National Library of Energy BETA

Sample records for mt sd nh

  1. Chi tit mn hc mt bn kia.

    E-Print Network [OSTI]

    California at Davis, University of

    v xã hi, ý n môi trng và sáng to. "Th ô xe p ca Hoa K," Davis là mt cng ng a dng và nng ng chào ón, Phát ?m và Nghe Trong Lãnh Vc Hc Tp, và các lãnh vc khác. Ngoài ra cng có nhiu c hi tham gia các t chc ti trng và phc v cng ng. Mun bit ngày tháng, hc phí và các chi tit khác, hãy n: www

  2. Saving Mt. Fuji

    E-Print Network [OSTI]

    Hacker, Randi

    2013-09-12

    Broadcast Transcript: Mt. Fuji, or Fujisan is it is known here in Japan, has just been added to Unesco's World Heritage list as a cultural asset, honoring it for providing thousands of years of inspiration to artists, poets ...

  3. Pipeline MT Instructions Identification Number

    E-Print Network [OSTI]

    Hong, Don

    Pipeline MT Instructions Identification Number For identification purposes, you will be assigned a special identification number. M# You can activate your MT email, login to PipelineMT to register for classes or pay tuition and fees. Activating the MTSU Email and PipelineMT accounts: Visit the website

  4. Basin Play State(s) Production Reserves Williston Bakken ND, MT, SD

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming Dry NaturalPrices1 Table 1.101 (Million Short6RU Ntight oil plays:

  5. Category:Pierre, SD | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButte County,Camilla, Georgia:GeothermalNEPA EnvironmentalOpenEI policiesPierre, SD

  6. 5, 1133111375, 2005 NH total ozone

    E-Print Network [OSTI]

    Paris-Sud XI, Universit de

    ACPD 5, 1133111375, 2005 NH total ozone increase S. Dhomse et al. Title Page Abstract Introduction On the possible causes of recent increases in NH total ozone from a statistical analysis of satellite data from License. 11331 #12;ACPD 5, 1133111375, 2005 NH total ozone increase S. Dhomse et al. Title Page Abstract

  7. Thermomagnetic Torque in Nh3

    E-Print Network [OSTI]

    Adair, Thomas W.; McClurg, G. R.

    1970-01-01

    raises the question of whether the Scott torque has the same sign as the molecular g~ factor in ammonia as it does in all other gases. The research reported here shows that NH3 is quite normal. Progress on a detailed theory for the transport... torque. The new ap- paratus' used in the present work gave no measur- able torque at zero magnetic field, and therefore no correction was needed. The ammonia was high-purity gas from the Mathe- son Gas Products Company with a stated purity of 99. 99...

  8. Publisher's Note: "Ab initio potential energy surfaces for NH,,3 -...-NH,,3 -

    E-Print Network [OSTI]

    Publisher's Note: "Ab initio potential energy surfaces for NH,,3 - ...-NH,,3 - ... with analytical.174.143.43. Redistribution subject to AIP license or copyright; see http://jcp.aip.org/about/rights_and_permissions #12;

  9. Apple Tree, NH Big Tree for May By Anne Krantz, NH Big Tree Team,

    E-Print Network [OSTI]

    New Hampshire, University of

    Apple Tree, NH Big Tree for May By Anne Krantz, NH Big Tree Team, UNH Cooperative Extension The explosion of apple blossoms in May transforms the most gnarled old tree into a delicate cloud of beauty (1817-1862) in his essay "The Wild Apple Tree," described the blossoms perfectly: `The flowers

  10. Mt. Baker Geothermal Project | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | OpenMt St HelensMt StMt.

  11. BUILDING BETTER CONE JET ALGORITHMS S.D. Ellis,1

    E-Print Network [OSTI]

    Huston, Joey

    BUILDING BETTER CONE JET ALGORITHMS S.D. Ellis,1 J. Huston,2 and M. Tnnesmann3 1 Seattle, WA 98195, such as jet algorithms, to more reliably bridge the gap between theory and experiment. We present recent results on the development of better cone jet algorithms. I. INTRODUCTION A common facet of essentially

  12. Mt Rainier Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | Open Energy(RECP)MtMt

  13. Supporting Information Geobacter sp. SD-1 with enhanced electrochemical activity in high salt

    E-Print Network [OSTI]

    1 Supporting Information Geobacter sp. SD-1 with enhanced electrochemical activity in high salt title: Geobacter sp. SD-1 in high salt solutions #12;2 Fig. S1. Current generation as a function of time

  14. Category:Concord, NH | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButte County,Camilla, Georgia: Energy014771°,NorthCLEAN WebinarNH Jump to:

  15. AA Dor - An Eclipsing sdOB - Brown Dwarf Binary

    E-Print Network [OSTI]

    Thomas Rauch

    2003-11-25

    AA Dor is an eclipsing, close, post common-envelope binary consisting of a sdOB primary star and an unseen secondary with an extraordinary small mass - formally a brown dwarf. The brown dwarf may have been a former planet which survived a common envelope phase and has even gained mass. A recent determination of the components' masses from results of NLTE spectral analysis and subsequent comparison to evolutionary tracks shows a discrepancy to masses derived from radial-velocity and the eclipse curves. Phase-resolved high-resolution and high-SN spectroscopy was carried out in order to investigate on this problem. We present results of a NLTE spectral analysis of the primary, an analysis of its orbital parameters, and discuss possible evolutionary scenarios.

  16. Developing Mt. Hope: The megawatt line

    SciTech Connect (OSTI)

    Rodzianko, P.; Fisher, F.S.

    1992-12-01

    After facing numerous obstacles, including opposition and competition, the Mt. Hope pumped-storage project in New Jersey has been licensed by FERC. That license will allow a former iron ore mine site to be used in producing a new resource-hydroelectricity. In early August 1992, after more than seven years of effort, the 2,000-MW Mt. Hope Waterpower Project was licensed by the Federal Energy Regulatory Commission (FERC). Getting the $1.8 billion pumped-storage project licensed was not an easy task. It involved 54 submittals to FERC, six public meetings, and costs of more than $12 million. Along the way, the project has withstood competing applications, community opposition, and legal battles. Getting a project of this magnitude off the ground is a challenge for even the most experienced developer. The effort was especially challenging for the Halecrest Company, a local family-owned and operated firm with no previous experience in hydroelectric development. When financing became tight, creative ways were found to raise seed capital for the project. When hydroelectric experience was needed, the company developed a world-class corporate team that carried Mt. Hope through the complexities of the licensing process and beyond. With license now in hand, the project developers are ready to move forward with negotiating power sales contracts and securing construction financing. The resulting project will be the second largest pumped-storage facility in the country-second only to the 2,100-MW Bath County project in Virginia. Mt. Hope will take six years to construct and is scheduled to be phased into operation beginning in 1999.

  17. Heavy metals and lead isotopes in sdB stars

    E-Print Network [OSTI]

    S. O'Toole; U. Heber

    2006-12-19

    We present a detailed abundance analysis of high-resolution ultraviolet echelle spectra of five subdwarf B stars obtained with HST-STIS The goal of our observations was to test the hypothesis that pulsations in sdBs are correlated to the surface abundances of iron-group elements. We study two pulsators and three non-pulsators and determined abundances for 25 elements including the iron group and even heavier elements such as tin and lead using LTE spectrum synthesis techniques. We find strong enrichments of heavy elements up to 2.9dex with respect to solar which are probably caused by atomic diffusion processes. No clear-cut correlation between pulsations and metal abundances becomes apparent. Abundances for lead isotopes are derived from very high resolution spectra using an UV line of triply ionised lead. As Pb terminates the s-process sequence Pb isotopic abundance ratios yield important constraints. It is very difficult to measure them in hot stars. For the first time we were able to measure them in two subluminous B stars and conclude that the 207Pb/208Pb is solar.

  18. Mt Rainier Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | Open Energy(RECP)Mt

  19. Mt Wheeler Power, Inc | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to: navigation,Mereg GmbHMontebalitoMt Princeton Hot Springs

  20. Marysville Mt Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville Mt Geothermal Area Jump to: navigation, search

  1. Mt Signal Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to: navigation, searchsource HistoryCharleston,Peak Utility Jump to:PosoMt

  2. nh Gi Tn Hi Ti Nguyn Thin Nhin do Trn Du Deep Horizon Gim nh bt Nhm Tng ni

    E-Print Network [OSTI]

    vng v c kim. Thit b dy cu vng s v tnh bt phi nhng loi c khc cng nh nhng c th cn qu nh ca l thi gian ngh ngi. Cc d n cng cung cp cho nhng ng dn tham gia hai loi thit b nh bt thay th - tr

  3. Proton transfer dynamics of the reaction H3O ,,NH3 ,H2O...NH4

    E-Print Network [OSTI]

    Farrar, James M.

    Proton transfer dynamics of the reaction H3O ,,NH3 ,H2O...NH4 studied using the crossed, Rochester, New York 14627 Received 29 September 2003; accepted 8 October 2003 The proton transfer reaction sharply asymmetry, and the maximum is close to the velocity and direction of the precursor ammonia beam

  4. Water Sampling At Mt Princeton Hot Springs Geothermal Area (Olson...

    Open Energy Info (EERE)

    Water Sampling At Mt Princeton Hot Springs Geothermal Area (Olson & Dellechaie, 1976) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water...

  5. Refraction Survey At Mt Princeton Hot Springs Geothermal Area...

    Open Energy Info (EERE)

    Refraction Survey At Mt Princeton Hot Springs Geothermal Area (Lamb, Et Al., 2012) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Refraction...

  6. 3D Mt Resistivity Imaging For Geothermal Resource Assessment...

    Open Energy Info (EERE)

    3D Mt Resistivity Imaging For Geothermal Resource Assessment And Environmental Mitigation At The Glass Mountain Kgra, California Jump to: navigation, search OpenEI Reference...

  7. Vertical Electrical Sounding Configurations At Mt Princeton Hot...

    Open Energy Info (EERE)

    Vertical Electrical Sounding Configurations At Mt Princeton Hot Springs Geothermal Area (Zohdy, Et Al., 1971) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home...

  8. Direct-Current Resistivity Survey At Mt Princeton Hot Springs...

    Open Energy Info (EERE)

    Direct-Current Resistivity Survey At Mt Princeton Hot Springs Area (Richards, Et Al., 2010) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity:...

  9. Geothermometry At Mt Princeton Hot Springs Geothermal Area (Pearl...

    Open Energy Info (EERE)

    Et Al., 1976) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Geothermometry At Mt Princeton Hot Springs Geothermal Area (Pearl, Et Al., 1976)...

  10. Scaling regression inputs by dividing by 2 sd Prior distribution for logistic regression

    E-Print Network [OSTI]

    Gelman, Andrew

    Scaling regression inputs by dividing by 2 sd Prior distribution for logistic regression Comparing Andrew Gelman Some Recent Progress in Simple Statistical Methods #12;Scaling regression inputs by dividing by 2 sd Prior distribution for logistic regression Comparing the upper third to the lower third

  11. MT3DMS v5.3 Supplemental User's Guide

    E-Print Network [OSTI]

    Zheng, Chunmiao

    published by the U.S. Army Corps of Engineers (Zheng and Wang, 1999; available at http://hydro.geo.ua.edu/mt3d). Readers should refer to Zheng and Wang (1999) for complete information on the theoretical Tonkin, Henning Prommer, Chris Langevin, Ned Banta, Eileen Poeter, and Rui Ma in various aspects of MT3

  12. MOBILE INTERACTIVE VISITOR INFORMATION SERVICE: PUKAHA MT. BRUCE TRIAL RESULTS

    E-Print Network [OSTI]

    Zealand Tourism Research Institute Sept 2005 #12;New Zealand Tourism Research Institute September 2005 www Information Service (MIVIS) mobile phones to access audio information at Pukaha Mt Bruce (PMB) were collected and range of visitors using the MIVIS phones in the Pukaha Mt Bruce setting. #12;New Zealand Tourism

  13. WPA Omnibus Award MT Wind Power Outreach

    SciTech Connect (OSTI)

    Brian Spangler, Manager Energy Planning and Renewables

    2012-01-30

    The objective of this grant was to further the development of Montana??s vast wind resources for small, medium, and large scale benefits to Montana and the nation. This was accomplished through collaborative work with wind industry representatives, state and local governments, the agricultural community, and interested citizens. Through these efforts MT Dept Environmental Quality (DEQ) was able to identify development barriers, educate and inform citizens, as well as to participate in regional and national dialogue that will spur the development of wind resources. The scope of DEQ??s wind outreach effort evolved over the course of this agreement from the development of the Montana Wind Working Group and traditional outreach efforts, to the current focus on working with the state??s university system to deliver a workforce trained to enter the wind industry.

  14. CHARACTERIZATION OF THE SELECTIVE REDUCTION OF NO BY NH3

    E-Print Network [OSTI]

    Lucas, D.

    2014-01-01

    in this study. with coal type. limiting the NH The optimumlight oil and several types of coal, and have provided somecombustion air. Several types of coal with different sulfur

  15. Mineralogic variation in drill holes USW NRG-6, NRG-7/7a, SD-7, SD-9, SD-12, and UZ{number_sign}14: New data from 1996--1997 analyses

    SciTech Connect (OSTI)

    Chipera, S.J.; Vaniman, D.T.; Bish, D.L.; Carey, J.W.

    1997-05-30

    New quantitative X-ray diffraction (QXRD) mineralogic data have been obtained for samples from drill holes NRG-6, NRG-7/7A, SD-7, SD-9, SD- 12, and UZ{number_sign}14. In addition, new QXRD analyses were obtained on samples located in a strategic portion of drill hole USW H-3. These data improve our understanding of the mineral stratigraphy at Yucca Mountain, and they further constrain the 3-D Mineralogic Model of Yucca Mountain. Some of the unexpected findings include the occurrence of the zeolite chabazite in the vitric zone of USW SD-7, broad overlap of vitric and zeolitic horizons (over vertical ranges up to 70 m), and the previously unrecognized importance of the bedded tuft beneath the Calico Hills Formation as a subunit with generally more extensive zeolitization than the Calico Hills Formation in the southern part of the potential repository area. Reassessment of data from drill hole USW H-5 suggests that the zeolitization of this bedded unit occurs in the northwestern part of the repository exploration block as well. Further analyses of the same interval in USW H-3, however, have not permitted the same conclusion to be reached for the southwestern part of the repository block because of the much poorer quality of the cuttings in H-3 compared with those from H-5. X-ray fluorescence (XRF) chemical data for drill holes USW SD-7, 9, and 12 show that the zeolitic horizons provide a >10 million year record of retardation of Sr transport, although the data also show that simplistic models of one-dimensional downward flow in the unsaturated zone (UZ) are inadequate. Complex interstratification of zeolites and glass, with highly variable profiles between drill cores, point to remaining problems in constructing detailed mineral stratigraphies. However, the new data in this report provide important information for constructing bounding models of zeolite stratigraphy for transport calculations.

  16. Recycling Lingware in a Multilingual MT System Steffen Leo Hansen

    E-Print Network [OSTI]

    Recycling Lingware in a Multilingual MT System Steffen Leo Hansen Manny Rayner David Carter Ivan (Rayner and Carter, 1997). The first is the most obvious: we start with a function- ing grammar

  17. Ground Gravity Survey At Mt Princeton Hot Springs Geothermal...

    Open Energy Info (EERE)

    lithologic distrubtions Notes Gravity low associated with Mt. Princeton Batholith; density contrast of -0.5 gcm3 of valley-fill sediments relative to batholith References J.E....

  18. NEAFS Y-mtDNA Workshop (Butler and Coble) November 1, 2006

    E-Print Network [OSTI]

    NEAFS Y-mtDNA Workshop (Butler and Coble) mtDNA November 1, 2006 http://www.cstl.nist.gov/biotech) mtDNA November 1, 2006 http://www.cstl.nist.gov/biotech/strbase/training.htm 2 Data Review-mtDNA Workshop (Butler and Coble) mtDNA November 1, 2006 http://www.cstl.nist.gov/biotech/strbase/training.htm 3

  19. Mt St Helens Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | OpenMt St HelensMt St

  20. Selective Catalytic Oxidation (SCO) of NH3 to N2 for Hot Exhaust...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Oxidation (SCO) of NH3 to N2 for Hot Exhaust Treatment Selective Catalytic Oxidation (SCO) of NH3 to N2 for Hot Exhaust Treatment Investigation of a series of transition metal...

  1. Study of On-Board Ammonia (NH3) Generation for SCR Operation...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Study of On-Board Ammonia (NH3) Generation for SCR Operation Study of On-Board Ammonia (NH3) Generation for SCR Operation The feasibility of on-board ammonia generation was...

  2. Canister storage building compliance assessment SNF project NRC equivalency criteria - HNF-SD-SNF-DB-003

    SciTech Connect (OSTI)

    BLACK, D.M.

    1999-08-11

    This document presents the Project's position on compliance with the SNF Project NRC Equivalency Criteria--HNF-SD-SNF-DE-003, Spent Nuclear Fuel Project Path Forward Additional NRC Requirements. No non-compliances are shown The compliance statements have been reviewed and approved by DOE. Open items are scheduled to be closed prior to project completion.

  3. sd2 Graphene: Kagome Band in a Hexagonal Lattice Miao Zhou,1

    E-Print Network [OSTI]

    Simons, Jack

    sd2 Graphene: Kagome Band in a Hexagonal Lattice Miao Zhou,1 Zheng Liu,1 Wenmei Ming,1 Zhengfei 2014; published 2 December 2014) Graphene, made of sp2 hybridized carbon, is characterized with a Dirac band, representative of its underlying 2D hexagonal lattice. The fundamental understanding of graphene

  4. 1 -NH Coverts Project: 1995-2002 Program Evaluation The New Hampshire Coverts Project

    E-Print Network [OSTI]

    New Hampshire, University of

    1 - NH Coverts Project: 1995-2002 Program Evaluation The New Hampshire Coverts Project In Their Own, sexual orientation, or veteran's status. #12;2 - NH Coverts Project: 1995-2002 Program Evaluation of responses to open-ended question (#12) 19 #12;3 - NH Coverts Project: 1995-2002 Program Evaluation

  5. Probing the lexicon in evaluating commercial MT systems Martin Volk

    E-Print Network [OSTI]

    for self evaluation consisted of technical, linguistic and ergonomic issues. As part of the linguisticProbing the lexicon in evaluating commercial MT systems Martin Volk University of Zurich Department Abstract In the past the evaluation of machine trans- lation systems has focused on single sys- tem

  6. Effects of reactant rotational excitations on H{sub 2} + NH{sub 2} ? H + NH{sub 3} reactivity

    SciTech Connect (OSTI)

    Song, Hongwei; Guo, Hua

    2014-12-28

    Rotational mode specificity of the title reaction is examined using an initial state selected time-dependent wave packet method on an accurate ab initio based global potential energy surface. This penta-atomic reaction presents an ideal system to test several dynamical approximations, which might be useful for future quantum dynamics studies of polyatomic reactions, particularly with rotationally excited reactants. The first approximation involves a seven-dimensional (7D) model in which the two non-reactive NH bonds are fixed at their equilibrium geometry. The second is the centrifugal sudden (CS) approximation within the 7D model. Finally, the J-shifting (JS) model is tested, again with the fixed NH bonds. The spectator-bond approximation works very well in the energy range studied, while the centrifugal sudden and J-shifting integral cross sections (ICSs) agree satisfactorily with the coupled-channel counterparts in the low collision energy range, but deviate at the high energies. The calculated integral cross sections indicate that the rotational excitation of H{sub 2} somewhat inhibits the reaction while the rotational excitations of NH{sub 2} have little effect. These findings are compared with the predictions of the sudden vector projection model. Finally, a simple model is proposed to predict rotational mode specificity using K-averaged reaction probabilities.

  7. (Have we found the Holy Grail?) Panel at MT-Summit 2003

    E-Print Network [OSTI]

    Wu, Dekai

    (Have we found the Holy Grail?) Panel at MT-Summit 2003 #12;The HKUST Leading Question Translation? If not, is the Holy Grail just around the corner? Translation Are we just about done? #12;Dekai Wu, MT

  8. Geothermal energy resource investigations at Mt. Spurr, Alaska

    SciTech Connect (OSTI)

    Turner, D.L.; Wescott, E.M. (eds.)

    1986-12-01

    Spurr volcano is a composite Quaternary cone of largely andesitic composition located on the west side of Cook Inlet about 80 miles west of Anchorage and about 40 miles from the Beluga electrical transmission line. Geologic mapping (Plate 1-1) shows that the present summit depression was produced by a Mt. St. Helens-type sector collapse, rather than by a caldera collapse. Geochronologic and previous tephrachronologic studies show that there has been an active magmatic system at Spurr volcano during the late Pleistocene-to-Holocene time interval that is of critical interest for geothermal energy resource assessment. Major effort was devoted to geochemical and geophysical surveys of the accessible area south of Mt. Spurr, in addition to geologic mapping and geochronologic studies. Many coincident mercury and helium anomalies were found, suggesting the presence of geothermal systems at depth. Extremely large electrical self-potential anomalies were also found, together with extensive zones of low resistivity discovered by our controlled-source audiomagnetotelluric survey. The juxtaposition of all of these different types of anomalies at certain areas on the south slope of Crater Peak indicates the presence of a geothermal system which should be accessible by drilling to about 2000 ft depth. It is also evident that there is a strong volcanic hazard to be evaluated in considering any development on the south side of Mt. Spurr. This hazardous situation may require angle drilling of production wells from safer areas and placement of power generation facilities at a considerable distance from hazardous areas.

  9. Hollow-fiber gas-membrane process for removal of NH{sub 3} from solution of NH{sub 3} and CO{sub 2}

    SciTech Connect (OSTI)

    Qin, Y.; Cabral, J.M.S.; Wang, S.

    1996-07-01

    A hollow-fiber supported gas membrane process for the separation of NH{sub 3} from aqueous solutions containing both NH{sub 3} and CO{sub 2} was investigated theoretically and experimentally. A lumen laminar flow and radial diffusion model was applied to calculate the membrane wall transfer coefficient from the data stripping a single volatile component, NH{sub 3} or CO{sub 2}, from their individual aqueous solutions. Influence of the type of membranes and operating conditions on mass-transfer rate were discussed, especially the influence of the membrane transfer coefficient on the film mass-transfer coefficient in the lumen. Appropriate configurations of the hollow-fiber modules for stripping of a single component were analyzed to optimize mass transfer. To predict the stripping of NH{sub 3} from a solution containing NH{sub 3} and CO{sub 2}, a mathematical model incorporating local chemical equilibria and Nernst-Planck diffusion was developed to describe the mass transport. The models described the experimental data fairly well. The experimental results showed that the supported gas membrane process can be used to remove NH{sub 3} effectively from aqueous media containing NH{sub 3} and CO{sub 2}.

  10. File:USDA-CE-Production-GIFmaps-SD.pdf | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New Pages RecentTempCampApplicationWorksheet 2011.pdfSD.pdf Jump to: navigation, search File

  11. Modeling Study of SCR/PGM Interactions in NH3 Slip Catalysts

    Broader source: Energy.gov [DOE]

    The focus of this research is on the optimization of NH3 slip catalyst performance by simulating the behavior of different SCR/PGM configurations.

  12. Opal Palmer Adisa. It Begins With Tears (Portsmouth, NH: Heinemann Press, 1997).

    E-Print Network [OSTI]

    Devlin, Leslie

    1997-01-01

    Opal Palmer Adisa. It Begins With Tears (Portsmouth, NH:Tears, is the first novel of Opal Palmer Adisa. She was born

  13. Mt St Helens Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | OpenMt St Helens

  14. MT Energie GmbH Co KG | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma,Information MHKMHK5 < MHKKemblaSolar Jump to:Industries Inc JumpMT

  15. RAPID/Roadmap/12-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevada <UtahMontanasourceWA-aCA-aMT-a <

  16. RAPID/Roadmap/15-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ | RoadmapCO-ceWA-eb <MT-a

  17. RAPID/Roadmap/17-MT-c | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ |a < RAPID‎CA-aHI-aaMT-c

  18. RAPID/Roadmap/18-MT-b | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ |a <-AK-b <CO-badMT-b

  19. RAPID/Roadmap/4-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎f <CA-aab <cdMT-a <

  20. RAPID/Roadmap/6-MT-d | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎fRAPID/Roadmap/6-CO-bacMT-d

  1. RAPID/Roadmap/6-MT-f | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎fRAPID/Roadmap/6-CO-bacMT-df

  2. City of Mt Pleasant, Utah (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler, Iowa (UtilityIowa Phone Number: (319) 385-2121City of Mt

  3. Mt Princeton Hot Springs Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to: navigation,Mereg GmbHMontebalitoMt Princeton Hot Springs Geothermal

  4. RAPID/Roadmap/14-MT-b | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-a <CA-cID-aMT-b <

  5. RAPID/Roadmap/14-MT-c | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-a <CA-cID-aMT-b

  6. RAPID/Roadmap/14-MT-d | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-a <CA-cID-aMT-bd

  7. RAPID/Roadmap/17-MT-d | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-ad-MT-d < RAPID‎ |

  8. RAPID/Roadmap/20-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-a < RAPID‎ |MT-a <

  9. RAPID/Roadmap/8-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-abFD-a < RAPID‎ID-eMT-a

  10. Micro-Earthquake At Marysville Mt Area (Blackwell) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville MtMedicalInformation 2-2005)1995) |Information

  11. HERO Ski Trip to Mt. Hood Meadows February

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (Journalvivo Low-Dose Low WeUpdateScienceForTrip to Mt. Hood Meadows

  12. nh Gi Thit Hi Ti Nguyn Thin Nhin Do S C Trn Du Deepwater Horizon

    E-Print Network [OSTI]

    ln cc bi bin trng bng phng. Vt liu ny cng c th nm thnh di nh di hai dm theo ng mc thy triu v di mc thy triu thuc pha Vnh Fort Pickens, thnh thong khch thm cng hay bi li ch ny. Cc mnh nh nha

  13. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    Strategies for Rural Communities. National Conference onallocation facing the rural community of Mt. Laguna? (EquityStrategies for Rural Communities. National Conference on

  14. DC Resistivity Survey (Dipole-Dipole Array) At Mt Princeton Hot...

    Open Energy Info (EERE)

    1971) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: DC Resistivity Survey (Dipole-Dipole Array) At Mt Princeton Hot Springs Geothermal Area...

  15. Source identification in acoustics and structural mechanics using Sierra/SD.

    SciTech Connect (OSTI)

    Walsh, Timothy Francis; Aquino, Wilkins; Ross, Michael

    2013-03-01

    In this report we derive both time and frequency-domain methods for inverse identification of sources in elastodynamics and acoustics. The inverse/design problem is cast in a PDE-constrained optimization framework with efficient computation of gradients using the adjoint method. The implementation of source inversion in Sierra/SD is described, and results from both time and frequency domain source inversion are compared to actual experimental data for a weapon store used in captive carry on a military aircraft. The inverse methodology is advantageous in that it provides a method for creating ground based acoustic and vibration tests that can reduce the actual number of flight tests, and thus, saving costs and time for the program.

  16. Simulation of an Ar/NH{sub 3} low pressure magnetized direct current discharge

    SciTech Connect (OSTI)

    Li Zhi [School of Science, University of Science and Technology Liaoning, Anshan 114051 (China); School of Physics and Optoelectronic Engineering, Dalian University of Technology, Dalian 116024 (China); Zhao Zhen [School of Chemistry and Life Science, Anshan Normal University, Anshan 114007 (China); School of Chemical Engineering, University of Science and Technology Liaoning, Anshan 114051 (China); Li Xuehui [Physiccal Science and Technical College, Dalian University, Dalian 116622 (China)

    2013-01-15

    A two-dimensional fluid model has been used to investigate the properties of plasma in an Ar/NH{sub 3} low pressure magnetized direct current discharge. We compared the simulation results with the theoretical and experimental results of the other gas discharge in which the magnetic field is considered. Results that obtained using this method are in good agreement with literature. The simulation results show that the positive ammonia ion density follows the positive argon ion density. The Ar{sub 2}{sup +} density is slightly higher than the Ar{sup +} density at 100 mTorr. The largest ammonia ion is NH{sub 3}{sup +} ion, followed by NH{sub 2}{sup +}, NH{sub 4}{sup +}, and NH{sup +} ions. The contribution of NH{sup +} ions to the density of the positive ammonia ions is marginal. The influence of pressure on the plasma discharge has been studied by simulation, and the mechanisms have been discussed. The average plasma density increases as pressure increased. The plasma density appears to be more inhomogeneous than that at the lower pressure. The ratio of charge particles changed as pressure increased. The Ar{sup +} density is slightly higher than the Ar{sub 2}{sup +} density as the pressure increased. It makes NH{sub 4}{sup +} ratio increase as pressure increased. It shows that the electron temperature drops with rising pressure by numerical calculation.

  17. Global distributions, time series and error characterization of atmospheric ammonia (NH[subscript 3]) from IASI satellite observations

    E-Print Network [OSTI]

    Van Damme, M.

    Ammonia (NH[subscript 3]) emissions in the atmosphere have increased substantially over the past decades, largely because of intensive livestock production and use of fertilizers. As a short-lived species, NH[subscript 3] ...

  18. Visual Field Maps, Population Receptive Field Sizes, and Visual Field Coverage in the Human MT Complex

    E-Print Network [OSTI]

    Dumoulin, Serge O.

    of processing in human motion-selective cortex. I N T R O D U C T I O N Neuroimaging experiments localize human by additional experiments. Defining human MT based on stimulus selectivity means that the identificationVisual Field Maps, Population Receptive Field Sizes, and Visual Field Coverage in the Human MT

  19. Bitcoin Transaction Malleability and MtGox Christian Decker and Roger Wattenhofer

    E-Print Network [OSTI]

    Bitcoin Transaction Malleability and MtGox Christian Decker and Roger Wattenhofer ETH Zurich International Publishing Switzerland 2014 #12;314 C. Decker and R. Wattenhofer exchanges its monopoly slowly doubled the withdrawn bitcoins, once from the withdrawal and once on its account on MtGox. In this work we

  20. An assessment of regional climate trends and changes to the Mt. Jaya glaciers of Irian Jaya

    E-Print Network [OSTI]

    Kincaid, Joni L.

    2007-09-17

    on the Mt. Jaya glaciers has been lacking since the early 1970s. Using IKONOS satellite images, the ice extents of the Mt. Jaya glaciers in 2000, 2002, 2003, 2004, and 2005 were mapped. The mapping indicates that the recessional trend which began in the mid...

  1. Mt. Etna tropospheric ash retrieval and sensitivity analysis using Moderate Resolution Imaging

    E-Print Network [OSTI]

    Oxford, University of

    Mt. Etna tropospheric ash retrieval and sensitivity analysis using Moderate Resolution Imaging.pugnaghi@unimore.it, gabriele.gangale@unimore.it Abstract. A retrieval of tropospheric volcanic ash from Mt Etna has been. In order to derive the ash plume optical thickness, the particle effective radius and the total mass

  2. A MT System from Turkmen to Turkish Employing Finite State and Statistical Methods

    E-Print Network [OSTI]

    Yanikoglu, Berrin

    between close language pairs can be relatively easier and can still benefit from simple(r) paradigms in MT with a disambiguation post-processing stage based on statistical language models. The very productive inflectionalA MT System from Turkmen to Turkish Employing Finite State and Statistical Methods A. Cneyd TANTU

  3. Deep-Ultraviolet Resonance Raman Excitation Profiles of NH4NO3, PETN, TNT, HMX, and RDX

    E-Print Network [OSTI]

    Asher, Sanford A.

    Deep-Ultraviolet Resonance Raman Excitation Profiles of NH4NO3, PETN, TNT, HMX, and RDX Manash nitrate (NH4NO3), pentaerythritol tetranitrate (PETN), trinitrotoluene (TNT), nitroamine (HMX. The ultraviolet (UV) resonance Raman/differential Raman cross-sections of NH4NO3, PETN, TNT, HMX, and RDX

  4. CHARACTERIZATION STUDIES OF THE SELECTIVE REDUCTION OF NO by NH3

    E-Print Network [OSTI]

    Brown, N.J.

    2013-01-01

    and Maloney, K.L. , "NOx Reduction with Ammonia: Laboratoryand Hashizawa, K. , "Reduction of NOx in Combustion ExhaustSelective Noncatalytic Reduction of NOx with NH3," EPRI NOx

  5. NH3 generation over commercial Three-Way Catalysts and Lean-NOx...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    generation over commercial Three-Way Catalysts and Lean-NOx Traps NH3 generation over commercial Three-Way Catalysts and Lean-NOx Traps Research to identify most promising...

  6. NH3 generation over commercial Three-Way Catalysts and Lean-NOx Traps

    Broader source: Energy.gov [DOE]

    Research to identify most promising catalytic formulations and operation for the in-situ generation of NH3, storage on a downstream SCR catalyst, and utilized to reduce the remaining NOx

  7. Rare Earth ? N = N* fs fGHZ fp nH fl

    E-Print Network [OSTI]

    Walter, Frederick M.

