National Library of Energy BETA

Sample records for moran rt marchand

  1. John A. Moran Eye Center

    E-Print Network [OSTI]

    Marc, Robert E.

    Normann Professor of Biomedical Engineering Adjunct Professor of Ophthalmology Artificial Vision Bradley#12;The John A. Moran Eye Center 2011 Visualizing Vision #12;John A. Moran Eye Center Research Profile · The Vision Institute · 21 NIH grants (18 JMEC, Vision Core) · 20 research

  2. Photo by Trevor Marchand Mud Masons of Mali

    E-Print Network [OSTI]

    Miller, Scott

    Photo by Trevor Marchand Mud Masons of Mali opened August 31, 2013 in the Focus Gallery, ob- jects and four films made in collaboration with five masons from Djenné, Mali. Ranging in age century (http://www.mnh.si.edu/ exhibits/mud-masons/). War in northern Mali and the overthrow of the gov

  3. Robert E. Marc Moran Eye Center

    E-Print Network [OSTI]

    Marc, Robert E.

    #12;Robert E. Marc Moran Eye Center University of Utah Disclosure REM is a principal of Signature IN RETINAL NEUROANATOMY Marc RE 2010 Synaptic Organization of the retina. Adler's Physiology of the Eye 7(3): e1000074 Marc RE 2009 Functional Anatomy of the Retina. Duane's Foundations of Clinical

  4. Public Data Structures: Counters as a Special Case Shlomo Moran

    E-Print Network [OSTI]

    Taubenfeld, Gadi

    Public Data Structures: Counters as a Special Case Hagit Brit Shlomo Moran Gadi Taubenfeld§ June 4, 2001 Abstract A public data structure is required to work correctly in a concurrent environment where many processes may try to access it, possibly at the same time. In implementing such a structure

  5. City of Moran, Kansas (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler, Iowa (Utility Company)Menasha,Monroe City,Moran, Kansas

  6. Identification of Local Clusters for Count Data: A Model-Based Moran's I Test

    E-Print Network [OSTI]

    Zhang, Tonglin

    in detecting local clusters by local association terms with an acceptable type I error probability. When usedIdentification of Local Clusters for Count Data: A Model-Based Moran's I Test Tonglin Zhang and Ge@wvu.edu 0 #12;Identification of Local Clusters for Count Data: A Model-Based Moran's I Test Abstract We set

  7. Air Entrainment by Contact Lines of a Solid Plate Plunged into a Viscous Fluid Antonin Marchand,1

    E-Print Network [OSTI]

    Air Entrainment by Contact Lines of a Solid Plate Plunged into a Viscous Fluid Antonin Marchand,1´te´roge`nes, UMR 7636 ESPCI -CNRS, Universite´ Paris-Diderot, 10 rue Vauquelin, 75005, Paris 2 Physics of Fluids)], typically 10 microns thick. The substrate is sufficiently clean and the vibrations sufficiently low to avoid

  8. Basing Cryptographic Protocols on Tamper-Evident Tal Moran,a,1,2

    E-Print Network [OSTI]

    Moran, Tal

    Basing Cryptographic Protocols on Tamper-Evident Seals$ Tal Moran,a,1,2 , Moni Naora,3 a are called "tamper-evident seals". Another physical object with this property is the "scratch-off card", of- ten used in lottery tickets. We consider three variations of tamper-evident seals, and show that under

  9. Anonymity and CSP for Voting Systems Murat Moran, James Heather, Steve Schneider

    E-Print Network [OSTI]

    Doran, Simon J.

    Anonymity and CSP for Voting Systems Murat Moran, James Heather, Steve Schneider Department Processes (CSP). In addition, we formalise conventional voting system with CSP and analyse whether our and the weak anonymity is more suitable specification for the voting processes. Keywords: anonymity, CSP

  10. Public Data Structures: Counters as a Special Case \\Lambda Hagit Brit y Shlomo Moran yz Gadi Taubenfeld x

    E-Print Network [OSTI]

    Moran, Shlomo

    Public Data Structures: Counters as a Special Case \\Lambda Hagit Brit y Shlomo Moran yz Gadi Taubenfeld x June 5, 2001 Abstract A public data structure is required to work correctly in a concurrent such a structure nothing can be assumed in advance about the number or the identities of the processes that might

  11. marchand-99.PDF

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26th AnnualHistoryM aterialsmFUSE: Functionmanaging the` [

  12. THEMATIC ISSUE ARTICLE: SYNTHESIS (rt9mheri1) Simulating a Model of Metabolic Closure

    E-Print Network [OSTI]

    -Bowden · Gabriel Piedrafita · Federico Mora´n · Mari´a Luz Ca´rdenas · Francisco Montero Received: 14 March 2012-Marseille Universite´, Marseille, France e-mail: acornish@imm.cnrs.fr G. Piedrafita Á F. Mora´n Á F. Montero Facultad

  13. MORAN, AMY CHRISTINE. A North Carolina Field Study to Evaluate Greenroof Runoff Quantity, Runoff Quality, and Plant Growth. (Under the direction of Gregory D. Jennings

    E-Print Network [OSTI]

    Hunt, William F.

    ABSTRACT MORAN, AMY CHRISTINE. A North Carolina Field Study to Evaluate Greenroof Runoff Quantity greenroofs were constructed for research and demonstration purposes in North Carolina; the first in North Carolina are Delosperma nubigenum, Sedum album, Sedum album murale, Sedum floriferum, Sedum

  14. moran-98.pdf

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26th AnnualHistoryMIII: TheJoint Statisticsmolybdenum |NERSC,77

  15. moran-99.PDF

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26th AnnualHistoryMIII: TheJoint Statisticsmolybdenum

  16. MAGNETIC CONFINEMENT OF RADIOTHERAPY BEAM-DOSE F.D. Becchetti, D.W. Litzenberg, J.M. Moran, T.W. O'Donnell, D.A. Roberts, B.A. Fraass, D.L.

    E-Print Network [OSTI]

    Becchetti, Fred

    MAGNETIC CONFINEMENT OF RADIOTHERAPY BEAM-DOSE PROFILES F.D. Becchetti, D.W. Litzenberg, J.M. Moran the magnetic confinement of HE electron and photon beam-dose profiles for typical radiotherapy beams. The HE magnetic field can provide a substantial improvement and control of the dose profile of clinical electron

  17. Parallel Picoliter RT-PCR Assays Using Microfluidics

    E-Print Network [OSTI]

    Quake, Stephen R.

    Parallel Picoliter RT-PCR Assays Using Microfluidics Joshua S. Marcus,, W. French Anderson The development of microfluidic tools for high-throughput nucleic acid analysis has become a burgeoning area of research in the post-genome era. Here, we have developed a microfluidic chip to perform 72 parallel 450-p

  18. RT-PCR cloning of expressed VSGs Harvesting cells

    E-Print Network [OSTI]

    Cross, George

    RT-PCR cloning of expressed VSGs Harvesting cells Starting material: 5­10x107 cells (BF) Centrifuge for at least 1 month). RNA extraction STAT-60 according to manufacturer's instructions. Resuspend RNA in 50 µl of DEPC-treated water. Measuring the A260 will suggest a yield of ~ 100 µg RNA from 108 cells

  19. Instruments of RT-2 Experiment onboard CORONASPHOTON and their test and evaluation II: RT-2/CZT payload

    E-Print Network [OSTI]

    Kotoch, Tilak B; Debnath, D; Malkar, J P; Rao, A R; Hingar, M K; Madhav, Vaibhav P; Sreekumar, S; Chakrabarti, Sandip K; 10.1007/s10686-010-9189-y

    2010-01-01

    Cadmium Zinc Telluride (CZT) detectors are high sensitivity and high resolution devices for hard X-ray imaging and spectroscopic studies. The new series of CZT detector modules (OMS40G256) manufactured by Orbotech Medical Solutions (OMS), Israel, are used in the RT-2/CZT payload onboard the CORONAS-PHOTON satellite. The CZT detectors, sensitive in the energy range of 20 keV to 150 keV, are used to image solar flares in hard X-rays. Since these modules are essentially manufactured for commercial applications, we have carried out a series of comprehensive tests on these modules so that they can be confidently used in space-borne systems. These tests lead us to select the best three pieces of the 'Gold' modules for the RT-2/CZT payload. This paper presents the characterization of CZT modules and the criteria followed for selecting the ones for the RT-2/CZT payload. The RT-2/CZT payload carries, along with three CZT modules, a high spatial resolution CMOS detector for high resolution imaging of transient X-ray ev...

  20. CAMELEON-RT: a Software Architecture Reference Model for Distributed, Migratable, and Plastic User

    E-Print Network [OSTI]

    CAMELEON-RT: a Software Architecture Reference Model for Distributed, Migratable, and Plastic User the problem space of distributed, migratable and plastic user interfaces, and presents CAMELEON-RT1 for distributed, migratable, and plastic user inter- faces. We have developed an early implementation of a run

  1. GreenRT: A Framework for the Design of Power-Aware Soft Real-Time Applications

    E-Print Network [OSTI]

    Mori, Greg

    and energy consumption. We experiment with GreenRT in the context of a pedestrian detection applica- tion. We show that using the GreenRT framework, appli- cations use less energy while meeting deadlines. EnergyGreenRT: A Framework for the Design of Power-Aware Soft Real-Time Applications Bo Chen, William Pak

  2. Intra-arterial administration of recombinant tissue-type plasminogen activator (rt-PA) causes more intracranial bleeding than does intravenous rt-PA in a transient rat middle cerebral artery occlusion model

    E-Print Network [OSTI]

    2011-01-01

    Access Intra-arterial administration of recombinant tissue-Intra-arterial (IA) administration of rt-PA for ischemicwith IA or intravenous (IV) administration especially as the

  3. LIVE CARS FOR USE IN CATFISH INDUSTRY Donald C. ,r nland, Rob rt L. ..rill,

    E-Print Network [OSTI]

    LIVE CARS FOR USE IN CATFISH INDUSTRY Donald C. ,r nland, Rob rt L. ..rill, & Jam's . IIall Live cars - -m sh "fish -holdmg bags "- -hav a vari tyof applications in th produ tion of pond - rai d chann fish to mov into th liv car . Information on holding capaciti and a m thod to accu- rat ly m t l' fish

  4. Power Minimization Techniques at the RT-Level and Afshin Abdollahi and Massoud Pedram

    E-Print Network [OSTI]

    Pedram, Massoud

    1 Power Minimization Techniques at the RT-Level and Below Afshin Abdollahi and Massoud Pedram Dept. of Electrical Engineering University of Southern California Los Angeles, CA 90089 U.S.A. Abstract ­ Power consumption and power-related issues have become a first-order concern for most designs and loom

  5. Modeling benzene plume elongation mechanisms exerted by ethanol using RT3D with a general

    E-Print Network [OSTI]

    Alvarez, Pedro J.

    Modeling benzene plume elongation mechanisms exerted by ethanol using RT3D with a general substrate ethanol on benzene fate and transport in fuel-contaminated groundwater and to discern the most influential benzene plume elongation mechanisms. The model, developed as a module for the Reactive Transport in 3

  6. RT-Based Administrative Models for Community Cyber Security Information Sharing

    E-Print Network [OSTI]

    Sandhu, Ravi

    RT-Based Administrative Models for Community Cyber Security Information Sharing Ravi Sandhu, Khalid Zaman Bijon Institute for Cyber Security World-Leading Research with Real Ravi Sandhu, Khalid Zaman Bijon Institute for Cyber Security University of Texas at San Antonio Oct. 15, 2011 International

  7. RT-Based Administrative Models for Community Cyber Security Information Sharing

    E-Print Network [OSTI]

    Sandhu, Ravi

    RT-Based Administrative Models for Community Cyber Security Information Sharing Ravi Sandhu, Khalid Zaman Bijon, Xin Jin, and Ram Krishnan Institute for Cyber Security & Department of Computer Science Institute for Cyber Security & Department of Electrical and Computer Engineering University of Texas at San

  8. Development of one-step SYBR Green real-time RT-PCR for quantifying bovine viral diarrhea virus type-1 and its comparison with conventional RT-PCR

    E-Print Network [OSTI]

    Zhang, Ni; Liu, Zhengwen; Han, Qunying; Qiu, Jianming; Chen, Jinghong; Zhang, Guoyu; Li, Zhu; Lou, Sai; Li, Na

    2011-07-29

    Background Bovine viral diarrhea virus (BVDV) is a worldwide pathogen in cattle and acts as a surrogate model for hepatitis C virus (HCV). One-step real-time fluorogenic quantitative reverse transcription polymerase chain reaction (RT-PCR) assay...

  9. Frog fence along Vermont Rt. 2 in sandbar wildlife management area collaboration between Vermont Agency of Transportation and Vermont Agency of Natural Resources

    E-Print Network [OSTI]

    Hoffman, Nelson

    2003-01-01

    FROG FENCE ALONG VERMONT RT. 2MANAGEMENT AREA COLLABORATION BETWEEN VERMONT AGENCY OFTRANSPORTATION AND VERMONT AGENCY OF NATURAL RESOURCES

  10. SU-E-J-42: Customized Deformable Image Registration Using Open-Source Software SlicerRT

    SciTech Connect (OSTI)

    Gaitan, J Cifuentes; Chin, L; Pignol, J; Kirby, N; Pouliot, J; Lasso, A; Pinter, C; Fichtinger, G

    2014-06-01

    Purpose: SlicerRT is a flexible platform that allows the user to incorporate the necessary images registration and processing tools to improve clinical workflow. This work validates the accuracy and the versatility of the deformable image registration algorithm of the free open-source software SlicerRT using a deformable physical pelvic phantom versus available commercial image fusion algorithms. Methods: Optical camera images of nonradiopaque markers implanted in an anatomical pelvic phantom were used to measure the ground-truth deformation and evaluate the theoretical deformations for several DIR algorithms. To perform the registration, full and empty bladder computed tomography (CT) images of the phantom were obtained and used as fixed and moving images, respectively. The DIR module, found in SlicerRT, used a B-spline deformable image registration with multiple optimization parameters that allowed customization of the registration including a regularization term that controlled the amount of local voxel displacement. The virtual deformation field at the center of the phantom was obtained and compared to the experimental ground-truth values. The parameters of SlicerRT were then varied to improve spatial accuracy. To quantify image similarity, the mean absolute difference (MAD) parameter using Hounsfield units was calculated. In addition, the Dice coefficient of the contoured rectum was evaluated to validate the strength of the algorithm to transfer anatomical contours. Results: Overall, SlicerRT achieved one of the lowest MAD values across the algorithm spectrum, but slightly smaller mean spatial errors in comparison to MIM software (MIM). On the other hand, SlicerRT created higher mean spatial errors than Velocity Medical Solutions (VEL), although obtaining an improvement on the DICE to 0.91. The large spatial errors were attributed to the poor contrast in the prostate bladder interface of the phantom. Conclusion: Based phantom validation, SlicerRT is capable of achieving comparable DIR accuracy to commercial programs such as MIM and VEL.

