bromofluorobenzene (BFB), and 1,2-DCB-d4 (1,2-

  6. Global Carbon Emissions in the Coming Decades: The Case of China

    E-Print Network [OSTI]

    Levine, Mark D.

    2008-01-01

    2006 GDP CO2 Population Source: LBNL, emissions are derivedCarbon Emissions Reductions, 2000-2020 Mt CO2 Source:CO 2 Emissions, 1950-2006 Mt CO2 USA PRC Source: Historical

  7. Cortical microtubule nucleation can organise the cytoskeleton of $Drosophila$ oocytes to define the anteroposterior axis

    E-Print Network [OSTI]

    Philipp Khuc Trong; Hélène Doerflinger; Jörn Dunkel; Daniel St. Johnston; Raymond E. Goldstein

    2015-09-26

    Many cells contain non-centrosomal arrays of microtubules (MT), but the assembly, organisation and function of these arrays are poorly understood. We present the first theoretical model for the non-centrosomal MT cytoskeleton in $Drosophila$ oocytes, in which $bicoid$ and $oskar$ mRNAs become localised to establish the anterior-posterior body axis. Constrained by experimental measurements, the model shows that a simple gradient of cortical MT nucleation is sufficient to reproduce the observed MT distribution, cytoplasmic flow patterns and localisation of $oskar$ and naive $bicoid$ mRNAs. Our simulations exclude a major role for cytoplasmic flows in localisation and reveal an organisation of the MT cytoskeleton that is more ordered than previously thought. Furthermore, modulating cortical MT nucleation induces a bifurcation in cytoskeletal organisation that accounts for the phenotypes of polarity mutants. Thus, our three-dimensional model explains many features of the MT network and highlights the importance of differential cortical MT nucleation for axis formation.

  8. Key China Energy Statistics 2011

    E-Print Network [OSTI]

    Levine, Mark

    2013-01-01

    includes crude oil, natural gas liquids, refinery feedstock,Liquid Petroleum Gas Refinery Gas Mt Mt Petroleum Other Products Natural GasLiquid Petroleum Gas Total Primary Energy Supply Refinery Gas Petroleum Other Products Natural Gas

  9. Chu, Locke, Browner Call for Comprehensive Energy Plan at Clean...

    Energy Savers [EERE]

    Solar, a Division of Capial Communications, MT PowerHouse The Garage, MT Principle Power, WA Project Green America, MD PSEG, NJ PSi, NC Quinn Gillespie & Assoc, DC Recycled...

  10. Membr. Cell Biol., 1999, Vol.13 (1), pp. 23-48 Reprints available directly from the publisher

    E-Print Network [OSTI]

    Vorobjev, Ivan

    Photocopying permitted by license only © 1999 OPA (Overseas Publishers Association) N.V. Published by license proteins dynein (towards the minus end of MT) or kinesin (towards the plus end of MT) using the ATP energy

  11. Biofuel Policies By: Rosemarie S. Gumera

    E-Print Network [OSTI]

    volume of oil palm harvest (800,000-900,000 mt instead of 1.0 million mt palm fruits/year 2. Bioethanol Renewable Fuels Alliance & Green pool commodities #12;#12;

  12. A macrodescriptor perspective of ecological attributes for the Bering and Barents Seas

    E-Print Network [OSTI]

    trophic steps and primary production fuels both the pelagic and benthic food webs. Commercial fish species biomass is greater in the EBS (7.6 mt) compared with BS (3.8 mt). Many alternate pathways exist in the BS

  13. How do healthy individuals adapt to reversed vision generated when using mirror specs? An investigation into mirror devices, adaptation to body schema and imagery ability in healthy participants 

    E-Print Network [OSTI]

    Walker, Joanna Louise

    2010-11-26

    Introduction: This study investigates a new form of Mirror Therapy (MT), the Mirror Specs. Evidence suggests that MT is a non-invasive, cost effective method of reducing pain and increasing functioning in some chronic pain ...

  14. China Energy Databook -- User Guide and Documentation, Version 7.0

    E-Print Network [OSTI]

    Fridley, Ed., David

    2008-01-01

    5B.7. Motor Vehicle Oil Consumption Table 5B.8. Length of5B.7. Motor Vehicle Oil Consumption Table 5B.8. Length ofTurnover (Mt-km) Fuel Oil Consumption Total Unit (kt) (t/Mt-

  15. Key China Energy Statistics 2011

    E-Print Network [OSTI]

    Levine, Mark

    2013-01-01

    Export Sources China's Coal Imports (2010) Import Sources Mt % of Total Indonesia Australia Viet Nam Mongolia Russia

  16. D A R G A N M . W . F R I E R S O N U N I V E R S I T Y O F W A S H I N G T O N , D E P A R T M E N T

    E-Print Network [OSTI]

    Frierson, Dargan

    over a mountain "Orographic" (mountain) clouds Mt Erebus #12;10/22/09 4 UFO clouds! Cloud cover related

  17. Canada's coal industry: full swing ahead

    SciTech Connect (OSTI)

    Stone, K. [Natural Resources Canada (Canada). Minerals and Metals Sector

    2007-03-15

    The article presents facts and figures about Canada's coal industry in 2006 including production, exports, imports, mines in operation, the Genesee 3 coal-fired generation unit, the Dodds-Roundhill Gasification Project, and new coal mine development plans. The outlook for 2007 is positive, with coal production expected to increase from 67 Mt in 2006 to 70 Mt in 2007 and exports expected to increase from 28 Mt in 2006 to 30 Mt in 2007.

  18. A primitive based approach for managing, deploying and monitoring in-building wireless sensor networks

    E-Print Network [OSTI]

    Dutta, Seemanta

    2012-01-01

    5.2 Synergy WSN MT primitives . . . . . . . . . . . . . .statistics . . . . . . . vi Synergy WSN managementbased devices Chapter 5 Synergy WSN primitives . . . . . .

  19. EIS-0092: Final Environmental Impact Statement

    Broader source: Energy.gov [DOE]

    Conversion to Coal, Holyoke Water Power Company, Mt. Tom Generating Station Unit 1 Holyoke, Hampden County, Massachusetts

  20. Climate Dynamics Observational, Theoretical and

    E-Print Network [OSTI]

    Webster, Peter J.

    of trop- ical 2mT and precipitation is greater in strong El Nino Southern Oscillation (ENSO) winters than

  1. Combined Heat and Power Systems (CHP): Capabilities (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2013-07-01

    D&MT Capabilities fact sheet that describes the NREL capabilities related to combined heat and power (CHP).

  2. Molecular Biology of the Cell Vol. 20, 29432953, June 15, 2009

    E-Print Network [OSTI]

    Hancock, William O.

    , play an inconsequential role in mediating MT bending in LLC-PK1 cells and that MT-based molecular mechanical forces control the spatial distribution of the MT array. INTRODUCTION Microtubules (MTs) are self-assemblingMolecular Biology of the Cell Vol. 20, 2943­2953, June 15, 2009 Anterograde Microtubule Transport

  3. Product Safety Recall GME EMERGEncy PoSition indicatinG Radio BEaconS (EPiRBS)

    E-Print Network [OSTI]

    identified a fault in the microprocessor of certain units that effectively shuts the beacon down. WeProduct Safety Recall GME EMERGEncy PoSition indicatinG Radio BEaconS (EPiRBS) Mt400/Mt401/Mt403 Standard Communications Pty Ltd designs and manufactures a range of Emergency Position Indicating Radio

  4. TTCC/NCC Fall Meeting October 6-8, 2009 St. Louis, MO

    E-Print Network [OSTI]

    CO2; cement is #8 of major contributors · Needed infrastructural renewal, cost of asphalt (5b-Poppoff) · Canadian GHG legislation previously mandated a 18% reduction in CO2 emissions final limit requirement...based on a clinker or cement baseline (MT/MT or BTU/MT). · Process CO2

  5. A synthesis of carbon in international trade

    E-Print Network [OSTI]

    Peters, G. P; Davis, S. J; Andrew, R.