    Rare Earth ? #12;N to date N = N* fs fGHZ fp nH fl N* = 4 x 1011 fs = 0.2 fGHZ = 0.1 fp = 0.8 nH = 2 fl = 1.0 N = 1.3 x 1010 #12;The Goldilocks Effect Earth is "Just Right" Yes, life on Earth has adapted to Earth, but ... Earth has just the right mass to be Tectonically-active Retain

  8. Baltic Astronomy, vol. 14, XXXXXX, 2005. SPECTRAL ANALYSIS OF sdB-He STARS FROM THE SDSS

    E-Print Network [OSTI]

    2005 July 28 Abstract. We present spectral classification and physical parameters of a sam- ple of "helium-rich" sdB-He stars from spectra obtained from the SDSS archive. The spectral classification discovered amongst the many thousand hot subdwarfs in the recent Quasar survey the Sloan Digital Sky Survey

  9. Baltic Astronomy, vol. 14, XXX--XXX, 2005. SPECTRAL ANALYSIS OF sdBHe STARS FROM THE SDSS

    E-Print Network [OSTI]

    Jeffery, Simon

    2005 July 28 Abstract. We present spectral classification and physical parameters of a sam ple of ``heliumrich'' sdBHe stars from spectra obtained from the SDSS archive. The spectral classification discovered amongst the many thousand hot subdwarfs in the recent Quasar survey -- the Sloan Digital Sky

  10. Extending the GHS Weil Descent Attack S.D. Galbraith, F. Hess and N.P. Smart

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    Extending the GHS Weil Descent Attack S.D. Galbraith, F. Hess and N.P. Smart Department of Computer Science, University of Bristol, Merchant Venturers Building, Woodland Road, Bristol, BS8 1UB, United due to Gaudry, Hess and Smart (GHS) to a much larger class of elliptic curves. This extended attack

  11. Volume 130, number 6 CHEMICAL PHYSICS LETTERS 24 October1986 VIBRATIONAL DEPENDENCE OF THE NH,+ (v2)+NO AND NO+(v) +NH,

    E-Print Network [OSTI]

    bending mode ( vz=O-12) causes no marked change in the charge transfer cross section, while in the reverse vibrational levels. We find that the vibrational excitation of the NH: v2 umbrella bending mode (v, = O-12 with the hope of con- firming or refuting this model. 2. Experimental In a previous paper we reported

  12. Proposal for the Award of a Contract for the Civil Engineering Work on the Extensions to Buildings SUH and SD at LEP Access point nr. 2

    E-Print Network [OSTI]

    1990-01-01

    Proposal for the Award of a Contract for the Civil Engineering Work on the Extensions to Buildings SUH and SD at LEP Access point nr. 2

  13. MT3D: a 3 dimensional magnetotelluric modeling program (user's guide and documentation for Rev. 1)

    SciTech Connect (OSTI)

    Nutter, C.; Wannamaker, P.E.

    1980-11-01

    MT3D.REV1 is a non-interactive computer program written in FORTRAN to do 3-dimensional magnetotelluric modeling. A 3-D volume integral equation has been adapted to simulate the MT response of a 3D body in the earth. An integro-difference scheme has been incorporated to increase the accuracy. This is a user's guide for MT3D.REV1 on the University of Utah Research Institute's (UURI) PRIME 400 computer operating under PRIMOS IV, Rev. 17.

  14. Improved determination of the atmospheric parameters of the pulsating sdB star Feige 48

    SciTech Connect (OSTI)

    Latour, M.; Fontaine, G.; Brassard, P.; Green, E. M.; Chayer, P.

    2014-06-10

    As part of a multifaceted effort to better exploit the asteroseismological potential of the pulsating sdB star Feige 48, we present an improved spectroscopic analysis of that star based on new grids of NLTE, fully line-blanketed model atmospheres. To that end, we gathered four high signal-to-noise ratio time-averaged optical spectra of varying spectral resolutions from 1.0 to 8.7 , and we made use of the results of four independent studies to fix the abundances of the most important metals in the atmosphere of Feige 48. The mean atmospheric parameters we obtained from our four spectra of Feige 48 are: T {sub eff} = 29,850 60 K, log g = 5.46 0.01, and log N(He)/N(H) = 2.88 0.02. We also modeled, for the first time, the He II line at 1640 from the STIS archive spectrum of the star, and with this line we found an effective temperature and a surface gravity that match well with the values obtained with the optical data. With some fine tuning of the abundances of the metals visible in the optical domain, we were able to achieve a very good agreement between our best available spectrum and our best-fitting synthetic one. Our derived atmospheric parameters for Feige 48 are in rather good agreement with previous estimates based on less sophisticated models. This underlines the relatively small effects of the NLTE approach combined with line blanketing in the atmosphere of this particular star, implying that the current estimates of the atmospheric parameters of Feige 48 are reliable and secure.

  15. Tunable far infrared laser spectroscopy of van der Waals bonds: Ar-NH sub 3

    SciTech Connect (OSTI)

    Gwo, Dz-Hung (Lawrence Berkeley Lab., CA (USA) California Univ., Berkeley, CA (USA). Dept. of Chemistry)

    1989-11-01

    Hyperfine resolved vibration-rotation-tunneling spectra of Ar--NH{sub 3} and (NH{sub 3}){sub 2}, generated in a planar supersonic jet, have been measured with the Berkeley tunable far infrared laser spectrometer. Among the seven rotationally assigned bands, one band belongs to Ar--NH{sub 3}, and the other six belong to (NH{sub 3}){sub 2}. To facilitate the intermolecular vibrational assignment for Ar--NH{sub 3}, a dynamics study aided by a permutation-inversion group theoretical treatment is performed on the rovibrational levels. The rovibrational quantum number correlation between the free internal rotor limit and the semi-rigid limit is established to provide a basic physical picture of the evolution of intermolecular vibrational component states. An anomalous vibronically allowed unique Q branch vibrational band structure is predicted to exist for a near prolate binary complex containing an inverting subunit. According to the model developed in this work, the observed band of Ar--NH{sub 3} centered at 26.470633(17) cm{sup {minus}1} can correlate only to either the fundamental dimeric stretching band for the A{sub 2} states with the NH{sub 3} inversional quantum number v{sub i} = 1, or the K{sub a} = 0 {l arrow} 0 subband of the lowest internal-rotation-inversion difference band. Although the estimated nuclear quadrupole coupling constant favors a tentative assignment in terms of the first possibility, a definitive assignment will require far infrared data and a dynamical model incorporating a potential surface.

  16. NEAFS Y-mtDNA Workshop (Butler and Coble) Markers, Core Loci, and Kits

    E-Print Network [OSTI]

    ) Ann Gross (MN) Jill Smerick (FBI) Sam Baechtel (FBI) Roger Frappier (CFS) Phil Kinsey (OR now MT) Gary Sims (CA DOJ) George Carmody (retired) Mike Adamowicz (CT) Bruce Budowle (FBI

  17. TIME-VARIABLEFILTERING OF MtTLTI[CHANNELSIGNALS USING MULTIPLE WINDOWS COHERENCEAND THE WEYL TRANSFORM

    E-Print Network [OSTI]

    Sandsten, Maria

    TIME-VARIABLEFILTERING OF MtTLTI[CHANNELSIGNALS USING MULTIPLE WINDOWS COHERENCEAND THE WEYL between all channel pairs. Time-frequency coherence functions are estimated using the multiple window

  18. The Genetic Structure of the Kuwaiti Population: mtDNA Inter- and Intra-population Variation

    E-Print Network [OSTI]

    Theyab, Jasem; Al-Bustan, Suzanne; Crawford, Michael H.

    2012-08-01

    it to their neighboring populations. These subpopulations were tested for genetic homogeneity and shown to be heterogeneous. Restriction fragment length polymorphism (RFLP) and mtDNA sequencing analyses of HVRI were used to reconstruct the genetic structure of Kuwait...

  19. Numerical analysis of a mixture of Ar/NH{sub 3} microwave plasma chemical vapor deposition reactor

    SciTech Connect (OSTI)

    Li Zhi [School of Physics and Optoelectronic Engineering, Dalian University of Technology, Dalian 116024 (China); School of Science, University of Science and Technology Liaoning, Anshan 114051 (China); Zhao Zhen [Chemistry Department, Anshan Normal University, Anshan 114007 (China); School of Chemical Engineering, University of Science and Technology Liaoning, Anshan 114051 (China); Li Xuehui [School of Physics and Optoelectronic Engineering, Dalian University of Technology, Dalian 116024 (China); Physical Science and Technical College, Dalian University, Dalian 116622 (China)

    2012-06-01

    A two-dimensional fluid model has been used to investigate the properties of plasma in Ar/NH{sub 3} microwave electron cyclotron resonance discharge at low pressure. The electromagnetic field model solved by the three-dimensional Simpson method is coupled to a fluid plasma model. The finite difference method was employed to discrete the governing equations. 40 species (neutrals, radicals, ions, and electrons) are consisted in the model. In total, 75 electron-neutral, 43 electron-ion, 167 neutral-neutral, 129 ion-neutral, 28 ion-ion, and 90 3-body reactions are used in the model. According to the simulation, the distribution of the densities of the considered plasma species has been showed and the mechanisms of their variations have been discussed. It is found that the main neutrals (Ar*, Ar**, NH{sub 3}{sup *}, NH, H{sub 2}, NH{sub 2}, H, and N{sub 2}) are present at high densities in Ar/NH{sub 3} microwave electron cyclotron resonance discharge when the mixing ratio of Ar/NH{sub 3} is 1:1 at 20 Pa. The density of NH is more than that of NH{sub 2} atom. And NH{sub 3}{sup +} are the most important ammonia ions. But the uniformity of the space distribution of NH{sub 3}{sup +} is lower than the other ammonia ions.

  20. Implied motion activation in cortical area MT can be explained by visual low-level features

    E-Print Network [OSTI]

    Oram, Mike

    ForReview Only Implied motion activation in cortical area MT can be explained by visual low Neuroscience #12;ForReview Only 1 Implied motion activation in cortical area MT can be explained by visual low, The Netherlands Page 1 of 51 Jounal of Cognitive Neuroscience 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

  1. Thermal Durability of Cu-CHA NH3-SCR Catalysts for Diesel NOx Reduction

    SciTech Connect (OSTI)

    Schmieg, Steven J.; Oh, Se H.; Kim, Chang H.; Brown, David B.; Lee, Jong H.; Peden, Charles HF; Kim, Do Heui

    2012-04-30

    Multiple catalytic functions (NOx conversion, NO and NH3 oxidation, NH3 storage) of a commercial Cu-zeolite urea/NH3-SCR catalyst were assessed in a laboratory fixed-bed flow reactor system after differing degrees of hydrothermal aging. Catalysts were characterized by using x-ray diffraction (XRD), 27Al solid state nuclear magnetic resonance (NMR) and transmission electron microscopy (TEM) / energy dispersive X-ray (EDX) spectroscopy to develop an understanding of the degradation mechanisms during catalyst aging. The catalytic reaction measurements of laboratory-aged catalysts were performed, which allows us to obtain a universal curve for predicting the degree of catalyst performance deterioration as a function of time at each aging temperature. Results show that as the aging temperature becomes higher, the zeolite structure collapses in a shorter period of time after an induction period. The decrease in SCR performance was explained by zeolite structure destruction and/or Cu agglomeration, as detected by XRD/27Al NMR and by TEM/EDX, respectively. Destruction of the zeolite structure and agglomeration of the active phase also results in a decrease in the NO/NH3 oxidation activity and the NH3 storage capacity of the catalyst. Selected laboratory aging conditions (16 h at 800oC) compare well with a 135,000 mile vehicle-aged catalyst for both performance and characterization criteria.

  2. A Review & Assessment of Current Operating Conditions Allowable Stresses in ASME Section III Subsection NH

    SciTech Connect (OSTI)

    R. W. Swindeman

    2009-12-14

    The current operating condition allowable stresses provided in ASME Section III, Subsection NH were reviewed for consistency with the criteria used to establish the stress allowables and with the allowable stresses provided in ASME Section II, Part D. It was found that the S{sub o} values in ASME III-NH were consistent with the S values in ASME IID for the five materials of interest. However, it was found that 0.80 S{sub r} was less than S{sub o} for some temperatures for four of the materials. Only values for alloy 800H appeared to be consistent with the criteria on which S{sub o} values are established. With the intent of undertaking a more detailed evaluation of issues related to the allowable stresses in ASME III-NH, the availabilities of databases for the five materials were reviewed and augmented databases were assembled.

  3. Formation of NH{sub 3} during the pyrolysis of a brown coal

    SciTech Connect (OSTI)

    Li, C.Z.; Pang, Y.; Li, X.G. [Monash Univ., Clayton, Victoria (Australia). Dept. of Chemical Engineering

    1998-12-31

    Emissions of oxides of nitrogen (NO, NO{sub 2} and N{sub 2}O) from power generation using coal are an important environmental problem, contributing to the formation of photochemical smog and acid rain or to the enhancement of greenhouse effects and to the enhanced depletion of stratospheric ozone. During pyrolysis, the nitrogen in coal, as a part of coal organic matter, is converted into NOx precursors (eg. NH{sub 3}, HCN, HNCO and the nitrogen in tar and char). These NOx precursors may then be converted into either NOx or N{sub 2} during subsequent combustion or gasification/combustion. The conversion efficiency of these NOx precursors into NOx depends strongly upon the type of NOx precursor. Knowledge of the formation of these NOx precursors during pyrolysis is therefore essential for the accurate predictions of NOx emissions from large scale power plants, and therefore for the development of optimum strategies for NOx reduction. Formation of NH{sub 3} during the pyrolysis of a Victorian brown coal (Loy Yang) has been studied in a novel reactor. The experimental results obtained suggest that a considerable amount of the nitrogen in the nascent char could be converted into NH{sub 3} if the char is held at high temperatures for a long period of time. The formation of NH{sub 3} from the thermal cracking of char was seen to last for more than an hour even at temperatures as high as 700--900 C. The experimental results seem to suggest that the differences in reactor geometries would account at least partially for some of the discrepancies in the literature regarding the formation of NH{sub 3} during the pyrolysis of coals. It is thought that NH{sub 3} may be formed from the hydrogenation of the N sites in the char by the active hydrogen generated from the thermal cracking of the char.

  4. NH13A: No-source tsunami forecasting for Alaska communities

    E-Print Network [OSTI]

    Tolkova, Elena

    NH13A: No-source tsunami forecasting for Alaska communities Dmitry Nicolsky (UAF) djnicolsky://nctr.pmel.noaa.gov/ Wave trains to Alaska: direction structure (time history) tsunami source R E S P and accurate regional tsunami forecasts A deep-ocean detector and a coastal site can be connected

  5. Experiment operations plan for the MT-4 experiment in the NRU reactor. [PWR

    SciTech Connect (OSTI)

    Russcher, G.E.; Wilson, C.L.; Parchen, L.J.; Marshall, R.K.; Hesson, G.M.; Webb, B.J.; Freshley, M.D.

    1983-06-01

    A series of thermal-hydraulic and cladding materials deformation experiments were conducted using light-water reactor fuel bundles as part of the Pacific Northwest Laboratory Loss-of-Coolant Accident (LOCA) Simulation Program. This report is the formal operations plan for MT-4 - the fourth materials deformation experiment conducted in the National Research Universal (NRU) reactor, Chalk River, Ontario, Canada. A major objective of MT-4 was to simulate a pressurized water reactor LOCA that could induce fuel rod cladding deformation and rupture due to a short-term adiabatic transient and a peak fuel cladding temperature of 1200K (1700/sup 0/F).

  6. VA VT CT RI MT WY CO ID UT OR NV CA AZ NM WA TN WV NC AR OK

    Broader source: Energy.gov (indexed) [DOE]

    2 1 Locations of Smart Grid Demonstration and Large-Scale Energy Storage Projects NH 32 Awards Support Projects in 24 States 6 11 MA...

  7. GM Media-Sept 21, 2007 PBS, NH4Cl and KCl

    E-Print Network [OSTI]

    GM Media- Sept 21, 2007 PBS, NH4Cl and KCl Final volume(L) 1 50 mM PBS 100 mM 200 mM Ingredient keep the PBS solution at room temperature. GM Media Preparation: For each litter of GM media add, mineral, and PBS solution if you are not going to use them inside MFC. Combine them prior to make GM media

  8. Dr. Joseph A. Shaw Electrical & Computer Engineering Dept., Montana State University, Bozeman, MT 59717

    E-Print Network [OSTI]

    Lawrence, Rick L.

    Dr. Joseph A. Shaw Electrical & Computer Engineering Dept., Montana State University, Bozeman, MT M.S. Electrical Engineering University of Utah 1987 B.S. Electrical Engineering University of Alaska Experience: 2008 present Professor Electrical & Computer Engineering (ECE) Department, Montana State

  9. Synchronous Dependency Insertion Grammars A Grammar Formalism for Syntax Based Statistical MT

    E-Print Network [OSTI]

    Synchronous Dependency Insertion Grammars A Grammar Formalism for Syntax Based Statistical MT Yuan formalism specifically designed for syntax-based sta- tistical machine translation. The synchro- nous between lan- guages, which many other synchronous grammars are unable to model. A Depend- ency Insertion

  10. MONTANA OUTDOORS 3130 MARCH APRIL 2014 FWP.MT.GOV/MTOUTDOORS Why mountain bluebirds

    E-Print Network [OSTI]

    Duckworth, Rene

    MONTANA OUTDOORS 3130 MARCH APRIL 2014 FWP.MT.GOV/MTOUTDOORS TURF WAR TWIST Why mountain bluebirds are good for this species in western Montana valleys but don't benefit, in the long run, mountain bluebirds. Although mountain blue- birds also lost nesting sites, they had evolved to also use habitats at higher

  11. Intermountain GIS Conference. April 1923 2010, Bozeman, MT. Patrick Lawrence, Maxwell BD, Rew LJ

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    Intermountain GIS Conference. April 1923 2010, Bozeman, MT. Patrick Lawrence, Maxwell BD, Rew in the Python programming language, drawing on Python's builtin library, the RPy extension, ArcGIS geoprocessing and ArcGIS Server. As inputs, it accepts transect shapefiles, transect text files, or point

  12. MT3DMS, A Modular Three-Dimensional Multispecies Transport Model User Guide to the

    E-Print Network [OSTI]

    Zheng, Chunmiao

    .M. Cozzarelli, M.H. Lahvis, and B.A. Bekins. 1998. Ground water contamination by crude oil near Bemidji (LNAPL) contaminant through the unsaturated zone and the formation of an oil lens on the water tableMT3DMS, A Modular Three-Dimensional Multispecies Transport Model User Guide to the Hydrocarbon

  13. Hybrid Rule-Based Example-Based MT: Feeding Apertium with Sub-sentential Translation Units

    E-Print Network [OSTI]

    Way, Andy

    Hybrid Rule-Based Example-Based MT: Feeding Apertium with Sub-sentential Translation Units Felipe Sanchez-Martinez Mikel L. Forcada Andy Way Dept. Llenguatges i Sistemes Inform`atics Universitat University Dublin 9, Ireland {mforcada,away}@computing.dcu.ie Abstract This paper describes a hybrid machine

  14. Stress magnitude and its temporal variation at Mt. Asama Volcano, Japan, from seismic anisotropy and GPS

    E-Print Network [OSTI]

    Utrecht, Universiteit

    Stress magnitude and its temporal variation at Mt. Asama Volcano, Japan, from seismic anisotropy stress Japan The Earth's stress regime is fundamental to its physical processes, yet few methods can determine absolute stress, and measurements of temporal variations in stress are controversial. The Global

  15. Some Effects of Mt. St. Helens Volcanic Ash on Juvenile Salmon Smolts

    E-Print Network [OSTI]

    Some Effects of Mt. St. Helens Volcanic Ash on Juvenile Salmon Smolts TIMOTHY W. NEWCOMB and THOMAS. Helens, which was completely decimated with vol- canic ash and mud slides. Heavy sediment loads smolts were exposed to various concentrations ofairborne volcanic ash from the 18 May 1980 eruption

  16. High-latitude vegetation dynamics: 850 years of vegetation development on Mt Hekla, Iceland

    E-Print Network [OSTI]

    Cutler, Nick

    2008-01-01

    on Mt Hekla in south-central Iceland. The chronosequence approach was used to infer 850 years of vegetation development from a suite of 14 lava flows (five of which had been disturbed by the deposition of volcanic tephra). The thesis is organised around...

  17. Geophys. 1. R. astr. Soc. (1987),89,7-18 MT and reflection: an essential combination

    E-Print Network [OSTI]

    Jones, Alan G.

    1987-01-01

    ) studies and seismic reflection profiles conducted. Unfortunately, over many more regions the seismic of the magnetotelluric (MT) technique as having a vertical resolution equivalent to the seismic refraction method, in almost every case, be made wherever a seismic reflection survey is undertaken. Examples are shown from

  18. [(CH3)4N][(C5H5NH)0.8((CH3)3NH)0.2]U2Si9O23F4 (USH-8): An Organically Templated Open-Framework Uranium Silicate

    E-Print Network [OSTI]

    Wang, Xiqu

    -Framework Uranium Silicate Xiqu Wang, Jin Huang, and Allan J. Jacobson* Department of Chemistry, Uni pyramids we obtained also a number of open-framework uranium silicates.18,19 These new compounds were-framework uranium fluorosilicate [(CH3)4N][(C5H5NH)0.8((CH3)3NH)0.2]U2Si9O23F4 (USH- 8) that has been synthesized

  19. T-Duality of Green-Schwarz Superstrings on AdS(d) x S(d) x M(10-2d)

    E-Print Network [OSTI]

    Abbott, Michael C; Penati, Silvia; Pittelli, Antonio; Sorokin, Dmitri; Sundin, Per; Tarrant, Justine; Wolf, Martin; Wulff, Linus

    2015-01-01

    We verify the self-duality of Green-Schwarz supercoset sigma models on AdS$_d \\times S^d $ backgrounds (d=2,3,5) under combined bosonic and fermionic T-dualities without gauge fixing kappa symmetry. We also prove this property for superstrings on AdS$_d \\times S^d \\times S^d$ (d=2,3) described by supercoset sigma models with the isometries governed by the exceptional Lie supergroups $D(2,1;\\alpha)$ (d=2) and $D(2,1;\\alpha)\\times D(2,1;\\alpha)$ (d=3), which requires an additional T-dualisation along one of the spheres. Then, by taking into account the contribution of non-supercoset fermionic modes (up to the second order), we provide evidence for the T-self-duality of the complete type IIA and IIB Green-Schwarz superstring theory on AdS$_d\\times S^d \\times T^{10-2d}$ (d=2,3) backgrounds with Ramond-Ramond fluxes. Finally, applying the Buscher-like rules to T-dualising supergravity fields, we prove the T-self-duality of the whole class of the AdS$_d\\times S^d \\times M^{10-2d}$ superbackgrounds with Ramond-Ramon...

  20. T-Duality of Green-Schwarz Superstrings on AdS(d) x S(d) x M(10-2d)

    E-Print Network [OSTI]

    Michael C. Abbott; Jeff Murugan; Silvia Penati; Antonio Pittelli; Dmitri Sorokin; Per Sundin; Justine Tarrant; Martin Wolf; Linus Wulff

    2015-09-25

    We verify the self-duality of Green-Schwarz supercoset sigma models on AdS$_d \\times S^d $ backgrounds (d=2,3,5) under combined bosonic and fermionic T-dualities without gauge fixing kappa symmetry. We also prove this property for superstrings on AdS$_d \\times S^d \\times S^d$ (d=2,3) described by supercoset sigma models with the isometries governed by the exceptional Lie supergroups $D(2,1;\\alpha)$ (d=2) and $D(2,1;\\alpha)\\times D(2,1;\\alpha)$ (d=3), which requires an additional T-dualisation along one of the spheres. Then, by taking into account the contribution of non-supercoset fermionic modes (up to the second order), we provide evidence for the T-self-duality of the complete type IIA and IIB Green-Schwarz superstring theory on AdS$_d\\times S^d \\times T^{10-2d}$ (d=2,3) backgrounds with Ramond-Ramond fluxes. Finally, applying the Buscher-like rules to T-dualising supergravity fields, we prove the T-self-duality of the whole class of the AdS$_d\\times S^d \\times M^{10-2d}$ superbackgrounds with Ramond-Ramond fluxes in the context of supergravity.

  1. Measurement and Modeling of Spatial NH3 Storage Distributions in a Commercial Small Port Cu Zeolite Urea SCR Catalyst

    Broader source: Energy.gov [DOE]

    A modified Spaci-IR technique can measure transient NH3 and NOx concentrations; data have been used to calibrate and validate an SCR model, with good agreement between experiments and simulations.

  2. SPECTROSCOPIC INVESTIGATION OF (NH4)2S TREATED GaSeTe FOR RADIATION DETECTOR APPLICATIONS

    SciTech Connect (OSTI)

    Nelson, A; Laurence, T; Conway, A; Behymer, E; Sturm, B; Voss, L; Nikolic, R; Payne, S; Mertiri, A; Pabst, G; Mandal, K; Burger, A

    2009-08-04

    The surface of the layered III-VI chalcogenide semiconductor GaSeTe was treated with (NH{sub 4}){sub 2}S at 60 C to modify the surface chemistry and determine the effect on transport properties. Room temperature photoluminescence (PL) measurements were used to assess the effect of the (NH{sub 4}){sub 2}S treatment on surface defect states. Evaluation of the subsequent surface chemistry was performed with high-resolution core-level photoemission measurements. Metal overlayers were deposited on the (NH{sub 4}){sub 2}S treated surfaces and the I-V characteristics were measured. The measurements were correlated to understand the effect of (NH{sub 4}){sub 2}S modification of the interfacial electronic structure with the goal of optimizing the metal/GaSeTe interface for radiation detector devices.

  3. Trigonometric Parallaxes for Two Late-Type Subdwarfs: LSR1425+71 (sdM8.0) and the Binary LSR1610-00 (sd?M6pec)

    E-Print Network [OSTI]

    C. C. Dahn; H. C. Harris; S. E. Levine; T. Tilleman; A. K. B. Monet; R. C. Stone; H. H. Guetter; B. Canzian; J. R. Pier; W. I. Hartkopf; J. Liebert; M. Cushing

    2008-06-13

    Trigonometric parallax astrometry and BVI photometry are presented for two late-type subdwarf candidates, LSR1425+71 (sdM8.0) and LSR1610-00 (sd?M6pec). For the former we measure an absolute parallax of 13.37+/-0.51 mas yielding Mv=15.25+/-0.09. The astrometry for LSR1610-00 shows that this object is an astrometric binary with a period of 1.66+/-0.01 yr. The photocentric orbit is derived from the data; it has a moderate eccentricity (e ~ 0.44+/-0.02) and a semi-major axis of 0.28+/-0.01 AU based on our measured absolute parallax of 31.02+/-0.26 mas. Our radial velocity measure of -108.1+/-1.6 km/s for LSR1610-00 at epoch 2006.179, when coupled with the observation of -95+/-1 km/s at epoch 2005.167 by Reiners & Basri, indicates a systemic radial velocity of -101+/-1 km/s for the LSR1610-00AB pair. The galactic velocity components for LSR1425+71 and LSR1610-00AB -- (U,V,W)=(84+/-6, -202+/-13, 66+/-14) km/s and (U,V,W)=(36+/-2, -232+/-2, -61+/-2) km/s, respectively. For both stars, the velocities are characteristic of halo population kinematics. However, modeling shows that both stars have orbits around the galaxy with high eccentricity that pass remarkably close to the galactic center. LSR1425+71 has a luminosity and colors consistent with its metal-poor subdwarf spectral classification, while LSR1610-00 has a luminosity and most colors indicative of being only mildly metal-poor, plus a uniquely red B-V color. The companion to LSR1610-00 must be a low-mass, substellar brown dwarf. We speculate on the paradoxical nature of LSR1610-00 and possible sources of its peculiarities.

  4. Structural transitions of ternary imide Li{sub 2}Mg(NH){sub 2} for hydrogen storage

    SciTech Connect (OSTI)

    Liang, C.; Gao, M. X.; Pan, H. G. Liu, Y. F.

    2014-08-25

    Phase transitions and energetic properties of Li{sub 2}Mg(NH){sub 2} with different crystal structures are investigated by experiments and first-principles calculations. The Li{sub 2}Mg(NH){sub 2} with the primitive cubic and orthorhombic structure is obtained by dynamically dehydrogenating a Mg(NH{sub 2}){sub 2}-2LiH mixture up to 280?C under an initial vacuum and 9.0?bars H{sub 2}, respectively. It is found that the obtained orthorhombic Li{sub 2}Mg(NH){sub 2} is converted to a primitive cubic structure as the dehydrogenation temperature is further increased to 400?C or performed by a 36?h of high-energetic ball milling. Moreover, the primitive cubic phase can be converted to an orthorhombic phase after heating at 280?C under 9.0?bars H{sub 2} for 1?h. Thermodynamic calculations show that the orthorhombic phase is the ground state structure of Li{sub 2}Mg(NH){sub 2}. The mechanism for phase transitions of Li{sub 2}Mg(NH){sub 2} is also discussed from the angle of energy.

  5. Hazard assessment in geothermal exploration: The case of Mt. Parker, Southern Philippines

    SciTech Connect (OSTI)

    Delfin, F.G. Jr.; Salonga, N.D.; Bayon, F.E.B.

    1996-12-31

    Hazard assessment of the Mt. Parker geothermal prospect, conducted in parallel with the surface exploration from 1992 to 1994, was undertaken to determine the long-term suitability of the prospect for development. By comparison with other acidic magmatic-hydrothermal systems in the Philippines, the geochemical data indicated minimal input of acidic magmatic fluids into Mt. Parker`s hydrothermal system. This system was regarded to be a neutral-pH and high-enthalpy chloride reservoir with temperature of at least 200-250{degrees}C. These favorable geochemical indications contrasted sharply with the C-14 and volcanological data indicating a shallow magmatic body with a potential for future eruption. This hazard led PNOC EDC to discontinue the survey and abandon the prospect by late 1994. On September 6, 1995, a flashflood of non-volcanic origin from the caldera lake killed nearly 100 people on the volcano`s northwestern flank.

  6. BiL4i|h@ EtU@ Q b @h3L 2ff L? 4i?L _ SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t ghyh u@hi *

    E-Print Network [OSTI]

    Catenacci, Roberto

    BiL4i|h@ EtU@ Q b @h3L 2ff L? 4i?L _ SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t ghyh u@hi *@*ic tLTh@ H t sxr u@hi *Ec fc i ~ ' Efc c f n |Ec fc f n rEfc fc E@ AhL@hi ?@ hi||@ o T@tt@?|i Tih *

  7. Rock Sampling At Mt Ranier Area (Frank, 1995) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/ColoradoRemsenburg-Speonk, NewMichigan: Energy Resources JumpMt Ranier Area (Frank, 1995)

  8. EC305 Problem Set 1 1. Let x(t) = m(t) cos 2fct, where m(t) is a real lowpass signal with bandwidth W and

    E-Print Network [OSTI]

    Bhashyam, Srikrishna

    EC305 Problem Set 1 1. Let x(t) = m(t) cos 2fct, where m(t) is a real lowpass signal with bandwidth a bandpass signal x(t) = m1(t) cos 2fct - m2(t) sin 2fct. (a) Determine the in-phase and quadrature components of this signal when the local os- cillators used have a phase offset of , i.e., they are cos (2fct

  9. Tidally dominated depositional environment for the Mt. Simon Sandstone in central Illinois

    SciTech Connect (OSTI)

    Sargent, M.L.; Lasemi, Z. (Illinois State Geological Survey, Champaign, IL (United States))

    1993-03-01

    Several hundred feet of core from the upper part of the Mt. Simon in central Illinois have been examined macroscopically. Grain sizes and their systematics, bedding characteristics, sedimentary structures, and relationships among beds show that the upper Mt. Simon Sandstone is composed of a series of fining-upward cycles up to 10 m (30 feet) thick. A typical cycle consists, in ascending order, of a sandy subtidal facies, a mixed sand and mud intertidal-flat facies, and a muddy upper tidal-flat facies upward through the succession, the maximum and average grain size becomes progressively finer and the cycles thinner. The lower sandstone of each cycle contains beds that are massive to cross bedded and cross laminated; some beds show scoured reactivation surfaces. A few cycles contain a middle unit characterized by flaser and lenticular bedding and abundant mudcracks. Mudcracks also are common in the shale beds at the top of each cycle. Sedimentary structures such as reactivation surfaces, flaser and lenticular bedding, and mudcracks suggest that these cycles were deposited in peritidal environments. The presence of Skolithos in some cycles suggests very shallow marine conditions. The within-cycle upward fining is caused by regression or progradation that reflects a progressive decrease in current velocity from subtidal to intertidal parts of the tidal flat. Frequent flooding of the tidal flat resulted in repeated fining-upward cycles within the upper part of the Mt. Simon Sandstone.

  10. Application of Remote Sensing Technology and Ecological Modeling of Forest Carbon Stocks in Mt. Apo Natural Park, Philippines

    E-Print Network [OSTI]

    Leal, Ligaya Rubas

    2015-01-23

    This dissertation work explored the application of remote sensing technology for the assessment of forest carbon storage in Mt. Apo Natural Park. Biomass estimation is traditionally conducted using destructive sampling with high levels...

  11. Sequence Stratigraphy and Detrital Zircon Geochronology of Middle-Late Ordovician Mt. Wilson Quartzite, British Columbia, Canada

    E-Print Network [OSTI]

    Hutto, Andrew Paul

    2012-07-16

    STRATIGRAPHY AND DETRITAL ZIRCON GEOCHRONOLOGY OF MIDDLE-LATE ORDOVICIAN MT. WILSON QUARTZITE, BRITISH COLUMBIA CANADA A Thesis by ANDREW PAUL HUTTO Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment... of the requirements for the degree of MASTER OF SCIENCE May 2012 Major Subject: Geology Sequence Stratigraphy and Detrital Zircon Geochronology of Middle-Late Ordovician Mt. Wilson...

