National Library of Energy BETA

Sample records for mt sd ne

  1. 50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links

    E-Print Network [OSTI]

    Allen, Gale

    that broadcast with a power of 50,000 Watts day and night. Some of these stations are what was once known50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links 50,000-Watt AM stations This list includes AM stations in the United States and Canada

  2. Electron capture and beta-decay rates for sd-shell nuclei in stellar environments relevant to high density O-Ne-Mg cores

    E-Print Network [OSTI]

    Toshio Suzuki; Hiroshi Toki; Ken'ichi Nomoto

    2015-12-01

    Electron capture and beta-decay rates for nuclear pairs in sd-shell are evaluated at high densities and high temperatures relevant to the final evolution of electron-degenerate O-Ne-Mg cores of stars with the initial masses of 8-10 solar mass. Electron capture induces a rapid contraction of the electron-degenerate O-Ne-Mg core. The outcome of rapid contraction depends on the evolutionary changes in the central density and temperature, which are determined by the competing processes of contraction, cooling, and heating. The fate of the stars are determined by these competitions, whether they end up with electron-capture supernovae or Fe core-collapse supernovae. Since the competing processes are induced by electron capture and beta-decay, the accurate weak rates are crucially important. The rates are obtained for pairs with A=20, 23, 24, 25 and 27 by shell-model calculations in sd-shell with the USDB Hamiltonian. Effects of Coulomb corrections on the rates are evaluated. The rates for pairs with A=23 and 25 are important for nuclear URCA processes that determine the cooling rate of O-Ne-Mg core, while those for pairs with A=20 and 24 are important for the core-contraction and heat generation rates in the core. We provide these nuclear rates at stellar environments in tables with fine enough meshes at various densities and temperatures for the studies of astrophysical processes sensitive to the rates. In particular, the accurate rate tables are crucially important for the final fates of not only O-Ne-Mg cores but also a wider range of stars such as C-O cores of lower mass stars.

  3. Ne

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shinesSolar Photovoltaic(MillionNature and Origin of the| NationalNavigatingNe

  4. Table 2 -Lime use and practices on Corn, major producing states, 2001 CO GA IL IN IA KS KY MI MN MO NE NY NC ND OH PA SD TX WI Area

    E-Print Network [OSTI]

    Kammen, Daniel M.

    MO NE NY NC ND OH PA SD TX WI Area Lime applied NR 85 81 85 67 16 72 55 27 65 10 57 53 NR 70 95 3 1 50 51 Lime (tons treated acre) NR 1.0 2.1 1.9 2.5 2.1 2.4 2.0 2.6 2.8 1.5 1.9 1.1 NR 1.9 1.7 NR 0.5 2 NC ND OH PA SD TX WI Area Lime applied NR 95 90 69 18 69 71 14 77 16 76 99 NR 82 80 NR 5 58 54 Lime

  5. NE Pacific St. NE Pacific St.

    E-Print Network [OSTI]

    Lake W ashington Ship Canal NE Pacific St. NE Pacific St. NE Boat St. 15th Ave NE 15thAveNE UniversityWayNE BrooklynAveNE NE Pacific St. MontlakeBlvdNE MontlakeBlvdNE Pacific Place NE University Burke-Gilman Trail METRO NW A CD D EF F GHI H J RR BB CC EE AA Rotunda Cafe Ocean Sciences Hitchcock

  6. 15Ne

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPO RetireesLecturersO β+-DecayBeFCPTC HourlyFNp,Ne

  7. 16Ne

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPO RetireesLecturersOThermal Neutron CaptureNe

  8. 18Ne

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPO RetireesLecturersOThermal NeutronC7O(α,36MgNNaNe

  9. 18Ne

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPO RetireesLecturersOThermal NeutronC7O(α,36MgNNaNe

  10. Saving Mt. Fuji

    E-Print Network [OSTI]

    Hacker, Randi

    2013-09-12

    Broadcast Transcript: Mt. Fuji, or Fujisan is it is known here in Japan, has just been added to Unesco's World Heritage list as a cultural asset, honoring it for providing thousands of years of inspiration to artists, poets ...

  11. Pipeline MT Instructions Identification Number

    E-Print Network [OSTI]

    Hong, Don

    Pipeline MT Instructions Identification Number For identification purposes, you will be assigned a special identification number. M# You can activate your MT email, login to PipelineMT to register for classes or pay tuition and fees. Activating the MTSU Email and PipelineMT accounts: Visit the website

  12. Basin Play State(s) Production Reserves Williston Bakken ND, MT, SD

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming Dry NaturalPrices1 Table 1.101 (Million Short6RU Ntight oil plays:

  13. MicroBooNE

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    source of neutrinos for MicroBooNE is BNB; however, the NuMI beam will provide higher electron neutrino and antineutrino event rates and a unique opportunity to study these events....

  14. BooNE: About BooNE

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits & InspectionsBerylliumBiomimetic(cousin -in-law toofHomeAbout BooNE

  15. Migration of nuclear shell gaps studied in the d(24Ne,p gamma)25Ne reaction

    E-Print Network [OSTI]

    W. N. Catford; C. N. Timis; R. C. Lemmon; M. Labiche; N. A. Orr; B. Fernandez-Dominguez; R. Chapman; M. Freer; M. Chartier; H. Savajols; M. Rejmund; N. L. Achouri; N. Amzal; N. I. Ashwood; T. D. Baldwin; M. Burns; L. Caballero; J. M. Casadjian; N. Curtis; G. de France; W. Gelletly; X. Liang; S. D. Pain; V. P. E. Pucknell; B. Rubio; O. Sorlin; K. Spohr; Ch. Theisen; D. D. Warner

    2010-04-09

    The transfer of neutrons onto 24Ne has been measured using a reaccelerated radioactive beam of 24Ne to study the (d,p) reaction in inverse kinematics. The unusual raising of the first 3/2+ level in 25Ne and its significance in terms of the migration of the neutron magic number from N=20 to N=16 is put on a firm footing by confirmation of this state's identity. The raised 3/2+ level is observed simultaneously with the intruder negative parity 7/2- and 3/2- levels, providing evidence for the reduction in the N=20 gap. The coincident gamma-ray decays allowed the assignment of spins as well as the transferred orbital angular momentum. The excitation energy of the 3/2+ state shows that the established USD shell model breaks down well within the sd model space and requires a revised treatment of the proton-neutron monopole interaction.

  16. Category:Pierre, SD | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButte County,Camilla, Georgia:GeothermalNEPA EnvironmentalOpenEI policiesPierre, SD

  17. Municipal Energy Agency of NE | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to: navigation,Mereg GmbHMontebalitoMt Princeton HotMultilagosAuthorityNE

  18. 18Ne.PDF

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPO RetireesLecturersOThermal NeutronC7O(α,36MgNNaNe

  19. 18Ne_78.PDF

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPO RetireesLecturersOThermal NeutronC7O(α,36MgNNaNe

  20. MiniBooNE:

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OFDetectionBenchmarkResults and Follow-OnMiniBooNE's6

  1. MicroBooNE

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on dark matterEnergyPublicatons ContactThousandEnergyMicroBooNE

  2. Proton-proton correlations observed in two-proton decay of $^{19}$Mg and $^{16}$Ne

    E-Print Network [OSTI]

    I. Mukha; L. Grigorenko; K. Summerer; L. Acosta; M. A. G. Alvarez; E. Casarejos; A. Chatillon; D. Cortina-Gil; J. Espino; A. Fomichev; J. E. Garcia-Ramos; H. Geissel; J. Gomez-Camacho; J. Hofmann; O. Kiselev; A. Korsheninnikov; N. Kurz; Yu. Litvinov; I. Martel; C. Nociforo; W. Ott; M. Pfutzner; C. Rodriguez-Tajes; E. Roeckl; M. Stanoiu; H. Weick; P. J. Woods

    2008-02-28

    Proton-proton correlations were observed for the two-proton decays of the ground states of $^{19}$Mg and $^{16}$Ne. The trajectories of the respective decay products, $^{17}$Ne+p+p and $^{14}$O+p+p, were measured by using a tracking technique with microstrip detectors. These data were used to reconstruct the angular correlations of fragments projected on planes transverse to the precursor momenta. The measured three-particle correlations reflect a genuine three-body decay mechanism and allowed us to obtain spectroscopic information on the precursors with valence protons in the $sd$ shell.

  3. Migration of Nuclear Shell Gaps Studied in the d({sup 24}Ne,p{gamma}){sup 25}Ne Reaction

    SciTech Connect (OSTI)

    Catford, W. N.; Timis, C. N.; Baldwin, T. D.; Gelletly, W.; Pain, S. D.; Lemmon, R. C.; Pucknell, V. P. E.; Warner, D. D.; Labiche, M.; Orr, N. A.; Achouri, N. L.; Chapman, R.; Amzal, N.; Burns, M.; Liang, X.; Spohr, K.; Freer, M.; Ashwood, N. I.

    2010-05-14

    The transfer of neutrons onto {sup 24}Ne has been measured using a reaccelerated radioactive beam of {sup 24}Ne to study the (d,p) reaction in inverse kinematics. The unusual raising of the first 3/2{sup +} level in {sup 25}Ne and its significance in terms of the migration of the neutron magic number from N=20 to N=16 is put on a firm footing by confirmation of this state's identity. The raised 3/2{sup +} level is observed simultaneously with the intruder negative parity 7/2{sup -} and 3/2{sup -} levels, providing evidence for the reduction in the N=20 gap. The coincident gamma-ray decays allowed the assignment of spins as well as the transferred orbital angular momentum. The excitation energy of the 3/2{sup +} state shows that the established USD shell model breaks down well within the sd model space and requires a revised treatment of the proton-neutron monopole interaction.

  4. BooNE versus MiniBooNE

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O OLaura|BilayerBiomimetic DyeBluevs MiniBooNE MiniBooNE refers

  5. Mt. Baker Geothermal Project | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | OpenMt St HelensMt StMt.

  6. BUILDING BETTER CONE JET ALGORITHMS S.D. Ellis,1

    E-Print Network [OSTI]

    Huston, Joey

    BUILDING BETTER CONE JET ALGORITHMS S.D. Ellis,1 J. Huston,2 and M. Tnnesmann3 1 Seattle, WA 98195, such as jet algorithms, to more reliably bridge the gap between theory and experiment. We present recent results on the development of better cone jet algorithms. I. INTRODUCTION A common facet of essentially

  7. Mt Rainier Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | Open Energy(RECP)MtMt

  8. US NE MA Site Consumption

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969 1.979Coal Consumers inYear JanSales Type: Sales120NE MA Site

  9. Supporting Information Geobacter sp. SD-1 with enhanced electrochemical activity in high salt

    E-Print Network [OSTI]

    1 Supporting Information Geobacter sp. SD-1 with enhanced electrochemical activity in high salt title: Geobacter sp. SD-1 in high salt solutions #12;2 Fig. S1. Current generation as a function of time

  10. AA Dor - An Eclipsing sdOB - Brown Dwarf Binary

    E-Print Network [OSTI]

    Thomas Rauch

    2003-11-25

    AA Dor is an eclipsing, close, post common-envelope binary consisting of a sdOB primary star and an unseen secondary with an extraordinary small mass - formally a brown dwarf. The brown dwarf may have been a former planet which survived a common envelope phase and has even gained mass. A recent determination of the components' masses from results of NLTE spectral analysis and subsequent comparison to evolutionary tracks shows a discrepancy to masses derived from radial-velocity and the eclipse curves. Phase-resolved high-resolution and high-SN spectroscopy was carried out in order to investigate on this problem. We present results of a NLTE spectral analysis of the primary, an analysis of its orbital parameters, and discuss possible evolutionary scenarios.

  11. Developing Mt. Hope: The megawatt line

    SciTech Connect (OSTI)

    Rodzianko, P.; Fisher, F.S.

    1992-12-01

    After facing numerous obstacles, including opposition and competition, the Mt. Hope pumped-storage project in New Jersey has been licensed by FERC. That license will allow a former iron ore mine site to be used in producing a new resource-hydroelectricity. In early August 1992, after more than seven years of effort, the 2,000-MW Mt. Hope Waterpower Project was licensed by the Federal Energy Regulatory Commission (FERC). Getting the $1.8 billion pumped-storage project licensed was not an easy task. It involved 54 submittals to FERC, six public meetings, and costs of more than $12 million. Along the way, the project has withstood competing applications, community opposition, and legal battles. Getting a project of this magnitude off the ground is a challenge for even the most experienced developer. The effort was especially challenging for the Halecrest Company, a local family-owned and operated firm with no previous experience in hydroelectric development. When financing became tight, creative ways were found to raise seed capital for the project. When hydroelectric experience was needed, the company developed a world-class corporate team that carried Mt. Hope through the complexities of the licensing process and beyond. With license now in hand, the project developers are ready to move forward with negotiating power sales contracts and securing construction financing. The resulting project will be the second largest pumped-storage facility in the country-second only to the 2,100-MW Bath County project in Virginia. Mt. Hope will take six years to construct and is scheduled to be phased into operation beginning in 1999.

  12. Heavy metals and lead isotopes in sdB stars

    E-Print Network [OSTI]

    S. O'Toole; U. Heber

    2006-12-19

    We present a detailed abundance analysis of high-resolution ultraviolet echelle spectra of five subdwarf B stars obtained with HST-STIS The goal of our observations was to test the hypothesis that pulsations in sdBs are correlated to the surface abundances of iron-group elements. We study two pulsators and three non-pulsators and determined abundances for 25 elements including the iron group and even heavier elements such as tin and lead using LTE spectrum synthesis techniques. We find strong enrichments of heavy elements up to 2.9dex with respect to solar which are probably caused by atomic diffusion processes. No clear-cut correlation between pulsations and metal abundances becomes apparent. Abundances for lead isotopes are derived from very high resolution spectra using an UV line of triply ionised lead. As Pb terminates the s-process sequence Pb isotopic abundance ratios yield important constraints. It is very difficult to measure them in hot stars. For the first time we were able to measure them in two subluminous B stars and conclude that the 207Pb/208Pb is solar.

  13. The NeXus data format

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Knnecke, Mark; Akeroyd, Frederick A.; Bernstein, Herbert J.; Brewster, Aaron S.; Campbell, Stuart I.; Clausen, Bjrn; Cottrell, Stephen; Hoffmann, Jens Uwe; Jemian, Pete R.; Mnnicke, David; et al

    2015-01-30

    NeXus is an effort by an international group of scientists to define a common data exchange and archival format for neutron, X-ray and muon experiments. NeXus is built on top of the scientific data format HDF5 and adds domain-specific rules for organizing data within HDF5 files, in addition to a dictionary of well defined domain-specific field names. The NeXus data format has two purposes. First, it defines a format that can serve as a container for all relevant data associated with a beamline. This is a very important use case. Second, it defines standards in the form of application definitionsmorefor the exchange of data between applications. NeXus provides structures for raw experimental data as well as for processed data.less

  14. MicroBooNE Detector Move

    ScienceCinema (OSTI)

    Flemming, Bonnie; Rameika, Gina

    2014-07-15

    On Monday, June 23, 2014 the MicroBooNE detector -- a 30-ton vessel that will be used to study ghostly particles called neutrinos -- was transported three miles across the Fermilab site and gently lowered into the laboratory's Liquid-Argon Test Facility. This video documents that move, some taken with time-lapse camerad, and shows the process of getting the MicroBooNE detector to its new home.

  15. NE-23 List of California Sites Hattie Carwell. SAN/NSQA Division

    Office of Legacy Management (LM)

    Projects Dffice of Nuclear Energy bee: W. Murphie, NE-23 J. Wagoners, NE-23 OTS NE-23 RF WUjtiiWXRR Wallo RF NEG (4) NE-23:AWallo:ph:353-5439:51889:IBM:13841 NE-...

  16. Mt Rainier Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | Open Energy(RECP)Mt

  17. Mt Wheeler Power, Inc | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to: navigation,Mereg GmbHMontebalitoMt Princeton Hot Springs

  18. Marysville Mt Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville Mt Geothermal Area Jump to: navigation, search

  19. Mt Signal Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to: navigation, searchsource HistoryCharleston,Peak Utility Jump to:PosoMt

  20. Water Sampling At Mt Princeton Hot Springs Geothermal Area (Olson...

    Open Energy Info (EERE)

    Water Sampling At Mt Princeton Hot Springs Geothermal Area (Olson & Dellechaie, 1976) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water...

  1. Refraction Survey At Mt Princeton Hot Springs Geothermal Area...

    Open Energy Info (EERE)

    Refraction Survey At Mt Princeton Hot Springs Geothermal Area (Lamb, Et Al., 2012) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Refraction...

  2. 3D Mt Resistivity Imaging For Geothermal Resource Assessment...

    Open Energy Info (EERE)

    3D Mt Resistivity Imaging For Geothermal Resource Assessment And Environmental Mitigation At The Glass Mountain Kgra, California Jump to: navigation, search OpenEI Reference...

  3. Vertical Electrical Sounding Configurations At Mt Princeton Hot...

    Open Energy Info (EERE)

    Vertical Electrical Sounding Configurations At Mt Princeton Hot Springs Geothermal Area (Zohdy, Et Al., 1971) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home...

  4. Direct-Current Resistivity Survey At Mt Princeton Hot Springs...

    Open Energy Info (EERE)

    Direct-Current Resistivity Survey At Mt Princeton Hot Springs Area (Richards, Et Al., 2010) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity:...

  5. Geothermometry At Mt Princeton Hot Springs Geothermal Area (Pearl...

    Open Energy Info (EERE)

    Et Al., 1976) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Geothermometry At Mt Princeton Hot Springs Geothermal Area (Pearl, Et Al., 1976)...

  6. Scaling regression inputs by dividing by 2 sd Prior distribution for logistic regression

    E-Print Network [OSTI]

    Gelman, Andrew

    Scaling regression inputs by dividing by 2 sd Prior distribution for logistic regression Comparing Andrew Gelman Some Recent Progress in Simple Statistical Methods #12;Scaling regression inputs by dividing by 2 sd Prior distribution for logistic regression Comparing the upper third to the lower third

  7. MT3DMS v5.3 Supplemental User's Guide

    E-Print Network [OSTI]

    Zheng, Chunmiao

    published by the U.S. Army Corps of Engineers (Zheng and Wang, 1999; available at http://hydro.geo.ua.edu/mt3d). Readers should refer to Zheng and Wang (1999) for complete information on the theoretical Tonkin, Henning Prommer, Chris Langevin, Ned Banta, Eileen Poeter, and Rui Ma in various aspects of MT3

  8. MOBILE INTERACTIVE VISITOR INFORMATION SERVICE: PUKAHA MT. BRUCE TRIAL RESULTS

    E-Print Network [OSTI]

    Zealand Tourism Research Institute Sept 2005 #12;New Zealand Tourism Research Institute September 2005 www Information Service (MIVIS) mobile phones to access audio information at Pukaha Mt Bruce (PMB) were collected and range of visitors using the MIVIS phones in the Pukaha Mt Bruce setting. #12;New Zealand Tourism

  9. WPA Omnibus Award MT Wind Power Outreach

    SciTech Connect (OSTI)

    Brian Spangler, Manager Energy Planning and Renewables

    2012-01-30

    The objective of this grant was to further the development of Montana??s vast wind resources for small, medium, and large scale benefits to Montana and the nation. This was accomplished through collaborative work with wind industry representatives, state and local governments, the agricultural community, and interested citizens. Through these efforts MT Dept Environmental Quality (DEQ) was able to identify development barriers, educate and inform citizens, as well as to participate in regional and national dialogue that will spur the development of wind resources. The scope of DEQ??s wind outreach effort evolved over the course of this agreement from the development of the Montana Wind Working Group and traditional outreach efforts, to the current focus on working with the state??s university system to deliver a workforce trained to enter the wind industry.

  10. Chi tit mn hc mt bn kia.

    E-Print Network [OSTI]

    California at Davis, University of

    v xã hi, ý n môi trng và sáng to. "Th ô xe p ca Hoa K," Davis là mt cng ng a dng và nng ng chào ón, Phát ?m và Nghe Trong Lãnh Vc Hc Tp, và các lãnh vc khác. Ngoài ra cng có nhiu c hi tham gia các t chc ti trng và phc v cng ng. Mun bit ngày tháng, hc phí và các chi tit khác, hãy n: www

  11. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O OLaura|BilayerBiomimetic DyeBluevs MiniBooNE MiniBooNE refers

  12. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O OLaura|BilayerBiomimetic DyeBluevs MiniBooNE MiniBooNE

  13. Mineralogic variation in drill holes USW NRG-6, NRG-7/7a, SD-7, SD-9, SD-12, and UZ{number_sign}14: New data from 1996--1997 analyses

    SciTech Connect (OSTI)

    Chipera, S.J.; Vaniman, D.T.; Bish, D.L.; Carey, J.W.

    1997-05-30

    New quantitative X-ray diffraction (QXRD) mineralogic data have been obtained for samples from drill holes NRG-6, NRG-7/7A, SD-7, SD-9, SD- 12, and UZ{number_sign}14. In addition, new QXRD analyses were obtained on samples located in a strategic portion of drill hole USW H-3. These data improve our understanding of the mineral stratigraphy at Yucca Mountain, and they further constrain the 3-D Mineralogic Model of Yucca Mountain. Some of the unexpected findings include the occurrence of the zeolite chabazite in the vitric zone of USW SD-7, broad overlap of vitric and zeolitic horizons (over vertical ranges up to 70 m), and the previously unrecognized importance of the bedded tuft beneath the Calico Hills Formation as a subunit with generally more extensive zeolitization than the Calico Hills Formation in the southern part of the potential repository area. Reassessment of data from drill hole USW H-5 suggests that the zeolitization of this bedded unit occurs in the northwestern part of the repository exploration block as well. Further analyses of the same interval in USW H-3, however, have not permitted the same conclusion to be reached for the southwestern part of the repository block because of the much poorer quality of the cuttings in H-3 compared with those from H-5. X-ray fluorescence (XRF) chemical data for drill holes USW SD-7, 9, and 12 show that the zeolitic horizons provide a >10 million year record of retardation of Sr transport, although the data also show that simplistic models of one-dimensional downward flow in the unsaturated zone (UZ) are inadequate. Complex interstratification of zeolites and glass, with highly variable profiles between drill cores, point to remaining problems in constructing detailed mineral stratigraphies. However, the new data in this report provide important information for constructing bounding models of zeolite stratigraphy for transport calculations.

  14. The MicroBooNE Technical Design Report

    E-Print Network [OSTI]

    McDonald, Kirk

    ................................................................................................................20 3 Design Criteria and Parameter TablesThe MicroBooNE Technical Design Report The MicroBooNE Collaboration 2/24/2012 #12;The Micro

  15. Recycling Lingware in a Multilingual MT System Steffen Leo Hansen

    E-Print Network [OSTI]

    Recycling Lingware in a Multilingual MT System Steffen Leo Hansen Manny Rayner David Carter Ivan (Rayner and Carter, 1997). The first is the most obvious: we start with a function- ing grammar

  16. Ground Gravity Survey At Mt Princeton Hot Springs Geothermal...

    Open Energy Info (EERE)

    lithologic distrubtions Notes Gravity low associated with Mt. Princeton Batholith; density contrast of -0.5 gcm3 of valley-fill sediments relative to batholith References J.E....

  17. Anatomy of molecular structures in $^{20}$Ne

    E-Print Network [OSTI]

    Zhou, E F; Li, Z P; Meng, J; Ring, P

    2015-01-01

    We present a beyond mean-field study of clusters and molecular structures in low-spin states of $^{20}$Ne with a multireference relativistic energy density functional, where the dynamical correlation effects of symmetry restoration and quadrupole-octupole shapes fluctuation are taken into account with projections on parity, particle number and angular momentum in the framework of the generator coordinate method. Both the energy spectrum and the electric multipole transition strengths for low-lying parity-doublet bands are better reproduced after taking into account the dynamical octupole vibration effect. Consistent with the finding in previous antisymmetrized molecular dynamics studies, a rotation-induced dissolution of the $\\alpha+^{16}$O molecular structure in $^{20}$Ne is predicted and this peculiar phenomenon is partially attributed to the special deformation-dependent moment of inertia.

  18. Anatomy of molecular structures in $^{20}$Ne

    E-Print Network [OSTI]

    E. F. Zhou; J. M. Yao; Z. P. Li; J. Meng; P. Ring

    2015-10-18

    We present a beyond mean-field study of clusters and molecular structures in low-spin states of $^{20}$Ne with a multireference relativistic energy density functional, where the dynamical correlation effects of symmetry restoration and quadrupole-octupole shapes fluctuation are taken into account with projections on parity, particle number and angular momentum in the framework of the generator coordinate method. Both the energy spectrum and the electric multipole transition strengths for low-lying parity-doublet bands are better reproduced after taking into account the dynamical octupole vibration effect. Consistent with the finding in previous antisymmetrized molecular dynamics studies, a rotation-induced dissolution of the $\\alpha+^{16}$O molecular structure in $^{20}$Ne is predicted and this peculiar phenomenon is partially attributed to the special deformation-dependent moment of inertia.

  19. NE Press Releases | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuelsof EnergyApril 2014 |DepartmentMultimedia and PhotosMyBlog Archive NE

  20. NEAFS Y-mtDNA Workshop (Butler and Coble) November 1, 2006

    E-Print Network [OSTI]

    NEAFS Y-mtDNA Workshop (Butler and Coble) mtDNA November 1, 2006 http://www.cstl.nist.gov/biotech) mtDNA November 1, 2006 http://www.cstl.nist.gov/biotech/strbase/training.htm 2 Data Review-mtDNA Workshop (Butler and Coble) mtDNA November 1, 2006 http://www.cstl.nist.gov/biotech/strbase/training.htm 3

  1. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O OLaura|BilayerBiomimetic DyeBluevs MiniBooNE

  2. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O OLaura|BilayerBiomimetic DyeBluevs MiniBooNEGoals of BooNE

  3. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O OLaura|BilayerBiomimetic DyeBluevsDetector The MiniBooNE tank

  4. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O OLaura|BilayerBiomimetic DyeBluevsDetector The MiniBooNE

  5. A=14Ne (1981AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01) (Not illustrated) 14Ne has not been observed. See

  6. A=14Ne (1986AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01) (Not illustrated) 14Ne has not been observed.

  7. A=14Ne (1991AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01) (Not illustrated) 14Ne has not been

  8. The MicroBooNE Experiment - Collaboration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired Solar FuelTechnologyTel: Name:Department ofThe DOE Tours MicroBooNE! -

  9. The MicroBooNE Experiment - Collaboration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDidDevelopment TopMetathesisSediments and Related J.TheMicroBooNE In the

  10. The MicroBooNE Experiment - Collaboration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDidDevelopment TopMetathesisSediments and Related J.TheMicroBooNE In

  11. Recent Results from MiniBooNE

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMassR&D100 Winners * Impacts onReal-Time ChemicalResults from MiniBooNE and the Future

  12. MicroBooNE Proposal Addendum March

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesse BergkampCentermillionStockpile StewardshipO'ConnorFirstMicroBooNE Proposal

  13. NE Blog Archive | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuelsof EnergyApril 2014 |DepartmentMultimedia and PhotosMyBlog Archive NE Blog

  14. Mt St Helens Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | OpenMt St HelensMt St

  15. Canister storage building compliance assessment SNF project NRC equivalency criteria - HNF-SD-SNF-DB-003

    SciTech Connect (OSTI)

    BLACK, D.M.

    1999-08-11

    This document presents the Project's position on compliance with the SNF Project NRC Equivalency Criteria--HNF-SD-SNF-DE-003, Spent Nuclear Fuel Project Path Forward Additional NRC Requirements. No non-compliances are shown The compliance statements have been reviewed and approved by DOE. Open items are scheduled to be closed prior to project completion.

  16. sd2 Graphene: Kagome Band in a Hexagonal Lattice Miao Zhou,1

    E-Print Network [OSTI]

    Simons, Jack

    sd2 Graphene: Kagome Band in a Hexagonal Lattice Miao Zhou,1 Zheng Liu,1 Wenmei Ming,1 Zhengfei 2014; published 2 December 2014) Graphene, made of sp2 hybridized carbon, is characterized with a Dirac band, representative of its underlying 2D hexagonal lattice. The fundamental understanding of graphene

  17. Probing the lexicon in evaluating commercial MT systems Martin Volk

    E-Print Network [OSTI]

    for self evaluation consisted of technical, linguistic and ergonomic issues. As part of the linguisticProbing the lexicon in evaluating commercial MT systems Martin Volk University of Zurich Department Abstract In the past the evaluation of machine trans- lation systems has focused on single sys- tem

  18. NE Pacific Basin --Tagging Data Kate Myers, Ph.D.

    E-Print Network [OSTI]

    Ocean B: NE Pacific Basin --Tagging Data Kate Myers, Ph.D. Principal Investigator, High Seas Salmon ocean tagging research on Columbia River salmon and steelhead migrating in the NE Pacific Basin R. Basin in 1995-2004. Fisheries and Oceans Canada, Pacific Biological Station, Nanaimo, B

  19. (Have we found the Holy Grail?) Panel at MT-Summit 2003

    E-Print Network [OSTI]

    Wu, Dekai

    (Have we found the Holy Grail?) Panel at MT-Summit 2003 #12;The HKUST Leading Question Translation? If not, is the Holy Grail just around the corner? Translation Are we just about done? #12;Dekai Wu, MT

  20. Geothermal energy resource investigations at Mt. Spurr, Alaska

    SciTech Connect (OSTI)

    Turner, D.L.; Wescott, E.M. (eds.)

    1986-12-01

    Spurr volcano is a composite Quaternary cone of largely andesitic composition located on the west side of Cook Inlet about 80 miles west of Anchorage and about 40 miles from the Beluga electrical transmission line. Geologic mapping (Plate 1-1) shows that the present summit depression was produced by a Mt. St. Helens-type sector collapse, rather than by a caldera collapse. Geochronologic and previous tephrachronologic studies show that there has been an active magmatic system at Spurr volcano during the late Pleistocene-to-Holocene time interval that is of critical interest for geothermal energy resource assessment. Major effort was devoted to geochemical and geophysical surveys of the accessible area south of Mt. Spurr, in addition to geologic mapping and geochronologic studies. Many coincident mercury and helium anomalies were found, suggesting the presence of geothermal systems at depth. Extremely large electrical self-potential anomalies were also found, together with extensive zones of low resistivity discovered by our controlled-source audiomagnetotelluric survey. The juxtaposition of all of these different types of anomalies at certain areas on the south slope of Crater Peak indicates the presence of a geothermal system which should be accessible by drilling to about 2000 ft depth. It is also evident that there is a strong volcanic hazard to be evaluated in considering any development on the south side of Mt. Spurr. This hazardous situation may require angle drilling of production wells from safer areas and placement of power generation facilities at a considerable distance from hazardous areas.

  1. Recent results from SciBooNE and MiniBooNE experiments

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMassR&D100 Winners * Impacts onReal-Time ChemicalResults from MiniBooNE and

  2. The Ne/O abundance ratio in the quiet Sun

    E-Print Network [OSTI]

    P. R. Young

    2005-10-10

    Aims: To determine the neon-to-oxygen abundance in the quiet Sun, a proxy for the photospheric abundance ratio. Method: An emission measure method applied to extreme ultraviolet emission lines of Ne IV-VI and O III-V ions observed by the Coronal Diagnostic Spectrometer on the SOHO satellite. Results: The average Ne/O abundance ratio in supergranule cell centre regions is 0.18 +/- 0.05, while in supergranule network regions is 0.16 +/- 0.04. A photospheric Ne/O ratio of 0.17 +/- 0.05 is suggested, in good agreement with the most recent compilation of solar photospheric abundances, but discrepant with a recent Ne/O ratio derived from stellar X-ray spectra and revised neon abundances suggested from solar interior models.

  3. {alpha}-cluster states in N{ne}Z nuclei

    SciTech Connect (OSTI)

    Goldberg, V. Z.; Rogachev, G. V.

    2012-10-20

    The importance of studies of {alpha}-Cluster structure in N{ne}Z light nuclei is discussed. Spin-parity assignments for the low-lying levels in {sup 10}C are suggested.

  4. File:USDA-CE-Production-GIFmaps-SD.pdf | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New Pages RecentTempCampApplicationWorksheet 2011.pdfSD.pdf Jump to: navigation, search File

  5. Mt St Helens Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | OpenMt St Helens

  6. MT Energie GmbH Co KG | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma,Information MHKMHK5 < MHKKemblaSolar Jump to:Industries Inc JumpMT

  7. RAPID/Roadmap/12-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevada <UtahMontanasourceWA-aCA-aMT-a <

  8. RAPID/Roadmap/15-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ | RoadmapCO-ceWA-eb <MT-a

  9. RAPID/Roadmap/17-MT-c | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ |a < RAPID‎CA-aHI-aaMT-c

  10. RAPID/Roadmap/18-MT-b | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ |a <-AK-b <CO-badMT-b

  11. RAPID/Roadmap/4-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎f <CA-aab <cdMT-a <

  12. RAPID/Roadmap/6-MT-d | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎fRAPID/Roadmap/6-CO-bacMT-d

  13. RAPID/Roadmap/6-MT-f | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎fRAPID/Roadmap/6-CO-bacMT-df

  14. City of Mt Pleasant, Utah (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler, Iowa (UtilityIowa Phone Number: (319) 385-2121City of Mt

  15. Mt Princeton Hot Springs Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to: navigation,Mereg GmbHMontebalitoMt Princeton Hot Springs Geothermal

  16. RAPID/Roadmap/14-MT-b | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-a <CA-cID-aMT-b <

  17. RAPID/Roadmap/14-MT-c | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-a <CA-cID-aMT-b

  18. RAPID/Roadmap/14-MT-d | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-a <CA-cID-aMT-bd

  19. RAPID/Roadmap/17-MT-d | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-ad-MT-d < RAPID‎ |

  20. RAPID/Roadmap/20-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-a < RAPID‎ |MT-a <

  1. RAPID/Roadmap/8-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-abFD-a < RAPID‎ID-eMT-a

  2. Micro-Earthquake At Marysville Mt Area (Blackwell) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville MtMedicalInformation 2-2005)1995) |Information

  3. HERO Ski Trip to Mt. Hood Meadows February

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (Journalvivo Low-Dose Low WeUpdateScienceForTrip to Mt. Hood Meadows

  4. A Letter of Intent to Build a MiniBooNE Near Detector: BooNE

    E-Print Network [OSTI]

    I. Stancu; Z. Djurcic; D. Smith; R. Ford; T. Kobilarcik; W. Marsh; C. D. Moore; J. Grange; B. Osmanov; H. Ray; G. T. Garvey; J. A. Green; W. C. Louis; C. Mauger; G. B. Mills; Z. Pavlovic; R. Van de Water; D. H. White; G. P. Zeller; W. Metcalf; B. P. Roe; A. A. Aguilar-Arevalo

    2009-10-14

    There is accumulating evidence for a difference between neutrino and antineutrino oscillations at the $\\sim 1$ eV$^2$ scale. The MiniBooNE experiment observes an unexplained excess of electron-like events at low energies in neutrino mode, which may be due, for example, to either a neutral current radiative interaction, sterile neutrino decay, or to neutrino oscillations involving sterile neutrinos and which may be related to the LSND signal. No excess of electron-like events ($-0.5 \\pm 7.8 \\pm 8.7$), however, is observed so far at low energies in antineutrino mode. Furthermore, global 3+1 and 3+2 sterile neutrino fits to the world neutrino and antineutrino data suggest a difference between neutrinos and antineutrinos with significant ($\\sin^22\\theta_{\\mu \\mu} \\sim 35%$) $\\bar \

  5. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    Strategies for Rural Communities. National Conference onallocation facing the rural community of Mt. Laguna? (EquityStrategies for Rural Communities. National Conference on

  6. DC Resistivity Survey (Dipole-Dipole Array) At Mt Princeton Hot...

    Open Energy Info (EERE)

    1971) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: DC Resistivity Survey (Dipole-Dipole Array) At Mt Princeton Hot Springs Geothermal Area...