    2012-01-01

    Russia South America Central America Eastern Europe West Asia Global Consumption Production (MtC) Exports (Russia South America Central America Eastern Europe West Asia Global Consumption Balance Production (MtC) Exports (Russia South America Central America Eastern Europe West Asia Global Consumption Balance Production (MtC) Exports (

  6. This is archived information. Please visit http://maths.manchester.ac.uk for current course unit information. General Information

    E-Print Network [OSTI]

    Sidorov, Nikita

    This is archived information. Please visit http://maths.manchester.ac.uk for current course unit information. General Information Title: Introduction to Financial Mathematics Unit code: MATH20912 Credit rating: 10 Level: 2 Pre-requisite units: MT1121 or MT1131, MT1141 (or some familiarity with basic

  7. GilesCounty,VA MonroeCounty,W

    E-Print Network [OSTI]

    Pearisburg Barney'sWall ButtMt. DoeMt. BaldKnob& Mt.LakeHotel BearCliffs WindRock WestVirginia MLBS Driving-inattheoffice-LewisHall102 (stonebuilding).Lookingnorth-eastata3DrenderingofSaltPondMountainandsurroundingvicinity. Mountain. MLBS is located at an elevation of 3800 ft atop Salt Pond Mountain on the Eastern Continen- tal Divide

  8. GilesCounty,VA MonroeCounty,W

    E-Print Network [OSTI]

    Pearisburg Barney'sWall ButtMt. DoeMt. BaldKnob& Mt.LakeHotel BearCliffs WindRock WestVirginia MLBS Driving-inattheoffice-LewisHall102 (stonebuilding). Lookingnorth-eastata3DrenderingofSaltPondMountainandsurroundingvicinity. Mountain. MLBS is located at an elevation of 3800 ft atop Salt Pond Mountain on the Eastern Continen- tal Divide

  9. Core Promoter Recognition Complex Switching in Liver Development and Regeneration

    E-Print Network [OSTI]

    D'Alessio, Joseph Anthony

    2009-01-01

    Sci 24(9): Deato, M.D. , Marr, M.T. , Sottero, T. , Inouye,Res 19: Deato, M.D. , Marr, M.T. , Sottero, T. , Inouye,1230-1239. Taatjes, D.J. , Marr, M.T. , and Tjian, R. 2004.

  10. neutronlethargyflux(n.cm2 neutron energy (MeV)

    E-Print Network [OSTI]

    FUEL (OUT OF CORE) FRESH FUEL (ON STARTUP) 10 MWD/MT (IN CORE) 10 MWD/MT (OUT OF CORE) 100 MWD/MT (IN) Pellet cracking caused by large thermal stresses in ceramic fuel Central void formation from high fuel centerline temperature Phase changes / recrystallization Changes in stoichiometry (oxygen/metal ratio

  11. Integrating Molecular Evolution and Morphology to Study the Evolutionary History of Lizardfishes and Their Allies

    E-Print Network [OSTI]

    Davis, Matthew P.

    2009-12-17

    Analyses, Hypothesis Testing, and Partitioning of RAG1 Data Set ………….................................................................. 20 Phylogenetic Analyses, Hypothesis Testing, and Data Partitioning of nucDNA and mtDNA Data Set... Sequence Analysis and Data Partitions of nucDNA and mtDNA Data Set ............................................................................................. 31 Phylogenetic Analysis of nucDNA and mtDNA Data Set and A Priori Hypothesis Tests...

  12. COORDINACION DE MATERIALES VIGENCIA: ABRIL 2013

    E-Print Network [OSTI]

    Vásquez, Carlos

    Fundición y Tratamientos Térmicos 4 SEP-DIC (SIN PARALELO) MC3610 + 130U.C OBTENCIÓN SUSTENTABLE DE-MAR (SIN PARALELO) MT3612 + 130U.C MT4732 Obtención Sustentable de Materiales 4 ABR-JUL (SIN PARALELO) MT

  13. Tumor CellDerived and Macrophage-Derived Cathepsin B Promotes Progression and Lung Metastasis of Mammary Cancer

    E-Print Network [OSTI]

    Bogyo, Matthew

    Tumor Cell­Derived and Macrophage-Derived Cathepsin B Promotes Progression and Lung Metastasis of mammary cancers compared with wild-type PyMT mice. Lung metastasis volumes were significantly reduced in PyMT;ctsb+/À , an effect that was not further enhanced in PyMT;ctsbÀ/À mice. Furthermore, lung

  14. Rotary Table Model: Oilwell A-49 1/2

    E-Print Network [OSTI]

    ,900 ft of 5½ in. drill pipe ASK System Manufacturer: Nautronix Model: 5002 (dual redundant) Type ft Normal Fuel Consumption Cruising: 33­38 mt/day DP (3 engines): 16.5­19.5 mt/day DP (2 engines): 12-value: 20; T-value: 9.3 mt Moonpool: 22 ft diameter Core Retrieving Winch National dual drum, independent

  15. ORR Environmental Monitoring Programs 7-1 7. ORR Environmental Monitoring Programs

    E-Print Network [OSTI]

    Pennycook, Steve

    radiation is also measured. Data from environmental monitoring activities are used to assess exposures and MT7 at the ETTP, and at MT2 at ORNL; solar radiation is measured at MT2 at #12;BOUND HWY 95 HWY 58, the mean value for external gamma radiation as measured at five ambient air monitoring stations on the ORR

  16. Obituary: Marshall T. Newman (1911-1994)

    E-Print Network [OSTI]

    Crawford, Michael H.

    1995-10-01

    . Science 128:476-477. Newman, M.T., and T.D. Stewart. 1959. Physical anthropology. Hdbk. Latin Am. Stud. 22:51- 68. Newman, M.T. 1960. Adaptations in the physique of American aborigines to nutritional factors. Hum. Biol. 32(3):288—313. Newman, M.T. 1960....T. 1960. Population analysis of finger and palm prints in highland and lowland Maya Indians. Am. J. Phys. Anthropol. 18(l):45-58. Newman, M.T., and F.M. Salzano. 1960. Physical anthropology. Hdbk. Latin Am. Stud. 23. Newman, M.T. 1961. Biological...

  17. Resolving the tips of the tree of life: How much mitochondrialdata doe we need?

    SciTech Connect (OSTI)

    Bonett, Ronald M.; Macey, J. Robert; Boore, Jeffrey L.; Chippindale, Paul T.