  12. SD 13130019: ANOTHER SECOND-GENERATION STAR WITH [Fe/H] = ?5.0, OBSERVED WITH THE MAGELLAN TELESCOPE

    E-Print Network [OSTI]

    Chiti, Anirudh

    We present a Magellan/MIKE high-resolution (R ~ 35,000) spectrum of the ancient star SD 1313?0019, which has an iron abundance of [Fe/H] = -5.0, paired with a carbon enhancement of [C/Fe] ~ 3.0. The star was initially ...

  13. 50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links

    E-Print Network [OSTI]

    Allen, Gale

    that broadcast with a power of 50,000 Watts day and night. Some of these stations are what was once known50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links 50,000-Watt AM stations This list includes AM stations in the United States and Canada

  14. BANDO PER IL RECLUTAMENTO DI UN RICERCATORE CON RAPPORTO DI LAVORO A TEMPO DETERMINATO CO FINANZIATO DALLA REGIONE LAZIO PER IL SETTORE S/D

    E-Print Network [OSTI]

    Di Pillo, Gianni

    FINANZIATO DALLA REGIONE LAZIO PER IL SETTORE S/D BIO/09 PRESSO IL DIPARTIMENTO DI FISIOLOGIA E FARMACOLOGIA "VITTORIO ERSPAMER" Il Direttore del Dipartimento di Fisiologia e Farmacologia "Vittorio Erspamer" Visto il Regione Lazio Viste le Delibere del Consiglio del Dipartimento di Fisiologia e Farmacologia "Vittorio

  15. Wireless Internet Access To Real-Time Transit Information S.D. Maclean, University of Washington, Dept. of Electrical Engineering, Box 352500, Seattle,

    E-Print Network [OSTI]

    TRB 02-3863 Wireless Internet Access To Real-Time Transit Information S.D. Maclean, University departure times for buses at user-selectable geographic locations to Internet-enabled mobile devices.e., wired) Internet connectivity is not available. Wireless access to real-time transit information

  16. Top-Down Intelligent Reservoir Modeling (TDIRM) Y.Gomez, Y. Khazaeni, S.D. Mohaghegh, SPE, West Virginia University, R. Gaskari, Intelligent Solutions, Inc.

    E-Print Network [OSTI]

    Mohaghegh, Shahab

    aspects of an oil reservoir. The models include different reservoir saturation conditions (saturated or under-saturated), different number of wells and different distributions of reservoir characteristicsSPE 124204 Top-Down Intelligent Reservoir Modeling (TDIRM) Y.Gomez, Y. Khazaeni, S.D. Mohaghegh

  17. The thermal decomposition of NH{sub 2}OH and subsequent reactions : ab initio transition state theory and reflected shock tube experiments.

    SciTech Connect (OSTI)

    Klippenstein, S. J.; Harding, L. B.; Ruscic, B.; Sivaramakrishnan, R.; Srinivasan, N. K.; Su, M.-C.; Michael, J. V.; Chemical Sciences and Engineering Division; Sonoma State Univ.

    2009-01-01

    Primary and secondary reactions involved in the thermal decomposition of NH{sub 2}OH are studied with a combination of shock tube experiments and transition state theory based theoretical kinetics. This coupled theory and experiment study demonstrates the utility of NH{sub 2}OH as a high temperature source of OH radicals. The reflected shock technique is employed in the determination of OH radical time profiles via multipass electronic absorption spectrometry. O-atoms are searched for with atomic resonance absorption spectrometry. The experiments provide a direct measurement of the rate coefficient, k{sub 1}, for the thermal decomposition of NH{sub 2}OH. Secondary rate measurements are obtained for the NH{sub 2} + OH (5a) and NH{sub 2}OH + OH (6a) abstraction reactions. The experimental data are obtained for temperatures in the range from 1355 to 1889 K and are well represented by the respective rate expressions: log[k/(cm{sup 3} molecule{sup -1} s{sup -1})] = (?10.12 {+-} 0.20) + (?6793 {+-} 317 K/T) (k{sub 1}); log[k/(cm{sup 3} molecule{sup -1} s{sup -1})] = (?10.00 {+-} 0.06) + (?879 {+-} 101 K/T) (k{sub 5a}); log[k/(cm{sup 3} molecule{sup -1} s{sup -1})] = (?9.75 {+-} 0.08) + (?1248 {+-} 123 K/T) (k{sub 6a}). Theoretical predictions are made for these rate coefficients as well for the reactions of NH{sub 2}OH + NH{sub 2}, NH{sub 2}OH + NH, NH + OH, NH{sub 2} + NH{sub 2}, NH{sub 2} + NH, and NH + NH, each of which could be of secondary importance in NH{sub 2}OH thermal decomposition. The theoretical analyses employ a combination of ab initio transition state theory and master equation simulations. Comparisons between theory and experiment are made where possible. Modest adjustments of predicted barrier heights (i.e., by 2 kcal/mol or less) generally yield good agreement between theory and experiment. The rate coefficients obtained here should be of utility in modeling NO{sub x} in various combustion environments.

  18. Selective catalytic reduction of NOx with NH3 over a Cu-SSZ-13 catalyst prepared by a solid state ion exchange method

    SciTech Connect (OSTI)

    Wang, Di; Gao, Feng; Peden, Charles HF; Li, Junhui; Kamasamudram, Krishna; Epling, William S.

    2014-06-01

    A novel solid state method was developed to synthesize Cu-SSZ-13 catalysts with excellent NH3-SCR performance and durable hydrothermal stability. After the solid state ion exchange (SSIE) process, the SSZ framework structure and surface area was maintained. In-situ DRIFTS and NH3-TPD experiments provide evidence that isolated Cu ions were successfully exchanged into the pores, which are the active centers for the NH3-SCR reaction.

  19. NH3 formation and utilization in regenerationof Pt/Ba/Al2O3 NOx storage-reduction catalyst with H2

    SciTech Connect (OSTI)

    Partridge Jr, William P [ORNL; Choi, Jae-Soon [ORNL

    2009-01-01

    The nature of H2 regeneration of a model Pt/Ba/Al2O3 LNT catalyst was investigated with specific focus on intra-catalyst formation and utilization of NH3 and its role in catalyst regeneration. In-situ measurements of the transient intra-catalyst species (H2, NH3, N2, NOx) distributions at different temperatures were used to detail the reaction evolution along the catalyst axis. Comparison of the species transients identifies unique individual natures for the reductant (H2), inert product (N2) and intermediate-reductant product (NH3) which readily explain the conventional effluent species sequence as an integral effect. The data demonstrates that NH3 is created on similar timescales as the N2 product inside the catalyst, but consumed as aggressively as H2 reductant along the catalyst. This spatiotemporal NH3 behavior experimentally confirms that Intermediate-NH3 regeneration pathway is active. Analysis at 200 and 325 C indicates equivalent local NOx storage, H2 consumption and regeneration effectiveness, but differing NH3/N2 ratio, suggesting a temperature-dependence of partitioning between Direct-H2 and Intermediate-NH3 regeneration pathways. Further experimental and numerical work is needed to more clearly understand the partitioning between the possible regeneration pathways. Nevertheless, the experimental data show that intermediate NH3 plays a significant role in LNT catalyst regeneration.

  20. Havre, MT Natural Gas Pipeline Imports From Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969CentralWellsMillion Cubic Feet) Havre, MT Natural Gas Pipeline

  1. Weak Interaction Rates Of sd-Shell Nuclei In Stellar Environment Calculated in the Proton-Neutron Quasiparticle Random Phase Approximation

    E-Print Network [OSTI]

    J. -U. Nabi; H. V. Klapdor-Kleingrothaus

    1999-07-27

    Allowed weak interaction rates for sd-shell nuclei in stellar environment are calculated using a generalized form of proton-neutron quasiparticle RPA model with separable Gamow-Teller forces. Twelve different weak rates are calculated for each nucleus as a function of temperature and density. This project consists of calculation of weak rates for a total of 709 nuclei with masses ranging from A = 18 to 100. This paper contains calculated weak rates for sd-shell nuclei. The calculated capture and decay rates take into consideration the latest experimental energy levels and ft value compilations. The results are also compared with earlier works. Particle emission processes from excited states, previously ignored, are taken into account, and are found to significantly affect some beta decay rates.

  2. BiL4i|h@ EW?uLh4@|U@ Q 2 ti||i4Mhi 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t

    E-Print Network [OSTI]

    Catenacci, Roberto

    BiL4i|h@ EW?uLh4@|U@ Q 2 ti||i4Mhi 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t ghyh u@hi *hi *hi _@ U#12; @ AhL@hi ?@ M@ti _i* ?U*iL i ?@ M@ti _i**hi sff E i s!E _Li ' e 2e2 n e#12

  3. BiL4i|h@ EW?uLh4@|U@ Q D B}?L 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t

    E-Print Network [OSTI]

    Catenacci, Roberto

    BiL4i|h@ EW?uLh4@|U@ Q D B}?L 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t ghyh u@hi *hi *? % n + n 5 ' f i 2% + ' f E@ #4Lt|h@hi Ui *@ *LhL ?|ihti3L?i i ?@ hi||@ , i |hL@h?i *i i^@3L? E2 T

  4. BiL4i|h@ EW?uLh4@|U@ Q 2 6iMMh@L 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t

    E-Print Network [OSTI]

    Catenacci, Roberto

    BiL4i|h@ EW?uLh4@|U@ Q 2 6iMMh@L 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t ghyh u@hi *hi *hi _@|L _@**i i^@3L? E|%n2+|5 ' | c %|+n25 ' UL? | T@h@4i|hL hi@*i E@ AhL@hi ? @*Lhi _ | Tih U * tt|i4@ ?L? @ tL*3L

  5. BiL4i|h@ EW?uLh4@|U@ Q b }i??@L 2ff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t

    E-Print Network [OSTI]

    Catenacci, Roberto

    BiL4i|h@ EW?uLh4@|U@ Q b }i??@L 2ff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t ghyh u@hi *hi *?i % + n 5 ' f i * T?|L @ ' Ec c @ tUhihi *hi||@ T@tt@?|i Tih @ i Lh|L}L?@*i @ Z ?| #12; M

  6. BiL4i|h@ EW?uLh4@|U@ Q S w}*L 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t

    E-Print Network [OSTI]

    Catenacci, Roberto

    BiL4i|h@ EW?uLh4@|U@ Q S w}*L 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t ghyh u@hi *hi * 5 hULh_ Ui rR@? ij i * tL||LtT@3L }i?ih@|L _@ i||Lh UL?|i?| ?i**@ T@hi?|it E@ @*UL*@hi *i _4i

  7. Closed-loop control of a SCR system using a NOx sensor cross-sensitive to NH3

    E-Print Network [OSTI]

    for an automotive selective catalytic reduction (SCR) system, for which the feedback is based on a NOx sensor illustrate the performance of the proposed approach. Keywords: Automotive emissions; Diesel engines; NOx, a mechanism is introduced to prevent large NH3-slip that could result from misinterpretation of data produced

  8. Adapted from laboratory protocols of the Center for Freshwater Biology, University of New Hampshire, Durham, N.H. 2010

    E-Print Network [OSTI]

    New Hampshire, University of

    , Durham, N.H. 2010 UNH CFB Protocol for the Monitoring of Cyanobacteria & Microcystins in Drinking Water delivery to UNH CFB lab. 5. Freeze the sample if delivery/ drop-off time exceeds 12 hours. Analyses: a, Quantiplate-ELISA Kit, (Portland, Me) with increased sensitivity (UNH, CFB). Results will be reported as ng

  9. Role of hydrogen-bonding and its interplay with octahedral tilting in CH3NH3PbI3

    E-Print Network [OSTI]

    Lee, Jung-Hoon; Bristowe, Nicholas C.; Bristowe, Paul D.; Cheetham, Anthony K.

    2015-03-05

    First principles calculations on the hybrid perovskite CH3NH3PbI3 predict strong hydrogen-bonding which influences the structure and dynamics of the methylammonium cation and reveal its interaction with the tilting of the PbI6 octahedra...

  10. Ultralow Absorption Coefficient and Temperature Dependence of Radiative Recombination of CH3NH3PbI3 Perovskite from

    E-Print Network [OSTI]

    Perovskite from Photoluminescence Chog Barugkin, Jinjin Cong, The Duong, Shakir Rahman, Hieu T. Nguyen perovskite methylammonium lead iodide (CH3NH3PbI3) films from 675 to 1400 nm. Unlike other methods used of organic-inorganic halide perovskite- based solar cells has attracted enormous interest from the entire PV

  11. Access Management in Multi-Administration Networks S. P. Lord, N.H. Pope, and Susan Stepney

    E-Print Network [OSTI]

    Stepney, Susan

    Access Management in Multi-Administration Networks S. P. Lord, N.H. Pope, and Susan Stepney GEC by different administrations, and allowing these administrations to maintain autonomy but to use each others services. Consider also what happens if these administrations have different policies on how access should

  12. SD 1313-0019 -- Another second-generation star with [Fe/H] = -5.0, observed with the Magellan Telescope

    E-Print Network [OSTI]

    Frebel, Anna; Ji, Alexander P; Jacobson, Heather R; Placco, Vinicius M

    2015-01-01

    We present a Magellan/MIKE high-resolution (R ~ 35,000) spectrum of the ancient star SD 1313-0019 which has an iron abundance of [Fe/H] = -5.0, paired with a carbon enhancement of [C/Fe] ~ 3.0. The star was initially identified by Allende Prieto et al. in the BOSS survey. Its medium-resolution spectrum suggested a higher metallicity of [Fe/H] = -4.3 due to the CaII K line blending with a CH feature which is a common issue related to the search for the most iron-poor stars. This star joins several other, similar stars with [Fe/H] < -5.0 that all display a combination of low iron and high carbon abundances. Other elemental abundances of SD 1313-0019 follow that of more metal-rich halo stars. From fitting the abundance pattern with yields of Population III supernova, we conclude that SD 1313-0019 had only one massive progenitor star with 20 - 30 M_sun that must have undergone a mixing and fallback episode. Overall, there are now five stars known with [Fe/H] < -5.0 (1D LTE abundances). This population of se...

  13. Effect of sulfated CaO on NO reduction by NH{sub 3} in the presence of excess oxygen

    SciTech Connect (OSTI)

    Tianjin Li; Yuqun Zhuo; Yufeng Zhao; Changhe Chen; Xuchang Xu [Tsinghua University, Beijing (China). Key Laboratory for Thermal Science and Power Engineering of Ministry of Education

    2009-04-15

    The effect of sulfated CaO on NO reduction by NH{sub 3} in the presence of excess oxygen was investigated to evaluate the potential of simultaneous SO{sub 2} and NO removal at the temperature range of 700-850{sup o}C. The physical and chemical properties of the CaO sulfation products were analyzed to investigate the NO reduction mechanism. Experimental results showed that sulfated CaO had a catalytic effect on NO reduction by NH{sub 3} in the presence of excess O{sub 2} after the sulfation reaction entered the transition control stage. With the increase of CaO sulfation extent in this stage, the activity for NO reduction first increased and then decreased, and the selectivity of NH{sub 3} for NO reduction to N{sub 2} increased. The byproduct (NO{sub 2} and N{sub 2}O) formation during NO reduction experiments was negligible. X-ray photoelectron spectroscopy (XPS) analysis showed that neither CaSO{sub 3} nor CaS was detected, indicating that the catalytic activity of NO reduction by NH{sub 3} in the presence of excess O{sub 2} over sulfated CaO was originated from the CaSO{sub 4} product. These results revealed that simultaneous SO{sub 2} and NOx control by injecting NH{sub 3} into the dry flue gas desulfurization process for NO reduction might be achieved. 38 refs., 6 figs., 1 tab.

  14. Verification of Allowable Stresses In ASME Section III Subsection NH For Grade 91 Steel & Alloy 800H

    SciTech Connect (OSTI)

    R. W. Swindeman; M. J. Swindeman; B. W. Roberts; B. E. Thurgood; D. L. Marriott

    2007-11-30

    The database for the creep-rupture of 9Cr-1Mo-V (Grade 91) steel was collected and reviewed to determine if it met the needs for recommending time-dependent strength values, S{sub t}, for coverage in ASME Section III Subsection NH (ASME III-NH) to 650 C (1200 F) and 600,000 hours. The accumulated database included over 300 tests for 1% total strain, nearly 400 tests for tertiary creep, and nearly 1700 tests to rupture. Procedures for analyzing creep and rupture data for ASME III-NH were reviewed and compared to the procedures used to develop the current allowable stress values for Gr 91 for ASME II-D. The criteria in ASME III-NH for estimating S{sub t} included the average strength for 1% total strain for times to 600,000 hours, 80% of the minimum strength for tertiary creep for times to 600,000 hours, and 67% of the minimum rupture strength values for times to 600,000 hours. Time-temperature-stress parametric formulations were selected to correlate the data and make predictions of the long-time strength. It was found that the stress corresponding to 1% total strain and the initiation of tertiary creep were not the controlling criteria over the temperature-time range of concern. It was found that small adjustments to the current values in III-NH could be introduced but that the existing values were conservative and could be retained. The existing database was found to be adequate to extend the coverage to 600,000 hours for temperatures below 650 C (1200 F).

  15. Update and Improve Subsection NH Alternative Simplified Creep-Fatigue Design Methods

    SciTech Connect (OSTI)

    Tai Asayama

    2009-10-26

    This report described the results of investigation on Task 10 of DOE/ASME Materials NGNP/Generation IV Project based on a contract between ASME Standards Technology, LLC (ASME ST-LLC) and Japan Atomic Energy Agency (JAEA). Task 10 is to Update and Improve Subsection NH -- Alternative Simplified Creep-Fatigue Design Methods. Five newly proposed promising creep-fatigue evaluation methods were investigated. Those are (1) modified ductility exhaustion method, (2) strain range separation method, (3) approach for pressure vessel application, (4) hybrid method of time fraction and ductility exhaustion, and (5) simplified model test approach. The outlines of those methods are presented first, and predictability of experimental results of these methods is demonstrated using the creep-fatigue data collected in previous Tasks 3 and 5. All the methods (except the simplified model test approach which is not ready for application) predicted experimental results fairly accurately. On the other hand, predicted creep-fatigue life in long-term regions showed considerable differences among the methodologies. These differences come from the concepts each method is based on. All the new methods investigated in this report have advantages over the currently employed time fraction rule and offer technical insights that should be thought much of in the improvement of creep-fatigue evaluation procedures. The main points of the modified ductility exhaustion method, the strain range separation method, the approach for pressure vessel application and the hybrid method can be reflected in the improvement of the current time fraction rule. The simplified mode test approach would offer a whole new advantage including robustness and simplicity which are definitely attractive but this approach is yet to be validated for implementation at this point. Therefore, this report recommends the following two steps as a course of improvement of NH based on newly proposed creep-fatigue evaluation methodologies. The first step is to modify the current approach by incorporating the partial advantages the new method offer, and the second step is to replace the current method by the simplified test approach when it has become technically mature enough. The recommendations are basically in line with the work scope of the Task Force on Creep-Fatigue of the Subgroup on Elevated Temperature Design of the Standards Committee of the ASME Boiler and Pressure Vessel Committee Section III.

  16. Intramolecular Hydrogen Bonding in Disubstituted Ethanes. A Comparison of NH,,,O-and OH,,,O-Hydrogen Bonding through Conformational Analysis of 4-Amino-4-oxobutanoate

    E-Print Network [OSTI]

    Goddard III, William A.

    Intramolecular Hydrogen Bonding in Disubstituted Ethanes. A Comparison of NH,,,O- and OH,,,O- Hydrogen Bonding through Conformational Analysis of 4-Amino-4-oxobutanoate (succinamate) and Monohydrogen 1 of amide NH,,,O- and carboxyl OH,,,O- hydrogen bonds were investigated via conformational analysis

  17. MT1-MMP promotes cell growth and ERK activation through c-Src and paxillin in three-dimensional collagen matrix

    SciTech Connect (OSTI)

    Takino, Takahisa; Tsuge, Hisashi; Ozawa, Terumasa [Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192 (Japan)] [Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192 (Japan); Sato, Hiroshi, E-mail: vhsato@kenroku.kanazawa-u.ac.jp [Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192 (Japan)] [Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192 (Japan)

    2010-06-11

    Membrane-type 1 matrix metalloproteinase (MT1-MMP) is essential for tumor invasion and growth. We show here that MT1-MMP induces extracellular signal-regulated kinase (ERK) activation in cancer cells cultured in collagen gel, which is indispensable for their proliferation. Inhibition of MT1-MMP by MMP inhibitor or small interfering RNA suppressed activation of focal adhesion kinase (FAK) and ERK in MT1-MMP-expressing cancer cells, which resulted in up-regulation of p21{sup WAF1} and suppression of cell growth in collagen gel. Cell proliferation was also abrogated by the inhibitor against ERK pathway without affecting FAK phosphorylation. MT1-MMP and integrin {alpha}{sub v}{beta}{sub 3} were shown to be involved in c-Src activation, which induced FAK and ERK activation in collagen gel. These MT1-MMP-mediated signal transductions were paxillin dependent, as knockdown of paxillin reduced cell growth and ERK activation, and co-expression of MT1-MMP with paxillin induced ERK activation. The results suggest that MT1-MMP contributes to proliferation of cancer cells in the extracellular matrix by activating ERK through c-Src and paxillin.

  18. Uranium hydrogeochemical and stream sediment reconnaissance of the Mt. Hayes NTMS quadrangle, Alaska

    SciTech Connect (OSTI)

    Not Available

    1981-05-01

    Results of a hydrogeochemical and stream sediment reconnaissance of the Mt. Hayes quadrangle, Alaska, are presented. In addition to this abbreviated data release, more complete data are available to the public in machine-readable form. In this data release are location data, field analyses, and Laboratory analyses of several different sample media. For the sake of brevity, many field site observations have not been included in this volume. These data are, however, available on the magnetic tape. Appendices A to D describe the sample media and summarize the analytical results for each medium. The data were subsetted by one of the Los Alamos National Laboratory (LANL) sorting programs into groups of stream sediment, lake sediment, stream water, lake water, and ground water samples. For each group which contains a sufficient number of observations, statistical tables, tables of raw data, and 1:1000000 scale maps of pertinent elements have been included in this report.

  19. EIS-0092: Conversion to Coal, Holyoke Water Power Company, Mt. Tom Generating Station Unit 1 Holyoke, Hampden County, Massachusetts

    Broader source: Energy.gov [DOE]

    The Economic Regulatory Administration prepared this statement to assess the environmental impacts of prohibiting Unit 1 of the Mt. Tom Generation Station Unit 1 from using either natural gas or petroleum products as a primary energy source, which would result in the utility burning low-sulfur coal.

  20. The Mechanism of Inhibition of Antibody-based Inhibitors of Membrane-type Serine Protease 1 (MT-SP1)

    E-Print Network [OSTI]

    Craik, Charles S.

    The Mechanism of Inhibition of Antibody-based Inhibitors of Membrane-type Serine Protease 1 (MT-SP1, 600 16th St. Genentech Hall, San Francisco, CA 94143, USA The mechanisms of inhibition of two novel sc-SP1 at low pH, and is a standard mechanism inhibitor of the protease. The mechanisms of inhibition

  1. Excellent activity and selectivity of Cu-SSZ-13 in the selective catalytic reduction of NOx with NH3

    SciTech Connect (OSTI)

    Kwak, Ja Hun; Tonkyn, Russell G.; Kim, Do Heui; Szanyi, Janos; Peden, Charles HF

    2010-10-21

    Superior activity and selectivity of a Cu ion-exchanged SSZ-13 zeolite in the selective catalytic reduction (SCR) of NOx with NH3 were observed, in comparison to Cu-beta and Cu-ZSM-5 zeolites. Cu-SSZ-13 was not only more active in the NOx SCR reaction over the entire temperature range studied (up to 550 C), but also more selective toward nitrogen formation, resulting in significantly lower amounts of NOx by-products (i.e., NO2 and N2O) than the other two zeolites. In addition, Cu-SSZ-13 demonstrated the highest activity and N2 formation selectivity in the oxidation of NH3. The results of this study strongly suggest that Cu-SSZ-13 is a promising candidate as a catalyst for NOx SCR with great potential in after-treatment systems for either mobile or stationary sources.

  2. RELAP5 assessment using semiscale SBLOCA test S-NH-1. International Agreement Report

    SciTech Connect (OSTI)

    Lee, E.J.; Chung, B.D.; Kim, H.J.

    1993-06-01

    2-inch cold leg break test S-NH-1, conducted at the 1/1705 volume scaled facility Semiscale was analyzed using RELAP5/MOD2 Cycle 36.04 and MOD3 Version 5m5. Loss of HPIS was assumed, and reactor trip occurred on a low PZR pressure signal (13.1 MPa), and pumps began an unpowered coastdown on SI signal (12.5 MPa). The system was recovered by opening ADV`s when the PCT became higher than 811 K. Accumulator was finally injected into the system when the primary system pressure was less than 4.0 MPa. The experiment was terminated when the pressure reached the LPIS actuation set point RELAP5/MOD2 analysis demonstrated its capability to predict, with a sufficient accuracy, the main phenomena occurring in the depressurization transient, both from a qualitative and quantitative points of view. Nevertheless, several differences were noted regarding the break flow rate and inventory distribution due to deficiencies in two-phase choked flow model, horizontal stratification interfacial drag, and a CCFL model. The main reason for the core to remain nearly fully covered with the liquid was the under-prediction of the break flow by the code. Several sensitivity calculations were tried using the MOD2 to improve the results by using the different options of break flow modeling (downward, homogeneous, and area increase). The break area compensating concept based on ``the integrated break flow matching`` gave the best results than downward junction and homogeneous options. And the MOD3 showed improvement in predicting a CCFL in SG and a heatup in the core.

  3. Study of NH stretching vibrations in small ammonia clusters by infrared spectroscopy in He droplets and ab initio calculations

    SciTech Connect (OSTI)

    Slipchenko, Mikhail N.; Sartakov, Boris G.; Vilesov, Andrey F.; Xantheas, Sotiris S.

    2007-08-09

    Infrared spectra of the NH stretching vibrations of (NH3)n clusters (n=2-4) have been obtained using the helium droplet isolation technique and first principles electronic structure anharmonic calculations. The measured spectra exhibit well-resolved bands, which have been assigned to the ?1, ?3, and 2?4 modes of the ammonia fragments in the clusters. The formation of a hydrogen bond in ammonia dimers leads to an increase of the infrared intensity by about a factor of four. In the larger clusters the infrared intensity per hydrogen bond is close to the one for dimers and approaches the value in the NH3 crystal. The intensity of the 2?4 overtone band in the trimer and tetramer increases by a factor of 10 relative to that in the monomer and dimer, and is comparable to the intensity of the ?1 and ?3 fundamental bands in larger clusters. This indicates the onset of the strong anharmonic coupling of the 2?4 and ?1 modes in larger clusters. The experimental assignments are compared to the ones obtained from first principles electronic structure anharmonic calculations for the dimer and trimer clusters. The anharmonic calculations were performed at the Mller-Plesset (MP2) level of electronic structure theory and were based on a second-order perturbative evaluation of rovibrational parameters and their effects on the vibrational spectra and average structures. In general there is excellent (<20 cm-1) agreement between the experimentally measured band origins for the N-H stretching frequencies and the calculated anharmonic vibrational frequencies. However, the calculations were found to overestimate the infrared intensities in clusters by about a factor of four. This work was supported by the Office of Basic Energy Sciences of the Department of Energy, in part by the Chemical Sciences program and in part by the Engineering and Geosciences Division. The Pacific Northwest National Laboratory is operated by Battelle for the US Department of Energy.

  4. High-temperature phase transformation and topochemical nature in ferroelastic (NH{sub 4}){sub 2}SO{sub 4}

    SciTech Connect (OSTI)

    Lee, Kwang-Sei; Oh, In-Hwan; Ko, Jae-Hyeon

    2014-04-01

    The electrical conductivity of ferroelastic ammonium sulfate (NH{sub 4}){sub 2}SO{sub 4} revealed an anomaly at around 130 C (=403 K, T{sub P}) on heating with large and irreversible thermal hysteresis through thermal cycle. Ferroelastic domain walls and surface morphology of (NH{sub 4}){sub 2}SO{sub 4} were investigated by hot-stage polarizing microscopy. Structural phase transition from an orthorhombic ferroelastic phase to a hexagonal paraelastic phase was not identified at T{sub P} upon heating. On further heating above T{sub P}, microscopic spots appeared and grew on the crystal surface, suggesting that the high-temperature anomaly at T{sub P} was an indication of an onset of thermal decomposition controlled by topochemical factors. The increase of electrical conductivity above T{sub P} was attributed to proton migration. - Graphical abstract: Surface morphology of the (100) face of (NH{sub 4}){sub 2}SO{sub 4} on heating, showing chemical reaction at the surface. - Highlights: We investigate the high-temperature phase transformation of ammonium sulfate. The increasing conductivity upon heating is attributed to proton migration. Structural phase transition from orthorhombic to hexagonal phase is not confirmed. High-temperature anomaly is related to an onset of thermal decomposition. The nature of the high-temperature anomaly is topochemical controlled by defects.

  5. Time-Resolved XAFS Spectroscopic Studies of B-H and N-H Oxidative Addition to Transition Metal Catalysts Relevant to Hydrogen Storage

    SciTech Connect (OSTI)

    Bitterwolf, Thomas E.

    2014-12-09

    Successful catalytic dehydrogenation of aminoborane, H3NBH3, prompted questions as to the potential role of N-H oxidative addition in the mechanisms of these processes. N-H oxidative addition reactions are rare, and in all cases appear to involve initial dative bonding to the metal by the amine lone pairs followed by transfer of a proton to the basic metal. Aminoborane and its trimethylborane derivative block this mechanism and, in principle, should permit authentic N-H oxidative attrition to occur. Extensive experimental work failed to confirm this hypothesis. In all cases either B-H complexation or oxidative addition of solvent C-H bonds dominate the chemistry.

  6. A Pyrrolyl-based Triazolophane: A Macrocyclic Receptor With CH and NH Donor Groups That Exhibits a Preference for Pyrophosphate Anions

    SciTech Connect (OSTI)

    Sessler, Jonathan L.; Cia, Jiajia; Gong, Han-Yuan; Yang, Xiauping; Arambula, Jonathan F.; Hay, Benjamin

    2010-01-01

    A pyrrolyl-based triazolophane, incorporating CH and NH donor groups, acts as a receptor for the pyrophosphate anion in chloroform solution. It shows selectivity for this trianion, followed by HSO{sub 4}{sup -} > H{sub 2}PO{sub 4}{sup -} > Cl{sup -} > Br{sup -} (all as the corresponding tetrabutylammonium salts), with NH-anion interactions being more important than CH-anion interactions. In the solid state, the receptor binds the pyrophosphate anion in a clip-like slot via NH and CH hydrogen bonds.

  7. Characterization of Cu-SSZ-13 NH3 SCR Catalysts: an in situ FTIR Study

    SciTech Connect (OSTI)

    Szanyi, Janos; Kwak, Ja Hun; Zhu, Haiyang; Peden, Charles HF

    2013-01-23

    The adsorption of CO and NO over Cu-SSZ-13 zeolite catalysts, highly active in the selective catalytic reduction of NOx with NH3, was investigated by FTIR spectroscopy, and the results obtained were compared to those collected from other Cu-ion exchanged zeolites (Y,FAU and ZSM-5). At low CO pressures at room temperature (295 K) CO form monocarbonyls exclusively on the Cu+ ions, while in the presence of gas phase CO dicarbonyls on Cu+ and adsorbed CO on Cu2+ centers form, as well. At low (cryogenic) sample temperatures tricarbonyl formation on Cu+ sites was also observed. The adsorption of NO produces IR bands that can be assigned to nitrosyls bound to both Cu+ and Cu2+ centers, and NO+ species located in charge compensating cationic positions of the chabasite framework. On the reduced Cu-SSZ-13 samples the formation of N2O was also detected. The assignment of the adsorbed NOx species was aided by adsorption experiments with isotopically labeled 15NO. The movement of Cu ions from the sterically hindered six member ring position to the more accessible cavity positions as a result of their interaction with adsorbates (NO and H2O) was clearly evidenced. Comparisons of the spectroscopy data obtained in the static transmission IR system to those collected in the flow-through diffuse reflectance cell points out that care must be taken when conclusions are drawn about the adsorptive and reactive properties of metal cation centers based on a set of data collected under well defined, specific experimental conditions. Financial support was provided by the US Department of Energy (DOE), Office of Energy Efficiency and Renewable Energy, Vehicle Technologies Program. This work was performed in the Environmental Molecular Sciences Laboratory (EMSL) at the Pacific Northwest National Laboratory (PNNL). The EMSL is a national scientific user facility supported by the US DOE, Office of Biological and Environmental Research. PNNL is a multi-program national laboratory operated for the US DOE by Battelle.

  8. Synthesis of the Long-Sought Unsubstituted Aminodiboranate Na(H3B-NH2-BH3) and Its N-Alkyl Analogs

    E-Print Network [OSTI]

    Girolami, Gregory S.

    storage materials.1-9 For example, ammonia borane, NH3 BH3, has an especially high gravimetric hydrogen as hydrogen storage materials.15-18 In a different context, metal complexes of amino- and amidoboranes can

  9. Applications of stable isotopes in hydrological studies of Mt. Apo geothermal field, Philippines

    SciTech Connect (OSTI)

    Salonga, N.D.; Aragon, G.M.; Nogara, J.B.; Sambrano, B.G.