  11. Implementation and commissioning of an integrated micro-CT/RT system with computerized independent jaw collimation

    SciTech Connect (OSTI)

    Jensen, Michael D.; Hrinivich, W. Thomas; Jung, Jongho A.; Holdsworth, David W.; Department of Medical Biophysics, The University of Western Ontario, 1151 Richmond Street, London, Ontario N6A 3K7; Department of Surgery, The University of Western Ontario, 1151 Richmond Street, London, Ontario N6A 3K7 ; Drangova, Maria; Chen, Jeff; Department of Medical Biophysics, The University of Western Ontario, 1151 Richmond Street, London, Ontario N6A 3K7; Department of Oncology, The University of Western Ontario, 1151 Richmond Street, London, Ontario N6A 3K7 ; Wong, Eugene; Department of Medical Biophysics, The University of Western Ontario, 1151 Richmond Street, London, Ontario N6A 3K7; Department of Oncology, The University of Western Ontario, 1151 Richmond Street, London, Ontario N6A 3K7; Department of Physics and Engineering, London Regional Cancer Program, London Health Sciences Centre, 800 Commissioners Road East, London, Ontario N6A 5W9

    2013-08-15

    Purpose: To design, construct, and commission a set of computer-controlled motorized jaws for a micro-CT/RT system to perform conformal image-guided small animal radiotherapy.Methods: The authors designed and evaluated a system of custom-built motorized orthogonal jaws, which allows the delivery of off-axis rectangular fields on a GE eXplore CT 120 preclinical imaging system. The jaws in the x direction are independently driven, while the y-direction jaws are symmetric. All motors have backup encoders, verifying jaw positions. Mechanical performance of the jaws was characterized. Square beam profiles ranging from 2 × 2 to 60 × 60 mm{sup 2} were measured using EBT2 film in the center of a 70 × 70 × 22 mm{sup 3} solid water block. Similarly, absolute depth dose was measured in a solid water and EBT2 film stack 50 × 50 × 50 mm{sup 3}. A calibrated Farmer ion chamber in a 70 × 70 × 20 mm{sup 3} solid water block was used to measure the output of three field sizes: 50 × 50, 40 × 40, and 30 × 30 mm{sup 2}. Elliptical target plans were delivered to films to assess overall system performance. Respiratory-gated treatment was implemented on the system and initially proved using a simple sinusoidal motion phantom. All films were scanned on a flatbed scanner (Epson 1000XL) and converted to dose using a fitted calibration curve. A Monte Carlo beam model of the micro-CT with the jaws has been created using BEAMnrc for comparison with the measurements. An example image-guided partial lung irradiation in a rat is demonstrated.Results: The averaged random error of positioning each jaw is less than 0.1 mm. Relative output factors measured with the ion chamber agree with Monte Carlo simulations within 2%. Beam profiles and absolute depth dose curves measured from the films agree with simulations within measurement uncertainty. Respiratory-gated treatments applied to a phantom moving with a peak-to-peak amplitude of 5 mm showed improved beam penumbra (80%–20%) from 3.9 to 0.8 mm.Conclusions: A set of computer-controlled motorized jaws for a micro-CT/RT system were constructed with position reliably better than a tenth of a millimeter. The hardware system is ready for image-guided conformal radiotherapy for small animals with capability of respiratory-gated delivery.

  12. Automatic Systole-Diastole Classification of Mitral Valve Complex from RT-3D Echocardiography based on Multiresolution Processing

    E-Print Network [OSTI]

    Wong, Kenneth K.Y.

    Automatic Systole-Diastole Classification of Mitral Valve Complex from RT-3D Echocardiography based, The Chinese University of Hong Kong, Hong Kong ABSTRACT Mitral valve repair is one of the most prevalent operations for various mitral valve conditions. Echocardiography, being famous for its low-cost, non

  13. Oceanography Vol.21, No.392 W o r k s h o p r e p o rt

    E-Print Network [OSTI]

    Buesseler, Ken

    Oceanography Vol.21, No.392 W o r k s h o p r e p o rt Controls on organic Carbon exportUroCeANs Workshop Vrije Universiteit Brussel · May 28­30, 2008 ThisarticlehasbeenpublishedinOceanography,Volume21,Number3,aquarterlyjournalofTheOceanographySociety.Copyright2008byTheOceanography

  14. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth disease virus and look-alike disease viruses

    SciTech Connect (OSTI)

    Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P

    2007-07-26

    A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  15. Reduced Toxicity With Intensity Modulated Radiation Therapy (IMRT) for Desmoplastic Small Round Cell Tumor (DSRCT): An Update on the Whole Abdominopelvic Radiation Therapy (WAP-RT) Experience

    SciTech Connect (OSTI)

    Desai, Neil B.; Stein, Nicholas F.; LaQuaglia, Michael P.; Alektiar, Kaled M.; Kushner, Brian H.; Modak, Shakeel; Magnan, Heather M.; Goodman, Karyn; Wolden, Suzanne L.

    2013-01-01

    Purpose: Desmoplastic small round cell tumor (DSRCT) is a rare malignancy typically involving the peritoneum in young men. Whole abdominopelvic radiation therapy (WAP-RT) using conventional 2-dimensional (2D) radiation therapy (RT) is used to address local recurrence but has been limited by toxicity. Our objectives were to assess the benefit of intensity modulated radiation therapy (IMRT) on toxicity and to update the largest series on radiation for DSRCT. Methods and Materials: The records of 31 patients with DSRCT treated with WAP-RT (22 with 2D-RT and 9 with IMRT) between 1992 and 2011 were retrospectively reviewed. All received multi-agent chemotherapy and maximal surgical debulking followed by 30 Gy of WAP-RT. A further focal boost of 12 to 24 Gy was used in 12 cases. Boost RT and autologous stem cell transplantation were nearly exclusive to patients treated with 2D-RT. Toxicities were assessed with the Common Terminology Criteria for Adverse Events. Dosimetric analysis compared IMRT and simulated 2D-RT dose distributions. Results: Of 31 patients, 30 completed WAP-RT, with a median follow-up after RT of 19 months. Acute toxicity was reduced with IMRT versus 2D-RT: P=.04 for gastrointestinal toxicity of grade 2 or higher (33% vs 77%); P=.02 for grade 4 hematologic toxicity (33% vs 86%); P=.01 for rates of granulocyte colony-stimulating factor; and P=.04 for rates of platelet transfusion. Post treatment red blood cell and platelet transfusion rates were also reduced (P=.01). IMRT improved target homogeneity ([D05-D95]/D05 of 21% vs 46%) and resulted in a 21% mean bone dose reduction. Small bowel obstruction was the most common late toxicity (23% overall). Updated 3-year overall survival and progression-free survival rates were 50% and 24%, respectively. Overall survival was associated with distant metastasis at diagnosis on multivariate analysis. Most failures remained intraperitoneal (88%). Conclusions: IMRT for consolidative WAP-RT in DSRCT improves hematologic toxicity in particular. Although the long-term efficacy of current treatment options remains disappointing, the improved therapeutic index of IMRT may aid in generalizing its use and allowing the addition of novel approaches such as intraperitoneal immunotherapy.

  16. Cko.efer f. (i.f\\~f':tn\\ltt E'~~CS'\\'~ A~\\ !f~ \\fb a... 'T":~4.r.-t..

    E-Print Network [OSTI]

    Li, Kin-Yin

    QC~-®! Cko.efer f. (i.f\\~f':tn\\ltt E'~~CS'\\'~ A~\\ !f~ \\fb a... 'T":~4.r.-t.. ~c-l.;~. ~e...CA weo

  17. CURRICULUM VITAE ROSALYN J MORAN PhD

    E-Print Network [OSTI]

    Moran, Rosalyn

    of Computational Neuroscience - Physica D - Biological Cybernetics - Frontiers in Human Neuroscience Ad, NOVA Technology Transfer Centre, University College Dublin. Nov 2005. Invited Speaker, Campus Company Development Program, NOVA Technology Transfer Centre, University College Dublin. Sept 2006. Student Award

  18. Metallicity Distribution in the Milky Way Disk Dana S. Balser, R.T. Rood, T.M. Bania, L.D. Anderson

    E-Print Network [OSTI]

    Balser, Dana S.

    al. (2006) Sun GC #12;Electron Temperature Radial Gradient K200)(T R)49257()4986406(T e galeMetallicity Distribution in the Milky Way Disk Dana S. Balser, R.T. Rood, T.M. Bania, L.D. Anderson Photo: Harry Morton #12;HII Region Electron Temperature and Metallicity Shaver et al. (1983) 1.15 e C L

  19. Assessing Terrain Stability in a GIS using SINMAP Pack, R.T. Research Associate Professor, Tarboton, D.G., Associate Professor1

    E-Print Network [OSTI]

    Tarboton, David

    Assessing Terrain Stability in a GIS using SINMAP Pack, R.T. Research Associate Professor, Tarboton State University, Logan, UT 84322-5230 Presented at the 15th annual GIS conference, GIS 2001, February 19-22, Vancouver, British Columbia Abstract SINMAP (Stability Index MAPping) is an ArcView GIS

  20. arXiv:1105.4207v1[math.RT]21May2011 Affine and degenerate affine BMW algebras: The center

    E-Print Network [OSTI]

    Ram, Arun

    arXiv:1105.4207v1[math.RT]21May2011 Affine and degenerate affine BMW algebras: The center Zajj of California, Davis One Shields Ave Davis, CA 95616 virk@math.ucdavis.edu Abstract The degenerate affine and affine BMW algebras arise naturally in the context of Schur- Weyl duality for orthogonal and symplectic

  1. The implementation of non pharmaceutical interventions(NPIs) in smaller to large communities and its relation to RO and R(t) during HIN1 pandemic 2009

    E-Print Network [OSTI]

    Hashmi, Sahar

    2011-01-01

    This thesis focuses on the use of non-pharmaceutical interventions (NPIs) during the time of the 2009 HINI pandemic and its possible relation to RO and R(t). RO is defined as the mean number of people that a newly infected ...

  2. Methanol Masers Observations in the 3-mm Bandwidth at the Radio Telescope RT-22 CrAO

    E-Print Network [OSTI]

    S. Yu. Zubrin; A. V. Antyufeyev; V. V. Myshenko; V. M. Shulga

    2007-12-10

    We report the beginning of the astronomical masers investigations in the 3-mm bandwidth at the radio telescope RT-22 (CrAO, Ukraine). For this purpose the special complex for maser lines investigation in 85...115 GHz frequency band is developed. It is made on the base of the low noise cryogenic Shottky-diode receiver and the high resolution Fourier-spectrometer. The cryogenic receiver has the DSB noise temperature less than 100K. The spectral channel separation of the Fourier-spectrometer is about 4kHz and the spectrometer bandwidth is 8 MHz. Results of maser observations of 8$^{0}-7^{1} $A$^{+}$ transition of methanol (95.169 GHz) towards DR-21(OH), DR-21W and NGC7538 are in good agreement with early obtained results by other authors. On the basis of the analysis of the location of masers in the NGC7538 direction we can assume that the origin of all known class I methanol masers in this region is connected with existing molecular outflows from young stars.

  3. SF 6432-RT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    version electronically. (b) Training Requirements. Any Contractor personnel who will enter a government site to perform work shall have completed all of the ES&H training...

  4. SF 6432-RT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    who require access must be U.S. citizens, or foreign nationals who are legal aliens or have the required authorization to perform work in the U.S. and must meet rules of...

  5. Austin(2)-RT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O O DBiomass andAtoms for PeaceAugustAugust,Stratus Sensing in

  6. RepoRt B

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMassR&D100 Winners *ReindustrializationEnergyWind Energy Wind FindBPA Profile The

  7. RepoRt B

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMassR&D100 Winners *ReindustrializationEnergyWind Energy Wind FindBPA Profile The1

  8. SF 6432-RT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation of Fe(II) byMultidayAlumni > The EnergyRyanPhysics6/14/11 Page 1 of6432-NIRT

  9. SF 6432-RT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation of Fe(II) byMultidayAlumni > The EnergyRyanPhysics6/14/11 Page 1 of6432-NIRTRT

  10. SF 6432-RT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation of Fe(II) byMultidayAlumni > The EnergyRyanPhysics6/14/11 Page 1 of6432-NIRTRTRT

  11. Application of real time transient temperature (RT{sup 3}) program on nuclear power plant HVAC analysis

    SciTech Connect (OSTI)

    Cai, Y.; Tomlins, V.A.; Haskell, N.L.; Giffels, F.W.

    1996-08-01

    A database oriented technical analysis program (RT) utilizing a lumped parameter model combined with a finite difference method was developed to concurrently simulate transient temperatures in single or multiple room(s)/area(s). Analyses can be seen for postulated design basis events, such as, 10CFR50 Appendix-R, Loss of Coolant Accident concurrent with Loss of Offsite Power (LOCA/LOOP), Station BlackOut (SBO), and normal station operating conditions. The rate of change of the air temperatures is calculated by explicitly solving a series of energy balance equations with heat sources and sinks that have been described. For building elements with heat absorbing capacity, an explicit Forward Time Central Space (FTCS) model of one dimensional transient heat conduction in a plane element is used to describe the element temperature profile. Heat migration among the rooms/areas is considered not only by means of conduction but also by means of natural convection induced by temperature differences through openings between rooms/areas. The program also provides a means to evaluate existing plant HVAC system performance. The performance and temperature control of local coolers/heaters can be also simulated. The program was used to calculate transient temperature profiles for several buildings and rooms housing safety-related electrical components in PWR and BWR nuclear power plants. Results for a turbine building and reactor building in a BWR nuclear power plant are provided here. Specific calculational areas were defined on the basis of elevation, physical barriers and components/systems. Transient temperature profiles were then determined for the bounding design basis events with winter and summer outdoor air temperatures.

  12. Preparation of genomic DNA for PCR 1. Centrifuge 5 mL of a saturated overnight culture of yeast cells at 5000 x g for 5 min at RT.

    E-Print Network [OSTI]

    Pace, Norman

    Preparation of genomic DNA for PCR 1. Centrifuge 5 mL of a saturated overnight culture of yeast water. 3. Transfer volume to screw-cap eppi tube and centrifuge at 5,000 x g for 5 min at RT. 4L of sterile glass beads and 200 µL of phenol-chloroform-isoamyl alcohol. 7. Vortex 15 min at RT. 8. Centrifuge

  13. TU-F-17A-06: Motion Stability and Dosimetric Impact of Spirometer-Based DIBH-RT of Left-Sided Breast Cancer

    SciTech Connect (OSTI)

    McKenzie, E; Yang, W; Burnison, M; Mirhadi, A; Hakimian, B; Stephen, S; Robert, R; Yue, Y; Sandler, H; Fraass, B

    2014-06-15

    Purpose: Patients undergoing radiotherapy (RT) for left-sided breast cancer have increased risk of coronary artery disease. Deep Inhalation Breath Hold assisted RT (DIBH-RT) is shown to increase the geometric separation of the target area and heart, reducing cardiac radiation dose. The purposes of this study are to use Cine MV portal images to determine the stability of spirometer-guided DIBH-RT and examine the dosimetric cardiopulmonary impact of this technique. Methods: Twenty consecutive patients with left-sided breast cancer were recruited to the IRB-approved study. Free-breathing (FB) and DIBH-CT's were acquired at simulation. Rigid registration of the FB-CT and DIBH-CT was performed using primarily breast tissue. Treatment plans were created for each FB-CT and DIBH-CT using identical paired tangent fields with field-in-field or electronic compensation techniques. Dosimetric evaluation included mean and maximum (Dmax) doses for the left anterior descending artery (LAD), mean heart dose, and left lung V20. Cine MV portal images were acquired for medial and lateral fields during treatment. Analysis of Cine images involved chest wall segmentation using an algorithm developed in-house. Intra- and inter-fractional chest wall motion were determined through affine registration to the first frame of each Cine. Results: Dose to each cardiac structure evaluated was significantly (p<0.001) reduced with the DIBH plans. Mean heart dose decreased from 2.9(0.9–6.6) to 1.6(0.6–5.3) Gy; mean LAD dose from 16.6(3–43.6) to 7.4(1.7–32.7) Gy; and LAD Dmax from 35.4 (6.1–53) to 18.4(2.5–51.2) Gy. No statistically significant reduction was found for the left lung V20. Average AP and SI median chest wall motion (intrafractional) was 0.1 (SD=0.9) and 0.5 (SD=1.1) mm, respectively. Average AP inter-fractional chest wall motion was 2.0 (SD=1.4) mm. Conclusion: Spirometer-based DIBH treatments of the left breast are reproducible both inter- and intra-fractionally, and provide a statistically and potentially clinically useful dosimetric advantage to cardiac structures.