  7. Status of the KM3NeT project

    E-Print Network [OSTI]

    Margiotta, A

    2014-01-01

    KM3NeT is a deep-sea research infrastructure being constructed in the Mediterranean Sea. It will be installed at three sites: KM3NeT-Fr, offshore Toulon, France, KM3NeT-It, offshore Portopalo di Capo Passero, Sicily (Italy) and KM3NeT-Gr, offshore Pylos, Peloponnese, Greece. It will host the next generation Cherenkov neutrino telescope and nodes for a deep sea multidisciplinary observatory, providing oceanographers, marine biologists, and geophysicists with real time measurements. The neutrino telescope will search for Galactic and extra-Galactic sources of neutrinos, complementing IceCube in its field of view. The detector will have a modular structure and consists of six building blocks, each including about one hundred Detection Units (DUs). Each DU will be equipped with 18 multi-PMT digital optical modules. The first phase of construction has started and shore and deep-sea infrastructures hosting the future KM3NeT detector are being prepared in France near Toulon and in Italy, near Capo Passero in Sicily....

  8. Source identification in acoustics and structural mechanics using Sierra/SD.

    SciTech Connect (OSTI)

    Walsh, Timothy Francis; Aquino, Wilkins; Ross, Michael

    2013-03-01

    In this report we derive both time and frequency-domain methods for inverse identification of sources in elastodynamics and acoustics. The inverse/design problem is cast in a PDE-constrained optimization framework with efficient computation of gradients using the adjoint method. The implementation of source inversion in Sierra/SD is described, and results from both time and frequency domain source inversion are compared to actual experimental data for a weapon store used in captive carry on a military aircraft. The inverse methodology is advantageous in that it provides a method for creating ground based acoustic and vibration tests that can reduce the actual number of flight tests, and thus, saving costs and time for the program.

  9. Massachusetts Institute of Technology Department of Facilities Building NE49

    E-Print Network [OSTI]

    Herr, Hugh

    Install site drainage and infrastructure for temp. utilities for bldg. construction Exterior B 8 Flush and backfill new 30" CHW Main Exterior C 9 Install drainage pipe and backfill utilities under Bldg. 39 Exterior, Electrical, Plumbing, Fire Protection MH - Manhole SOE - Support of Excavation SS - Sanitary Sewer SD - Storm

  10. Visual Field Maps, Population Receptive Field Sizes, and Visual Field Coverage in the Human MT Complex

    E-Print Network [OSTI]

    Dumoulin, Serge O.

    of processing in human motion-selective cortex. I N T R O D U C T I O N Neuroimaging experiments localize human by additional experiments. Defining human MT based on stimulus selectivity means that the identificationVisual Field Maps, Population Receptive Field Sizes, and Visual Field Coverage in the Human MT

  11. Bitcoin Transaction Malleability and MtGox Christian Decker and Roger Wattenhofer

    E-Print Network [OSTI]

    Bitcoin Transaction Malleability and MtGox Christian Decker and Roger Wattenhofer ETH Zurich International Publishing Switzerland 2014 #12;314 C. Decker and R. Wattenhofer exchanges its monopoly slowly doubled the withdrawn bitcoins, once from the withdrawal and once on its account on MtGox. In this work we

  12. An assessment of regional climate trends and changes to the Mt. Jaya glaciers of Irian Jaya

    E-Print Network [OSTI]

    Kincaid, Joni L.

    2007-09-17

    on the Mt. Jaya glaciers has been lacking since the early 1970s. Using IKONOS satellite images, the ice extents of the Mt. Jaya glaciers in 2000, 2002, 2003, 2004, and 2005 were mapped. The mapping indicates that the recessional trend which began in the mid...

  13. Mt. Etna tropospheric ash retrieval and sensitivity analysis using Moderate Resolution Imaging

    E-Print Network [OSTI]

    Oxford, University of

    Mt. Etna tropospheric ash retrieval and sensitivity analysis using Moderate Resolution Imaging.pugnaghi@unimore.it, gabriele.gangale@unimore.it Abstract. A retrieval of tropospheric volcanic ash from Mt Etna has been. In order to derive the ash plume optical thickness, the particle effective radius and the total mass

  14. A MT System from Turkmen to Turkish Employing Finite State and Statistical Methods

    E-Print Network [OSTI]

    Yanikoglu, Berrin

    between close language pairs can be relatively easier and can still benefit from simple(r) paradigms in MT with a disambiguation post-processing stage based on statistical language models. The very productive inflectionalA MT System from Turkmen to Turkish Employing Finite State and Statistical Methods A. Cneyd TANTU

  15. NeW DIRECTIONS STRATEgIC PLAN

    E-Print Network [OSTI]

    Fleming, Andrew J.

    NeW DIRECTIONS STRATEgIC PLAN 2013-2015 #12;Education Plan Research and Innovation Plan Future both in Australia and overseas. Strategic Objective 1: eDUcatiON PlaN Strategic Objective 2: 2.3 Review Workforce Plan Campus, Capital and IT Plan Finance Plan CONTENTS 03 06 09 12 15 #12;The University aspires

  16. NeMO 2004 Cruise Report R/V Thomas G. Thompson

    E-Print Network [OSTI]

    NeMO 2004 Cruise Report R/V Thomas G. Thompson Compiled by Shannon Ristau and Susan Merle TN 173 18: Pictures from ROPOS Dives............................................................3 Figure 1: NeMO 2004....................................................9 1.0 NeMO 2004 SCIENCE SUMMARY (Bill Chadwick)........................................11 1

  17. Production rate of cosmogenic 21 Ne in quartz estimated from 10

    E-Print Network [OSTI]

    Shuster, David L.

    Production rate of cosmogenic 21 Ne in quartz estimated from 10 Be, 26 Al, and 21 Ne concentrations Antarctica production rate calibration We estimated the production rate of 21 Ne in quartz using a set production rate. As the erosion rate can be determined from 10 Be and 26 Al concentrations, this allows

  18. Baltic Astronomy, vol. 14, XXXXXX, 2005. SPECTRAL ANALYSIS OF sdB-He STARS FROM THE SDSS

    E-Print Network [OSTI]

    2005 July 28 Abstract. We present spectral classification and physical parameters of a sam- ple of "helium-rich" sdB-He stars from spectra obtained from the SDSS archive. The spectral classification discovered amongst the many thousand hot subdwarfs in the recent Quasar survey the Sloan Digital Sky Survey

  19. Baltic Astronomy, vol. 14, XXX--XXX, 2005. SPECTRAL ANALYSIS OF sdBHe STARS FROM THE SDSS

    E-Print Network [OSTI]

    Jeffery, Simon

    2005 July 28 Abstract. We present spectral classification and physical parameters of a sam ple of ``heliumrich'' sdBHe stars from spectra obtained from the SDSS archive. The spectral classification discovered amongst the many thousand hot subdwarfs in the recent Quasar survey -- the Sloan Digital Sky

  20. Extending the GHS Weil Descent Attack S.D. Galbraith, F. Hess and N.P. Smart

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    Extending the GHS Weil Descent Attack S.D. Galbraith, F. Hess and N.P. Smart Department of Computer Science, University of Bristol, Merchant Venturers Building, Woodland Road, Bristol, BS8 1UB, United due to Gaudry, Hess and Smart (GHS) to a much larger class of elliptic curves. This extended attack

  1. Proposal for the Award of a Contract for the Civil Engineering Work on the Extensions to Buildings SUH and SD at LEP Access point nr. 2

    E-Print Network [OSTI]

    1990-01-01

    Proposal for the Award of a Contract for the Civil Engineering Work on the Extensions to Buildings SUH and SD at LEP Access point nr. 2

  2. MT3D: a 3 dimensional magnetotelluric modeling program (user's guide and documentation for Rev. 1)

    SciTech Connect (OSTI)

    Nutter, C.; Wannamaker, P.E.

    1980-11-01

    MT3D.REV1 is a non-interactive computer program written in FORTRAN to do 3-dimensional magnetotelluric modeling. A 3-D volume integral equation has been adapted to simulate the MT response of a 3D body in the earth. An integro-difference scheme has been incorporated to increase the accuracy. This is a user's guide for MT3D.REV1 on the University of Utah Research Institute's (UURI) PRIME 400 computer operating under PRIMOS IV, Rev. 17.

  3. Improved determination of the atmospheric parameters of the pulsating sdB star Feige 48

    SciTech Connect (OSTI)

    Latour, M.; Fontaine, G.; Brassard, P.; Green, E. M.; Chayer, P.

    2014-06-10

    As part of a multifaceted effort to better exploit the asteroseismological potential of the pulsating sdB star Feige 48, we present an improved spectroscopic analysis of that star based on new grids of NLTE, fully line-blanketed model atmospheres. To that end, we gathered four high signal-to-noise ratio time-averaged optical spectra of varying spectral resolutions from 1.0 to 8.7 , and we made use of the results of four independent studies to fix the abundances of the most important metals in the atmosphere of Feige 48. The mean atmospheric parameters we obtained from our four spectra of Feige 48 are: T {sub eff} = 29,850 60 K, log g = 5.46 0.01, and log N(He)/N(H) = 2.88 0.02. We also modeled, for the first time, the He II line at 1640 from the STIS archive spectrum of the star, and with this line we found an effective temperature and a surface gravity that match well with the values obtained with the optical data. With some fine tuning of the abundances of the metals visible in the optical domain, we were able to achieve a very good agreement between our best available spectrum and our best-fitting synthetic one. Our derived atmospheric parameters for Feige 48 are in rather good agreement with previous estimates based on less sophisticated models. This underlines the relatively small effects of the NLTE approach combined with line blanketing in the atmosphere of this particular star, implying that the current estimates of the atmospheric parameters of Feige 48 are reliable and secure.

  4. Overview of DOE-NE Proliferation and Terrorism Risk Assessment

    SciTech Connect (OSTI)

    Sadasivan, Pratap

    2012-08-24

    Research objectives are: (1) Develop technologies and other solutions that can improve the reliability, sustain the safety, and extend the life of current reactors; (2) Develop improvements in the affordability of new reactors to enable nuclear energy; (3) Develop Sustainable Nuclear Fuel Cycles; and (4) Understand and minimize the risks of nuclear proliferation and terrorism. The goal is to enable the use of risk information to inform NE R&D program planning. The PTRA program supports DOE-NE's goal of using risk information to inform R&D program planning. The FY12 PTRA program is focused on terrorism risk. The program includes a mix of innovative methods that support the general practice of risk assessments, and selected applications.

  5. NEAFS Y-mtDNA Workshop (Butler and Coble) Markers, Core Loci, and Kits

    E-Print Network [OSTI]

    ) Ann Gross (MN) Jill Smerick (FBI) Sam Baechtel (FBI) Roger Frappier (CFS) Phil Kinsey (OR now MT) Gary Sims (CA DOJ) George Carmody (retired) Mike Adamowicz (CT) Bruce Budowle (FBI

  6. TIME-VARIABLEFILTERING OF MtTLTI[CHANNELSIGNALS USING MULTIPLE WINDOWS COHERENCEAND THE WEYL TRANSFORM

    E-Print Network [OSTI]

    Sandsten, Maria

    TIME-VARIABLEFILTERING OF MtTLTI[CHANNELSIGNALS USING MULTIPLE WINDOWS COHERENCEAND THE WEYL between all channel pairs. Time-frequency coherence functions are estimated using the multiple window

  7. The Genetic Structure of the Kuwaiti Population: mtDNA Inter- and Intra-population Variation

    E-Print Network [OSTI]

    Theyab, Jasem; Al-Bustan, Suzanne; Crawford, Michael H.

    2012-08-01

    it to their neighboring populations. These subpopulations were tested for genetic homogeneity and shown to be heterogeneous. Restriction fragment length polymorphism (RFLP) and mtDNA sequencing analyses of HVRI were used to reconstruct the genetic structure of Kuwait...

  8. Implied motion activation in cortical area MT can be explained by visual low-level features

    E-Print Network [OSTI]

    Oram, Mike

    ForReview Only Implied motion activation in cortical area MT can be explained by visual low Neuroscience #12;ForReview Only 1 Implied motion activation in cortical area MT can be explained by visual low, The Netherlands Page 1 of 51 Jounal of Cognitive Neuroscience 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

  9. DOE NE Used Fuel Disposition FY2015 Working Group Presentations http://energy.sandia.gov/energy/nuclear-energy/ne-workshops/ufd-working-group-2015/

    E-Print Network [OSTI]

    DOE NE Used Fuel Disposition FY2015 Working Group Presentations http://energy.sandia.gov/energy/nuclear-energy 1 of 5 #12;DOE NE Used Fuel Disposition FY2015 Working Group Presentations http://energy.sandia.gov/energy/nuclear-energy Level Waste Rigali UFD WG 2015-06-10 Wed Afternoon 1245 Salt Repository Research Actinide and Microbial

  10. Low Energy Kaon Physics at Da$?$NE

    E-Print Network [OSTI]

    Paola Gianotti

    2012-05-21

    DA$\\Phi$NE $e^+ e^-$ collider is an abundant source of low energy $K \\bar K$ pairs suitable to explore different fields of non perturbative QCD regime. Two different experiments, DEAR and FINUDA, using different experimental techniq ues are trying to shed new light on the strong interaction at the nucleon scale by producing high precision results at this energy range. The DEAR experiment is studying kaonic atoms in order to determine antikaon-nucleon scattering lengths. FINUDA aims to produce hypernuclei to study nuclear structure and $\\Lambda$-N interaction.

  11. {sup 18}Ne production for the Beta beams project

    SciTech Connect (OSTI)

    Hodk, Rastislav [Institute of Experimental and Applied Physics, CTU in Prague, Horsk 3/22a, CZ-12800 Prague (Czech Republic); Mendona, Tania M. [IFIMUP and IN - Institute of Nanosciences and Nanotechnologies, Rua do Campo Alegre 687, 4169-007 Porto, Portugal and CERN, CH-1211 Geneva 23 (Swaziland); Stora, Thierry [CERN, CH-1211 Geneva 23 (Switzerland)

    2013-12-30

    Intense relativistic (anti)neutrino beams are an unique tool required to study fundamental properties of neutrinos such as neutrino oscillation parameters, as well as their Majorana or Dirac nature, the lepton number conservation hypothesis and the absolute neutrino mass scale. Such beams originate from acceleration of ?-decaying radioactive ions (Beta beams). A molten fluoride salt target has been developed for the production of the required rates of low-Q baseline isotope {sup 18}Ne for the Beta beams project. The prototyped unit has been tested on-line at ISOLDE-CERN. In this contribution an overview of the prototyping and on-line tests is presented.

  12. Property:EIA/861/IsoNe | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo,AltFuelVehicle2 Jump to: navigation, search This is a property of type Boolean.IsoNe Jump

  13. The MicroBooNE Technical Design Report

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired Solar FuelTechnologyTel: Name:Department of EnergyMicroBooNE

  14. The MicroBooNE Experiment - Public Notes

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired Solar FuelTechnologyTel: Name:Department ofThe DOE Tours MicroBooNE!

  15. MiniBooNE/LSND Neutrino Oscillation Results

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OFDetectionBenchmarkResults and Follow-OnMiniBooNE's

  16. MiniBooNE_LoNu_Shaevitz.ppt

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OFDetectionBenchmarkResults and Follow-OnMiniBooNE's6Up

  17. The MicroBooNE Experiment - At Work

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDidDevelopment TopMetathesisSediments and Related J.The FourMicroBooNE

  18. The MicroBooNE Experiment - Conference Talks

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDidDevelopment TopMetathesisSediments and Related J.TheMicroBooNE

  19. PNM Resources 2401 Aztec NE, MS-Z100

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested PartiesBuilding energy codes have a more thanPNM Resources 2401 Aztec NE,

  20. MicroBooNE TPC Wires Image Map

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesse BergkampCentermillionStockpile StewardshipO'ConnorFirstMicroBooNE

  1. Djurcic_MiniBooNE_NuFact2010

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would like submit theCovalentLaboratory |Sector Full reportTown Hallfrom MiniBooNE

  2. A Case Study For Geothermal Exploration In The Ne German Basin...

    Open Energy Info (EERE)

    Ne German Basin- Integrated Interpretation Of Seismic Tomography, Litho-Stratigraphy, Salt Tectonics, And Thermal Structure Jump to: navigation, search OpenEI Reference...

  3. Demonstration Assessment of LED Roadway Lighting: NE Cully Blvd., Portland, OR

    SciTech Connect (OSTI)

    Royer, M. P.; Poplawski, M. E.; Tuenge, J. R.

    2012-08-01

    GATEWAY program report on a demonstration of LED roadway lighting on NE Cully Boulevard in Portland, OR, a residential collector road.

  4. Experiment operations plan for the MT-4 experiment in the NRU reactor. [PWR

    SciTech Connect (OSTI)

    Russcher, G.E.; Wilson, C.L.; Parchen, L.J.; Marshall, R.K.; Hesson, G.M.; Webb, B.J.; Freshley, M.D.

    1983-06-01

    A series of thermal-hydraulic and cladding materials deformation experiments were conducted using light-water reactor fuel bundles as part of the Pacific Northwest Laboratory Loss-of-Coolant Accident (LOCA) Simulation Program. This report is the formal operations plan for MT-4 - the fourth materials deformation experiment conducted in the National Research Universal (NRU) reactor, Chalk River, Ontario, Canada. A major objective of MT-4 was to simulate a pressurized water reactor LOCA that could induce fuel rod cladding deformation and rupture due to a short-term adiabatic transient and a peak fuel cladding temperature of 1200K (1700/sup 0/F).

  5. ccsd00000561 Proton Zemach radius from measurements of the hyper ne

    E-Print Network [OSTI]

    ccsd00000561 (version 1) : 25 Aug 2003 Proton Zemach radius from measurements of the hyper#12;ne and discuss the information about the electromagnetic structure of protons that could be extracted from theoretical results on the proton polarizability e#11;ects and the experimental hydrogen hyper#12;ne splitting

  6. Neuropathic pain (NeP) is pain resulting from nervous tissue damage. It is chronic,

    E-Print Network [OSTI]

    Burn, Charlotte

    Why? Neuropathic pain (NeP) is pain resulting from nervous tissue damage. It is chronic, affects activity and quality of life. NeP is difficult to recognise in animals who can't report how they feel. We use clinical signs for diagnosis of Nep. However, we don't know if they are reliable. Sensory testing

  7. The Cretaceous/ Tertiary boundary: sedimentology and micropalaeontology at El Mulato section, NE Mexico

    E-Print Network [OSTI]

    Thomas, Ellen

    The Cretaceous/ Tertiary boundary: sedimentology and micropalaeontology at El Mulato section, NE and sedimentological analysis of this transition at the El Mulato section (NE Mexico), in order to infer the little Palaeogene Velasco Formation, there is a 2-m-thick Clastic Unit. Strati- graphical and sedimentological ana

  8. THE GENESIS SOLAR WIND CONCENTRATOR TARGET: MASS FRACTIONATION CHARACTERISED BY NE ISOTOPES

    SciTech Connect (OSTI)

    WIENS, ROGER C.; OLINGER, C.; HEBER, V.S.; REISENFELD, D.B.; BURNETT, D.S.; ALLTON, J.H.; BAUR, H.; WIECHERT, U.; WIELER, R.

    2007-01-02

    The concentrator on Genesis provides samples of increased fluences of solar wind ions for precise determination of the oxygen isotopic composition of the solar wind. The concentration process caused mass fractionation as function of the radial target position. They measured the fractionation using Ne released by UV laser ablation along two arms of the gold cross from the concentrator target to compare measured Ne with modeled Ne. The latter is based on simulations using actual conditions of the solar wind during Genesis operation. Measured Ne abundances and isotopic composition of both arms agree within uncertainties indicating a radial symmetric concentration process. Ne data reveal a maximum concentration factor of {approx} 30% at the target center and a target-wide fractionation of Ne isotopes of 3.8%/amu with monotonously decreasing {sup 20}Ne/{sup 22}Ne ratios towards the center. The experimentally determined data, in particular the isotopic fractionation, differ from the modeled data. They discuss potential reasons and propose future attempts to overcome these disagreements.

  9. Effective versus ion thermal temperatures in the Weizmann Ne Z-pinch: Modeling and stagnation physics

    E-Print Network [OSTI]

    Zarnitsky, Yuri

    Effective versus ion thermal temperatures in the Weizmann Ne Z-pinch: Modeling and stagnation of Technology, Haifa, Israel 5 National Security Technologies, LLC, Las Vegas, Nevada 89144, USA (Received 23 thermal and effective temperatures is investigated through simulations of the Ne gas puff z-pinch reported

  10. Dr. Joseph A. Shaw Electrical & Computer Engineering Dept., Montana State University, Bozeman, MT 59717

    E-Print Network [OSTI]

    Lawrence, Rick L.

    Dr. Joseph A. Shaw Electrical & Computer Engineering Dept., Montana State University, Bozeman, MT M.S. Electrical Engineering University of Utah 1987 B.S. Electrical Engineering University of Alaska Experience: 2008 present Professor Electrical & Computer Engineering (ECE) Department, Montana State

  11. Synchronous Dependency Insertion Grammars A Grammar Formalism for Syntax Based Statistical MT

    E-Print Network [OSTI]

    Synchronous Dependency Insertion Grammars A Grammar Formalism for Syntax Based Statistical MT Yuan formalism specifically designed for syntax-based sta- tistical machine translation. The synchro- nous between lan- guages, which many other synchronous grammars are unable to model. A Depend- ency Insertion

  12. MONTANA OUTDOORS 3130 MARCH APRIL 2014 FWP.MT.GOV/MTOUTDOORS Why mountain bluebirds

    E-Print Network [OSTI]

    Duckworth, Rene

    MONTANA OUTDOORS 3130 MARCH APRIL 2014 FWP.MT.GOV/MTOUTDOORS TURF WAR TWIST Why mountain bluebirds are good for this species in western Montana valleys but don't benefit, in the long run, mountain bluebirds. Although mountain blue- birds also lost nesting sites, they had evolved to also use habitats at higher

  13. Intermountain GIS Conference. April 1923 2010, Bozeman, MT. Patrick Lawrence, Maxwell BD, Rew LJ

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    Intermountain GIS Conference. April 1923 2010, Bozeman, MT. Patrick Lawrence, Maxwell BD, Rew in the Python programming language, drawing on Python's builtin library, the RPy extension, ArcGIS geoprocessing and ArcGIS Server. As inputs, it accepts transect shapefiles, transect text files, or point

  14. MT3DMS, A Modular Three-Dimensional Multispecies Transport Model User Guide to the

    E-Print Network [OSTI]

    Zheng, Chunmiao

    .M. Cozzarelli, M.H. Lahvis, and B.A. Bekins. 1998. Ground water contamination by crude oil near Bemidji (LNAPL) contaminant through the unsaturated zone and the formation of an oil lens on the water tableMT3DMS, A Modular Three-Dimensional Multispecies Transport Model User Guide to the Hydrocarbon

  15. Hybrid Rule-Based Example-Based MT: Feeding Apertium with Sub-sentential Translation Units

    E-Print Network [OSTI]

    Way, Andy

    Hybrid Rule-Based Example-Based MT: Feeding Apertium with Sub-sentential Translation Units Felipe Sanchez-Martinez Mikel L. Forcada Andy Way Dept. Llenguatges i Sistemes Inform`atics Universitat University Dublin 9, Ireland {mforcada,away}@computing.dcu.ie Abstract This paper describes a hybrid machine

  16. Stress magnitude and its temporal variation at Mt. Asama Volcano, Japan, from seismic anisotropy and GPS

    E-Print Network [OSTI]

    Utrecht, Universiteit

    Stress magnitude and its temporal variation at Mt. Asama Volcano, Japan, from seismic anisotropy stress Japan The Earth's stress regime is fundamental to its physical processes, yet few methods can determine absolute stress, and measurements of temporal variations in stress are controversial. The Global

  17. Some Effects of Mt. St. Helens Volcanic Ash on Juvenile Salmon Smolts

    E-Print Network [OSTI]

    Some Effects of Mt. St. Helens Volcanic Ash on Juvenile Salmon Smolts TIMOTHY W. NEWCOMB and THOMAS. Helens, which was completely decimated with vol- canic ash and mud slides. Heavy sediment loads smolts were exposed to various concentrations ofairborne volcanic ash from the 18 May 1980 eruption

  18. High-latitude vegetation dynamics: 850 years of vegetation development on Mt Hekla, Iceland

    E-Print Network [OSTI]

    Cutler, Nick

    2008-01-01

    on Mt Hekla in south-central Iceland. The chronosequence approach was used to infer 850 years of vegetation development from a suite of 14 lava flows (five of which had been disturbed by the deposition of volcanic tephra). The thesis is organised around...

  19. Geophys. 1. R. astr. Soc. (1987),89,7-18 MT and reflection: an essential combination

    E-Print Network [OSTI]

    Jones, Alan G.

    1987-01-01

    ) studies and seismic reflection profiles conducted. Unfortunately, over many more regions the seismic of the magnetotelluric (MT) technique as having a vertical resolution equivalent to the seismic refraction method, in almost every case, be made wherever a seismic reflection survey is undertaken. Examples are shown from

  20. Reference Grant Holder Research Organisation Project Title NE/J005398/2 Professor Christopher Perry University of Exeter

    E-Print Network [OSTI]

    Grant Reference Grant Holder Research Organisation Project Title NE/J005398/2 Professor Christopher and resultant sediment records of the event. NE/J006122/1 Dr David Tappin NERC British Geological Survey Japan of severe wildfires on moorland carbon dynamics NE/J01141X/1 Dr Stephen G. Willis Durham University

  1. The Ne-to-O abundance ratio of the interstellar medium from IBEX-Lo observations

    SciTech Connect (OSTI)

    Park, J.; Kucharek, H.; Mbius, E.; Leonard, T.; Bzowski, M.; Sok?, J. M.; Kubiak, M. A.; Fuselier, S. A.; McComas, D. J.

    2014-11-01

    In this paper we report on a two-year study to estimate the Ne/O abundance ratio in the gas phase of the local interstellar cloud (LIC). Based on the first two years of observations with the Interstellar Boundary Explorer, we determined the fluxes of interstellar neutral (ISN) O and Ne atoms at the Earth's orbit in spring 2009 and 2010. A temporal variation of the Ne/O abundance ratio at the Earth's orbit could be expected due to solar cycle-related effects such as changes of ionization. However, this study shows that there is no significant change in the Ne/O ratio at the Earths orbit from 2009 to 2010. We used time-dependent survival probabilities of the ISNs to calculate the Ne/O abundance ratio at the termination shock. Then we estimated the Ne/O abundance ratio in the gas phase of the LIC with the use of filtration factors and the ionization fractions. From our analysis, the Ne/O abundance ratio in the LIC is 0.33 0.07, which is in agreement with the abundance ratio inferred from pickup-ion measurements.

  2. Level-resolved R-matrix calculations for the electron-impact excitation of Ne{sup 3+} and Ne{sup 6+}

    SciTech Connect (OSTI)

    Ludlow, J. A.; Lee, T. G.; Ballance, C. P.; Loch, S. D.; Pindzola, M. S.

    2011-08-15

    Large-scale R-matrix calculations are carried out for the electron-impact excitation of Ne{sup 3+} and Ne{sup 6+}. For Ne{sup 3+}, a 581-LSJ-level R-matrix intermediate coupling frame transformation calculation is made for excitations up to the n=4 shell. For some transitions, large effective collision strength differences are found with current 23-jKJ-level Breit-Pauli R-matrix and earlier 22-LSJ-level R-matrix jj omega (JAJOM) calculations. For Ne{sup 6+}, a 171-jKJ-level Breit-Pauli R-matrix calculation is made for excitations up to the n=5 shell. For some transitions, large effective collision strength differences are found with current 46-jKJ-level Breit-Pauli R-matrix and earlier 46-LSJ-level R-matrix JAJOM calculations. Together with existing R-matrix calculations for other ion stages, high-quality excitation data are now available for astrophysical and laboratory plasma modeling along the entire Ne isonuclear sequence.

  3. Low-lying neutron fp-shell intruder states in Ne-27

    E-Print Network [OSTI]

    Wilson, Graham Wallace; Brown, S. M.; Catford, W. N.; Thomas, J. S.; Ferná ndez-Domí nguez, B.; Orr, N. A.; Labiche, M.; Rejmund, M.; Achouri, N. L.; Al Falou, H.; Ashwood, N. I.; Beaumel, D.; Blumenfeld, Y.; Brown, B. A.; Chapman, R.

    2012-01-23

    in TIARA and the recoil in VAMOS was compared to that of the incident beam. For 27Ne? ?26Ne + n, the momentum of the undetected neutron was sufficiently well defined to resolve these events from elastic scattering [23]. The energies of protons populating...RAPID COMMUNICATIONS PHYSICAL REVIEW C 85, 011302(R) (2012) Low-lying neutron f p-shell intruder states in 27Ne S. M. Brown,1 W. N. Catford,1 J. S. Thomas,1 B. Fernandez-Dom?nguez,2,3 N. A. Orr,2 M. Labiche,4 M. Rejmund,5 N. L. Achouri,2 H. Al...

  4. T-Duality of Green-Schwarz Superstrings on AdS(d) x S(d) x M(10-2d)

    E-Print Network [OSTI]

    Abbott, Michael C; Penati, Silvia; Pittelli, Antonio; Sorokin, Dmitri; Sundin, Per; Tarrant, Justine; Wolf, Martin; Wulff, Linus

    2015-01-01

    We verify the self-duality of Green-Schwarz supercoset sigma models on AdS$_d \\times S^d $ backgrounds (d=2,3,5) under combined bosonic and fermionic T-dualities without gauge fixing kappa symmetry. We also prove this property for superstrings on AdS$_d \\times S^d \\times S^d$ (d=2,3) described by supercoset sigma models with the isometries governed by the exceptional Lie supergroups $D(2,1;\\alpha)$ (d=2) and $D(2,1;\\alpha)\\times D(2,1;\\alpha)$ (d=3), which requires an additional T-dualisation along one of the spheres. Then, by taking into account the contribution of non-supercoset fermionic modes (up to the second order), we provide evidence for the T-self-duality of the complete type IIA and IIB Green-Schwarz superstring theory on AdS$_d\\times S^d \\times T^{10-2d}$ (d=2,3) backgrounds with Ramond-Ramond fluxes. Finally, applying the Buscher-like rules to T-dualising supergravity fields, we prove the T-self-duality of the whole class of the AdS$_d\\times S^d \\times M^{10-2d}$ superbackgrounds with Ramond-Ramon...

  5. T-Duality of Green-Schwarz Superstrings on AdS(d) x S(d) x M(10-2d)

    E-Print Network [OSTI]

    Michael C. Abbott; Jeff Murugan; Silvia Penati; Antonio Pittelli; Dmitri Sorokin; Per Sundin; Justine Tarrant; Martin Wolf; Linus Wulff

    2015-09-25

    We verify the self-duality of Green-Schwarz supercoset sigma models on AdS$_d \\times S^d $ backgrounds (d=2,3,5) under combined bosonic and fermionic T-dualities without gauge fixing kappa symmetry. We also prove this property for superstrings on AdS$_d \\times S^d \\times S^d$ (d=2,3) described by supercoset sigma models with the isometries governed by the exceptional Lie supergroups $D(2,1;\\alpha)$ (d=2) and $D(2,1;\\alpha)\\times D(2,1;\\alpha)$ (d=3), which requires an additional T-dualisation along one of the spheres. Then, by taking into account the contribution of non-supercoset fermionic modes (up to the second order), we provide evidence for the T-self-duality of the complete type IIA and IIB Green-Schwarz superstring theory on AdS$_d\\times S^d \\times T^{10-2d}$ (d=2,3) backgrounds with Ramond-Ramond fluxes. Finally, applying the Buscher-like rules to T-dualising supergravity fields, we prove the T-self-duality of the whole class of the AdS$_d\\times S^d \\times M^{10-2d}$ superbackgrounds with Ramond-Ramond fluxes in the context of supergravity.

  6. Trigonometric Parallaxes for Two Late-Type Subdwarfs: LSR1425+71 (sdM8.0) and the Binary LSR1610-00 (sd?M6pec)

    E-Print Network [OSTI]

    C. C. Dahn; H. C. Harris; S. E. Levine; T. Tilleman; A. K. B. Monet; R. C. Stone; H. H. Guetter; B. Canzian; J. R. Pier; W. I. Hartkopf; J. Liebert; M. Cushing

    2008-06-13

    Trigonometric parallax astrometry and BVI photometry are presented for two late-type subdwarf candidates, LSR1425+71 (sdM8.0) and LSR1610-00 (sd?M6pec). For the former we measure an absolute parallax of 13.37+/-0.51 mas yielding Mv=15.25+/-0.09. The astrometry for LSR1610-00 shows that this object is an astrometric binary with a period of 1.66+/-0.01 yr. The photocentric orbit is derived from the data; it has a moderate eccentricity (e ~ 0.44+/-0.02) and a semi-major axis of 0.28+/-0.01 AU based on our measured absolute parallax of 31.02+/-0.26 mas. Our radial velocity measure of -108.1+/-1.6 km/s for LSR1610-00 at epoch 2006.179, when coupled with the observation of -95+/-1 km/s at epoch 2005.167 by Reiners & Basri, indicates a systemic radial velocity of -101+/-1 km/s for the LSR1610-00AB pair. The galactic velocity components for LSR1425+71 and LSR1610-00AB -- (U,V,W)=(84+/-6, -202+/-13, 66+/-14) km/s and (U,V,W)=(36+/-2, -232+/-2, -61+/-2) km/s, respectively. For both stars, the velocities are characteristic of halo population kinematics. However, modeling shows that both stars have orbits around the galaxy with high eccentricity that pass remarkably close to the galactic center. LSR1425+71 has a luminosity and colors consistent with its metal-poor subdwarf spectral classification, while LSR1610-00 has a luminosity and most colors indicative of being only mildly metal-poor, plus a uniquely red B-V color. The companion to LSR1610-00 must be a low-mass, substellar brown dwarf. We speculate on the paradoxical nature of LSR1610-00 and possible sources of its peculiarities.