    1996-12-31

    The local precipitation in Mt. Apo is depleted of heavy isotopes owing to high elevation and landward location of the field. Rainwaters infiltrate the shallow grounds, circulate in short distances with almost no interaction with the host bed rocks, and effuse in the surface as cold springs. Lakes and rivers are affected by surface evaporation while the acid SO{sub 4} springs are affected by both evaporation and steam-heating. Only the neutral-pH Cl springs have the signature of the deep thermal fluids. The parent fluids of the deep thermal brine contain Cl of 4,800 to 5,000 mg/kg, {delta}{sup 18}O of -4.62 to -4.13 {per_thousand} and {delta}{sup 2}H of -60.0 to -57.8 {per_thousand}. Inside the Sandawa Collapse, boiling of the parent fluids resulted in a two-phase reservoir with lighter isotope contents. The thermal fluids laterally flow towards the west where they are affected by cooling and mixing of cold waters. Deep water recharge has {delta}{sup 18}O of -10.00 {per_thousand} and {delta}{sup 2}H = -61.20 {per_thousand} which come from the upper slopes of Sandawa Collapse (1580-1700 mASL).

  10. Four-year prospective study of the respiratory effects of volcanic ash from Mt. St. Helens

    SciTech Connect (OSTI)

    Buist, A.S.; Vollmer, W.M.; Johnson, L.R.; Bernstein, R.S.; McCamant, L.E.

    1986-04-01

    This report describes the 4-yr follow-up of 712 loggers exposed over an extended period to varying levels of fresh volcanic ash from the 1980 eruptions of Mt. St. Helens. Concerns related to the irritant effect the ash might have on the airways and also to its fibrogenic potential if exposures were intense and continued over many years. Our subjects were divided into 3 groups: high, low, and no exposure. Baseline testing was begun in June 1980, 1 month after the major eruption, and follow-up testing continued on an annual basis through 1984; 88% of the loggers have been tested at least 3 times. Analysis of lung function data showed that a significant, exposure-related decline in FEV1 occurred during the first year after the eruption. The decline was short-lived, however, and by 1984 the differences between exposure groups were no longer significant. Self-reported symptoms of cough, phlegm, and wheeze showed a similar pattern. No ash-related changes were seen in chest roentgenograms taken in 1980 and in 1984. Our findings are consistent with the hypothesis that the inhaled ash caused mucus hypersecretion and/or airway inflammation that reversed when the exposure levels decreased. The ash levels to which the loggers were exposed were low compared with permissible occupational levels for nuisance dusts, but generally higher than the total suspended particulate levels permissible in ambient air.

  11. CO2 flood tests on whole core samples of the Mt. Simon sandstone, Illinois Basin

    SciTech Connect (OSTI)

    O'Connor, William K.; Rush, Gilbert E.

    2005-09-01

    Geological sequestration of CO2, whether by enhanced oil recovery (EOR), coal-bed methane (CBM) recovery, or saline aquifer injection is a promising near-term sequestration methodology. While tremendous experience exists for EOR, and CBM recovery has been demonstrated in existing fields, saline aquifer injection studies have only recently been initiated. Studies evaluating the availability of saline aquifers suitable for CO2 injection show great potential, however, the long-term fate of the CO2 injected into these ancient aqueous systems is still uncertain. For the subject study, a series of laboratory-scale CO2 flood tests were conducted on whole core samples of the Mt. Simon sandstone from the Illinois Basin. By conducting these tests on whole core samples rather than crushed core, an evaluation of the impact of the CO2 flood on the rock mechanics properties as well as the geochemistry of the core and brine solution has been possible. This empirical data could provide a valuable resource for the validation of reservoir models under development for these engineered CO2 systems.

  12. Assignment 4 BS4a Actuarial Science Oxford MT 2011 IX A.4 Inflation, taxation and project appraisal

    E-Print Network [OSTI]

    Winkel, Matthias

    Assignment 4 ­ BS4a Actuarial Science ­ Oxford MT 2011 IX A.4 Inflation, taxation and project are indexed by reference to the value of a retail price index with a time lag of 8 months. The retail price index value in September 1996 was Q(-8/12) = 200 and in March 1997 was Q(-2/12) = 206. The issue price

  13. Electron capture and beta-decay rates for sd-shell nuclei in stellar environments relevant to high density O-Ne-Mg cores

    E-Print Network [OSTI]

    Toshio Suzuki; Hiroshi Toki; Ken'ichi Nomoto

    2015-12-01

    Electron capture and beta-decay rates for nuclear pairs in sd-shell are evaluated at high densities and high temperatures relevant to the final evolution of electron-degenerate O-Ne-Mg cores of stars with the initial masses of 8-10 solar mass. Electron capture induces a rapid contraction of the electron-degenerate O-Ne-Mg core. The outcome of rapid contraction depends on the evolutionary changes in the central density and temperature, which are determined by the competing processes of contraction, cooling, and heating. The fate of the stars are determined by these competitions, whether they end up with electron-capture supernovae or Fe core-collapse supernovae. Since the competing processes are induced by electron capture and beta-decay, the accurate weak rates are crucially important. The rates are obtained for pairs with A=20, 23, 24, 25 and 27 by shell-model calculations in sd-shell with the USDB Hamiltonian. Effects of Coulomb corrections on the rates are evaluated. The rates for pairs with A=23 and 25 are important for nuclear URCA processes that determine the cooling rate of O-Ne-Mg core, while those for pairs with A=20 and 24 are important for the core-contraction and heat generation rates in the core. We provide these nuclear rates at stellar environments in tables with fine enough meshes at various densities and temperatures for the studies of astrophysical processes sensitive to the rates. In particular, the accurate rate tables are crucially important for the final fates of not only O-Ne-Mg cores but also a wider range of stars such as C-O cores of lower mass stars.

  14. [NH{sub 3}(CH{sub 2}){sub 2}NH{sub 3}][Co(SO{sub 4}){sub 2}(H{sub 2}O){sub 4}]: Chemical preparation, crystal structure, thermal decomposition and magnetic properties

    SciTech Connect (OSTI)

    Rekik, Walid; Naili, Houcine; Mhiri, Tahar [Laboratoire de l'Etat Solide, Departement de Chimie, Faculte des Sciences de Sfax, BP 802, 3018 Sfax (Tunisia); Bataille, Thierry [Sciences Chimiques de Rennes (CNRS, UMR 6226), Groupe Materiaux Inorganiques: Chimie Douce et Reactivite, Universite de Rennes I, Avenue du General Leclerc, 35042 Rennes Cedex (France)], E-mail: thierry.bataille@univ-rennes1.fr

    2008-10-02

    Cobalt ethylenediammonium bis(sulfate) tetrahydrate, [NH{sub 3}(CH{sub 2}){sub 2}NH{sub 3}][Co(SO{sub 4}){sub 2}(H{sub 2}O){sub 4}], has been synthesised by slow evaporation at room temperature. It crystallises in the triclinic system, space group P1-bar, with the unit cell parameters: a = 6.8033(2), b 7.0705(2), c = 7.2192(3) A, {alpha} = 74.909(2){sup o}, {beta} = 72.291(2){sup o}, {gamma} = 79.167(2){sup o}, Z = 1 and V = 317.16(2) A{sup 3}. The Co(II) atom is octahedrally coordinated by four water molecules and two sulfate tetrahedra leading to trimeric units [Co(SO{sub 4}){sub 2}(H{sub 2}O){sub 4}]. These units are linked to each other and to the ethylenediammonium cations through OW-H...O and N-H...O hydrogen bonds, respectively. The zero-dimensional structure is described as an alternation between cationic and anionic layers along the crystallographic b-axis. The dehydration of the precursor proceeds through three stages leading to crystalline intermediary hydrate phases and an anhydrous compound. The magnetic measurements show that the title compound is predominantly paramagnetic with weak antiferromagnetic interactions.

  15. Dark Matter Particle Spectroscopy at the LHC: Generalizing M(T2) to Asymmetric Event Topologies

    SciTech Connect (OSTI)

    Konar, Partha; Kong, Kyoungchul; Matchev, Konstantin T.; Park, Myeonghun; /Florida U.

    2012-04-03

    We consider SUSY-like missing energy events at hadron colliders and critically examine the common assumption that the missing energy is the result of two identical missing particles. In order to experimentally test this hypothesis, we generalize the subsystem M{sub T2} variable to the case of asymmetric event topologies, where the two SUSY decay chains terminate in different 'children' particles. In this more general approach, the endpoint M{sub T2(max)} of the M{sub T2} distribution now gives the mass {tilde M}p({tilde M}{sub c}{sup (a)}, {tilde M}{sub c}{sup (b)}) of the parent particles as a function of two input children masses {tilde M}{sub c}{sup (a)} and {tilde M}{sub c}{sup (b)}. We propose two methods for an independent determination of the individual children masses M{sub c}{sup (a)} and M{sub c}{sup (b)}. First, in the presence of upstream transverse momentum PUTM the corresponding function {tilde M}p({tilde M}{sub c}{sup (a)}, {tilde M}{sub c}{sup (b)}, P{sub UTM}) is independent of P{sub UTM} at precisely the right values of the children masses. Second, the previously discussed MT2 'kink' is now generalized to a 'ridge' on the 2-dimensional surface {tilde M}p({tilde M}{sub c}{sup (a)}, {tilde M}{sub c}{sup (b)}). As we show in several examples, quite often there is a special point along that ridge which marks the true values of the children masses. Our results allow collider experiments to probe a multi-component dark matter sector directly and without any theoretical prejudice.

  16. Uranium hydrogeochemical and stream-sediment reconnaissance of the Mt. Michelson NTMS quadrangle, Alaska

    SciTech Connect (OSTI)

    Zinkl, R.J.; Shettel, D.L. Jr.; Langfeldt, S.L.; Hardy, L.C.; D'Andrea, R.F. Jr.

    1982-04-01

    This report presents results of a Hydrogeochemical and Stream Sediment Reconnaissance (HSSR) of the Mt. Michelson NTMS quadrangle, Alaska. In addition to this abbreviated data release, more complete data are available to the public in machine-readable form. These machine-readable data, as well as quarterly or semiannual program progress reports containing further information on the HSSR program in general, or on the Los Alamos National Laboratory (LANL) portion of the program in particular, are available from DOE's Technical Library at its Grand Junction Area Office. Presented in this data release are location data, field analyses, and laboratory analyses of several different sample media. For the sake of brevity, many field site observations have not been included in this volume; these data are, however, available on the magnetic tape. Appendices A and B describe the sample media and summarize the analytical results for each medium. The data have been subdivided by one of the Los Alamos National Laboratory sorting programs of Zinkl and others (1981a) into groups of stream-sediment and lake-sediment samples. For each group which contains a sufficient number of observations, statistical tables, tables of raw data, and 1:1,000,000 scale maps of pertinent elements have been included in this report. Also included are maps showing results of multivariate statistical analyses. Information on the field and analytical procedures used by the Los Alamos National Laboratory during sample collection and analysis may be found in any HSSR data release prepared by the Laboratory and will not be included in this report.

  17. Regeneration of field-spent activated carbon catalysts for low-temperature selective catalytic reduction of NOx with NH3

    SciTech Connect (OSTI)

    Jeon, Jong Ki; Kim, Hyeonjoo; Park, Young-Kwon; Peden, Charles HF; Kim, Do Heui

    2011-10-15

    In the process of producing liquid crystal displays (LCD), the emitted NOx is removed over an activated carbon catalyst by using selective catalytic reduction (SCR) with NH3 at low temperature. However, the catalyst rapidly deactivates primarily due to the deposition of boron discharged from the process onto the catalyst. Therefore, this study is aimed at developing an optimal regeneration process to remove boron from field-spent carbon catalysts. The spent carbon catalysts were regenerated by washing with a surfactant followed by drying and calcination. The physicochemical properties before and after the regeneration were investigated by using elemental analysis, TG/DTG (thermogravimetric/differential thermogravimetric) analysis, N2 adsorption-desorption and NH3 TPD (temperature programmed desorption). Spent carbon catalysts demonstrated a drastic decrease in DeNOx activity mainly due to heavy deposition of boron. Boron was accumulated to depths of about 50 {mu}m inside the granule surface of the activated carbons, as evidenced by cross-sectional SEM-EDX analysis. However, catalyst activity and surface area were significantly recovered by removing boron in the regeneration process, and the highest NOx conversions were obtained after washing with a non-ionic surfactant in H2O at 70 C, followed by treatment with N2 at 550 C.

  18. Observational results of a multi-telescope campaign in search of interstellar urea [(NH{sub 2}){sub 2}CO

    SciTech Connect (OSTI)

    Remijan, Anthony J.; Snyder, Lewis E.; Kuo, Hsin-Lun; Looney, Leslie W.; Friedel, Douglas N.; McGuire, Brett A.; Golubiatnikov, G. Yu; Lovas, Frank J.; Ilyushin, V. V.; Alekseev, E. A.; Dyubko, S. F.; McCall, Benjamin J.; Hollis, Jan M.

    2014-03-10

    In this paper, we present the results of an observational search for gas phase urea [(NH{sub 2}){sub 2}CO] observed toward the Sgr B2(N-LMH) region. We show data covering urea transitions from ?100 GHz to 250 GHz from five different observational facilities: the Berkeley-Illinois-Maryland-Association (BIMA) Array, the Combined Array for Research in Millimeter-wave Astronomy (CARMA), the NRAO 12 m telescope, the IRAM 30 m telescope, and the Swedish-ESO Submillimeter Telescope (SEST). The results show that the features ascribed to urea can be reproduced across the entire observed bandwidth and all facilities by best-fit column density, temperature, and source size parameters which vary by less than a factor of two between observations merely by adjusting for telescope-specific parameters. Interferometric observations show that the emission arising from these transitions is cospatial and compact, consistent with the derived source sizes and emission from a single species. Despite this evidence, the spectral complexity of both (NH{sub 2}){sub 2}CO and of Sgr B2(N) makes the definitive identification of this molecule challenging. We present observational spectra, laboratory data, and models, and discuss our results in the context of a possible molecular detection of urea.

  19. International Best Practices for Pre-Processing and Co-Processing Municipal Solid Waste and Sewage Sludge in the Cement Industry

    E-Print Network [OSTI]

    Hasanbeigi, Ali

    2013-01-01

    centrifuges, anaerobic digesters, and sludge dryers. In+Sludge Drier (SD) MS+MT+Anaerobic digester (AD) MS+MT+AD+DC

  20. Construction integrity assessment report (ETN-98-0005) S-Farm overground transfer (OGT) system valve pit 241-S-B to valve pit 241-S-D

    SciTech Connect (OSTI)

    HICKS, D.F.

    1999-08-12

    The S-Farm overground transfer (OGT) line will bypass the existing line(s), between valve pits 241-S-B and 241-S-D that no longer meet system requirements. The new OGT line will provide a waste transfer pipeline between these valve pits in support of saltwell pumping activities. The length of the OGT line is approximately 180 ft from pit to pit. The primary pipe is nominal 1-in. diameter stainless steel (SST) braided Ethylene-propylene Diene Monomer (EPDM) hose. The encasement pipe is a nominal 3-in., flanged, SST pipe made up of several different length pipe spool pieces (drawing H-2-829564, sh. 1 and sh. 2). The OGT line slopes from valve pit 241-S-B toward valve pit 241-S-D. At each end, the primary and encasement pipe connect to a pit entry spool piece. The pit entry spool pieces are constructed of prefabricated SST materials. These spool pieces allow for the separation of the primary and encasement pipelines after the pipes have entered the valve pits (drawing H-2-818280, sh. 2). The pit entry spool pieces also allow for leak detection of the encasement pipe at each end (drawing H-2-829564, sh. 2). The OGT encasement pipeline is supported above ground by adjustable height unistrut brackets and precast concrete bases (drawing H-2-829654, sh. 1). The pipeline is heat-traced and insulated. The heat tracing and insulation supply and retain latent heat that prevents waste solidification during transfers and provides freeze protection. The total length of the pipeline is above ground, thereby negating the need for cathodic corrosion protection. This Construction Integrity Assessment Report (CIAR) is prepared by Fluor Daniel Northwest for Numatec Hanford Corporation/Lockheed Martin Hanford Corporation, the operations contractor, and the U. S. Department of Energy, the system owner. The CIAR is intended to verify that construction was performed in accordance with the provisions of Washington Administrative Code, WAC-173-303-640 (3) (c), (e), (f) and (h).

  1. Portable SD Recorder Product Overview

    E-Print Network [OSTI]

    storage is matched by six hours recording time from four AA Alkaline / Ni-MH batteries. Drag and drop file file transfer 4 x AA Batteries, providing six hours recording (w/Alkaline 1450mAh batteries Speaker Standard level 450 mW/8 ohms General Power consumption Recording/Playback 4.2 W (DC) Battery life

  2. NA SD 452.2

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal of Honor recipients honored at Y-12CONTROLLEDStatements |Mo-99N

  3. Unusual defect physics in CH{sub 3}NH{sub 3}PbI{sub 3} perovskite solar cell absorber

    SciTech Connect (OSTI)

    Yin, Wan-Jian Shi, Tingting; Yan, Yanfa

    2014-02-10

    Thin-film solar cells based on Methylammonium triiodideplumbate (CH{sub 3}NH{sub 3}PbI{sub 3}) halide perovskites have recently shown remarkable performance. First-principle calculations show that CH{sub 3}NH{sub 3}PbI{sub 3} has unusual defect physics: (i) Different from common p-type thin-film solar cell absorbers, it exhibits flexible conductivity from good p-type, intrinsic to good n-type depending on the growth conditions; (ii) Dominant intrinsic defects create only shallow levels, which partially explain the long electron-hole diffusion length and high open-circuit voltage in solar cell. The unusual defect properties can be attributed to the strong Pb lone-pair s orbital and I p orbital antibonding coupling and the high ionicity of CH{sub 3}NH{sub 3}PbI{sub 3}.

  4. 4D Density Determination of NH Radicals in an MSE Microplasma Combining Planar Laser Induced Fluorescence and Cavity Ring-Down Spectroscopy

    SciTech Connect (OSTI)

    Visser, Martin; Schenk, Andreas; Gericke, Karl-Heinz [Technische Universitaet Braunschweig, Institut fuer Physikalische und Theoretische Chemie Hans-Sommer-Str. 10, 38106 Braunschweig (Germany)

    2010-10-13

    An application of microplasmas is surface modification under mild conditions and of small, well defined areas. For this, an understanding of the plasma composition is of importance. First results of our work on the production and detection of NH radicals in a capacitively coupled radio frequency (RF) microplasma are presented. A microstructured comb electrode was used to generate a glow discharge in a hydrogen/nitrogen gas mixture by applying 13.56 MHz RF voltage. The techniques of planar laser induced fluorescence (PLIF) and cavity ring-down spectroscopy (CRDS) are used for space and time resolved, quantitative detection of the NH radical in the plasma. The rotational temperature was determined to be 820 K and, the density 5.1x10{sup 12} cm{sup 3}. Also, time dependent behaviour of the NH production was observed.

  5. MRI of the lung using hyperpolarized He-3 at very low magnetic field (3 mT)

    E-Print Network [OSTI]

    Bidinosti, C P; Tastevin, G; Vignaud, A; Nacher, P J

    2004-01-01

    Optical pumping of He-3 produces large (hyper) nuclear-spin polarizations independent of the magnetic resonance imaging (MRI) field strength. This allows lung MRI to be performed at reduced fields with many associated benefits, such as lower tissue susceptibility gradients and decreased power absorption rates. Here we present results of 2D imaging as well as accurate 1D gas diffusion mapping of the human lung using He-3 at very low field (3 mT). Furthermore, measurements of transverse relaxation in zero applied gradient are shown to accurately track pulmonary oxygen partial pressure, opening the way for novel imaging sequences.

  6. nh gi Tn tht Ti nguyn Thin nhin Trn du Deepwater Horizon D n phc hi C bin ti B Bin Quc Gia

    E-Print Network [OSTI]

    Horizon. Sau s c trn du Deepwater Horizon, mt lng ng k du t n bi bin dc theo Florida Panhandle. Trong vi C ra( Thallasiumtestudium ) , loi ph bin nht ti thm c bin GUIS 3 ) t cc im quan trc o lng v

  7. nh Gi Tn Hi Ti Nguyn Thin Nhin do Trn Du Deep Horizon D n nng cp ng mn vo Khu

    E-Print Network [OSTI]

    tht v dch v gii tr trong vng t thuc B ni V nm bang vng Vnh. Sau s c trn du Deep Horizon, mt lng du v cc hot ng i ph u lm tn tht cc c hi gii tr v lm gim cht lng tri nghim ca du khch n khu

  8. nh Gi Thit Hi Ti Nguyn Thin Nhin ca V Trn Du Deepwater Horizon Cc D n To S Sng Ven B

    E-Print Network [OSTI]

    s c s dng khong 0,3 dm ng b bin v s to ra khon mt dm Anh (acre) vng mi trng sng Florida ang cng tc. Cu cng trung tm Thnh Ph Pensacola v s hon thnh vic xy dng cng trnh chn sng th ba ti y

  9. Solvent extraction of Li+, H3O+ and NH4+ into nitrobenzene by using sodium dicarbollylcobaltate and calix[4]arene-bis(t-octylbenzo-18-crown-6)

    SciTech Connect (OSTI)

    Makrlik, Emanuel; Selucky, P.; Vanura, Petr; Moyer, Bruce A

    2013-01-01

    From extraction experiments and c-activity measurements, the exchange extraction constants corresponding to the general equilibrium M+ (aq) + NaL+ (nb) , ML+ (nb) + Na+ (aq) taking place in the two-phase water nitrobenzene system (M+ = Li+, H3O+, NH+4; L = calix[4]arene-bis(t-octylbenzo-18-crown-6); aq = aqueous phase, nb = nitrobenzene phase) were evaluated. Furthermore, the stability constants of the ML+ complexes in nitrobenzene saturated with water were calculated; they were found to increase in the following cation order: zH3O+ < Li+ < NH+4.

  10. Microstructures and properties of CH{sub 3}NH{sub 3}PbI{sub 3?x}Cl{sub x} hybrid solar cells

    SciTech Connect (OSTI)

    Suzuki, Kohei E-mail: oku@mat.usp.ac.jp; Suzuki, Atsushi E-mail: oku@mat.usp.ac.jp; Zushi, Masahito E-mail: oku@mat.usp.ac.jp; Oku, Takeo E-mail: oku@mat.usp.ac.jp

    2015-02-27

    Halide-perovskite CH{sub 3}NH{sub 3}PbI{sub 3} was produced on mesoporous TiO{sub 2} layer by spin-coating a precursor solution of PbCl{sub 2} and CH{sub 3}NH{sub 3}I in dimethylformamide. The role of the annealing process and chlorine (Cl) doping for the perovskite-phase formation was investigated. It was found that crystallization of the perovskite materials was stimulated by the annealing process, and that longer annealing time is necessary for the Cl-doped perovskite compared with that of non-doped perovskite phase.

  11. A polymorphism in metallothionein 1A (MT1A) is associated with cadmium-related excretion of urinary beta 2?microglobulin

    SciTech Connect (OSTI)

    Lei, Lijian; Department of Epidemiology, School of Public Health, Shanxi Medical University, Shanxi ; Chang, Xiuli; Rentschler, Gerda; Tian, Liting; Zhu, Guoying; Chen, Xiao; Jin, Taiyi; Broberg, Karin

    2012-12-15

    Objectives: Cadmium (Cd) toxicity of the kidney varies between individuals despite similar exposure levels. In humans Cd is mainly bound to metallothioneins (MT), which scavenge its toxic effects. Here we analyzed whether polymorphisms in MT genes MT1A and MT2A influence Cd-related kidney damage. Methods: In a cross-sectional study N = 512 volunteers were selected from three areas in South-Eastern China, which to varying degree were Cd-polluted from a smelter (control area [median Cd in urine U-Cd = 2.67 ?g/L], moderately [U-Cd = 4.23 ?g/L] and highly [U-Cd = 9.13 ?g/L] polluted areas). U-Cd and blood Cd (B-Cd) concentrations were measured by graphite-furnace atomic absorption spectrometry. MT1A rs11076161 (G/A), MT2A rs10636 (G/C) and MT2A rs28366003 (A/G) were determined by Taqman assays; urinary N-Acetyl-beta-(D)-Glucosaminidase (UNAG) by spectrometry, and urinary ?2-microglobulin (UB2M) by ELISA. Results: Higher B-Cd (natural log-transformed) with increasing number of MT1A rs11076161 A-alleles was found in the highly polluted group (p-value trend = 0.033; all p-values adjusted for age, sex, and smoking). In a linear model a significant interaction between rs11076161 genotype and B-Cd was found for UNAG (p = 0.001) and UB2M concentrations (p = 0.001). Carriers of the rs11076161 AA genotype showed steeper slopes for the associations between Cd in blood and natural log-transformed UB2M (? = 1.2, 95% CI 0.721.6) compared to GG carriers (? = 0.30, 95% CI 0.150.45). Also for UNAG (natural log-transformed) carriers of the AA genotype had steeper slopes (? = 0.55, 95% CI 0.270.84) compared to GG carriers (? = 0.018, 95% CI ? 0.790.11). Conclusions: MT1A rs11076161 was associated with B-Cd concentrations and Cd-induced kidney toxicity at high exposure levels. -- Highlights: ? Cadmium is toxic to the kidney but the susceptibility differs between individuals. ? The toxic effect of cadmium is scavenged by metallothioneins. ? A common variant of metallothionein 1A was genotyped in 512 cadmium exposed humans. ? Variant carriers of this polymorphism showed more kidney damage from cadmium. ? The frequency of these variants needs to be taken into account in risk assessment.

  12. LOCA simulation in the national research universal reactor program: postirradiation examination results for the third materials experiment (MT-3)

    SciTech Connect (OSTI)

    Rausch, W.N.

    1984-04-01

    A series of in-reactor experiments were conducted using full-length 32-rod pressurized water reactor (PWR) fuel bundles as part of the Loss-of-Coolant Accident (LOCA) Simulation Program. The third materials experiment (MT-3) was the sixth in the series of thermal-hydraulic and materials deformation/rutpure experiments conducted in the National Research Universal (NRU) reactor, Chalk River, Ontario, Canada. The main objective of the experiment was to evaluate ballooning and rupture during active two-phase cooling in the temperature range from 1400 to 1500/sup 0/F (1030 to 1090 K). The 12 test rods in the center of the 32-rod bundle were initially pressurized to 550 psi (3.8 MPa) to insure rupture in the correct temperature range. All 12 of the rods ruptured, with an average peak bundle strain of approx. 55%. The UKAEA also funded destructive postirradiation examination (PIE) of several of the ruptured rods from the MT-3 experiment. This report describes the work performed and presents the PIE results. Information obtained during the PIE included cladding thickness measurements metallography, and particle size analysis of the cracked and broken fuel pellets.

  13. Searches for supersymmetry using the MT2 variable in hadronic events produced in pp collisions at 8 TeV

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Khachatryan, V.

    2015-05-15

    Searches for supersymmetry (SUSY) are performed using a sample of hadronic events produced in 8 TeV pp collisions at the CERN LHC. The searches are based on the MT2 variable, which is a measure of the transverse momentum imbalance in an event. The data were collected with the CMS detector and correspond to an integrated luminosity of 19.5 fb?. Two related searches are performed. The first is an inclusive search based on signal regions defined by the value of the MT2 variable, the hadronic energy in the event, the jet multiplicity, and the number of jets identified as originating frommorebottom quarks. The second is a search for a mass peak corresponding to a Higgs boson decaying to a bottom quark-antiquark pair, where the Higgs boson is produced as a decay product of a SUSY particle. For both searches, the principal backgrounds are evaluated with data control samples. No significant excess over the expected number of background events is observed, and exclusion limits on various SUSY models are derived.less

  14. Rabies Requirements for NH 4-H Animals Upon the recommendation of the New Hampshire State Veterinarian, all mammals shown or exhibited

    E-Print Network [OSTI]

    New Hampshire, University of

    Rabies Requirements for NH 4-H Animals Upon the recommendation of the New Hampshire State Veterinarian, all mammals shown or exhibited at New Hampshire 4-H events including fairs, shows, clinics, 4-H and fairs may have additional vaccination and health requirements as recommended by the New Hampshire State

  15. Phase Transformations of the Ternary System (NH4)2SO4-H2SO4-H2O and the Implications for Cirrus Cloud Formation

    E-Print Network [OSTI]

    the presence of NH4 + ions in the aerosol of the upper troposphere. Low-temperature ternary phase diagrams distribution alters the cloud's radiative properties, persistence, and surface area available for heterogeneous radiation, which insulates or warms Earth, and scattering the sun's visible radiation upward, thus cooling

  16. Detailed modeling and laser-induced fluorescence imaging of nitric oxide in a NH3-seeded non-premixed methane/air flame

    E-Print Network [OSTI]

    Bell, John B.

    non-premixed methane/air flame John B. Bell, Marcus S. Day, Joseph F. Grcar Computing Sciences-induced fluorescence imaging of nitric oxide in a NH3-seeded non-premixed methane/air flame Abstract In this paper we study the formation of NO in laminar, nitrogen diluted methane diffusion flames that are seeded

  17. An Investigation of Ammonia Extraction from Liquid Manure Using a Gas-Permeable Membrane Pollution of air, soil and water caused by excessive ammonia (NH3) emission and deposition from animal

    E-Print Network [OSTI]

    Mukhtar, Saqib

    An Investigation of Ammonia Extraction from Liquid Manure Using a Gas-Permeable Membrane Summary Pollution of air, soil and water caused by excessive ammonia (NH3) emission and deposition from animal by extracting it from liquid manure and potentially using the recovered NH3 as fertilizer. For this purpose, lab

  18. THE ROTATIONAL SPECTRUM OF ANTI-ETHYLAMINE (CH3CH2NH2) FROM 10 TO 270 GHz: A LABORATORY STUDY AND ASTRONOMICAL SEARCH IN SGR B2(N)

    E-Print Network [OSTI]

    Ziurys, Lucy M.

    AND ASTRONOMICAL SEARCH IN SGR B2(N) A. J. Apponi, M. Sun, D. T. Halfen,1 and L. M. Ziurys Departments of Chemistry identification of methylamine (CH3NH2) and ethylamine (CH3CH2NH2) in the aerogel collectors (Sandford et al. 2006

  19. DRAFT of 2015 Natural Resources Stewards Course Curriculum Overview Fridays, beginning Sept. 4, 2015 Dec. 4, 2015, 8:30 a.m. to 4:00 p.m. at NH Fish and Game Dept.

    E-Print Network [OSTI]

    and Game Dept. Session 4 9/25/15 1:00 pm - 8:00 pm Permaculture Day Nottingham, NH Special session and Sustainable Design Services Session 5 10/02/15 8:30 am - 4:00 pm Permaculture Principles and Ethics & Reading the Forested Landscape Society for the Protection of NH Forests permaculture principles introduced forces

  20. MOSE: zooming on the Meso-NH mesoscale model performances at the surface layer at ESO sites (Paranal and Armazones)

    E-Print Network [OSTI]

    Lascaux, Franck; di Arcetri, INAF / Osservatorio Astrofisico; 10.1117/12.925934

    2012-01-01

    In the context of the MOSE project, in this contribution we present a detailed analysis of the Meso-NH mesoscale model performances and their dependency on the model and orography horizontal resolutions in proximity of the ground. The investigated sites are Cerro Paranal (site of the ESO Very Large Telescope - VLT) and Cerro Armazones (site of the ESO European Extremely Large Telescope - E-ELT), in Chile. At both sites, data from a rich statistical sample of different nights are available - from AWS (Automated Weather Stations) and masts - giving access to wind speed, wind direction and temperature at different levels near the ground (from 2 m to 30 m above the ground). In this study we discuss the use of a very high horizontal resolution (dX=0.1 km) numerical configuration that overcomes some specific limitations put in evidence with a standard configuration with dX=0.5 km. In both sites results are very promising. The study is co-funded by ESO and INAF.

  1. Density Functional Studies of Stoichiometric Surfaces of Orthorhombic Hybrid Perovskite CH3NH3PbI3

    SciTech Connect (OSTI)

    Wang, Yun; Huang, Jingsong; Sumpter, Bobby G; Zhang, Haimin; Liu, Porun; Yang, Huagui; Zhao, Huijun

    2015-01-01

    Organic/inorganic hybrid perovskite materials are highly attractive for dye-sensitized solar cells as demonstrated by their rapid advances in energy conversion efficiency. In this work, the structures, energetics, and electronic properties for a range of stoichiometric surfaces of the orthorhombic perovskite CH3NH3PbI3 are theoretically studied using density functional theory. Various possible spatially and constitutionally isomeric surfaces are considered by diversifying the spatial orientations and connectivities of surface Pb-I bonds. The comparison of the surface energies for the most stable configurations identified for various surfaces shows that the stabilities of stoichiometric surfaces are mainly dictated by the coordination numbers of surface atoms, which are directly correlated with the numbers of broken bonds. Additionally, Coulombic interactions between I anions and organic countercations on the surface also contribute to the stabilization. Electronic properties are compared between the most stable (100) surface and the bulk phase, showing generally similar features except for the lifted band degeneracy and the enhanced bandgap energy for the surface. These studies on the stoichiometric surfaces serve as the first step toward gaining a fundamental understanding of the interfacial properties in the current structural design of perovskite based solar cells, in order to achieve further breakthroughs in solar conversion efficiencies.