    2005-04-29

    Mitochondrial (mt) DNA sequences are used extensively to reconstruct evolutionary relationships among recently diverged animals,and have constituted the most widely used markers for species- and generic-level relationships for the last decade or more. However, most studies to date have employed relatively small portions of the mt-genome. In contrast, complete mt-genomes primarily have been used to investigate deep divergences, including several studies of the amount of mt sequence necessary to recover ancient relationships. We sequenced and analyzed 24 complete mt-genomes from a group of salamander species exhibiting divergences typical of those in many species-level studies. We present the first comprehensive investigation of the amount of mt sequence data necessary to consistently recover the mt-genome tree at this level, using parsimony and Bayesian methods. Both methods of phylogenetic analysis revealed extremely similar results. A surprising number of well supported, yet conflicting, relationships were found in trees based on fragments less than {approx}2000 nucleotides (nt), typical of the vast majority of the thousands of mt-based studies published to date. Large amounts of data (11,500+ nt) were necessary to consistently recover the whole mt-genome tree. Some relationships consistently were recovered with fragments of all sizes, but many nodes required the majority of the mt-genome to stabilize, particularly those associated with short internal branches. Although moderate amounts of data (2000-3000 nt) were adequate to recover mt-based relationships for which most nodes were congruent with the whole mt-genome tree, many thousands of nucleotides were necessary to resolve rapid bursts of evolution. Recent advances in genomics are making collection of large amounts of sequence data highly feasible, and our results provide the basis for comparative studies of other closely related groups to optimize mt sequence sampling and phylogenetic resolution at the ''tips'' of the Tree of Life.

  18. Taiwan geology Plate collision at 80 mm/yr

    E-Print Network [OSTI]

    Gung, Yuancheng

    4 #12;Meander #12;#12;#12;=/ #12;: () () () () () : : 2.0 1.51.75 1.25 1.0 #12/yr (Ratio: 1.9%, Area: 0.024%) Average sediment discharge to ocean: 384 Mt/yr --- 160 Mt/yr (544 Mt.m.s) = Sediments (ton.s-1) Sediments (ton.s-1) ÷ Density (t/m3) ÷ Area (m2) = Erosion (mm.s-1) Calculation: Stream

  19. [Vietnamese] Tiu Nghin cu

    E-Print Network [OSTI]

    Biederman, Irving

    . Nhn c mt bn sao có ch ký và ngày tháng ca t mu chp thun cho cuc nghiên cu ó. 10. C hi tùy ý chp thun

  20. EERE PowerPoint 97-2004 Template: Green Version

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    MT Gravity Radar Geology Geothermal Technologies Office 2015 Peer Review Kelly Rose, NETL Scott Urquhart, Zonge Int. Adam Schultz, OSU Paul Vincent, OSU Track 3 EGS1 This...

  1. Geothermal Resources Exploration And Assessment Around The Cove...

    Open Energy Info (EERE)

    collected various geophysical data around the geothermal field, including heat flow, gravity, MT, seismic surface wave phase and group velocity maps, seismic body wave travel...

  2. A U.S. and China Regional Analysis of Distributed Energy Resources in Buildings

    E-Print Network [OSTI]

    Feng, Wei

    2014-01-01

    they are much cheaper than fuel cells. In China, governmentengines, micro-turbines, fuel cells, and variable renewablemicro- turbines (MT), and fuel cells (FC) during the past

  3. Optimizing Distributed Energy Resources and Building Retrofits with the Strategic DER-CAModel

    E-Print Network [OSTI]

    Stadler, Michael

    2014-01-01

    PV, solar thermal, storage, fuel cells, etc. ) decisions andmicro turbines (MT), fuel cells (FC), and gas turbines (GT),micro-turbine, FC – fuel cell. Table 8: Energy storage (

  4. Social Media in the Emergency Medicine Residency Curriculum: Social Media Responses to the Residents' Perspective Article

    E-Print Network [OSTI]

    Hayes, BD; Kobner, S; Trueger, NS; Yiu, S; Lin, M

    2015-01-01

    medicine residency curriculum. Ann Emerg Med. 2014;64:396-Medicine Residency Curriculum 15. UCSF ?rst US medicalDE, Thomas PA, Hughes MT. Curriculum Development for Medical

  5. Business Case for Energy Efficiency in Support of Climate Change Mitigation, Economic and Societal Benefits in the United States

    E-Print Network [OSTI]

    Bojda, Nicholas

    2011-01-01

    mt CO 2 in 2030. According to WEO, with current policies inmt CO 2 in 2030. According to WEO, with current policies in

  6. Full-waveform based microseismic source mechanism studies in the Barnett Shale: Linking microseismicity to reservoir geomechanics

    E-Print Network [OSTI]

    Song, Fuxian

    Seismic moment tensors (MTs) of microearthquakes contain important information on the reservoir and fracturing mechanisms. Difficulties arise when attempting to retrieve complete MT with conventional amplitude inversion ...

  7. SEARCH FOR UNDERGROUND OPENINGS FOR IN SITU TEST FACILITIES IN CRYSTALLINE ROCK

    E-Print Network [OSTI]

    Wallenberg, H.A.

    2010-01-01

    Quartzite, Shale, Granodiorite Depth (ft) New Mexico GrantShale, Sandstone, Granite Stock Inactive (1979) NEW JERSEY Mt. Hope and Scrub Oaks Mines NEW MEXICO

  8. Alternative Energy Development and China's Energy Future

    E-Print Network [OSTI]

    Zheng, Nina

    2012-01-01

    Ag/Forestry Residues Biogas from org effluent Municipalmil m2 Mtce Mt consumption Biogas and Biomass GasificationBesides solar water heaters, biogas is another alternative

  9. Conference Proceedings

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    G., Angel, M., Bement, M.T., Salvino, L., "Structural Health Monitoring for Ship Structures," Proceedings of 7th International Workshop on Structural Health Monitoring,...

  10. WIND DATA REPORT September 1, 2003 November 31, 2003

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    WIND DATA REPORT Mt. Tom September 1, 2003 ­ November 31, 2003 Prepared for Massachusetts...................................................................................................................... 9 Wind Speed Time Series............................................................................................................. 9 Wind Speed Distributions

  11. WIND DATA REPORT December 1, 2003 February 29, 2004

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    WIND DATA REPORT Mt. Tom December 1, 2003 ­ February 29, 2004 Prepared for Massachusetts Technology.................................................................................................................... 10 Wind Speed Time Series........................................................................................................... 10 Wind Speed Distributions

  12. Industry

    E-Print Network [OSTI]

    Bernstein, Lenny

    2008-01-01

    carbon capture and storage in the ammonia, cement and steelCapture and Storage 2030 Production (Mt) a A1 Ammonia o,p

  13. A Five-Component Magneto-Telluric Method In Geothermal Exploration...

    Open Energy Info (EERE)

    the five standard electromagnetic components quantitatively, and in particular the vertical magnetic component. The application of this method - named the M.T.-5-E.X. - to...

  14. Key China Energy Statistics 2012

    E-Print Network [OSTI]

    Levine, Mark

    2013-01-01

    Others Total Oil Refining by Product (1985-2010) AAGRMtce Mt Fuel Oil Kerosene Petroleum Other Products RefineryProduction by Product Shares Fuel Oil Kerosene Petroleum

  15. Multi-Building Microgrids for a Distributed Energy Future in Portugal

    E-Print Network [OSTI]

    Mendes, Goncalo

    2013-01-01

    electricity tariff “MT – Médias utilizações em ciclo semanal normal” for the Education,electricity tariff considered in the DER-CAM runs for the Education,

  16. Fabrication of a Short-Period Nb3Sn Superconducting Undulator

    E-Print Network [OSTI]

    Dietderich, Daniel

    2008-01-01

    Trans. on Applied Superconductivity, Vol. 13, No. 2, pp.Trans. on Applied Superconductivity, MT-19, June 2005. [7]Trans. on Applied Superconductivity, vol. 15, no. 2, 2005,

  17. Evaluation of Efficiency Activities in the Industrial Sector Undertaken in Response to Greenhouse Gas Emission Reduction Targets

    E-Print Network [OSTI]

    Price, Lynn

    2010-01-01

    CO2 Emissions Reduced (Mt) Taxes Subsidies Agreements Total Source:CO2 from UTO Source: CARB, 2009a; LBNL own estimates Not Specified: emissions

  18. How Can China Lighten Up? Urbanization, Industrialization and Energy Demand Scenarios

    E-Print Network [OSTI]

    Aden, Nathaniel T.