  7. Fermilab | Newsroom | Press Releases | June 24, 2014: MicroBooNE...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    jpeg images. When using these images, please credit each photo as indicated. Med Res | Hi Res The 30-ton MicroBooNE neutrino detector was transported across the Fermilab site on...

  8. Exploring the {sup 22}Ne(p,?){sup 23}Na reaction at LUNA and at HZDR

    SciTech Connect (OSTI)

    Cavanna, Francesca [Dipartimento di fisica, Universit di Genova, and INFN Sezione di Genova, Genova (Italy); Collaboration: LUNA Collaboration

    2014-05-09

    The {sup 22}Ne(p,?){sup 23}Na reaction is involved in the hydrogen burning NeNa cycle. This determines the nucleosynthesis of the Ne and Na isotopes in the Red Giant Branch and Asymptotic Giant Branch phases of stellar evolution. In the energy range relevant for astrophysics (20 keV < E < 600 keV), the {sup 22}Ne(p,?){sup 23}Na reaction rate is highly uncertain because of the contribution of a large number of resonances never measured directly. A related study is under preparation at the Laboratory for Underground Nuclear Astrophysics (LUNA), in the Gran Sasso National Laboratory, and it will cover the energy range 100 keV < E < 400 keV. Meanwhile, a measurement at higher energies (i.e. 436 keV) has been carried out at the Tandetron accelerator of the HZDR (Helmholtz Zentrum Dresden Rossendorf) in Germany. Some preliminary results will be presented.

  9. Hazard assessment in geothermal exploration: The case of Mt. Parker, Southern Philippines

    SciTech Connect (OSTI)

    Delfin, F.G. Jr.; Salonga, N.D.; Bayon, F.E.B.

    1996-12-31

    Hazard assessment of the Mt. Parker geothermal prospect, conducted in parallel with the surface exploration from 1992 to 1994, was undertaken to determine the long-term suitability of the prospect for development. By comparison with other acidic magmatic-hydrothermal systems in the Philippines, the geochemical data indicated minimal input of acidic magmatic fluids into Mt. Parker`s hydrothermal system. This system was regarded to be a neutral-pH and high-enthalpy chloride reservoir with temperature of at least 200-250{degrees}C. These favorable geochemical indications contrasted sharply with the C-14 and volcanological data indicating a shallow magmatic body with a potential for future eruption. This hazard led PNOC EDC to discontinue the survey and abandon the prospect by late 1994. On September 6, 1995, a flashflood of non-volcanic origin from the caldera lake killed nearly 100 people on the volcano`s northwestern flank.

  10. First-forbidden beta decay of 17N and 17Ne

    E-Print Network [OSTI]

    D. J. Millener

    1997-02-07

    It is shown that differences, due to charge-dependent effects, in the 17N and 17Ne ground-state wave functions account for the fact that the experimentally measured branch for the beta+ decay of 17Ne to the first excited state of 17F is roughly a factor of two larger than expected on the basis of nuclear matrix elements which reproduce the corresponding beta- branch in the decay of 17N.

  11. BiL4i|h@ EtU@ Q b @h3L 2ff L? 4i?L _ SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t ghyh u@hi *

    E-Print Network [OSTI]

    Catenacci, Roberto

    BiL4i|h@ EtU@ Q b @h3L 2ff L? 4i?L _ SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t ghyh u@hi *@*ic tLTh@ H t sxr u@hi *Ec fc i ~ ' Efc c f n |Ec fc f n rEfc fc E@ AhL@hi ?@ hi||@ o T@tt@?|i Tih *

  12. Rock Sampling At Mt Ranier Area (Frank, 1995) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/ColoradoRemsenburg-Speonk, NewMichigan: Energy Resources JumpMt Ranier Area (Frank, 1995)

  13. EC305 Problem Set 1 1. Let x(t) = m(t) cos 2fct, where m(t) is a real lowpass signal with bandwidth W and

    E-Print Network [OSTI]

    Bhashyam, Srikrishna

    EC305 Problem Set 1 1. Let x(t) = m(t) cos 2fct, where m(t) is a real lowpass signal with bandwidth a bandpass signal x(t) = m1(t) cos 2fct - m2(t) sin 2fct. (a) Determine the in-phase and quadrature components of this signal when the local os- cillators used have a phase offset of , i.e., they are cos (2fct

  14. Tidally dominated depositional environment for the Mt. Simon Sandstone in central Illinois

    SciTech Connect (OSTI)

    Sargent, M.L.; Lasemi, Z. (Illinois State Geological Survey, Champaign, IL (United States))

    1993-03-01

    Several hundred feet of core from the upper part of the Mt. Simon in central Illinois have been examined macroscopically. Grain sizes and their systematics, bedding characteristics, sedimentary structures, and relationships among beds show that the upper Mt. Simon Sandstone is composed of a series of fining-upward cycles up to 10 m (30 feet) thick. A typical cycle consists, in ascending order, of a sandy subtidal facies, a mixed sand and mud intertidal-flat facies, and a muddy upper tidal-flat facies upward through the succession, the maximum and average grain size becomes progressively finer and the cycles thinner. The lower sandstone of each cycle contains beds that are massive to cross bedded and cross laminated; some beds show scoured reactivation surfaces. A few cycles contain a middle unit characterized by flaser and lenticular bedding and abundant mudcracks. Mudcracks also are common in the shale beds at the top of each cycle. Sedimentary structures such as reactivation surfaces, flaser and lenticular bedding, and mudcracks suggest that these cycles were deposited in peritidal environments. The presence of Skolithos in some cycles suggests very shallow marine conditions. The within-cycle upward fining is caused by regression or progradation that reflects a progressive decrease in current velocity from subtidal to intertidal parts of the tidal flat. Frequent flooding of the tidal flat resulted in repeated fining-upward cycles within the upper part of the Mt. Simon Sandstone.

  15. Application of Remote Sensing Technology and Ecological Modeling of Forest Carbon Stocks in Mt. Apo Natural Park, Philippines

    E-Print Network [OSTI]

    Leal, Ligaya Rubas

    2015-01-23

    This dissertation work explored the application of remote sensing technology for the assessment of forest carbon storage in Mt. Apo Natural Park. Biomass estimation is traditionally conducted using destructive sampling with high levels...

  16. Sequence Stratigraphy and Detrital Zircon Geochronology of Middle-Late Ordovician Mt. Wilson Quartzite, British Columbia, Canada

    E-Print Network [OSTI]

    Hutto, Andrew Paul

    2012-07-16

    STRATIGRAPHY AND DETRITAL ZIRCON GEOCHRONOLOGY OF MIDDLE-LATE ORDOVICIAN MT. WILSON QUARTZITE, BRITISH COLUMBIA CANADA A Thesis by ANDREW PAUL HUTTO Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment... of the requirements for the degree of MASTER OF SCIENCE May 2012 Major Subject: Geology Sequence Stratigraphy and Detrital Zircon Geochronology of Middle-Late Ordovician Mt. Wilson...

  17. Additional or Lost Gillnet Tag Order Form All NE multispecies Category A, E, and F Day gillnet vessels fishing for NE multispecies and/or vessels fishing

    E-Print Network [OSTI]

    vessels fishing for NE multispecies and/or vessels fishing under a monkfish DAS using gillnet gear must tag their gillnets with BLUE gillnet tags. Vessel owners are required to account for the total number of tags issued. Should tags be lost, missing, or destroyed, vessel owners/operators must report

  18. Inelastic processes in Na$^{+}-$Ne, Ar and Ne$^{+},$ Ar$^{+}-$Na collisions in energy range $0.5-14$ keV

    E-Print Network [OSTI]

    Lomsadze, R A; Kezerashvili, R Ya

    2015-01-01

    Absolute cross sections for charge-exchange, ionization and excitation in Na$% ^{+}-$Ne and Na$^{+}-$Ar collisions were measured in the ion energy range $% 0.5-10$ keV using a refined version of a capacitor method, and collision and optical spectroscopy methods simultaneously in the same experimental set-up. Ionization cross sections for Ne$^{+}-$Na and Ar$^{+}-$Na collisions are measured at the energies of $2-14$ keV using a crossed-beam spectroscopy method. The experimental data and the schematic correlation diagrams are used to analyze and determine the mechanisms for these processes. For the charge-exchange process in Na$^{+}$ $-$Ar collisions two nonadiabatic regions are revealed and mechanisms responsible for these regions are explained. Structural peculiarity on the excitation function for the resonance lines of argon atoms in Na$^{+}$ $-$Ar collisions are observed and the possible mechanisms of this phenomenon are explored. The measured ionization cross sections for Na$^{+}-$Ne and Ne$^{+}-$Na collisi...

  19. Studies of states in 19Ne about the 18F + p threshold and the 18Ne(?,p) HCNO breakout reaction

    E-Print Network [OSTI]

    Josephides, Alexis Noel

    2009-01-01

    The rate of destruction of 18F via the 18F + p reactions is of importance in both novae and X-ray burster explosive scenarios. The rate of the competing destructive reactions, 18F(p,?)19Ne and 18F(p,?)15O, depend upon ...

  20. SD 13130019: ANOTHER SECOND-GENERATION STAR WITH [Fe/H] = ?5.0, OBSERVED WITH THE MAGELLAN TELESCOPE

    E-Print Network [OSTI]

    Chiti, Anirudh

    We present a Magellan/MIKE high-resolution (R ~ 35,000) spectrum of the ancient star SD 1313?0019, which has an iron abundance of [Fe/H] = -5.0, paired with a carbon enhancement of [C/Fe] ~ 3.0. The star was initially ...

  1. BANDO PER IL RECLUTAMENTO DI UN RICERCATORE CON RAPPORTO DI LAVORO A TEMPO DETERMINATO CO FINANZIATO DALLA REGIONE LAZIO PER IL SETTORE S/D

    E-Print Network [OSTI]

    Di Pillo, Gianni

    FINANZIATO DALLA REGIONE LAZIO PER IL SETTORE S/D BIO/09 PRESSO IL DIPARTIMENTO DI FISIOLOGIA E FARMACOLOGIA "VITTORIO ERSPAMER" Il Direttore del Dipartimento di Fisiologia e Farmacologia "Vittorio Erspamer" Visto il Regione Lazio Viste le Delibere del Consiglio del Dipartimento di Fisiologia e Farmacologia "Vittorio

  2. Wireless Internet Access To Real-Time Transit Information S.D. Maclean, University of Washington, Dept. of Electrical Engineering, Box 352500, Seattle,

    E-Print Network [OSTI]

    TRB 02-3863 Wireless Internet Access To Real-Time Transit Information S.D. Maclean, University departure times for buses at user-selectable geographic locations to Internet-enabled mobile devices.e., wired) Internet connectivity is not available. Wireless access to real-time transit information

  3. Top-Down Intelligent Reservoir Modeling (TDIRM) Y.Gomez, Y. Khazaeni, S.D. Mohaghegh, SPE, West Virginia University, R. Gaskari, Intelligent Solutions, Inc.

    E-Print Network [OSTI]

    Mohaghegh, Shahab

    aspects of an oil reservoir. The models include different reservoir saturation conditions (saturated or under-saturated), different number of wells and different distributions of reservoir characteristicsSPE 124204 Top-Down Intelligent Reservoir Modeling (TDIRM) Y.Gomez, Y. Khazaeni, S.D. Mohaghegh

  4. Gas Purity effect on GEM Performance in He and Ne at Low Temperatures

    E-Print Network [OSTI]

    Galea, R; Dodd, J; Ju, Y; Leltchouk, M; Pavlyuchenko, D; Rehak, P; Tcherniatine, V; Willis, W

    2006-01-01

    The performance of Gas Electron Multipliers (GEMs) in gaseous He, Ne, He+H2 and Ne+H2 was studied at temperatures in the range of 3-293 K. This paper reports on previously published measurements and additional studies on the effects of the purity of the gases in which the GEM performance is evaluated. In He, at temperatures between 77 and 293 K, triple-GEM structures operate at rather high gains, exceeding 1000. There is an indication that this high gain is achieved through the Penning effect as a result of impurities in the gas. At lower temperatures the gain-voltage characteristics are significantly modified probably due to the freeze-out of these impurities. Double-GEM and single-GEM structures can operate down to 3 K at gains reaching only several tens at a gas density of about 0.5 g/l; at higher densities the maximum gain drops further. In Ne, the maximum gain also drops at cryogenic temperatures. The gain drop in Ne at low temperatures can be re-established in Penning mixtures of Ne+H2: very high gains,...

  5. Havre, MT Natural Gas Pipeline Imports From Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969CentralWellsMillion Cubic Feet) Havre, MT Natural Gas Pipeline

  6. MCViNE -- An object oriented Monte Carlo neutron ray tracing simulation package

    E-Print Network [OSTI]

    Lin, Jiao Y Y; Granroth, Garrett E; Abernathy, Douglas L; Lumsden, Mark D; Winn, Barry; Aczel, Adam A; Aivazis, Michael; Fultz, Brent

    2015-01-01

    MCViNE (Monte-Carlo VIrtual Neutron Experiment) is a versatile Monte Carlo (MC) neutron ray-tracing program that provides researchers with tools for performing computer modeling and simulations that mirror real neutron scattering experiments. By adopting modern software engineering practices such as using composite and visitor design patterns for representing and accessing neutron scatterers, and using recursive algorithms for multiple scattering, MCViNE is flexible enough to handle sophisticated neutron scattering problems including, for example, neutron detection by complex detector systems, and single and multiple scattering events in a variety of samples and sample environments. In addition, MCViNE can take advantage of simulation components in linear-chain-based MC ray tracing packages widely used in instrument design and optimization, as well as NumPy-based components that make prototypes useful and easy to develop. These developments have enabled us to carry out detailed simulations of neutron scatteri...

  7. Characterization of fragment emission in ^{20}Ne (7 - 10 MeV/nucleon) + ^{12}C reactions

    E-Print Network [OSTI]

    Aparajita Dey; C. Bhattacharya; S. Bhattacharya; S. Kundu; K. Banerjee; S. Mukhopadhyay; D. Gupta; T. Bhattacharjee; S. R. Banerjee; S. Bhattacharyya; T. K. Rana; S. K. Basu; R. Saha; K. Krishan; A. Mukherjee; D. Bandopadhyay; C. Beck

    2007-07-23

    The inclusive energy distributions of the complex fragments (3 $\\leq$ Z $\\leq$ 7) emitted from the bombardment of ^{12}C by ^{20}Ne beams with incident energies between 145 and 200 MeV have been measured in the angular range 10$^{o} \\leq \\theta_{lab} \\leq$ 50^{o}. Damped fragment yields in all the cases have been found to be the characteristic of emission from fully energy equilibrated composites. The binary fragment yields are compared with the standard statistical model predictions. Enhanced yields of entrance channel fragments (5 $\\leq$ Z $\\leq$ 7) indicate the survival of orbiting-like process in ^{20}Ne + ^{12}C system at these energies.

  8. Low-lying dipole resonance in neutron-rich Ne isotopes

    E-Print Network [OSTI]

    Kenichi Yoshida; Nguyen Van Giai

    2008-02-12

    Microscopic structure of the low-lying isovector dipole excitation mode in neutron-rich $^{26,28,30}$Ne is investigated by performing deformed quasiparticle-random-phase-approximation (QRPA) calculations. The particle-hole residual interaction is derived from a Skyrme force through a Landau-Migdal approximation. We have obtained the low-lying resonance in $^{26}$Ne at around 8.5 MeV. It is found that the isovector dipole strength at $E_{x}low-lying resonance is overlapping with the giant resonance.

  9. Weak Interaction Rates Of sd-Shell Nuclei In Stellar Environment Calculated in the Proton-Neutron Quasiparticle Random Phase Approximation

    E-Print Network [OSTI]

    J. -U. Nabi; H. V. Klapdor-Kleingrothaus

    1999-07-27

    Allowed weak interaction rates for sd-shell nuclei in stellar environment are calculated using a generalized form of proton-neutron quasiparticle RPA model with separable Gamow-Teller forces. Twelve different weak rates are calculated for each nucleus as a function of temperature and density. This project consists of calculation of weak rates for a total of 709 nuclei with masses ranging from A = 18 to 100. This paper contains calculated weak rates for sd-shell nuclei. The calculated capture and decay rates take into consideration the latest experimental energy levels and ft value compilations. The results are also compared with earlier works. Particle emission processes from excited states, previously ignored, are taken into account, and are found to significantly affect some beta decay rates.

  10. BiL4i|h@ EW?uLh4@|U@ Q 2 ti||i4Mhi 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t

    E-Print Network [OSTI]

    Catenacci, Roberto

    BiL4i|h@ EW?uLh4@|U@ Q 2 ti||i4Mhi 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t ghyh u@hi *hi *hi _@ U#12; @ AhL@hi ?@ M@ti _i* ?U*iL i ?@ M@ti _i**hi sff E i s!E _Li ' e 2e2 n e#12

  11. BiL4i|h@ EW?uLh4@|U@ Q D B}?L 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t

    E-Print Network [OSTI]

    Catenacci, Roberto

    BiL4i|h@ EW?uLh4@|U@ Q D B}?L 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t ghyh u@hi *hi *? % n + n 5 ' f i 2% + ' f E@ #4Lt|h@hi Ui *@ *LhL ?|ihti3L?i i ?@ hi||@ , i |hL@h?i *i i^@3L? E2 T

  12. BiL4i|h@ EW?uLh4@|U@ Q 2 6iMMh@L 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t

    E-Print Network [OSTI]

    Catenacci, Roberto

    BiL4i|h@ EW?uLh4@|U@ Q 2 6iMMh@L 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t ghyh u@hi *hi *hi _@|L _@**i i^@3L? E|%n2+|5 ' | c %|+n25 ' UL? | T@h@4i|hL hi@*i E@ AhL@hi ? @*Lhi _ | Tih U * tt|i4@ ?L? @ tL*3L

  13. BiL4i|h@ EW?uLh4@|U@ Q b }i??@L 2ff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t

    E-Print Network [OSTI]

    Catenacci, Roberto

    BiL4i|h@ EW?uLh4@|U@ Q b }i??@L 2ff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t ghyh u@hi *hi *?i % + n 5 ' f i * T?|L @ ' Ec c @ tUhihi *hi||@ T@tt@?|i Tih @ i Lh|L}L?@*i @ Z ?| #12; M

  14. BiL4i|h@ EW?uLh4@|U@ Q S w}*L 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t

    E-Print Network [OSTI]

    Catenacci, Roberto

    BiL4i|h@ EW?uLh4@|U@ Q S w}*L 2fff +ULh_L *i hi}L*i _i* }LULG tL||L SD T?| t _ii hTi|ihi *L tUh||Lc |h@ SD i H t ghyh u@hi *hi * 5 hULh_ Ui rR@? ij i * tL||LtT@3L }i?ih@|L _@ i||Lh UL?|i?| ?i**@ T@hi?|it E@ @*UL*@hi *i _4i

  15. SD 1313-0019 -- Another second-generation star with [Fe/H] = -5.0, observed with the Magellan Telescope

    E-Print Network [OSTI]

    Frebel, Anna; Ji, Alexander P; Jacobson, Heather R; Placco, Vinicius M

    2015-01-01

    We present a Magellan/MIKE high-resolution (R ~ 35,000) spectrum of the ancient star SD 1313-0019 which has an iron abundance of [Fe/H] = -5.0, paired with a carbon enhancement of [C/Fe] ~ 3.0. The star was initially identified by Allende Prieto et al. in the BOSS survey. Its medium-resolution spectrum suggested a higher metallicity of [Fe/H] = -4.3 due to the CaII K line blending with a CH feature which is a common issue related to the search for the most iron-poor stars. This star joins several other, similar stars with [Fe/H] < -5.0 that all display a combination of low iron and high carbon abundances. Other elemental abundances of SD 1313-0019 follow that of more metal-rich halo stars. From fitting the abundance pattern with yields of Population III supernova, we conclude that SD 1313-0019 had only one massive progenitor star with 20 - 30 M_sun that must have undergone a mixing and fallback episode. Overall, there are now five stars known with [Fe/H] < -5.0 (1D LTE abundances). This population of se...

  16. The LSND puzzle in the light of MiniBooNE results

    E-Print Network [OSTI]

    Thomas Schwetz

    2008-05-15

    I give a brief overview over various attempts to reconcile the LSND evidence for oscillations with all other global neutrino data, including the results from MiniBooNE. I discuss the status of oscillation schemes with one or more sterile neutrinos and comment on various exotic proposals.

  17. Pacific Northwest Generating Cooperative 711 NE Halsey Portland, OR 97232-1268

    E-Print Network [OSTI]

    Pacific Northwest Generating Cooperative 711 NE Halsey Portland, OR 97232-1268 (503) 288-1234 Fax and Wildlife Program, guided by principles of cost effectiveness. Because our members continue to contribute significantly to the fish and wildlife program through their electric rates, PNGC is deeply interested in seeing

  18. Beyond Standard Model Searches in the MiniBooNE Experiment

    SciTech Connect (OSTI)

    Katori, Teppei; Conrad, Janet M.

    2015-01-01

    The MiniBooNE Experiment has contributed substantially to beyond standard model searches in the neutrino sector. The experiment was originally designed to test the $\\Delta m^2$~1 eV$^2$ region of the sterile neutrino hypothesis by observing $\

  19. Beyond Standard Model Searches in the MiniBooNE Experiment

    E-Print Network [OSTI]

    Teppei Katori; Janet Conrad

    2014-04-30

    The MiniBooNE Experiment has contributed substantially to beyond standard model searches in the neutrino sector. The experiment was originally designed to test the $\\Delta m^2$~1 eV$^2$ region of the sterile neutrino hypothesis by observing $\

  20. Beyond Standard Model Searches in the MiniBooNE Experiment

    E-Print Network [OSTI]

    Katori, Teppei

    2014-01-01

    The MiniBooNE Experiment has contributed substantially to beyond standard model searches in the neutrino sector. The experiment was originally designed to test the $\\Delta m^2$~1 eV$^2$ region of the sterile neutrino hypothesis by observing $\

  1. Search for core-collapse supernovae using the MiniBooNE neutrino detector

    E-Print Network [OSTI]

    Karagiorgi, Georgia Stelios

    We present a search for core-collapse supernovae in the Milky Way galaxy, using the MiniBooNE neutrino detector. No evidence is found for core-collapse supernovae occurring in our Galaxy in the period from December 14, ...

  2. Searches for new physics at MiniBooNE : sterile neutrinos and mixing freedom

    E-Print Network [OSTI]

    Karagiorgi, Georgia S. (Georgia Stelios)

    2010-01-01

    The MiniBooNE experiment was designed to perform a search for Vu --> Ve oscillations in a region of A[delta]sin 2 20very different from that allowed by standard, three neutrino oscillations, as determined by solar and ...

  3. Beyond standard model searches in the MiniBooNE experiment

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Katori, Teppei; Conrad, Janet M.

    2014-08-05

    The MiniBooNE experiment has contributed substantially to beyond standard model searches in the neutrino sector. The experiment was originally designed to test the ?m2~1eV2 region of the sterile neutrino hypothesis by observing ?e(?-e) charged current quasielastic signals from a ??(?-?) beam. MiniBooNE observed excesses of ?e and ?-e candidate events in neutrino and antineutrino mode, respectively. To date, these excesses have not been explained within the neutrino standard model (?SM); the standard model extended for three massive neutrinos. Confirmation is required by future experiments such as MicroBooNE. MiniBooNEmorealso provided an opportunity for precision studies of Lorentz violation. The results set strict limits for the first time on several parameters of the standard-model extension, the generic formalism for considering Lorentz violation. Most recently, an extension to MiniBooNE running, with a beam tuned in beam-dump mode, is being performed to search for dark sector particles. In addition, this review describes these studies, demonstrating that short baseline neutrino experiments are rich environments in new physics searches.less

  4. Simulation for KM3NeT using ANTARES-Software

    E-Print Network [OSTI]

    S. Kuch

    2006-06-21

    The KM3NeT project is a common European effort for the design of a km3-scale deep-sea neutrino telescope in the Mediterranean. For the upcoming Design Study simulations have been done using modified ANTARES software. Several concepts and ideas have been tested for their merits and feasibility.

  5. Oil and Gas CDT Cenomanian-Turonian Palaeoenvironments of NE Brazil

    E-Print Network [OSTI]

    Henderson, Gideon

    Oil and Gas CDT Cenomanian-Turonian Palaeoenvironments of NE Brazil Margin University of Birmingham, biostratigraphy, Brazil, Cretaceous Overview The Late Cretaceous stratigraphy of the Equatorial margin of North East Brazil holds a unique record of the final stages of the opening of the South Atlantic. During

  6. Abstract El'gygytgyn Crater Lake, NE Siberia was investigated for sedimentological proxies for

    E-Print Network [OSTI]

    Garneau, Michelle

    Abstract El'gygytgyn Crater Lake, NE Siberia was investigated for sedimentological proxies for regional climate change with a focus on the past 65 ka. Sedimentological parameters assessed rela- tive extensive sedimentological study of limnic sediment proxies of this age from Chukotka (Fig. 1

  7. MT1-MMP promotes cell growth and ERK activation through c-Src and paxillin in three-dimensional collagen matrix

    SciTech Connect (OSTI)

    Takino, Takahisa; Tsuge, Hisashi; Ozawa, Terumasa [Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192 (Japan)] [Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192 (Japan); Sato, Hiroshi, E-mail: vhsato@kenroku.kanazawa-u.ac.jp [Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192 (Japan)] [Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192 (Japan)

    2010-06-11

    Membrane-type 1 matrix metalloproteinase (MT1-MMP) is essential for tumor invasion and growth. We show here that MT1-MMP induces extracellular signal-regulated kinase (ERK) activation in cancer cells cultured in collagen gel, which is indispensable for their proliferation. Inhibition of MT1-MMP by MMP inhibitor or small interfering RNA suppressed activation of focal adhesion kinase (FAK) and ERK in MT1-MMP-expressing cancer cells, which resulted in up-regulation of p21{sup WAF1} and suppression of cell growth in collagen gel. Cell proliferation was also abrogated by the inhibitor against ERK pathway without affecting FAK phosphorylation. MT1-MMP and integrin {alpha}{sub v}{beta}{sub 3} were shown to be involved in c-Src activation, which induced FAK and ERK activation in collagen gel. These MT1-MMP-mediated signal transductions were paxillin dependent, as knockdown of paxillin reduced cell growth and ERK activation, and co-expression of MT1-MMP with paxillin induced ERK activation. The results suggest that MT1-MMP contributes to proliferation of cancer cells in the extracellular matrix by activating ERK through c-Src and paxillin.

  8. Uranium hydrogeochemical and stream sediment reconnaissance of the Mt. Hayes NTMS quadrangle, Alaska

    SciTech Connect (OSTI)

    Not Available

    1981-05-01

    Results of a hydrogeochemical and stream sediment reconnaissance of the Mt. Hayes quadrangle, Alaska, are presented. In addition to this abbreviated data release, more complete data are available to the public in machine-readable form. In this data release are location data, field analyses, and Laboratory analyses of several different sample media. For the sake of brevity, many field site observations have not been included in this volume. These data are, however, available on the magnetic tape. Appendices A to D describe the sample media and summarize the analytical results for each medium. The data were subsetted by one of the Los Alamos National Laboratory (LANL) sorting programs into groups of stream sediment, lake sediment, stream water, lake water, and ground water samples. For each group which contains a sufficient number of observations, statistical tables, tables of raw data, and 1:1000000 scale maps of pertinent elements have been included in this report.

  9. Journal of the Geological Society, London, Vol. 160, 2003, pp. 677685. Printed in Great Britain. Tectonic evolution of the NE Palmyride mountain belt, Syria

    E-Print Network [OSTI]

    . 677 Tectonic evolution of the NE Palmyride mountain belt, Syria: the Bishri crustal block GRAHAM BREW1 is a broad NE-plunging inverted basin located at the NE portion of the Palmyride mountain belt where that has driven the evolution of intracontinental Syria. Keywords: Palmyride mountain belt, Syria, seismic

  10. EIS-0092: Conversion to Coal, Holyoke Water Power Company, Mt. Tom Generating Station Unit 1 Holyoke, Hampden County, Massachusetts

    Broader source: Energy.gov [DOE]

    The Economic Regulatory Administration prepared this statement to assess the environmental impacts of prohibiting Unit 1 of the Mt. Tom Generation Station Unit 1 from using either natural gas or petroleum products as a primary energy source, which would result in the utility burning low-sulfur coal.

  11. The Mechanism of Inhibition of Antibody-based Inhibitors of Membrane-type Serine Protease 1 (MT-SP1)

    E-Print Network [OSTI]

    Craik, Charles S.

    The Mechanism of Inhibition of Antibody-based Inhibitors of Membrane-type Serine Protease 1 (MT-SP1, 600 16th St. Genentech Hall, San Francisco, CA 94143, USA The mechanisms of inhibition of two novel sc-SP1 at low pH, and is a standard mechanism inhibitor of the protease. The mechanisms of inhibition

  12. Strategic Plan for Nuclear Energy -- Knowledge Base for Advanced Modeling and Simulation (NE-KAMS)

    SciTech Connect (OSTI)

    Kimberlyn C. Mousseau

    2011-10-01

    The Nuclear Energy Computational Fluid Dynamics Advanced Modeling and Simulation (NE-CAMS) system is being developed at the Idaho National Laboratory (INL) in collaboration with Bettis Laboratory, Sandia National Laboratory (SNL), Argonne National Laboratory (ANL), Utah State University (USU), and other interested parties with the objective of developing and implementing a comprehensive and readily accessible data and information management system for computational fluid dynamics (CFD) verification and validation (V&V) in support of nuclear energy systems design and safety analysis. The two key objectives of the NE-CAMS effort are to identify, collect, assess, store and maintain high resolution and high quality experimental data and related expert knowledge (metadata) for use in CFD V&V assessments specific to the nuclear energy field and to establish a working relationship with the U.S. Nuclear Regulatory Commission (NRC) to develop a CFD V&V database, including benchmark cases, that addresses and supports the associated NRC regulations and policies on the use of CFD analysis. In particular, the NE-CAMS system will support the Department of Energy Office of Nuclear Energy Advanced Modeling and Simulation (NEAMS) Program, which aims to develop and deploy advanced modeling and simulation methods and computational tools for reliable numerical simulation of nuclear reactor systems for design and safety analysis. Primary NE-CAMS Elements There are four primary elements of the NE-CAMS knowledge base designed to support computer modeling and simulation in the nuclear energy arena as listed below. Element 1. The database will contain experimental data that can be used for CFD validation that is relevant to nuclear reactor and plant processes, particularly those important to the nuclear industry and the NRC. Element 2. Qualification standards for data evaluation and classification will be incorporated and applied such that validation data sets will result in well-defined, well-characterized data. Element 3. Standards will be established for the design and operation of experiments for the generation of new validation data sets that are to be submitted to NE-CAMS that addresses the completeness and characterization of the dataset. Element 4. Standards will be developed for performing verification and validation (V&V) to establish confidence levels in CFD analyses of nuclear reactor processes; such processes will be acceptable and recognized by both CFD experts and the NRC.

  13. Neutron-induced gamma-ray production cross sections for the first excited-state transitions in Ne-20 and Ne-22

    E-Print Network [OSTI]

    S. MacMullin; M. Boswell; M. Devlin; S. R. Elliott; N. Fotiades; V. E. Guiseppe; R. Henning; T. Kawano; B. H. LaRoque; R. O. Nelson; J. M. O'Donnell

    2012-10-03

    Background: Neutron-induced reactions are a significant concern for experiments that require extremely low levels of radioactive backgrounds. Measurements of gamma-ray production cross sections over a wide energy range will help to predict and identify neutron backgrounds in these experiments. Purpose: Determine partial gamma-ray production cross sections for neutron-induced reactions in natural neon. Methods: The broad-spectrum neutron beam at the Los Alamos Neutron Science Center (LANSCE) was used for the measurement. Gamma rays from neutron-induced reactions were detected using the GErmanium Array for Neutron Induced Excitations (GEANIE). Results: Partial gamma-ray cross sections were measured for the first excited-state transitions in Ne-20 and Ne-22. The measured cross sections were compared to the TALYS and CoH3 nuclear reaction codes. Conclusions: These are the first experimental data for (n,n') reactions in neon. In addition to providing data to aid in the prediction and identification of neutron backgrounds in low-background experiments, these new measurements will help refine cross-section predictions in a mass region where models are not well constrained.

  14. Conical Emission from Shock Waves in Ne(1-20 AGeV)+U Collisions

    E-Print Network [OSTI]

    Philip Rau; Jan Steinheimer; Barbara Betz; Hannah Petersen; Marcus Bleicher; Horst Stcker

    2010-03-05

    The formation and propagation of high-density compression waves, e.g. Mach shock waves, in cold nuclear matter is studied by simulating high-energy nucleus-nucleus collisions of Ne with U in the energy range from E_lab = 0.5 AGeV to 20 AGeV. In an ideal hydrodynamic approach, the high-density shock wave created by the small Ne nucleus passing through the heavy U nucleus is followed by a slower and more dilute Mach shock wave which causes conical emission of particles at the Mach cone angle. The conical emission originates from low-density regions with a small flow velocity comparable to the speed of sound. Moreover, it is shown that the angular distributions of emitted baryons clearly distinguish between a hydrodynamic approach and binary cascade processes used in the Ultra-relativistic Quantum Molecular Dynamics (UrQMD) transport model.