  2. Effects of constraints in general branched molecules: A quantitative ab initio study in HCO-L-Ala-NH2

    E-Print Network [OSTI]

    Pablo Echenique; J. L. Alonso; Ivan Calvo

    2006-12-04

    A general approach to the design of accurate classical potentials for protein folding is described. It includes the introduction of a meaningful statistical measure of the differences between approximations of the same potential energy, the definition of a set of Systematic and Approximately Separable and Modular Internal Coordinates (SASMIC), much convenient for the simulation of general branched molecules, and the imposition of constraints on the most rapidly oscillating degrees of freedom. All these tools are used to study the effects of constraints in the Conformational Equilibrium Distribution (CED) of the model dipeptide HCO-L-Ala-NH2. We use ab initio Quantum Mechanics calculations including electron correlation at the MP2 level to describe the system, and we measure the conformational dependence of the correcting terms to the naive CED based in the Potential Energy Surface (PES) without any simplifying assumption. These terms are related to mass-metric tensors determinants and also occur in the Fixman's compensating potential. We show that some of the corrections are non-negligible if one is interested in the whole Ramachandran space. On the other hand, if only the energetically lower region, containing the principal secondary structure elements, is assumed to be relevant, then, all correcting terms may be neglected up to peptides of considerable length. This is the first time, as far as we know, that the analysis of the conformational dependence of these correcting terms is performed in a relevant biomolecule with a realistic potential energy function.

  3. Khi phc Sm D tho K hoch Khi phc Sm v nh gi Mi trng Giai on IV N g y 2 0 t h n g 5

    E-Print Network [OSTI]

    on IV c trn www.gulfspillrestoration.noaa. gov v nhiu a im trong cng ng vng vnh (xem dan sch trn Trc Giai on IV, cc y vin thng qua ba k hoch khi phc sm, bao gm tng cng 54 d n trn khp vng Vnh vi tng chi ph khong 698 triu USD. Cc y vin cng thng qua mt K Hoch Khi phc Sm theo quy trnh v

  4. Soil Science Society of America Journal This work was presented at the 12th North American Forest Soils Conference, Whitefish, MT, 1620

    E-Print Network [OSTI]

    Martin, Timothy

    Soils Conference, Whitefish, MT, 1620 June 2013, in the Production Systems for Biomass and Bioenergy silvicultural practices used, and when combined with suitable site preparation techniques and the deployment fourfold higher aboveground pine biomass than the C treatment (7.7 Mg ha-1); the untreated CF (17.9 Mg ha-1

  5. NEAFS Y-mtDNA Workshop (Butler and Coble) November 1, 2006 http://www.cstl.nist.gov/biotech/strbase/training.htm 1

    E-Print Network [OSTI]

    NEAFS Y-mtDNA Workshop (Butler and Coble) November 1, 2006 http://www.cstl.nist.gov/biotech textbook (now in its 2nd Edition) STRBase website: http://www.cstl.nist.gov/biotech/strbase/ Family: wife Terilynne and 6 children Hobbies: reading and writing http://www.cstl.nist.gov/biotech

  6. Comment on ``A modified leapfrog scheme for shallow water equations'' by Wen-Yih Sun and Oliver M.T. Sun

    E-Print Network [OSTI]

    Williams, Paul

    Commentary Comment on ``A modified leapfrog scheme for shallow water equations'' by Wen-Yih Sun and Oliver M.T. Sun Paul D. Williams Department of Meteorology, University of Reading, UK a r t i c l e i n f integration of the shallow-water equa- tions using the leapfrog time-stepping scheme [Sun Wen-Yih, Sun Oliver

  7. Table 2 -Lime use and practices on Corn, major producing states, 2001 CO GA IL IN IA KS KY MI MN MO NE NY NC ND OH PA SD TX WI Area

    E-Print Network [OSTI]

    Kammen, Daniel M.

    MO NE NY NC ND OH PA SD TX WI Area Lime applied NR 85 81 85 67 16 72 55 27 65 10 57 53 NR 70 95 3 1 50 51 Lime (tons treated acre) NR 1.0 2.1 1.9 2.5 2.1 2.4 2.0 2.6 2.8 1.5 1.9 1.1 NR 1.9 1.7 NR 0.5 2 NC ND OH PA SD TX WI Area Lime applied NR 95 90 69 18 69 71 14 77 16 76 99 NR 82 80 NR 5 58 54 Lime

  8. Direct Observation of Long Electron-Hole Diffusion Distance beyond 1 Micrometer in CH3NH3PbI3 Perovskite Thin Film

    E-Print Network [OSTI]

    Li, Yu; Li, Yunlong; Wang, Wei; Bian, Zuqiang; Xiao, Lixin; Wang, Shufeng; Gong, Qihuang

    2015-01-01

    In high performance perovskite based on CH3NH3PbI3, the formerly reported short charge diffusion distance is a confliction to thick working layer in solar cell devices. We carried out a study on charge diffusion in spin-coated CH3NH3PbI3 perovskite thin film by transient fluorescent spectroscopy. A thickness-dependent fluorescent lifetime was found. This effect correlates to the defects at crystal grain boundaries. By coating the film with electron or hole transfer layer, PCBM or Spiro-OMeTAD respectively, we observed the charge transfer directly through the fluorescent decay. One-dimensional diffusion model was applied to obtain long charge diffusion distances, which is ~1.3 micron for electrons and ~5.2 micron for holes. This study gives direct support to the high performance of perovskite solar cells.

  9. The Origin and Coupling Mechanism of the Magnetoelectric Effect in TM Cl 2 -4SC(NH 2 ) 2 ( TM = Ni and Co)

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Mun, Eundeok; Wilcox, Jason; Manson, Jamie L.; Scott, Brian; Tobash, Paul; Zapf, Vivien S.

    2014-01-01

    Most research on multiferroics and magnetoelectric effects to date has focused on inorganic oxides. Molecule-based materials are a relatively new field in which to search for magnetoelectric multiferroics and to explore new coupling mechanisms between electric and magnetic order. We present magnetoelectric behavior in NiCl 2 -4SC(NH 2 ) 2 (DTN) and CoCl 2 -4SC(NH 2 ) 2 (DTC). These compounds form tetragonal structures where the transition metal ion (Ni or Co) is surrounded by four electrically polar thiourea molecules [SC(NH 2 ) 2 ]. By tracking the magnetic and electric properties of these compounds as a function ofmoremagnetic field, we gain insights into the coupling mechanism by observing that, in DTN, the electric polarization tracks the magnetic ordering, whereas in DTC it does not. For DTN, all electrically polar thiourea molecules tilt in the same direction along the c -axis, breaking spatial-inversion symmetry, whereas, for DTC, two thiourea molecules tilt up and two tilt down with respect to c -axis, perfectly canceling the net electrical polarization. Thus, the magnetoelectric coupling mechanism in DTN is likely a magnetostrictive adjustment of the thiourea molecule orientation in response to magnetic order. less

  10. Modeling of plasma chemistry in an atmospheric pressure Ar/NH{sub 3} cylindrical dielectric barrier discharge described using the one-dimensional fluid model

    SciTech Connect (OSTI)

    Li Zhi [School of Science, University of Science and Technology Liaoning, Anshan 114051 (China); School of Physics and Optoelectronic Engineering, Dalian University of Technology, Dalian 116024 (China); Zhao Zhen [School of Chemistry and Life Science, Anshan Normal University, Anshan 114007 (China); School of Chemical Engineering, University of Science and Technology Liaoning, Anshan 114051 (China); Li Xuehui [Physical Science and Technical College, Dalian University, Dalian 116622 (China)

    2013-01-15

    The keynote of our research is to study the gas phase chemistry in an atmospheric pressure Ar/NH{sub 3} cylindrical dielectric barrier discharge, which is very important to produce the iron-nitride magnetic fluid. For this purpose, a home-made one dimensional fluid model with the Scharfetter-Gummel method has been developed. The equations solved are the particle balances, assuming a drift-diffusion approximation for the fluxes, and the electron energy equation. The self-consistent electric field is obtained by the simultaneous solution of Poisson's equation. The simulations were carried out for the different ammonia concentrations (2%, 3.5%, and 7%), at a voltage of 1 kV, and a driving frequency of 20 kHz. It concluded that the major ion products of Ar are Ar{sup +} and Ar{sub 2}{sup +}. Ar{sup +} is the most important positive ions, followed by Ar{sub 2}{sup +}. It is shown that the NH{sup +} density is smaller than that of the other ammonia ions. The density of NH{sub 4}{sup +} is more than that of the other ammonia ions when the ammonia concentration increased. The diffuse mode can be established after the discharge was ignited, and the mode changes to filamentary mode with an increase in ammonia concentration.

  11. Improvements in the M-T relation and mass function and the measured Omega_m through clusters evolution

    E-Print Network [OSTI]

    A. Del Popolo

    2003-09-05

    In this paper, I revisit the constraints obtained by several authors (Reichart et al. 1999; Eke et al. 1998; Henry 2000) on the estimated values of Omega_m, n and sigma_8 in the light of recent theoretical developments: 1) new theoretical mass functions (Sheth & Tormen 1999, Sheth, Mo & Tormen 1999, Del Popolo 2002b); 2) a more accurate mass-temperature relation, also determined for arbitrary Omega_m and Omega_{\\Lambda} (Voit 2000, Pierpaoli et al. 2001, Del Popolo 2002a). Firstly, using the quoted improvements, I re-derive an expression for the X-ray Luminosity Function (XLF), similarly to Reichart et al. (1999), and then I get some constraints to \\Omega_m and n, by using the ROSAT BCS and EMSS samples and maximum-likelihood analysis. Then I re-derive the X-ray Temperature Function (XTF), similarly to Henry (2000) and Eke et al. (1999), re-obtaining the constraints on Omega_m, n, sigma_8. Both in the case of the XLF and XTF, the changes in the mass function and M-T relation produces an increase in Omega_m of \\simeq 20% and similar results in sigma_8 and n.

  12. Tiu Ch Chn La D n Khi Phc Sm Vo ngy 21 thng 4 nm 2011, cc y Vin nh Gi Tn Hi

    E-Print Network [OSTI]

    s tn hi cng l mt yu t quan trng trong quy trnh la chn d n); Kh nng thnh cng ca tng gii php thay Tc ng ca mi gii php ti sc khe v s an ton ca cng ng ng gp vo vic bo v s ton vn ca mi trng v nhin i vi bn hoc cc bn c trch nhim vi v trn du iu ny cng nhm tm kim s n b i vi tn hi gy ra

  13. A Complete Solution Classification and Unified Algorithmic Treatment for the One- and Two-Step Asymmetric S-Transverse Mass (MT2) Event Scale Statistic

    E-Print Network [OSTI]

    Joel W. Walker

    2014-08-29

    The MT2 or "s-transverse mass" statistic was developed to associate a parent mass scale to a missing transverse energy signature, given that escaping particles are generally expected in pairs, while collider experiments are sensitive to just a single transverse momentum vector sum. This document focuses on the generalized extension of that statistic to asymmetric one- and two-step decay chains, with arbitrary child particle masses and upstream missing transverse momentum. It provides a unified theoretical formulation, complete solution classification, taxonomy of critical points, and technical algorithmic prescription for treatment of the MT2 event scale. An implementation of the described algorithm is available for download, and is also a deployable component of the author's selection cut software package AEACuS (Algorithmic Event Arbiter and Cut Selector). Appendices address combinatoric event assembly, algorithm validation, and a complete pseudocode.

  14. Probing the Mechanism of the Mycobacterium tuberculosis [beta]-Ketoacyl-Acyl Carrier Protein Synthase III mtFabH: Factors Influencing Catalysis and Substrate Specificity

    SciTech Connect (OSTI)

    Brown, Alistair K.; Sridharan, Sudharsan; Kremer, Laurent; Lindenberg, Sandra; Dover, Lynn G.; Sacchettini, James C.; Besra, Gurdyal S.

    2010-11-30

    Mycolic acids are the dominant feature of the Mycobacterium tuberculosis cell wall. These {alpha}-alkyl, {beta}-hydroxy fatty acids are formed by the condensation of two fatty acids, a long meromycolic acid and a shorter C{sub 24}-C{sub 26} fatty acid. The component fatty acids are produced via a combination of type I and II fatty acid synthases (FAS) with FAS-I products being elongated by FAS-II toward meromycolic acids. The {beta}-ketoacyl-acyl carrier protein (ACP) synthase III encoded by mtfabH (mtFabH) links FAS-I and FAS-II, catalyzing the condensation of FAS-I-derived acyl-CoAs with malonyl-acyl carrier protein (ACP). The acyl-CoA chain length specificity of mtFabH was assessed in vitro; the enzyme extended longer, physiologically relevant acyl-CoA primers when paired with AcpM, its natural partner, than with Escherichia coli ACP. The ability of the enzyme to use E. coli ACP suggests that a similar mode of binding is likely with both ACPs, yet it is clear that unique factors inherent to AcpM modulate the substrate specificity of mtFabH. Mutation of proposed key mtFabH residues was used to define their catalytic roles. Substitution of supposed acyl-CoA binding residues reduced transacylation, with double substitutions totally abrogating activity. Mutation of Arg{sup 46} revealed its more critical role in malonyl-AcpM decarboxylation than in the acyl-CoA binding role. Interestingly, this effect was suppressed intragenically by Arg{sup 161} {yields} Ala substitution. Our structural studies suggested that His{sup 258}, previously implicated in malonyl-ACP decarboxylation, also acts as an anchor point for a network of water molecules that we propose promotes deprotonation and transacylation of Cys{sup 122}.

  15. Structural and tectonic implications of pre-Mt. Simon strata -- or a lack of such -- in the western part of the Illinois basin

    SciTech Connect (OSTI)

    Sargent, M.L. (Illinois State Geological Survey, Champaign, IL (United States))

    1993-03-01

    The discovery of a pre-Mt. Simon lithic arenite (arkose) in southwestern Ohio has lead to reevaluation of many basement tests in the region. Several boreholes in adjacent states have been reexamined by others and are now believed to bottom in the Middle Run Formation. Seismic-reflection sections in western Ohio and Indiana have indicated pre-Mt. Simon basins filled with layered rocks that are interpreted to be Middle Run, however, the pre-Mt. Simon basins and east of Illinois. Samples from Illinois basement tests were reexamined to determine whether they had encountered similar strata. All reported crystalline-basement tests in Illinois show diagnostic igneous textures and mineralogical associations. Coarsely crystalline samples in cores show intergrown subhedral grains of quartz, microcline, and sodic plagioclase. Medium-crystalline rocks in cuttings samples show numerous examples of micrographic intergrowths of quartz and K-feldspar. This texture cannot be authigenically grown in a sediment and probably could not have survived a single cycle of erosion and deposition. Aphanitic rocks show porphyritic and spherulitic textures that are distinctly igneous and would be destroyed by weathering. Substantial relief on the Precambrian crystalline surface in Illinois is postulated for major structural features like the LaSalle Anticlinorium, the Sparta Shelf, the Ste. Genevieve Fault zone, etc. Paleotopographic relief up to 300 m (1,000 feet) is documented from drilling on the western flank of the basin.

  16. Exploiting parameter space in MOFs: a 20-fold enhancement of phosphate-ester hydrolysis with UiO-66-NH 2

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Katz, Michael J.; Moon, Su-Young; Mondloch, Joseph E.; Beyzavi, M. Hassan; Stephenson, Casey J.; Hupp, Joseph T.; Farha, Omar K.

    2015-02-24

    The hydrolysis of nerve agents is of primary concern due to the severe toxicity of these agents. Using a MOF-based catalyst (UiO-66), we have previously demonstrated that the hydrolysis can occur with relatively fast half-lives of 50 minutes. However, these rates are still prohibitively slow to be efficiently utilized for some practical applications (e.g., decontamination wipes used to clean exposed clothing/skin/vehicles). We thus turned our attention to derivatives of UiO-66 in order to probe the importance of functional groups on the hydrolysis rate. Three UiO-66 derivatives were explored; UiO-66-NO2 and UiO-66-(OH)2 showed little to no change in hydrolysis rate. However,moreUiO-66-NH2 showed a 20 fold increase in hydrolysis rate over the parent UiO-66 MOF. Half-lives of 1 minute were observed with this MOF. In order to probe the role of the amino moiety, we turned our attention to UiO-67, UiO-67-NMe2 and UiO-67-NH2. In these MOFs, the amino moiety is in close proximity to the zirconium node. We observed that UiO-67-NH2 is a faster catalyst than UiO-67 and UiO-67-NMe2. We conclude that the role of the amino moiety is to act as a proton-transfer agent during the catalytic cycle and not to hydrogen bond or to form a phosphorane intermediate.less

  17. Regulatory Safety Issues in the Structural Design Criteria of ASME Section III Subsection NH and for Very High Temperatures for VHTR & GEN IV

    SciTech Connect (OSTI)

    William J. ODonnell; Donald S. Griffin

    2007-05-07

    The objective of this task is to identify issues relevant to ASME Section III, Subsection NH [1], and related Code Cases that must be resolved for licensing purposes for VHTGRs (Very High Temperature Gas Reactor concepts such as those of PBMR, Areva, and GA); and to identify the material models, design criteria, and analysis methods that need to be added to the ASME Code to cover the unresolved safety issues. Subsection NH was originally developed to provide structural design criteria and limits for elevated-temperature design of Liquid Metal Fast Breeder Reactor (LMFBR) systems and some gas-cooled systems. The U.S. Nuclear Regulatory Commission (NRC) and its Advisory Committee for Reactor Safeguards (ACRS) reviewed the design limits and procedures in the process of reviewing the Clinch River Breeder Reactor (CRBR) for a construction permit in the late 1970s and early 1980s, and identified issues that needed resolution. In the years since then, the NRC and various contractors have evaluated the applicability of the ASME Code and Code Cases to high-temperature reactor designs such as the VHTGRs, and identified issues that need to be resolved to provide a regulatory basis for licensing. This Report describes: (1) NRC and ACRS safety concerns raised during the licensing process of CRBR , (2) how some of these issues are addressed by the current Subsection NH of the ASME Code; and (3) the material models, design criteria, and analysis methods that need to be added to the ASME Code and Code Cases to cover unresolved regulatory issues for very high temperature service.

  18. Preparation of Single Phase Films of CH3NH3Pb(I1-xBrx)3 with Sharp Optical Band Edges

    E-Print Network [OSTI]

    Sadhanala, Aditya; Deschler, Felix; Thomas, Tudor H; Dutton, Sin E.; Goedel, Karl C.; Hanusch, Fabian C.; Lai, May L.; Steiner, Ullrich; Bein, Thomas; Docampo, Pablo; Cahen, David; Friend, Richard H.

    2014-07-09

    ?inorganic perovskite (CH3NH3PbI3?xClx) solar cells now show photovoltaic (PV) performance1?4 approaching 18%,5,6 and high charge-carrier mobilities.7 Perovskite films have also shown promising photoluminescence quantum efficiencies (PLQEs) of more than 70% and lasing... .; Grat?zel, M.; Mhaisalkar, S.; Sum, T. C. Low-Temperature Solution- Processed Wavelength-Tunable Perovskites for Lasing. Nat. Mater. 2014, 13, 476?480. (9) Deschler, F.; Price, M.; Pathak, S.; Klintberg, L. E.; Jarausch, D.- D.; Higler, R.; Hu?ttner, S...

  19. Synthesis and Evaluation of Cu/SAPO-34 Catalysts for NH3-SCR 2: Solid-state Ion Exchange and One-pot Synthesis

    SciTech Connect (OSTI)

    Gao, Feng; Walter, Eric D.; Washton, Nancy M.; Szanyi, Janos; Peden, Charles HF

    2015-01-01

    Cu-SAPO-34 catalysts are synthesized using two methods: solid-state ion exchange (SSIE) and one-pot synthesis. SSIE is conducted by calcining SAPO-34/CuO mixtures at elevated temperatures. For the one-pot synthesis method, Cu-containing chemicals (CuO and CuSO4) are added during gel preparation. A high-temperature calcination step is also needed for this method. Catalysts are characterized with surface area/pore volume measurements, temperature programmed reduction (TPR), electron paramagnetic resonance (EPR) and nuclear magnetic resonance (NMR) spectroscopies, and scanning electron microscopy (SEM). Catalytic properties are examined using standard ammonia selective catalytic reduction (NH3-SCR) and ammonia oxidation reactions. In Cu-SAPO-34 samples formed using SSIE, Cu presents both as isolated Cu2+ ions and unreacted CuO. The former is highly active and selective in NH3-SCR, while the latter catalyzes a side reaction; notably, the non-selective oxidation of NH3 above 350 C. Using the one-pot method followed by a high-temperature aging treatment, it is possible to form Cu SAPO-34 samples with predominately isolated Cu2+ ions at low Cu loadings. However at much higher Cu loadings, isolated Cu2+ ions that bind weakly with the CHA framework and CuO clusters also form. These Cu moieties are very active in catalyzing non-selective NH3 oxidation above 350 C. Low-temperature reaction kinetics indicate that Cu-SAPO-34 samples formed using SSIE have core-shell structures where Cu is enriched in the shell layers; while Cu is more evenly distributed within the one-pot samples. Reaction kinetics also suggest that at low temperatures, the local environment next to Cu2+ ion centers plays little role on the overall catalytic properties. The authors gratefully acknowledge the US Department of Energy (DOE), Energy Efficiency and Renewable Energy, Vehicle Technologies Office for the support of this work. The research described in this paper was performed at the Environmental Molecular Sciences Laboratory (EMSL), a national scientific user facility sponsored by the DOEs Office of Biological and Environmental Research and located at Pacific Northwest National Laboratory (PNNL). PNNL is operated for the US DOE by Battelle under contract number DE-AC05-76RL01830. The authors also thank Shari Li (PNNL) for surface area/pore volume measurements, and Bruce W. Arey (PNNL) for SEM measurements. Discussions with Drs. A. Yezerets, K. Kamasamudram, J.H. Li, N. Currier and J.Y. Luo from Cummins, Inc. and H.Y. Chen and H. Hess from Johnson-Matthey are greatly appreciated.

  20. AFFECTS OF MECHANICAL MILLING AND METAL OXIDE ADDITIVES ON SORPTION KINETICS OF 1:1 LiNH2/MgH2 MIXTURE

    SciTech Connect (OSTI)

    Erdy, C.; Anton, D.; Gray, J.

    2010-12-08

    The destabilized complex hydride system composed of LiNH{sub 2}:MgH{sub 2} (1:1 molar ratio) is one of the leading candidates of hydrogen storage with a reversible hydrogen storage capacity of 8.1 wt%. A low sorption enthalpy of {approx}32 kJ/mole H{sub 2} was first predicted by Alapati et al. utilizing first principle density function theory (DFT) calculations and has been subsequently confirmed empirically by Lu et al. through differential thermal analysis (DTA). This enthalpy suggests that favorable sorption kinetics should be obtainable at temperatures in the range of 160 C to 200 C. Preliminary experiments reported in the literature indicate that sorption kinetics are substantially lower than expected in this temperature range despite favorable thermodynamics. Systematic isothermal and isobaric sorption experiments were performed using a Sievert's apparatus to form a baseline data set by which to compare kinetic results over the pressure and temperature range anticipated for use of this material as a hydrogen storage media. Various material preparation methods and compositional modifications were performed in attempts to increase the kinetics while lowering the sorption temperatures. This paper outlines the results of these systematic tests and describes a number of beneficial additions which influence kinetics as well as NH{sub 3} formation.

  1. Littleton Mt. Washington

    E-Print Network [OSTI]

    Pringle, James "Jamie"

    Across New Hampshire IN TRAVELING NEW HAMPSHIRE HIGHWAYS AND BACK ROADS, you'll discover New Hampshire, Keene Nashua Community College, Nashua BAE Systems of N.A., Nashua University of New Hampshire, Durham Great Bay Community College, Portsmouth New Hampshire Space grant Consortium 1 23 4 56 7 8 9 10 11 12 13

  2. versity (MT Assistant o

    E-Print Network [OSTI]

    discipline um vitae, s and contac electronica cmsearch@ 2011, an trategic Fac nitiative ates are en rsities

  3. Calculation of exact vibrational spectra for P{sub 2}O and CH{sub 2}NH using a phase space wavelet basis

    SciTech Connect (OSTI)

    Halverson, Thomas, E-mail: tom.halverson@ttu.edu; Poirier, Bill [Department of Chemistry and Biochemistry and Department of Physics, Texas Tech University, P.O. Box 41061, Lubbock, Texas 79409-1061 (United States)

    2014-05-28

    Exact quantum dynamics calculations of vibrational spectra are performed for two molecular systems of widely varying dimensionality (P{sub 2}O and CH{sub 2}NH), using a momentum-symmetrized Gaussian basis. This basis has been previously shown to defeat exponential scaling of computational cost with system dimensionality. The calculations were performed using the new SWITCHBLADE black-box code, which utilizes both dimensionally independent algorithms and massive parallelization to compute very large numbers of eigenstates for any fourth-order force field potential, in a single calculation. For both molecules considered here, many thousands of vibrationally excited states were computed, to at least an intermediate level of accuracy (tens of wavenumbers). Future modifications to increase the accuracy to spectroscopic levels, along with other potential future improvements of the new code, are also discussed.

  4. Qualifying composition dependent p and n self-doping in CH{sub 3}NH{sub 3}PbI{sub 3}

    SciTech Connect (OSTI)

    Wang, Qi; Shao, Yuchuan; Huang, Jinsong; Xie, Haipeng; Lyu, Lu; Liu, Xiaoliang; Gao, Yongli

    2014-10-20

    We report the observation of self-doping in perovskite. CH{sub 3}NH{sub 3}PbI{sub 3} was found to be either n- or p-doped by changing the ratio of methylammonium halide (MAI) and lead iodine (PbI{sub 2}) which are the two precursors for perovskite formation. MAI-rich and PbI{sub 2}-rich perovskite films are p and n self-doped, respectively. Thermal annealing can convert the p-type perovskite to n-type by removing MAI. The carrier concentration varied as much as six orders of magnitude. A clear correlation between doping level and device performance was also observed.

  5. F.E. S.D. Gender

    Office of Environmental Management (EM)

    80+ 1.000 COMPARISON 0 0 UGESP Q-21 EXCEPTION WFR Impact Analysis SELECTION RATE % OF POOL SELECTED POOL FLAG STANDARD DEVIATION FISHER'S EXACT 80% RULE EXPECTED OF PERSONS...

  6. F.E. S.D. Gender

    Energy Savers [EERE]

    OF PERSONS AFFECTED UGESP Q-21 EXCEPTION WFR Impact Analysis SELECTION RATE % OF POOL SELECTED POOL FLAG STANDARD DEVIATION FISHER'S EXACT 80% RULE EXPECTED OF PERSONS...

  7. OPTIONAL I-""... ..o SD

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and700 GJO-2003-411-TAC GJO-PIN~$ ., .,. ' e' , Ucl

  8. Microsoft Word - SD452.3 FINAL

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal of Honor recipients honored at Y-12CONTROLLED DOCUMENT OFFICE

  9. F.E. S.D. Gender

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum12, 2015Executive Order 13514 FederalEnergy Extraction UtilityReduction in792

  10. F.E. S.D. Gender

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum12, 2015Executive Order 13514 FederalEnergy Extraction UtilityReduction

  11. Structure of duplex DNA containing the cisplatin 1,2-{Pt(NH3)2}[superscript 2]+-d(GpG) crosslink at 1.77 [Angstrom] resolution

    E-Print Network [OSTI]

    Todd, Ryan C.

    We report the 1.77- resolution X-ray crystal structure of a dodecamer DNA duplex with the sequence 5?-CCTCTGGTCTCC-3? that has been modified to contain a single engineered 1,2-cis-{Pt(NH3)2}2+-d(GpG) cross-link, the major ...

  12. Experimental and Theoretical EPR Study of Jahn?Teller-Active [HIPTN[subscript 3]N]MoL Complexes (L = N[subscript 2], CO, NH[subscript 3])

    E-Print Network [OSTI]

    McNaughton, Rebecca L.

    The trigonally symmetric Mo(III) coordination compounds [HIPTN[subscript 3]N]MoL (L = N[subscript 2], CO, NH[subscript 3]; [HIPTN3N]Mo = [(3,5-(2,4,6-i-Pr[subscript 3]C[subscript 6]H[subscript 2])[subscript 2]C[subscript ...

  13. Ammoniumcobaltnickel phosphates, NH{sub 4}[Co{sub 1?x}Ni{sub x}PO{sub 4}]H{sub 2}O

    SciTech Connect (OSTI)

    Torre-Fernndez, Laura; Trobajo, Camino [Departamentos de Qumica Fsica y Analtica y Qumica Orgnica e Inorgnica, Universidad de Oviedo-CINN, Oviedo, Asturias 33006 (Spain); Pedro, Imanol de [CITIMAC, Facultad de Ciencias, Universidad de Cantabria, 39005 Santander (Spain); Alfonso, Beln F. [Departamento de Fsica, Universidad de Oviedo, Oviedo, Asturias 33007 (Spain); Fabelo, Oscar [Institut Laue Langevin, Grenoble, France and Instituto de Ciencia de Materiales de Aragn, CSIC-Universidad de Zaragoza, Zaragoza (Spain); Blanco, Jess A. [Departamento de Fsica, Universidad de Oviedo, Oviedo, Asturias 33007 (Spain); Garca, Jos R., E-mail: jrgm@uniovi.es [Departamentos de Qumica Fsica y Analtica y Qumica Orgnica e Inorgnica, Universidad de Oviedo-CINN, Oviedo, Asturias 33006 (Spain); Garca-Granda, Santiago [Departamentos de Qumica Fsica y Analtica y Qumica Orgnica e Inorgnica, Universidad de Oviedo-CINN, Oviedo, Asturias 33006 (Spain)

    2013-10-15

    The ammoniumcobaltnickel phosphates, NH{sub 4}[Co{sub 1?x}Ni{sub x}PO{sub 4}]H{sub 2}O (x=0.00, 0.34, 0.59, 0.70, 1.00), and the deuterated forms, ND{sub 4}[Co{sub 1?x}Ni{sub x}PO{sub 4}]D{sub 2}O (x=0.00, 0.38, 0.48, 0.69, 0.85), have been synthesized under mild hydrothermal conditions and characterised using X-ray and neutron diffraction, chemical and thermal analysis, and magnetic measurements. Their crystal structures, including hydrogen positions, were determined by Rietveld refinement using single-crystal X-ray and neutron powder diffraction data. The space group of these orthorhombic crystals modifies as a function of their composition. The magnetic susceptibility and magnetization measurements of these ammoniumcobaltnickel phosphates show antiferromagnetic behaviour, and the Neel temperature evolves from 5.5 K (x=0.00) up to 13.2 K (x=1.00). - Graphical abstract: We obtained single crystals for all the members of the family. In this series, although all crystals are orthorhombic, the space group changes as a function of the composition, showing how the single-crystal diffraction data is capable to manifest structural subtleties that had not been described before for this group of materials. All the investigated materials behave antiferromagnetically with ordering temperatures from 5.5 K up to 13.2 K. Display Omitted - Highlights: The ammoniumcobaltnickel phosphates, NH{sub 4}[Co{sub 1?x}Ni{sub x}PO{sub 4}]H{sub 2}O (x=0.00, 0.34, 0.59, 0.70, 1.00) and the deuterated forms ND4[Co1-xNixPO4]D{sub 2}O (x=0.00, 0.38, 0.49, 0.68, 0.85) have synthesized by hydrothermal synthesis. The structural studies of these compounds are introduced as a function of the composition. The magnetic studies show an antiferromagnetically behavior with ordering temperatures from 5.5 K to 13.2 K.

  14. Investigation of carbon distribution with {sup 14}C as tracer for carbon dioxide (CO{sub 2}) sequestration through NH{sub 4}HCO{sub 3} production

    SciTech Connect (OSTI)

    Zhongxian Cheng; Youhua Ma; Xin Li; Wei-Ping Pan [Western Kentucky University, Bowling Green, KY (United States). Institute for Combustion Science and Environmental Technology

    2007-12-15

    This work studies carbon fate using the {sup 14}C tracer technique in ecosystems when synthesized fertilizer is applied. The concept of aqueous ammonia solution scrubbing CO{sub 2} from flue gas is used in the fertilizer synthesis. Products after the capture are ammonium bicarbonate (ABC, NH{sub 4}HCO{sub 3}) or long-term effect ammonium bicarbonate (LEABC, NH{sub 4}HCO{sub 3}), an economic source of nitrogen fertilizer. The ABC or LEABC is used as a 'carrier' to transport CO{sub 2} from the atmosphere to the crops and soil. An indoor greenhouse was built, and wheat was chosen as the plant to study in this ecosystem. The investigated ecosystem consists of plant (wheat), soils with three different pH values (alkaline, neutral, and acidic), and three types of underground water (different Ca{sup 2+} and Mg{sup 2+} concentrations). After biological assimilation and metabolism in wheat receiving ABC or LEABC, it was found that a considerable amount (up to 10%) of the carbon source was absorbed by the wheat with increased biomass production. The majority of the unused carbon source (up to 76%) percolated into the soil as carbonates, such as environmentally benign calcium carbonate (CaCO{sub 3}). Generally speaking, alkaline soil has a higher capability to capture and store carbon. For the same soil, there is no apparent difference in carbon capturing capability between ABC and LEABC. These findings answer the question of how carbon is distributed after synthesized ABC or LEABC is applied into the ecosystem. In addition, a separate postexperiment on carbon forms that existed in the soil was made. It was found that up to 88% of the trapped carbon existed in the form of insoluble salts (i.e., CaCO{sub 3}) in alkaline soils. This indicates that alkaline soil has a greater potential for storing carbon after the use of the synthesized ABC or LEABC from exhausted CO{sub 2}. 21 refs., 6 figs., 5 tabs.