    2010-01-01

    CO2 emissions per capita Urban Rural Commercial Only Source:Emissions in Global Context WEO '08 global mt CO2 WEO '08 China CLU Source:

  19. Technologies and Policies to Improve Energy Efficiency in Industry

    E-Print Network [OSTI]

    Price, Lynn

    2008-01-01

    CO2 Emissions (MtCO2) Transport Residential Buildings Commercial Buildings Agriculture Agriculture Commercial Buildings Residential Buildings Transport Industry Source:

  20. PHYSICAL REVIEW B 91, 245202 (2015) Improved predictions of the physical properties of Zn-and Cd-based wide band-gap

    E-Print Network [OSTI]

    Curtarolo, Stefano

    2015-01-01

    Department of Physics, Central Michigan University, Mt. Pleasant, Michigan 48859, USA 2 Center for Materials scrutiny for their potential applications in spintronics, optoelectronics, and photovoltaics [1

  1. Key China Energy Statistics 2011

    E-Print Network [OSTI]

    Levine, Mark

    2013-01-01

    China's Fuel Combustion CO 2 Emissions by Fuel Mt CO 2 Coal Oil Natural Gas Note: Data based on total final consumption

  2. Alternative Energy Development and China's Energy Future

    E-Print Network [OSTI]

    Zheng, Nina

    2012-01-01

    Solar Water Heater Geothermal energy Biomass Pellets mil m2 Mtce Mt consumption Biogas and Biomass Gasification Liquid Biofuels Bioethanol Biodiesel mil rural households

  3. Proceedings of the 50th Annual Meeting of the Association for Computational Linguistics, pages 302310, Jeju, Republic of Korea, 8-14 July 2012. c 2012 Association for Computational Linguistics

    E-Print Network [OSTI]

    -ranks the n- best output of a MT decoder, and the work of Tromble et al. (2008) and Kumar et al. (2009), which

  4. Development and HVS Validation of Design Tables for Permeable Interlocking Concrete Pavement: Final Report

    E-Print Network [OSTI]

    Li, Hui; Jones, David; Wu, Rongzong; Harvey, John T

    2014-01-01

    29  Figure 5.7: GeotextileR-value geotextile was placed on the subgradePendergrass, Georgia (donated geotextile) + WeberMT, Bangor,

  5. Script generation and multitasking in HIV-1 infection : implications for everyday functioning

    E-Print Network [OSTI]

    Scott, James Cobb

    2009-01-01

    Gagnon S. (2004). Script generation following frontal andGroup. (2005). Action (verb) generation in HIV-1 infection.Note. SG = Script Generation test; MT = Multitasking test. *

  6. Assessment of China's Energy-Saving and Emission-Reduction Accomplishments and Opportunities During the 11th Five Year Plan

    E-Print Network [OSTI]

    Levine, Mark D.

    2010-01-01

    of 10 Mt. District Cogeneration Projects. Compared withheat efficiency of cogeneration can increase 30%. Heatto establishing 300 MW cogeneration units with environmental

  7. Industrial Energy Efficiency and Climate Change Mitigation

    E-Print Network [OSTI]

    Worrell, Ernst

    2009-01-01

    mitigate 21 MtCO 2 . Cogeneration (also called Combined Heatefficiencies. Industrial cogeneration is an important partpotential for industrial cogeneration is estimated at almost

  8. Other Participants 2006 | U.S. DOE Office of Science (SC)

    Office of Science (SC) Website

    Hill High School , Chapel Hill , NC East Rankin Academy , Pelahatchie , MS Edwin O. Smith High School , Mansfield , CT Fergus High School , Lewistown , MT Hillcrest High School...

  9. Other Participants 2004 | U.S. DOE Office of Science (SC)

    Office of Science (SC) Website

    School , Billings , MT Smoky Hill High School, Aurora, CO Southside High School , Fort Smith , AR St. Croix Country Day School , Kingshill, VI Stevens High School , Rapid City ,...

  10. Property Prediction Tools for Tailored Polymer Composite Structures

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Structures Polymer Composite Structures Merit Review: February 27, 2008 Presenter: M.T. Smith (PNNL) Principal Investigators: B.N. Nguyen (PNNL), V. Kunc (ORNL) Pacific Northwest...

  11. A Resource Conceptual Model for the Ngatamariki Geothermal Field...

    Open Energy Info (EERE)

    a permeable 280C resource. However, economic and access complications halted further drilling. After initial access was obtained in 2004, RJV conducted MT surveys and...

  12. Quantifying the Comprehensive Greenhouse Gas Co-Benefits of Green Buildings

    E-Print Network [OSTI]

    Mozingo, Louise; Arens, Ed

    2014-01-01

    25%   reduction  in  both  water  and  energy  use  within  previous  precedent  for  water-­?energy  studies   (CEC  MT/gal) Source,for,water,energy,intensities:,CAPCOA,(2010),,

  13. Pattern Of Shallow Ground Water Flow At Mount Princeton Hot Springs...

    Open Energy Info (EERE)

    and Geothermal Research. () . Related Geothermal Exploration Activities Activities (1) Direct-Current Resistivity Survey At Mt Princeton Hot Springs Area (Richards, Et Al.,...

  14. Modeling basin- and plume-scale processes of CO2 storage for full-scale deployment

    E-Print Network [OSTI]

    Zhou, Q.

    2010-01-01

    models of Mt. Simon gas storage fields in the Illinoiscaprock in aquifer gas storage, 1: Caprock of infiniteEvaluation of underground gas storage conditions in aquifers

  15. Magnetotelluric investigations of the lithosphere beneath the central Rae craton, mainland

    E-Print Network [OSTI]

    Jones, Alan G.

    . The magnetotelluric (MT) method, a natural source electromagnetic technique used to image the electrical resistivity, Ontario, Canada, 3 Dublin Institute for Advanced Studies, Dublin, Ireland Abstract New magnetotelluric

  16. Modeling-Computer Simulations At Dixie Valley Geothermal Area...

    Open Energy Info (EERE)

    and Multi-Scale Geothermal Fluid Connections in the Dixie Valley-Central Nevada Seismic Belt Area- Implications from Mt Resistivity Surveying Additional References Retrieved from...