  15. Neutron Transfer Studied with a Radioactive beam of 24Ne, using TIARA at SPIRAL

    E-Print Network [OSTI]

    W. N. Catford; C. N. Timis; R. C. Lemmon; M. Labiche; N. A. Orr; L. Caballero; R. Chapman; M. Chartier; M. Rejmund; H. Savajols; for the TIARA Collaboration

    2009-12-20

    A general experimental technique for high resolution studies of nucleon transfer reactions using radioactive beams is briefly described, together with the first new physics results that have been obtained with the new TIARA array. These first results from TIARA are for the reaction 24Ne(d,p)25Ne, studied in inverse kinematics with a pure radioactive beam of 100,000 pps from the SPIRAL facility at GANIL. The reaction probes the energies of neutron orbitals relevant to very neutron rich nuclei in this mass region and the results highlight the emergence of the N=16 magic number for neutrons and the associated disappearance of the N=20 neutron magic number for the very neutron rich neon isotopes.

  16. The thermonuclear rate for the 19F(a,p)22Ne reaction at stellar temperatures

    E-Print Network [OSTI]

    Claudio Ugalde; Richard Azuma; Aaron Couture; Joachim Grres; Hye-Young Lee; Edward Stech; Elizabeth Strandberg; Wanpeng Tan; Michael Wiescher

    2008-03-04

    The $^{19}$F($\\alpha$,p)$^{22}$Ne reaction is considered to be one of the main sources of fluorine depletion in AGB and Wolf-Rayet stars. The reaction rate still retains large uncertainties due to the lack of experimental studies available. In this work the yields for both exit channels to the ground state and first excited state of $^{22}$Ne have been measured and several previously unobserved resonances have been found in the energy range E$_{lab}$=792-1993 keV. The level parameters have been determined through a detailed R-matrix analysis of the reaction data and a new reaction rate is provided on the basis of the available experimental information.

  17. The prototype detection unit of the KM3NeT detector

    E-Print Network [OSTI]

    Adrin-Martnez, S; Aharonian, F; Aiello, S; Albert, A; Ameli, F; Anassontzis, E G; Anghinolfi, M; Anton, G; Anvar, S; Ardid, M; Avgitas, T; Balasi, K; Band, H; Barbarino, G; Barbarito, E; Barbato, F; Baret, B; Baron, S; Barrios, J; Belias, A; Berbee, E; Berg, A M van den; Berkien, A; Bertin, V; Beurthey, S; van Beveren, V; Beverini, N; Biagi, S; Biagioni, A; Bianucci, S; Billault, M; Birbas, A; Rookhuizen, H Boer; Bormuth, R; Bouch, V; Bouhadef, B; Bourlis, G; Boutonnet, C; Bouwhuis, M; Bozza, C; Bruijn, R; Brunner, J; Cacopardo, G; Caillat, L; Calamai, M; Calvo, D; Capone, A; Caramete, L; Caruso, F; Cecchini, S; Ceres, A; Cereseto, R; Champion, C; Chteau, F; Chiarusi, T; Christopoulou, B; Circella, M; Classen, L; Cocimano, R; Coleiro, A; Colonges, S; Coniglione, R; Cosquer, A; Costa, M; Coyle, P; Creusot, A; Cuttone, G; D'Amato, C; D'Amico, A; De Bonis, G; De Rosa, G; Deniskina, N; Destelle, J -J; Distefano, C; Di Capua, F; Donzaud, C; Dornic, D; Dorosti-Hasankiadeh, Q; Drakopoulou, E; Drouhin, D; Drury, L; Durand, D; Eberl, T; Elsaesser, D; Enzenhfer, A; Fermani, P; Fusco, L A; Gajanana, D; Gal, T; Galat, S; Garufi, F; Gebyehu, M; Giordano, V; Gizani, N; GraciaRuiz, R; Graf, K; Grasso, R; Grella, G; Grmek, A; Habel, R; van Haren, H; Heid, T; Heijboer, A; Heine, E; Henry, S; Hernndez-Rey, J J; Herold, B; Hevinga, M A; van der Hoek, M; Hofestdt, J; Hogenbirk, J; Hugon, C; Hl, J; Imbesi, M; James, C W; Jansweijer, P; Jochum, J; de Jong, M; Jongen, M; Kadler, M; Kalekin, O; Kappes, A; Kappos, E; Katz, U; Kavatsyuk, O; Keller, P; Kieft, G; Koffeman, E; Kok, H; Kooijman, P; Koopstra, J; Korporaal, A; Kouchner, A; Kreykenbohm, I; Kulikovskiy, V; Lahmann, R; Lamare, P; Larosa, G; Lattuada, D; Provost, H Le; Leismller, K P; Leisos, A; Lenis, D; Leonora, E; LindseyClark, M; Alvarez, C D Llorens; Lhner, H; Lonardo, A; Loucatos, S; Louis, F; Maccioni, E; Mannheim, K; Manolopoulos, K; Margiotta, A; Mari?, O; Markou, C; Martnez-Mora, J A; Martini, A; Masullo, R; Melis, K W; Michael, T; Migliozzi, P; Migneco, E; Miraglia, A; Mollo, C M; Mongelli, M; Morganti, M; Mos, S; Moudden, Y; Musico, P; Musumeci, M; Nicolaou, C; Nicolau, C A; Orlando, A; Orzelli, A; Papaikonomou, A; Papaleo, R; P?v?la?, G E; Peek, H; Pellegrino, C; Pellegriti, M G; Perrina, C; Piattelli, P; Pikounis, K; Popa, V; Pradier, Th; Priede, M; Phlhofer, G; Pulvirenti, S; Racca, C; Raffaelli, F; Randazzo, N; Rapidis, P A; Razis, P; Real, D; Resvanis, L; Reubelt, J; Riccobene, G; Rovelli, A; Saldaa, M; Samtleben, D F E; Sanguineti, M; Santangelo, A; Sapienza, P; Schmelling, J; Schnabel, J; Sciacca, V; Sedita, M; Seitz, T; Sgura, I; Simeone, F; Sipala, V; Spitaleri, A; Spurio, M; Stavropoulos, G; Steijger, J; Stolarczyk, T; Stransky, D; Taiuti, M; Terreni, G; Tzier, D; Thraube, S; Thompson, L F; Timmer, P; Trasatti, L; Trovato, A; Tselengidou, M; Tsirigotis, A; Tzamarias, S; Tzamariudaki, E; Vallage, B; Van Elewyck, V; Vermeulen, J; Vernin, P; Vicini, P; Viola, S; Vivolo, D; Werneke, P; Wiggers, L; Wilms, J; de Wolf, E; van Wooning, R H L; Zonca, E; Zornoza, J D; Ziga, J; Zwart, A

    2015-01-01

    A prototype detection unit of the KM3NeT deep-sea neutrino telescope has been installed at 3500m depth 80km offshore the Italian coast. KM3NeT in its final configuration will contain several hundreds of detection units. Each detection unit is a mechanical structure anchored to the sea floor, held vertical by a submerged buoy and supporting optical modules for the detection of Cherenkov light emitted by charged secondary particles emerging from neutrino interactions. This prototype string implements three optical modules with 31 photomultiplier tubes each. These optical modules were developed by the KM3NeT Collaboration to enhance the detection capability of neutrino interactions. The prototype detection unit was operated since its deployment in May 2014 until its decommissioning in July 2015. Reconstruction of the particle trajectories from the data requires a nanosecond accuracy in the time calibration. A procedure for relative time calibration of the photomultiplier tubes contained in each optical module is...

  18. The KM3NeT deep-sea neutrino telescope

    E-Print Network [OSTI]

    Margiotta, Annarita

    2014-01-01

    KM3NeT is a deep-sea research infrastructure being constructed in the Mediterranean Sea. It will host the next generation Cherenkov neutrino telescope and nodes for a deep sea multidisciplinary observatory, providing oceanographers, marine biologists, and geophysicists with real time measurements. The neutrino telescope will complement IceCube in its field of view and exceed it substantially in sensitivity. Its main goal is the detection of high energy neutrinos of astrophysical origin. The detector will have a modular structure with six building blocks, each consisting of about one hundred Detection Units (DUs). Each DU will be equipped with 18 multi-PMT digital optical modules. The first phase of construction has started and shore and deep-sea infrastructures hosting the future KM3NeT detector are being prepared offshore Toulon, France and offshore Capo Passero on Sicily, Italy. The technological solutions for the neutrino detector of KM3NeT and the expected performance of the neutrino telescope are present...

  19. Benthic biological and biogeochemical patterns and processes across an oxygen minimum zone (Pakistan margin, NE Arabian Sea)

    E-Print Network [OSTI]

    Levin, Lisa

    (Pakistan margin, NE Arabian Sea) Gregory L. Cowie a,, Lisa A. Levin b a The Sir John Murray Laboratories), and organic matter (OM) availability on benthic communities and processes across the Pakistan Margin

  20. Strategic Plan for Nuclear Energy -- Knowledge Base for Advanced Modeling and Simulation (NE-KAMS)

    SciTech Connect (OSTI)

    Rich Johnson; Kimberlyn C. Mousseau; Hyung Lee

    2011-09-01

    NE-KAMS knowledge base will assist computational analysts, physics model developers, experimentalists, nuclear reactor designers, and federal regulators by: (1) Establishing accepted standards, requirements and best practices for V&V and UQ of computational models and simulations, (2) Establishing accepted standards and procedures for qualifying and classifying experimental and numerical benchmark data, (3) Providing readily accessible databases for nuclear energy related experimental and numerical benchmark data that can be used in V&V assessments and computational methods development, (4) Providing a searchable knowledge base of information, documents and data on V&V and UQ, and (5) Providing web-enabled applications, tools and utilities for V&V and UQ activities, data assessment and processing, and information and data searches. From its inception, NE-KAMS will directly support nuclear energy research, development and demonstration programs within the U.S. Department of Energy (DOE), including the Consortium for Advanced Simulation of Light Water Reactors (CASL), the Nuclear Energy Advanced Modeling and Simulation (NEAMS), the Light Water Reactor Sustainability (LWRS), the Small Modular Reactors (SMR), and the Next Generation Nuclear Power Plant (NGNP) programs. These programs all involve computational modeling and simulation (M&S) of nuclear reactor systems, components and processes, and it is envisioned that NE-KAMS will help to coordinate and facilitate collaboration and sharing of resources and expertise for V&V and UQ across these programs. In addition, from the outset, NE-KAMS will support the use of computational M&S in the nuclear industry by developing guidelines and recommended practices aimed at quantifying the uncertainty and assessing the applicability of existing analysis models and methods. The NE-KAMS effort will initially focus on supporting the use of computational fluid dynamics (CFD) and thermal hydraulics (T/H) analysis for M&S of nuclear reactor systems, components and processes, and will later expand to include materials, fuel system performance and other areas of M&S as time and funding allow.

  1. Applications of stable isotopes in hydrological studies of Mt. Apo geothermal field, Philippines

    SciTech Connect (OSTI)

    Salonga, N.D.; Aragon, G.M.; Nogara, J.B.; Sambrano, B.G.

    1996-12-31

    The local precipitation in Mt. Apo is depleted of heavy isotopes owing to high elevation and landward location of the field. Rainwaters infiltrate the shallow grounds, circulate in short distances with almost no interaction with the host bed rocks, and effuse in the surface as cold springs. Lakes and rivers are affected by surface evaporation while the acid SO{sub 4} springs are affected by both evaporation and steam-heating. Only the neutral-pH Cl springs have the signature of the deep thermal fluids. The parent fluids of the deep thermal brine contain Cl of 4,800 to 5,000 mg/kg, {delta}{sup 18}O of -4.62 to -4.13 {per_thousand} and {delta}{sup 2}H of -60.0 to -57.8 {per_thousand}. Inside the Sandawa Collapse, boiling of the parent fluids resulted in a two-phase reservoir with lighter isotope contents. The thermal fluids laterally flow towards the west where they are affected by cooling and mixing of cold waters. Deep water recharge has {delta}{sup 18}O of -10.00 {per_thousand} and {delta}{sup 2}H = -61.20 {per_thousand} which come from the upper slopes of Sandawa Collapse (1580-1700 mASL).

  2. Four-year prospective study of the respiratory effects of volcanic ash from Mt. St. Helens

    SciTech Connect (OSTI)

    Buist, A.S.; Vollmer, W.M.; Johnson, L.R.; Bernstein, R.S.; McCamant, L.E.

    1986-04-01

    This report describes the 4-yr follow-up of 712 loggers exposed over an extended period to varying levels of fresh volcanic ash from the 1980 eruptions of Mt. St. Helens. Concerns related to the irritant effect the ash might have on the airways and also to its fibrogenic potential if exposures were intense and continued over many years. Our subjects were divided into 3 groups: high, low, and no exposure. Baseline testing was begun in June 1980, 1 month after the major eruption, and follow-up testing continued on an annual basis through 1984; 88% of the loggers have been tested at least 3 times. Analysis of lung function data showed that a significant, exposure-related decline in FEV1 occurred during the first year after the eruption. The decline was short-lived, however, and by 1984 the differences between exposure groups were no longer significant. Self-reported symptoms of cough, phlegm, and wheeze showed a similar pattern. No ash-related changes were seen in chest roentgenograms taken in 1980 and in 1984. Our findings are consistent with the hypothesis that the inhaled ash caused mucus hypersecretion and/or airway inflammation that reversed when the exposure levels decreased. The ash levels to which the loggers were exposed were low compared with permissible occupational levels for nuisance dusts, but generally higher than the total suspended particulate levels permissible in ambient air.

  3. CO2 flood tests on whole core samples of the Mt. Simon sandstone, Illinois Basin

    SciTech Connect (OSTI)

    O'Connor, William K.; Rush, Gilbert E.

    2005-09-01

    Geological sequestration of CO2, whether by enhanced oil recovery (EOR), coal-bed methane (CBM) recovery, or saline aquifer injection is a promising near-term sequestration methodology. While tremendous experience exists for EOR, and CBM recovery has been demonstrated in existing fields, saline aquifer injection studies have only recently been initiated. Studies evaluating the availability of saline aquifers suitable for CO2 injection show great potential, however, the long-term fate of the CO2 injected into these ancient aqueous systems is still uncertain. For the subject study, a series of laboratory-scale CO2 flood tests were conducted on whole core samples of the Mt. Simon sandstone from the Illinois Basin. By conducting these tests on whole core samples rather than crushed core, an evaluation of the impact of the CO2 flood on the rock mechanics properties as well as the geochemistry of the core and brine solution has been possible. This empirical data could provide a valuable resource for the validation of reservoir models under development for these engineered CO2 systems.

  4. Assignment 4 BS4a Actuarial Science Oxford MT 2011 IX A.4 Inflation, taxation and project appraisal

    E-Print Network [OSTI]

    Winkel, Matthias

    Assignment 4 ­ BS4a Actuarial Science ­ Oxford MT 2011 IX A.4 Inflation, taxation and project are indexed by reference to the value of a retail price index with a time lag of 8 months. The retail price index value in September 1996 was Q(-8/12) = 200 and in March 1997 was Q(-2/12) = 206. The issue price

  5. NE-20

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReport for the Weldon Spring,7=cr5rnP 7694 i+lJ ,E-23N V O 1 8hi v.

  6. NE-24

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReport for the Weldon Spring,7=cr5rnP 7694 i+lJ ,E-23N V O 1

  7. NE-23

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and MyersHr.EvaluationJune~ofOF OHlO - TO J.s,'

  8. NE-23,

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and MyersHr.EvaluationJune~ofOF OHlO -t:"'. ? -

  9. NE-23:

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and MyersHr.EvaluationJune~ofOF OHlO -t:"'. ?

  10. NE-24

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and MyersHr.EvaluationJune~ofOF OHlO -t:"'.

  11. 20Ne

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPONeApril 30,University Turbine Systems55MgNa

  12. 17Ne

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPO RetireesLecturersOThermal NeutronC β--DecayFNNe

  13. 19Ne

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPONe β+-Decay Evaluated Data Measurements 1939WH02:

  14. 19Ne

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPONe β+-Decay Evaluated Data Measurements 1939WH02:

  15. Impact of the uncertainty in ?-captures on {sup 22}Ne on the weak s-process in massive stars

    SciTech Connect (OSTI)

    Nishimura, N. [Astrophysics group, EPSAM, Keele University, Keele, ST5 1BH, UK and NuGrid Project (United Kingdom); Hirschi, R. [Astrophysics group, EPSAM, Keele University, Keele, ST5 1BH, UK and Kavli IPMU (WPI), University of Tokyo, Kashiwa, 277-8583 (Japan); Pignatari, M. [NuGrid Project and Department of Physics, University of Basel, Basel, CH-4056 (Switzerland); Herwig, F. [NuGrid Project and Department of Physics and Astronomy, University of Victoria, Victoria, BC V8P5C2 (Canada); Beard, M. [NuGrid Project and Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States); Imbriani, G. [Dipartiment di Scienze Fisiche, Universita di Napoli Federico II, Napoli (Italy); Grres, J.; Boer, R. J. de; Wiescher, M. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States)

    2014-05-02

    Massive stars at solar metallicity contribute to the production of heavy elements with atomic masses between A = 60 and A = 90 via the so-called weak s-process (which takes place during core He and shell C burning phases). Furthermore, recent studies have shown that rotation boosts the s-process production in massive stars at low metallicities, with a production that may reach the barium neutron-magic peak. These results are very sensitive to neutron source and neutron poison reaction rates. For the weak s-process, the main neutron source is the reaction {sup 22}Ne(?,n){sup 25}Mg, which is in competition with {sup 22}Ne(?,?){sup 26}Mg. The uncertainty of both rates strongly affects the nucleosynthesis predictions from stellar model calculations. In this study, we investigate the impact of the uncertainty in ?-captures on {sup 22}Ne on the s-process nucleosynthesis in massive stars both at solar and at very low metallicity. For this purpose, we post-process, with the Nugrid mppnp code, non-rotating and rotating evolutionary models 25M{sub ?} stars at two different metallicities: Z = Z{sub ?} and Z = 10{sup ?5}Z{sub ?}, respectively. Our results show that uncertainty of {sup 22}Ne(?,n){sup 25}Mg and {sup 22}Ne(?,?){sup 26}Mg rates have a significant impact on the final elemental production especially for metal poor rotating models. Beside uncertainties in the neutron source reactions, for fast rotating massive stars at low metallicity we revisit the impact of the neutron poisoning effect by the reaction chain {sup 16}O(n,?){sup 17}O(?,?){sup 21}Ne, in competition with the {sup 17}O(?,n){sup 20}Ne, recycling the neutrons captured by {sup 16}O.

  16. The prototype detection unit of the KM3NeT detector

    E-Print Network [OSTI]

    KM3NeT Collaboration; S. Adrin-Martnez; M. Ageron; F. Aharonian; S. Aiello; A. Albert; F. Ameli; E. G. Anassontzis; M. Anghinolfi; G. Anton; S. Anvar; M. Ardid; T. Avgitas; K. Balasi; H. Band; G. Barbarino; E. Barbarito; F. Barbato; B. Baret; S. Baron; J. Barrios; A. Belias; E. Berbee; A. M. van den Berg; A. Berkien; V. Bertin; S. Beurthey; V. van Beveren; N. Beverini; S. Biagi; A. Biagioni; S. Bianucci; M. Billault; A. Birbas; H. Boer Rookhuizen; R. Bormuth; V. Bouch; B. Bouhadef; G. Bourlis; C. Boutonnet; M. Bouwhuis; C. Bozza; R. Bruijn; J. Brunner; G. Cacopardo; L. Caillat; M. Calamai; D. Calvo; A. Capone; L. Caramete; F. Caruso; S. Cecchini; A. Ceres; R. Cereseto; C. Champion; F. Chteau; T. Chiarusi; B. Christopoulou; M. Circella; L. Classen; R. Cocimano; A. Coleiro; S. Colonges; R. Coniglione; A. Cosquer; M. Costa; P. Coyle; A. Creusot; G. Cuttone; C. D'Amato; A. D'Amico; G. De Bonis; G. De Rosa; N. Deniskina; J. -J. Destelle; C. Distefano; F. Di Capua; C. Donzaud; D. Dornic; Q. Dorosti-Hasankiadeh; E. Drakopoulou; D. Drouhin; L. Drury; D. Durand; T. Eberl; D. Elsaesser; A. Enzenhfer; P. Fermani; L. A. Fusco; D. Gajanana; T. Gal; S. Galat; F. Garufi; M. Gebyehu; V. Giordano; N. Gizani; R. GraciaRuiz; K. Graf; R. Grasso; G. Grella; A. Grmek; R. Habel; H. van Haren; T. Heid; A. Heijboer; E. Heine; S. Henry; J. J. Hernndez-Rey; B. Herold; M. A. Hevinga; M. van der Hoek; J. Hofestdt; J. Hogenbirk; C. Hugon; J. Hl; M. Imbesi; C. W. James; P. Jansweijer; J. Jochum; M. de Jong; M. Jongen; M. Kadler; O. Kalekin; A. Kappes; E. Kappos; U. Katz; O. Kavatsyuk; P. Keller; G. Kieft; E. Koffeman; H. Kok; P. Kooijman; J. Koopstra; A. Korporaal; A. Kouchner; I. Kreykenbohm; V. Kulikovskiy; R. Lahmann; P. Lamare; G. Larosa; D. Lattuada; H. Le Provost; K. P. Leismller; A. Leisos; D. Lenis; E. Leonora; M. LindseyClark; C. D. Llorens Alvarez; H. Lhner; A. Lonardo; S. Loucatos; F. Louis; E. Maccioni; K. Mannheim; K. Manolopoulos; A. Margiotta; O. Mari?; C. Markou; J. A. Martnez-Mora; A. Martini; R. Masullo; K. W. Melis; T. Michael; P. Migliozzi; E. Migneco; A. Miraglia; C. M. Mollo; M. Mongelli; M. Morganti; S. Mos; Y. Moudden; P. Musico; M. Musumeci; C. Nicolaou; C. A. Nicolau; A. Orlando; A. Orzelli; A. Papaikonomou; R. Papaleo; G. E. P?v?la?; H. Peek; C. Pellegrino; M. G. Pellegriti; C. Perrina; P. Piattelli; K. Pikounis; V. Popa; Th. Pradier; M. Priede; G. Phlhofer; S. Pulvirenti; C. Racca; F. Raffaelli; N. Randazzo; P. A. Rapidis; P. Razis; D. Real; L. Resvanis; J. Reubelt; G. Riccobene; A. Rovelli; M. Saldaa; D. F. E. Samtleben; M. Sanguineti; A. Santangelo; P. Sapienza; J. Schmelling; J. Schnabel; V. Sciacca; M. Sedita; T. Seitz; I. Sgura; F. Simeone; V. Sipala; A. Spitaleri; M. Spurio; G. Stavropoulos; J. Steijger; T. Stolarczyk; D. Stransky; M. Taiuti; G. Terreni; D. Tzier; S. Thraube; L. F. Thompson; P. Timmer; L. Trasatti; A. Trovato; M. Tselengidou; A. Tsirigotis; S. Tzamarias; E. Tzamariudaki; B. Vallage; V. Van Elewyck; J. Vermeulen; P. Vernin; P. Vicini; S. Viola; D. Vivolo; P. Werneke; L. Wiggers; J. Wilms; E. de Wolf; R. H. L. van Wooning; E. Zonca; J. D. Zornoza; J. Ziga; A. Zwart

    2015-10-06

    A prototype detection unit of the KM3NeT deep-sea neutrino telescope has been installed at 3500m depth 80km offshore the Italian coast. KM3NeT in its final configuration will contain several hundreds of detection units. Each detection unit is a mechanical structure anchored to the sea floor, held vertical by a submerged buoy and supporting optical modules for the detection of Cherenkov light emitted by charged secondary particles emerging from neutrino interactions. This prototype string implements three optical modules with 31 photomultiplier tubes each. These optical modules were developed by the KM3NeT Collaboration to enhance the detection capability of neutrino interactions. The prototype detection unit was operated since its deployment in May 2014 until its decommissioning in July 2015. Reconstruction of the particle trajectories from the data requires a nanosecond accuracy in the time calibration. A procedure for relative time calibration of the photomultiplier tubes contained in each optical module is described. This procedure is based on the measured coincidences produced in the sea by the 40K background light and can easily be expanded to a detector with several thousands of optical modules. The time offsets between the different optical modules are obtained using LED nanobeacons mounted inside them. A set of data corresponding to 600 hours of livetime was analysed. The results show good agreement with Monte Carlo simulations of the expected optical background and the signal from atmospheric muons. An almost background-free sample of muons was selected by filtering the time correlated signals on all the three optical modules. The zenith angle of the selected muons was reconstructed with a precision of about 3{\\deg}.

  17. Dark Matter Particle Spectroscopy at the LHC: Generalizing M(T2) to Asymmetric Event Topologies

    SciTech Connect (OSTI)

    Konar, Partha; Kong, Kyoungchul; Matchev, Konstantin T.; Park, Myeonghun; /Florida U.

    2012-04-03

    We consider SUSY-like missing energy events at hadron colliders and critically examine the common assumption that the missing energy is the result of two identical missing particles. In order to experimentally test this hypothesis, we generalize the subsystem M{sub T2} variable to the case of asymmetric event topologies, where the two SUSY decay chains terminate in different 'children' particles. In this more general approach, the endpoint M{sub T2(max)} of the M{sub T2} distribution now gives the mass {tilde M}p({tilde M}{sub c}{sup (a)}, {tilde M}{sub c}{sup (b)}) of the parent particles as a function of two input children masses {tilde M}{sub c}{sup (a)} and {tilde M}{sub c}{sup (b)}. We propose two methods for an independent determination of the individual children masses M{sub c}{sup (a)} and M{sub c}{sup (b)}. First, in the presence of upstream transverse momentum PUTM the corresponding function {tilde M}p({tilde M}{sub c}{sup (a)}, {tilde M}{sub c}{sup (b)}, P{sub UTM}) is independent of P{sub UTM} at precisely the right values of the children masses. Second, the previously discussed MT2 'kink' is now generalized to a 'ridge' on the 2-dimensional surface {tilde M}p({tilde M}{sub c}{sup (a)}, {tilde M}{sub c}{sup (b)}). As we show in several examples, quite often there is a special point along that ridge which marks the true values of the children masses. Our results allow collider experiments to probe a multi-component dark matter sector directly and without any theoretical prejudice.

  18. Uranium hydrogeochemical and stream-sediment reconnaissance of the Mt. Michelson NTMS quadrangle, Alaska

    SciTech Connect (OSTI)

    Zinkl, R.J.; Shettel, D.L. Jr.; Langfeldt, S.L.; Hardy, L.C.; D'Andrea, R.F. Jr.

    1982-04-01

    This report presents results of a Hydrogeochemical and Stream Sediment Reconnaissance (HSSR) of the Mt. Michelson NTMS quadrangle, Alaska. In addition to this abbreviated data release, more complete data are available to the public in machine-readable form. These machine-readable data, as well as quarterly or semiannual program progress reports containing further information on the HSSR program in general, or on the Los Alamos National Laboratory (LANL) portion of the program in particular, are available from DOE's Technical Library at its Grand Junction Area Office. Presented in this data release are location data, field analyses, and laboratory analyses of several different sample media. For the sake of brevity, many field site observations have not been included in this volume; these data are, however, available on the magnetic tape. Appendices A and B describe the sample media and summarize the analytical results for each medium. The data have been subdivided by one of the Los Alamos National Laboratory sorting programs of Zinkl and others (1981a) into groups of stream-sediment and lake-sediment samples. For each group which contains a sufficient number of observations, statistical tables, tables of raw data, and 1:1,000,000 scale maps of pertinent elements have been included in this report. Also included are maps showing results of multivariate statistical analyses. Information on the field and analytical procedures used by the Los Alamos National Laboratory during sample collection and analysis may be found in any HSSR data release prepared by the Laboratory and will not be included in this report.

  19. LSND versus MiniBooNE: Sterile neutrinos with energy dependent masses and mixing?

    E-Print Network [OSTI]

    Thomas Schwetz

    2008-01-25

    Standard active--sterile neutrino oscillations do not provide a satisfactory description of the LSND evidence for neutrino oscillations together with the constraints from MiniBooNE and other null-result short-baseline oscillation experiments. However, if the mass or the mixing of the sterile neutrino depends in an exotic way on its energy all data become consistent. I explore the phenomenological consequences of the assumption that either the mass or the mixing scales with the neutrino energy as $1/E_\

  20. DOE-NE Proliferation and Terrorism Risk Assessment: FY12 Plans Update

    SciTech Connect (OSTI)

    Sadasivan, Pratap

    2012-06-21

    This presentation provides background information on FY12 plans for the DOE Office of Nuclear Energy Proliferation and Terrorism Risk Assessment program. Program plans, organization, and individual project elements are described. Research objectives are: (1) Develop technologies and other solutions that can improve the reliability, sustain the safety, and extend the life of current reactors; (2) Develop improvements in the affordability of new reactors to enable nuclear energy; (3) Develop Sustainable Nuclear Fuel Cycles; and (4) Understand and minimize the risks of nuclear proliferation and terrorism - Goal is to enable the use of risk information to inform NE R&D program planning.

  1. Thermonuclear reaction rate of $^{18}$Ne($\\alpha$,$p$)$^{21}$Na from Monte-Carlo calculations

    E-Print Network [OSTI]

    Mohr, P; Iliadis, C

    2014-01-01

    The $^{18}$Ne($\\alpha$,$p$)$^{21}$Na reaction impacts the break-out from the hot CNO-cycles to the $rp$-process in type I X-ray bursts. We present a revised thermonuclear reaction rate, which is based on the latest experimental data. The new rate is derived from Monte-Carlo calculations, taking into account the uncertainties of all nuclear physics input quantities. In addition, we present the reaction rate uncertainty and probability density versus temperature. Our results are also consistent with estimates obtained using different indirect approaches.

  2. Thermonuclear reaction rate of $^{18}$Ne($?$,$p$)$^{21}$Na from Monte-Carlo calculations

    E-Print Network [OSTI]

    P. Mohr; R. Longland; C. Iliadis

    2014-12-14

    The $^{18}$Ne($\\alpha$,$p$)$^{21}$Na reaction impacts the break-out from the hot CNO-cycles to the $rp$-process in type I X-ray bursts. We present a revised thermonuclear reaction rate, which is based on the latest experimental data. The new rate is derived from Monte-Carlo calculations, taking into account the uncertainties of all nuclear physics input quantities. In addition, we present the reaction rate uncertainty and probability density versus temperature. Our results are also consistent with estimates obtained using different indirect approaches.

  3. r-Process Nucleosynthesis in Shocked Surface Layers of O-Ne-Mg Cores

    E-Print Network [OSTI]

    H. Ning; Y. -Z. Qian; B. S. Meyer

    2007-08-13

    We demonstrate that rapid expansion of the shocked surface layers of an O-Ne-Mg core following its collapse can result in r-process nucleosynthesis. As the supernova shock accelerates through these layers, it makes them expand so rapidly that free nucleons remain in disequilibrium with alpha-particles throughout most of the expansion. This allows heavy r-process isotopes including the actinides to form in spite of the very low initial neutron excess of the matter. We estimate that yields of heavy r-process nuclei from this site may be sufficient to explain the Galactic inventory of these isotopes.

  4. Skåne County, Sweden: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing Capacity forSilicium de ProvenceSolar Jump to: navigation, searchSkåne

  5. MiniBooNE's First Oscillation Result Morgan Wascko Imperial College London

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OFDetectionBenchmarkResults and Follow-OnMiniBooNE's First

  6. MiniBooNE: Up and Running Morgan Wascko Morgan Wascko Louisiana State University

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OFDetectionBenchmarkResults and Follow-OnMiniBooNE's6Up and

  7. Neutrino Scattering Results from MiniBooNE R. Tayloe, Indiana U.

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shinesSolar Photovoltaic(MillionNature and OriginMiniBooNE's NeutrinoPhysics/SΒ

  8. 2011 Annual Planning Summary for Nuclear Energy (NE) | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l De p u t y A s s i s t a nsecond report111.pdfofofof(NETL) |(NE).