  14. Fast Analytical Continuum Treatments of Solvation Franois Marchand and Amedeo Caflisch

    E-Print Network [OSTI]

    Caflisch, Amedeo

    in the simulation system, at the price of high computational cost. In fact, the solvent molecules greatly increase]. Furthermore, such a model directly yields the so-called effective energy, which is the sum of the solute potential energy in vacuo and the solvation free energy. In contrast, explicit water simulations have

  15. Microsoft PowerPoint - Marchand_ARM_STM_2008_Poster_Classification_II.ppt

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on darkMicroorganismsnow widely usingOverviewRepresentativeness

  16. Development and Characterization of A Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out

    SciTech Connect (OSTI)

    Smith, S M; Danganan, L; Tammero, L; Vitalis, B; Lenhoff, R; Naraghi-arani, P; Hindson, B

    2007-08-06

    Lawrence Livermore National Laboratory (LLNL), in collaboration with the Department of Homeland Security (DHS) and the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Services (APHIS) has developed candidate multiplexed assays that may potentially be used within the National Animal Health Laboratory Network (NAHLN), the National Veterinary Services Laboratory (Ames, Iowa) and the Plum Island Animal Disease Center (PIADC). This effort has the ability to improve our nation's capability to discriminate between foreign animal diseases and those that are endemic using a single assay, thereby increasing our ability to protect food and agricultural resources with a diagnostic test which could enhance the nation's capabilities for early detection of a foreign animal disease. In FY2005 with funding from the DHS, LLNL developed the first version (Version 1.0) of a multiplexed (MUX) nucleic-acid-based RT-PCR assay that included signatures for foot-and-mouth disease virus (FMDV) detection with rule-out tests for two other foreign animal diseases (FADs) of swine, Vesicular Exanthema of Swine (VESV) and Swine Vesicular Disease Virus (SVDV), and four other domestic viral diseases Bovine Viral Diarrhea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1), Bluetongue virus (BTV) and Parapox virus complex (which includes Bovine Papular Stomatitis Virus [BPSV], Orf of sheep, and Pseudocowpox). In FY06, LLNL has developed Bovine and Porcine species-specific panel which included existing signatures from Version 1.0 panel as well as new signatures. The MUX RT-PCR porcine assay for detection of FMDV includes the FADs, VESV and SVD in addition to vesicular stomatitis virus (VSV) and porcine reproductive and respiratory syndrome (PRRS). LLNL has also developed a MUX RT-PCR bovine assay for detection of FMDV with rule out tests for the two bovine FADs malignant catarrhal fever (MCF), rinderpest virus (RPV) and the domestic diseases vesicular stomatitis virus (VSV), bovine viral diarrhea virus (BVDV), infectious bovine rhinotracheitus virus (BHV-1), bluetongue virus (BTV), and the Parapox viruses (which are of two bovine types) bovine papular stomatitis virus (BPSV) and psuedocowpox (PCP). A timeline for this development is presented in Table 1. The development of the Version 1.0 panel for FMDV rule-out and the most current efforts aimed to designed species specific panels has spanned over 2 1/2 years with multiple collaborative partnerships. This document provides a summary of the development, testing and performance data at OIE Stage 1 Feasibility into Stage 2 Assay Development and Standardization1 (see Table 2), gathered as of June 30th, 2007 for the porcine and bovine MUX assay panels. We present an overview of the identification and selection of candidate genetic signatures, the assay development process, and preliminary performance data for each of the individual signatures as characterized in the multiplexed format for the porcine and bovine panels. The Stage 1 Feasibility data of the multiplexed panels is presented in this report also includes relevant data acquired from the Version 1.0 panel as supporting information where appropriate. In contrast to last years effort, the development of the bovine and porcine panels is pending additional work to complete analytical characterization of FMDV, VESV, SVD, RPV and MCF. The signature screening process and final panel composition impacts this effort. The unique challenge presented this year was having strict predecessor limitations in completing characterization, where efforts at LLNL must precede efforts at PIADC, such challenges were alleviated in the 2006 reporting by having characterization data from the interlaboratory comparison and at Plum Island under AgDDAP project. We will present an addendum at a later date with additional data on the characterization of the porcine and bovine multiplex assays when that data is available. As a summary report, this document does not provide the details of signature generation, evaluation, and testing, nor does it provide spec

  17. Cloud Monitoring for Large Cosmic Ray Sites R.W. Clay, B.R. Dawson, R.T. Pace, D.S. Riordan, A.G.K. Smith, N.R. Wild

    E-Print Network [OSTI]

    OG 4.5.23 Cloud Monitoring for Large Cosmic Ray Sites R.W. Clay, B.R. Dawson, R.T. Pace, D monitoring of the cloud distribution in the night sky within the experimental fiducial volume. We have developed infra-red detectors which are capa- ble of responding to cloud in daytime or night-time. We

  18. NOAA Technical Rep_o_rt_N_M_F_S_l_2_4 o_c_to_b_er_I_99_5 Effects of the Cessation of

    E-Print Network [OSTI]

    NOAA Technical Rep_o_rt_N_M_F_S_l_2_4 o_c_to_b_er_I_99_5 Effects of the Cessation of Sewage Sludge Technical Report NMFS 124 A Technical Report of the Fishery Bulletin Effects of the Cessation of Sewage Sludge Dumping at the 12-Mile Site Proceedings ofthe 12-Mile Dumpsite Symposium Ocean Place Hilton Hotel

  19. MICRON MOUSE IMAGING SYSTEM The Micron Mouse Imaging System is a Core Resource for the Moran

    E-Print Network [OSTI]

    Marc, Robert E.

    light source/power supply (K) Micron camera base and mounting arm (E) Micron custom light guide (L, amplifier, light source, monitor power cables #12;3 SYSTEM PARTS LIGHT SOURCE CAMERA AMPLIFIER Quick keyB steps Press DISP to exit CAMERA NEUTRAL DENSITY KNOB LIGHT GUIDE DO NOT TOUCH LIGHT GUIDE CONNECTOR

  20. The link between Darwin and antioxidants from olives Moran Brouk (Dr. Ayelet Fishman-supervisor)

    E-Print Network [OSTI]

    as an antioxidant for either pharmaceutical or food preparations (i.e. functional foods). Despite the great-supervisor) Department of Biotechnology and Food Engineering, Technion-Israel Institute of Technology, Haifa, 32000

  1. Frequency and longitudinal trends of household care product use Rebecca E. Moran a

    E-Print Network [OSTI]

    Leistikow, Bruce N.

    SUPERB Indoor environment d-limonene a b s t r a c t The use of household cleaning products and air infiltrating to the indoor environment to form potentially toxic secondary pollutants. Although realistic, frequencies of use of eight types of household cleaning products and air fresheners and the performance

  2. Comments from Congressman James P. Moran, 8th District of Virginia...

    Energy Savers [EERE]

    of Schnader Harrison Segal and Lewis LLP and City Attorney, Ignacio B. Pessoa, and offer my additional comments on the Tuesday, December 20th order governing future operations...

  3. Department of Energy Reply to Congressman James P. Moran | Department of

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-in electricLaboratory |EducationDepartment5-3:Washington, D.C.

  4. Comments from Congressman James P. Moran, 8th District of Virginia

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-in electric vehicle (PEV)Day-June 22, 2015 | DepartmentSupporting the

  5. STAT U S R E V I E W O F K I N G M AC K E R E L I N T H E G U L F O F M E X I C O F E AT U R E A RT I C L E 3

    E-Print Network [OSTI]

    and the Gulf of Mexico group. Both groups undergo long-distance migrations each year from the northern part they feed on large schools of baitfish.The Gulf of Mexico group splits during the winter migration with some A RT I C L E 3 Status Review of King Mackerel in the Gulf of Mexico Feature Article 3 CHRISTOPHER M

  6. Multiple Pedestrian Tracking using Colour and Motion Models Zhengqiang Jiang, Du Q. Huynh, William Moran, Subhash Challa and Nick Spadaccini

    E-Print Network [OSTI]

    Huynh, Du

    Multiple Pedestrian Tracking using Colour and Motion Models Zhengqiang Jiang, Du Q. Huynh, William information to track pedestrians in video sequences captured by a fixed camera. Pedestrians are firstly-based model, we extract a 4-dimensional colour histogram for each detected pedestrian window and compare

  7. SEMI-ANNUAL REPORTS FOR FREEPORT McMoran - FE DKT. NO. 13-26-LNG - ORDER

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterestedReplacement-2-AA-1 SECTION J APPENDIX A ADVANCE- FE DKT.3365NO. 3600LLC -3290 |

  8. Development and Characterization of a Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out Supplemental Materials

    SciTech Connect (OSTI)

    Smith, S; Danganan, L; Tammero, L; Lenhoff, R; Naraghi-arani, P; Hindson, B

    2007-08-06

    Lawrence Livermore National Laboratory (LLNL), in collaboration with the Department of Homeland Security (DHS) and the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Services (APHIS) has developed advanced rapid diagnostics that may be used within the National Animal Health Laboratory Network (NAHLN), the National Veterinary Services Laboratory (Ames, Iowa) and the Plum Island Animal Disease Center (PIADC). This effort has the potential to improve our nation's ability to discriminate between foreign animal diseases and those that are endemic using a single assay, thereby increasing our ability to protect animal populations of high economic importance in the United States. Under 2005 DHS funding we have developed multiplexed (MUX) nucleic-acid-based PCR assays that combine foot-and-mouth disease virus (FMDV) detection with rule-out tests for two other foreign animal diseases Vesicular Exanthema of Swine (VESV) and Swine Vesicular Disease (SVD) and four other domestic viral diseases Bovine Viral Diarrhea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1 or Infectious Bovine Rhinotracheitus IBR), Bluetongue virus (BTV) and Parapox virus complex (which includes Bovine Papular Stomatitis Virus BPSV, Orf of sheep, and Pseudocowpox). Under 2006 funding we have developed a Multiplexed PCR [MUX] porcine assay for detection of FMDV with rule out tests for VESV and SVD foreign animal diseases in addition to one other domestic vesicular animal disease vesicular stomatitis virus (VSV) and one domestic animal disease of swine porcine reproductive and respiratory syndrome (PRRS). We have also developed a MUX bovine assay for detection of FMDV with rule out tests for the two bovine foreign animal diseases malignant catarrhal fever (MCF), rinderpest virus (RPV) and the domestic diseases vesicular stomatitis virus (VSV), bovine viral diarrhea virus (BVDV), infectious bovine rhinotracheitus virus (BHV-1), bluetongue virus (BTV), and the Parapox viruses which are of two bovine types bovine papular stomatitis virus (BPSV) and psuedocowpox (PCP). This document provides details of signature generation, evaluation, and testing, as well as the specific methods and materials used. A condensed summary of the development, testing and performance of the multiplexed assay panel was presented in a 126 page separate document, entitled 'Development and Characterization of A Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out'. This supplemental document provides additional details of large amount of data collected for signature generation, evaluation, and testing, as well as the specific methods and materials used for all steps in the assay development and utilization processes. In contrast to last years effort, the development of the bovine and porcine panels is pending additional work to complete analytical characterization of FMDV, VESV, VSV, SVD, RPV and MCF. The signature screening process and final panel composition impacts this effort. The unique challenge presented this year was having strict predecessor limitations in completing characterization, where efforts at LLNL must preceed efforts at PIADC, such challenges were alleviated in the 2006 reporting by having characterization data from the interlaboratory comparison and at Plum Island under AgDDAP project. We will present an addendum at a later date with additional data on the characterization of the porcine and bovine multiplex assays when that data is available.

  9. 2010 AnnuAl RepoRt Whitehead Institute

    E-Print Network [OSTI]

    Sabatini, David M.

    5 Jacob Hanna (Jaenisch lab) PAGE 6 Adapted with permission, Development, Gutzman and Sive, Mar 1 with glucocorticoids to promote BFU-E progenitor self-renewal". Flygare J, Rayon Estrada V, Shin C, Gupta S, Lodish HF

  10. 20072008 Complete RepoRt Table of Contents LEHIGH UNIVERSITY

    E-Print Network [OSTI]

    Napier, Terrence

    . Balding '70 ++ W. Gregg Baldwin '74 Wendy and Gary Balter '11P Terry E. Banet '83 Jane Bannan '54 '05GP ++ Peter C. Bayer '60 '84P Theodore F. Bayer '70 Margaret Bearn William G. Beattie '59 '88P '93P ++ Blythe

  11. C tr ti N R rt Construction News Report

    E-Print Network [OSTI]

    floor. · Continued storm pipe on the 3rd floor. · Continued heating hot water lines on the 3rd floorg on the 2nd floor. St t d i t i ll f i th 2 d fl Continued heating hot water lines on the 3rd floor temporary routing out of the building. · Completed heating hot water mains on the 2nd floor. Bid Package 312

  12. La matire grise RAPPoRt 2008-2010

    E-Print Network [OSTI]

    Shoubridge, Eric

    Personnel infirmier: Notre centre névralgique 14 Initiatives du CECR: Idées brillantes 16 Séries de infirmiers, neuroscience Patricia O'Connor, IA, M. Sc. A., CHE1 Lucia Fabijan, B. Sc. Inf., M. Sc. A. 1 Directrice des soins infirmiers & infirmière en chef au Centre universitaire de santé McGill depuis octobre

  13. Kraft Rt Kraft Electronics Inc | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas: Energy ResourcesOrderInformationKizildereTexas:Solar IncKrafla Geothermal

  14. NEAC-RT ComLtr 11.1.12

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties -Department of EnergyNEW YORKFuel Cycle

  15. Error Probability Bounds for Balanced Binary Relay Trees Zhenliang Zhang, Ali Pezeshki, William Moran, Stephen D. Howard, and Edwin K. P. Chong

    E-Print Network [OSTI]

    Pezeshki, Ali

    as a star architecture [1]­[15],[31], in which all sensors directly connect to the fusion center. A typical and independent sensors. The root of the tree represents a fusion center that makes the overall detection decision the sensors is aggregated into the fusion center via the intermediate relay nodes. In this context, we

  16. [2] O. Biran, S. Moran, and S. Zaks. A combinatorial characterization of the distributed 1solvable tasks. Journal of Algorithm 11, pages 420--440, 1990.