  17. Measurement of the top quark mass with dilepton events selected using neuroevolution at CDF

    E-Print Network [OSTI]

    CDF Collaboration; T. Aaltonen

    2009-04-14

    We report a measurement of the top quark mass $M_t$ in the dilepton decay channel $t\\bar{t}\\to b\\ell'^{+}\

  18. Neutral kaon interferometry in Au plus Au collisions at root(S)(NN) =200GeV 

    E-Print Network [OSTI]

    Abelev, B. I.; Aggarwal, M. M.; Ahammed, Z.; Amonett, J.; Anderson, B. D.; Anderson, M.; Arkhipkin, D.; Averichev, G. S.; Bai, Y.; Balewski, J.; Barannikova, O.; Barnby, L. S.; Baudot, J.; Bekele, S.; Belaga, V. V.; Bellingeri-Laurikainen, A.; Bellwied, R.; Benedosso, F.; Bhardwaj, S.; Bhasin, A.; Bhati, A. K.; Bichsel, H.; Bielcik, J.; Bielcikova, J.; Bland, L. C.; Blyth, S. -L; Bonner, B. E.; Botje, M.; Bouchet, J.; Brandin, A. V.; Bravar, A.; Burton, T. P.; Bystersky, M.; Cadman, R. V.; Cai, X. Z.; Caines, H.; de la Barca Sanchez, M. Calderon; Castillo, J.; Catu, O.; Cebra, D.; Chajecki, Z.; Chaloupka, P.; Chattopadhyay, S.; Chen, H. F.; Chen, J. H.; Cheng, J.; Cherney, M.; Chikanian, A.; Christie, W.; Coffin, J. P.; Cormier, T. M.; Cosentino, M. R.; Cramer, J. G.; Crawford, H. J.; Das, D.; Das, S.; Dash, S.; Daugherity, M.; de Moura, M. M.; Dedovich, T. G.; DePhillips, M.; Derevschikov, A. A.; Didenko, L.; Dietel, T.; Djawotho, P.; Dogra, S. M.; Dong, W. J.; Dong, X.; Draper, J. E.; Du, F.; Dunin, V. B.; Dunlop, J. C.; Mazumdar, M. R. Dutta; Eckardt, V.; Edwards, W. R.; Efimov, L. G.; Emelianov, V.; Engelage, J.; Eppley, G.; Erazmus, B.; Estienne, M.; Fachini, P.; Fatemi, R.; Fedorisin, J.; Filimonov, K.; Filip, P.; Finch, E.; Fine, V.; Fisyak, Y.; Fu, J.; Gagliardi, Carl A.; Gaillard, L.; Ganti, M. S.; Ghazikhanian, V.; Ghosh, P.; Gonzalez, J. E.; Gorbunov, Y. G.; Gos, H.; Grebenyuk, O.; Grosnick, D.; Guertin, S. M.; Guimaraes, K. S. F. F.; Gupta, N.; Gutierrez, T. D.; Haag, B.; Hallman, T. J.; Hamed, A.; Harris, J. W.; He, W.; Heinz, M.; Henry, T. W.; Hepplemann, S.; Hippolyte, B.; Hirsch, A.; Hjort, E.; Hoffman, A. M.; Hoffmann, G. W.; Horner, M. J.; Huang, H. Z.; Huang, S. L.; Hughes, E. W.; Humanic, T. J.; Igo, G.; Jacobs, P.; Jacobs, W. W.; Jakl, P.; Jia, F.; Jiang, H.; Jones, P. G.; Judd, E. G.; Kabana, S.; Kang, K.; Kapitan, J.; Kaplan, M.; Keane, D.; Kechechyan, A.; Khodyrev, V. Yu; Kim, B. C.; Kiryluk, J.; Kisiel, A.; Kislov, E. M.; Klein, S. R.; Kocoloski, A.; Koetke, D. D.; Kollegger, T.; Kopytine, M.; Kotchenda, L.; Kouchpil, V.; Kowalik, K. L.; Kramer, M.; Kravtsov, P.; Kravtsov, V. I.; Krueger, K.; Kuhn, C.; Kulikov, A. I.; Kumar, A.; Kuznetsov, A. A.; Lamont, M. A. C.; Landgraf, J. M.; Lange, S.; LaPointe, S.; Laue, F.; Lauret, J.; Lebedev, A.; Lednicky, R.; Lee, C. -H; Lehocka, S.; LeVine, M. J.; Li, C.; Li, Q.; Li, Y.; Lin, G.; Lin, X.; Lindenbaum, S. J.; Lisa, M. A.; Liu, F.; Liu, H.; Liu, J.; Liu, L.; Liu, Z.; Ljubicic, T.; Llope, W. J.; Long, H.; Longacre, R. S.; Love, W. A.; Lu, Y.; Ludlam, T.; Lynn, D.; Ma, G. L.; Ma, J. G.; Ma, Y. G.; Magestro, D.; Mahapatra, D. P.; Majka, R.; Mangotra, L. K.; Manweiler, R.; Margetis, S.; Markert, C.; Martin, L.; Matis, H. S.; Matulenko, Yu A.; McClain, C. J.; McShane, T. S.; Melnick, Yu; Meschanin, A.; Millane, J.; Miller, M. L.; Minaev, N. G.; Mioduszewski, Saskia; Mironov, C.; Mischke, A.; Mishra, D. K.; Mitchell, J.; Mohanty, B.; Molnar, L.; Moore, C. F.; Morozov, D. A.; Munhoz, M. G.; Nandi, B. K.; Nattrass, C.; Nayak, T. K.; Nelson, J. M.; Netrakanti, P. K.; Nogach, L. V.; Nurushev, S. B.; Odyniec, G.; Ogawa, A.; Okorokov, V.; Oldenburg, M.; Olson, D.; Pachr, M.; Pal, S. K.; Panebratsev, Y.; Panitkin, S. Y.; Pavlinov, A. I.; Pawlak, T.; Peitzmann, T.; Perevoztchikov, V.; Perkins, C.; Peryt, W.; Phatak, S. C.; Picha, R.; Planinic, M.; Pluta, J.; Poljak, N.; Porile, N.; Porter, J.; Poskanzer, A. M.; Potekhin, M.; Potrebenikova, E.; Potukuchi, B. V. K. S.; Prindle, D.; Pruneau, C.; Putschke, J.; Rakness, G.; Raniwala, R.; Raniwala, S.; Ray, R. L.; Razin, S. V.; Reinnarth, J.; Relyea, D.; Retiere, F.; Ridiger, A.; Ritter, H. G.; Roberts, J. B.; Rogachevskiy, O. V.; Romero, J. L.; Rose, A.; Roy, C.; Ruan, L.; Russcher, M. J.; Sahoo, R.; Sakuma, T.; Salur, S.; Sandweiss, J.; Sarsour, M.; Sazhin, P. S.; Schambach, J.; Scharenberg, R. P.; Schmitz, N.; Schweda, K.; Seger, J.; Selyuzhenkov, I.; Seyboth, P.; Shabetai, A.; Shahaliev, E.; Shao, M.; Sharma, M.; Shen, W. Q.; Shimanskiy, S. S.; Sichtermann, E. P.; Simon, F.; Singaraju, R. N.; Smirnov, N.; Snellings, R.; Sood, G.; Sorensen, P.; Sowinski, J.; Speltz, J.; Spinka, H. M.; Srivastava, B.; Stadnik, A.; Stanislaus, T. D. S.; Stock, R.; Stolpovsky, A.; Strikhanov, M.; Stringfellow, B.; Suaide, A. A. P.; Sugarbaker, E.; Sumbera, M.; Sun, Z.; Surrow, B.; Swanger, M.; Symons, T. J. M.; de Toledo, A. Szanto; Tai, A.; Takahashi, J.; Tang, A. H.; Tarnowsky, T.; Thein, D.; Thomas, J. H.; Timmins, A. R.; Timoshenko, S.; Tokarev, M.; Trainor, T. A.; Trentalange, S.; Tribble, Robert E.; Tsai, O. D.; Ulery, J.; Ullrich, T.; Underwood, D. G.; Van Buren, G.; van der Kolk, N.; van Leeuwen, M.; Molen, A. M. Vander; Varma, R.; Vasilevski, I. M.; Vasiliev, A. N.; Vernet, R.; Vigdor, S. E.