  9. DOE-NE-STD-1004-92; Root Cause Analysis Guidance Document

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum Based| Department8, 2015 GATEWAY6.1viii ACRONYMS,4-97NE-STD-1004-92 DOE

  10. EcoCAR: The NeXt Challenge | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum Based|DepartmentStatementofApril 25,EV Everywhere|Muscle Car |EcoCAR: The NeXt

  11. International Best Practices for Pre-Processing and Co-Processing Municipal Solid Waste and Sewage Sludge in the Cement Industry

    E-Print Network [OSTI]

    Hasanbeigi, Ali

    2013-01-01

    centrifuges, anaerobic digesters, and sludge dryers. In+Sludge Drier (SD) MS+MT+Anaerobic digester (AD) MS+MT+AD+DC

  12. The importance of $^{22}$Ne($\\alpha$, n)$^{25}$Mg as s-process neutron source and the s-process thermometer $^{151}$Sm

    E-Print Network [OSTI]

    CERN. Geneva. ISOLDE and Neutron Time-of-Flight Experiments Committee; Andriamonje, Samuel A; Angelopoulos, P; Assimakopoulos, P A; Audouin, L; Badurek, G; Bakos, G A; Bauge, E; Baumann, P; Beer, H; Benlliure, J; Benlloch, J M; Boffi, S; Boiano, A; Borcea, C; Brusegan, A; Buono, S; Calvio, F; Cambronero, C F; Cano-Ott, D; Cennini, P; Charpak, Georges; Chepel, V Yu; Colonna, N; Corts, G; Corvi, F; Cura, J L; Czajkowski, S; Dasso, C H; David, S; De Blas, A; De Poli, M; Del Moral, R; Delaroche, J P; Della Mea, G; Derr, J; Dez, S; Dolfini, R; Durn, I; Eleftheriadis, C; Embid-Segura, M; Farget, F; Ferreira-Marques, R; Ferrari, A; Furman, W I; Gadea, A; Garzn, J A; Giomataris, Ioanis; Giusti, C; Gonzlez-Romero, E M; Goverdovski, A A; Gramegna, F; Griesmayer, E; Grudzevich, O; Guber, K H; Gundrorin, N; Gunsing, F; Hage-Ali, M; Haight, B; Harissopoulos, S V; Heil, M; Ioannides, K G; Ioannou, P; Isaev, S; Jastrzebski, J J; Jericha, E; Kadi, Y; Kppeler, F K; Kalfas, C A; Karamis, D; Kazakov, L; Kelic, A; Ketlerov, V; Kitis, G; Khler, P E; Konovalov, V; Kopach, Yu N; Kossionides, E; Lacoste, V; Lavielle, B; Leal, L C; Leeb, H; Leprtre, A; Lopes, M; Lozano, M; Martnez-Val, J M; Mastinu, P F; Matteucci, M F; Matveev, D V; Mengoni, A; Meunier, R; Milazzo, P M; Mnguez-Torres, E; Mitrofanov, V P; Molina, A; Mordenti, R; Mutti, P; Napiorkowski, P J; Nicolis, N G; Nolte, R; Oberhummer, Heinz; Ordine, A; Ortega, R; Pacati, F D; Pakou, A A; Papadopoulos, I M; Papaevangelou, T; Paradelis, T; Pavlik, A; Pavlopoulos, P; Perlado, J M; Piera, M; Piksaikin, V M; Plag, R; Plompen, A; Poch, A; Policarpo, Armando; Popov, A; Popov, Yu; Pretel, C; Quaranta, A; Quesada, J M; Radermacher, E; Radici, M; Raman, S; Rapp, W; Rauscher, T; Reifarth, R; Rigato, V; Rubbia, Carlo; Rudolf, G; Rullhusen, P; Rundberg, B; Sakelliou, L; Saldaa, F; Santos, D M; Sanz, J; Savvidis, S; Schuhmacher, H; Sedyshev, P V; Sergent, C; Serov, D; Simonoff, M; Stphan, C; Tagliente, G; Tan, J L; Tapia, C; Tassan-Got, L; Terrani, M; Terchychnyi, R; Tsagas, N; Tzima, A; Vardaci, E; Ventura, A; Villamarn, D; Vlachoudis, V; Voinov, A V; Voss, F; Weigmann, H; Wendler, H; Wiescher, M C; Wisshak, K; Zeinalov, S S; INTC

    2000-01-01

    The importance of $^{22}$Ne($\\alpha$, n)$^{25}$Mg as s-process neutron source and the s-process thermometer $^{151}$Sm

  13. Neutron-g Pulse Shape Discrimination with NE213 Liquid Scintillator: Comparison of Different Sampling Rate/Bit Resolution Digital Acquisition Systems Datasets

    E-Print Network [OSTI]

    Neutron-g Pulse Shape Discrimination with NE213 Liquid Scintillator: Comparison of Different Sampling Rate/Bit Resolution Digital Acquisition Systems Datasets

  14. $^{22}Ne$ a primary source of neutron for the s-process and a major neutron poison in CEMP AGB stars

    E-Print Network [OSTI]

    Gallino, R; Husti, L; Kppeler, F; Cristallo, S; Straniero, O

    2006-01-01

    $^{22}Ne$ a primary source of neutron for the s-process and a major neutron poison in CEMP AGB stars

  15. Probing surface distribution of $\\alpha$-cluster in $^{20}$Ne via $\\alpha$-transfer reaction

    E-Print Network [OSTI]

    Fukui, Tokuro; Suhara, Tadahiro; Kanada-En'yo, Yoshiko; Ogata, Kazuyuki

    2015-01-01

    Direct evidence of the $\\alpha$-cluster development in bound states has not been obtained yet although a number of experimental studies were carried out to extract the information of the clustering. In particular in conventional analyses of $\\alpha$-transfer reactions, there exist a few significant problems on reaction models, which are insufficient to qualitatively discuss the cluster structure. We aim to verify the development of the $\\alpha$-cluster structure from observables. As the first application, it is argued to extract the spatial information of the cluster structure of the $^{20}$Ne nucleus in its ground state through the cross section of the $\\alpha$-transfer reaction $^{16}$O($^6$Li,~$d$)$^{20}$Ne. For the analysis of the transfer reaction, we work with the coupled-channels Born approximation (CCBA) approach, in which the breakup effect of $^6$Li is explicitly taken into account by means of the continuum-discretized coupled-channels method (CDCC) based on the three-body $\\alpha + d + {}^{16}$O mo...

  16. Photoionization-pumped, Ne II, x-ray laser studies project. Final report

    SciTech Connect (OSTI)

    Richardson, M.C.; Hagelstein, P.L.; Eckart, M.J.; Forsyth, J.M.; Gerrassimenko, M.; Soures, J.M.

    1984-01-01

    The energetics of this pumping scheme are shown. Short-pulse (50 to 100 ps) laser irradiation of an appropriate x-ray flashlamp medium generates broad-band emission in the range of 300 to 800 eV which preferentially photoionizes Ne to the /sup 2/S state of Ne II creating an inversion at approximately 27 eV. Although this approach does not depend on precise spectral overlap between the x-ray pump radiation and the medium to be pumped, it does require that the x-ray medium remain un-ionized prior to photoionization by the soft x-ray emission. Well-controlled focus conditions are required to ensure that the x-ray medium is not subjected to electron or x-ray preheat prior to irradiation by the soft x-ray source. The magnitude of the population inversion is predicted to be critically dependent upon rapid photoionization of the two states; therefore, ultra-short pulse irradiation of the laser flashlamps is required.

  17. The importance of 15O(a,g)19Ne to X-ray bursts and superbursts

    E-Print Network [OSTI]

    Jacob Lund Fisker; Joachim Gorres; Michael Wiescher; Barry Davids

    2006-06-21

    One of the two breakout reactions from the hot CNOcycle is 15O(a,g)19Ne, which at low temperatures depends strongly on the resonance strength of the 4.033 MeV state in 19Ne. An experimental upper limit has been placed on its strength, but the lower limit on the resonance strength and thereby the astrophysical reaction rate is unconstrained experimentally. However, this breakout reaction is crucial to the thermonuclear runaway which causes type I X-ray bursts on accreting neutron stars. In this paper we exploit astronomical observations in an attempt to constrain the relevant nuclear physics and deduce a lower limit on the reaction rate. Our sensitivity study implies that if the rate were sufficiently small, accreting material would burn stably without bursts. The existence of type I X-ray bursts and superbursts consequently suggests a lower limit on the 15O(a,g)19Ne reaction rate at low temperatures.

  18. Construction integrity assessment report (ETN-98-0005) S-Farm overground transfer (OGT) system valve pit 241-S-B to valve pit 241-S-D

    SciTech Connect (OSTI)

    HICKS, D.F.

    1999-08-12

    The S-Farm overground transfer (OGT) line will bypass the existing line(s), between valve pits 241-S-B and 241-S-D that no longer meet system requirements. The new OGT line will provide a waste transfer pipeline between these valve pits in support of saltwell pumping activities. The length of the OGT line is approximately 180 ft from pit to pit. The primary pipe is nominal 1-in. diameter stainless steel (SST) braided Ethylene-propylene Diene Monomer (EPDM) hose. The encasement pipe is a nominal 3-in., flanged, SST pipe made up of several different length pipe spool pieces (drawing H-2-829564, sh. 1 and sh. 2). The OGT line slopes from valve pit 241-S-B toward valve pit 241-S-D. At each end, the primary and encasement pipe connect to a pit entry spool piece. The pit entry spool pieces are constructed of prefabricated SST materials. These spool pieces allow for the separation of the primary and encasement pipelines after the pipes have entered the valve pits (drawing H-2-818280, sh. 2). The pit entry spool pieces also allow for leak detection of the encasement pipe at each end (drawing H-2-829564, sh. 2). The OGT encasement pipeline is supported above ground by adjustable height unistrut brackets and precast concrete bases (drawing H-2-829654, sh. 1). The pipeline is heat-traced and insulated. The heat tracing and insulation supply and retain latent heat that prevents waste solidification during transfers and provides freeze protection. The total length of the pipeline is above ground, thereby negating the need for cathodic corrosion protection. This Construction Integrity Assessment Report (CIAR) is prepared by Fluor Daniel Northwest for Numatec Hanford Corporation/Lockheed Martin Hanford Corporation, the operations contractor, and the U. S. Department of Energy, the system owner. The CIAR is intended to verify that construction was performed in accordance with the provisions of Washington Administrative Code, WAC-173-303-640 (3) (c), (e), (f) and (h).

  19. Wave packet and statistical quantum calculations for the He + NeH{sup +} ? HeH{sup +} + Ne reaction on the ground electronic state

    SciTech Connect (OSTI)

    Koner, Debasish; Panda, Aditya N.; Barrios, Lizandra; Gonzlez-Lezana, Toms

    2014-09-21

    A real wave packet based time-dependent method and a statistical quantum method have been used to study the He + NeH{sup +} (v, j) reaction with the reactant in various ro-vibrational states, on a recently calculated ab initio ground state potential energy surface. Both the wave packet and statistical quantum calculations were carried out within the centrifugal sudden approximation as well as using the exact Hamiltonian. Quantum reaction probabilities exhibit dense oscillatory pattern for smaller total angular momentum values, which is a signature of resonances in a complex forming mechanism for the title reaction. Significant differences, found between exact and approximate quantum reaction cross sections, highlight the importance of inclusion of Coriolis coupling in the calculations. Statistical results are in fairly good agreement with the exact quantum results, for ground ro-vibrational states of the reactant. Vibrational excitation greatly enhances the reaction cross sections, whereas rotational excitation has relatively small effect on the reaction. The nature of the reaction cross section curves is dependent on the initial vibrational state of the reactant and is typical of a late barrier type potential energy profile.

  20. Portable SD Recorder Product Overview

    E-Print Network [OSTI]

    storage is matched by six hours recording time from four AA Alkaline / Ni-MH batteries. Drag and drop file file transfer 4 x AA Batteries, providing six hours recording (w/Alkaline 1450mAh batteries Speaker Standard level 450 mW/8 ohms General Power consumption Recording/Playback 4.2 W (DC) Battery life

  1. NA SD 452.2

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal of Honor recipients honored at Y-12CONTROLLEDStatements |Mo-99N

  2. QSO ABSORPTION SYSTEMS DETECTED IN Ne VIII: HIGH-METALLICITY CLOUDS WITH A LARGE EFFECTIVE CROSS SECTION

    SciTech Connect (OSTI)

    Meiring, J. D.; Tripp, T. M. [Department of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States)] [Department of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Werk, J. K.; Prochaska, J. X. [University of California Observatories-Lick Observatory, UC Santa Cruz, CA 95064 (United States)] [University of California Observatories-Lick Observatory, UC Santa Cruz, CA 95064 (United States); Howk, J. C. [Department of Physics, University of Notre Dame, 225 Nieuwland Science Hall, Notre Dame, IN 46556 (United States)] [Department of Physics, University of Notre Dame, 225 Nieuwland Science Hall, Notre Dame, IN 46556 (United States); Jenkins, E. B. [Princeton University Observatory, Peyton Hall, Ivy Lane, Princeton, NJ 08544 (United States)] [Princeton University Observatory, Peyton Hall, Ivy Lane, Princeton, NJ 08544 (United States); Lehner, N.; Sembach, K. R. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States)] [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States)

    2013-04-10

    Using high-resolution, high signal-to-noise ultraviolet spectra of the z{sub em} = 0.9754 quasar PG1148+549 obtained with the Cosmic Origins Spectrograph (COS) on the Hubble Space Telescope, we study the physical conditions and abundances of Ne VIII+O VI absorption line systems at z{sub abs} = 0.68381, 0.70152, 0.72478. In addition to Ne VIII and O VI, absorption lines from multiple ionization stages of oxygen (O II, O III, O IV) are detected and are well aligned with the more highly ionized species. We show that these absorbers are multiphase systems including hot gas (T Almost-Equal-To 10{sup 5.7} K) that produces Ne VIII and O VI, and the gas metallicity of the cool phase ranges from Z = 0.3 Z{sub Sun} to supersolar. The cool ( Almost-Equal-To 10{sup 4} K) phases have densities n{sub H} Almost-Equal-To 10{sup -4} cm{sup -3} and small sizes (<4 kpc); these cool clouds are likely to expand and dissipate, and the Ne VIII may be within a transition layer between the cool gas and a surrounding, much hotter medium. The Ne VIII redshift density, dN/dz{approx}7{sup +7}{sub -3}, requires a large number of these clouds for every L > 0.1 L* galaxy and a large effective absorption cross section ({approx}> 100 kpc), and indeed, we find a star-forming {approx}L {sup *} galaxy at the redshift of the z{sub abs} = 0.72478 system, at an impact parameter of 217 kpc. Multiphase absorbers like these Ne VIII systems are likely to be an important reservoir of baryons and metals in the circumgalactic media of galaxies.

  3. A new investigation of electron neutrino appearance oscillations with improved sensitivity in the MiniBooNE+ experiment

    E-Print Network [OSTI]

    R. Dharmapalan; S. Habib; C. Jiang; I. Stancu; Z. Djurcic; R. A. Johnson; A. Wickremasinghe; G. Karagiorgi; M. H. Shaevitz; B. C. Brown; F. G. Garcia; R. Ford; W. Marsh; C. D. Moore; D. Perevalov; C. C. Polly; J. Grange; J. Mousseau; B. Osmanov; H. Ray; R. Cooper; R. Tayloe; R. Thornton; G. T. Garvey; W. Huelsnitz; W. C. Louis; C. Mauger; G. B. Mills; Z. Pavlovic; R. Van de Water; D. H. White; R. Imlay; M. Tzanov; B. P. Roe; A. A. Aguilar-Arevalo; T. Katori; P. Nienaber

    2013-10-02

    We propose the addition of scintillator to the existing MiniBooNE detector to allow a test of the neutral-current/charged-current (NC/CC) nature of the MiniBooNE low-energy excess. Scintillator will enable the reconstruction of 2.2 MeV $\\gamma$s from neutron-capture on protons following neutrino interactions. Low-energy CC interactions where the oscillation excess is observed should have associated neutrons with less than a 10% probability. This is in contrast to the NC backgrounds that should have associated neutrons in approximately 50% of events. We will measure these neutron fractions with $\

  4. MRI of the lung using hyperpolarized He-3 at very low magnetic field (3 mT)

    E-Print Network [OSTI]

    Bidinosti, C P; Tastevin, G; Vignaud, A; Nacher, P J

    2004-01-01

    Optical pumping of He-3 produces large (hyper) nuclear-spin polarizations independent of the magnetic resonance imaging (MRI) field strength. This allows lung MRI to be performed at reduced fields with many associated benefits, such as lower tissue susceptibility gradients and decreased power absorption rates. Here we present results of 2D imaging as well as accurate 1D gas diffusion mapping of the human lung using He-3 at very low field (3 mT). Furthermore, measurements of transverse relaxation in zero applied gradient are shown to accurately track pulmonary oxygen partial pressure, opening the way for novel imaging sequences.

  5. A polymorphism in metallothionein 1A (MT1A) is associated with cadmium-related excretion of urinary beta 2?microglobulin

    SciTech Connect (OSTI)

    Lei, Lijian; Department of Epidemiology, School of Public Health, Shanxi Medical University, Shanxi ; Chang, Xiuli; Rentschler, Gerda; Tian, Liting; Zhu, Guoying; Chen, Xiao; Jin, Taiyi; Broberg, Karin

    2012-12-15

    Objectives: Cadmium (Cd) toxicity of the kidney varies between individuals despite similar exposure levels. In humans Cd is mainly bound to metallothioneins (MT), which scavenge its toxic effects. Here we analyzed whether polymorphisms in MT genes MT1A and MT2A influence Cd-related kidney damage. Methods: In a cross-sectional study N = 512 volunteers were selected from three areas in South-Eastern China, which to varying degree were Cd-polluted from a smelter (control area [median Cd in urine U-Cd = 2.67 ?g/L], moderately [U-Cd = 4.23 ?g/L] and highly [U-Cd = 9.13 ?g/L] polluted areas). U-Cd and blood Cd (B-Cd) concentrations were measured by graphite-furnace atomic absorption spectrometry. MT1A rs11076161 (G/A), MT2A rs10636 (G/C) and MT2A rs28366003 (A/G) were determined by Taqman assays; urinary N-Acetyl-beta-(D)-Glucosaminidase (UNAG) by spectrometry, and urinary ?2-microglobulin (UB2M) by ELISA. Results: Higher B-Cd (natural log-transformed) with increasing number of MT1A rs11076161 A-alleles was found in the highly polluted group (p-value trend = 0.033; all p-values adjusted for age, sex, and smoking). In a linear model a significant interaction between rs11076161 genotype and B-Cd was found for UNAG (p = 0.001) and UB2M concentrations (p = 0.001). Carriers of the rs11076161 AA genotype showed steeper slopes for the associations between Cd in blood and natural log-transformed UB2M (? = 1.2, 95% CI 0.721.6) compared to GG carriers (? = 0.30, 95% CI 0.150.45). Also for UNAG (natural log-transformed) carriers of the AA genotype had steeper slopes (? = 0.55, 95% CI 0.270.84) compared to GG carriers (? = 0.018, 95% CI ? 0.790.11). Conclusions: MT1A rs11076161 was associated with B-Cd concentrations and Cd-induced kidney toxicity at high exposure levels. -- Highlights: ? Cadmium is toxic to the kidney but the susceptibility differs between individuals. ? The toxic effect of cadmium is scavenged by metallothioneins. ? A common variant of metallothionein 1A was genotyped in 512 cadmium exposed humans. ? Variant carriers of this polymorphism showed more kidney damage from cadmium. ? The frequency of these variants needs to be taken into account in risk assessment.

  6. BP Studentship* in the Department of Earth Sciences of the University of Oxford Tectonic evolution of the Parnaiba cratonic basin, NE Brazil

    E-Print Network [OSTI]

    of the Parnaiba cratonic basin, NE Brazil Supervisors: Prof. A. B. Watts and Dr. M. Daly (BP) * Subject to funding structure and petroleum play. The focus will be on the Parnaiba basin in NE Brazil, one of the world in Brazil and the UK, will involve the acquisition of seismic reflection and refraction profile data along

  7. Effect of supplementation on vitamin A and zinc nutriture of children in northeast (NE) Thailand

    SciTech Connect (OSTI)

    Udomkesmalee, E.; Dhanamitta, S.; Charoenklatkul, S.; Tantipopipat, S.; Banjong, O.; Rojroongwasinkul, N.; Kramer, T.R.; Smith, J.C. Jr. USDA, Beltsville, MD )

    1991-03-11

    Previous surveys of the nutritional status of young children in NE Thailand suggested that they may benefit from vitamin A (VA) and/or zinc (Zn) supplementation. 140 children, with low plasma retinol concentrations were entered in a double-blind study. They were randomized and supplemented with either VA, Zn, VA + Zn or placebo each weekday for 6 mos. All subjects consumed their usual diet that provided adequate protein, less than recommended calories, fat, Zn and VA. Biochemical indices of VA and Zn status increased significantly. The children had adequate VA liver stores as assessed by relative dose response. Zn supplementation resulted in improvement of vision restoration time in dim light using rapid dark adaptometry. VA and Zn synergistically normalized conjunctival epithelium after a 6 mo supplementation. Data suggest that functional improvements of populations with suboptimal VA and Zn nutriture can be accomplished by supplementation with {lt}2 times of RDA of these nutrients.

  8. Deep sea tests of a prototype of the KM3NeT digital optical module

    E-Print Network [OSTI]

    Adrin-Martnez, S; Aharonian, F; Aiello, S; Albert, A; Ameli, F; Anassontzis, E G; Anghinolfi, M; Anton, G; Anvar, S; Ardid, M; de Asmundis, R; Band, H; Barbarino, G; Barbarito, E; Barbato, F; Baret, B; Baron, S; Belias, A; Berbee, E; Berg, A M van den; Berkien, A; Bertin, V; Beurthey, S; van Beveren, V; Beverini, N; Biagi, S; Bianucci, S; Billault, M; Birbas, A; Rookhuizen, H Boer; Bormuth, R; Bouche, V; Bouhadef, B; Bourlis, G; Bouwhuis, M; Bozza, C; Bruijn, R; Brunner, J; Cacopardo, G; Caillat, L; Calamai, M; Calvo, D; Capone, A; Caramete, L; Caruso, F; Cecchini, S; Ceres, A; Cereseto, R; Champion, C; Chateau, F; Chiarusi, T; Christopoulou, B; Circella, M; Classen, L; Cocimano, R; Colonges, S; Coniglione, R; Cosquer, A; Costa, M; Coyle, P; Creusot, A; Curtil, C; Cuttone, G; D'Amato, C; D'Amico, A; De Bonis, G; De Rosa, G; Deniskina, N; Destelle, J -J; Distefano, C; Donzaud, C; Dornic, D; Dorosti-Hasankiadeh, Q; Drakopoulou7, E; Drouhin, D; Drury, L; Durand, D; Eberl, T; Eleftheriadis, C; Elsaesser, D; Enzenhofer, A; Fermani, P; Fusco, L A; Gajana, D; Gal, T; Galata, S; Gallo, F; Garufi, F; Gebyehu, M; Giordano, V; Gizani, N; Ruiz, R Gracia; Graf, K; Grasso, R; Grella, G; Grmek, A; Habel, R; van Haren, H; Heid, T; Heijboer, A; Heine, E; Henry, S; Hernandez-Rey, J J; Herold, B; Hevinga, M A; van der Hoek, M; Hofestadt, J; Hogenbirk, J; Hugon, C; Hosl, J; Imbesi, M; James, C; Jansweijer, P; Jochum, J; de Jong, M; Kadler, M; Kalekin, O; Kappes, A; Kappos, E; Katz, U; Kavatsyuk, O; Keller, P; Kieft, G; Koffeman, E; Kok, H; Kooijman, P; Koopstra, J; Korporaal, A; Kouchner, A; Koutsoukos, S; Kreykenbohm, I; Kulikovskiy, V; Lahmann, R; Lamare, P; Larosa, G; Lattuada, D; Provost, H Le; Leisos, A; Lenis, D; Leonora, E; Clark, M Lindsey; Liolios, A; Alvarez, C D Llorens; Lohner, H; Presti, D Lo; Louis, F; Maccioni, E; Mannheim, K; Manolopoulos, K; Margiotta, A; Maris, O; Markou, C; Martinez-Mora, J A; Martini, A; Masullo, R; Michael, T; Migliozzi, P; Migneco, E; Miraglia, A; Mollo, C; Mongelli, M; Morganti, M; Mos, S; Moudden, Y; Musico, P; Musumeci, M; Nicolaou, C; Nicolau, C A; Orlando, A; Orzelli, A; Papageorgiou, K; Papaikonomou, A; Papaleo, R; Pavalas, G E; Peek, H; Pellegrino, C; Pellegriti, M G; Perrina, C; Petridou, C; Piattelli, P; Popa, V; Pradier, Th; Priede, M; Puhlhofer, G; Pulvirenti, S; Racca, C; Raffaelli, F; Randazzo, N; Rapidis, P A; Razis, P; Real, D; Resvanis, L; Reubelt, J; Riccobene, G; Rovelli, A; Royon, J; Saldana, M; Samtleben, D F E; Sanguineti, M; Santangelo, A; Sapienza, P; Savvidis, I; Schmelling, J; Schnabel, J; Sedita, M; Seitz, T; Sgura, I; Simeone, F; Siotis, I; Sipala, V; Solazzo, M; Spitaleri, A; Spurio, M; Steijger, J; Stolarczyk, T; Stransky, D; Taiuti, M; Terreni, G; Tezier, D; Theraube, S; Thompson, L F; Timmer, P; Trapierakis, H I; Trasatti, L; Trovato, A; Tselengidou, M; Tsirigotis, A; Tzamarias, S; Tzamariudaki, E; Vallage, B; Van Elewyck, V; Vermeulen, J; Vernin, P; Viola, S; Vivolo, D; Werneke, P; Wiggers, L; Wilms, J; de Wolf, E; van Wooning, R H L; Yatkin, K; Zachariadou, K; Zonca, E; Zornoza, J D; Ziga, J; Zwart, A

    2014-01-01

    The first prototype of a photo-detection unit of the future KM3NeT neutrino telescope has been deployed in the deep waters of the Mediterranean Sea. This digital optical module has a novel design with a very large photocathode area segmented by the use of 31 three inch photomultiplier tubes. It has been integrated in the ANTARES detector for in-situ testing and validation. This paper reports on the first months of data taking and rate measurements. The analysis results highlight the capabilities of the new module design in terms of background suppression and signal recognition. The directionality of the optical module enables the recognition of multiple Cherenkov photons from the same $^{40}$K decay and the localization bioluminescent activity in the neighbourhood. The single unit can cleanly identify atmospheric muons and provide sensitivity to the muon arrival directions.

  9. Astrophysical S-factors for fusion reactions involving C, O, Ne and Mg isotopes

    E-Print Network [OSTI]

    M. Beard; A. V. Afanasjev; L. C. Chamon; L. R. Gasques; M. Wiescher; D. G. Yakovlev

    2010-02-03

    Using the Sao Paulo potential and the barrier penetration formalism we have calculated the astrophysical factor S(E) for 946 fusion reactions involving stable and neutron-rich isotopes of C, O, Ne, and Mg for center-of-mass energies E varying from 2 MeV to 18-30 MeV (covering the range below and above the Coulomb barrier). We have parameterized the energy dependence S(E) by an accurate universal 9-parameter analytic expression and present tables of fit parameters for all the reactions. We also discuss the reduced 3-parameter version of our fit which is highly accurate at energies below the Coulomb barrier, and outline the procedure for calculating the reaction rates. The results can be easily converted to thermonuclear or pycnonuclear reaction rates to simulate various nuclear burning phenomena, in particular, stellar burning at high temperatures and nucleosynthesis in high density environments.

  10. LOCA simulation in the national research universal reactor program: postirradiation examination results for the third materials experiment (MT-3)

    SciTech Connect (OSTI)

    Rausch, W.N.

    1984-04-01

    A series of in-reactor experiments were conducted using full-length 32-rod pressurized water reactor (PWR) fuel bundles as part of the Loss-of-Coolant Accident (LOCA) Simulation Program. The third materials experiment (MT-3) was the sixth in the series of thermal-hydraulic and materials deformation/rutpure experiments conducted in the National Research Universal (NRU) reactor, Chalk River, Ontario, Canada. The main objective of the experiment was to evaluate ballooning and rupture during active two-phase cooling in the temperature range from 1400 to 1500/sup 0/F (1030 to 1090 K). The 12 test rods in the center of the 32-rod bundle were initially pressurized to 550 psi (3.8 MPa) to insure rupture in the correct temperature range. All 12 of the rods ruptured, with an average peak bundle strain of approx. 55%. The UKAEA also funded destructive postirradiation examination (PIE) of several of the ruptured rods from the MT-3 experiment. This report describes the work performed and presents the PIE results. Information obtained during the PIE included cladding thickness measurements metallography, and particle size analysis of the cracked and broken fuel pellets.

  11. Searches for supersymmetry using the MT2 variable in hadronic events produced in pp collisions at 8 TeV

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Khachatryan, V.

    2015-05-15

    Searches for supersymmetry (SUSY) are performed using a sample of hadronic events produced in 8 TeV pp collisions at the CERN LHC. The searches are based on the MT2 variable, which is a measure of the transverse momentum imbalance in an event. The data were collected with the CMS detector and correspond to an integrated luminosity of 19.5 fb?. Two related searches are performed. The first is an inclusive search based on signal regions defined by the value of the MT2 variable, the hadronic energy in the event, the jet multiplicity, and the number of jets identified as originating frommorebottom quarks. The second is a search for a mass peak corresponding to a Higgs boson decaying to a bottom quark-antiquark pair, where the Higgs boson is produced as a decay product of a SUSY particle. For both searches, the principal backgrounds are evaluated with data control samples. No significant excess over the expected number of background events is observed, and exclusion limits on various SUSY models are derived.less

  12. Using MiniBooNE neutral current elastic cross section results to constrain 3+1 sterile neutrino models

    E-Print Network [OSTI]

    Callum Wilkinson; Susan Cartwright; Lee Thompson

    2014-01-10

    The MiniBooNE Neutral Current Elastic (NCEL) cross section results are used to extract limits in the $\\Delta m^{2}-\\sin^{2}\\vartheta_{\\mu s}$ plane for a 3+1 sterile neutrino model with a mass splitting $0.1 \\leq \\Delta m^{2} \\leq 10.0$ eV$^{2}$. GENIE is used with a cross section model close to the one employed by MiniBooNE to make event rate predictions using simulations on the MiniBooNE target material CH$_{2}$. The axial mass is a free parameter in all fits. Sterile modifications to the flux and changes to the cross section in the simulation relate the two and allow limits to be set on sterile neutrino mixing using cross section results. The large axial mass problem makes it necessary for experiments to perform their own axial mass fits, but a prior fit to the same dataset could mask a sterile oscillation signal if the sterile and cross section model parameters are not independent. We find that for the NCEL dataset there are significant correlations between the sterile and cross section model parameters, making a fit to both models simultaneously necessary to get robust results. Failure to do this results in stronger than warranted limits on the sterile parameters. The general problems that the current uncertainty on charged-current quasi-elastic (CCQE) and NCEL cross sections at MiniBooNE energies pose for sterile neutrino measurements are discussed.

  13. 6 JUNE 2014 VOL 344 ISSUE 6188 1095SCIENCE sciencemag.org ne reason for the use of biofuels is

    E-Print Network [OSTI]

    Napp, Nils

    6 JUNE 2014 VOL 344 ISSUE 6188 1095SCIENCE sciencemag.org O ne reason for the use of biofuels good and bad outcomes, depending on the approach (1). Thus, comments about biofuels in recent reports of indirect land-use change on GHG emissions (5) identified the possibility that biofuels may endan- ger

  14. Measurements of nuclear $?$-ray line emission in interactions of protons and $?$ particles with N, O, Ne and Si

    E-Print Network [OSTI]

    H. Benhabiles-Mezhoud; J. Kiener; J. -P. Thibaud; V. Tatischeff; I. Deloncle; A. Coc; J. Duprat; C. Hamadache; A. Lefebvre-Schuhl; J. -C. Dalouzy; F. De Grancey; F. De Oliveira; F. Dayras; N. De Srville; M. -G. Pellegriti; L. Lamia; S. Ouichaoui

    2010-11-11

    $\\gamma$-ray production cross sections have been measured in proton irradiations of N, Ne and Si and $\\alpha$-particle irradiations of N and Ne. In the same experiment we extracted also line shapes for strong $\\gamma$-ray lines of $^{16}$O produced in proton and $\\alpha$-particle irradiations of O. For the measurements gas targets were used for N, O and Ne and a thick foil was used for Si. All targets were of natural isotopic composition. Beams in the energy range up to 26 MeV for protons and 39 MeV for $\\alpha$-particles have been delivered by the IPN-Orsay tandem accelerator. The $\\gamma$ rays have been detected with four HP-Ge detectors in the angular range 30$^{\\circ}$ to 135$^{\\circ}$. We extracted 36 cross section excitation functions for proton reactions and 14 for $\\alpha$-particle reactions. For the majority of the excitation functions no other data exist to our knowledge. Where comparison with existing data was possible usually a very good agreement was found. It is shown that these data are very interesting for constraining nuclear reaction models. In particular the agreement of cross section calculations in the nuclear reaction code TALYS with the measured data could be improved by adjusting the coupling schemes of collective levels in the target nuclei $^{14}$N, $^{20,22}$Ne and $^{28}$Si. The importance of these results for the modeling of nuclear $\\gamma$-ray line emission in astrophysical sites is discussed.

  15. Fingerprints of the nodal structure of autoionizing vibrational wave functions in clusters: Interatomic Coulombic decay in Ne dimer

    E-Print Network [OSTI]

    Moiseyev, Nimrod

    Fingerprints of the nodal structure of autoionizing vibrational wave functions in clusters of Nonlinear Physics in Complex Systems, Technion--Israel Institute of Technology, Haifa 32000, Israel Robin the autoionizing electron or the Ne kinetic energy distributions. This phenomenon is associated with the properties

  16. Demonstration Assessment of LED Roadway Lighting: NE Cully Boulevard Portland, OR

    SciTech Connect (OSTI)

    Royer, Michael P.; Poplawski, Michael E.; Tuenge, Jason R.

    2012-06-29

    A new roadway lighting demonstration project was initiated in late 2010, which was planned in conjunction with other upgrades to NE Cully Boulevard, a residential collector road in the northeast area of Portland, OR. With the NE Cully Boulevard project, the Portland Bureau of Transportation hoped to demonstrate different light source technologies and different luminaires side-by-side. This report documents the initial performance of six different newly installed luminaires, including three LED products, one induction product, one ceramic metal halide product, and one high-pressure sodium (HPS) product that represented the baseline solution. It includes reported, calculated, and measured performance; evaluates the economic feasibility of each of the alternative luminaires; and documents user feedback collected from a group of local Illuminating Engineering Society (IES) members that toured the site. This report does not contain any long-term performance evaluations or laboratory measurements of luminaire performance. Although not all of the installed products performed equally, the alternative luminaires generally offered higher efficacy, more appropriate luminous intensity distributions, and favorable color quality when compared to the baseline HPS luminaire. However, some products did not provide sufficient illumination to all areasvehicular drive lanes, bicycle lanes, and sidewalksor would likely fail to meet design criteria over the life of the installation due to expected depreciation in lumen output. While the overall performance of the alternative luminaires was generally better than the baseline HPS luminaire, cost remains a significant barrier to widespread adoption. Based on the cost of the small quantity of luminaires purchased for this demonstration, the shortest calculated payback period for one of the alternative luminaire types was 17.3 years. The luminaire prices were notably higher than typical prices for currently available luminaires purchased in larger quantities. At prices that are more typical, the payback would be less than 10 years. In addition to the demonstration luminaires, a networked control system was installed for additional evaluation and demonstration purposes. The capability of control system to measure luminaire input power was explored in this study. A more exhaustive demonstration and evaluation of the control system will be the subject of future GATEWAY report(s).