  15. Quantifying Uncertainty in Chemical Systems Modeling M.T. Reagan1, H.N. Najm1, P.P. Pebay1, O.M. Knio2 and R.G. Ghanem2

    E-Print Network [OSTI]

    Frey, Pascal

    Quantifying Uncertainty in Chemical Systems Modeling M.T. Reagan1, H.N. Najm1, P.P. Pebay1, O The Johns Hopkins University, Baltimore, MD 21218, USA Abstract. This study compares two techniques of Chemical Kinetics 1. Introduction Chemical kinetics computations require the specification of a number

  16. A new A&P Food Market in Mt. Kisco, New York, is enjoying annual energy cost savings of nearly $130,000 with the installation of an integrated microturbine power system

    E-Print Network [OSTI]

    Pennycook, Steve

    Background A new A&P Food Market in Mt. Kisco, New York, is enjoying annual energy cost savings, heating and power solutions, was installed in 2005 in the 57,000- square-foot facility. The New York supermarket was the first U.S. customer to take delivery of the new system. The PureComfort system is designed

  17. Visualizing the Surface Infrastructure Used to Move 2 MtCO2/year from the Dakota Gasification Company to the Weyburn CO2 Enhanced Oil Recovery Project: Version of July 1, 2009

    SciTech Connect (OSTI)

    Dooley, James J.

    2009-07-09

    Google Earth Pro has been employed to create an interactive flyover of the worlds largest operational carbon dioxide capture and storage project. The visualization focuses on the transport and storage of 2 MtCO2/year which is captured from the Dakota Gasification Facility (Beula, North Dakota) and transported 205 miles and injected into the Weyburn oil field in Southeastern Saskatchewan.

  18. Imaging ion-molecule reactions: Charge transfer and C-N bond formation in the C{sup +}+ NH{sub 3} system

    SciTech Connect (OSTI)

    Pei, Linsen; Farrar, James M. [Department of Chemistry, University of Rochester, Rochester, New York 14627 (United States)

    2012-05-28

    The velocity mapping ion imaging method is applied to the ion-molecule reactions occurring between C{sup +} and NH{sub 3}. The velocity space images are collected over the relative collision energy range from 1.5 to 3.3 eV, allowing both product kinetic energy distributions and angular distributions to be obtained from the data. The charge transfer process appears to be direct, dominated by long-range electron transfer that results in minimal deflection of the products. The product kinetic energy distributions are consistent with a process dominated by energy resonance. The kinetic energy distributions for C-N bond formation appear to scale with the total available energy, providing strong evidence that energy in the [CNH{sub 3}]{sup +} precursor to products is distributed statistically. The angular distributions for C-N bond formation show pronounced forward-backward symmetry, as expected for a complex that resembles a prolate symmetric top decaying along its symmetry axis.

  19. MOSE: a feasibility study for optical turbulence forecasts with the Meso-Nh mesoscale model to support AO facilities at ESO sites (Paranal and Armazones)

    E-Print Network [OSTI]

    Masciadri, E; 10.1117/12.925924

    2012-01-01

    We present very encouraging preliminary results obtained in the context of the MOSE project, an on-going study aiming at investigating the feasibility of the forecast of the optical turbulence and meteorological parameters (in the free atmosphere as well as in the boundary and surface layer) at Cerro Paranal (site of the Very Large Telescope - VLT) and Cerro Armazones (site of the European Extremely Large Telescope - E-ELT), both in Chile. The study employs the Meso-Nh atmospheric mesoscale model and aims at supplying a tool for optical turbulence forecasts to support the scheduling of the scientific programs and the use of AO facilities at the VLT and the E-ELT. In this study we take advantage of the huge amount of measurements performed so far at Paranal and Armazones by ESO and the TMT consortium in the context of the site selection for the E-ELT and the TMT to constraint/validate the model. A detailed analysis of the model performances in reproducing the atmospheric parameters (T, V, p, H, ...) near the g...

  20. Application of x-ray tomography to optimization of new NOx/NH3 mixed potential sensors for vehicle on-board emissions control

    SciTech Connect (OSTI)

    Nelson, Mark A; Brosha, Eric L; Mukundan, Rangachary; Garzon, Fernando H

    2009-01-01

    Mixed potential sensors for the detection of hydrocarbons, NO{sub x}, and NH{sub 3} have been previously developed at Los Alamos National Laboratory (LANL). The LANL sensors have a unique design incorporating dense ceramic-pelletlmetal-wire electrodes and porous electrolytes. The performance of current-biased sensors using an yttria-stabilized zirconia (YSZ) electrolyte and platinum and La{sub 0.8}Sr{sub 0.2}CrO{sub 3} electrodes is reported. X-ray tomography has been applied to non-destructively examine internal structures of these sensors. NO{sub x} and hydrocarbon response of the sensors under various bias conditions is reported, and very little NO{sub x} response hysteresis was observed. The application of a 0.6 {mu}A bias to these sensors shifts the response from a hydrocarbon response to a NO{sub x} response equal for both NO and NO{sub 2} species at approximately 500 {sup o}C in air.

  1. LOW-TEMPERATURE ION TRAP STUDIES OF N{sup +}({sup 3} P{sub ja} ) + H{sub 2}(j) {yields} NH{sup +} + H

    SciTech Connect (OSTI)

    Zymak, I.; Hejduk, M.; Mulin, D.; Plasil, R.; Glosik, J.; Gerlich, D.

    2013-05-01

    Using a low-temperature 22-pole ion trap apparatus, detailed measurements for the title reaction have been performed between 10 K and 100 K in order to get some state specific information about this fundamental hydrogen abstraction process. The relative population of the two lowest H{sub 2} rotational states, j = 0 and 1, has been varied systematically. NH{sup +} formation is nearly thermo-neutral; however, to date, the energetics are not known with the accuracy required for low-temperature astrochemistry. Additional complications arise from the fact that, so far, there is no reliable theoretical or experimental information on how the reactivity of the N{sup +} ion depends on its fine-structure (FS) state {sup 3} P{sub ja} . Since in the present trapping experiment, thermalization of the initially hot FS population competes with hydrogen abstraction, the evaluation of the decay of N{sup +} ions over long storage times and at various He and H{sub 2} gas densities provides information on these processes. First assuming strict adiabatic behavior, a set of state specific rate coefficients is derived from the measured thermal rate coefficients. In addition, by recording the disappearance of the N{sup +} ions over several orders of magnitude, information on nonadiabatic transitions is extracted including FS-changing collisions.

  2. NH Coverts Project Advisory Committee Meeting Notes, April 3, 2015 NH Fish & Game, Concord, NH

    E-Print Network [OSTI]

    New Hampshire, University of

    Members Present: Peter Beblowski, Antrim Karen Bennett, UNH Coop. Extension Cynthia Bruss, Springfield integrating wildlife-friendly agriculture into the list of `land management' options. Upcoming 2015 Workshop #12;- Cynthia pointed out the need for a presentation in the state on reptiles (particularly, snakes

  3. Notices 20 Miles Northwest of Rapid City SD Rapid City SD 57702

    Office of Environmental Management (EM)

    Availability of the Proposed Southline Transmission Line Project Draft Environmental Impact Statement and Draft Resource Management Plan Amendment, New Mexico and Arizona AGENCY:...

  4. Morphology control of open-framework zinc phosphate Zn{sub 4}(H{sub 3}O)(NH{sub 4}){sub 3}(PO{sub 4}){sub 4} via microwave-assisted technique

    SciTech Connect (OSTI)

    Ding, Ling; Song, Yu; Yang, Wei; Xue, Run-Miao; Zhai, Shang-Ru; An, Qing-Da

    2013-08-15

    Open-framework zinc phosphates were synthesized by microwave-assisted technique, and it was shown that the morphology of as-prepared materials could be easily tailored by changing synthesis temperature, reaction time and pH value. During the synthesis, when the reaction temperature increases from 130 C to 220 C, the products transformed from hexagonal prisms to polyhedron along with the disappearance of the hexagonal prisms vertical plane. Simultaneously, both the reaction time and pH value could promote the nucleation and growth of crystal particles. More interestingly, the target products with different morphologies could be obtained by varying the usage of NaOH or NH{sub 3}H{sub 2}O at 130 C during the microwave synthesis process. - Graphical abstract: Zinc phosphates with variable morphologies can be obtained by simply tuning the microwave-heating temperatures. Display Omitted - Highlights: Synthesis of open-framework Zn{sub 4} (H{sub 3}O) (NH{sub 4}){sub 3}(PO{sub 4}){sub 4} compounds employing microwave technique. Dependence of morphology on the reaction conditions. Morphology transformation from hexagonal prisms to polyhedron was observed.

  5. Spatiotemporal distribution of NOx storage and impact on NH3 and N2O selectivities during lean/rich cycling of a Ba-based lean NOx trap catalyst

    SciTech Connect (OSTI)

    Choi, Jae-Soon [ORNL; Partridge Jr, William P [ORNL; Pihl, Josh A [ORNL; Kim, Miyoung [ORNL; Koci, Petr [Institute of Chemical Technology, Prague, Czech Republic; Daw, C Stuart [ORNL

    2012-01-01

    We summarize results from an investigation of the spatiotemporal distribution of NO{sub x} storage and intermediate gas species in determining the performance of a fully formulated, Ba-based, lean NO{sub x} trap catalyst under lean/rich cycling conditions. By experimentally resolving spatiotemporal profiles of gas composition, we found that stored NO{sub x} was significantly redistributed along the monolith axis during the rich phase of the cycle by release and subsequent downstream re-adsorption. Sulfur poisoning of upstream NO{sub x} storage sites caused the active NO{sub x}-storage zone to be displaced downstream. This axial displacement in turn influenced rich-phase NO{sub x} release and re-adsorption. As sulfur poisoning increased, NH3 slip at the catalyst exit also increased due to its formation closer to the catalyst outlet and decreased exposure to downstream oxidation by surface oxygen. N{sub 2}O formation was found to be associated with nitrate reduction rather than oxidation of NH3 by stored oxygen. We propose that the observed evolution of N{sub 2}O selectivity with sulfation can be explained by changes in the spatiotemporal distribution of NO{sub x} storage resulting in either increased or decreased number of precious-metal sites surrounded by nitrates.

  6. Study on the reduction of atmospheric mercury emissions from mine waste enriched soils through native grass cover in the Mt. Amiata region of Italy

    SciTech Connect (OSTI)

    Fantozzi, L., E-mail: l.fantozzi@iia.cnr.it [CNR-Institute of Atmospheric Pollution Research, c/o: UNICAL-Polifunzionale, 87036 Rende (Italy); Ferrara, R., E-mail: romano.ferrara@pi.ibf.cnr.it [CNR-Institute of Biophysics, San Cataldo Research Area, Via G. Moruzzi 1, 56124 Pisa (Italy); Dini, F., E-mail: fdiniprotisti@gmail.com [University of Pisa, Department of Biology, Via A. Volta 4, 56126 Pisa (Italy); Tamburello, L., E-mail: ltamburello@biologia.unipi.it [University of Pisa, Department of Biology, Via Derna 1, I-56126 Pisa (Italy); Pirrone, N.; Sprovieri, F. [CNR-Institute of Atmospheric Pollution Research, c/o: UNICAL-Polifunzionale, 87036 Rende (Italy)] [CNR-Institute of Atmospheric Pollution Research, c/o: UNICAL-Polifunzionale, 87036 Rende (Italy)

    2013-08-15

    Atmospheric mercury emissions from mine-waste enriched soils were measured in order to compare the mercury fluxes of bare soils with those from other soils covered by native grasses. Our research was conducted near Mt. Amiata in central Italy, an area that was one of the largest and most productive mining centers in Europe up into the 1980s. To determine in situ mercury emissions, we used a Plexiglas flux chamber connected to a portable mercury analyzer (Lumex RA-915+). This allowed us to detect, in real time, the mercury vapor in the air, and to correlate this with the meteorological parameters that we examined (solar radiation, soil temperature, and humidity). The highest mercury flux values (8000 ng m{sup ?2} h{sup ?1}) were observed on bare soils during the hours of maximum insulation, while lower values (250 ng m{sup ?2} h{sup ?1}) were observed on soils covered by native grasses. Our results indicate that two main environmental variables affect mercury emission: solar radiation intensity and soil temperature. The presence of native vegetation, which can shield soil surfaces from incident light, reduced mercury emissions, a result that we attribute to a drop in the efficiency of mercury photoreduction processes rather than to decreases in soil temperature. This finding is consistent with decreases in mercury flux values down to 3500 ng m{sup ?2} h{sup ?1}, which occurred under cloudy conditions despite high soil temperatures. Moreover, when the soil temperature was 28 C and the vegetation was removed from the experimental site, mercury emissions increased almost four-fold. This increase occurred almost immediately after the grasses were cut, and was approximately eight-fold after 20 h. Thus, this study demonstrates that enhancing wild vegetation cover could be an inexpensive and effective approach in fostering a natural, self-renewing reduction of mercury emissions from mercury-contaminated soils. -- Highlights: ? Mercury air/surface exchange from grass covered soil is different from bare soil. ? Light enhances mercury emissions and is the main parameter driving the process. ? The presence of wild vegetation covering the soil reduces mercury emission. ? Vegetative covers could be a solution to reduce atmospheric mercury pollution.

  7. High external quantum efficiency and fill-factor InGaN/GaN heterojunction solar cells grown by NH3-based molecular beam epitaxy

    SciTech Connect (OSTI)

    Lang, J. R.; Neufeld, C. J.; Hurni, C. A.; Cruz, S. C.; Matioli, E.; Mishra, U. K.; Speck, J. S.

    2011-04-01

    High external quantum efficiency (EQE) p-i-n heterojunction solar cellsgrown by NH3 -based molecular beam epitaxy are presented. EQE values including optical losses are greater than 50% with fill-factors over 72% when illuminated with a 1 sun AM0 spectrum. Optical absorptionmeasurements in conjunction with EQE measurements indicate an internal quantum efficiency greater than 90% for the InGaN absorbing layer. By adjusting the thickness of the top p-type GaN window contact layer, it is shown that the short-wavelength (<365 nm) quantum efficiency is limited by the minority carrier diffusion length in highly Mg-doped p-GaN.

  8. Hydrogen storage in a combined M.sub.xAlH.sub.6/M'.sub.y(NH.sub.2).sub.z system and methods of making and using the same

    DOE Patents [OSTI]

    Lu, Jun (Salt Lake City, UT); Fang, Zhigang Zak (Salt Lake City, UT); Sohn, Hong Yong (Salt Lake City, UT)

    2012-04-03

    As a promising clean fuel for vehicles, hydrogen can be used for propulsion, either directly or in fuel cells. Hydrogen storage compositions having high storage capacity, good dehydrogenation kinetics, and hydrogen release and uptake reactions which are reversible are disclosed and described. Generally a hydrogen storage composition of a metal aluminum hexahydride and a metal amide can be used. A combined system (Li.sub.3AIH.sub.6/3LiNH.sub.2) with a very high inherent hydrogen capacity (7.3 wt %) can be carried out at moderate temperatures, and with approximately 95% of that inherent hydrogen storage capacity (7.0%) is reversible over repeated cycling of release and uptake.

  9. An ancient origin for the enigmatic Flat-Headed Frogs (Bombinatoridae: Barbourula) from the islands of Southeast Asia.

    E-Print Network [OSTI]

    Brown, Rafe M.

    2010-01-01

    published data (e.g., [18,19]). All primer details are provided in Table 1. The PCR conditions used were standard and the thermal cycle profile was as follows: 94uC (3 min; 35 cycles of 94uC (30 s), 50uC [for mt genes] or 55uC [for nuc genes] (30 s), 72uC (1... AAAAAGCTTCAAACTGGGATTAGATACCCCACTAT [96] 16SH mt 39 r GCTAGACCATKATGCAAAAGGTA [97] 12SM mt 59 R GGCAAGTCGTAACATGGTAAG [98] 16SA mt 39 r ATGTTTTTGGTAAACAGGCG [99] 16SC mt 59 R GTRGGCCTAAAAGCAGCCAC [98] 16SD mt 39 r CTCCGGTCTGAACTCAGATCACGTAG [98] CXCR4-G nuc 59 R AGCAACAGTGGAARAANGC...

  10. An Ancient Origin for the Enigmatic Flat-Headed Frogs (Bombinatoridae: Barbourula) from the Islands of Southeast Asia

    E-Print Network [OSTI]

    Blackburn, David C.; Bickford, David P.; Diesmos, Arvin C.; Iskandar, Djoko T; Brown, Rafe M.

    2010-08-09

    published data (e.g., [18,19]). All primer details are provided in Table 1. The PCR conditions used were standard and the thermal cycle profile was as follows: 94uC (3 min; 35 cycles of 94uC (30 s), 50uC [for mt genes] or 55uC [for nuc genes] (30 s), 72uC (1... AAAAAGCTTCAAACTGGGATTAGATACCCCACTAT [96] 16SH mt 39 r GCTAGACCATKATGCAAAAGGTA [97] 12SM mt 59 R GGCAAGTCGTAACATGGTAAG [98] 16SA mt 39 r ATGTTTTTGGTAAACAGGCG [99] 16SC mt 59 R GTRGGCCTAAAAGCAGCCAC [98] 16SD mt 39 r CTCCGGTCTGAACTCAGATCACGTAG [98] CXCR4-G nuc 59 R AGCAACAGTGGAARAANGC...

  11. Accurate ab initio-based adiabatic global potential energy surface for the 2{sup 2}A? state of NH{sub 2} by extrapolation to the complete basis set limit

    SciTech Connect (OSTI)

    Li, Y. Q.; Ma, F. C.; Sun, M. T.

    2013-10-21

    A full three-dimensional global potential energy surface is reported first time for the title system, which is important for the photodissociation processes. It is obtained using double many-body expansion theory and an extensive set of accurate ab initio energies extrapolated to the complete basis set limit. Such a work can be recommended for dynamics studies of the N({sup 2}D) + H{sub 2} reaction, a reliable theoretical treatment of the photodissociation dynamics and as building blocks for constructing the double many-body expansion potential energy surface of larger nitrogen/hydrogen containing systems. In turn, a preliminary theoretical study of the reaction N({sup 2}D)+H{sub 2}(X{sup 1}?{sub g}{sup +})(?=0,j=0)?NH(a{sup 1}?)+H({sup 2}S) has been carried out with the method of quasi-classical trajectory on the new potential energy surface. Integral cross sections and thermal rate constants have been calculated, providing perhaps the most reliable estimate of the integral cross sections and the rate constants known thus far for such a reaction.

  12. Effective hole extraction using MoO{sub x}-Al contact in perovskite CH{sub 3}NH{sub 3}PbI{sub 3} solar cells

    SciTech Connect (OSTI)

    Zhao, Yixin; Nardes, Alexandre M.; Zhu, Kai

    2014-05-26

    We report an 11.4%-efficient perovskite CH{sub 3}NH{sub 3}PbI{sub 3} solar cell using low-cost molybdenum oxide/aluminum (i.e., MoO{sub x}/Al) as an alternative top contact to replace noble/precious metals (e.g., Au or Ag) for extracting photogenerated holes. The device performance of perovskite solar cells using a MoO{sub x}/Al top contact is comparable to that of cells using the standard Ag top contact. Analysis of impedance spectroscopy measurements suggests that using 10-nm-thick MoO{sub x} and Al does not affect charge-recombination properties of perovskite solar cells. Using a thicker (20-nm) MoO{sub x} layer leads to a lower cell performance caused mainly by a reduced fill factor. Our results suggest that MoO{sub x}/Al is promising as a low-cost and effective hole-extraction contact for perovskite solar cells.

  13. Herschel-HIFI observations of H2O, NH3 and N2H+ toward high-mass starless and proto-stellar clumps identified by the Hi-GAL survey

    E-Print Network [OSTI]

    Olmi, Luca; Codella, Claudio

    2015-01-01

    Our present understanding of high-mass star formation still remains very schematic. In particular, it is not yet clear how much of the difference between low-mass and high-mass star formation occurs during the earliest star formation phases. The chemical characteristics of massive cold clumps, and the comparison with those of their low-mass counterparts, could provide crucial clues about the exact role that chemistry plays in differentiating the early phases of low-mass and high-mass star formation. Water, in particular, is a unique probe of physical and chemical conditions in star-forming regions. Using the HIFI instrument of Herschel we have observed the ortho-NH3 (1_0-0_0) (572GHz), ortho-H2O (1_10-1_01) (557GHz) and N2H+ (6-5) (559GHz) lines toward a sample of high-mass starless and proto-stellar clumps selected from the "Herschel} Infrared Galactic Plane Survey" (Hi-GAL). We compare our results to previous studies of low-mass and high-mass proto-stellar objects. At least one of the three molecular lines ...

  14. 2000-Liter-Gesellschaft --Entwicklungschance fr Nord und Sd

    E-Print Network [OSTI]

    Wehrli, Bernhard

    2000-Liter-Gesellschaft -- Entwicklungschance fr Nord und Sd Die Schweizerische Umweltstiftung initiiert die Real-Vision der 2000-Liter- Gesellschaft um den Wasserverbrauch von weltweit rund 4'000 Litern pro Person und Tag auf 2'000 Liter zu reduzieren. Die 2000-Liter-Gesellschaft ist das

  15. The COSI Framework -Carbon Offsets with SD Impacts (COSI)

    E-Print Network [OSTI]

    Cape Town, South Africa Karen Holm Olsen, PhD UNEP Ris Centre #12;Outline of Presentation Policy and a high quantity of CERs (trade-offs) A common conclusion across different assessment methodologies

  16. Oblique slamming, planing and skimming S.D. Howison

    E-Print Network [OSTI]

    Howison, Sam

    , inviscid hydrodynamics, ship slamming, water entry, planing. 1 Introduction The phenomenon of violent impacts where there is the possibility of either cavitation on the "downstream" segment of the contact

  17. Microsoft Word - SD243-1_Clean_20140429

    National Nuclear Security Administration (NNSA)

    Acknowledgement Form RMP appointment forms are located on the NNSA Records Management internet site or by submitting a request to the RPO group email NNSARecordsManagement@nnsa.doe...

  18. Tutorial Fator de Impacto BIBLIOTECA DE CINCIAS DA SADE SD

    E-Print Network [OSTI]

    Paraná, Universidade Federal do

    calculo realizado nas demais colunas Total Cites ­ número de citações que a revista teve nos últimos dois Half-life ­ Idade mediana ­ Calculo do número de citações ano a contar pelo 1º. Número da revista #12;

  19. DOE - Office of Legacy Management -- Edgemont Mill Site - SD 01

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth Dakota Edgemont, SouthLaboratoryDiv - NYCorp - NJ

  20. Microsoft Word - SD 351-1 FINAL.doc

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal of Honor recipients honored at Y-12

  1. Microsoft Word - SD243-1_Clean_20140429

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal of Honor recipients honored at Y-12CONTROLLED DOCUMENT OFFICE OF

  2. HNF-SD-WM-TI-740, Rev. OA

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (Journalvivo Low-Dose Low34 Revision 0 Approved for69 Revision71748884045.

  3. HNF-SD-WM-TI-740, Rev. OC

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (Journalvivo Low-Dose Low34 Revision 0 Approved for69

  4. Improvement of ASME NH for Grade 91

    SciTech Connect (OSTI)

    Bernard Riou

    2007-10-09

    This report has been prepared in the context of Task 3 of the ASME/DOE Gen IV material project. It has been identified that creep-fatigue evaluation procedures presently available in ASME (1) and RCC-MR (2) have been mainly developed for austenitic stainless steels and may not be suitable for cyclic softening materials such as mod 9 Cr 1 Mo steel (grade 91). The aim of this document is, starting from experimental test results, to perform a review of the procedures and, if necessary, provide recommendations for their improvements.

  5. Pittsburg, NH Natural Gas Exports to Canada

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    9 2010 2011 2012 2013 2014 View History Pipeline Volumes 0 0 336 199 95 373 2007-2014 Pipeline Prices -- -- 7.54 2.62 6.65 4.06 2007-2014...

  6. NH Timber Yield Tax Overview (RSA 79)

    E-Print Network [OSTI]

    New Hampshire, University of

    land. The bond is usually equal to the amount of expected yield tax. When can you appeal: If a taxpayer denies the appeal then the taxpayer may appeal to the Department of Revenue within 180 days of the tax

  7. Pittsburg, NH Natural Gas Exports to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan FebCubic Feet)PricePricethethePrice4) Part26,767 18,297 19,826

  8. Pittsburg, NH Natural Gas Exports to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan FebCubic Feet)PricePricethethePrice4) Part26,767 18,297

  9. Triptolide, a diterpenoid triepoxide, induces antitumor proliferation via activation of c-Jun NH{sub 2}-terminal kinase 1 by decreasing phosphatidylinositol 3-kinase activity in human tumor cells

    SciTech Connect (OSTI)

    Miyata, Yoshiki [Department of Biochemistry and Molecular Biology, Tokyo University of Pharmacy and Life Science, School of Pharmacy, Hachioji, Tokyo 192-0392 (Japan); Sato, Takashi [Department of Biochemistry and Molecular Biology, Tokyo University of Pharmacy and Life Science, School of Pharmacy, Hachioji, Tokyo 192-0392 (Japan)]. E-mail: satotak@ps.toyaku.ac.jp; Ito, Akira [Department of Biochemistry and Molecular Biology, Tokyo University of Pharmacy and Life Science, School of Pharmacy, Hachioji, Tokyo 192-0392 (Japan)

    2005-11-04

    Triptolide, a diterpenoid triepoxide extracted from the Chinese herb Tripterygium wilfordii Hook f., exerts antitumorigenic actions against several tumor cells, but the intracellular target signal molecule(s) for this antitumorigenesis activity of triptolide remains to be identified. In the present study, we demonstrated that triptolide, in a dose-dependent manner, inhibited the proliferation of human fibrosarcoma HT-1080, human squamous carcinoma SAS, and human uterine cervical carcinoma SKG-II cells. In addition, triptolide was found to decrease phosphatidylinositol 3-kinase (PI3K) activity. A PI3K inhibitor, LY-294002, mimicked the triptolide-induced antiproliferative activity in HT-1080, SAS, and SKG-II cells. There was no change in the activity of Akt or protein kinase C (PKC), both of which are downstream effectors in the PI3K pathway. Furthermore, the phosphorylation of Ras, Raf, and mitogen-activated protein/extracellular signal-regulated kinase 1/2 was not modified in HT-1080 cells treated with triptolide. However, the phosphorylation of c-Jun NH{sub 2}-terminal kinase 1 (JNK1) was found to increase in both triptolide- and LY-294002-treated cells. Furthermore, the triptolide-induced inhibition of HT-1080 cell proliferation was not observed by JNK1 siRNA-treatment. These results provide novel evidence that PI3K is a crucial target molecule in the antitumorigenic action of triptolide. They further suggest a possible triptolide-induced inhibitory signal for tumor cell proliferation that is initiated by the decrease in PI3K activity, which in turn leads to the augmentation of JNK1 phosphorylation via the Akt and/or PKC-independent pathway(s). Moreover, it is likely that the activation of JNK1 is required for the triptolide-induced inhibition of tumor proliferation.

  10. Thng 9, 2011 Xu t b n b i O ce of International A airs M i thng tin trong t ri ny u c trn m ng. c thng tin chi ti t v c p nh t, xin vui lng

    E-Print Network [OSTI]

    Wu, Yih-Min

    ng. c thng tin chi ti t v c p nh t, xin vui lng tra c u t i website c a chng ti : http Loan Chng trnh o t o c p b ng cho sinh vin qu c t Lin h v i chng ti International Student Taiwan University ( i h c qu c gia i Loan) Room 419, 4F, 2nd Administration Building (Phng 419, T ng 4

  11. Pukaha Mt Bruce Capability Building Project

    E-Print Network [OSTI]

    : _________________________________________________ ISO ID: ____________________________ Department: ___________________________________________ Office Reports Applicant Certification Access privileges are issued to staff members with the understanding

  12. Why Mt Etna? C. Doglioni,1

    E-Print Network [OSTI]

    between these two approaches: (i) evo- lution and dip of the foreland mono- cline are used in Doglioni et

  13. Mt Ranier Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | Open

  14. Marysville Mt Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma,InformationIllinois:Martin, Michigan:

  15. Babb, MT Natural Gas Export to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease

  16. Babb, MT Natural Gas Export to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease0 0 20 0 0 122 1996-2014

  17. Havre, MT Natural Gas Exports to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan Feb Mar Apr MayYear Jan FebMississippi119,456 111,949HOW TO

  18. Havre, MT Natural Gas Exports to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan Feb Mar Apr MayYear Jan FebMississippi119,456 111,949HOW TO2,504

  19. Controlled Source Audio MT | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (Utility Company)| Open(Evans, EtInformation Control of Well KS-8 inSource

  20. Mt Peak Utility | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to: navigation, searchsource HistoryCharleston,Peak Utility Jump to:

  1. Mt Poso Cogeneration | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to: navigation, searchsource HistoryCharleston,Peak Utility Jump to:Poso

  2. Category:Billings, MT | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButte County,Camilla, Georgia: Energy014771°,North Dakota:Bonn |NJ

  3. "Block" "Spot Column" "Spot Row" ORF ID Gene Block Column Row Name ID X Y Dia. F635 Median F635 Mean F635 SD B635 Median B635 Mean B635 SD % > B635+1SD % > B635+2SD F635 % Sat. F532 Median F532 Mean F532 SD B532 Median B532 Mean B532 SD % > B532+1SD % > B

    E-Print Network [OSTI]

    Winston, Fred

    622 100 100 0 2580 2796 1174 63 89 234 100 100 0 5.257 5.315 5.223 5.619 2.874 5.004 0.873 2.394 13231

  4. Bulk gold catalyzed oxidation reactions of amines and isocyanides and iron porphyrin catalyzed N-H and O-H bond insertion/cyclization reactions of diamines and aminoalcohols

    SciTech Connect (OSTI)

    Klobukowski, Erik

    2011-12-29

    This work involves two projects. The first project entails the study of bulk gold as a catalyst in oxidation reactions of isocyanides and amines. The main goal of this project was to study the activation and reactions of molecules at metal surfaces in order to assess how organometallic principles for homogeneous processes apply to heterogeneous catalysis. Since previous work had used oxygen as an oxidant in bulk gold catalyzed reactions, the generality of gold catalysis with other oxidants was examined. Amine N-oxides were chosen for study, due to their properties and use in the oxidation of carbonyl ligands in organometallic complexes. When amine N-oxides were used as an oxidant in the reaction of isocyanides with amines, the system was able to produce ureas from a variety of isocyanides, amines, and amine N-oxides. In addition, the rate was found to generally increase as the amine N-oxide concentration increased, and decrease with increased concentrations of the amine. Mechanistic studies revealed that the reaction likely involves transfer of an oxygen atom from the amine N-oxide to the adsorbed isocyanide to generate an isocyanate intermediate. Subsequent nucleophilic attack by the amine yields the urea. This is in contrast to the bulk gold-catalyzed reaction mechanism of isocyanides with amines and oxygen. Formation of urea in this case was proposed to proceed through a diaminocarbene intermediate. Moreover, formation of the proposed isocyanate intermediate is consistent with the reactions of metal carbonyl ligands, which are isoelectronic to isocyanides. Nucleophilic attack at coordinated CO by amine N-oxides produces CO{sub 2} and is analogous to the production of an isocyanate in this gold system. When the bulk gold-catalyzed oxidative dehydrogenation of amines was examined with amine N-oxides, the same products were afforded as when O{sub 2} was used as the oxidant. When the two types of oxidants were directly compared using the same reaction system and conditions, it was found that the oxidative dehydrogenation of dibenzylamine to Nbenzylidenebenzylamine, with N-methylmorpholine N-oxide (NMMO), was nearly quantitative (96%) within 24 h. However, the reaction with oxygen was much slower, with only a 52% yield of imine product over the same time period. Moreover, the rate of reaction was found to be influenced by the nature of the amine N-oxide. For example, the use of the weakly basic pyridine N-oxide (PyNO) led to an imine yield of only 6% after 24 h. A comparison of amine N-oxide and O2 was also examined in the oxidation of PhCH{sub 2}OH to PhCHO catalyzed by bulk gold. In this reaction, a 52% yield of the aldehyde was achieved when NMMO was used, while only a 7% product yield was afforded when O{sub 2} was the oxidant after 48 h. The bulk gold-catalyzed oxidative dehydrogenation of cyclic amines generates amidines, which upon treatment with Aerosil and water were found to undergo hydrolysis to produce lactams. Moreover, 5-, 6-, and 7-membered lactams could be prepared through a one-pot reaction of cyclic amines by treatment with oxygen, water, bulk gold, and Aerosil. This method is much more atom economical than industrial processes, does not require corrosive acids, and does not generate undesired byproducts. Additionally, the gold and Aerosil catalysts can be readily separated from the reaction mixture. The second project involved studying iron(III) tetraphenylporphyrin chloride, Fe(TPP)Cl, as a homogeneous catalyst for the generation of carbenes from diazo reagents and their reaction with heteroatom compounds. Fe(TPP)Cl, efficiently catalyzed the insertion of carbenes derived from methyl 2-phenyldiazoacetates into O-H bonds of aliphatic and aromatic alcohols. Fe(TPP)Cl was also found to be an effective catalyst for tandem N-H and O-H insertion/cyclization reactions when 1,2-diamines and 1,2-alcoholamines were treated with diazo reagents. This approach provides a one-pot process for synthesizing piperazinones and morpholinones and related analogues such as quinoxalinones and benzoxazin-2-ones.