    2006-01-01

    and chaoticity parameters, respectively. The results are qualitatively consistent with m(T) systematics established with pions in a scenario characterized by a strong collective flow....

  19. Cryptic Faulting and Multi-Scale Geothermal Fluid Connections...

    Open Energy Info (EERE)

    and Multi-Scale Geothermal Fluid Connections in the Dixie Valley-Central Nevada Seismic Belt Area- Implications from Mt Resistivity Surveying Jump to: navigation, search...

  20. Sectoral trends in global energy use and greenhouse gas emissions

    E-Print Network [OSTI]

    2006-01-01

    Emissions (Mt CO2) Region Pacific OECD Canada/US Europe Transition Economies Latin America Africa/Middle East Asia World

  1. A Target-Oriented Magnetotelluric Inversion Approach For Characterizin...

    Open Energy Info (EERE)

    drilled to establish an in situ laboratory to investigate the potential for geothermal energy production. Classical 2-D smooth inversion of the MT data, recorded along two...

  2. Magnetotellurics At Kilauea Southwest Rift And South Flank Area...

    Open Energy Info (EERE)

    Unknown Notes Magnetotelluric Imaging, G. Michael Hoversten. The project title derived from its inception. The project however moved from the application of MT on Kilauea...

  3. Comunidades de partidarios en redes sociales: estudio de las elecciones catalanas de 2010 y 2012

    E-Print Network [OSTI]

    Moro, Esteban

    diferentes tipos de comunicación (mención, MT, o retuit, RT), de las palabras utilizadas o de los hashtags, da indicación sobre la formación de grupos (partisanos) que comparten una misma ideología, flujos de populares en este tipo de estudios es el de utilizar el número de RT, MT o número de menciones de los

  4. Mat Williams (Edinburgh University) John Grace (Edinburgh University)

    E-Print Network [OSTI]

    Magnani, F., M. Mencuccini, et al. (2007). "The human footprint in the carbon cycle of temperate (2006). · Woody biomass carbon ~ 580 Mt. · Soil carbon stock (to 0.8M) ~1200 Mt. PhD scope: · Link soil. LULUCF (2006) Wheldrake Forest Alice Holt #12;2 1. Carbon pools and fluxes in forests 2. The key

  5. Feedback Mechanism for Microtubule Length Regulation by Stathmin Gradients

    E-Print Network [OSTI]

    Maria Zeitz; Jan Kierfeld

    2014-12-09

    We formulate and analyze a theoretical model for the regulation of microtubule (MT) polymerization dynamics by the signaling proteins Rac1 and stathmin. In cells, the MT growth rate is inhibited by cytosolic stathmin, which, in turn, is inactivated by Rac1. Growing MTs activate Rac1 at the cell edge, which closes a positive feedback loop. We investigate both tubulin sequestering and catastrophe promotion as mechanisms for MT growth inhibition by stathmin. For a homogeneous stathmin concentration in the absence of Rac1, we find a switch-like regulation of the MT mean length by stathmin. For constitutively active Rac1 at the cell edge, stathmin is deactivated locally, which establishes a spatial gradient of active stathmin. In this gradient, we find a stationary bimodal MT length distributions for both mechanisms of MT growth inhibition by stathmin. One subpopulation of the bimodal length distribution can be identified with fast growing and long pioneering MTs in the region near the cell edge, which have been observed experimentally. The feedback loop is closed through Rac1 activation by MTs. For tubulin sequestering by stathmin, this establishes a bistable switch with two stable states: one stable state corresponds to upregulated MT mean length and bimodal MT length distributions, i.e., pioneering MTs; the other stable state corresponds to an interrupted feedback with short MTs. Stochastic effects as well as external perturbations can trigger switching events. For catastrophe promoting stathmin we do not find bistability.

  6. Proceedings of COLING 2012: Posters, pages 411420, COLING 2012, Mumbai, December 2012.

    E-Print Network [OSTI]

    Proceedings of COLING 2012: Posters, pages 411­420, COLING 2012, Mumbai, December 2012. Classifier language processing tasks such as Machine Translation (MT). However, the mapping of tense in MT is a very mapping a correct tense from source-side into target-side in this case is difficult and thus it poses

  7. The Complete Chloroplast and Mitochondrial DNA Sequence of Ostreococcus tauri: Organelle Genomes of the Smallest Eukaryote Are Examples of

    E-Print Network [OSTI]

    Gent, Universiteit

    The Complete Chloroplast and Mitochondrial DNA Sequence of Ostreococcus tauri: Organelle Genomes The complete nucleotide sequence of the mt (mitochondrial) and cp (chloroplast) genomes of the unicellular green alga Ostreococcus tauri has been determined. The mt genome assembles as a circle of 44,237 bp

  8. Thomas G. Thompson TN121 23 February 12 March, 2001

    E-Print Network [OSTI]

    Key, Kerry

    transmitter broadcasts energy to seafloor electric field recorders, and magnetotelluric (MT) sounding on the transit back to San Diego (to evaluate the effect of the coast on the MT fields). These instruments will be recovered from the New Horizon in August 2001 during the second leg. Intermsofshipuseanddatacollection

  9. Timber Committee Market Discussions Geneva, 8 October 2003

    E-Print Network [OSTI]

    by avoiding unnecessary and costly legislation · To increase the influence of the paper industry by speaking of the paper industry by speaking "with one voice" to the EU institutions · To implement a pro-active way,257 · Employment: 251,100 · Turnover: 73 billion EUR · Paper and Board production: 90 MT · Pulp production: 39 MT

  10. Six Week Session: ANTH 045.40 (GS;US;IL) CULTURAL ANTHROPOLOGY ( 3)

    E-Print Network [OSTI]

    Maranas, Costas

    credits in economics MT R 4:30 ­ 7:00 p.m. 3 credits #339904 BIOL 110.40 (GN) BIOLOGY: BASIC CONCEPTS; economic life, society, government, religion, and art among traditional peoples. MT R 9:00 a.m. ­ 11:30 p) Chemical Principles I (3) Basic concepts and quantitative relations. Students may take only one course

  11. Cours-XII/Clavin2015.key

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 p Dp Dt q m c p T w, D Dt w, D Dt t + m(t) x m(t) 1 t D , 4 x (t) 0 D heat release induction oscillations oscillations Reaction rate (Realtive units) Relative...

  12. The efficiency of mitochondrial electron transport chain is increased in the long-lived mrg19

    E-Print Network [OSTI]

    Babu, M. Madan

    The efficiency of mitochondrial electron transport chain is increased in the long-lived mrg19 mtROS and contribute to longevity. This increased mitochondrial efficiency (i.e. low mtROS generated the observed higher mito- chondrial efficiency in the long-lived mrg19 mutant of Saccharomyces cerevisiae

  13. Lyapunov optimizing measures for C1 expanding maps of the

    E-Print Network [OSTI]

    Wright, Francis

    Lyapunov optimizing measures for C1 expanding maps of the circle Oliver Jenkinson and Ian D. Morris Abstract. For a generic C1 expanding map of the circle, the Lyapunov maximizing measure is unique, fully/Z, and let M(T) denote the set of T-invariant Borel probability measures. For any µ M(T), its Lyapunov

  14. The Scottish Forestry Strategy: 2011-2014 Implementation Plan & 2010-2011 Progress Report.

    E-Print Network [OSTI]

    The Scottish Forestry Strategy: 2011-2014 Implementation Plan & 2010-2011 Progress Report. Progress.43 Mt CO2 0.45 Mt CO2 1 year Installed capacity of wood energy plant (megawatt thermal and electrical MWth 75 MWe 1 year Number of non-domestic, wood fuelled energy systems installed FCS 2006 2007 2008

  15. JOURNAL OF GEOPHYSICAL RESEARCH, VOL. 94, NO. BIO, PAGES 14,111-14,125, OCTOBER 10,1989 Magnetotelluric Observations Across the Juan de Fuca Subduction System

    E-Print Network [OSTI]

    Jones, Alan G.

    interpretation. Broadband audiomagnetotelluric (AM1)/MT soundings (approx. 0.01-500 s period) were collectei~train upper crustal heterogeneity but sense also into the upper mantle. Fifteen long-period MT recordings, is continuous eastward from the seacoast and ends abruptly at the High Cascades. It signifies an electrically

  16. Origin and significance of aromatic hydrocarbons in giant iron ore deposits of the late Archean Hamersley Basin,

    E-Print Network [OSTI]

    Brocks, Jochen J.