  17. Soil Science Society of America Journal This work was presented at the 12th North American Forest Soils Conference, Whitefish, MT, 1620

    E-Print Network [OSTI]

    Martin, Timothy

    Soils Conference, Whitefish, MT, 1620 June 2013, in the Production Systems for Biomass and Bioenergy silvicultural practices used, and when combined with suitable site preparation techniques and the deployment fourfold higher aboveground pine biomass than the C treatment (7.7 Mg ha-1); the untreated CF (17.9 Mg ha-1

  18. NEAFS Y-mtDNA Workshop (Butler and Coble) November 1, 2006 http://www.cstl.nist.gov/biotech/strbase/training.htm 1

    E-Print Network [OSTI]

    NEAFS Y-mtDNA Workshop (Butler and Coble) November 1, 2006 http://www.cstl.nist.gov/biotech textbook (now in its 2nd Edition) STRBase website: http://www.cstl.nist.gov/biotech/strbase/ Family: wife Terilynne and 6 children Hobbies: reading and writing http://www.cstl.nist.gov/biotech

  19. Comment on ``A modified leapfrog scheme for shallow water equations'' by Wen-Yih Sun and Oliver M.T. Sun

    E-Print Network [OSTI]

    Williams, Paul

    Commentary Comment on ``A modified leapfrog scheme for shallow water equations'' by Wen-Yih Sun and Oliver M.T. Sun Paul D. Williams Department of Meteorology, University of Reading, UK a r t i c l e i n f integration of the shallow-water equa- tions using the leapfrog time-stepping scheme [Sun Wen-Yih, Sun Oliver

  20. Compact NE213 neutron spectrometer with high energy resolution for fusion applications

    SciTech Connect (OSTI)

    Zimbal, A.; Reginatto, M.; Schuhmacher, H.; Bertalot, L.; Esposito, B.; Poli, F.; Adams, J.M.; Popovichev, S.; Kiptily, V.; Murari, A. [Physikalisch-Technische Bundesanstalt, Bundesalleee 100, D-38116 Braunschweig (Germany); Associazione Euratom-ENEA sulla Fusione, C.R. Frascati, C.P. 65, Frascati, I-00044, Roma (Italy); Association Euratom-UKAEA Fusion, Culham Science Center, Abingdon, OX14 3DB (United Kingdom); Consorzio RFX--Associazione Euratom-ENEA sulla Fusione, Corso Stati Uniti 4, 35127 Padua (Italy)

    2004-10-01

    Neutron spectrometry is a tool for obtaining important information on the fuel ion composition, velocity distribution and temperature of fusion plasmas. A compact NE213 liquid scintillator, fully characterized at Physikalisch-Technische Bundesanstalt, was installed and operated at the Joint European Torus (JET) during two experimental campaigns (C8-2002 and trace tritium experiment-TTE 2003). The results show that this system can operate in a real fusion experiment as a neutron (1.5 MeV

  1. Signal Processing in the MicroBooNE LArTPC

    E-Print Network [OSTI]

    Joshi, Jyoti

    2015-01-01

    The MicroBooNE experiment is designed to observe interactions of neutrinos with a Liquid Argon Time Projection Chamber (LArTPC) detector from the on-axis Booster Neutrino Beam (BNB) and off-axis Neutrinos at the Main Injector (NuMI) beam at Fermi National Accelerator Laboratory. The detector consists of a $2.5~m\\times 2.3~m\\times 10.4~m$ TPC including an array of 32 PMTs used for triggering and timing purposes. The TPC is housed in an evacuable and foam insulated cryostat vessel. It has a 2.5 m drift length in a uniform field up to 500 V/cm. There are 3 readout wire planes (U, V and Y co-ordinates) with a 3-mm wire pitch for a total of 8,256 signal channels. The fiducial mass of the detector is 60 metric tons of LAr. In a LArTPC, ionization electrons from a charged particle track drift along the electric field lines to the detection wire planes inducing bipolar signals on the U and V (induction) planes, and a unipolar signal collected on the (collection) Y plane. The raw wire signals are processed by speciali...

  2. Improved Search for ??????e Oscillations in the MiniBooNE Experiment

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Aguilar-Arevalo, A. A.; Brown, B. C.; Bugel, L.; Cheng, G.; Church, E. D.; Conrad, J. M.; Dharmapalan, R.; Djurcic, Z.; Finley, D. A.; Ford, R.; et al

    2013-04-15

    The MiniBooNE experiment at Fermilab reports results from an analysis of ?e appearance data from 11.2710? protons on target in the antineutrino mode, an increase of approximately a factor of 2 over the previously reported results. An event excess of 78.428.5 events (2.8?) is observed in the energy range 200QE????e, the best oscillation fit to the excess has a probability of 66% while the background-only fit has a ? probability of 0.5% relative to the best fit. The data are consistent with antineutrino oscillations in the 0.01moresome overlap with the evidence for antineutrino oscillations from the Liquid Scintillator Neutrino Detector. All of the major backgrounds are constrained by in situ event measurements so nonoscillation explanations would need to invoke new anomalous background processes. The neutrino mode running also shows an excess at low energy of 162.047.8 events (3.4?) but the energy distribution of the excess is marginally compatible with a simple two neutrino oscillation formalism. Expanded models with several sterile neutrinos can reduce the incompatibility by allowing for CP violating effects between neutrino and antineutrino oscillations.less

  3. Proposal of a new generation of Laser Beacon for time calibration in the KM3NeT neutrino telescope

    SciTech Connect (OSTI)

    Real, Diego [IFIC, Instituto de Fsica Corpuscular, CSIC-Universidad de Valencia, C Collaboration: KM3NeT Collaboration

    2014-11-18

    The KM3NeT collaboration aims at the construction of a multi-km3 high-energy neutrino telescope in the Mediterranean Sea consisting of a matrix of pressure resistant glass spheres holding each a set (31) of small area photomultipliers. The main motivation of the telescope is to observe cosmic neutrinos through the Cherenkov light induced in sea water by charged particles produced in neutrino interactions with the surrounding medium. A relative time calibration between photomultipliers of the order of 1 ns is required to achieve an optimal performance. To this end, several time calibration subsystems have been developed. In this article, the proposal of a last generation Laser Beacon, to be used in KM3NeT and developed to measure and monitor the relative time offsets between photomultipliers, is presented.

  4. High Level Requirements for the Nuclear Energy -- Knowledge Base for Advanced Modeling and Simulation (NE-KAMS)

    SciTech Connect (OSTI)

    Rich Johnson; Hyung Lee; Kimberlyn C. Mousseau

    2011-09-01

    The US Department of Energy, Office of Nuclear Energy (DOE-NE), has been tasked with the important mission of ensuring that nuclear energy remains a compelling and viable energy source in the U.S. The motivations behind this mission include cost-effectively meeting the expected increases in the power needs of the country, reducing carbon emissions and reducing dependence on foreign energy sources. In the near term, to ensure that nuclear power remains a key element of U.S. energy strategy and portfolio, the DOE-NE will be working with the nuclear industry to support safe and efficient operations of existing nuclear power plants. In the long term, to meet the increasing energy needs of the U.S., the DOE-NE will be investing in research and development (R&D) and working in concert with the nuclear industry to build and deploy new, safer and more efficient nuclear power plants. The safe and efficient operations of existing nuclear power plants and designing, licensing and deploying new reactor designs, however, will require focused R&D programs as well as the extensive use and leveraging of advanced modeling and simulation (M&S). M&S will play a key role in ensuring safe and efficient operations of existing and new nuclear reactors. The DOE-NE has been actively developing and promoting the use of advanced M&S in reactor design and analysis through its R&D programs, e.g., the Nuclear Energy Advanced Modeling and Simulation (NEAMS) and Consortium for Advanced Simulation of Light Water Reactors (CASL) programs. Also, nuclear reactor vendors are already using CFD and CSM, for design, analysis, and licensing. However, these M&S tools cannot be used with confidence for nuclear reactor applications unless accompanied and supported by verification and validation (V&V) and uncertainty quantification (UQ) processes and procedures which provide quantitative measures of uncertainty for specific applications. The Nuclear Energy Knowledge base for Advanced Modeling and Simulation (NE-KAMS) is being developed at the Idaho National Laboratory in conjunction with Bettis Laboratory, Sandia National Laboratories, Argonne National Laboratory, Utah State University and others with the objective of establishing a comprehensive and web-accessible knowledge base that will provide technical services and resources for V&V and UQ of M&S in nuclear energy sciences and engineering. The knowledge base will serve as an important resource for technical exchange and collaboration that will enable credible and reliable computational models and simulations for application to nuclear reactor design, analysis and licensing. NE-KAMS will serve as a valuable resource for the nuclear industry, academia, the national laboratories, the U.S. Nuclear Regulatory Commission (NRC) and the public and will help ensure the safe, economical and reliable operation of existing and future nuclear reactors. From its inception, NE-KAMS will directly support nuclear energy research, development and demonstration programs within the U.S. Department of Energy (DOE), including the CASL, NEAMS, Light Water Reactor Sustainability (LWRS), Small Modular Reactors (SMR), and Next Generation Nuclear Power Plant (NGNP) programs. These programs all involve M&S of nuclear reactor systems, components and processes, and it is envisioned that NE-KAMS will help to coordinate and facilitate collaboration and sharing of resources and expertise for V&V and UQ across these programs.

  5. Investigation of complete and incomplete fusion dynamics of {sup 20}Ne induced reactions at energies above the Coulomb barrier

    SciTech Connect (OSTI)

    Singh, D., E-mail: dsinghiuac@gmail.com [Centre for Applied Physics, Central University of Jharkhand, Ranchi-835 205 (India); Ali, R. [Department of Physics, G.F.(P.G.), College, Shahjahanpur-242 001 (India); Kumar, Harish; Ansari, M. Afzal [Department of Physics, Aligarh Muslim University, Aligarh-202 002 (India); Rashid, M. H.; Guin, R. [Variable Energy Cyclotron Centre, 1/AF, Bidhan Nagar, Kolkata-700 064 (India)

    2014-08-14

    Experiment has been performed to explore the complete and incomplete fusion dynamics in heavy ion collisions using stacked foil activation technique. The measurement of excitation functions of the evaporation residues produced in the {sup 20}Ne+{sup 165}Ho system at projectile energies ranges ? 4-8 MeV/nucleon have been done. Measured cumulative and direct cross-sections have been compared with the theoretical model code PACE-2, which takes into account only the complete fusion process. The analysis indicates the presence of contributions from incomplete fusion processes in some ?-emission channels following the break-up of the projectile {sup 20}Ne in the nuclear field of the target nucleus {sup 165}Ho.

  6. Comment on "15O(alpha,gamma)19Ne Breakout Reaction and Impact on X-Ray Bursts"

    E-Print Network [OSTI]

    B. Davids

    2008-04-12

    A recently published letter reports a measurement of alpha decay from states in 19Ne at excitation energies below 4.5 MeV. The measured alpha decay branching ratios B_alpha are used to calculate the astrophysical rate of the 15O(alpha,gamma)19Ne reaction and to draw conclusions regarding the transition between steady state and unstable nuclear burning on accreting neutron stars. Here I show that the calculated astrophysical reaction rate is based on an unreliable value of B_alpha for the 4.03 MeV state and point out a serious internal inconsistency in the letter's treatment of low statistics alpha decay measurements.

  7. NE]NL~GY r. ORNL/Sub/80-1 386/ &02 C)aS^" B ~Assessment of Internal Combustion

    E-Print Network [OSTI]

    Oak Ridge National Laboratory

    NE]NL~GY r. ORNL/Sub/80-1 386/ &02 C)aS^" B ~Assessment of Internal Combustion LAn COMBUSTION ENGINES AS DRIVERS FOR HEAT PUMPS FINAL REPORT Date Published: January 1984 Report Prepared

  8. Improvements in the M-T relation and mass function and the measured Omega_m through clusters evolution

    E-Print Network [OSTI]

    A. Del Popolo

    2003-09-05

    In this paper, I revisit the constraints obtained by several authors (Reichart et al. 1999; Eke et al. 1998; Henry 2000) on the estimated values of Omega_m, n and sigma_8 in the light of recent theoretical developments: 1) new theoretical mass functions (Sheth & Tormen 1999, Sheth, Mo & Tormen 1999, Del Popolo 2002b); 2) a more accurate mass-temperature relation, also determined for arbitrary Omega_m and Omega_{\\Lambda} (Voit 2000, Pierpaoli et al. 2001, Del Popolo 2002a). Firstly, using the quoted improvements, I re-derive an expression for the X-ray Luminosity Function (XLF), similarly to Reichart et al. (1999), and then I get some constraints to \\Omega_m and n, by using the ROSAT BCS and EMSS samples and maximum-likelihood analysis. Then I re-derive the X-ray Temperature Function (XTF), similarly to Henry (2000) and Eke et al. (1999), re-obtaining the constraints on Omega_m, n, sigma_8. Both in the case of the XLF and XTF, the changes in the mass function and M-T relation produces an increase in Omega_m of \\simeq 20% and similar results in sigma_8 and n.

  9. A Complete Solution Classification and Unified Algorithmic Treatment for the One- and Two-Step Asymmetric S-Transverse Mass (MT2) Event Scale Statistic

    E-Print Network [OSTI]

    Joel W. Walker

    2014-08-29

    The MT2 or "s-transverse mass" statistic was developed to associate a parent mass scale to a missing transverse energy signature, given that escaping particles are generally expected in pairs, while collider experiments are sensitive to just a single transverse momentum vector sum. This document focuses on the generalized extension of that statistic to asymmetric one- and two-step decay chains, with arbitrary child particle masses and upstream missing transverse momentum. It provides a unified theoretical formulation, complete solution classification, taxonomy of critical points, and technical algorithmic prescription for treatment of the MT2 event scale. An implementation of the described algorithm is available for download, and is also a deployable component of the author's selection cut software package AEACuS (Algorithmic Event Arbiter and Cut Selector). Appendices address combinatoric event assembly, algorithm validation, and a complete pseudocode.

  10. Probing the Mechanism of the Mycobacterium tuberculosis [beta]-Ketoacyl-Acyl Carrier Protein Synthase III mtFabH: Factors Influencing Catalysis and Substrate Specificity

    SciTech Connect (OSTI)

    Brown, Alistair K.; Sridharan, Sudharsan; Kremer, Laurent; Lindenberg, Sandra; Dover, Lynn G.; Sacchettini, James C.; Besra, Gurdyal S.

    2010-11-30

    Mycolic acids are the dominant feature of the Mycobacterium tuberculosis cell wall. These {alpha}-alkyl, {beta}-hydroxy fatty acids are formed by the condensation of two fatty acids, a long meromycolic acid and a shorter C{sub 24}-C{sub 26} fatty acid. The component fatty acids are produced via a combination of type I and II fatty acid synthases (FAS) with FAS-I products being elongated by FAS-II toward meromycolic acids. The {beta}-ketoacyl-acyl carrier protein (ACP) synthase III encoded by mtfabH (mtFabH) links FAS-I and FAS-II, catalyzing the condensation of FAS-I-derived acyl-CoAs with malonyl-acyl carrier protein (ACP). The acyl-CoA chain length specificity of mtFabH was assessed in vitro; the enzyme extended longer, physiologically relevant acyl-CoA primers when paired with AcpM, its natural partner, than with Escherichia coli ACP. The ability of the enzyme to use E. coli ACP suggests that a similar mode of binding is likely with both ACPs, yet it is clear that unique factors inherent to AcpM modulate the substrate specificity of mtFabH. Mutation of proposed key mtFabH residues was used to define their catalytic roles. Substitution of supposed acyl-CoA binding residues reduced transacylation, with double substitutions totally abrogating activity. Mutation of Arg{sup 46} revealed its more critical role in malonyl-AcpM decarboxylation than in the acyl-CoA binding role. Interestingly, this effect was suppressed intragenically by Arg{sup 161} {yields} Ala substitution. Our structural studies suggested that His{sup 258}, previously implicated in malonyl-ACP decarboxylation, also acts as an anchor point for a network of water molecules that we propose promotes deprotonation and transacylation of Cys{sup 122}.

  11. Angular momentum exchange by gravitational torques and infall in the circumbinary disk of the protostellar system L1551 NE

    SciTech Connect (OSTI)

    Takakuwa, Shigehisa; Ho, Paul T. P. [Academia Sinica Institute of Astronomy and Astrophysics, P.O. Box 23-141, Taipei 10617, Taiwan (China); Saito, Masao [Joint ALMA Observatory, Ave. Alonso de Cordova 3107, Vitacura, Santiago (Chile); Saigo, Kazuya [ALMA Project Office, National Astronomical Observatory of Japan, Osawa 2-21-1, Mitaka, Tokyo 181-8588 (Japan); Matsumoto, Tomoaki [Faculty of Humanity and Environment, Hosei University, Chiyoda-ku, Tokyo 102-8160 (Japan); Lim, Jeremy [Department of Physics, University of Hong Kong, Pokfulam Road (Hong Kong); Hanawa, Tomoyuki, E-mail: takakuwa@asiaa.sinica.edu.tw [Center for Frontier Science, Chiba University, Inage-ku, Chiba 263-8522 (Japan)

    2014-11-20

    We report an ALMA observation of the Class I binary protostellar system L1551 NE in the 0.9 mm continuum, C{sup 18}O (3-2), and {sup 13}CO (3-2) lines at a ?1.6 times higher resolution and a ?6 times higher sensitivity than those of our previous SubMillimeter Array (SMA) observations, which revealed a r ? 300 AU scale circumbinary disk in Keplerian rotation. The 0.9 mm continuum shows two opposing U-shaped brightenings in the circumbinary disk and exhibits a depression between the circumbinary disk and the circumstellar disk of the primary protostar. The molecular lines trace non-axisymmetric deviations from Keplerian rotation in the circumbinary disk at higher velocities relative to the systemic velocity, where our previous SMA observations could not detect the lines. In addition, we detect inward motion along the minor axis of the circumbinary disk. To explain the newly observed features, we performed a numerical simulation of gas orbits in a Roche potential tailored to the inferred properties of L1551 NE. The observed U-shaped dust features coincide with locations where gravitational torques from the central binary system are predicted to impart angular momentum to the circumbinary disk, producing shocks and hence density enhancements seen as a pair of spiral arms. The observed inward gas motion coincides with locations where angular momentum is predicted to be lowered by the gravitational torques. The good agreement between our observation and model indicates that gravitational torques from the binary stars constitute the primary driver for exchanging angular momentum so as to permit infall through the circumbinary disk of L1551 NE.

  12. Investigation of thermonuclear $^{18}$Ne($?$,$p$)$^{21}$Na rate via resonant elastic scattering of $^{21}$Na+$p$

    E-Print Network [OSTI]

    L. Y. Zhang; J. J. He; A. Parikh; S. W. Xu; H. Yamaguchi; D. Kahl; S. Kubono; P. Mohr; J. Hu; P. Ma; S. Z. Chen; Y. Wakabayashi; H. W. Wang; W. D. Tian; R. F. Chen; B. Guo; T. Hashimoto; Y. Togano; S. Hayakawa; T. Teranishi; N. Iwasa; T. Yamada; T. Komatsubara; Y. H. Zhang; X. H. Zhou

    2014-03-19

    The $^{18}$Ne($\\alpha$,$p$)$^{21}$Na reaction is thought to be one of the key breakout reactions from the hot CNO cycles to the rp-process in type I x-ray bursts. In this work, the resonant properties of the compound nucleus $^{22}$Mg have been investigated by measuring the resonant elastic scattering of $^{21}$Na+$p$. An 89 MeV $^{21}$Na radioactive beam delivered from the CNS Radioactive Ion Beam Separator bombarded an 8.8 mg/cm$^2$ thick polyethylene (CH$_{2}$)$_{n}$ target. The $^{21}$Na beam intensity was about 2$\\times$10$^{5}$ pps, with a purity of about 70% on target. The recoiled protons were measured at the center-of-mass scattering angles of $\\theta_{c.m.}$$\\approx$175.2${^\\circ}$, 152.2${^\\circ}$, and 150.5${^\\circ}$ by three sets of $\\Delta E$-$E$ telescopes, respectively. The excitation function was obtained with the thick-target method over energies $E_x$($^{22}$Mg)=5.5--9.2 MeV. In total, 23 states above the proton-threshold in $^{22}$Mg were observed, and their resonant parameters were determined via an $R$-matrix analysis of the excitation functions. We have made several new $J^{\\pi}$ assignments and confirmed some tentative assignments made in previous work. The thermonuclear $^{18}$Ne($\\alpha$,$p$)$^{21}$Na rate has been recalculated based on our recommended spin-parity assignments. The astrophysical impact of our new rate has been investigated through one-zone postprocessing x-ray burst calculations. We find that the $^{18}$Ne($\\alpha$,$p$)$^{21}$Na rate significantly affects the peak nuclear energy generation rate, reaction fluxes, as well as the onset temperature of this breakout reaction in these astrophysical phenomena.

  13. Structural and tectonic implications of pre-Mt. Simon strata -- or a lack of such -- in the western part of the Illinois basin

    SciTech Connect (OSTI)

    Sargent, M.L. (Illinois State Geological Survey, Champaign, IL (United States))

    1993-03-01

    The discovery of a pre-Mt. Simon lithic arenite (arkose) in southwestern Ohio has lead to reevaluation of many basement tests in the region. Several boreholes in adjacent states have been reexamined by others and are now believed to bottom in the Middle Run Formation. Seismic-reflection sections in western Ohio and Indiana have indicated pre-Mt. Simon basins filled with layered rocks that are interpreted to be Middle Run, however, the pre-Mt. Simon basins and east of Illinois. Samples from Illinois basement tests were reexamined to determine whether they had encountered similar strata. All reported crystalline-basement tests in Illinois show diagnostic igneous textures and mineralogical associations. Coarsely crystalline samples in cores show intergrown subhedral grains of quartz, microcline, and sodic plagioclase. Medium-crystalline rocks in cuttings samples show numerous examples of micrographic intergrowths of quartz and K-feldspar. This texture cannot be authigenically grown in a sediment and probably could not have survived a single cycle of erosion and deposition. Aphanitic rocks show porphyritic and spherulitic textures that are distinctly igneous and would be destroyed by weathering. Substantial relief on the Precambrian crystalline surface in Illinois is postulated for major structural features like the LaSalle Anticlinorium, the Sparta Shelf, the Ste. Genevieve Fault zone, etc. Paleotopographic relief up to 300 m (1,000 feet) is documented from drilling on the western flank of the basin.

  14. Transfer mechanism in /sup 16/O+/sup 24/Mg and /sup 20/Ne+/sup 24/Mg elastic scattering

    SciTech Connect (OSTI)

    NING Ping-Zhi; GAO Cheng-Qun; HE Guo-Zhu

    1985-10-01

    The mechanism of transferring a cluster of nucleons between two colliding nuclei is considered to explain the backward angle oscillatory rise in the differential cross section of the elastic scattering between certain nuclei, such as /sup 16/O+/sup 24/Mg or /sup 20/Ne+/sup 24/Mg. The nuclear molecular orbit approximation theory is applied. For one-step transfer, if the parameter involved is assumed to be adjustable, the numerical calculations can be made to fit the experimental results naturally.

  15. Search for a Direct Large-Cluster-Transfer Process in the C-12,c-13(ne-20,a) Reaction

    E-Print Network [OSTI]

    Murakami, T.; Takahashi, N.; Lui, YW; Takada, E.; Tanner, D. M.; Tribble, Robert E.; Ungricht, E.; Nagatani, K.

    1985-01-01

    of the present calcula- tion might have an uncertainty more than 20%. It should be noted that the statistical yrast-line model'4 with the parameters ra=1.15 fm, 60 =12.5 MeV, which we used for the ' C(' O,a) reaction, predicts l, = 21.5t for the '2C(20Ne, a... initiated by the exper- imental discovery of broad peaks in the continuum region of the '2C('60, o.) reaction. ' Since the excitation energies of those peaks were closely correlated to energies of the ' C+' C intermediate, or nuclear molecular resonances...

  16. A Measurement of the muon neutrino charged current quasielastic interaction and a test of Lorentz violation with the MiniBooNE experiment

    SciTech Connect (OSTI)

    Katori, Teppei; /Indiana U.

    2008-12-01

    The Mini-Booster neutrino experiment (MiniBooNE) at Fermi National Accelerator Laboratory (Fermilab) is designed to search for {nu}{sub {mu}} {yields} {nu}{sub e} appearance neutrino oscillations. Muon neutrino charged-current quasi-elastic (CCQE) interactions ({nu}{sub {mu}} + n {yields} {mu} + p) make up roughly 40% of our data sample, and it is used to constrain the background and cross sections for the oscillation analysis. Using high-statistics MiniBooNE CCQE data, the muon-neutrino CCQE cross section is measured. The nuclear model is tuned precisely using the MiniBooNE data. The measured total cross section is {sigma} = (1.058 {+-} 0.003 (stat) {+-} 0.111 (syst)) x 10{sup -38} cm{sup 2} at the MiniBooNE muon neutrino beam energy (700-800 MeV). {nu}{sub e} appearance candidate data is also used to search for Lorentz violation. Lorentz symmetry is one of the most fundamental symmetries in modern physics. Neutrino oscillations offer a new method to test it. We found that the MiniBooNE result is not well-described using Lorentz violation, however further investigation is required for a more conclusive result.

  17. Effects of initial state fluctuations in the final state elliptic flow measurements using the NeXSPheRIO model

    E-Print Network [OSTI]

    Rafael Derradi de Souza; Jun Takahashi; Takeshi Kodama; Paul Sorensen

    2012-04-27

    We present a systematic study of the effects due to initial condition fluctuations in systems formed by heavy-ion collisions using the hydrodynamical simulation code NeXSPheRIO. The study was based on a sample of events generated simulating Au+Au collisions at center of mass energy of 200 GeV per nucleon pair with impact parameter ranging from most central to peripheral collisions. The capability of the NeXSPheRIO code to control and save the initial condition (IC) as well as the final state particles after the 3D hydrodynamical evolution allows for the investigation of the sensitivity of the experimental observables to the characteristics of the early IC. Comparisons of results from simulated events generated using fluctuating initial conditions and smooth initial condition are presented for the experimental observable elliptic flow parameter ($v_2$) as a function of the transverse momentum, $p_t$, and centrality. We compare $v_2$ values estimated using different methods, and how each method responds to effects of fluctuations in the initial condition. Finally, we quantify the flow fluctuations and compare to the fluctuations of the initial eccentricity of the energy density distribution in the transverse plane.

  18. Forward fitting of experimental data from a NE213 neutron detector installed with the magnetic proton recoil upgraded spectrometer at JET

    SciTech Connect (OSTI)

    Binda, F. Ericsson, G.; Eriksson, J.; Hellesen, C.; Conroy, S.; Sundn, E. Andersson; Collaboration: JET-EFDA Team

    2014-11-15

    In this paper, we present the results obtained from the data analysis of neutron spectra measured with a NE213 liquid scintillator at JET. We calculated the neutron response matrix of the instrument combining MCNPX simulations, a generic proton light output function measured with another detector and the fit of data from ohmic pulses. For the analysis, we selected a set of pulses with neutral beam injection heating (NBI) only and we applied a forward fitting procedure of modeled spectral components to extract the fraction of thermal neutron emission. The results showed the same trend of the ones obtained with the dedicated spectrometer TOFOR, even though the values from the NE213 analysis were systematically higher. This discrepancy is probably due to the different lines of sight of the two spectrometers (tangential for the NE213, vertical for TOFOR). The uncertainties on the thermal fraction estimates were from 4 to 7 times higher than the ones from the TOFOR analysis.

  19. Littleton Mt. Washington

    E-Print Network [OSTI]

    Pringle, James "Jamie"

    Across New Hampshire IN TRAVELING NEW HAMPSHIRE HIGHWAYS AND BACK ROADS, you'll discover New Hampshire, Keene Nashua Community College, Nashua BAE Systems of N.A., Nashua University of New Hampshire, Durham Great Bay Community College, Portsmouth New Hampshire Space grant Consortium 1 23 4 56 7 8 9 10 11 12 13

  20. versity (MT Assistant o

    E-Print Network [OSTI]

    discipline um vitae, s and contac electronica cmsearch@ 2011, an trategic Fac nitiative ates are en rsities

  1. Grant Reference Grant Holder Research Organisation Project Title NE/I015299/1 Robert Upstill-Goddard Newcastle University Surfactant control of air-sea gas exchange in coastal waters

    E-Print Network [OSTI]

    Grant Reference Grant Holder Research Organisation Project Title NE/I015299/1 Robert Upstill NE/I015361/1 Timothy Heaton NERC British Geological Survey The oxygen isotope composition's University of Belfast 14C as a tool to trace terrestrial carbon in a complex lake: implications for food

  2. Charge-state-correlated cross sections for electron loss, capture, and ionization in C{sup 3+}-Ne collisions

    SciTech Connect (OSTI)

    Kirchner, T. [Institut fuer Theoretische Physik, TU Clausthal, Leibnizstrasse 10, D-38678 Clausthal-Zellerfeld (Germany); Santos, A.C.F.; Sant'Anna, M.M. [Instituto de Fisica, Universidade Federal do Rio de Janeiro, Cx. Postal 68528, Rio de Janeiro 21941-972 (Brazil); Luna, H.; Sigaud, G.M.; Montenegro, E.C. [Departamento de Fisica, Pontificia Universidade Catolica do Rio de Janeiro, RJ 22452-970 (Brazil); Melo, W.S. [Departamento de Fisica, Universidade Federal de Juiz de Fora, Juiz de Fora 36036-330 (Brazil)

    2005-07-15

    Charge-state-correlated total cross sections for projectile-electron loss, capture, and target ionization in C{sup 3+}-Ne collisions have been measured and calculated at absolute energies in the few MeV regime. The calculations are based on a recently proposed coupled mean-field approach which combines a set of nonperturbative single-particle calculations for the initial projectile electrons with another one for the initial target electrons. The basis generator method has been used to solve these equations. Very good overall agreement between experimental and theoretical data is found, which provides further evidence for the applicability of the approach to rather complex many-electron collision systems. One notable exception is the cross section for elastic projectile-electron loss associated with no change of the target charge state. In this case, the theoretical and experimental results differ qualitatively.

  3. Effects of CP Violation from Neutral Heavy Fermions on Neutrino Oscillations, and the LSND/MiniBooNE Anomalies

    E-Print Network [OSTI]

    Ann E Nelson

    2010-10-19

    Neutrinos may mix with ultralight fermions, which gives flavor oscillations, and with heavier fermions, which yields short distance flavor change. I consider the case where both effects are present. I show that in the limit where a single oscillation length is experimentally accessible, the effects of heavier fermions on neutrino oscillations can generically be accounted for by a simple formula containing four parameters, including observable CP violation. I consider the anomalous LSND and MiniBooNE results, and show that these can be fit in a model with CP violation and two additional sterile neutrinos, one in the mass range between 0.1 and 20 eV, and the other with mass between 33 eV and 40 GeV. I also show that this model can avoid conflict with constraints from existing null short baseline experimental results.

  4. Using the X-FEL to photo-pump X-ray laser transitions in He-like Ne

    SciTech Connect (OSTI)

    Nilsen, J; Rohringer, N

    2011-08-30

    Nearly four decades ago H-like and He-like resonantly photo-pumped laser schemes were proposed for producing X-ray lasers. However, demonstrating these schemes in the laboratory has proved to be elusive because of the difficulty of finding a strong resonant pump line. With the advent of the X-ray free electron laser (X-FEL) at the SLAC Linac Coherent Light Source (LCLS) we now have a tunable X-ray laser source that can be used to replace the pump line in previously proposed laser schemes and allow researchers to study the physics and feasibility of resonantly photo-pumped laser schemes. In this paper we use the X-FEL at 1174 eV to photo-pump the singly excited 1s2p state of He-like Ne to the doubly excited 2p3p state and model gain on the 2p3p-2p2s transition at 175 eV and the 2p3p-1s3p transition at 1017 eV. One motivation for studying this scheme is to explore possible quenching of the gain due to strong non-linear coupling effects from the intense X-FEL beam We compare this scheme with photo-pumping the He-like Ne ground state to the 1s3p singly excited state followed by lasing on the 3p-2s and 3d-2p transitions at 158 and 151 eV. Experiments are being planned at LCLS to study these laser processes and coherent quantum effects.

  5. Grant Holder Research Organisation Project Title Grant Reference Peter Bernath University of York Satellite Observations of Halogen-Containing Molecules NE/I022663/1

    E-Print Network [OSTI]

    Grant Holder Research Organisation Project Title Grant Reference Peter Bernath University of York, Ice and Super-cooled Water Particles. NE/I023058/1 Gareth Chisham NERC British Antarctic Survey The University of Manchester Effects of a warming climate on the key organic carbon cycle processes

  6. Spring 2009 PSY 362: Cognitive Neuroscience Quick Overview Classes: WED 4-6:40pm, NE-060 Prerequisites: Psy 101, 260

    E-Print Network [OSTI]

    Gallo, Linda C.

    Spring 2009 PSY 362: Cognitive Neuroscience Quick Overview Classes: WED 4-6:40pm, NE-060. #225E Textbook: Gazzaniga, Ivry & Mangun: Cognitive Neuroscience. 3rd ed. Norton 2009. Tips and Details. 1 [optional] Feb 4 2 Cells and Neuroanatomy I Ch. 2: 18-25; Ch. 3: 50-77 Feb 11 3 Neuroanatomy II

  7. SciBooNE/MiniBooNE

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust, High-ThroughputUpcoming ReleaseSecurityPediatric CancerSchedules of KeySchoenbornŽ.

  8. F.E. S.D. Gender

    Office of Environmental Management (EM)

    80+ 1.000 COMPARISON 0 0 UGESP Q-21 EXCEPTION WFR Impact Analysis SELECTION RATE % OF POOL SELECTED POOL FLAG STANDARD DEVIATION FISHER'S EXACT 80% RULE EXPECTED OF PERSONS...

  9. F.E. S.D. Gender

    Energy Savers [EERE]

    OF PERSONS AFFECTED UGESP Q-21 EXCEPTION WFR Impact Analysis SELECTION RATE % OF POOL SELECTED POOL FLAG STANDARD DEVIATION FISHER'S EXACT 80% RULE EXPECTED OF PERSONS...

  10. OPTIONAL I-""... ..o SD

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and700 GJO-2003-411-TAC GJO-PIN~$ ., .,. ' e' , Ucl

  11. Microsoft Word - SD452.3 FINAL

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal of Honor recipients honored at Y-12CONTROLLED DOCUMENT OFFICE

  12. F.E. S.D. Gender

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum12, 2015Executive Order 13514 FederalEnergy Extraction UtilityReduction in792

  13. F.E. S.D. Gender

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum12, 2015Executive Order 13514 FederalEnergy Extraction UtilityReduction

  14. http://ig1207.sakura.ne.jp/blog2/2ch/item.php?id=135704 1/8 2014-01-27 08:55:55

    E-Print Network [OSTI]

    Chiao, Jung-Chih

    2/8/2014 http://ig1207.sakura.ne.jp/blog2/2ch/item.php?id=135704 1/8 ..... | ..... 2014-01-27 08:55:55 0 0 quot;!?1.8 quot; 1.8 110 0 #12;2/8/2014 http://ig1207.sakura.ne.jp/blog #12;2/8/2014 http://ig1207.sakura.ne.jp/blog2/2ch/item.php?id=135704 3/8 caesarchannel 3

  15. Neutral current quasielastic (anti)neutrino scattering beyond the Fermi gas model at MiniBooNE and BNL kinematics

    E-Print Network [OSTI]

    M. V. Ivanov; A. N. Antonov; M. B. Barbaro; C. Giusti; A. Meucci; J. A. Caballero; R. Gonzalez-Jimenez; E. Moya de Guerra; J. M. Udias

    2015-03-14

    Neutral current quasielastic (anti)neutrino scattering cross sections on a $^{12}$C target are analyzed using a realistic spectral function $S(p,E)$ that gives a scaling function in accordance with the ($e,e'$) scattering data. The spectral function accounts for the nucleon-nucleon (NN) correlations by using natural orbitals (NOs) from the Jastrow correlation method and has a realistic energy dependence. The standard value of the axial mass $M_A= 1.032$ GeV is used in all calculations. The role of the final-state interaction (FSI) on the spectral and scaling functions, as well as on the cross sections is accounted for. A comparison of the calculations with the empirical data of the MiniBooNE and BNL experiments is performed. Our results are analyzed in comparison with those when NN correlations are not included, and also with results from other theoretical approaches, such as the relativistic Fermi gas (RFG), the relativistic mean field (RMF), the relativistic Green's function (RGF), as well as with the SuperScaling Approach (SuSA) based on the analysis of quasielastic electron scattering.