  5. i hc ng cp th gii i hc Binghamton, i hc Tiu bang New York, to dng c danh ting ca

    E-Print Network [OSTI]

    Zhang, Zhongfei "Mark"

    nht ti New York v ng th 18 trong c nc. Mt s l do gm kh nng duy tr s lng sinh vin, t l tt nghip cho cc sinh vin i hc c hng nn gio dc cht lng cao vi chi ph phi chng. i hc Binghamton mang n cho tip cng nh l lun nh tnh v nh lng. H cng c c hi tin hnh nghin cu, lm vic trn c s cng tc v

  6. 2.8 Mt5.6 Mt Turning over a New Leaf

    E-Print Network [OSTI]

    to local communities and other stewards of our natural resources. Forest Trends analyzes strategic market natural ecosystems, which provide life-sustaining processes, by promoting incentives stemming from a broad 19th Street, NW 4th floor Washington, DC 20036 info@ecosystemmarketplace.com www

  7. Present address: South Dakota Department of Game, Fish and Parks, 20641 SD HWY 1806, Ft Pierre, SD 57532, USA. Corresponding author email address: chris.longhenry@state.sd.us

    E-Print Network [OSTI]

    ) aquacultural harvest data to model climate effects on variability of juvenile yellow perch year class strength-permanent wetlands. KEY WORDS Climatic effects, Perca flavescens, recruitment, wetlands, yellow perch Climate factors) and increased water levels (Henderson 1985) have also been positively related to abundance of larval yellow

  8. Synthesis and crystal structure of a new open-framework iron phosphate (NH{sub 4}){sub 4}Fe{sub 3}(OH){sub 2}F{sub 2}[H{sub 3}(PO{sub 4}){sub 4}]: Novel linear trimer of corner-sharing Fe(III) octahedra

    SciTech Connect (OSTI)

    Mi, Jin-Xiao; Wang, Cheng-Xin; Chen, Ning; Li, Rong; Pan, Yuanming

    2010-12-15

    A new iron phosphate (NH{sub 4}){sub 4}Fe{sub 3}(OH){sub 2}F{sub 2}[H{sub 3}(PO{sub 4}){sub 4}] has been synthesized hydrothermally at HF concentrations from 0.5 to 1.2 mL. Single-crystal X-ray diffraction analysis reveals its three-dimensional open-framework structure (monoclinic, space group P2{sub 1}/n (No. 14), a=6.2614(13) A, b=9.844(2) A, c=14.271(3) A, {beta}=92.11(1){sup o}, V=879.0(3) A{sup 3}). This structure is built from isolated linear trimers of corner-sharing Fe(III) octahedra, which are linked by (PO{sub 4}) groups to form ten-membered-ring channels along [1 0 0]. This isolated, linear trimer of corner-sharing Fe(III) octahedra, [(FeO{sub 4}){sub 3}(OH){sub 2}F{sub 2}], is new and adds to the diverse linkages of Fe polyhedra as secondary building units in iron phosphates. The trivalent iron at octahedral sites for the title compound has been confirmed by synchrotron Fe K-edge XANES spectra and magnetic measurements. Magnetic measurements also show that this compound exhibit a strong antiferromagnetic exchange below T{sub N}=17 K, consistent with superexchange interactions expected for the linear trimer of ferric octahedra with the Fe-F-Fe angle of 132.5{sup o}. -- Graphical abstract: The three-dimensional open-framework structure of (NH{sub 4}){sub 4}Fe{sub 3}(OH){sub 2}F{sub 2}[H{sub 3}(PO{sub 4}){sub 4}] is built from a novel isolated, linear (FeO{sub 4}){sub 3}(OH){sub 2}F{sub 2} trimer of corner-sharing Fe(III) octahedra linked by PO{sub 4} tetrahedra. Display Omitted

  9. Source:http://webarchive.nationalarchives.gov.uk/20090224120513/teachernet.gov.uk/sustainabl A manual for all students taking SD modules or the SD

    E-Print Network [OSTI]

    Brierley, Andrew

    of BREEAM Excellent for the new Medical Building. The Sustainable Development Undergraduate Programme

  10. ARSENIC IN PRIVATE WELLS IN NH YEAR 1 FINAL REPORT

    E-Print Network [OSTI]

    Bucci, David J.

    performed geospatial analysis of the well water arsenic estimates and survey results and produced the maps............................................................................................... 8 Well water treatment .................................................................................................. 7 Well water quality

  11. Introduction to the NH 4-H Dairy Goat Project

    E-Print Network [OSTI]

    New Hampshire, University of

    and dam of the same breed that conforms to breed standards and also has the correct number of consecutive Animal Identification: Permanent ID The animal must have an ear tag, ear tattoo, tail tattoo of their tail. Scrapie Tag: All goats of any age or sex brought to a show or exhibition from either out of state

  12. Hc ph $13,160 Nh $8,920

    E-Print Network [OSTI]

    Gering, Jon C.

    Hc ph $13,160 Nh $8,920 Cc khon chi khc $3,532 Tng cng $25,612 XP HNG QUC GIA, CHI PH HP L nhc Chp nhn ng vin sau khi hon thnh kho hc Tng cng Anh ng Hc Bng Tt c ng vin u c cn nhc cho hc hc da trn thnh tch hc tp Chi Ph Chi ph c tnh cho nm hc 2014-2015 Kho Tng Cng Anh Ng / ESL

  13. Department of Physics 9 Library Way Durham, NH 03824

    E-Print Network [OSTI]

    in support of a multidisciplinary center for flexible electronics. Areas of particular interest include research effort in flexible electronics. Please submit your application as a single PDF document quantum phenomena in low-dimensional electronic materials and devices. UNH is committed to creating

  14. 4th Annual NH 4-H State Shooting Sports

    E-Print Network [OSTI]

    New Hampshire, University of

    or just enjoy Archery, Pistol, Rifle, Shotgun and a special Knowledge Quiz Bowl competition Cost: $5 for others. Pistol - .22 Cal. Pistol - open sights. 10 shots standing at 25 feet. 100 possible points

  15. nh@power.ece.ntua.gr ... , 7 2012

    E-Print Network [OSTI]

    Psarrakos, Panayiotis

    W irrigation pumps in each house 2011 Next generation Sunny Island inverters, to deal with islanded mode

  16. DOE - Office of Legacy Management -- R Brew Co - NH 01

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth Dakota Edgemont,Manufacturing0-19Rulison - COQueen City

  17. Public Service Co of NH | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource HistoryPotentialRuralUtilityScalePVGeneration Jump to:SpatialResolutionWidthPrue,PSNH) Jump to: navigation,

  18. Public Service Co of NH | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to:Newberg,Energy LLCALLETE Inc dEAPrysmian Jump

  19. Pittsburg, NH Natural Gas Pipeline Imports From Canada (Dollars per

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year Jan Feb

  20. Pittsburg, NH Natural Gas Pipeline Imports From Canada (Dollars per

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year Jan FebThousand Cubic

  1. Shell plans $2. 2-billion renovation of Dutch refinery

    SciTech Connect (OSTI)

    Ladeur, P. (Shell Internationale Petroleum Maatschappij B.V., Hague (Netherlands)); Bijwaard, H.

    1993-04-26

    Royal Dutch/Shell Group recently approved a $2.2 billion rejuvenation of its Pernis refinery, near Rotterdam. This upgrade will enable the refinery to meet product volume and quality demands well into the next century, while reducing environmental emissions. Cornerstones of the $1.7-billion main revamp project are a single-train, 8,000 metric tons/sd (mt/sd), or about 56,000 b/sd, hydrocracking unit and a three-train 1,650 mt/sd residue-gasification unit for production of hydrogen and sulfur-free fuel gas. Fuel gas will be used in a new 115-mw electricity cogeneration plant. In addition, new amine treating, sulfur recovery, and tail gas units will be installed. The paper describes the process selection; hydrocracking unit; gasification unit; utilities; construction; and environmental aspects.

  2. A New Architecture for Implantable Transceivers

    E-Print Network [OSTI]

    Dawson, Joel

    the bed) Perhaps during doctor's visit Alternatively, cell phone or PDA can function as a "basestation Modulation Transmitter m(t) s(t) m(t) s(t) #12;Antenna as part of the oscillator tank Loop Antenna radiation and substrate, on top of a copper patch. Q in free space of 115; inductance of 23nH; radiation efficiency of 0

  3. Hunter Building, Kelburn Campus VICTORIA UNIVERSITY

    E-Print Network [OSTI]

    Frean, Marcus

    Trng i hc Tng Hp Victoria gm có bn c s ti Wellington, New Zealand. Wellington là th ô và cng là trung tâm vn hóa ca New Zealand. ây là mt ni hc tp lý tng giành cho sinh viên quc t và cng là mt thành ph i Cng + Khoa Hc Vt Lý + Toán hc + Thit k + Lch S New Zealand Hin i * + Khoa Hc Sinh Hc. *Sinh viên

  4. M thanh ton 4310-55 [FWS-R4-FHC-2013-N108; [FVHC98130406900-XXX-FF04G01000

    E-Print Network [OSTI]

    lng cha tng c du v thi khc t cc gin khoan v t u ging khoan trn y bin. Deepwater Horizon trn trn. Mt s lng cha xc nh kh t nhin cng c pht hnh cho mi trng nh l kt qu ca v trn du. Ngi c y gian c bn (cht lng v iu kin c th tn ti nu s c trn du khng xy ra ti nguyn) hon tt. Cn c cc

  5. Comment on ``Specific Heat and Shape Transitions in Light sd Nuclei''

    E-Print Network [OSTI]

    B. J. Cole; H. G. Miller; R. M. Quick

    1994-09-02

    This comment re-examines the origin of structure seen in the computed specific heat of finite nuclei. In a recent paper, Civitarese and Schvellinger suggest that such structure is due to model-space truncation in the calculations. We reaffirm our conclusion that the structure is caused by a collective-to-non-collective phase transformation at low temperatures, signaled by a change in the nuclear level density below 10 MeV excitation energy.

  6. ADMINISTRATIVE CHANGE TO NNSA SD G-1027, "GUIDANCE ON USING RELEASE...

    National Nuclear Security Administration (NNSA)

    needed based on consideration of the physical and chemical form and available dispersive energy sources. For Hazard Category 2 thresholds, the adjustment is performed by...

  7. UNIVERSIDADE FEDERAL DO PARAN -SETOR DE CINCIAS DA SADE SIBI -BIBLIOTECA DE CINCIAS DA SADE -SD

    E-Print Network [OSTI]

    Paran, Universidade Federal do

    - RADIOLOGIA1 ARTIGOS INDEXADOS (Revistas no localizadas em bases de dados bibliogrficas esto com espao em. Hemangioendotelioma Heptico: aspectos radiolgicos e evoluo clnica de um caso. Radiologia Brasileira, v.36, n.1, p

  8. UNIVERSIDADE FEDERAL DO PARAN -SETOR DE CINCIAS DA SADE SIBI -BIBLIOTECA DE CINCIAS DA SADE -SD

    E-Print Network [OSTI]

    Paran, Universidade Federal do

    crnicas atravs de ressonncia magntica de 3 Tesla. Mestrado em Medicina (Radiologia). Universidade

  9. perturbation Peyser, T.A.; Murray, S.D.; Farley, D.R.; Logory...

    Office of Scientific and Technical Information (OSTI)

    These experiments were performed using the Nova laser. Measurements of the time-evolution of the mixing region were reported previously. We compared the experimental...

  10. Microsoft Word - RedSeal_Smart Grid Policy Logistics RFI-sd.docx

    Energy Savers [EERE]

    smart grid technologies that will significantly increase the number and availability of digital access points for hackers to cause harm through smart meters, automated control...

  11. Hard Drive Camcorder Elegant and slim HDD/microSD Hybrid camcorder with KONICA MINOLTA

    E-Print Network [OSTI]

    Backlight Control Auto Illumi. Light Data Battery Picture Titles Quick Restart Direct DVD Button: 680k Effective Pixels for Capture (Moving images - 340k-pixel) (Still images - 340k-pixel) KONICA.0 F Stop - F1.8 - F4.0 Filter Diameter (mm) - 30.5 Video Image Stabilization Full Range AF

  12. Geobacter sp. SD-1 with enhanced electrochemical activity in high-salt concentration solutions

    E-Print Network [OSTI]

    , was obtained from a biofilm dominated by Geobacter sulfur- reducens in a microbial fuel cell fuel cells (MFCs), microbial electrolysis cells (MECs) as well as other systems, are technologies are exoelectrogenic, and there are different characteris- tics needed for optimal growth on dissolving minerals

  13. IPNO DR-01-010 PAO/SD/PMT/Bases/Design

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    variation of the particle density with the primary energy and the distance between the shower core.3 and -3.3 V regulated supplies. The total power budget for one PMT base is limited to 500 mW i.e. 1.5 m by cosmic rays with energies of up to 1021 eV. The surface array is composed of 1,600 Cerenkov water tanks

  14. PROC. S.D. ACAD. SCI., VOL. 74 (1995) 77 RELATIONSIllP BETWEEN DIETARY

    E-Print Network [OSTI]

    1995-01-01

    -TAILED DEER IN THE NORTHERN BLACK HILLS OF SOUTH DAKOTA Robert G. Osborn and Jonathan A. Jenks Department Black Hills ofSouth Dakota. Fecal samples werecollectedattwo week intervals from Januarythrough March (Howery and Pfister, 1990), elk (Cervlls elaplrlls; Leslie and Starkey. 1985), bighorn sheep (Ovis

  15. An updated anthropogenic CO2 inventory in the Atlantic Ocean S.-D. Choi,1

    E-Print Network [OSTI]

    to the industrial revolution to the current level of more than 370 ppm [Neftel et al., 1985; Keeling and Whorf, 2000 accumulated in the world oceans during the industrial era. This global oceanic uptake accounts

  16. Session Name: Data Transfer (session D2SD) Co-Chairs: Andrew Cherry, Eli Dart

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effect Photovoltaics -7541 Unlimited Release4: "Short-Term Energy Prices -

  17. ADMINISTRATIVE CHANGE TO NNSA SD G-1027, "GUIDANCE ON USING RELEASE FRACTION AND MODERN

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReporteeo | National Nuclear Securityhr |oft I s s u e450.2G 1027

  18. ADMINISTRATIVE CHANGE TO SD 251.1, Policy Letters: NNSA Policies, Supplemental Directives, and Business Operating

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReporteeo | National Nuclear Securityhr |oft I s s u e450.2G 1027NA

  19. Microsoft Word - RedSeal_Smart Grid Policy Logistics RFI-sd.docx

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties - WAPAEnergy May2.docTechnicalBARACK ofAcquisition Smart Grid RFI

  20. NNSA Supplemental Guidance: NA-1 SD G 1027 | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties -Department of EnergyNEW1for Acquisition and ProjectNNSA SitesNNSA

  1. Vertical Electrical Sounding Configurations At Mt Princeton Hot Springs

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, NewArkansas:Standards Jump to:VernonWisconsin:Labs LLP

  2. Integrated Dense Array and Transect MT Surveying at Dixie Valley...

    Open Energy Info (EERE)

    Dixie Valley Geothermal Area, Nevada- Structural Controls, Hydrothermal Alteration and Deep Fluid Sources Jump to: navigation, search OpenEI Reference LibraryAdd to library...

  3. Improving Machine Tool Interoperability Using Standardized Interface Protocols: MT Connect

    E-Print Network [OSTI]

    Vijayaraghavan, Athulan; Sobel, Will; Fox, Armando; Dornfeld, David; Warndorf, Paul

    2008-01-01

    23-26, 2008 IMPROVING MACHINE TOOL INTEROPERABILITY USINGMTConnect TM data from a machine tool for process planningpotential of improved machine-tool interoperability through

  4. Compound and Elemental Analysis At Mt St Helens Area (Shevenell...

    Open Energy Info (EERE)

    Date Usefulness not indicated DOE-funding Unknown References L. Shevenell, F. Goff (2000) Temporal Geochemical Variations In Volatile Emissions From Mount St Helens, Usa,...

  5. Northwest Distributed/Community Wind Workgroup Meeting- MT

    Broader source: Energy.gov [DOE]

    The Northwest Wind Resource and Action Center, which is partially funded by the U.S. Department of Energy, will facilitate a workgroup meeting for stakeholders involved in the distributed and...

  6. Thermal Gradient Holes At Mt Princeton Hot Springs Geothermal...

    Open Energy Info (EERE)

    the area References J. Held, F. Henderson (2012) New developments in Colorado geothermal energy projects Additional References Retrieved from "http:en.openei.orgw...

  7. Deriving Semantic Knowledge from Descriptive Texts using an MT System

    E-Print Network [OSTI]

    Spirtes, Peter

    , instantiating concepts in an upper model for the electric power domain. In an extension of the basic system, we statements for entry into the Ontology Works electrical power factbase [9]. The system was extended to allow and textual description for a model of the North west electric power grid [10]. A set of texts were written

  8. Improving Machine Tool Interoperability Using Standardized Interface Protocols: MT Connect

    E-Print Network [OSTI]

    Vijayaraghavan, Athulan; Sobel, Will; Fox, Armando; Dornfeld, David; Warndorf, Paul

    2008-01-01

    interoperability enabled by MTConnect TM can provide the mechanism for process and system monitoring and optimization with respect to energy and

  9. Analysis of borehole temperature data from the Mt. Princeton...

    Open Energy Info (EERE)

    Colorado (abstract only) Author P. Morgan Conference AAPG Rocky Mountain Meeting; Salt Lake County, Utah; 10811 Published AAPG Rocky Mountain Meeting, 2013 DOI Not Provided...

  10. Urdu Localization Project: Lexicon, MT and TTS (ULP) Sarmad HUSSAIN

    E-Print Network [OSTI]

    , Pakistan sarmad.hussain@nu.edu.pk Abstract Pakistan has a population of 140 million speaking more than 56, also the national language of Pakistan. Being a developing population, Pakistani people need access-10% of these people are familiar with English. Therefore, Government of Pakistan has embarked on a project which

  11. School of Mathematics and Statistics MT5824 Topics in Groups

    E-Print Network [OSTI]

    St Andrews, University of

    .] Deduce that GpG (G). Use the previous question to show that (G) = GpG. Show that G can be generated

  12. Compound and Elemental Analysis At Mt St Helens Area (Shevenell...

    Open Energy Info (EERE)

    not indicated DOE-funding Unknown References Lisa Shevenell, Fraser Goff (1995) Evolution Of Hydrothermal Waters At Mount St Helens, Washington, Usa Additional References...

  13. Todd J. Kaiser Montana State University, Bozeman, MT

    E-Print Network [OSTI]

    Kaiser, Todd J.

    and Actuators Workshop, pp 85-88, June 2000. E. Selected Invited Presentations "Solar Cell Basics for Teachers Square Cambridge, MA 02139 C. Selected Journal Publications "A Wireless Sensor Interrogation Design for Passive Resonant Frequency Sensors using Frequency Modulation Spectroscopy," Brian Peterson, Andrew Olson

  14. DLT -AN INDUSTRIAL R & D PROJECT FOR MULTILINGUAL MT

    E-Print Network [OSTI]

    by an ophthalmo-logist towards the end of the nineteenth century) is not usually considered a respectable object-term development and maintenance of a complex translation and world knowledge system is a task that can only

  15. *MT 4S1SGOO ^ Ris-M-2672

    E-Print Network [OSTI]

    . APPLICATIONS OF NEUTRON RADIOGRAPHY 14 7.1. Nuclear industry 16 Nuclear fuel 16 General 23 7.2. Industrial of application of neutron radiography in industry and the nuclear field. October 1987 Ris National Laboratory 26 Real-time 26 Engine fluids 26 7.3. Non-industrial applications 27 Biology, medicine and dentistry

  16. Extrinsic Evaluation of Patent MT: Review and Commentary

    E-Print Network [OSTI]

    Oard, Doug

    ." The National Institute of Informatics (NII) Testbeds and Community for Information Access Research (NTCIR these tasks into three broad categories (expressed here using specific examples of languages and sources College Park, MD 20742 USA oard@umd.edu Noriko Kando National Institute of Informatics Tokyo, Japan kando

  17. Seismicity induced by seasonal groundwater recharge at Mt. Hood, Oregon

    E-Print Network [OSTI]

    Manga, Michael

    and narrow-width pore-fluid pressure signal. Time delays between this seasonal groundwater recharge-fluid pressure fraction, PP/P0W0.1, of the applied near-surface pore-fluid pressure perturbation, P0W0.1 MPa Elsevier B.V. All rights reserved. Keywords: hydroseismicity; groundwater; pore-uid pressure; permeability

  18. Statistical Theory MT 2009 Problems 1: Solution sketches

    E-Print Network [OSTI]

    Reinert, Gesine

    =1 Xi and put T = X 1 n-1 n i=1(Xi - X)2 . Show that T is an ancillary statistic. What does this say the distribution of T does not depend on neither; it is an ancillary statistic. Thus a t-test based on exponential of A is independent of (so A is an ancillary statistic). c) Show that any value in the interval x(n) - 1 2 , x(1) + 1

  19. Self Potential At Mt Princeton Hot Springs Geothermal Area (Richards...

    Open Energy Info (EERE)

    2008 - 2010 Usefulness useful DOE-funding Unknown Exploration Basis Determination of groundwater flux patterns Notes Researchers collected 2700 SP measurements. Equilibrium...

  20. DC Resistivity Survey (Wenner Array) At Mt Princeton Hot Springs...

    Open Energy Info (EERE)

    2008 - 2010 Usefulness useful DOE-funding Unknown Exploration Basis Determination of groundwater flux patterns Notes Researchers measured DC resistivity and produced 12 resistivity...

  1. Graduate Student Handbook The Graduate Group in Molecular Toxicology (MT)

    E-Print Network [OSTI]

    (Stat 2, 20) 1 Semester Mathematics Differential and Integral Calculus (Math 1A) 1 Semester Chemistry and Microbial Biology, Chemistry, Public Health, Environmental Science and Policy Management, Integrative in the core courses. Research units (NST 299) are not calculated into this GPA requirement. To receive

  2. 2323 University Way, Suite 239 Bozeman, MT 59717

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    is accomplished through exposure and penetration of the contaminated material by superheated steam for an adequate through autoclaving. After sterilization in a steam autoclave, these materials are considered non amount of time. Because steam will not penetrate a sealed plastic autoclave bag, bags containing dry

  3. MSc Programme In the programme, MT engineers acquire a thorough

    E-Print Network [OSTI]

    Langendoen, Koen

    . Research within the Marine Technology group focuses on ship hydromechanics, shipbuilding and design, safety of new ones. Ship Production is concerned in particular with the management of shipbuilding projects

  4. Ground Gravity Survey At Marysville Mt Area (Blackwell) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainableGlynn County,Solar Jump to:ResourcesGriggsOpen| OpenAl., 1979)Al., 2003)

  5. Ground Magnetics At Marysville Mt Area (Blackwell) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainableGlynn County,Solar JumpInformation Crump's Hot Springs Area (DOE

  6. File:INL-geothermal-mt.pdf | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New Pages Recent Changes AllApschem.pdfgasp 03.pdf JumpGerak.pdf Jump to:hi.pdf Jump

  7. Data Acquisition-Manipulation At Marysville Mt Area (Blackwell) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (UtilityInstruments Inc JumpIowa: EnergyDarkEnergy InformationEnergy

  8. Mt Carmel Public Utility Co | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | Open Energy(RECP)

  9. RAPID/Roadmap/1-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevada <UtahMontanasource History

  10. RAPID/Roadmap/11-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevada <UtahMontanasourceWA-a <aa <

  11. RAPID/Roadmap/11-MT-b | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevada <UtahMontanasourceWA-a <aa <b <

  12. RAPID/Roadmap/13-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ | Roadmap Jumpf <ID-a

  13. RAPID/Roadmap/14-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ | RoadmapCO-c

  14. RAPID/Roadmap/14-MT-e | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ | RoadmapCO-ce < RAPID‎

  15. RAPID/Roadmap/17-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ |a < RAPID‎CA-aHI-aa

  16. RAPID/Roadmap/18-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ |a <-AK-b <CO-bad

  17. RAPID/Roadmap/19-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎f < RAPID‎ |

  18. RAPID/Roadmap/3-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎f <CA-aa <dFD-pca <

  19. RAPID/Roadmap/3-MT-b | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎f <CA-aa <dFD-pca <b

  20. RAPID/Roadmap/6-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎fRAPID/Roadmap/6-CO-bac <a

  1. RAPID/Roadmap/6-MT-b | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎fRAPID/Roadmap/6-CO-bac <ab

  2. RAPID/Roadmap/6-MT-c | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎fRAPID/Roadmap/6-CO-bac

  3. RAPID/Roadmap/7-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa <NV-b < RAPID‎ |ahn

  4. Whitlash, MT Natural Gas Imports by Pipeline from Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan3Additions (Million CubicYearSeparation9,195 7,707 7,062 6,571

  5. 2007-mt-elbert | netl.doe.gov

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPONe β+-Decay EvaluatedThe6 Feature2007 News7

  6. Port of Morgan, MT Natural Gas Exports to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan FebCubic Feet)PricePricethethePrice4)402 424 265 257485,026

  7. Port of Morgan, MT Natural Gas Exports to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan FebCubic Feet)PricePricethethePrice4)402 424 265

  8. Sweetgrass, MT Liquefied Natural Gas Exports to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan3 November 2013Additions (Million CubicYearCubic(Million,109 932

  9. Sweetgrass, MT Natural Gas Pipeline Imports From Canada (Million Cubic

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan3 November 2013Additions (MillionThousand Cubic Feet) Year

  10. Babb, MT Liquefied Natural Gas Exports (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease Separation A4.98

  11. City of Mt Pleasant, Iowa (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler, Iowa (UtilityIowa Phone Number: (319) 385-2121 Website:

  12. City of Mt Pleasant, Tennessee (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler, Iowa (UtilityIowa Phone Number: (319) 385-2121

  13. Village of Mt Horeb, Wisconsin (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop IncIowa (Utility Company)Idaho) Jump to:NewVermont (Utility Company) Jump

  14. RAPID/Roadmap/11-MT-c | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report Url

  15. RAPID/Roadmap/17-MT-b | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-ad

  16. RAPID/Roadmap/3-MT-c | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-a <CA-a <HI-ec <

  17. RAPID/Roadmap/3-MT-d | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-a <CA-a <HI-ec <d

  18. RAPID/Roadmap/3-MT-e | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-a <CA-a <HI-ec <de

  19. RAPID/Roadmap/3-MT-f | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-a <CA-a <HI-ec <def

  20. RAPID/Roadmap/5-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-a <CA-ae

  1. RAPID/Roadmap/6-MT-e | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-ab < RAPID‎ |c <dee

  2. RAPID/Roadmap/9-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-abFD-a <aAK-a

  3. Mt. Wachusett Community College Makes Huge Investment in Wind Power |

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nAand DOEDepartment of Energy Motion to Mr. Daniel CohenJUN 1 1 20133

  4. BWXT Pantex, LLC Route 726, Mt. Athos Road

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia National 1 PAGE 1 OF2Guidance to the RevisedEIS 9B.

  5. BWXT Pantex, LLC Route 726, Mt. Athos Road

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia National 1 PAGE 1 OF2Guidance to the RevisedEIS 9B.I I .

  6. BWXT Pantex, LLC Route 726, Mt. Athos Road

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia National 1 PAGE 1 OF2Guidance to the RevisedEIS 9B.I I

  7. BWXT Pantex, LLC Route 726, Mt. Athos Road

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia National 1 PAGE 1 OF2Guidance to the RevisedEIS 9B.I I

  8. BWXT Pantex, LLC Route 726, Mt. Athos Road

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia National 1 PAGE 1 OF2Guidance to the RevisedEIS 9B.I II

  9. BWXT Pantex, LLC Route 726, Mt. Athos Road Lynchburg, V

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia National 1 PAGE 1 OF2Guidance to the RevisedEIS 9B.I IIV

  10. Field Mapping At Marysville Mt Area (Blackwell) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePowerEdisto ElectricMonaster And Coolbaugh, 2007)

  11. Magnetotelluric Techniques At Mt Princeton Hot Springs Geothermal Area

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenarios Towards 2050EnermarGeneration Jump to:New(Held & Henderson,

  12. Mt Wheeler Power, Inc (Utah) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to: navigation, searchsource HistoryCharleston,Peak Utility Jump

  13. Mt. Edgecumbe High School Wind Project | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to: navigation, searchsource HistoryCharleston,Peak Utility JumpEdgecumbe

  14. 3D Mt Resistivity Imaging For Geothermal Resource Assessment And

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop IncIowa (UtilityMichigan)data bookresult9) Jump to:13:28-07:00

  15. Sweetgrass, MT Liquefied Natural Gas Exports (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Page WelcomeDecadeSumary(Million Cubic

  16. Sweetgrass, MT Liquefied Natural Gas Exports Price (Dollars per Thousand

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Page WelcomeDecadeSumary(Million

  17. Sweetgrass, MT Liquefied Natural Gas Exports Price (Dollars per Thousand

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Page WelcomeDecadeSumary(MillionCubic

  18. Sweetgrass, MT Liquefied Natural Gas Pipeline Exports to Canada (Dollars

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Page

  19. Sweetgrass, MT Liquefied Natural Gas Pipeline Exports to Canada (Dollars

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Pageper Thousand Cubic Feet) Year

  20. Sweetgrass, MT Liquefied Natural Gas Pipeline Exports to Canada (Million

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Pageper Thousand Cubic Feet)

  1. Sweetgrass, MT Natural Gas Pipeline Imports From Canada (Dollars per

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Pageper Thousand Cubic

  2. Sweetgrass, MT Natural Gas Pipeline Imports From Canada (Dollars per

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Pageper Thousand CubicThousand Cubic

  3. Sweetgrass, MT Natural Gas Pipeline Imports From Canada (Million Cubic

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Pageper Thousand CubicThousand

  4. Sweetgrass, MT Natural Gas Pipeline Imports From Canada (Million Cubic

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearbyWithdrawalsHome Pageper Thousand

  5. IDENTIFYING THE USAGE PATTERNS OF METHYL TERT-BUTYL ETHER (MTBE) AND OTHER OXYGENATES IN GASOLINE USING GASOLINE

    E-Print Network [OSTI]

    IDENTIFYING THE USAGE PATTERNS OF METHYL TERT-BUTYL ETHER (MTBE) AND OTHER OXYGENATES IN GASOLINE USING GASOLINE SURVEYS By Michael J. Moran, Rick M. Clawges, and John S. Zogorski U.S. Geological Survey 1608 Mt. View Rapid City, SD 57702 Methyl tert-butyl ether (MTBE) is commonly added to gasoline

  6. DEVELOPMENT OF FUNCTIONAL NANOPARTICULATE MATERIALS: Examination of the Functional and Structural Properties of Nanoparticulate Metal Complexes Prepared by Precipitation with Compressed Antisolvent Technology

    E-Print Network [OSTI]

    Nguyen, Joseph G.

    2008-01-01

    thank her enough. Th?nh ????t m? t?i c? ?????.c l? do s?4 h?) tr?. l?+n lao t?2 gia ???nh. Ba m?! c?0a t?i l? m?*t v? d?/ ??i?$n h?nh v?# l?ng th????ng con v? h?& ??? hy sinh c?? cu?*c ???,i ???$ con c?i ?????.c th?nh ????t. C?c anh ch?% em c?0a...; Noyes Data Corporation: Park Ridge, 1992. 6. Armor, J. N. Catal. Today 1995, 26, 99-105. 7. Armor, J. N. Catal. Today 1995, 26, 147-158. 8. Clean Air Technology Center; Information Transfer and Program Integration Division; Office of Air Quality...

  7. Diamines (NH2(CH2)nNH2; n = 4, 6, 12) have been employed as a prelayer for immobilizing C60 onto ITO elec-

    E-Print Network [OSTI]

    Kwak, Juhyoun

    of the formation of C60 SAMs using diamine linkages. ITO glass was cleaned with acetone and dried by blowing N2

  8. SD-VBS: The San Diego Vision Benchmark Suite Sravanthi Kota Venkata, Ikkjin Ahn, Donghwan Jeon, Anshuman Gupta,

    E-Print Network [OSTI]

    Cortes, Corinna

    platforms. The C code minimizes pointer usage and employs clean constructs to make them easier across a diverse and rich set of fields including medicine, automotive robotics, web search, guidance platforms in real-time. Recently, motivated by the power crisis brought on by tran- sistor scaling

  9. Microsoft Word - HQ-#465026-v1-NNSA_SD_350_2_-_FINAL_9-6-CLEAN

    National Nuclear Security Administration (NNSA)

    and Project Management NNSA SUPPLEMENTAL DIRECTIVE Approved: 10-18-12 USE OF MANAGEMENT AND OPERATING CONTRACTOR EMPLOYEES FOR SERVICES TO THE NATIONAL NUCLEAR SECURITY...

  10. Is Tritium over-regulated by DOE? Should the TFG support NA-1 SD G 1027 tritium values?

    Office of Energy Efficiency and Renewable Energy (EERE)

    Presentation from the 32nd Tritium Focus Group Meeting held in Germantown, Maryland on April 23-25, 2013.

  11. Reservoir characterization of the Ordovician Red River Formation in southwest Williston Basin Bowman County, ND and Harding County, SD

    SciTech Connect (OSTI)

    Sippel, M.A.; Luff, K.D.; Hendricks, M.L.; Eby, D.E.

    1998-07-01

    This topical report is a compilation of characterizations by different disciplines of the Red River Formation in the southwest portion of the Williston Basin and the oil reservoirs which it contains in an area which straddles the state line between North Dakota and South Dakota. Goals of the report are to increase understanding of the reservoir rocks, oil-in-place, heterogeneity, and methods for improved recovery. The report is divided by discipline into five major sections: (1) geology, (2) petrography-petrophysical, (3) engineering, (4) case studies and (5) geophysical. Interwoven in these sections are results from demonstration wells which were drilled or selected for special testing to evaluate important concepts for field development and enhanced recovery. The Red River study area has been successfully explored with two-dimensional (2D) seismic. Improved reservoir characterization utilizing 3-dimensional (3D) and has been investigated for identification of structural and stratigraphic reservoir compartments. These seismic characterization tools are integrated with geological and engineering studies. Targeted drilling from predictions using 3D seismic for porosity development were successful in developing significant reserves at close distances to old wells. Short-lateral and horizontal drilling technologies were tested for improved completion efficiency. Lateral completions should improve economics for both primary and secondary recovery where low permeability is a problem and higher density drilling is limited by drilling cost. Low water injectivity and widely spaced wells have restricted the application of waterflooding in the past. Water injection tests were performed in both a vertical and a horizontal well. Data from these tests were used to predict long-term injection and oil recovery.