    Origin and significance of aromatic hydrocarbons in giant iron ore deposits of the late Archean extractable saturated and aromatic hydrocarbons. The host rocks belong to the $2.5 billion years (Ga) old Mt and Newman (Mt Whaleback). The saturated hydrocarbons in the rock extracts have the composition of highly

  17. Microtubule Patterning and Manipulation Using Electrophoresis and Self-Assembled Monolayers 

    E-Print Network [OSTI]

    Noel, John

    2010-07-14

    -assembled monolayer (SAM) was developed which prevented MT adsorption in the absence of passivating proteins. The morphology and thickness of the SAM was measured to determine the mechanism of formation and origin of the MT-resistant behavior. The SAM was integrated...

  18. The epibenthic megafauna of the northern Gulf of Mexico continental slope 

    E-Print Network [OSTI]

    Ziegler, Matthew Peek

    2002-01-01

    meter isobaths. Table 1 General site information for DGOMB Site ac I bl b2 b3 nb2 nb3 nb5 rw1 rw2 fw3 rw4 rw5 wl w2 w3 w5 w6 wc5 wc12 cl c4 c7 2000 c12 mtl 2000 mt2 mt3 mt4 mt5 mt6 s35 s36 s37 s38 s39 s41 2000 s42... megafaunal densities reached 780/ha. A total of 15 major taxonomic groups were identified from photographs Table 2 General results by site for DGoMB eel bl b2 b3 ab2 nb3 ab5 rwl rw2 fw3 rw4 rw5 wl w2 w3 w5 w6 wc5 wc12 cl c4 c7 2000 c...

  19. Coordinate amplification of metallothionein I and II gene sequences in cadmium-resistant CHO variants

    SciTech Connect (OSTI)

    Hildebrand, C.E.; Crawford, B.D.; Enger, M.D.

    1983-01-01

    Cadmium-resistanc (Cd/sup r/) variants of the Chinese hamster cell line, CHO, have been derived by stepwise selection for growth in medium containing CdCl/sub 2/. These variants show coordinately increased production of both metallothionein (MT) I and II and were stably resistant to Cd/sup 2 +/ in the absence of continued selection. Genomic DNAs from these Cd/sup r/ sublines were analyzed for both MT gene copy number and MT gene organization, using cDNA sequence probes specific for each of the two Chinese hamster isometallothioneins. These analyses revealed coordinate amplification of MT I and II genes in all Cd/sup r/ variants which had increased copies of MT-encoding sequences. In situ hybridization of an MT-encoding probe to mitotic chromosomes of a Cd/sup r/ variant, which has amplified MT genes at least 14-fold, revealed a single chromosomal site of hybridization. These results suggest that the isoMTs constitute a functionally related gene cluster which amplifies coordinately in response to toxic metal stress.

  20. Novel function of glutathione transferase in rat liver mitochondrial membrane: Role for cytochrome c release from mitochondria

    SciTech Connect (OSTI)

    Lee, Kang Kwang; Shimoji, Manami; Hossain, Quazi Sohel [Laboratory of Molecular Genetics and Pharmacology, School of Health Sciences, Faculty of Medicine, University of the Ryukyus, 207 Uehara, Nishihara, Okinawa 903-0215 (Japan); Sunakawa, Hajime [Department of Oral and Maxillofacial Functional Rehabilitation, Faculty of Medicine, University of the Ryukyus, 207 Uehara, Nishihara, Okinawa 903-0215 (Japan); Aniya, Yoko [Laboratory of Molecular Genetics and Pharmacology, School of Health Sciences, Faculty of Medicine, University of the Ryukyus, 207 Uehara, Nishihara, Okinawa 903-0215 (Japan)], E-mail: yaniya@med.u-ryukyu.ac.jp

    2008-10-01

    Microsomal glutathione transferase (MGST1) is activated by oxidative stress. Although MGST1 is found in mitochondrial membranes (mtMGST1), there is no information about the oxidative activation of mtMGST1. In the present study, we aimed to determine whether mtMGST1 also undergoes activation and about its function. When rats were treated with galactosamine/lipopolysaccharide (GalN/LPS), mtMGST1 activity was significantly increased, and the increased activity was reduced by the disulfide reducing agent dithiothreitol. In mitochondria from GalN/LPS-treated rats, disulfide-linked mtMGST1 dimer and mixed protein glutathione disulfides (glutathionylation) were detected. In addition, cytochrome c release from mitochondria isolated from GalN/LPS-treated rats was observed, and the release was inhibited by anti-MGST1 antibodies. Incubation of mitochondria from control rats with diamide and diamide plus GSH in vitro resulted in dimer- and mixed disulfide bond-mediated activation of mtMGST1, respectively. The activation of mtMGST1 by diamide plus GSH caused cytochrome c release from the mitochondria, and the release was prevented by treatment with anti-MGST1 antibodies. In addition, diamide plus GSH treatment caused mitochondrial swelling accompanied by cytochrome c release, which was inhibited by cyclosporin A (CsA) and bongkrekic acid (BKA), inhibitors of the mitochondrial permeability transition (MPT) pore. Furthermore, mtMGST1 activity was also inhibited by CsA and BKA. These results indicate that mtMGST1 is activated through mixed disulfide bond formation that contributes to cytochrome c release from mitochondria through the MPT pore.

  1. R u t c o r R e p o r t

    E-Print Network [OSTI]

    T Cx. Markowitz's mean-variance model (1952, 1959) is usually formulated in three different ways: Model I. maximize mT x subject to xT Cx V n i=1 xi = 1 x 0, (1.1) Model II. minimize xT Cx subject to mT x M n i=1 xi = 1 x 0, (1.2) Model III. maximize {mT x - xT Cx} subject to n i=1 xi = 1 x 0, (1

  2. Dependence of the microwave surface resistance of superconducting niobium on the magnitude of the rf field

    SciTech Connect (OSTI)

    Romanenko, A.; Grassellino, A. [Fermi National Accelerator Laboratory, Batavia, Illinois 60510 (United States)] [Fermi National Accelerator Laboratory, Batavia, Illinois 60510 (United States)

    2013-06-24

    Utilizing difference in temperature dependencies we decoupled Bardeen-Cooper-Schrieffer (BCS) and residual components of the microwave surface resistance of superconducting niobium at all rf fields up to B{sub rf}{approx}115 mT. We reveal that the residual resistance decreases with field at B{sub rf} Less-Than-Or-Equivalent-To 40 mT and strongly increases in chemically treated niobium at B{sub rf}>80 mT. We find that BCS surface resistance is weakly dependent on field in the clean limit, whereas a strong and peculiar field dependence emerges after 120 Degree-Sign C vacuum baking.