  16. PETROPHYSICAL INVESTIGATION OF THE SECONDARY RECOVERY POTENTIAL IN THE CHERRY CANYON FORMATION NE LEA FIELD LEA COUNTY, NEW MEXICO

    SciTech Connect (OSTI)

    T. Scott Hickman

    2002-06-01

    Read and Stevens has proposed the evaluation of the waterflood potential from the Cherry Canyon formation in the NE Lea Field in lea County, New Mexico. Much of the development in this area is approaching primary recovery limitations; additional recovery of remaining oil reserves by waterflood needs to be evaluated. The Cherry Canyon formation is composed of fine grained sandstone, containing clay material which results in high water saturation, and also has the tendency to swell and reduce reservoir permeability--the ability of fluid to flow through the rock pores and fractures. There are also abundant organic materials that interfere with obtaining reliable well logs. These complications have limited oil in place calculations and identification of net pay zones, presenting a challenge to the planned waterflood. Core analysis of the Cherry Canyon should improve the understanding of existing well logs and possibly indicate secondary recovery measures, such as waterflood, to enhance field recovery. Lacking truly representative core to provide accurate analyses, Read and Stevens will obtain and preserve fresh core. The consulting firm of T. Scott Hickman and Associates will then collaborate on special core analyses and obtain additional well logs for a more detailed analysis of reservoir properties. The log interpretation will be compared to the core analysis results, and the entire collected data set will be used to assess the potential and economic viability of successfully waterflooding the identified oil zones. Successful results from the project will improve accuracy of log interpretation and establish a methodology for evaluating secondary recovery by waterflood.

  17. Quantifying Uncertainty in Chemical Systems Modeling M.T. Reagan1, H.N. Najm1, P.P. Pebay1, O.M. Knio2 and R.G. Ghanem2

    E-Print Network [OSTI]

    Frey, Pascal

    Quantifying Uncertainty in Chemical Systems Modeling M.T. Reagan1, H.N. Najm1, P.P. Pebay1, O The Johns Hopkins University, Baltimore, MD 21218, USA Abstract. This study compares two techniques of Chemical Kinetics 1. Introduction Chemical kinetics computations require the specification of a number

  18. A new A&P Food Market in Mt. Kisco, New York, is enjoying annual energy cost savings of nearly $130,000 with the installation of an integrated microturbine power system

    E-Print Network [OSTI]

    Pennycook, Steve

    Background A new A&P Food Market in Mt. Kisco, New York, is enjoying annual energy cost savings, heating and power solutions, was installed in 2005 in the 57,000- square-foot facility. The New York supermarket was the first U.S. customer to take delivery of the new system. The PureComfort system is designed

  19. Visualizing the Surface Infrastructure Used to Move 2 MtCO2/year from the Dakota Gasification Company to the Weyburn CO2 Enhanced Oil Recovery Project: Version of July 1, 2009

    SciTech Connect (OSTI)

    Dooley, James J.

    2009-07-09

    Google Earth Pro has been employed to create an interactive flyover of the worlds largest operational carbon dioxide capture and storage project. The visualization focuses on the transport and storage of 2 MtCO2/year which is captured from the Dakota Gasification Facility (Beula, North Dakota) and transported 205 miles and injected into the Weyburn oil field in Southeastern Saskatchewan.

  20. Measurement of K+ production cross section by 8 GeV protons using high energy neutrino interactions in the SciBooNE detector

    E-Print Network [OSTI]

    The SciBooNE Collaboration; G. Cheng; C. Mariani; J. L. Alcaraz-Aunion; S. J. Brice; L. Bugel; J. Catala-Perez; J. M. Conrad; Z. Djurcic; U. Dore; D. A. Finley; A. J. Franke; C. Giganti; a J. J. Gomez-Cadenas; P. Guzowski; A. Hanson; Y. Hayato; K. Hiraide; G. Jover-Manas; G. Karagiorgi; T. Katori; Y. K. Kobayashi; T. Kobilarcik; H. Kubo; Y. Kurimoto; W. C. Louis; P. F. Loverre; L. Ludovici; K. B. M. Mahn; S. Masuike; K. Matsuoka; V. T. McGary; W. Metcalf; G. B. Mills; G. Mitsuka; Y. Miyachi; S. Mizugashira; C. D. Moore; Y. Nakajima; T. Nakaya; R. Napora; P. Nienaber; D. Orme; M. Otani; A. D. Russell; F. Sanchez; M. H. Shaevitz; T. -A. Shibata; M. Sorel; R. J. Stefanski; H. Takei; H. -K. Tanaka; M. Tanaka; R. Tayloe; I. J. Taylor; R. J. Tesarek; Y. Uchida; R. Van de Water; J. J. Walding; M. O. Wascko; H. B. White; M. Yokoyama; G. P. Zeller; E. D. Zimmerman

    2011-07-29

    The SciBooNE Collaboration reports K+ production cross section and rate measurements using high energy daughter muon neutrino scattering data off the SciBar polystyrene (C8H8) target in the SciBooNE detector. The K+ mesons are produced by 8 GeV protons striking a beryllium target in Fermilab Booster Neutrino Beam line (BNB). Using observed neutrino and antineutrino events in SciBooNE, we measure d2{\\sigma}/dpd{\\Omega} = (5.34 \\times 0.76) mb/(GeV/c \\times sr) for p + Be -> K+ + X at mean K+ energy of 3.9 GeV and angle (with respect to the proton beam direction) of 3.7 degrees, corresponding to the selected K+ sample. Compared to Monte Carlo predictions using previous higher energy K+ production measurements, this measurement, which uses the NUANCE neutrino interaction generator, is consistent with a normalization factor of 0.85\\times0.12. This agreement is evidence that the extrapolation of the higher energy K+ measurements to an 8 GeV beam energy using Feynman scaling is valid. This measurement reduces the error on the K+ production cross section from 40% to 14%.

  1. Strengths of the resonances at 436, 479, 639, 661, and 1279 keV in the $^{22}$Ne(p,$?$)$^{23}$Na reaction

    E-Print Network [OSTI]

    Rosanna Depalo; Francesca Cavanna; Federico Ferraro; Alessandra Slemer; Tariq Al-Abdullah; Shavkat Akhmadaliev; Michael Anders; Daniel Bemmerer; Zoltn Elekes; Giovanni Mattei; Stefan Reinicke; Konrad Schmidt; Carlo Scian; Louis Wagner

    2015-07-14

    The $^{22}$Ne(p,$\\gamma$)$^{23}$Na reaction is included in the neon-sodium cycle of hydrogen burning. A number of narrow resonances in the Gamow window dominates the thermonuclear reaction rate. Several resonance strengths are only poorly known. As a result, the $^{22}$Ne(p,$\\gamma$)$^{23}$Na thermonuclear reaction rate is the most uncertain rate of the cycle. Here, a new experimental study of the strengths of the resonances at 436, 479, 639, 661, and 1279 keV proton beam energy is reported. The data have been obtained using a tantalum target implanted with $^{22}$Ne. The strengths $\\omega\\gamma$ of the resonances at 436, 639, and 661 keV have been determined with a relative approach, using the 479 and 1279 keV resonances for normalization. Subsequently, the ratio of resonance strengths of the 479 and 1279 keV resonances was determined, improving the precision of these two standards. The new data are consistent with, but more precise than, the literature with the exception of the resonance at 661 keV, which is found to be less intense by one order of magnitude. In addition, improved branching ratios have been determined for the gamma decay of the resonances at 436, 479, and 639 keV.

  2. Measurement of K+ production cross section by 8 GeV protons using high energy neutrino interactions in the SciBooNE detector

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Cheng, G.

    2011-07-28

    The SciBooNE Collaboration reports K+ production cross section and rate measurements using high energy daughter muon neutrino scattering data off the SciBar polystyrene (C8H8) target in the SciBooNE detector. The K+ mesons are produced by 8 GeV protons striking a beryllium target in Fermilab Booster Neutrino Beam line (BNB). Using observed neutrino and antineutrino events in SciBooNE, we measure d2?/dpd? = (5.34 0.76) mb/(GeV/c x sr) for p + Be =K+ + X at mean K+ energy of 3.9 GeV and angle (with respect to the proton beam direction) of 3.7 degrees, corresponding to the selected K+ sample. Compared tomoreMonte Carlo predictions using previous higher energy K+ production measurements, this measurement, which uses the NUANCE neutrino interaction generator, is consistent with a normalization factor of 0.85 0.12. This agreement is evidence that the extrapolation of the higher energy K+ measurements to an 8 GeV beam energy using Feynman scaling is valid. This measurement reduces the error on the K+ production cross section from 40% to 14%.less

  3. Strengths of the resonances at 436, 479, 639, 661, and 1279 keV in the $^{22}$Ne(p,$?$)$^{23}$Na reaction

    E-Print Network [OSTI]

    Rosanna Depalo; Francesca Cavanna; Federico Ferraro; Alessandra Slemer; Tariq Al-Abdullah; Shavkat Akhmadaliev; Michael Anders; Daniel Bemmerer; Zoltn Elekes; Giovanni Mattei; Stefan Reinicke; Konrad Schmidt; Carlo Scian; Louis Wagner

    2015-09-18

    The $^{22}$Ne(p,$\\gamma$)$^{23}$Na reaction is included in the neon-sodium cycle of hydrogen burning. A number of narrow resonances in the Gamow window dominates the thermonuclear reaction rate. Several resonance strengths are only poorly known. As a result, the $^{22}$Ne(p,$\\gamma$)$^{23}$Na thermonuclear reaction rate is the most uncertain rate of the cycle. Here, a new experimental study of the strengths of the resonances at 436, 479, 639, 661, and 1279 keV proton beam energy is reported. The data have been obtained using a tantalum target implanted with $^{22}$Ne. The strengths $\\omega\\gamma$ of the resonances at 436, 639, and 661 keV have been determined with a relative approach, using the 479 and 1279 keV resonances for normalization. Subsequently, the ratio of resonance strengths of the 479 and 1279 keV resonances was determined, improving the precision of these two standards. The new data are consistent with, but more precise than, the literature with the exception of the resonance at 661 keV, which is found to be less intense by one order of magnitude. In addition, improved branching ratios have been determined for the gamma decay of the resonances at 436, 479, and 639 keV.

  4. Measurement of K+ production cross section by 8 GeV protons using high energy neutrino interactions in the SciBooNE detector

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Cheng, G [Columbia U.; Mariani, C [Columbia U.; Alcaraz-Aunion, J L [Barcelona, IFAE; Brice, S J [Fermilab; Bugel, L [MIT; Catala-Perez, J [Valencia U.; Conrad, J M [MIT; Djurcic, Z [Columbia U.; Dore, U [Banca di Roma; INFN, Rome; Finley, D A [Fermilab; Franke, A J [Columbia U.; Banca di Roma; INFN, Rome

    2011-07-28

    The SciBooNE Collaboration reports K+ production cross section and rate measurements using high energy daughter muon neutrino scattering data off the SciBar polystyrene (C8H8) target in the SciBooNE detector. The K+ mesons are produced by 8 GeV protons striking a beryllium target in Fermilab Booster Neutrino Beam line (BNB). Using observed neutrino and antineutrino events in SciBooNE, we measure d2?/dpd? = (5.34 0.76) mb/(GeV/c x sr) for p + Be =K+ + X at mean K+ energy of 3.9 GeV and angle (with respect to the proton beam direction) of 3.7 degrees, corresponding to the selected K+ sample. Compared to Monte Carlo predictions using previous higher energy K+ production measurements, this measurement, which uses the NUANCE neutrino interaction generator, is consistent with a normalization factor of 0.85 0.12. This agreement is evidence that the extrapolation of the higher energy K+ measurements to an 8 GeV beam energy using Feynman scaling is valid. This measurement reduces the error on the K+ production cross section from 40% to 14%.

  5. Strengths of the resonances at 436, 479, 639, 661, and 1279 keV in the $^{22}$Ne(p,$?$)$^{23}$Na reaction

    E-Print Network [OSTI]

    Rosanna Depalo; Francesca Cavanna; Federico Ferraro; Alessandra Slemer; Tariq Al-Abdullah; Shavkat Akhmadaliev; Michael Anders; Daniel Bemmerer; Zoltn Elekes; Giovanni Mattei; Stefan Reinicke; Konrad Schmidt; Carlo Scian; Louis Wagner

    2015-10-21

    The $^{22}$Ne(p,$\\gamma$)$^{23}$Na reaction is included in the neon-sodium cycle of hydrogen burning. A number of narrow resonances in the Gamow window dominates the thermonuclear reaction rate. Several resonance strengths are only poorly known. As a result, the $^{22}$Ne(p,$\\gamma$)$^{23}$Na thermonuclear reaction rate is the most uncertain rate of the cycle. Here, a new experimental study of the strengths of the resonances at 436, 479, 639, 661, and 1279 keV proton beam energy is reported. The data have been obtained using a tantalum target implanted with $^{22}$Ne. The strengths $\\omega\\gamma$ of the resonances at 436, 639, and 661 keV have been determined with a relative approach, using the 479 and 1279 keV resonances for normalization. Subsequently, the ratio of resonance strengths of the 479 and 1279 keV resonances was determined, improving the precision of these two standards. The new data are consistent with, but more precise than, the literature with the exception of the resonance at 661 keV, which is found to be less intense by one order of magnitude. In addition, improved branching ratios have been determined for the gamma decay of the resonances at 436, 479, and 639 keV.

  6. Strengths of the resonances at 436, 479, 639, 661, and 1279 keV in the $^{22}$Ne(p,$\\gamma$)$^{23}$Na reaction

    E-Print Network [OSTI]

    Depalo, Rosanna; Ferraro, Federico; Slemer, Alessandra; Al-Abdullah, Tariq; Akhmadaliev, Shavkat; Anders, Michael; Bemmerer, Daniel; Elekes, Zoltn; Mattei, Giovanni; Reinicke, Stefan; Schmidt, Konrad; Scian, Carlo; Wagner, Louis

    2015-01-01

    The $^{22}$Ne(p,$\\gamma$)$^{23}$Na reaction is included in the neon-sodium cycle of hydrogen burning. A number of narrow resonances in the Gamow window dominates the thermonuclear reaction rate. Several resonance strengths are only poorly known. As a result, the $^{22}$Ne(p,$\\gamma$)$^{23}$Na thermonuclear reaction rate is the most uncertain rate of the cycle. Here, a new experimental study of the strengths of the resonances at 436, 479, 639, 661, and 1279 keV proton beam energy is reported. The data have been obtained using a tantalum target implanted with $^{22}$Ne. The strengths $\\omega\\gamma$ of the resonances at 436, 639, and 661 keV have been determined with a relative approach, using the 479 and 1279 keV resonances for normalization. Subsequently, the ratio of resonance strengths of the 479 and 1279 keV resonances was determined, improving the precision of these two standards. The new data are consistent with, but more precise than, the literature with the exception of the resonance at 661 keV, which i...

  7. A survey of Existing V&V, UQ and M&S Data and Knowledge Bases in Support of the Nuclear Energy - Knowledge base for Advanced Modeling and Simulation (NE-KAMS)

    SciTech Connect (OSTI)

    Hyung Lee; Rich Johnson, Ph.D.; Kimberlyn C. Moussesau

    2011-12-01

    The Nuclear Energy - Knowledge base for Advanced Modeling and Simulation (NE-KAMS) is being developed at the Idaho National Laboratory in conjunction with Bettis Laboratory, Sandia National Laboratories, Argonne National Laboratory, Oak Ridge National Laboratory, Utah State University and others. The objective of this consortium is to establish a comprehensive knowledge base to provide Verification and Validation (V&V) and Uncertainty Quantification (UQ) and other resources for advanced modeling and simulation (M&S) in nuclear reactor design and analysis. NE-KAMS will become a valuable resource for the nuclear industry, the national laboratories, the U.S. NRC and the public to help ensure the safe operation of existing and future nuclear reactors. A survey and evaluation of the state-of-the-art of existing V&V and M&S databases, including the Department of Energy and commercial databases, has been performed to ensure that the NE-KAMS effort will not be duplicating existing resources and capabilities and to assess the scope of the effort required to develop and implement NE-KAMS. The survey and evaluation have indeed highlighted the unique set of value-added functionality and services that NE-KAMS will provide to its users. Additionally, the survey has helped develop a better understanding of the architecture and functionality of these data and knowledge bases that can be used to leverage the development of NE-KAMS.

  8. BooNE Collaboration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O OLaura|BilayerBiomimetic DyeBlue Gene/QENT2.0.01

  9. BooNE Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O OLaura|BilayerBiomimetic DyeBlue Gene/QENT2.0.01Experiment

  10. BooNE: Posters

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O OLaura|BilayerBiomimetic DyeBluevsDetectorPicture

  11. NE-23 W

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and MyersHr.EvaluationJune~ofOF OHlO -

  12. 20Ne Cross Section

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPONeApril 30,University Turbine Systems55MgNap, X)

  13. 20Ne Cross Section

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPONeApril 30,University Turbine Systems55MgNap, X)α,

  14. 20Ne.PDF

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPONeApril 30,University Turbine Systems55MgNap, X)α,

  15. 20Ne_78.PDF

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPONeApril 30,University Turbine Systems55MgNap, X)α,

  16. 625 Marion St. NE

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPONeApril351APPLICATION OF kVProposed - FINAL 605

  17. 19Ne.PDF

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPONe β+-Decay Evaluated Data Measurements 1939WH02:

  18. 19Ne_78.PDF

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPONe β+-Decay Evaluated Data Measurements 1939WH02:

  19. MiniBooNE

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OFDetectionBenchmark Performancelayerν µ Charged Current

  20. MiniBooNE

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OFDetectionBenchmark Performancelayerν µ Charged

  1. NE Blog Archive

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing SwimmingMicrosoft

  2. NE Press Releases

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing SwimmingMicrosoft The basics of small modular

  3. UPdate THE NE

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCEDInstallers/ContractorsPhotovoltaicsStateofEnergy FuelFEDERALDepartment of Energy 1

  4. I. Neutrino Oscillations with the MiniBooNE Experiment at FNAL Louis … 4-Year Plan and Status of the MiniBooNE Experiment Mills … n Cross Sections, n Fluxes, HARP, & SCIBooNE Van de Water … Electronics & Future n Experiments BooNE & OscSNS II. Hadron Physics with the PHENIX Experiment at BNL Liu … Overview, Spin Physics, J/y's, Muons, W's Leitch … CNM Physics, JPARC, muTr/PHENIX Operations Leitch … FVTX Proposal Summary, Staffing, & Budget Plan

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (JournalvivoHighHussein KhalilResearch &ENERGY IPhysics from MiniBooNE

  5. Notices 20 Miles Northwest of Rapid City SD Rapid City SD 57702

    Office of Environmental Management (EM)

    Availability of the Proposed Southline Transmission Line Project Draft Environmental Impact Statement and Draft Resource Management Plan Amendment, New Mexico and Arizona AGENCY:...

  6. Experimental measurements of the O15(alpha,gamma)Ne19 reaction rate and the stability of thermonuclear burning on accreting neutron stars

    E-Print Network [OSTI]

    Jacob Lund Fisker; Wanpeng Tan; Joachim Goerres; Michael Wiescher; Randall L. Cooper

    2007-05-07

    Neutron stars in close binary star systems often accrete matter from their companion stars. Thermonuclear ignition of the accreted material in the atmosphere of the neutron star leads to a thermonuclear explosion which is observed as an X-ray burst occurring periodically between hours and days depending on the accretion rate. The ignition conditions are characterized by a sensitive interplay between the accretion rate of the fuel supply and its depletion rate by nuclear burning in the hot CNO cycle and the rp-process. For accretion rates close to stable burning the burst ignition therefore depends critically on the hot CNO breakout reaction, O15(alpha,gamma)Ne19, that regulates the flow between the hot CNO cycle and the rapid proton capture process. Until recently, the O15(alpha,gamma)Ne19-reaction rate was not known experimentally and the theoretical estimates carried significant uncertainties. In this paper we perform a parameter study of the uncertainty of this reaction rate and determine the astrophysical consequences of the first measurement of this reaction rate. Our results corroborate earlier predictions and show that theoretically burning remains unstable up to accretion rates near the Eddington limit, in contrast to astronomical observations.

  7. Research Needs for Magnetic Fusion Energy Sciences. Report of the Research Needs Workshop (ReNeW) Bethesda, Maryland, June 8-12, 2009

    SciTech Connect (OSTI)

    2009-06-08

    Nuclear fusion - the process that powers the sun - offers an environmentally benign, intrinsically safe energy source with an abundant supply of low-cost fuel. It is the focus of an international research program, including the ITE R fusion collaboration, which involves seven parties representing half the world's population. The realization of fusion power would change the economics and ecology of energy production as profoundly as petroleum exploitation did two centuries ago. The 21st century finds fusion research in a transformed landscape. The worldwide fusion community broadly agrees that the science has advanced to the point where an aggressive action plan, aimed at the remaining barriers to practical fusion energy, is warranted. At the same time, and largely because of its scientific advance, the program faces new challenges; above all it is challenged to demonstrate the timeliness of its promised benefits. In response to this changed landscape, the Office of Fusion Energy Sciences (OFES ) in the US Department of Energy commissioned a number of community-based studies of the key scientific and technical foci of magnetic fusion research. The Research Needs Workshop (ReNeW) for Magnetic Fusion Energy Sciences is a capstone to these studies. In the context of magnetic fusion energy, ReNeW surveyed the issues identified in previous studies, and used them as a starting point to define and characterize the research activities that the advance of fusion as a practical energy source will require. Thus, ReNeW's task was to identify (1) the scientific and technological research frontiers of the fusion program, and, especially, (2) a set of activities that will most effectively advance those frontiers. (Note that ReNeW was not charged with developing a strategic plan or timeline for the implementation of fusion power.) This Report presents a portfolio of research activities for US research in magnetic fusion for the next two decades. It is intended to provide a strategic framework for realizing practical fusion energy. The portfolio is the product of ten months of fusion-community study and discussion, culminating in a Workshop held in Bethesda, Maryland, from June 8 to June 12, 2009. The Workshop involved some 200 scientists from Universities, National Laboratories and private industry, including several scientists from outside the US. Largely following the Basic Research Needs model established by the Office of Basic Energy Sciences (BES ), the Report presents a collection of discrete research activities, here called 'thrusts.' Each thrust is based on an explicitly identified question, or coherent set of questions, on the frontier of fusion science. It presents a strategy to find the needed answers, combining the necessary intellectual and hardware tools, experimental facilities, and computational resources into an integrated, focused program. The thrusts should be viewed as building blocks for a fusion program plan whose overall structure will be developed by OFES , using whatever additional community input it requests. Part I of the Report reviews the issues identified in previous fusion-community studies, which systematically identified the key research issues and described them in considerable detail. It then considers in some detail the scientific and technical means that can be used to address these is sues. It ends by showing how these various research requirements are organized into a set of eighteen thrusts. Part II presents a detailed and self-contained discussion of each thrust, including the goals, required facilities and tools for each. This Executive Summary focuses on a survey of the ReNeW thrusts. The following brief review of fusion science is intended to provide context for that survey. A more detailed discussion of fusion science can be found in an Appendix to this Summary, entitled 'A Fusion Primer.'

  8. Enhanced T-lymphocyte blastogenic response to tuberculin (PPD) in children of northeast (NE) Thailand supplemented with vitamin A (VA) and zinc (Zn)

    SciTech Connect (OSTI)

    Kramer, T.R.; Udomkesmalee, E.; Dhanamitta, S.; Sirisinha, S.; Charoenkiatkul, S.; Tantipopipat, S.; Banjong, O.; Rojroongwasinkul, N.; Smith, J.C. Jr. Mahidol Univ., Nakhon Pathom )

    1991-03-15

    Beneficial effects of Va and/or Zn supplementation of children in NE Thailand are described in a companion abstract. In the same study, blastogenic response (BR) of T-lymphocytes to concanavalin-A (ConA) and PPD were assayed in cultures containing mononuclear cells (MNC) or whole blood (WB). Methods were previously described. Children were previously vaccinated with BCG. BR to ConA of MNC or WB from children supplemented with VA, Zn, VA + Zn or placebo were similar. BR to PPD of MNC was higher in children receiving VA + Zn than placebo, but not in children supplemented with VA or Zn alone. Data indicate that children with suboptimal VA and Zn nutriture supplemented with < 2 times RDA of these nutrients showed enhanced cellular immunity to PPD. This observation is relevant to BCG immunization program and thus may benefit public health.

  9. Idaho National Laboratory Ten-year Site Plan (2012 through 2021) -- DOE-NE's National Nuclear Capability -- Developing and Maintaining the INL Infrastructure

    SciTech Connect (OSTI)

    Cal Ozaki

    2010-06-01

    To meet long-term objectives to transform the Idaho National Laboratory (INL), we are providing an integrated, long-term vision of infrastructure requirements that support research, development and demonstration (RD&D) goals outlined in the DOE strategic plans, including the NE Roadmap and reports such as Facilities for the Future of Nuclear Energy Research: A Twenty-year Outlook. The goal of the INL Ten-year Site Plan (TYSP) is to clearly link RD&D mission goals and INL core capabilities with infrastructure requirements (single and multi-program), establish the 10-year end-state vision for INL complexes, identify and prioritize infrastructure and capability gaps, as well as the most efficient and economic approaches to closing those gaps.

  10. Properties of resonant states in 18Ne relevant to key 14O(alpha,p)17F breakout reaction in type I x-ray bursts

    E-Print Network [OSTI]

    J. Hu; J. J. He; A. Parikh; S. W. Xu; H. Yamaguchi; D. Kahl; P. Ma; J. Su; H. W. Wang; T. Nakao; Y. Wakabayashi; T. Teranishi; K. I. Hahn; J. Y. Moon; H. S. Sung; T. Hashimoto; A. A. Chen; D. Irvine; C. S. Lee; S. Kubono

    2014-03-10

    The $^{14}$O($\\alpha$,$p$)$^{17}$F reaction is one of the key reactions involved in the breakout from the hot-CNO cycle to the rp-process in type I x-ray bursts. The resonant properties in the compound nucleus $^{18}$Ne have been investigated through resonant elastic scattering of $^{17}$F+$p$. The radioactive $^{17}$F beam was separated by the CNS Radioactive Ion Beam separator (CRIB) and bombarded a thick H$_2$ gas target at 3.6 MeV/nucleon. The recoiling light particles were measured by using three ${\\Delta}$E-E silicon telescopes at laboratory angles of $\\theta$$_{lab}$$\\approx$3$^\\circ$, 10$^\\circ$ and 18$^\\circ$, respectively. Five resonances at $E_{x}$=6.15, 6.28, 6.35, 6.85, and 7.05 MeV were observed in the excitation functions. Based on an $R$-matrix analysis, $J^{\\pi}$=1$^-$ was firmly assigned to the 6.15-MeV state. This state dominates the thermonuclear $^{14}$O($\\alpha$,$p$)$^{17}$F rate below 1 GK. We have also confirmed the existence and spin-parities of three states between 6.1 and 6.4 MeV. As well, a possible new excited state in $^{18}$Ne was observed at $E_{x}$=6.85$\\pm$0.11 MeV and tentatively assigned as $J$=0. This state could be the analog state of the 6.880 MeV (0$^{-}$) level in the mirror nucleus $^{18}$O, or a bandhead state (0$^+$) of the six-particle four-hole (6$p$-4$h$) band. A new thermonuclear rate of the $^{14}$O($\\alpha$,$p$)$^{17}$F reaction has been determined, and its astrophysical impact has been examined within the framework of one-zone x-ray burst postprocessing calculations.

  11. Study on the reduction of atmospheric mercury emissions from mine waste enriched soils through native grass cover in the Mt. Amiata region of Italy

    SciTech Connect (OSTI)

    Fantozzi, L., E-mail: l.fantozzi@iia.cnr.it [CNR-Institute of Atmospheric Pollution Research, c/o: UNICAL-Polifunzionale, 87036 Rende (Italy); Ferrara, R., E-mail: romano.ferrara@pi.ibf.cnr.it [CNR-Institute of Biophysics, San Cataldo Research Area, Via G. Moruzzi 1, 56124 Pisa (Italy); Dini, F., E-mail: fdiniprotisti@gmail.com [University of Pisa, Department of Biology, Via A. Volta 4, 56126 Pisa (Italy); Tamburello, L., E-mail: ltamburello@biologia.unipi.it [University of Pisa, Department of Biology, Via Derna 1, I-56126 Pisa (Italy); Pirrone, N.; Sprovieri, F. [CNR-Institute of Atmospheric Pollution Research, c/o: UNICAL-Polifunzionale, 87036 Rende (Italy)] [CNR-Institute of Atmospheric Pollution Research, c/o: UNICAL-Polifunzionale, 87036 Rende (Italy)

    2013-08-15

    Atmospheric mercury emissions from mine-waste enriched soils were measured in order to compare the mercury fluxes of bare soils with those from other soils covered by native grasses. Our research was conducted near Mt. Amiata in central Italy, an area that was one of the largest and most productive mining centers in Europe up into the 1980s. To determine in situ mercury emissions, we used a Plexiglas flux chamber connected to a portable mercury analyzer (Lumex RA-915+). This allowed us to detect, in real time, the mercury vapor in the air, and to correlate this with the meteorological parameters that we examined (solar radiation, soil temperature, and humidity). The highest mercury flux values (8000 ng m{sup ?2} h{sup ?1}) were observed on bare soils during the hours of maximum insulation, while lower values (250 ng m{sup ?2} h{sup ?1}) were observed on soils covered by native grasses. Our results indicate that two main environmental variables affect mercury emission: solar radiation intensity and soil temperature. The presence of native vegetation, which can shield soil surfaces from incident light, reduced mercury emissions, a result that we attribute to a drop in the efficiency of mercury photoreduction processes rather than to decreases in soil temperature. This finding is consistent with decreases in mercury flux values down to 3500 ng m{sup ?2} h{sup ?1}, which occurred under cloudy conditions despite high soil temperatures. Moreover, when the soil temperature was 28 C and the vegetation was removed from the experimental site, mercury emissions increased almost four-fold. This increase occurred almost immediately after the grasses were cut, and was approximately eight-fold after 20 h. Thus, this study demonstrates that enhancing wild vegetation cover could be an inexpensive and effective approach in fostering a natural, self-renewing reduction of mercury emissions from mercury-contaminated soils. -- Highlights: ? Mercury air/surface exchange from grass covered soil is different from bare soil. ? Light enhances mercury emissions and is the main parameter driving the process. ? The presence of wild vegetation covering the soil reduces mercury emission. ? Vegetative covers could be a solution to reduce atmospheric mercury pollution.

  12. Corona driven air propulsion for cooling of electronics F. Yang, N.E. Jewell-Larsen, D.L. Brown, K. Pendergrass, D.A. Parker, I.A. Krichtafovitch*, A.V. Mamishev

    E-Print Network [OSTI]

    Mamishev, Alexander

    Corona driven air propulsion for cooling of electronics F. Yang, N.E. Jewell-Larsen, D.L. Brown, K of Washington, Seattle, WA 98105, USA *Chief Scientific Officer, Kronos Air Technologies, Redmond, WA 98052, USA Abstract: The possibility of building a high voltage electrostatic air pump for cooling of microelectronics

  13. Meeting Name Score Rank Grant Reference Grant Holder Research Organisation Project Title Call Panel A 10 1 NE/L011328/1 Christopher Davies University of Leeds A New Energy Budget for Earth's Core and

    E-Print Network [OSTI]

    Meeting Name Score Rank Grant Reference Grant Holder Research Organisation Project Title Call Panel Rethinking carbonate diagenesis: clues to past carbon cycling from an overlooked carbon sink IRF OCT13 Panel of Criegee Biradical Chemistry IRF OCT13 Panel B 8 3 NE/L011166/1 James Brearley NERC British Antarctic

  14. Published June 1, 2003. Distribution restricted to Sponsors until September 1, 2003. auto-id center massachusetts institute of technology, 400 technology sq, building ne46, 6th floor, cambridge, ma 02139-4307, usa

    E-Print Network [OSTI]

    Brock, David

    Program in Logistics at the Massachusetts Institute of Technology and is currently working on MIT Auto corporate logistics and operations management positions. He has a Bachelors of Science in food technology massachusetts institute of technology, 400 technology sq, building ne46, 6th floor, cambridge, ma 02139

  15. Published June 1, 2003. Distribution restricted to Sponsors until September 1, 2003. auto-id center massachusetts institute of technology, 400 technology sq, building ne46, 6th floor, cambridge, ma 02139-4307, usa

    E-Print Network [OSTI]

    Brock, David

    management for the last six years. He was Product Manager at Optimum Logistics, Director of Global Logistics a Master of Engineering in Logistics from the Massachusetts Institute of Technology and a PhD in Solid massachusetts institute of technology, 400 technology sq, building ne46, 6th floor, cambridge, ma 02139

  16. Multiphoton ionization and high-order harmonic generation of He, Ne, and Ar atoms in intense pulsed laser fields: Self-interaction-free time-dependent density-functional theoretical approach

    E-Print Network [OSTI]

    Chu, Shih-I; Tong, Xiao-Min

    2001-06-12

    We present a detailed study of the multiphoton ionization and high-order harmonic generation (HHG) processes of rare-gas atoms (He, Ne, and Ar) in intense pulsed laser fields by means of a self-interaction-free time-dependent density...