  12. OO84O4c6sP HNF-SD-WM-II-740, Rev. OB

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shinesSolarNewsusceptometer under pressureNavyNumericalO K30 SeeOO84O4c6sP

  13. Microsoft Word - HQ-#465026-v1-NNSA_SD_350_2_-_FINAL_9-6-CLEAN

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal of Honor recipients honored at Y-12 |SanApproved:

  14. Phase IV Proposed Early Restoration Project PROJECT DESCRIPTION

    E-Print Network [OSTI]

    ni v Hoa k. Mc ch tng s lng lm t ca chim nc qun c bng vic khi phc v bo v qun o c tr ti Vng vnh hin ch ang c s lng lm t hn ch ca loi chim nc do s suy gim v din tch cng nh mi trng sng. Vnh o Dickinson II hon ton bin mt lng chim lm t t vi thp k trc. Lng chim nc sinh sng trn o Dressing Point

  15. Key China Energy Statistics 2011

    E-Print Network [OSTI]

    Levine, Mark

    2013-01-01

    kerosene, diesel oil, fuel oil, LPG, refinery gas and otherMt Diesel Oil Mt Fuel Oil Mt LPG Mt Refinery Gas Mt Other

  16. Key China Energy Statistics 2012

    E-Print Network [OSTI]

    Levine, Mark

    2013-01-01

    kerosene, diesel oil, fuel oil, LPG, refinery gas and otherMt Diesel Oil Mt Fuel Oil Mt LPG Mt Refinery Gas Mt Other

  17. 4 Liberty Lane West, Hampton, NH 03842 (917) 445-1143 davidqiu0115@gmail.com

    E-Print Network [OSTI]

    (WTE) Versus Coal Electricity in Their Environmental Impacts Conducted waste management research and coal electricity industry in Shanghai Energy & Environmental Dept, BAOSTEEL GROUP CO. Summer Intern, USA; 2. Ling Qiu, Part I: Analysis of the Economics of Waste-toEnergy Plants; Part II: MSW Sorting

  18. NH3-Selective Catalytic Reduction over Ag/Al2O3 Catalysts | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Catalytic Reduction over AgAl2O3 Catalysts DRIFT spectroscopy used together with flow reactor experiments to investigate the role of H2 for SCR over AgAl2O3 deer12tamm.pdf...

  19. Experimental and Modelling Study of the Effect of Diffusional Limitations on the NH3 SCR Activity

    Broader source: Energy.gov [DOE]

    Simulations different feed conditions and temperature variations were compared to experimental data collected in validation runs at the monolith scale; made direct comparison of experimental data on the same catalyst in the two configurations (powder vs. monolith)

  20. Extreme Back Angle Nh-2 Elastic-Scattering at 794 Mev

    E-Print Network [OSTI]

    Bonner, BE; Simmons, J. E.; Evans, M. L.; Glass, G.; Hiebert, John C.; Jain, M.; Northcliffe, L. C.; Bjork, C. W.; Riley, P. J.; Cassapakis, C. G.

    1978-01-01

    results in a +8% scale error in the cross sections reported here. Corrections to the data consisted of the follom- lng: (1) Deuteron loss from nuclear interactions in the material traversed in the spectrometer. This was calculated 'according to tmo... for the observed peak in elastic pD scattering. ' Several calculations have ernbel- lished the original idea by the inclusion' of many possible N*'s, but it appears that N* probabilities are small. Another approach' has utilized the Yao technique to relate...

  1. Continued investigations of the catalytic reduction of N? to NH? by molybdenum triamidoamine complexes

    E-Print Network [OSTI]

    Hanna, Brian S. (Brian Stewart)

    2011-01-01

    A study of the effects of employing different solvents and the introduction of dihydrogen during the catalytic reduction of dinitrogen to ammonia with [HIPTN 3N]Mo complexes was completed. During a catalytic reaction, the ...

  2. S t r e e t Old Concord Rd-NH155A

    E-Print Network [OSTI]

    F O N D A G G1 M S P R H Town Lot Town Lot Reserved and Metered West Edge Lot Mast Road Lot 2, and Mast Road Lots. PARKING MAP AS AMENDED, JULY 2015PARKING MAP AS AMENDED, JULY 2015 PERMIT PARKING. Valid Service, Vendor, Trustee, Emeritus, and Volunteer permits are also good in these lots. B Lot K15

  3. S t r e e t Old Concord Rd-NH155A

    E-Print Network [OSTI]

    New Hampshire, University of

    A G G1 G M S Municipal Public Parking Municipal Reserved Parking P R Mast Road Lot 1 West Edge Lot Mast Road Lot 2 Woodside Lot F.H.EAST F.H.WEST SPINNEY LANE LOT (spec. assigned only) Gables Lot in all lots except A, West Edge, and Mast Road Lots. PARKING MAP AS AMENDED, JULY 2014PARKING MAP

  4. Evaluation of NH3-SCR Catalyst Technology on a 250-kW Stationary...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    More Documents & Publications Engine and Reactor Evaluations of HC-SCR for Diesel NOx Reduction Two Catalyst Formulations - One Solution for NOx After-treatment Systems...

  5. Vor ref.: NH/BLU/CBEI Notat nr.: 02-0346d

    E-Print Network [OSTI]

    : The report describes methods for reducing deposition of chlorides on boiler tubes in relation to biomass fractions - optimization of boiler air and fuel supply - additive dosing. Among those possibilities it has

  6. Year Month U.S. Average PAD District I Average CT ME MA NH RI

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    1996 January ... 94.6 96.1 94.5 93.0 92.0 89.1 94.9 92.6 94.7 111.7 February ... 95.9 97.5 96.2 93.2 93.8 90.8 95.6 93.7 94.4 112.9...

  7. Year Month U.S. Average PAD District I Average CT ME MA NH RI

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    1997 January ... 107.9 109.0 108.6 105.2 106.5 102.1 107.0 104.4 106.5 130.4 February ... 105.1 106.0 105.2 102.2 103.4 101.0 104.5...

  8. Progress on Acidic Zirconia Mixed Oxides for Efficient NH3-SCR Catalysis

    Office of Energy Efficiency and Renewable Energy (EERE)

    Details progress on non-zeolitic zirconia-based mixed oxides as promising new SCR catalyst materials and results of engine bench testing of full-size SCR prototype confirms Details progress on non-zeolitic zirconia-based mixed oxides as promising new SCR catalyst materials and results of engine bench testing of full-size SCR prototype confirms potential for formulation of Euro 6 SCR catalysts

  9. nh phm vi, Cc Web: http://www.gulfspillrestoration.noaa.gov

    E-Print Network [OSTI]

    ://www.gulfspillrestoration.noaa.gov earlyrestorationcomments@fws.gov U F W f ngv tHoangdHoaK),P.O.Box2099,Fairhope,AL 36533 t hi Ti nguyn Thin nhin

  10. CHARACTERIZATION STUDIES OF THE SELECTIVE REDUCTION OF NO by NH3

    E-Print Network [OSTI]

    Brown, N.J.

    2013-01-01

    post combustion gases of propane/air in a laboratory scalepost combustion gases of propane/air in a laboratory scaleThe combustion products of propane and air are diluted by

  11. CHARACTERIZATION STUDIES OF THE SELECTIVE REDUCTION OF NO by NH3

    E-Print Network [OSTI]

    Brown, N.J.

    2013-01-01

    of NO, The combustion products of propane and air areinjection. The combustion products of propane and air arein the post combustion gases of propane/air in a laboratory

  12. Selective Catalytic Oxidation (SCO) of NH3 to N2 for Hot Exhaust Treatment

    Broader source: Energy.gov [DOE]

    Investigation of a series of transition metal oxides and precious metal based catalysts for ammonia selective oxidation at low temperatures

  13. ELECTRICAL RESISTIVITY AS A TOOL FOR IDENTIFYING GEOLOGIC HETEROGENEITIES WHICH CONTROL SEEPAGE AT MIRROR LAKE, NH

    E-Print Network [OSTI]

    Toran, Laura

    ), and methods that calculate seepage based upon proxies such as measured hydraulic and temperature gradients University, Philadelphia, PA Laura Toran, Temple University, Philadelphia, PA Donald O. Rosenberry, United. In-situ measurements of seepage coincident with resistivity surveys suggested a relationship between

  14. Update and Improve Subsection NH - Simplified Elastic and Inelastic Design Analysis Methods

    SciTech Connect (OSTI)

    Jeries J. Abou-Hanna; Douglas L. Marriott; Timothy E. McGreevy

    2009-06-27

    The objective of this subtask is to develop a template for the 'Ideal' high temperature design Code, in which individual topics can be identified and worked on separately in order to provide the detail necessary to comprise a comprehensive Code. Like all ideals, this one may not be attainable as a practical matter. The purpose is to set a goal for what is believed the 'Ideal' design Code should address, recognizing that some elements are not mutually exclusive and that the same objectives can be achieved in different way. Most, if not all existing Codes may therefore be found to be lacking in some respects, but this does not mean necessarily that they are not comprehensive. While this subtask does attempt to list the elements which individually or in combination are considered essential in such a Code, the authors do not presume to recommend how these elements should be implemented or even, that they should all be implemented at all. The scope of this subtask is limited to compiling the list of elements thought to be necessary or at minimum, useful in such an 'Ideal' Code; suggestions are provided as to their relationship to one another. Except for brief descriptions, where these are needed for clarification, neither this repot, nor Task 9 as a whole, attempts to address details of the contents of all these elements. Some, namely primary load limits (elastic, limit load, reference stress), and ratcheting (elastic, e-p, reference stress) are dealt with specifically in other subtasks of Task 9. All others are merely listed; the expectation is that they will either be the focus of attention of other active DOE-ASME GenIV Materials Tasks, e.g. creep-fatigue, or to be considered in future DOE-ASME GenIV Materials Tasks. Since the focus of this Task is specifically approximate methods, the authors have deemed it necessary to include some discussion on what is meant by 'approximate'. However, the topic will be addressed in one or more later subtasks. This report describes work conducted toward developing a template for what might be the 'Ideal' high temperature design Code. While attempting to be as comprehensive as possible as to subject matter, it does not presume to recommend what individual components of a Code should be implemented, some of which is the focus of other Tasks in the DOE-ASME Gen IV/NGNP Materials Projects. This report does serve as a basis for construction of an attribute chart which is being prepared as part of Task 9.2; the intention for which is to provide a uniform format and concise means for summarizing and comparing other high temperature Codes currently in use around the world.

  15. Quasi-Elastic Charge-Exchange in Nh-2-]Pnn at 794 Mev

    E-Print Network [OSTI]

    Bonner, BE; Simmons, J. E.; Wallace, J. M.; Evans, M. L.; Glass, G.; Hiebert, John C.; Jain, M.; Northcliffe, L. C.; Bjork, C. W.; Riley, P. J.; Cassapakis, C. G.

    1978-01-01

    UOLUME 17, NUMBER 2 FEBRUARY 1978 Quasielastic charge exchange in n28 -+ pnn at 794 Mev~ 9. E. Bonner, J. E. Simmons, and J. M. Wallace Los Alamos Scientific Laboratory, University of California, Los A/amos, Ne~ Mexico 87545 M. I . Evans, f G. Glass... CEX. Quoted errors are de- rived from statistical errors only. Parameter d'0/fit= & e~& + &2e~2 Quas ielastic Elastic Present expt. Saclay (814 MeV) Elastic Los Alamos (800 MeV) (7 ( f3( A2 Pp do./rA (t=0) (=A)+ Ap) 12.87 + 0.22 123,4 +5...

  16. N_H - N_HI correlation in Gigahertz-peaked-spectrum galaxies

    E-Print Network [OSTI]

    Ostorero, L; Diaferio, A; Siemiginowska, A; Stawarz, ?; Moderski, R; Labiano, A

    2015-01-01

    With the Westerbork Synthesis Radio Telescope, we performed HI observations of a sample of known X-ray emitting Gigahertz-peaked-spectrum galaxies with compact-symmetric-object morphology (GPS/CSOs) that lacked an HI absorption detection. We combined radio and X-ray data of the full sample of X-ray emitting GPS/CSOs and found a significant, positive correlation between the column densities of the total and neutral hydrogen ($N_{\\rm H}$ and $N_{\\rm HI}$, respectively). Using a Bayesian approach, we simultaneously quantified the parameters of the $N_{\\rm H} - N_{\\rm HI}$ relation and the intrinsic spread of the data set. For a specific subset of our sample, we found $N_{\\rm H} \\propto N_{\\rm HI}^b$, with $b=0.93^{+0.49}_{-0.33}$, and $\\sigma_{int} (N_{\\rm H})= 1.27^{+1.30}_{-0.40}$. The $N_{\\rm H} - N_{\\rm HI}$ correlation suggests a connection between the physical properties of the radio and X-ray absorbing gas.

  17. nh Gi Thit Hi Ti Nguyn Thin Nhin Trong S C Trn Du Deepwater Horizon

    E-Print Network [OSTI]

    tr c xut ny nhm mc ch nng cao v/hoc tng cng vic s dng v/hoc tn hng nhng ti nguyn thin nhin ca cng chng. D n Pht Trin Cc C Hi Gii Tr Tng Cng trn Phn Mi Escribano Point ca Khu Vc Qun, loi b mnh vn sau cn bo v sa cha ng s, bung in thoi cng cng ti li ra, phng tin thng tin, c s trnh

  18. White Cedar Farm is a 202-acre property in Kingston, NH. 16 acres are currently in

    E-Print Network [OSTI]

    New Hampshire, University of

    , and is home to over two hundred laying hens. They also have sheep and goats, which they plan to use for meat in the greenhouse without paying costly prices for heating. They use the greenhouse throughout the year, producing, and one more source of income. Basic infrastructure also helps, especially in times of severe weather

  19. Infrared spectroscopic signatures of (NH4)2SO4 aerosols

    E-Print Network [OSTI]

    Weis, David D.; Ewing, George E.

    1996-08-20

    - ____ _ IRDetector xperiment p oduced a rosols at 304-5% RH as measured spectroscopically. Finally, i sedimentation experim nts, I /  aerosols were trapped in the flow-through cell just as they were queous Solution WroCloth Desiccant in the desiccating cell... to the cell wall was packed with silica gel. In this  x3.6 rs(SO cell he inle and outlet ports are nearly parallel with the cell axis. 0.40 Infrared extinction spectra were obtained by directing collimated radiation from a Fourier transform infrared (FT...

  20. An NH Moiety Is Not Required for Anion Binding to Amides in Aqueous Solution

    E-Print Network [OSTI]

    temperature (LCST) of PDEA was measured as a function of the concentration for 11 sodium salts in aqueous-in effect to occur. INTRODUCTION The physical behavior of numerous surfactants, polymers, and biomolecules the LCST of the polymer with increasing the salt concentration. Weakly hydrated anions (SCN- , ClO4 - , I

  1. Photodetachment spectroscopy of the C2nH ,,n24... anions

    E-Print Network [OSTI]

    Maier, John Paul

    12 These discoveries opened the route for the detection of larger hydrocarbons, e.g., the homologous series detection has been reported, models of the interstellar chem- istry predict also high abundances for Cn , Cn or helium coupled to an electric discharge. Part of the plasma entered through a skimmer into a linear time

  2. CHARACTERIZATION STUDIES OF THE SELECTIVE REDUCTION OF NO by NH3

    E-Print Network [OSTI]

    Brown, N.J.

    2013-01-01

    desirability of monitoring temperature, nitric oxide level,desirability of monitoring temperature, nitric oxide level,rotameter and by monitoring the gas temperature and pressure

  3. Progress on Acidic Zirconia Mixed Oxides for Efficient NH3-SCR...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    zirconia-based mixed oxides as promising new SCR catalyst materials and results of engine bench testing of full-size SCR prototype confirms potential for formulation of Euro...

  4. 2010 MARINE MICROBES GORDON RESEARCH CONFERENCE (JULY 4-9, 2010 - TILTON SCHOOL, TILTON NH)

    SciTech Connect (OSTI)

    David Kirchman

    2010-04-09

    Marine microbes include representatives from all three kingdoms of life and collectively carry out virtually all forms of metabolisms found on the planet. Because of this metabolic and genetic diversity, these microbes mediate many of the reactions making up global biogeochemical cycles which govern the flow of energy and material in the biosphere. The goal of this conference is to bring together approaches and concepts from studies of microbial evolution, genomics, ecology, and oceanography in order to gain new insights into marine microbes and their biogeochemical functions. The integration of scales, from genes to global cycles, will result in a better understanding of marine microbes and of their contribution to the carbon cycle and other biogeochemical processes.

  5. Year Month U.S. Average PAD District I Average CT ME MA NH RI

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames City of",6,1,"Omaha Public PowerOECD/IEA - 2008 © OECD/IEA - 2008 © OECD/IEA - 2008 1993 January ........................... 94.3

  6. Year Month U.S. Average PAD District I Average CT ME MA NH RI

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames City of",6,1,"Omaha Public PowerOECD/IEA - 2008 © OECD/IEA - 2008 © OECD/IEA - 2008 1993 January ........................... 94.3

  7. Year Month U.S. Average PAD District I Average CT ME MA NH RI

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames City of",6,1,"Omaha Public PowerOECD/IEA - 2008 © OECD/IEA - 2008 © OECD/IEA - 2008 1993 January ........................... 94.3

  8. Year Month U.S. Average PAD District I Average CT ME MA NH RI

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames City of",6,1,"Omaha Public PowerOECD/IEA - 2008 © OECD/IEA - 2008 © OECD/IEA - 2008 1993 January ........................... 94.3

  9. Year Month U.S. Average PAD District I Average CT ME MA NH RI

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames City of",6,1,"Omaha Public PowerOECD/IEA - 2008 © OECD/IEA - 2008 © OECD/IEA - 2008 1993 January ........................... 94.3

  10. Pittsburg, NH Natural Gas Pipeline Exports to Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan FebCubic Feet)PricePricethethePrice4) Part26,767Year Jan Feb

  11. Pittsburg, NH Natural Gas Pipeline Imports From Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan FebCubic Feet)PricePricethethePrice4) Part26,767YearYear Jan

  12. EA-1801: Granite Reliable Power Wind Park Project in Coos County, NH |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum Based| Department8,DepartmentFinalinDepartment of Energy 6:Department

  13. EECBG Success Story: Grants to Help N.H. Towns Conserve Energy | Department

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum Based|Department of EnergyDepartment of Energy FindingTraffic Tunnelof

  14. Grants to Help N.H. Towns Conserve Energy | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum12,Executive CompensationEnergyGet Current:5Logging SystemsCleanupGrantGrants

  15. Pittsburg, NH Natural Gas Pipeline Exports to Canada (Dollars per Thousand

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year Jan Feb Mar4) PartCubic

  16. Pittsburg, NH Natural Gas Pipeline Exports to Canada (Dollars per Thousand

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year Jan Feb Mar4)

  17. Pittsburg, NH Natural Gas Pipeline Exports to Canada (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year Jan Feb Mar4)Decade

  18. Pittsburg, NH Natural Gas Pipeline Exports to Canada (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year Jan Feb Mar4)DecadeYear

  19. Pittsburg, NH Natural Gas Pipeline Imports From Canada (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year Jan FebThousand

  20. Pittsburg, NH Natural Gas Pipeline Imports From Canada (Million Cubic Feet)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the Price (Percent) Year Jan FebThousandYear Jan

  1. L thnh vin ca Tp on Russell danh ting, Trng i hc Cardiff rt c

    E-Print Network [OSTI]

    Davies, Christopher

    t phng pháp ging dy, hng nghiên cu cng nh tn dng các c s vt cht tuyt vi ca trng. Thành ph Cardiff là mt hát và vin bo tàng, cng nh thng xuyên ng cai các s kin th thao ln, các chuyn lu din hoà nhc sân vn ng Khoa hc Sc kho và i sng. Sinh viên cng có th ng ký các khoá hc khác ti i hc Cardiff và s nhn c t vn và

  2. A national comparison of structural factors affecting participation in selected wildlife-related activities

    E-Print Network [OSTI]

    Knowles, William Roy

    1989-01-01

    . 92 15. 94 15. 56 15. 49 14. 80 14. 78 14. 68 14. 66 14. 36 14. 01 13. 80 13. 03 12. 89 12. 64 12. 20 12. 19 SD OR CO ME IA FL NE PA MN Ml VT AZ OK WA MO NH NM NV ND OH MA VA CA IL MD 40. 65 32. 19 29. 66 29... Angling State Hunting State Nonconsumptive VA NH NM 25. 51 25. 20 25. 13 23. 71 22. 94 AZ 10. 60 NC 10. 09 NH 9. 50 WA 9. 32 IN 9. 16 N AR 14. 36 14. 27 14. 18 13. 29 1 2. 73 DE 22. 59 NY 8. 69 12. 65 NV MD 21. 34 21. 18 20. 30...

  3. C;\\u U ,RAI Y Mt. PI OJ 1, Mich.

    E-Print Network [OSTI]

    /3 cup salad dressing 2 ta blespoons chopped onion 1 tea poon salt Pepper to season Salad greens Dram he Oll off he tuna Brea. the tuna in 0 large pieces. ix every- thing together except he salad greens. Pu the una-po a 0 salad in the refrigera or until cold Serve he una-potato salad on the so ad greens #12

  4. Www.deq.mt.gov/MFS/LawRules/Circular2 | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEtGeorgia:Illinois:Wizard Power

  5. Thermal And-Or Near Infrared At Marysville Mt Area (Blackwell) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013) |InformationThe2009) | Open Energy2008) | Open EnergyEnergy

  6. Thermal And-Or Near Infrared At Mt Ranier Area (Frank, 1995) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013) |InformationThe2009) | Open Energy2008) | Open

  7. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    incentivizing unbridled water extraction, this situation ledhow much individual water extraction practices impact theexcessive groundwater extraction Water Scarcity and Ac- cess

  8. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    103113 18 Freeman, Strategic Management: A StakeholderFreeman, R. Edward. Strategic Management: A StakeholderCommander. 39,40 Freeman Strategic Management: A Stakeholder

  9. In-situ aircraft observations of the 2000 Mt. Hekla volcanic cloud: Composition and chemical

    E-Print Network [OSTI]

    Lee, Shan-Hu

    to sulfuric acid was broadly consistent with changing OH concentrations at the time of the vernal equinox

  10. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    of Fire and Invasive Alien Plant Management Practices inof Fire and Invasive Alien Plant Management Practices inof Fire and Invasive Alien Plant Management Practices in

  11. mtDNA Variation in Caste Populations of Andhra Pradesh, India.

    E-Print Network [OSTI]

    Bamshad, Michael; Fraley, Alexander E.; Crawford, Michael H.; Cann, Rebecca L.; Busi, Baskara R.; Naidu, J. M.; Jorde, Lynn B.

    1996-01-01

    Various anthropological analyses have documented extensive regional variation among populations on the subcontinent of India using morphological, protein, blood group, and nuclear DNA polymorphisms. These patterns are the product of complex...

  12. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    11 California State Water Resources Control Board, The WaterSan Diego Regional Water Quality Control Board, Watershed73 California State Water Resources Control Board, The Water

  13. Montana Weed Control Association Annual Meeting. January 11th 2011, Great Falls, MT.

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    Seed movement by vehicles: how many, how far, and under what conditions? Movement of seeds by vehicles is generally thought to increase the spread of invasive plant species, but few studies have vehicles when driven a range of distances on different surfaces (asphalt, unpaved and offroad) under wet

  14. LETTERS TO THE EDITOR Two years ago at the MT Summit held in Hakone, Japan,

    E-Print Network [OSTI]

    is based on the Arthur D. Little (ADL) study of the production experience with the Georgetown Russian). Finally, it was suggested that there were better ways for the federal government to spend these R & D

  15. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    Libecap, Gary D. Rescuing Water Markets: Lessons from OwensWest and Its Disappearing Water, Revised Edition. Revised. (Thomas. Estimating Water Requirements for Firefighting

  16. A Demonstration Project for Capturing Geothermal Energy from Mine Waters beneath Butte, MT

    Broader source: Energy.gov [DOE]

    Project objectives. Demonstrate performance of heat pumps in a large HVAC system in a heating-dominated climate.

  17. Istituzioni di Matematiche I (CH-CI-MT) ________________________________V_IIIo_foglio_di_esercizi______________________*

    E-Print Network [OSTI]

    Candilera, Maurizio

    flesso e B quello a tangente parallela all'asse delle ordinate, si determini il* * volume del solido ottenuto dalla rotazione della regione finita di piano compresa tra l'arco AB, la retta OA e l* *'asse delle ascisse, di un intero giro attorno alla asse medesimo. ESERCIZIO 4. Si disegni nel piano

  18. The CAFE experiment : a joint seismic and MT investigation of the Cascadia subduction system

    E-Print Network [OSTI]

    McGary, R. Shane

    2013-01-01

    In this thesis we present results from inversion of data using dense arrays of collocated seismic and magnetotelluric stations located in the Cascadia subduction zone region of central Washington. In the migrated seismic ...

  19. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    1: Climate Change and the Energy Crisis. (2008). Getting Our1: Climate Change and the Energy Crisis. (2008). http://

  20. IDBA-MT: De novo Assembler for Metatranscriptomic Data generated from Next-Generating Sequencing Technology

    E-Print Network [OSTI]

    Chin, Francis Y.L.

    Parkinson Biochemistry & Molecular and Medical Genetics University of Toronto, 27 King's College Circle, Toronto, Ontario, Canada M5S 1A1 Email: john.parkinson@utoronto.ca Telephone: 416-813-5746 Francis Y of microbes in human gut was found to be related to common diseases such as Inflammatory Bowel Disease (IBD

  1. Hawaiian Hot-spot Swell Structure from Seafloor MT Sounding Steven Constable

    E-Print Network [OSTI]

    Key, Kerry

    on the hotspot (Cough, 1979; Detrick and Crough, 1978); (ii) compositional underplating of depleted mantle

  2. NEAFS Y-mtDNA Workshop (Butler and Coble) November 1, 2006

    E-Print Network [OSTI]

    Human Genome The Human Genome Nuclear DNA 3 billion bp High Power Of Discrimination Mitochondrial DNA 16 11 12 13 14 15 16 17 18 19 20 21 22 X Y Sex- chromosomes Autosomes 3.2 billion bp Nuclear DNA), and use a genetic code for amino acids different that the nuclear DNA. New mitochondria are formed

  3. The Investigation on Fibrous Veins and Their Host from Mt. Ida, Ouachita Mountains, Arkansas

    E-Print Network [OSTI]

    Chung, Jae Won

    2004-09-30

    , the ?13C and ?18O compositions of the host lithologies range from 1.5 to -3.0 per mil and 7.5 to -14.0 per mil (VPDB), respectively. By contrast, the ?18O composition of the veins is remarkably constant (-13.5 per mil) among veins of starkly different...

  4. Compound Nouns in a Unification-Based MT System Pierrette Bouillon Katharina Boesefeldt

    E-Print Network [OSTI]

    of the texts involved in order to translate compounds efficientlyand correctly. We first give a brief overview

  5. MT3522 Knot Theory Solutions 4 1. (i) The closure of 2

    E-Print Network [OSTI]

    Walker, Grant

    molecule. O 1 :unknot O 2 :split unlink or opposite matched M 1 :pos trefoil M 2 :pos Hopf link or 3 #12; or opposite O 1 O 2 :pos trefoil :pos Hopf link :unknot or matched M 2 :split unlink M 1 opposite 2 or O 1 O

  6. m)T7(T^/f^\\ \\ / Riso-R-430 The Geochemistry

    E-Print Network [OSTI]

    -LEVEL HASTE 22 Uranium 31 Neptunium 35 Plutonium 38 Americium 41 CHEMISTRY OF TECHNETIUM 44 ADSORPTION, stability-diagrams for the transuranium elements from uranium to americium under diverse conditions have GROUNDWATER COMPOSITIONS 7 COMPLEX CHEMISTRY 12 CRITICAL ANION CONCENTRATION IN GROUND WATERS 17 THE CHEMISTRY

  7. mtAndroid Aplicao Mvel Android de Apoio a Percursos Pedestres Outdoor

    E-Print Network [OSTI]

    da Silva, Alberto Rodrigues

    às capacidades de um Smartphone e das tecnologias disponíveis no meio envolvente. Além das principais técnicas e tecnologias de localização existentes

  8. On the stability of the Earth's radiative energy balance: Response to the Mt. Pinatubo eruption

    E-Print Network [OSTI]

    short wave energy into the outgoing long wave energy stream, it is of interest to understand how and why

  9. Building America Case Study: Lancaster County Career and Technology Center Green Home 3, Mt Joy, Pennsylvania

    SciTech Connect (OSTI)

    Not Available

    2014-12-01

    Transitioning from standard light frame to a thermal mass wall system in a high performance home will require a higher level of design integration with the mechanical systems. The much higher mass in the ICF wall influences heat transfer through the wall and affects how the heating and cooling system responds to changing outdoor conditions. This is even more important for efficient, low-load homes with efficient heat pump systems in colder climates where the heating and cooling peak loads are significantly different from standard construction.This report analyzes a range of design features and component performance estimates in an effort to select practical, cost-effective solutions for high performance homes in a cold climate. Of primary interest is the influence of the ICF walls on developing an effective air sealing strategy and selecting an appropriate heating and cooling equipment type and capacity. The domestic water heating system is analyzed for costs and savings to investigate options for higher efficiency electric water heating. A method to ensure mechanical ventilation air flows is examined. The final solution package includes high-R mass walls, very low infiltration rates, multi-stage heat pump heating, solar thermal domestic hot water system, and energy recovery ventilation. This solution package can be used for homes to exceed 2012 International Energy Conservation Code requirements throughout all climate zones and achieves the DOE Challenge Home certification.

  10. J. Geomag. Geoelectr., 49, 727-737, 1997 Introduction to MT.,.DIW2 Special Issue

    E-Print Network [OSTI]

    Jones, Alan G.

    line, with 300 m dipoles. In-line electric fields only were recorded on this line. The four full 5, Downing Street, Cambridge, England, CB2 9EQ 1. Introduction The second Magnetotelluric Data Interpretation

  11. ATH 1300/1600 M-MT MAGLEV HYBRID TURBOMOLECULAR PUMPS

    E-Print Network [OSTI]

    Wager, John F.

    ). In Europe, AVTF-France headquarters and three of its subsidiaries, Alcatel Hochvakuumtechnik (Germany, Research and development, High energy physics, Space simulation, Accelerators. ADVANTAGES: High throughput of experience in the field of turbomolecular pump design. In order to ensure the best possible performance

  12. AMTA 2006 Overview of Statistical MT 1 An Overview of Statistical

    E-Print Network [OSTI]

    Smith, David A.

    , govt documents (~30M words) ... Serbian KhmerChechen {... ... { Bible/Koran/ Book of Mormon/ Dianetics

  13. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    of R: A Language and Environment for Statistical ComputingR Development Core Team. R: A language and environment for statistical

  14. Manual for Development of a Transient MODFLOW/MT3DMS/SEAWAT Simulation

    E-Print Network [OSTI]

    Barrash, Warren

    . The results of this model run are compared to the observed data in an effort to correctly identify...................................................................................... 19 Creating River Coverage........................................................................................... 20 Creating the River Arcs

  15. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    rain gardens, soil amendments, permeable pavements, and infiltration devices could offer potential solutions to problems of water

  16. Bern, 28. Januar 2015 / MT Weisung: Wechselkurs fr das Budgetieren neuer EU Grants

    E-Print Network [OSTI]

    Sola, Rolf Haenni

    Forschung Prof. Dr. Christian Leumann Vizerektor Hochschulstrasse 4 CH-3012 Bern Tel. +41 031 631 43 55 Christian.leumann@rektorat.unibe.ch www.rektorat.unibe.ch Vizerektorat, Hochschulstrasse 4, CH-3012 Bern #12;

  17. Bern, 28 January 2015 / MT Directive: Exchange rate for budgeting new EU grants

    E-Print Network [OSTI]

    Richner, Heinz

    -Rectorate Research Prof. Dr. Christian Leumann Vizerektor Hochschulstrasse 4 CH-3012 Bern Tel. +41 031 631 43 55 Christian.leumann@rektorat.unibe.ch www.rektorat.unibe.ch Vice-Rectorate, Hochschulstrasse 4, CH-3012 Bern

  18. Altered Mitochondrial Retrograde Signaling in Response to mtDNA Depletion or a Ketogenic Diet

    E-Print Network [OSTI]

    Selfridge, Jennifer Eva

    2012-12-31

    pathways and general neuronal dependence on anaerobic metabolism. Specifically, the electron transport chain function is reduced both systemically and in brains of individuals affected by Alzheimer's disease, amyotrophic lateral sclerosis, and Parkinson...

  19. Testing neural mechanisms that may underlie spatiotopic processing in area MT

    E-Print Network [OSTI]

    Ong, Wei Song

    2012-01-01

    Hence if motion processing occurs in retinal coordinates, wethat show motion processing do so in retinal coordinates, wein retinal coordinates, can have spatiotopic processing. In

  20. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    various small-scale water suppliers, the San Diego CountyDepartment, major water suppliers for the region (e.g. Mounttries to work with suppliers Acknowledges that infrastruc-