  3. Value of Information spreadsheet

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Trainor-Guitton, Whitney

    This spreadsheet represents the information posteriors derived from synthetic data of magnetotellurics (MT). These were used to calculate value of information of MT for geothermal exploration. Information posteriors describe how well MT was able to locate the "throat" of clay caps, which are indicative of hidden geothermal resources. This data is full explained in the peer-reviewed publication: Trainor-Guitton, W., Hoversten, G. M., Ramirez, A., Roberts, J., Júlíusson, E., Key, K., Mellors, R. (Sept-Oct. 2014) The value of spatial information for determining well placement: a geothermal example, Geophysics.

  4. Value of Information spreadsheet

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Trainor-Guitton, Whitney

    2014-05-12

    This spreadsheet represents the information posteriors derived from synthetic data of magnetotellurics (MT). These were used to calculate value of information of MT for geothermal exploration. Information posteriors describe how well MT was able to locate the "throat" of clay caps, which are indicative of hidden geothermal resources. This data is full explained in the peer-reviewed publication: Trainor-Guitton, W., Hoversten, G. M., Ramirez, A., Roberts, J., Júlíusson, E., Key, K., Mellors, R. (Sept-Oct. 2014) The value of spatial information for determining well placement: a geothermal example, Geophysics.

  5. Key China Energy Statistics 2012

    E-Print Network [OSTI]

    Levine, Mark

    2013-01-01

    South Korea Other Crude Oil Production by Region (1985-2010)West Chinese Crude Oil Production by Regional Shares EastHenan Other Total Crude Oil Production: 209 Mt China's Crude

  6. Mechanisms of post-myocardial infarction healing : from acute survival to chronic remodeling

    E-Print Network [OSTI]

    Hunt, Darlene L.

    2009-01-01

    Biol 2002;3(8):566-574. 110. Poss KD, Wilson LG, Keating MT.AM, Du X-J. Mouse model of post-infarct ventricular rupture:therapy for symptomatic post infarction pericarditis.

  7. Key China Energy Statistics 2012

    E-Print Network [OSTI]

    Levine, Mark

    2013-01-01

    South Korea Other Crude Oil Production by Region (1985-2010)North West Chinese Crude Oil Production by Regional SharesHenan Other Total Crude Oil Production: 209 Mt China's Crude

  8. Second ML4HMT Workshop, pages 3744, COLING 2012, Mumbai, December 2012.

    E-Print Network [OSTI]

    to Optimise the Division of Labour in Hybrid MT (ML4HMT-12). Our work is based on a confusion network selection is often done by Minimum Bayes Risk (MBR) decoding which selects a hypothesis with minimum average

  9. Building Energy-Efficiency Best Practice Policies and Policy Packages

    E-Print Network [OSTI]

    Levine, Mark

    2014-01-01

    to consumers, energy suppliers, builders, the environment,property owners and four energy suppliers. This group’s  CERT, requires domestic energy suppliers to save 293 Mt CO 2

  10. Miniature mechanical transfer optical coupler

    DOE Patents [OSTI]

    Abel, Philip (Overland Park, KS); Watterson, Carl (Kansas City, MO)

    2011-02-15

    A miniature mechanical transfer (MT) optical coupler ("MMTOC") for optically connecting a first plurality of optical fibers with at least one other plurality of optical fibers. The MMTOC may comprise a beam splitting element, a plurality of collimating lenses, and a plurality of alignment elements. The MMTOC may optically couple a first plurality of fibers disposed in a plurality of ferrules of a first MT connector with a second plurality of fibers disposed in a plurality of ferrules of a second MT connector and a third plurality of fibers disposed in a plurality of ferrules of a third MT connector. The beam splitting element may allow a portion of each beam of light from the first plurality of fibers to pass through to the second plurality of fibers and simultaneously reflect another portion of each beam of light from the first plurality of fibers to the third plurality of fibers.

  11. Application Of Gravity And Deep Dipole Geoelectrics In The Volcanic...

    Open Energy Info (EERE)

    Application Of Gravity And Deep Dipole Geoelectrics In The Volcanic Area Of Mt Etna (Sicily) Jump to: navigation, search OpenEI Reference LibraryAdd to library Journal Article:...

  12. EERE PowerPoint 97-2004 Template: Green Version

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Approach (Fracture Size, Fracture Density, In-situ Stress) * Develop new integrated non-linear least-squares MT inversion in source-type space based on three independent datasets...

  13. Modeling of Thermal Storage Systems in MILP Distributed Energy Resource Models

    E-Print Network [OSTI]

    Steen, David

    2014-01-01

    generation electric vehicle fuel cell ground-source heatMT: micro-turbine, FC: fuel cell, HX: heat exchanger forfor natural gas fired fuel cells, today the subsidy has

  14. Alternative Energy Development and China's Energy Future

    E-Print Network [OSTI]

    Zheng, Nina

    2012-01-01

    with the 2010 annual copper demand for alternative energySteel Copper Uranium Fuel Cycle Energy Demand Because therethe cumulative demand of 4.7 Mt copper exceeds the 2009

  15. Tax Credits, Rebates & Savings | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Climate Action Plan (New Brunswick, Canada) New Brunswick-led initiatives will result in greenhouse gas emission reductions of 5.5 megatonnes (millions of tonnes, Mt) annually in...

  16. Review of China's Low-Carbon City Initiative and Developments in the Coal Industry

    E-Print Network [OSTI]

    Fridley, David

    2014-01-01

    http://www.iea.org/weo/docs/weo2011/homepage/WEO2011_Press_the 2011 World Energy Outlook (WEO) New Policies Scenario,Mt of raw coal by 2030. The IEA WEO 2011’s forecast is also

  17. Metalation and Demetalation of Human Metallothionein Studied by Ion Mobility Mass Spectrometry 

    E-Print Network [OSTI]

    Chen, Shu-Hua

    2015-04-28

    The mechanism of cadmium binding to intact human metallothionein-2A (MT) is investigated. We describe two complementary mass spectrometry (MS) strategies to study the metalation/demetalation mechanism: (i) chemical labeling ...

  18. Page 1 Name: SI#: Midterm 2- Math 341 (11/1/05) SHOW ALL ...

    E-Print Network [OSTI]

    Nov 1, 2005 ... ein/ll Mm mem-j i ? ift@ => l??=4~l??hrtm4`?? @rfi f4. E. 6. (l5pts) Show that Cauchy sequences converge. Path Mtn Mt o. @aV-:Am than.

  19. China Energy Primer

    E-Print Network [OSTI]

    Ni, Chun Chun

    2010-01-01

    began in the late 1980s. LPG, refinery gas, and chemicalWax Diesel Oil Fuel Oi? LPG (Unit: Mt) Petroleum Year Cokeheating (1.7% to 7.6%), LPG (0.8% to 9.8%), and natural

  20. Improving the Carbon Dioxide Emission Estimates from the Combustion of Fossil Fuels in California

    E-Print Network [OSTI]

    de la Rue du Can, Stephane

    2010-01-01

    IPP Kbbl kLBS kst kW LBNL LPG Mcf MECS MMBtu Mt MTBE MVSTAFFliquefied petroleum gas (LPG), or still gas. The secondhydrogen include natural gas, LPG, naphtha, and refinery