  17. VOLUME 87, NUMBER 20 P H Y S I C A L R E V I E W L E T T E R S 12 NOVEMBER 2001 Evidence Concerning Drying Behavior of Ne near a Cs Surface

    E-Print Network [OSTI]

    Curtarolo, Stefano

    as a function of the adsorption system and the temperature T . For example, at saturated vapor pressure (SVP), a liquid drop may bead up on a surface exhibiting a finite contact angle Q. This "nonwetting" be- havior) Using density functional and Monte Carlo methods, we have studied the properties of Ne adsorbed on a Cs

  18. Nuclear Energy -- Knowledge Base for Advanced Modeling and Simulation (NE-KAMS) Code Verification and Validation Data Standards and Requirements: Fluid Dynamics Version 1.0

    SciTech Connect (OSTI)

    Greg Weirs; Hyung Lee

    2011-09-01

    V&V and UQ are the primary means to assess the accuracy and reliability of M&S and, hence, to establish confidence in M&S. Though other industries are establishing standards and requirements for the performance of V&V and UQ, at present, the nuclear industry has not established such standards or requirements. However, the nuclear industry is beginning to recognize that such standards are needed and that the resources needed to support V&V and UQ will be very significant. In fact, no single organization has sufficient resources or expertise required to organize, conduct and maintain a comprehensive V&V and UQ program. What is needed is a systematic and standardized approach to establish and provide V&V and UQ resources at a national or even international level, with a consortium of partners from government, academia and industry. Specifically, what is needed is a structured and cost-effective knowledge base that collects, evaluates and stores verification and validation data, and shows how it can be used to perform V&V and UQ, leveraging collaboration and sharing of resources to support existing engineering and licensing procedures as well as science-based V&V and UQ processes. The Nuclear Energy Knowledge base for Advanced Modeling and Simulation (NE-KAMS) is being developed at the Idaho National Laboratory in conjunction with Bettis Laboratory, Sandia National Laboratories, Argonne National Laboratory, Utah State University and others with the objective of establishing a comprehensive and web-accessible knowledge base to provide V&V and UQ resources for M&S for nuclear reactor design, analysis and licensing. The knowledge base will serve as an important resource for technical exchange and collaboration that will enable credible and reliable computational models and simulations for application to nuclear power. NE-KAMS will serve as a valuable resource for the nuclear industry, academia, the national laboratories, the U.S. Nuclear Regulatory Commission (NRC) and the public and will help ensure the safe, economical and reliable operation of existing and future nuclear reactors.

  19. MiniBooNE Results and Neutrino Schemes with 2 sterile Neutrinos: Possible Mass Orderings and Observables related to Neutrino Masses

    E-Print Network [OSTI]

    Srubabati Goswami; Werner Rodejohann

    2007-10-08

    The MiniBooNE and LSND experiments are compatible with each other when two sterile neutrinos are added to the three active ones. In this case there are eight possible mass orderings. In two of them both sterile neutrinos are heavier than the three active ones. In the next two scenarios both sterile neutrinos are lighter than the three active ones. The remaining four scenarios have one sterile neutrino heavier and another lighter than the three active ones. We analyze all scenarios with respect to their predictions for mass-related observables. These are the sum of neutrino masses as constrained by cosmological observations, the kinematic mass parameter as measurable in the KATRIN experiment, and the effective mass governing neutrinoless double beta decay. It is investigated how these non-oscillation probes can distinguish between the eight scenarios. Six of the eight possible mass orderings predict positive signals in the KATRIN and future neutrinoless double beta decay experiments. We also remark on scenarios with three sterile neutrinos. In addition we make some comments on the possibility of using decays of high energy astrophysical neutrinos to discriminate between the mass orderings in presence of two sterile neutrinos.

  20. Extraordinary luminous soft X-ray transient MAXI J0158744 as an ignition of a nova on a very massive O-Ne white dwarf

    SciTech Connect (OSTI)

    Morii, M.; Serino, M.; Mihara, T.; Sugizaki, M.; Tomida, H.; Kimura, M.; Nakahira, S.; Suwa, F.; Negoro, H.; Kennea, J. A.; Pritchard, T.; Page, K. L.; Osborne, J. P.; Curran, P. A.; Walter, F. M.; Kuin, N. P. M.; Hiroi, K.; Usui, R.; Kawai, N.; Gehrels, N.; and others

    2013-12-20

    We present the observation of an extraordinary luminous soft X-ray transient, MAXI J0158744, by the Monitor of All-sky X-ray Image (MAXI) on 2011 November 11. This transient is characterized by a soft X-ray spectrum, a short duration (1.3 10{sup 3} s < ?T{sub d} < 1.10 10{sup 4} s), a rapid rise (<5.5 10{sup 3} s), and a huge peak luminosity of 2 10{sup 40} erg s{sup 1} in 0.7-7.0 keV band. With Swift observations and optical spectroscopy from the Small and Moderate Aperture Research Telescope System, we confirmed that the transient is a nova explosion, on a white dwarf in a binary with a Be star, located near the Small Magellanic Cloud. An early turn-on of the super-soft X-ray source (SSS) phase (<0.44 days), the short SSS phase duration of about one month, and a 0.92 keV neon emission line found in the third MAXI scan, 1296 s after the first detection, suggest that the explosion involves a small amount of ejecta and is produced on an unusually massive O-Ne white dwarf close to, or possibly over, the Chandrasekhar limit. We propose that the huge luminosity detected with MAXI was due to the fireball phase, a direct manifestation of the ignition of the thermonuclear runaway process in a nova explosion.

  1. Design and operation of a setup with a camera and adjustable mirror to inspect the sense-wire planes of the Time Projection Chamber inside the MicroBooNE cryostat

    E-Print Network [OSTI]

    Benjamin Carls; Glenn Horton-Smith; Catherine C. James; Robert M. Kubinski; Stephen Pordes; Anne Schukraft; Thomas Strauss

    2015-08-26

    Detectors in particle physics, particularly when including cryogenic components, are often enclosed in vessels that do not provide any physical or visual access to the detectors themselves after installation. However, it can be desirable for experiments to visually investigate the inside of the vessel. The MicroBooNE cryostat hosts a TPC with sense-wire planes, which had to be inspected for damage such as breakage or sagging. This paper describes an approach to view the inside of the MicroBooNE cryostat with a setup of a camera and a mirror through one of its cryogenic service nozzles. The paper describes the camera and mirror chosen for the operation, the illumination, and the mechanical structure of the setup. It explains how the system was operated and demonstrates its performance.

  2. Design and Operation of A Setup with A Camera and Adjustable Mirror to Inspect the Sense-Wire Planes of the Time Projection Chamber Inside the MicroBooNE Cryostat

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Carls, Benjamin; Horton-Smith, Glenn; James, Catherine C.; Kubinski, Robert M.; Pordes, Stephen; Schukraft, Anne; Strauss, Thomas

    2015-08-26

    Detectors in particle physics, particularly when including cryogenic components, are often enclosed in vessels that do not provide any physical or visual access to the detectors themselves after installation. However, it can be desirable for experiments to visually investigate the inside of the vessel. The MicroBooNE cryostat hosts a TPC with sense-wire planes, which had to be inspected for damage such as breakage or sagging. This inspection was performed after the transportation of the vessel with the enclosed detector to its final location, but before filling with liquid argon. Our paper describes an approach to view the inside of themoreMicroBooNE cryostat with a setup of a camera and a mirror through one of its cryogenic service nozzles. The paper also describes the camera and mirror chosen for the operation, the illumination, and the mechanical structure of the setup. It explains how the system was operated and demonstrates its performance.less

  3. Energy for the future with Ris from nuclear power to sustainable energy Ris NatioNal laboRatoRy foR sustaiNable eNeRgy

    E-Print Network [OSTI]

    Energy for the future with Ris from nuclear power to sustainable energy Ris NatioNal laboRatoRy foR sustaiNable eNeRgy edited by MoRteN JastRup #12;Energy for the future #12;Energy for the future with Ris from nuclear power to sustainable energy Translated from 'Energi til fremtiden med Ris fra

  4. Results from SKM-200-GIBS on multiparticle azimuthal correlations in C-Ne and C-Cu collisions at energy of 3.7 GeV per nucleon

    E-Print Network [OSTI]

    L. Chkhaidze; T. Djobava; L. Kharkhelauri

    2000-08-03

    The transverse momentum technique is used to analyse charged-particle exclusive data in central C-Ne and C-Cu interactions at energy of 3.7 GeV per nucleon. Clear evidence of in-plane and out-of-plane (squeeze-out) flow effects for protons and pi^{-} mesons have been obtained. In C-Ne interactions in-plane flow of pi^{-} mesons is in the same direction as for the protons, while in C-Cu collisions pions show antuflow behaviour. From the transverse momentum and azimuthal distributions of protons and pi^{-} mesons with respect to the reaction plane, the flow (the measure of the amount of collective transverse momentum transfer in the reaction plane) and the parameter a_{2} (the measure of the anisotropic emission strength) have been extracted. The flow effects increase with the mass of the particle and the mass number of target A_{T}. The comparison of our in-plane flow results with flow data for various projectile/target configurations was made using the scaled flow F_{S}=F/(A_{P} ^{1/3}+A_{T}^{1/3}). F_{S} demonstrates a common scaling behaviour for flow values from different systems. The Quark Gluon String Model (QGSM) was used for the comparison with the experimental data. The QGSM yields a signature of in-plane and out-of-plane flow effects in C-ne and C-Cu collisions for protons.

  5. An ancient origin for the enigmatic Flat-Headed Frogs (Bombinatoridae: Barbourula) from the islands of Southeast Asia.

    E-Print Network [OSTI]

    Brown, Rafe M.

    2010-01-01

    published data (e.g., [18,19]). All primer details are provided in Table 1. The PCR conditions used were standard and the thermal cycle profile was as follows: 94uC (3 min; 35 cycles of 94uC (30 s), 50uC [for mt genes] or 55uC [for nuc genes] (30 s), 72uC (1... AAAAAGCTTCAAACTGGGATTAGATACCCCACTAT [96] 16SH mt 39 r GCTAGACCATKATGCAAAAGGTA [97] 12SM mt 59 R GGCAAGTCGTAACATGGTAAG [98] 16SA mt 39 r ATGTTTTTGGTAAACAGGCG [99] 16SC mt 59 R GTRGGCCTAAAAGCAGCCAC [98] 16SD mt 39 r CTCCGGTCTGAACTCAGATCACGTAG [98] CXCR4-G nuc 59 R AGCAACAGTGGAARAANGC...

  6. An Ancient Origin for the Enigmatic Flat-Headed Frogs (Bombinatoridae: Barbourula) from the Islands of Southeast Asia

    E-Print Network [OSTI]

    Blackburn, David C.; Bickford, David P.; Diesmos, Arvin C.; Iskandar, Djoko T; Brown, Rafe M.

    2010-08-09

    published data (e.g., [18,19]). All primer details are provided in Table 1. The PCR conditions used were standard and the thermal cycle profile was as follows: 94uC (3 min; 35 cycles of 94uC (30 s), 50uC [for mt genes] or 55uC [for nuc genes] (30 s), 72uC (1... AAAAAGCTTCAAACTGGGATTAGATACCCCACTAT [96] 16SH mt 39 r GCTAGACCATKATGCAAAAGGTA [97] 12SM mt 59 R GGCAAGTCGTAACATGGTAAG [98] 16SA mt 39 r ATGTTTTTGGTAAACAGGCG [99] 16SC mt 59 R GTRGGCCTAAAAGCAGCCAC [98] 16SD mt 39 r CTCCGGTCTGAACTCAGATCACGTAG [98] CXCR4-G nuc 59 R AGCAACAGTGGAARAANGC...

  7. Overview of NE Research Programs

    Office of Environmental Management (EM)

    Accelerated Development of Zr-Containing New Generation FM Steels for Advanced Nuclear Reactors Pacific Northwest National Laboratory Chuck Henager None Nanocrystalline SiC...

  8. BooNE News Articles

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O OLaura|BilayerBiomimetic DyeBlue

  9. BooNE: Interesting Facts

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O OLaura|BilayerBiomimetic DyeBluevsDetector

  10. BooNE: Picture Gallery

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O OLaura|BilayerBiomimetic DyeBluevsDetectorPicture Gallery

  11. MiniBooNE Results

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OFDetectionBenchmarkResults and Follow-On Experiments W. C.

  12. BooNE Neutrino Oscillations

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory of raregovAboutRecovery ActTools toBadging,BioscienceOutreach 12forBoard of

  13. ICARUS/MicroBooNE

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (JournalvivoHighHussein KhalilResearch &ENERGYWho should attend?by J.)

  14. 2000-Liter-Gesellschaft --Entwicklungschance fr Nord und Sd

    E-Print Network [OSTI]

    Wehrli, Bernhard

    2000-Liter-Gesellschaft -- Entwicklungschance fr Nord und Sd Die Schweizerische Umweltstiftung initiiert die Real-Vision der 2000-Liter- Gesellschaft um den Wasserverbrauch von weltweit rund 4'000 Litern pro Person und Tag auf 2'000 Liter zu reduzieren. Die 2000-Liter-Gesellschaft ist das

  15. The COSI Framework -Carbon Offsets with SD Impacts (COSI)

    E-Print Network [OSTI]

    Cape Town, South Africa Karen Holm Olsen, PhD UNEP Ris Centre #12;Outline of Presentation Policy and a high quantity of CERs (trade-offs) A common conclusion across different assessment methodologies

  16. Oblique slamming, planing and skimming S.D. Howison

    E-Print Network [OSTI]

    Howison, Sam

    , inviscid hydrodynamics, ship slamming, water entry, planing. 1 Introduction The phenomenon of violent impacts where there is the possibility of either cavitation on the "downstream" segment of the contact

  17. Microsoft Word - SD243-1_Clean_20140429

    National Nuclear Security Administration (NNSA)

    Acknowledgement Form RMP appointment forms are located on the NNSA Records Management internet site or by submitting a request to the RPO group email NNSARecordsManagement@nnsa.doe...

  18. Tutorial Fator de Impacto BIBLIOTECA DE CINCIAS DA SADE SD

    E-Print Network [OSTI]

    Paraná, Universidade Federal do

    calculo realizado nas demais colunas Total Cites ­ número de citações que a revista teve nos últimos dois Half-life ­ Idade mediana ­ Calculo do número de citações ano a contar pelo 1º. Número da revista #12;

  19. DOE - Office of Legacy Management -- Edgemont Mill Site - SD 01

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth Dakota Edgemont, SouthLaboratoryDiv - NYCorp - NJ

  20. Microsoft Word - SD 351-1 FINAL.doc

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal of Honor recipients honored at Y-12

  1. Microsoft Word - SD243-1_Clean_20140429

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal of Honor recipients honored at Y-12CONTROLLED DOCUMENT OFFICE OF

  2. HNF-SD-WM-TI-740, Rev. OA

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (Journalvivo Low-Dose Low34 Revision 0 Approved for69 Revision71748884045.

  3. HNF-SD-WM-TI-740, Rev. OC

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (Journalvivo Low-Dose Low34 Revision 0 Approved for69

  4. Research Needs for Fusion-Fission Hybrid Systems. Report of the Research Needs Workshop (ReNeW) Gaithersburg, Maryland, September 30 - October 2, 2009

    SciTech Connect (OSTI)

    2009-09-30

    Largely in anticipation of a possible nuclear renaissance, there has been an enthusiastic renewal of interest in the fusion-fission hybrid concept, driven primarily by some members of the fusion community. A fusion-fission hybrid consists of a neutron-producing fusion core surrounded by a fission blanket. Hybrids are of interest because of their potential to address the main long-term sustainability issues related to nuclear power: fuel supply, energy production, and waste management. As a result of this renewed interest, the U.S. Department of Energy (DOE), with the participation of the Office of Fusion Energy Sciences (OFES), Office of Nuclear Energy (NE), and National Nuclear Security Administration (NNSA), organized a three-day workshop in Gaithersburg, Maryland, from September 30 through October 2, 2009. Participants identified several goals. At the highest level, it was recognized that DOE does not currently support any R&D in the area of fusion-fission hybrids. The question to be addressed was whether or not hybrids offer sufficient promise to motivate DOE to initiate an R&D program in this area. At the next level, the workshop participants were asked to define the research needs and resources required to move the fusion-fission concept forward. The answer to the high-level question was given in two ways. On the one hand, when viewed as a standalone concept, the fusion-fission hybrid does indeed offer the promise of being able to address the sustainability issues associated with conventional nuclear power. On the other hand, when participants were asked whether these hybrid solutions are potentially more attractive than contemplated pure fission solutions (that is, fast burners and fast breeders), there was general consensus that this question could not be quantitatively answered based on the known technical information. Pure fission solutions are based largely on existing both fusion and nuclear technology, thereby prohibiting a fair side-by-side comparison. Another important issue addressed at the conference was the time scale on which long-term sustainability issues must be solved. There was a wide diversity of opinion and no consensus was possible. One group, primarily composed of members of the fission community, argued that the present strategies with respect to waste management (on-site storage) and fuel supply (from natural uranium) would suffice for at least 50 years, with the main short-term problem being the economics of light water reactors (LWRs). Many from the fusion community believed that the problems, particularly waste management, were of a more urgent nature and that we needed to address them sooner rather than later. There was rigorous debate on all the issues before, during, and after the workshop. Based on this debate, the workshop participants developed a set of high-level Findings and Research Needs and a companion set of Technical Findings and Research Needs. In the context of the Executive Summary it is sufficient to focus on the high-level findings which are summarized.

  5. Branch xylem density variations across the Amazon Basin

    E-Print Network [OSTI]

    2009-01-01

    dec) Latitutude (dec) 7-SW-Venezuela 4-N-Peru r 2 =0.15 P Venezuela 5-Ecuador MT-Brazil BoliviaN-Peru Ecuador Colombia SW-Venezuela NE-Venezuela AM-Brazil

  6. COS OBSERVATIONS OF METAL LINE AND BROAD LYMAN-{alpha} ABSORPTION IN THE MULTI-PHASE O VI AND Ne VIII SYSTEM AT z = 0.20701 TOWARD HE 0226-4110

    SciTech Connect (OSTI)

    Savage, B. D. [Department of Astronomy, University of Wisconsin-Madison, 475 North Charter Street, Madison, WI 53706 (United States); Lehner, N. [Department of Physics, University of Notre Dame, 225 Nieuwland Science Hall, Notre Dame, IN 46556 (United States); Narayanan, A. [Indian Institute of Space Science and Technology, Thiruvananthapuram 695547, Kerala (India)

    2011-12-20

    Observations of the QSO HE 0226-4110 (z{sub em} = 0.495) with the Cosmic Origins Spectrograph (COS) from 1134 to 1796 A with a resolution of {approx}17 km s{sup -1} and signal-to-noise ratio (S/N) per resolution element of 20-40 are used to study the multi-phase absorption system at z = 0.20701 containing O VI and Ne VIII. The system was previously studied with lower S/N observations with Far-Ultraviolet Spectroscopic Explorer (FUSE) and Space Telescope Imaging Spectrograph (STIS). The COS observations provide more reliable measures of the H I and metal lines present in the system and reveal the clear presence of broad Ly{alpha} (BLA) absorption with b = 72(+13, -6) km s{sup -1} and log N(H I) = 13.87 {+-} 0.08. Detecting BLAs associated with warm gas absorbers is crucial for determining the temperature, metallicity, and total baryonic content of the absorbers. The BLA is probably recording the trace amount of thermally broadened H I in the collisionally ionized plasma with log T {approx} 5.7 that also produces the O VI and Ne VIII absorption. The total hydrogen column in the collisionally ionized gas, log N(H) {approx} 20.1, exceeds that in the cooler photoionized gas in the system by a factor of {approx}22. The oxygen abundance in the collisionally ionized gas is [O/H] = -0.89 {+-} 0.08 {+-} 0.07. The absorber probably occurs in the circumgalactic environment (halo) of a foreground L = 0.25L{sub *} disk galaxy with an impact parameter of 109 h{sub 70}{sup -1} kpc identified by Mulchaey and Chen.

  7. Pukaha Mt Bruce Capability Building Project

    E-Print Network [OSTI]

    : _________________________________________________ ISO ID: ____________________________ Department: ___________________________________________ Office Reports Applicant Certification Access privileges are issued to staff members with the understanding

  8. Why Mt Etna? C. Doglioni,1

    E-Print Network [OSTI]

    between these two approaches: (i) evo- lution and dip of the foreland mono- cline are used in Doglioni et

  9. Mt Ranier Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | Open

  10. Marysville Mt Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma,InformationIllinois:Martin, Michigan:

  11. Babb, MT Natural Gas Export to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease

  12. Babb, MT Natural Gas Export to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724per ThousandLease0 0 20 0 0 122 1996-2014

  13. Havre, MT Natural Gas Exports to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan Feb Mar Apr MayYear Jan FebMississippi119,456 111,949HOW TO

  14. Havre, MT Natural Gas Exports to Canada

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan Feb Mar Apr MayYear Jan FebMississippi119,456 111,949HOW TO2,504

  15. Controlled Source Audio MT | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (Utility Company)| Open(Evans, EtInformation Control of Well KS-8 inSource

  16. Mt Peak Utility | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to: navigation, searchsource HistoryCharleston,Peak Utility Jump to:

  17. Mt Poso Cogeneration | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to: navigation, searchsource HistoryCharleston,Peak Utility Jump to:Poso

  18. Category:Billings, MT | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButte County,Camilla, Georgia: Energy014771°,North Dakota:Bonn |NJ

  19. "Block" "Spot Column" "Spot Row" ORF ID Gene Block Column Row Name ID X Y Dia. F635 Median F635 Mean F635 SD B635 Median B635 Mean B635 SD % > B635+1SD % > B635+2SD F635 % Sat. F532 Median F532 Mean F532 SD B532 Median B532 Mean B532 SD % > B532+1SD % > B

    E-Print Network [OSTI]

    Winston, Fred

    622 100 100 0 2580 2796 1174 63 89 234 100 100 0 5.257 5.315 5.223 5.619 2.874 5.004 0.873 2.394 13231

  20. 2.8 Mt5.6 Mt Turning over a New Leaf

    E-Print Network [OSTI]

    to local communities and other stewards of our natural resources. Forest Trends analyzes strategic market natural ecosystems, which provide life-sustaining processes, by promoting incentives stemming from a broad 19th Street, NW 4th floor Washington, DC 20036 info@ecosystemmarketplace.com www

  1. Present address: South Dakota Department of Game, Fish and Parks, 20641 SD HWY 1806, Ft Pierre, SD 57532, USA. Corresponding author email address: chris.longhenry@state.sd.us

    E-Print Network [OSTI]

    ) aquacultural harvest data to model climate effects on variability of juvenile yellow perch year class strength-permanent wetlands. KEY WORDS Climatic effects, Perca flavescens, recruitment, wetlands, yellow perch Climate factors) and increased water levels (Henderson 1985) have also been positively related to abundance of larval yellow

  2. CRISTINA L. ARCHER (ne Cristina Lozej)

    E-Print Network [OSTI]

    Firestone, Jeremy

    . 2000 2004 Programmer/Consulting Meteorologist, Pacific Gas and Electric (PG&E), Planetweather.com, Golden Gate Weather Services, IPS of California, and Qwikcast.com. 1999 Teacher Assistant, Civil. Jacobson, 2012: Where is the ideal location for a US East Coast offshore grid? Geophysical Research Letters

  3. Seco ndary Story Hea dli ne Introduction

    E-Print Network [OSTI]

    Wilson, W. Stephen

    visited with my dad's brother that afternoon who we stayed with in Tacoma. The next day, Friday, we went are mathematicians. We came back to Tacoma and went to the Sound Transit offices which had closed an hour earlier turned into a store complex. We ate lunch and looked at Sound Transit's plans for both its Tacoma Link

  4. Nucleosynthesis in O-Ne-Mg Supernovae

    E-Print Network [OSTI]

    R. D. Hoffman; B. Muller; H. -T. Janka

    2007-12-27

    We have studied detailed nucleosynthesis in the shocked surface layers of an Oxygen-Neon-Magnesium core collapse supernova with an eye to determining if the conditions are suitable for r process nucleosynthesis. We find no such conditions in an unmodified model, but do find overproduction of N=50 nuclei (previously seen in early neutron-rich neutrino winds) in amounts that, if ejected, would pose serious problems for galactic chemical evolution.

  5. Nucleosynthesis in O-Ne-Mg Supernovae

    SciTech Connect (OSTI)

    Hoffman, R D; Janka, H; Muller, B

    2007-12-18

    We have studied detailed nucleosynthesis in the shocked surface layers of an oxygen-neon-magnesium core collapse supernova with an eye to determining whether the conditions are suitable for r-process nucleosynthesis. We find no such conditions in an unmodified model, but do find overproduction of N=50 nuclei (previously seen in early neutron-rich neutrino winds) in amounts that, if ejected, would pose serious problems for Galactic chemical evolution.

  6. neWorldWeek DebatInformation&

    E-Print Network [OSTI]

    Sussex, University of

    lives of bumblebees. Save our Bumblebees Talk 2-3pm Jubilee LT Celebrate Holi with Rangoli, music global poverty and its relationship with international trade and migra- tion. Globalisation and Global Poverty 6-7pm Jubilee 144 A showcase of our student groups' hard work from throughout the year. Ticketed

  7. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O OLaura|BilayerBiomimetic DyeBluevs MiniBooNEGoals of

  8. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O OLaura|BilayerBiomimetic DyeBluevs MiniBooNEGoals ofin a

  9. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O OLaura|BilayerBiomimetic DyeBluevs MiniBooNEGoals ofin

  10. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O OLaura|BilayerBiomimetic DyeBluevs MiniBooNEGoals

  11. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O OLaura|BilayerBiomimetic DyeBluevs MiniBooNEGoalsCalibration

  12. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O OLaura|BilayerBiomimetic DyeBluevs

  13. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O OLaura|BilayerBiomimetic DyeBluevsDetector The MiniBooNELight

  14. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O OLaura|BilayerBiomimetic DyeBluevsDetector The

  15. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O OLaura|BilayerBiomimetic DyeBluevsDetector TheCivil

  16. CA Mr. Andrew Wallo, III, NE-23

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and Myers Co -VANaval ,, *' ; . FinalLI CIi5W

  17. M r. Andrew Wallo, III, NE-23

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and MyersHr. Anthony V. Andolina:I 1 '\Ll 1vr*M O

  18. Mr. Andrew Wallo, III, NE-23

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and MyersHr.EvaluationJune 20070.C. 20545 OCT 28300,

  19. Mr. Andrew Wallo, III, NE-23

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and MyersHr.EvaluationJune 20070.C. 20545 OCT 28300,

  20. Mr. Andrew Wallo, III, NE-23

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and MyersHr.EvaluationJune 20070.C. 20545 OCT

  1. REPLY TO ATTN OF NE-301

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and700 GJO-2003-411-TACe - .'pJ3u44x:Y" .

  2. A=10Ne (1979AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion Batteries PrintA279AJ01) (See the2004TI06) (Not79AJ01)

  3. A=10Ne (1984AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion Batteries PrintA279AJ01) (See the2004TI06)

  4. A=10Ne (1988AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion Batteries PrintA279AJ01) (See the2004TI06)8AJ01) (Not

  5. A=10Ne (2004TI06)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion Batteries PrintA279AJ01) (See the2004TI06)8AJ01)

  6. A=11Ne (1980AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion Batteries80AJ01) (See the Isobar68AJ02) (Not0AJ01) (Not

  7. A=11Ne (1985AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion Batteries80AJ01) (See the Isobar68AJ02) (Not0AJ01)

  8. A=11Ne (1990AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion Batteries80AJ01) (See the Isobar68AJ02)

  9. A=11Ne (2012KE01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion Batteries80AJ01) (See the Isobar68AJ02)2012KE01) (Not

  10. A=12Ne (1980AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion Batteries80AJ01) (See0AJ01) (Not5AJ01) (See68AJ02)

  11. A=12Ne (1985AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion Batteries80AJ01) (See0AJ01) (Not5AJ01) (See68AJ02)5AJ01)

  12. A=12Ne (1990AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion Batteries80AJ01) (See0AJ01) (Not5AJ01)

  13. A=13Ne (1976AJ04)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion Batteries80AJ01)86AJ01) (Not91AJ01) (Not

  14. A=13Ne (1981AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion Batteries80AJ01)86AJ01) (Not91AJ01) (Not

  15. A=13Ne (1986AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion Batteries80AJ01)86AJ01) (Not91AJ01) (Not6AJ01) (Not

  16. A=13Ne (1991AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion Batteries80AJ01)86AJ01) (Not91AJ01) (Not6AJ01)

  17. A=16Ne (1977AJ02)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01) (Not93TI07) (Not illustrated)71AJ02)

  18. A=16Ne (1982AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01) (Not93TI07) (Not illustrated)71AJ02)82AJ01) (See

  19. A=16Ne (1986AJ04)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01) (Not93TI07) (Not illustrated)71AJ02)82AJ01)

  20. A=16Ne (1993TI07)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01) (Not93TI07) (Not illustrated)71AJ02)82AJ01)93TI07)

  1. A=16Ne (71AJ02)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01) (Not93TI07) (Not

  2. A=17Ne (1977AJ02)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01) (Not93TI07)93TI07) (See93TI07)

  3. A=17Ne (1982AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01) (Not93TI07)93TI07) (See93TI07)82AJ01) (See the

  4. A=17Ne (1986AJ04)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01) (Not93TI07)93TI07) (See93TI07)82AJ01) (See

  5. A=17Ne (1993TI07)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01) (Not93TI07)93TI07) (See93TI07)82AJ01) (See93TI07)

  6. A=17Ne (71AJ02)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01) (Not93TI07)93TI07) (See93TI07)82AJ01)

  7. A=18Ne (1959AJ76)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01)72AJ02) (See Energy Level3AJ01)

  8. A=18Ne (1978AJ03)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01)72AJ02) (See Energy Level3AJ01)1978AJ03) (See

  9. A=18Ne (1983AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01)72AJ02) (See Energy Level3AJ01)1978AJ03)

  10. A=18Ne (1987AJ02)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01)72AJ02) (See Energy Level3AJ01)1978AJ03)7AJ02) (See

  11. A=18Ne (1995TI07)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01)72AJ02) (See Energy Level3AJ01)1978AJ03)7AJ02)

  12. A=18Ne (72AJ02)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01)72AJ02) (See Energy

  13. A=19Ne (1959AJ76)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01)72AJ02) (See72AJ02)1959AJ76) (See Energy Level

  14. A=19Ne (1978AJ03)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01)72AJ02) (See72AJ02)1959AJ76) (See Energy

  15. A=19Ne (1983AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01)72AJ02) (See72AJ02)1959AJ76) (See Energy83AJ01)

  16. A=19Ne (1987AJ02)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01)72AJ02) (See72AJ02)1959AJ76) (See

  17. A=19Ne (1995TI07)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01)72AJ02) (See72AJ02)1959AJ76) (See95TI07) (See

  18. A=19Ne (72AJ02)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01)72AJ02) (See72AJ02)1959AJ76) (See95TI07)

  19. A=20Ne (1978AJ03)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01)72AJ02)78AJ03) (Not98TI06)3AJ01) (See78AJ03) (See

  20. A=20Ne (1983AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01)72AJ02)78AJ03) (Not98TI06)3AJ01) (See78AJ03)

  1. A=20Ne (1987AJ02)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01)72AJ02)78AJ03) (Not98TI06)3AJ01) (See78AJ03)7AJ02)

  2. A=20Ne (1998TI06)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01)72AJ02)78AJ03) (Not98TI06)3AJ01)

  3. A=20Ne (59AJ76)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01)72AJ02)78AJ03) (Not98TI06)3AJ01)59AJ76) (See Energy

  4. A=20Ne (72AJ02)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01)72AJ02)78AJ03) (Not98TI06)3AJ01)59AJ76) (See

  5. MiniBooNE E. D. Zimmerman

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OFDetectionBenchmark Performancelayerν µ

  6. MiniBooNE E. D. Zimmerman

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OFDetectionBenchmark Performancelayerν µLatest results

  7. MiniBooNE E. D. Zimmerman

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OFDetectionBenchmark Performancelayerν µLatest

  8. MiniBooNE Nuebar Data Release

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OFDetectionBenchmark Performancelayerν

  9. MiniBooNE Oscillation Results

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OFDetectionBenchmark PerformancelayerνOscillation Results

  10. MiniBooNE Pion Group

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OFDetectionBenchmark PerformancelayerνOscillation

  11. MiniBooNE Pion Group

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OFDetectionBenchmark PerformancelayerνOscillationPion

  12. MiniBooNE Steve Brice Fermilab

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OFDetectionBenchmarkResults and Follow-On Experiments W. 17

  13. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits & InspectionsBerylliumBiomimetic(cousin -in-law toofHomeAbout

  14. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits & InspectionsBerylliumBiomimetic(cousin -in-law toofHomeAboutThe

  15. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits & InspectionsBerylliumBiomimetic(cousin -in-law

  16. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits & InspectionsBerylliumBiomimetic(cousin -in-lawInteresting Facts

  17. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits & InspectionsBerylliumBiomimetic(cousin -in-lawInteresting

  18. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits & InspectionsBerylliumBiomimetic(cousin -in-lawInterestingPicture

  19. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits & InspectionsBerylliumBiomimetic(cousin

  20. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits & InspectionsBerylliumBiomimetic(cousinData Releases This page

  1. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits & InspectionsBerylliumBiomimetic(cousinData Releases This

  2. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits & InspectionsBerylliumBiomimetic(cousinData Releases ThisPlots The

  3. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits & InspectionsBerylliumBiomimetic(cousinData Releases ThisPlots

  4. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits & InspectionsBerylliumBiomimetic(cousinData Releases

  5. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits & InspectionsBerylliumBiomimetic(cousinData ReleasesProceedings

  6. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits & InspectionsBerylliumBiomimetic(cousinData

  7. BooNE: Booster Neutrino Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits & InspectionsBerylliumBiomimetic(cousinDataTalks and Proceedings

  8. The MicroBooNE Experiment - Collaboration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDidDevelopment TopMetathesisSediments and Related J.The

  9. The MicroBooNE Experiment - Publications

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDidDevelopment TopMetathesisSediments and Related

  10. NE - Nuclear Energy - Energy Conservation Plan

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing SwimmingMicrosoft Word1SustainabilityEnergyTO8:00AMENERGY

  11. NE Blog Archive | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing SwimmingMicrosoft The basics of small modular reactor

  12. NE Blog Archive | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing SwimmingMicrosoft The basics of small modular reactor2

  13. NE Blog Archive | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing SwimmingMicrosoft The basics of small modular reactor2Mars

  14. NE Press Releases | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing SwimmingMicrosoft The basics of small modularSeptember 20, 2013

  15. NE Press Releases | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing SwimmingMicrosoft The basics of small modularSeptember 20,

  16. NE Press Releases | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing SwimmingMicrosoft The basics of small modularSeptember 20,March

  17. NE Press Releases | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing SwimmingMicrosoft The basics of small modularSeptember

  18. NE Press Releases | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing SwimmingMicrosoft The basics of small modularSeptemberDecember

  19. NE Press Releases | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing SwimmingMicrosoft The basics of small

  20. NE Press Releases | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing SwimmingMicrosoft The basics of smallApril 6, 2010