    E-Print Network [OSTI]

    Moran, Shlomo

    . Information and Computation, 105(1):132--158, July 1993. [6] A. Fekete. Asynchronous approximate agreement event e(i), associated with processor P i . This mapping should guarantee that if s is fair for i, then the run M dm (c; s) is fair for p i . By varying the way in which e(i) depends on P i , various

  17. Hydrologic and Aquatic Species Implications of the Proposed Pebble Mine, Bristol Bay, Alaska

    E-Print Network [OSTI]

    Cundy, Fiona

    2012-01-01

    causing  acid  mine  drainage   (Moran  2007).     Problem  potential  for  acid  mine  drainage,  due  to  the   high  

  18. Quantum State Protection and Transfer Using Superconducting Qubits

    E-Print Network [OSTI]

    Keane, Kyle Michael

    2012-01-01

    relaxation . . . . . . . . .1.5 Superconducting ? ux-biasedCorrection Algorithms for Superconducting Qubits,” APS Marchand correction for superconducting qubits,” Phys. Rev. A,

  19. Advertising Stigmatas: The Evolution of Advertising in American Poetic Culture

    E-Print Network [OSTI]

    Spies, Elizabeth Jean

    2010-01-01

    1998. Wicke, Jennifer. Advertising Fictions: Literature,2005. Marchand, Roland. Advertising and the American Dream:DoubleDay Mitchell, Andrew. Advertising, Exposure, Memory,

  20. CIRAAnnuAl RepoRt 2005-2006AnnuAl RepoRt 2005-2006 CIRA ANNUAL REPORT FY 05/06

    E-Print Network [OSTI]

    Collett Jr., Jeffrey L.

    State University Department of Economics/CIRA Mark DeMaria, Colorado State University NOAA RAMM BranchSat and National Park Service Air Quality Research Division activities) to allow the reader a more complete with the infrastructure and intellectual talent produced and used by both sides of the funded activities. For further

  1. EuropeanEuropean ControlControl ConferenceConference,, KosKos RT 2007RT 2007 Randomized Algorithms for Systems and

    E-Print Network [OSTI]

    Tempo, Roberto

    was invented by Metropolis, UlamUlam, von, von Neumann, Fermi,Neumann, Fermi, ...... (Manhattan project)(Manhattan project) Las Vegas first appeared in computer science in the lateLas Vegas first appeared in computer

  2. This list does not imply DOE endorsement of the individuals or...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    416-969-6413 Ontario, CANADA Moran, Milton milton.moran@phifer.com 205-750-3068 AL Morris, Nick Nick.Morris@Xyleminc.com UNITED KINGDOM Morrison, Stuart stuart.morrison@clydeun...

  3. This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research

    E-Print Network [OSTI]

    Wahlberg, Niklas

    et al., 2003), insects (Mardulyn and Whitfield, 1999; Jordal et al., 2000; Von Dohlen and Moran, 2000

  4. Phylogenetics of Coenonymphina (Nymphalidae: Satyrinae) and the problem of rooting rapid radiations

    E-Print Network [OSTI]

    Wahlberg, Niklas

    et al., 2003), insects (Mardulyn and Whitfield, 1999; Jordal et al., 2000; Von Dohlen and Moran, 2000

  5. The Role of Native Riparian Vegetation in Resisting Invasion by Giant Reed, Arundo donax

    E-Print Network [OSTI]

    Palenscar, Kai

    2012-01-01

    see Quinn & Holt 2004) or biocontrol agents (Moran & Goolsbyagent for giant reed, Arundo donax (Poales: Poaceae) in North America. Biocontrol

  6. nature immunology VOLUME 13 NUMBER 12 DECEMBER 2012 1155 A rt i c l e s

    E-Print Network [OSTI]

    Zhijie, Liu

    system provides a critical first line of defense against invading microorganisms, including pathogenic a wide variety of highly invariant molecular structures known as `pathogen-associated molecular pat bacterial pathogens use cyclic diguanosine monophosphate (c-di-GMP) or cyclic diadenosine monophosphate (c

  7. The Florida State University Foundation 20112012 AnnuAl RepoRt

    E-Print Network [OSTI]

    McQuade, D. Tyler

    assets giFt Commitment By PUrPose giving By individUals and organizations Planned giving Commitments total giFts By College/University Unit historiCal endowment totals Recognition 2 3 4 6 8 10 18 support of, and continued commitment to, Florida State University. Since its founding in 1960, the Florida

  8. Quantifying a bystander response following microbeam irradiation using single-cell RT-PCR analyses

    E-Print Network [OSTI]

    studies of radiation-induced bystander responses reported that exposure to very low doses of a for Radiological Research, Columbia University, New York, NY, USA Objective. There is growing recognition that the effects of ionizing radiation may extend to more than those cells that directly suffer damage to DNA

  9. Center for Power Electronics Systems 2012 CPES AnnuAl REPoRt

    E-Print Network [OSTI]

    Ha, Dong S.

    center dedicated to improving electrical power processing and distribution that impact systems of all for creating advanced electric power processing systems of the highest value to society. CPES, with annual and processes us- ing electrical power. This results in increased industrial productivity and product quality

  10. AN RT-UML MODEL FOR BUILDING FASTER-THAN-REAL-TIME SIMULATORS

    E-Print Network [OSTI]

    Katsaros, Panagiotis

    demanding, requiring a consistent specification for developing such systems. This paper presents guidelines, obtaining and storing system and the model data during the auditing interval, and auditing, that is, examining a) if the system has been #12;modified during the last auditing interval (system reformations), b

  11. National Aeronautics and Space Administration Student ReSeaRch RepoRt

    E-Print Network [OSTI]

    propulsion Laboratory (JpL) JpL has a long history of working with educational insti- tutions. We believe is the end-to-end implementation of unprecedented robotic space missions to study earth, the Solar System of the JPL campus. #12;1 Inside Welcome 3 Solar System Science 5 earth Science 8 astrophysics & Space Science

  12. Climate Change: A Catastrophe in Slow Motion R.T. Pierrehumbert*

    E-Print Network [OSTI]

    Pierrehumbert, Raymond

    as unique or even unusually impressive. When oxygen-generating photosynthetic algae evolved between one--the animals and plants we know and love). And when plants colonized land half a billion years ago, they vastly generations and of the biosphere at large.2 It is against this backdrop that the foundation of international

  13. Modeling benzene plume elongation mechanisms exerted by ethanol using RT3D with a general

    E-Print Network [OSTI]

    Alvarez, Pedro J.

    E10 gasoline (i.e., a blend with 10% vol/vol ethanol/ gasoline) showed that mean benzene plume of E10 gasoline (10% vol/vol ethanol), which compares favorably to field observations. For low benzene Act requirements. The widespread use of ethanol in gasoline has led to an increase in its potential

  14. Seattle Regulatory Pathways to Net Zero Water Phase 1 status RePoRt

    E-Print Network [OSTI]

    Department of Planning and Development City Green Building prepared by: Cascadia Green Building Council July are often wasteful and result in increased demands on publicly owned utilities for supply and treatment -- that is, projects seeking to operate within the water budget of their sites by utilizing closed loop

  15. 'ji<'rt-tt*: 1 'M'*"iV--'-*-'' The Wellcome Trust

    E-Print Network [OSTI]

    Rambaut, Andrew

    and future. © Closing the tube The genetics of spina bifida and anencephaly Andrew Copp © A rash pump and disease Medicine in the sixteenth and seventeenth centuries Andrew Wear The prion see-saw The two sides

  16. http://dsc.u fcg.edu .br/ s rt Desenvolvimento de Uma Ferramenta de

    E-Print Network [OSTI]

    Cirne, Walfredo

    energia elétrica necessário para o diagnóstico de falhas em linhas de transmissão. A ferramenta foi de supervisão e controle das modernas redes de transmissão e distribuição de energia elétrica têm raiz (7). Várias empresas e grupos de pesquisa têm pesquisado e desenvol

  17. RT: A Role-based Trust-management Framework Ninghui Li John C. Mitchell

    E-Print Network [OSTI]

    Mitchell, John C.

    resources. Supported in part by DARPA through SPAWAR contract N66001-00- C-8015. While sharing resources infrastructure and support for se- cure, trusted dynamic coalitions, with emphasis on the fol- lowing areas: 1

  18. Diffuse large B-cell lymphoma: sub-classification by massive parallel quantitative RT-PCR

    E-Print Network [OSTI]

    Xue, Xuemin; Zeng, Naiyan; Gao, Zifen; Du, Ming-Qing

    2014-11-24

    ;103:275-282. 7. Choi WW, Weisenburger DD, Greiner TC et al. A new immunostain algorithm classifies diffuse large B-cell lymphoma into molecular subtypes with high accuracy. Clin Cancer Res 2009;15:5494-5502. 8. Gutierrez-Garcia G, Cardesa-Salzmann T, Climent...

  19. L thnh vin ca Tp on Russell danh ting, Trng i hc Cardiff rt c

    E-Print Network [OSTI]

    Davies, Christopher

    t phng pháp ging dy, hng nghiên cu cng nh tn dng các c s vt cht tuyt vi ca trng. Thành ph Cardiff là mt hát và vin bo tàng, cng nh thng xuyên ng cai các s kin th thao ln, các chuyn lu din hoà nhc sân vn ng Khoa hc Sc kho và i sng. Sinh viên cng có th ng ký các khoá hc khác ti i hc Cardiff và s nhn c t vn và

  20. Trch rt t ng vn phm LTAG cho ting Vit L Hng Phng1

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Trích rút t ng vn phm LTAG cho ting Vit Lê Hng Phng1 , Nguyn Th Minh Huyn1 , Nguyn Phng Thái1 t ng LTAG t kho vn bn gán nhãn cú pháp (treebank). Chúng tôi trình bày kt qu trích rút mt vn phm LTAG cho ting Vit. Chng trình trích rút t ng các vn phm LTAG c lp vi ngôn ng và c phân phi di dng mã ngun m

  1. Preliminary ILAW Formulation Algorithm Description, 24590 LAW RPT-RT-04-0003, Rev. 1

    SciTech Connect (OSTI)

    Kruger, Albert A.; Kim, Dong-Sang; Vienna, John D.

    2013-12-03

    The U.S. Department of Energy (DOE), Office of River Protection (ORP), has contracted with Bechtel National, Inc. (BNI) to design, construct, and commission the Hanford Tank Waste Treatment and Immobilization Plant (WTP) at the Hanford Site (DOE 2000). This plant is designed to operate for 40 years and treat roughly 50 million gallons of mixed hazardous high-level waste (HLW) stored in 177 underground tanks at the Hanford Site. The process involves separating the hight-level and low-activity waste (LAW) fractions through filtration, leaching, Cs ion exchange, and precipitation. Each fraction will be separately vitrified into borosilicate waste glass. This report documents the initial algorithm for use by Hanford WTP in batching LAW and glass-forming chemicals (GFCs) in the LAW melter feed preparation vessel (MFPV). Algorithm inputs include the chemical analyses of the pretreated LAW in the concentrate receipt vessel (CRV), the volume of the MFPV heel, and the compositions of individual GFCs. In addition to these inputs, uncertainties in the LAW composition and processing parameters are included in the algorithm.

  2. 2012 EmploymEnt REpoRt RICE MBA Full TIME

    E-Print Network [OSTI]

    Aazhang, Behnaam

    Director of Product Management Cameron Guillermo Mezzatesta Project Manager Samuel Veselka Project Manager Magalhaes Global Accounts Manager Lloyd's Jeffrey Freedman Associate Marathon Oil Corporation Jesse Filipi Production Engineer McKinsey & Company Joseph Abdou Associate Justin Dahl Associate Mercer Rachel Mc

  3. V-190: ASUS RT-N66U Router AiCloud Security Bypass Security Issue |

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyThe U.S.Lacledeutilities. The Economics ofConductMultiple vulnerabilities

  4. 22th International Meeting on org. geochem. The fate of organic matter in mangrove sediments

    E-Print Network [OSTI]

    Boyer, Edmond

    the behaviour of carbohydrates and lignin during early diagenesis (Marchand et al., 2003; 2004; 2005; in press). Here, we propose to present an integrated conceptual model for organic sedimentation and diagenesis

  5. EAOG Sville The fate of organic matter in mangrove sediments

    E-Print Network [OSTI]

    Boyer, Edmond

    during early diagenesis (Marchand et al., 2003; 2004; 2005; in press). Here, we propose to present an integrated conceptual model for organic sedimentation and diagenesis in French Guiana mangroves, taking

  6. OPTIMAL DISCRETE CONTROLLER SYNTHESIS FOR MODELING FAULT-TOLERANT DISTRIBUTED SYSTEMS

    E-Print Network [OSTI]

    Girault, Alain

    , http://pop-art.inrialpes.fr/ girault, Alain.Girault@inria.fr 3 INRIA, IRISA, http://www.irisa.fr/prive/ hmarchan, Herve.Marchand@inria.fr 4 INRIA, LIG, http://pop-art.inrialpes.fr/ rutten, Eric

  7. OPTIMAL DISCRETE CONTROLLER SYNTHESIS FOR MODELING FAULTTOLERANT DISTRIBUTED SYSTEMS

    E-Print Network [OSTI]

    Girault, Alain

    , http://pop­art.inrialpes.fr/ # girault, Alain.Girault@inria.fr 3 INRIA, IRISA, http://www.irisa.fr/prive/ hmarchan, Herve.Marchand@inria.fr 4 INRIA, LIG, http://pop­art.inrialpes.fr/ # rutten, Eric

  8. Entropy and Energy: Toward a Definition of Physical Sustainability

    E-Print Network [OSTI]

    Hermanowicz, Slawomir W

    2005-01-01

    Perspective by Exergy Analysis. Environmental Science &Moran, M.J. (1999). Exergy Analysis, Costing and AssessmentSteward, F.R. (1988). Exergy Analysis of Thermal, Chemical,

  9. Ra p po Rt d 'act i v i te 2 0 1 0 Musum national d'Histoire naturelle

    E-Print Network [OSTI]

    même but : mieux connaître la nature afin de mieux la préserver. Un credo que le Muséum fait vivre dans

  10. Extraction of RNA-Trizol RNA extraction from M. tuberculosis (Mahenthiralingam 1998) is useful for RT-PCR

    E-Print Network [OSTI]

    L polypropylene tubes 9. Tabletop centrifuge 10. Vortex 11. 13 mL Sarstedt tube B. Protocol Steps 1. Grow 50 ml well. 5. Vortex for 1 minute then add 5X volume (5 ml) Trizol to each tube. 6. Vortex each sample tubes and centrifuge for at 2,000 x g for 10 minutes. 3. Discard supernatant and centrifuge tubes at 2

  11. nature structural & molecular biology VOLUME 19 NUMBER 7 JULY 2012 671 a rt i c l e s

    E-Print Network [OSTI]

    Dinner, Aaron

    )DNAadducts4,5. Knockout experiments in mice have further established mALKBH2 as the housekeeping enzyme as the initial step of its `passive' baseflipping process22­24. Despite different strategies used

  12. A RT I C L E S 36 NATURE CELL BIOLOGY VOLUME 9 | NUMBER 1 | JANUARY 2007

    E-Print Network [OSTI]

    Cai, Long

    on neutrophil chemotaxis. To study PtdIns(3,4,5)P3 metabolism in living primary cells, we generated a novel a chemoattractant gradient. TheamoebaDictyosteliumdiscoideumandmammalianneutrophilsare the best-studied chemotactic in a shallow anterior-to-posterior gradient that approximates receptor occupancy11 . Instead, the second

  13. Kline-DNA Quantification with RT-PCR March 30, 2004 SMART Meeting (Virginia Beach, VA) 1

    E-Print Network [OSTI]

    /280 : ·Is not Human Specific ·Does not satisfy FBI QA Document section 9.3 ·Requires at least 10 ng Green Assay ·Is not Human Specific ·Does not satisfy FBI QA Document section 9.3 ·Requires the sample Technologies Group, Human Identity Project Quantiblot Assay ·Is Human Specific ·Does satisfy FBI QA Document

  14. IUT de Villetaneuse, Universit Paris 13, Sorbonne Paris Cit Licence Pro R&T ASUR Travaux pratiques de cryptographie

    E-Print Network [OSTI]

    André, Étienne

    pratiques de cryptographie Cryptographie : GPG Étienne André Version du sujet : 1er décembre 2014 Ce TP s avec LibreOffice et exporté en PDF. Nom du fichier : crypto-TP-gpg-nom-prenom.pdf Adresse électronique : Etienne.Andre(arobase)univ-paris13.fr Objet du courriel : « TP crypto GPG : » Le compte

  15. Math 21C Final, Fall 02. 1. A particle moves with position vector given by r(t) = t2

    E-Print Network [OSTI]

    Ni, Lei

    of a rectangular box labeled so x is the smallest and z is the largest then in order that the package should) Find the absolute max and min of f(x, y) over the set D = {(x, y)|g(x, y) 4}. 6. If you send a package V (x, y, z) = xyz for a package that is not over sized. 7. (a) Write the iterated integral 1 0 1/y 1

  16. SU-E-T-99: Design and Development of Isocenter Parameter System for CT Simulation Laser Based On DICOM RT

    SciTech Connect (OSTI)

    Luo, G

    2014-06-01

    Purpose: In order to receive DICOM files from treatment planning system and generate patient isocenter positioning parameter file for CT laser system automatically, this paper presents a method for communication with treatment planning system and calculation of isocenter parameter for each radiation field. Methods: Coordinate transformation and laser positioning file formats were analyzed, isocenter parameter was calculated via data from DICOM CT Data and DICOM RTPLAN file. An in-house software-DicomGenie was developed based on the object-oriented program platform-Qt with DCMTK SDK (Germany OFFIS company DICOM SDK) . DicomGenie was tested for accuracy using Philips CT simulation plan system (Tumor LOC, Philips) and A2J CT positioning laser system (Thorigny Sur Marne, France). Results: DicomGenie successfully established DICOM communication between treatment planning system, DICOM files were received by DicomGenie and patient laser isocenter information was generated accurately. Patient laser parameter data files can be used for for CT laser system directly. Conclusion: In-house software DicomGenie received and extracted DICOM data, isocenter laser positioning data files were created by DicomGenie and can be use for A2J laser positioning system.

  17. p hys i csworl d. co m $rrp*:rt*xri*r:tivicy; Top five a lications Fantasticflve

    E-Print Network [OSTI]

    Washington at Seattle, University of - Department of Physics, Electroweak Interaction Research Group

    of super- conductivity in terms of their impact on society? This article lists a top five selected by Paul may be a beautiful phenomenon, but materials that can conduct with zero resistance have not quite, followed by magnets for medical imaging and for particle colliders in second and third, re- spectively

  18. Tritium Retention in TFTR C.H. Skinner, G Ascione, D. Mueller, A Nagy, R.T. Walters,

    E-Print Network [OSTI]

    Budny, Robert

    ° Boronization PDC NBvent various -4000 0 4000 8000 12000 curies T puff NB inj. NB pump turbo pump Short term level in any plasma operation #12;First in-vessel maintenance after extensive DT operations TFTR

  19. Opgave 1 20 Et bin rt tr med heltal i knuderne kan repr senteres som en v rdi af

    E-Print Network [OSTI]

    Brodal, Gerth Stølting

    Deltr s, t:Tree ! Bool der afg r, om s er et deltr af t. En naiv algoritme for dette problem er vil give en tidskompleksitet p Ojtjjsj. En smartere algoritme er kun at unders ge dette for de knuder lgende algoritme er gyldig og korrekt. Algoritme: Heltalskvadratrod Stimulans: n: n0 Respons: r: r2 n r

  20. Sub-RepoRt commiSSioned to aSSiSt the all-paRty

    E-Print Network [OSTI]

    Crawford, Ian

    Authority. Direct negotiations, brokered by the United States Secretary of State, John to the weaponry and manpower at the disposal of Hamas and its supporters in Gaza, were

  1. Observation of a new high-? and high-density state of a magnetospheric plasma in RT-1

    SciTech Connect (OSTI)

    Saitoh, H.; Yano, Y.; Yoshida, Z.; Nishiura, M.; Morikawa, J.; Kawazura, Y.; Nogami, T.; Yamasaki, M. [Graduate School of Frontier Sciences, The University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8561 (Japan)

    2014-08-15

    A new high-? and high-density state is reported for a plasma confined in a laboratory magnetosphere. In order to expand the parameter regime of an electron cyclotron resonance heating experiment, the 8.2?GHz microwave power of the Ring Trap 1 device has been upgraded with the installation of a new waveguide system. The rated input power launched from a klystron was increased from 25 to 50?kW, which enabled the more stable formation of a hot-electron high-? plasma. The diamagnetic signal (the averaged value of four magnetic loops signals) of a plasma reached 5.2 mWb. According to a two-dimensional Grad-Shafranov analysis, the corresponding local ? value is close to 100%.

  2. NATURE STRUCTURAL & MOLECULAR BIOLOGY VOLUME 16 NUMBER 12 DECEMBER 2009 1267 A RT I C L E S

    E-Print Network [OSTI]

    Chou, James

    of BM2 is also a coiled-coil tetramer, and its unusually large electrostatic dipole moment suggests-coil tetramer with a packing angle of about -37° (Fig. 1a). The tetramer has a well 1Department of Biological

  3. Magnetic properties of RT2Zn20; R = rare earth, T = Fe, Co, Ru, Os and Ir

    SciTech Connect (OSTI)

    Jia, Shuang

    2008-12-15

    It is well known that rare earth intermetallic compounds have versatile, magnetic properties associated with the 4f electrons: a local moment associated with the Hund's rule ground state is formed in general, but a strongly correlated, hybridized state may also appear for specific 4f electronic configuration (eg. for rare earth elements such as Ce or Yb). On the other hand, the conduction electrons in rare earth intermetallic compounds, certainly ones associated with non hybridizing rare earths, usually manifest non-magnetic behavior and can be treated as a normal, non-interacted Fermi liquid, except for some 3d-transition metal rich binary or ternary systems which often manifest strong, itinerant, d electron dominant magnetic behavior. Of particular interest are examples in which the band filling of the conduction electrons puts the system in the vicinity of a Stoner transition: such systems, characterized as nearly or weakly ferromagnet, manifest strongly correlated electronic properties [Moriya, 1985]. For rare earth intermetallic compounds, such systems provide an additional versatility and allow for the study of the behaviors of local moments and hybridized moments which are associated with 4f electron in a correlated conduction electron background.

  4. arXiv:math.RT/0411017v220Feb2005 STANDARD BASES FOR AFFINE SL(N)-MODULES

    E-Print Network [OSTI]

    Kreiman, Victor

    a basis of a given Demazure module of SLnC. The roof operator is more elementary (and much more efficient of a recursive but very simple algorithm, the roof operator, which is analogous to the left-key construction of Lascoux-Schutzenberger. The roof operator is in a sense orthogonal to the crystal operators. The most

  5. 1) EtOH, rt 2) K2CO3 (5 eq.), MeI (20 eq.)

    E-Print Network [OSTI]

    HHO H 19) Toluene, 180°C 20, 21, 22 20) NaH, CS2, MeI 21) AIBN, nBu3SnH, 110°C 22) BBr3 (10 eq), DCM

  6. arXiv:math/9910114v1[math.RT]21Oct1999 ON THE GHOST CENTRE OF LIE SUPERALGEBRAS

    E-Print Network [OSTI]

    Gorelik, Maria

    (g) is not easy to describe and, in general, it is not noetherian algebra. However, in the case when the top algebra can be easily described-- see Theorem 3.3. The above condition on top g1 holds for the simple ("anticentre"). We calculate the anticentre in the case when the top external degree of g1 is a trivial g0

  7. 2011NatureAmerica,Inc.Allrightsreserved. T e c h n i ca l R e p o RT s

    E-Print Network [OSTI]

    Sia, Samuel K.

    -to-use point-of-care (POC) assay that faithfully replicates all steps of ELISA, at a lower total material cost settings5,6, the device must also be low cost. A switch in the strategy by which microfluidics is normally performed will be needed before complex laboratory assays can be miniaturized at low cost for use in remote

  8. DOE/SC-ARM-10-032 ARM Climate Research Facility AnnuAl RepoRt - 2010

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation Current HAB Packet HanfordDOE ProjectREMOTE-HANDLED TRU76

  9. DOE/SC-ARM-12-023 ARM Climate Research Facility AnnuAl RepoRt - 2012

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation Current HAB Packet HanfordDOE ProjectREMOTE-HANDLED TRU764 The Arctic6

  10. Retinal Neurotransmitters Robert E. Marc

    E-Print Network [OSTI]

    Marc, Robert E.

    Retinal Neurotransmitters Robert E. Marc John Moran Eye Center University of Utah School of References: 85 Abbreviated Title: Retinal Neurotransmitters *Correspondence to: Robert E. Marc, Moran Eye-6500. Facsimile (801) 581-3357 robert.marc@hsc.utah.edu #12;Rbert E. Marc Retinal Neurotransmitters Introduction

  11. Robert E. Marc: The Structure of Vertebrate Retinas In: J Toyoda (ed.) The Retinal Basis of Vision

    E-Print Network [OSTI]

    Marc, Robert E.

    Robert E. Marc: The Structure of Vertebrate Retinas In: J Toyoda (ed.) The Retinal Basis of Vision Elsevier, Amsterdam 1998 The Structure of Vertebrate Retinas Robert E. Marc John Moran Eye Center, retinal neurons, neuronal patterning, neuronal stratification Correspondence: Robert E. Marc John Moran

  12. SPECIES PROFILE New Hampshire Wildlife Action PlanA-218

    E-Print Network [OSTI]

    New Hampshire, University of

    SPECIES PROFILE New Hampshire Wildlife Action PlanA-218 Federal Listing: None State Listing: None Global Rank: G5 State Rank: S3 Authors: Kim A. Tuttle and M. N. Marchand, New Hampshire Fish and Game grass- lands, pine barrens, blueberry barrens, and grassy hilltops (Klemens 1993, New Hampshire Reptile

  13. Item 3, FGSR Council November 26, 2014 N:\\Administration\\FGSR COUNCIL\\Minutes Agendas\\2014-2015\\November 2014\\2.0 Council 22-10-2014 Minutes FGSR Council.docx

    E-Print Network [OSTI]

    Wang, Hao "Howard"

    Doucette, Mechanical Eng A Palmer, Anthropology E Foley, Med. Micro. & Immun. L McTavish, Art & Design Goodwin, Phys Ed & Recreation I Martyniak, Educational Studies R Marchand, Physics L Laidlaw, Elementary, Education Graduate Program Administrator Representatives D Blair, Computing Science G Dowler, Mechanical

  14. FGSR Council meeting summary, 2006/09/15 Summary Minutes of a Meeting of the

    E-Print Network [OSTI]

    Wang, Hao "Howard"

    Department Representatives E Bork, Ag, Food & Nutri Sciences S Rice, Linguistics J Greer, Art & Design P Minev, Math & Stat Sciences B Lemire, Biochemistry Z Xia, Mechanical Engineering H McDermid, Biological & Recreation R Short, Educational Psychology R Marchand, Physics J McClay, Elementary Education C Benishin

  15. FGSR Council Minutes, 2006/03/17 Summary Minutes of a Meeting of the

    E-Print Network [OSTI]

    Wang, Hao "Howard"

    , Linguistics S Caufield, Art & Design YS Wong, Math & Stat Sciences H McDermid, Biological Sciences Z Xia, Mechanical Engineering J Kao, Business (PhD) M Glerum, Medical Genetics A Nelson, Chem & Mat Eng G Lopaschuk & Recreation J McClay, Elementary Education R Marchand, Physics H Zwicker, English & Film Studies P Dixon

  16. FYI: July 5, 1990 - Decentler 27, 1990

    E-Print Network [OSTI]

    1990-01-01

    CONTACT PERSQ"I Mike Ramirez (913) 296-3721 Depanment of Transportation Lynn George (913) 864-4942 University of Kansas Mike Ramirez (913) 296-3721 Department of Transportation Jo Ann Moran (913) 296-1290 Department of Health and Environment Jo... Ann Moran (913) 296-1290 Depanment of Health and Environment Jo Ann Moran \\913) 296-1290 Department oi Health and Environment Mike Ramirez (913) 296-3721 Dep~ntofTransportation Mike Ramirez (913) 296-3721 Dep~ntofTransponadon Mike Ramirez (913...

  17. Don't break the pipeline: Ensuring a workforce for the burning plasma era G.M. Olynyk, Z.S. Hartwig, and R.T. Mumgaard

    E-Print Network [OSTI]

    .S. fusion energy sci- ences is a fusion nuclear science facility ("FNSF") or a small-scale prototype power- sion scientists is in position by the late s, the recent trajectory is instead one of managed decline- dents to senior scientists and tenured faculty--such that the transmission of knowledge remains

  18. J. Electrochem. Soc., Vol. 142, No. 11, November 1995 9 The Electrochemical Society, Inc. 3815 Q = In [c~a+ ~ ~ ~ -in io -RT ~ [5

    E-Print Network [OSTI]

    Weidner, John W.

    to be attractive for treating low level nuclear wastes. The development of a simple divided electrochemical-cell model operating in a batch mode, used for the reduction of nitrates and nitrites from nuclear wastes to the above proce- dure is 1.49 mA/cm 2,which ismore than an order of magni- tude lower than that of copper

  19. 1350 VOLUME 46 | NUMBER 12 | DECEMBER 2014 Nature GeNetics t e c h n i c a l r e p o rt s

    E-Print Network [OSTI]

    Kaski, Samuel

    genome;however,callingvariantsintheremaining10%of thegenome. Accurate determination of an individual's genome is essential for understanding both human hereditary disease and cancer. Advances in genome sequencing have made it possible, at relatively low cost

  20. FRAMES-2.0 Software System: Linking to the Groundwater Modeling System (GMS) RT3D and MT3DMS Models

    SciTech Connect (OSTI)

    Whelan, Gene; Castleton, Karl J.; Pelton, Mitch A.

    2007-08-08

    Linkages to the Groundwater Modeling System have been developed at Pacific Northwest National Laboratory to enable the Nuclear Regulatory Commission (NRC) to more realistically assess the risk to the public of radioactive contaminants at NRC-licensed sites. Common software tools presently in use are limited in that they cannot assess contaminant migration through complex natural environments. The purpose of this initiative is to provide NRC with a licensing safety-analysis tool with sufficient power, flexibility, and utility that it can serve as the primary software platform for analyzing the hazards associated with licensing actions at those “complex” sites at which the traditional tools are inappropriate. As a tool designed to realistically approximate prospective doses to the public, this initiative addresses NRC’s safety-performance goal by confirming that licensing actions do not result in undue risk to the public.

  1. A N N U A L R E P O RT 2 0 0 6 -0 7 COLLEGE OF ARTS & SCIENCES

    E-Print Network [OSTI]

    Frantz, Kyle J.

    labora- tories to elementary, middle and high schools around the state.The Bio-Bus program, which won. · An international team of scientists working at Georgia State University's Center for High Angular Resolution instruments and techniques. McAlister and the CHARA Array Project Team ­ which he led ­ won the award

  2. Transactions, SMiRT 21, 6-11 November, 2011, New Delhi, India Div-VII: Paper ID# 804 DEVELOPMENT OF PARTIAL SAFETY FACTORS FOR ACCIDENTAL

    E-Print Network [OSTI]

    Bhattacharya, Baidurya

    were designed using the French RCC-G code. The raft of the PWHR at Tarapur was designed using the ASME code and checked against RCC-G [1]. There is yet no formal Indian design standard for containment structures. In 2007, the Atomic Energy Regulatory Board (AERB) of India released the CSE-3 codes [3] which

  3. Mechanistic Evaluation of the Pros and Cons of Digital RT-LAMP for HIV1 Viral Load Quantification on a Microfluidic Device and

    E-Print Network [OSTI]

    Ismagilov, Rustem F.

    on a Microfluidic Device and Improved Efficiency via a Two-Step Digital Protocol Bing Sun, Feng Shen, Stephanie E, California 91125, United States *S Supporting Information ABSTRACT: Here we used a SlipChip microfluidic by the yield of desired cDNA. We were able to overcome the limitations by developing a microfluidic protocol

  4. Analysis of genes regulated by the peroxide response regulator PerR in Borrelia burgdorferi using real-time RT-PCR 

    E-Print Network [OSTI]

    Swingle, Kristen Lynn

    2002-01-01

    are quite disparate and include differences in temperature, pH, and oxygen concentration. Although it has been shown that the aforementioned factors alter gene expression, few regulatory proteins have been identified in the B. burgdorferi genome. bb0647...

  5. 5/17/13 12:44 PMBronk Page 1 of 14http://firstmonday.org/ojs/index.php/fm/rt/printerFriendly/2192/2052

    E-Print Network [OSTI]

    Wallach, Dan

    terror tactics in pursuit of their political agendas. This paper argues that the language used to frame have constructed damning cases against organized crime and other nefarious actors through the use information technologies. Falling between the boundaries of the information, computer and political sciences

  6. 1.1 Basic ideas r(t) is the position of a particle; r = |r| is the distance to the origin.

    E-Print Network [OSTI]

    Rucklidge, Alastair

    speed of the particle is v = R. (11) #12;Chapter 2 Dynamics: Newton's laws of motion and gravitation 2 interacting though equal and opposite forces is constant. 3 #12;4 2.2 Newton's Law of Gravitation 2.2 Newton's Law of Gravitation Two particles of masses M and m a distance r apart exert a mutually attractive

  7. Opgave 1 (20%) Et bin#rt tr# med heltal i knuderne kan repr#senteres som en v#rdi af

    E-Print Network [OSTI]

    Brodal, Gerth Stølting

    #rdiprocedure: Proc Deltr#[s, t: Tree] ! (Bool) der afg#r, om s er et deltr# af t. En naiv algoritme for dette problem rod. Det vil give en tidskompleksitet p# O(jtjjsj). En smartere algoritme er kun at unders#ge dette, at f#lgende algoritme er gyldig og korrekt. Algoritme: Heltalskvadratrod Stimulans: n: nâ??0 Respons: r

  8. 2010-2011 ANNUAl REPoRt O F Y E S H I V A U N I V E R S I T Y

    E-Print Network [OSTI]

    Kenny, Paraic

    , Nigeria, Rwanda, South Africa and Uganda. ·Each year, Einstein faculty members and some 50 medical, Einstein's Jack and Pearl Resnick Campus pulses with energy. Our research centers are where our world

  9. Sulphate record from a northeast Greenland ice core over the last 1200 years based on continuous flow analysis

    E-Print Network [OSTI]

    Fischer, Hubertus

    distribution of heat, salt, and moisture, potentially driving climatic change on regional to global scales; Moran et al., 2006). In 2004, the first Integrated Ocean Drilling Program expedition to the Lomonosov

  10. Middletown Springs Town Plan Adopted September 10, 2002

    E-Print Network [OSTI]

    Brown, Gregory G.

    Middletown Springs Town Plan Adopted September 10, 2002 Select Board: Fred Bradley, Chair Robin Chesnut-Tangerman John Colvin Shirley Moyer, Secretary William Reed Planning Commission: Robert Moran.............................................................................. 11 Utilities, Facilities, and Services

  11. Mineralogy and Petrology (2007) 91: 1124 DOI 10.1007/s00710-007-0183-7

    E-Print Network [OSTI]

    Cartigny, Pierre

    2007-01-01

    to 90 km along a cold geothermal gradient (8 C=km). Unmetamor- phosed and HP metasediments show is available for mafic rocks and metasediments sub- ducted along warm geothermal gradients (Moran et al., 1992

  12. Systematic revision of Elaphoglossum (Dryopteridaceae) in French Polynesia, with the description of three new

    E-Print Network [OSTI]

    of three new species GERMINAL ROUHAN1 *, DAVID H. LORENCE2 , TIMOTHY J. MOTLEY3 , JUDITH GARRISON HANKS4 groups (sections and subsections) (Moran, Garrison-Hanks & Rouhan, 2007a). The main clades

  13. INTRODUCTION A common reproductive strategy among aquatic and marine

    E-Print Network [OSTI]

    and Strathmann, 1998; Moran and Woods, 2007; Woods and Podolsky, 2007) and on amphibian egg masses (Seymour, 1994; Seymour and Bradford, 1995; Mitchell and Seymour, 2003). For all egg masses, however, predicting transient

  14. Genealogical constructions of population models Alison M. Etheridge Thomas G. Kurtz

    E-Print Network [OSTI]

    Kurtz, Tom

    Genealogical constructions of population models Alison M. Etheridge Thomas G. Kurtz Department, Moran model, lookdown construction, genealogies, voter model, generators, stochastic equations, Lambda number of individuals in the population is used to infer the `genealogical trees' that relate those genes

  15. A Simple Self-Maintaining Metabolic System: Robustness, Autocatalysis, Bistability

    E-Print Network [OSTI]

    Piedrafita1 , Francisco Montero1 , Federico Mora´n1 , Mari´a Luz Ca´rdenas2 , Athel Cornish-Bowden2 * 1-maintaining mode, the entire network being necessary to maintain the two catalysts. Citation: Piedrafita G, Montero

  16. When to clean and how to clean biofilms in heat exchangers

    E-Print Network [OSTI]

    Pogiatzis, T.A.; Vassiliadis, V.S.; Mergulhão, F.J.; Wilson, D.I.

    2014-07-02

    .M. Generalized Benders decomposition. Journal Of Optimization Theory Applications. 1972, 10, 237 - 60. [23] Nebot, E., Casanueva, J.F., Casanueva, T., Sales, D. Model for fouling deposition on power plant steam condensers cooled with seawater: effect of water... .K., Pokroy, B., Seminara, A., Aizenberg, J. Bacterial biofilm shows persistent resistance to liquid wetting and gas penetration. Proceedings of the National Academy of Sciences of the United States of America. 2011, 108, 995-1000. [19] Marchand, S., De Block...

  17. , 20140502, published 13 August 20142812014Proc. R. Soc. B Glenn Yannic, Loc Pellissier, Mal Le Corre, Christian Dussault, Louis Bernatchez and Steeve D.

    E-Print Network [OSTI]

    Bernatchez, Louis

    ´decine, Que´bec, Que´bec, Canada G1V 0A6 2 Institut de Biologie Inte´grative et des Syste`mes (IBIS), Universite´ Laval, Pavillon Charles-Euge`ne-Marchand, Que´bec, Que´bec, Canada G1V 0A6 3 Department'Environnement, de la Faune et des Parcs du Que´bec, 880 chemin Sainte-Foy, Que´bec, Que´bec, Canada G1S 4X4

  18. Intellectual Property as Informaiton: A law and economics approach

    E-Print Network [OSTI]

    Barbosa, Cláudio R.

    2007-01-01

    A tutela jurídica da biotecnologia. São Paulo : RT, 1998.A tutela jurídica da biotecnologia. São Paulo : RT, 1998.

  19. F E AT U R E A RT I C L E 2 N E W E N G L A N D G R O U N D F I S H

    E-Print Network [OSTI]

    , its management, and prospects for long-term recovery and sustainability. BACKGROUND New England has by substantial losses of both ships and men to the vagaries of the North Atlan- tic. The catch from distant

  20. Thermodynamics Practice Problems of Unit I 1. a) For ideal gas, dU = nCvdT , delta(U) = 3R(T2 T1) = 124.7 J

    E-Print Network [OSTI]

    Wang, Ping

    ln(T2/T1) =0.422 J/K 2. a). Carnot Cycle provides the maximum thermal efficiency, eta = Ws/Qh = (QhJ/kg) = 144.5 kg/s 3. Rankine Cycle. eta = Ws/Qh = (H3 ­ H2)/(H2-H1) State properties State point T (o C) P

  1. Parallel Global Optimization with the Particle Swarm Algorithm J.F. Schutte1, J.A. Reinbolt2, B.J. Fregly1,2, R.T. Haftka1, A.D. George3

    E-Print Network [OSTI]

    Neumaier, Arnold

    , the Particle Swarm Optimization (PSO) algorithm. The parallel PSO algorithm's robustness and efficiency an almost linear increase in throughput for up to 30 nodes in a computational cluster. Parallel PSO provides of hours [1]. The Particle Swarm Optimization (PSO) algorithm is a recent addition to the list of global

  2. "Bond paths and van der Waals interactions in orpiment, As2S3", G.V. Gibbs, A.F. Wallace, R. Zallen, R.T. Downs. N.L.

    E-Print Network [OSTI]

    Zallen, Richard

    in Amorphous Chalcogenides", R. Zallen, in Amorphous Metals and Semiconductors, edited by P. Haasen and R. I., Phys. Rev. B 25, 781 (1982). · "Crystal Structures", R. Zallen, chapter one in Handbook on Semiconductors, Vol. 1 (North-Holland, Amsterdam, 1982), pp. 1-27. · "The Effect of Pressure on Optical

  3. T E C H N I C A L R E P O RT S I N C O M P U T E R S C I E N C E Technische Universitt Dortmund

    E-Print Network [OSTI]

    Morik, Katharina

    with the popularity of the Social Web. Recommenders can not only be used to sort and filter Web 2.0 and social network systems. Web 2.0 users explicitly provide personal information and implicitly express preferences through Recommender Systems & the Social Web Dietmar Jannach, Werner Geyer, Jill Freyne, Sarabjot Singh Anand, Casey

  4. Near and Sub-Barrier Fusion of Neutron-Rich Light Nuclei A. Elias, J. Lane, A. Liao, J. P. Schmidt, T. K. Steinbach, B. Wiggins, S. Hudan, R.T. de Souza

    E-Print Network [OSTI]

    de Souza, Romualdo T.

    of the neutron star crust is too low for fusion of 12C. Fusion of neutron rich light nuclei has been hypothesizedNear and Sub-Barrier Fusion of Neutron-Rich Light Nuclei A. Elias, J. Lane, A. Liao, J. P. Schmidt://nuchem.iucf.indiana.edu IU Dept of Chemistry: http://chem.indiana.edu Demonstrate the feasibility to measure the fusion cross

  5. Inelastic Neutron Study ofTHF+D, Clathrates K.T. Tait!.', F. R. Trouw', M.P. Hehlen', A. H. Shapiro', Y. Zhao' and R.T. Downs'

    E-Print Network [OSTI]

    Downs, Robert T.

    incorporated into hydrogen- bonded, cage-like ice host trameworks. Storage of hydrogen in molecular form within for hydrogen storage. Recent work has demonstrated that it is possible to obtain up to 4 wt% hydrogen ice were to be used as a hydrogen storage medium, it is possible that similar materials and engineering

  6. T E C H N I C A L R E P O RT S I N C O M P U T E R S C I E N C E Technische Universitt Dortmund

    E-Print Network [OSTI]

    Morik, Katharina

    , University of Torino, Italy Bettina Berendt, K.U.Leuven, Belgium Shlomo Berkovsky, University of Melbourne to mine this data for actionable knowledge, and to effectively use the discovered knowledge to enhance retrieval and filtering, databases, agent architectures, knowledge representation, data mining, text mining

  7. THIELE CENTRE for applied mathematics in natural science

    E-Print Network [OSTI]

    Schierup, Mikkel Heide

    ]), or a finite dam or fluid model (Asmussen [3] , Moran [23], Stadje [28]). Furthermore, they are used in models tends to infinity in the case where the L´evy process is light-tailed and the mean is either strictly is explicitly calculated. The case of negative mean and heavy tails case is treated in Andersen [1

  8. Types of Stations and Activities at Each: 1) Short Station

    E-Print Network [OSTI]

    ) from starboard A-Frame­ Hydro Team · Fe CTD cast (1) at some locations - Wu · VPR cast (1) from stern A camera deployed from ice-Cooper/Grebmier team · If necessary, small boat work to access ice- Gradinger small boat ­ Moran At 5-6 Open Water Stations: · Van Veen Grab sampling from stern A-frame, 3/8" wire, 3

  9. DNA BARCODING DNA barcoding exposes a case of mistaken identity

    E-Print Network [OSTI]

    Schuettpelz, Eric

    the Victorian era (Allen 1969; Moran 2004) and has recently enjoyed renewed popularity due, in part, and xeric-adapted members of the Pteridaceae (including the cryptogrammoids, adiantoids, and cheilanthoids high temperatures, bright light, and alkaline con- ditions, making them well adapted to many landscape

  10. IDENTIFYING THE USAGE PATTERNS OF METHYL TERT-BUTYL ETHER (MTBE) AND OTHER OXYGENATES IN GASOLINE USING GASOLINE

    E-Print Network [OSTI]

    IDENTIFYING THE USAGE PATTERNS OF METHYL TERT-BUTYL ETHER (MTBE) AND OTHER OXYGENATES IN GASOLINE USING GASOLINE SURVEYS By Michael J. Moran, Rick M. Clawges, and John S. Zogorski U.S. Geological Survey 1608 Mt. View Rapid City, SD 57702 Methyl tert-butyl ether (MTBE) is commonly added to gasoline

  11. RELATIONS BETWEEN THE DETECTION OF METHYL TERT-BUTYL ETHER (MTBE) IN SURFACE AND GROUND WATER AND ITS CONTENT IN GASOLINE

    E-Print Network [OSTI]

    AND ITS CONTENT IN GASOLINE By Michael J. Moran, Mike J. Halde, Rick M. Clawges and John S. Zogorski U in the United States as an octane enhancer and oxygenate in gasoline. Octane enhancement began in the late 1970's with the phase-out of tetraethyl lead from gasoline. The use of oxygenates was expanded

  12. COLLEGE OF WILLIAM & MARY ATHLETIC DEPARTMENT ORGANIZATION CHART Athletic Director

    E-Print Network [OSTI]

    Lewis, Robert Michael

    Smith Claudette Canady Myrtle Cox Support Staff Jaime LaBianco- Business Managers Patricia Moran Kyle. of Compliance James Cullimore Shelfer Peace George Williams Derek J Melvin Vacant Tommy Bricker Derek Melvin Coach Maria Caro Assistant M/W Golf Coach Ed Teer Head Women's Gymnastics Coach Mary Lewis Assistant

  13. Fast Bayesian reconstruction of chaotic dynamical systems via extended Kalman filtering Renate Meyer1,

    E-Print Network [OSTI]

    Christensen, Nelson

    compare the new algorithm to the Gibbs sampler using the logistic, the tent, and the Moran-Ricker maps the parameters because they do not take into account that the values of the ``inde- pendent'' variable in 14 to generate a sample from the joint posterior distribution of unknown parameters and unknown

  14. ENERGY CONVERSION Spring 2011

    E-Print Network [OSTI]

    Bahrami, Majid

    , 5th Edition Michael J. Moran and Howard N. Shapiro, John Wiley and Sons Inc., New York, NY, 2004, John Willey 2010. 3) Alternative Energy Systems and Applications, by B.K. Hodge, John Willey 2010. 41 ENSC 461 ENERGY CONVERSION Spring 2011 Instructor: Dr. Majid Bahrami 4372 Email

  15. Microbial invasion of the Caribbean by an Indo-Pacific coral zooxanthella

    E-Print Network [OSTI]

    Microbial invasion of the Caribbean by an Indo-Pacific coral zooxanthella D. Tye Pettaya,b,1 , Drew Institutes of Energy and the Environment, University Park, PA 16802 Edited by Nancy A. Moran, University functions are poorly documented (6). Microbial invasions are difficult to detect, especially among free

  16. Basing Cryptographic Protocols on Tamper-Evident Seals In this paper we attempt to formally study two very intuitive physical models: sealed envelopes and

    E-Print Network [OSTI]

    Naor, Moni

    Basing Cryptographic Protocols on Tamper-Evident Seals Tal Moran Moni Naor Abstract In this paper are called "tamper-evident seals". Another physical object with this property is the "scratch-off card", often used in lottery tickets. We consider three variations of tamper-evident seals, and show that under

  17. Information Processing: Amacrine Cells Robert E. Marc

    E-Print Network [OSTI]

    Marc, Robert E.

    Cover Information Processing: Amacrine Cells Robert E. Marc Department of Ophthalmology John A. Moran Eye Center 65 Mario Capecchi Dr University of Utah Salt Lake City, UT 84132 robert.marc@hsc.utah.edu Robert E. Marc :: Chapter 197 :: Information Processing: Amacrine Cells :: page 1 of 34 #12;Keywords

  18. Bryan William Jones, Ph.D. Marc Laboratory

    E-Print Network [OSTI]

    Marc, Robert E.

    Bryan William Jones, Ph.D. Marc Laboratory John A. Moran Eye Center Dept. Ophthalmology University (IgG) library has been produced by the Marc Lab at the University of Utah, targeting over 60 types;MC signature collapse & recovery in Retinal Detachment Cat Retina (Marc, Murray, Fisher, Lindberg

  19. Injury and Repair: Retinal Remodeling Robert E. Marc

    E-Print Network [OSTI]

    Marc, Robert E.

    Injury and Repair: Retinal Remodeling Robert E. Marc Department of Ophthalmology John A. Moran Eye Center 65 Mario Capecchi Dr University of Utah Salt Lake City, UT 84132 robert.marc@hsc.utah.edu Keywords photoreceptors In press Elsevier Encyclopedia of the Eye Robert E. Marc :: Chapter 220 :: Injury and Repair

  20. Journal of Animal Ecology 2007

    E-Print Network [OSTI]

    Engen, Steinar

    on the dynamics of central European great and blue tit popula- tions. This generates synchronous fluctuations Ecological Society Blackwell Publishing Ltd The extended Moran effect and large-scale synchronous, Bauernstrasse 14, D-38162 Cremlingen, Germany Summary 1. Synchronous fluctuations of geographically separated

  1. GENERAL TECHNICAL REPORT PSW-GTR-245 Spatiotemporal Distribution Patterns of

    E-Print Network [OSTI]

    in Northern Mexico1 Gustavo Pérez-Verdin2 , M. A. Márquez-Linares3 , A. Cortes-Ortiz3 , and M. Salmerón of forest fires in Durango, one of the most affected States in Mexico, was conducted. The Moran's index, Mexico; Seasonality, Geographically Weighted Regression. Introduction In Mexico, most forest fires occur

  2. TOWARDS ESTIMATING TOTAL ECONOMIC VALUE

    E-Print Network [OSTI]

    Bateman, Ian J.

    TOWARDS ESTIMATING TOTAL ECONOMIC VALUE OF FORESTS IN MEXICO by Neil Adger Katrina Brown Raffaello OF FORESTS IN MEXICO by Neil Adger Katrina Brown Raffaello Cervigni Dominic Moran Centre for Social and SEDESOL for their assistance whilst in Mexico, and David Pearce and Kerry Turner for comments on earlier

  3. Fall 2015 BOSTONIA airway and sends it to a lab

    E-Print Network [OSTI]

    Spence, Harlan Ernest

    / BY BARBARA MORAN most cancer deaths in the United States. According to the National Cancer Institute it in a limited number of medical centers in the United States to gather feedback on how the test is used and its inter- est to NASA since many astronauts have lost bone mass, at a rate of about one percent per month

  4. Postdoctoral position in microfluidics for life and medical sciences at Technion -Israel Institute of Technology

    E-Print Network [OSTI]

    Rimon, Elon

    Postdoctoral position in microfluidics for life and medical sciences at Technion - Israel Institute of Technology The Microfluidic Technologies Laboratory at Technion, led by Prof. Moran Bercovici, is seeking of novel bio-microfluidic tools and assays. The Microfluidic Technologies Laboratory (microfluidics

  5. Computer Science Department Technion, IIT Algorithms in Computational Biology 236522

    E-Print Network [OSTI]

    Beimel, Amos

    Computer Science Department Technion, IIT Algorithms in Computational Biology ­ 236522 Moed A Exam Spring 2007, 24.9.07 Lecturer: Shlomo Moran TA: Ilan Gronau - Exam Duraion: 3 hours - The Exam has 3 structure can be used to answer the desired queries. 2. (23 pts) Denote by Si the sequence S after deletion

  6. Journal of Animal Ecology 2005

    E-Print Network [OSTI]

    Trexler, Joel C.

    Journal of Animal Ecology 2005 © 2005 British Ecological Society Blackwell Publishing, Ltd Everglades, Moran effect, spatial synchrony. Journal of Animal Ecology (2005) doi: 10.1111/j.1365-mail: cruetz@sigmaxi.org #12;2 C. R. Ruetz et al. © 2005 British Ecological Society, Journal of Animal Ecology

  7. A compact proton spectrometer for measurement of the absolute DD proton spectrum from which yield and R are determined in thin-shell inertial-confinement-fusion

    E-Print Network [OSTI]

    . Landen,3 M. J. Moran,3 R. A. Zacharias,3 J. D. Kilkenny,4 and A. Nikroo4 1 Plasma Science and Fusion Energetics, University of Rochester, Rochester, New York 14623, USA 3 Lawrence Livermore National Laboratory and implemented using a linear accelerator and applied to experiments at the OMEGA laser facility and the National

  8. Evaluating the Predictive Validity of DIBELS Literacy Measures with Third Grade Spanish-Speaking English Language Learners

    E-Print Network [OSTI]

    Kim, Jennifer Sun

    2012-01-01

    Intervention (RtI)………………………………………………… .. 5 Curriculum BasedResponse to Intervention (RtI) is a three-tiered preventionResearch conducted on RtI with EL learners has resulted in

  9. Goal Setting: Enhancing Academic Attitudes and Achievement in High School Gifted Underachievers

    E-Print Network [OSTI]

    Sivaraman, Rhonda Czapla

    2012-01-01

    C. E. , & Rollins, K. (2009). RtI for nuturing giftedness:Implications for the RtI school- based team. Gifted Child

  10. An Examination of the Predictive Validity of Early Literacy Measures for Korean English Language Learners

    E-Print Network [OSTI]

    Nam, Jeanie Eunjoo

    2011-01-01

    learners: support for an RTI model. The California Schoolto Intervention (RtI)………………………………………….. Standards forResponse to Intervention (RtI) Given the benefits of early

  11. Search for: All records | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    (RT) (54 Gy locally advanced and 45 Gy postsurgery) and concomitant continuous-infusion 5-fluorouracil (5FU) (200 mgmsup 2d throughout RT). After 4 weeks, patients...

  12. Spinal epidural empyema in seven dogs

    E-Print Network [OSTI]

    Lavely, J A; Vernau, karen M; Vernau, W; Herrgesell, E J; Lecouteur, R A

    2006-01-01

    the spinal cord and vertebral column. With greater access toneurologic examination, vertebral column radiographs, my-Rt femur, Lt tibia, Rt ulna Vertebral column: no significant

  13. Using a theory of planned behavior approach to assess principals' Professional intentions to promote diversity awareness beyond the level recommended by their district 

    E-Print Network [OSTI]

    Landeck, Edith Suzanne

    2009-05-15

    Paola and Tschannen-Moran (2003) state ?as the nation seeks significant reforms in education through standards and accountability, it increasingly looks to principals? as there is a general belief that good 11 school principals are the cornerstones of good... principal; persons seeking the principalship must couple mastery of these elements with an additional quality for the school to be successful. These authors define this additional quality as purpose; other authors refer to this extra element as: ?care...

  14. Clinical and Experimental Optometry 88.5 September 2005 Retinal remodelling Jones, Watt and Marc

    E-Print Network [OSTI]

    Marc, Robert E.

    and Marc OPTOMETRY C L I N I C A L A N D E X P E R I M E N T A L Clin Exp Optom 2005; 88: 5: 282D Robert E Marc PhD Moran Eye Center, School of Medicine, University of Utah, Salt Lake City, USA Submitted and Experimental Optometry 88.5 September 2005 283 Retinal remodelling Jones, Watt and Marc dystrophies

  15. Essays in econometrics

    E-Print Network [OSTI]

    Oryshchenko, Vitaliy

    2011-03-15

    businesses via learning, imitation and other routes, with empirical results on spillovers being quite mixed (Blomstro¨m and Kokko, 1998; Go¨rg and Greenaway, 2001; Moran, Graham, and Blomstro¨m, 2005; Hu, 2004; Singh, 2004). The possibility of knowledge... spillovers from multinationals to indigenous enterprises is tightly linked to the type of training offered to employees of those firms. Local enter- prises may benefit from knowledge spillovers as trained employees move from foreign to local firms...

  16. Mathematical formula books and statistical tables are to be provided THE UNIVERSITY OF MANCHESTER

    E-Print Network [OSTI]

    Lionheart, Bill

    MATH38191 Two Hours Mathematical formula books and statistical tables are to be provided of the three questions A1. (a) Define (net) return Rt and log return rt at time t in terms of the price Pt > 0 at time t and the price Pt-1 > 0 at time t - 1. Show that rt = log(1 + Rt). [2+2 marks] (b) Consider

  17. Individualized Estimates of Second Cancer Risks After Contemporary Radiation Therapy for

    E-Print Network [OSTI]

    Brenner, David Jonathan

    are largely based on radiation therapy (RT) fields and doses no longer in use, and these estimates do and low-dose (20 Gy) RT for mediastinal Hodgkin lymphoma. METHODS. Three RT plans were constructed for 37 tissue doses with the omission of axillary RT. Low-dose (20 Gy) IFRT was associated with a 77% and 57

  18. APPUNTI DALLE LEZIONI DI ISTITUZIONI DI FISICA MATEMATICA

    E-Print Network [OSTI]

    Bologna, Università di

    seicento. Dunque questo modello meccanico rende conto di una legge termodinamica macroscopica (pV = RT

  19. Reminder:! homework grades and comments are on OAK!

    E-Print Network [OSTI]

    Palmeri, Thomas

    ? #12;RTj = 1 n rti i=1 n mean RT - overall mean RT in a given condition function (CDF) RTj = 1 n rti i=1 n mean RT F! j (t) = #elements in sample t n #12;cumulative distribution function (CDF) RTj = 1 n rti i=1 n mean RT F! j (t) = #elements in sample t n probability

  20. CHP - New Technologies that Work 

    E-Print Network [OSTI]

    Herweck, R.

    2012-01-01

    heat ? Cooling and refrigeration ? Steam production ?Dehumidification DE Packaged System at Site CHP: It?s time for Reliability Combined Heat & Power provides significantly greater reliability than central generation and T&D that could prevent... of appreciation for the amount of energy that can be saved ? General lack of necessary measurements such as flow rates and temperatures on cooling loops and other heat exchangers Nominal Capacity: 5 RT 10 RT 20 RT 30 RT 50 RT Model WFC-SC/SH Water...

  1. C O L L E G E O F A RT S & S C I E N C EV A N D E R B I L T U N I V E R S I T Y n a remote jungle of Guatemala, Professor

    E-Print Network [OSTI]

    Wikswo, John

    of Guatemala, Professor Arthur Demarest and his team of Vanderbilt and Guatemalan archeologists have uncov in Guatemala (please see sidebar, page 4). The Cancuén research might cause scholars to revise their views

  2. 4.7 A G R I C U LT U R E : A N I M P O RT A N T NO N -P O I N T S O U R C E O F P O L LU T I O N by Hans Schreier, Kenneth J. Hall, Sandra J. Brown,

    E-Print Network [OSTI]

    transformation into urban use. However, the newest concern about agricultural sustainability clearly comes from nutrient applications to the land (Summary Report Steer- ing Committee 1997). As urban development) and spotted frog (Rana pretiosa) (Orchard 1992; 1994). Amphibians are dependent on wetlands for reproduc- tion

  3. V A N D E R B I L T U N I V E R S I T Y C O L L E G E O F A RT S & S C I E N C E Vanderbilt Institute of

    E-Print Network [OSTI]

    Wikswo, John

    Keith Wood, Designer Anthony J. Spence, E'80, Director of Advancement Communications Vanderbilt," says Richard McCarty, A&S dean. "This expanded commitment to Jewish Stud- ies advances Vanderbilt

  4. V A N D E R B I L T U N I V E R S I T Y C O L L E G E O F A RT S & S C I E N C E S U M M E R 2 0 0 5

    E-Print Network [OSTI]

    Wikswo, John

    of poverty, or a solution to it? What do churches think about genetics, and how will their political clout how poverty relates to reli- gion. Does organized religion reinforce the politics that keep people

  5. W I N T E R 2 0 0 2 V A N D E R B I L T U N I V E R S I T Y C O L L E G E O F A RT S & S C I E N C E

    E-Print Network [OSTI]

    Wikswo, John

    produced by the detector in a new high- energy physics experiment, called BTeV. Not only must the system manufacturers begin offering guidance systems that allow your car to drive you automatically to and from work, you may have an ambitious new computer science project at the Fermi National Accel- erator Laboratory

  6. A Framework for Real-Time Service-Oriented Architecture

    E-Print Network [OSTI]

    Panahi, Mark; Nie, Weiran; Lin, Kwei-Jay

    2009-01-01

    in service-oriented architectures,” Journal of Service-the RT-Llama RT-SOA architecture. We present the performanceZ. Wang, and W. Weiss, An Architecture for Differentiated

  7. Stat 39000/FinMath 34500 Lecture 9 IT^O PROCESSES

    E-Print Network [OSTI]

    Mykland, Per A.

    C(St, t) = BtC St Bt , t = ert C(e-rt St, t) Hence: C(s, t) = ert C(e-rt s, t) = ert E [f(ST ) | St = e

  8. Numerical models of Rayleigh-Taylor instabilities superimposed upon convection

    E-Print Network [OSTI]

    Schmeling, Harro

    one R.T.-overturn to multiple convective with salt tectonics (R.T.), plutonism (R.T.), plate overturns. Secondly, how is the temperature field tectonics and mantle flows (convection) (see e.g. affected

  9. Early Response-to-Intervention Measures and Criteria as Predictors of Reading Disability in 3rd Grade

    E-Print Network [OSTI]

    Beach, Kristen Dawn

    2012-01-01

    among traditional and RTI-based definitions of readingResponse-to- Intervention ( RtI) framework for identifyingderived from a longitudinal RtI project executed in low-

  10. Response to Intervention Within Restrictive Settings: A Multi-Tiered Behavioral Intervention System for Addressing Behavior Problems Within the Top Tier

    E-Print Network [OSTI]

    Thornton, Sage

    2011-01-01

    Caption F igure 1. Recycled RtI model. Tier III: IntensifiedL. , & McGraw, K. (2009). RTI in the classroom: Guidelinessuch as Response to Intervention (RtI) and Positive Behavior

  11. Changing Places: How Communities Will Improve the Health of Boys of Color

    E-Print Network [OSTI]

    Edley, Christopher; Ruiz de Velasco, Jorge

    2010-01-01

    Response to Intervention (RtI) framework, available onlinea Response to Intervention (RtI) frame- work (see Cunha etsupport Ap s du In try rti ce Transitional jobs Community-

  12. School-Based Screening: A Population-Based Approach to Inform and Monitor Children’s Mental Health Needs

    E-Print Network [OSTI]

    Dowdy, Erin; Ritchey, Kristin; Kamphaus, R. W.

    2010-01-01

    a response to intervention (RTI) model on identi?cation ofresponse to intervention (RtI) movement of identifying andwithin a school as a part of a RtI program to determine risk

  13. Effect of a Targeted Early Literacy Intervention for English Learners

    E-Print Network [OSTI]

    Arellano, Elizabeth Michelle

    2013-01-01

    learners: Support for an RTI model. The California SchoolResponse to Intervention (RtI) framework, participants wereResponse to Intervention (RtI), phonological awareness (PA),

  14. 1) Introduction In order to relate neurophysiological data in the primary

    E-Print Network [OSTI]

    Yen, Shih-Cheng

    . Direct Saccade Task Fixation Stimulus Monitor RT In Window Reward Eye Pos (H) Eye Pos (V) Fixation Stimulus Monitor RT In Window Reward Eye Pos (H) Eye Pos (V) Putative Processes 1) Fixate 2) Perceive

  15. The calculus of vector valued functions is used

    E-Print Network [OSTI]

    r(t) = porn 0 ecur:es_r'() ( _ ) an. r1(s) — (3 — s, s — 2, s ) intersect? Find their angle of inter- r(t) = i — j + e'" k section correct to the nearest degree.

  16. http://pss.sagepub.com/ Psychological Science

    E-Print Network [OSTI]

    Oregon, University of

    performance using absolute reaction time (RT)--a measure that is not sensitive to search efficiency--they do

  17. A Clean Slate Design of Internet's Congestion Control Algorithm

    E-Print Network [OSTI]

    Duffy, Ken

    /N(t) R(t) #12;RCP: The Basic Mechanism !"# $%&'(%) *+,%-./012& !"# *+,%-3012& !"# *+,%-3012& !"#4 567 *+,%-3012& 89#4567 !%:)':;?,%(?,%(

  18. The Naked Truth about Hadronic Regge Trajectories

    E-Print Network [OSTI]

    A. E. Inopin

    2000-12-19

    We have reconstructed Regge trajectories (RT), using all existing data on masses and spin-parities of all currently known hadrons. In this resonance energy region meson and baryon RT are grossly nonlinear, and only 12% of all RT could be classified as a linear, with $\\sigma=0$, $\\alpha'\\simeq 0.9$ GeV${}^{-2}$.

  19. Specification and Analysis of Attribute-based Authorization Policy

    E-Print Network [OSTI]

    Sandhu, Ravi

    Policy The Big Goal Flexible, scalable authorization for decentralized, collaborative environments policy to support collaboration in open systems RT: A Role-based Trust-management* framework Need. Winsborough 6 Role-based Trust Management (RT) A family of credential / policy languages Simplest, RT0, has

  20. A CSP View on UMLRT structure diagrams Clemens Fischer, ErnstRudiger Olderog and Heike Wehrheim

    E-Print Network [OSTI]

    Habel, Annegret

    A CSP View on UML­RT structure diagrams Clemens Fischer, Ernst­R¨udiger Olderog and Heike Wehrheim UML­RT structure diagrams together with the formal method CSP­OZ combining CSP and Object­Z. While CSP­OZ is used for specifying the system components themselves (by CSP­OZ classes), UML­RT diagrams provide

  1. QER- Comment of E. Winkler

    Broader source: Energy.gov [DOE]

    I am one of many rejecting the idea of the proposed Kinder Moran pipeline. The people don't want to pay for a multibillionaire's expansion of his fossil fuel kingdom. Also, the methane pollution of this form of energy is not "clean energy." And most importantly it is destructive to the earth and the health of the people. As stewards of the planet, we must do better, and we are doing better, with cleaner and more economical forms of energy. Please, have a conscience and a vision. No fracked gas pipeline expansion.

  2. City of Moreno Valley,, California (Utility Company) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler, Iowa (Utility Company)Menasha,Monroe City,Moran,

  3. City of Morgan City, Utah (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler, Iowa (Utility Company)Menasha,Monroe City,Moran,Utah (Utility

  4. City of Morganton, North Carolina (Utility Company) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler, Iowa (Utility Company)Menasha,Monroe City,Moran,Utah

  5. City of Morrill, Kansas (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler, Iowa (Utility Company)Menasha,Monroe City,Moran,UtahMorrill,

  6. Adatbzisok elmlete 10. eloads Katona Gyula Y.

    E-Print Network [OSTI]

    Katona, Gyula Y.

    SQL-ben Az SQL-ben az ismeretlen vagy nem létezo értéket a NULL érték jelképezi. A NULL használatakor;ADATBÁZISOK ELM�LETE 10. EL OADÁS 2/22 NULL érték az SQL-ben Az SQL-ben az ismeretlen vagy nem létezo értéket 10. EL OADÁS 2/22 NULL érték az SQL-ben Az SQL-ben az ismeretlen vagy nem létezo értéket a NULL érték

  7. A robust and efficient approach to detect 3D rectal tubes from CT colonography

    SciTech Connect (OSTI)

    Yang Xiaoyun; Slabaugh, Greg [Medicsight PLC, Kensington Centre, 66 Hammersmith Road, London (United Kingdom)

    2011-11-15

    Purpose: The rectal tube (RT) is a common source of false positives (FPs) in computer-aided detection (CAD) systems for CT colonography. A robust and efficient detection of RT can improve CAD performance by eliminating such ''obvious'' FPs and increase radiologists' confidence in CAD. Methods: In this paper, we present a novel and robust bottom-up approach to detect the RT. Probabilistic models, trained using kernel density estimation on simple low-level features, are employed to rank and select the most likely RT tube candidate on each axial slice. Then, a shape model, robustly estimated using random sample consensus (RANSAC), infers the global RT path from the selected local detections. Subimages around the RT path are projected into a subspace formed from training subimages of the RT. A quadratic discriminant analysis (QDA) provides a classification of a subimage as RT or non-RT based on the projection. Finally, a bottom-top clustering method is proposed to merge the classification predictions together to locate the tip position of the RT. Results: Our method is validated using a diverse database, including data from five hospitals. On a testing data with 21 patients (42 volumes), 99.5% of annotated RT paths have been successfully detected. Evaluated with CAD, 98.4% of FPs caused by the RT have been detected and removed without any loss of sensitivity. Conclusions: The proposed method demonstrates a high detection rate of the RT path, and when tested in a CAD system, reduces FPs caused by the RT without the loss of sensitivity.

  8. Physician Beliefs and Practices for Adjuvant and Salvage Radiation Therapy After Prostatectomy

    SciTech Connect (OSTI)

    Showalter, Timothy N.; Ohri, Nitin; Teti, Kristopher G.; Foley, Kathleen A.; Keith, Scott W.; Trabulsi, Edouard J.; Lallas, Costas D.; Dicker, Adam P.; Hoffman-Censits, Jean; Pizzi, Laura T.; Gomella, Leonard G.

    2012-02-01

    Purpose: Despite results of randomized trials that support adjuvant radiation therapy (RT) after radical prostatectomy (RP) for prostate cancer with adverse pathologic features (APF), many clinicians favor selective use of salvage RT. This survey was conducted to evaluate the beliefs and practices of radiation oncologists (RO) and urologists (U) regarding RT after RP. Methods and Materials: We designed a Web-based survey of post-RP RT beliefs and policies. Survey invitations were e-mailed to a list of 926 RO and 591 U. APF were defined as extracapsular extension, seminal vesicle invasion, or positive surgical margin. Differences between U and RO in adjuvant RT recommendations were evaluated by comparative statistics. Multivariate analyses were performed to evaluate factors predictive of adjuvant RT recommendation. Results: Analyzable surveys were completed by 218 RO and 92 U (overallresponse rate, 20%). Adjuvant RT was recommended based on APF by 68% of respondents (78% RO, 44% U, p <0.001). U were less likely than RO to agree that adjuvant RT improves survival and/or biochemical control (p < 0.0001). PSA thresholds for salvage RT were higher among U than RO (p < 0.001). Predicted rates of erectile dysfunction due to RT were higher among U than RO (p <0.001). On multivariate analysis, respondent specialty was the only predictor of adjuvant RT recommendations. Conclusions: U are less likely than RO to recommend adjuvant RT. Future research efforts should focus on defining the toxicities of post-RP RT and on identifying the subgroups of patients who will benefit from adjuvant vs. selective salvage RT.

  9. RADIO FREQUENCY IDENTIFICATION DEVICES: EFFECTIVENESS IN IMPROVING SAFEGUARDS AT GAS-CENTRIFUGE URANIUM-ENRICHMENT PLANTS.

    SciTech Connect (OSTI)

    JOE,J.

    2007-07-08

    Recent advances in radio frequency identification devices (RFIDs) have engendered a growing interest among international safeguards experts. Potentially, RFIDs could reduce inspection work, viz. the number of inspections, number of samples, and duration of the visits, and thus improve the efficiency and effectiveness of international safeguards. This study systematically examined the applications of RFIDs for IAEA safeguards at large gas-centrifuge enrichment plants (GCEPs). These analyses are expected to help identify the requirements and desirable properties for RFIDs, to provide insights into which vulnerabilities matter most, and help formulate the required assurance tests. This work, specifically assesses the application of RFIDs for the ''Option 4'' safeguards approach, proposed by Bruce Moran, U. S. Nuclear Regulatory Commission (NRC), for large gas-centrifuge uranium-enrichment plants. The features of ''Option 4'' safeguards include placing RFIDs on all feed, product and tails (F/P/T) cylinders, along with WID readers in all FP/T stations and accountability scales. Other features of Moran's ''Option 4'' are Mailbox declarations, monitoring of load-cell-based weighing systems at the F/P/T stations and accountability scales, and continuous enrichment monitors. Relevant diversion paths were explored to evaluate how RFIDs improve the efficiency and effectiveness of safeguards. Additionally, the analysis addresses the use of RFIDs in conjunction with video monitoring and neutron detectors in a perimeter-monitoring approach to show that RFIDs can help to detect unidentified cylinders.

  10. Population-Based Study of Trends and Variations in Radiotherapy as Part of Primary Treatment of Cancer in the Southern Netherlands Between 1988 and 2006, With an Emphasis on Breast and Rectal Cancer

    SciTech Connect (OSTI)

    Vulto, Johanna C.M. [Comprehensive Cancer Centre South (IKZ), Eindhoven Cancer Registry, Eindhoven (Netherlands)], E-mail: ansvulto@home.nl; Lybeert, Marnix L.M. [Department of Radiotherapy, Catharina Hospital, Eindhoven (Netherlands); Louwman, Marieke W.J. [Comprehensive Cancer Centre South (IKZ), Eindhoven Cancer Registry, Eindhoven (Netherlands); Poortmans, Philip M.P. [Dr. Bernard Verbeeten Institute, Tilburg (Netherlands); Coebergh, Jan Willem W. [Comprehensive Cancer Centre South (IKZ), Eindhoven Cancer Registry, Eindhoven (Netherlands); Department of Public Health, Erasmus University Medical Centre, Rotterdam (Netherlands)

    2009-06-01

    Purpose: To explore current variations in the use of primary radiotherapy (RT) in a region with two RT departments with adjacent referral areas, one in the eastern and one in the western sector of the southern region of the Netherlands. Methods and Materials: We calculated the proportion of 147,588 patients with newly diagnosed cancer between 1988 and 2006 in the southern Netherlands who received primary RT. Especially for breast and rectal cancer patients we studied primary RT use according to stage (breast cancer) and age and separately for the eastern and western sectors. Results: The number of patients with new diagnoses receiving primary RT increased from 1,668 patients in 1988 to 2,971 patients in 2006, with the proportion of the overall patients receiving RT remaining more or less unchanged ({+-}30%). However, only 20% of elderly patients (75+ years) received primary RT. Over time, more patients with prostate and rectal cancer, fewer patients with lung and bladder cancer or Hodgkin's lymphoma, and, recently, more patients with cervical or endometrial cancer received RT. The proportion of patients with most other tumor types treated with RT remained more or less unchanged. The total RT rate was slightly higher for patients in the eastern sector. Of particular note, patients with breast or rectal cancer in the eastern sector were significantly more likely to receive primary RT than were their counterparts in the western sector (odds ratio = 1.4, 95% confidence interval =1.4-1.5, and odds ratio = 1.4, 95% confidence interval = 1.3-1.6, respectively). Conclusions: Although the number of RT-treated patients increased substantially during 1988 to 2006, the proportion remained essentially unchanged. In addition, large variations were found in referral rates for RT, especially in later years, between the eastern and the western sectors of the region.

  11. Phase Measurement of Cognitive Impairment Specific to Radiotherapy

    SciTech Connect (OSTI)

    Armstrong, Carol L.; Shera, David M.; Lustig, Robert A.; Phillips, Peter C.

    2012-07-01

    Purpose: Memory impairment is an early-delayed effect of radiotherapy (RT). The prospective longitudinal measurement of the cognitive phase effects from RT was conducted on treated and untreated brain tumor patients. The study design investigated semantic vs. perceptual and visual vs. verbal memory to determine the most disease-specific measure of RT-related changes and understanding of the neurotoxicity from RT to the brain. Methods and Materials: Tests of memory that had previously shown RT-related phasic changes were compared with experimental tests of memory to test hypotheses about cognition targeted to the neural toxicity of RT. The results from 41 irradiated and 29 nonirradiated patients with low-grade, supratentorial tumors were analyzed. The methods controlled for comorbid white matter risk, recurrence, interval after treatment, and age (18-69 years). The effects were examined before RT and at three points after RT to 1 year using a mixed effects model that included interval, group, surgical status, medication use, practice, and individual random effects. Four new tests of memory and other candidate cognitive tests were investigated, and a post hoc analysis of a comprehensive battery of tests was performed to identify the cognitive processes most specific to RT. Results: The RT effects on memory were identified in the treated group only; among the new tests of memory and the complete neurocognitive battery, the RT effects were significant only for delayed recall (p < 0.009) and interval to recognize (p < 0.002). Tumor location was not related to the treatment effect. Memory decline was specific to retrieval of semantic memories; a double dissociation of semantic from perceptual visual memory was demonstrated in the RT group. Conclusions: These results implicate memory dependent on the semantic cortex and the hippocampal memory system. A cognitive measurement that is brief but specific to neural mechanisms is effective and feasible for studies of RT damage.

  12. External Beam Radiotherapy for Colon Cancer: Patterns of Care

    SciTech Connect (OSTI)

    Dunn, Emily F., E-mail: dunn@humonc.wisc.ed [Department of Human Oncology, University of Wisconsin School of Medicine and Public Health, Madison, WI (United States); Kozak, Kevin R. [Department of Human Oncology, University of Wisconsin School of Medicine and Public Health, Madison, WI (United States); Moody, John S. [Division of Radiation Oncology, Moses Cone Regional Cancer Center, Greensboro, NC (United States)

    2010-04-15

    Purpose: Despite its common and well characterized use in other gastrointestinal malignancies, little is known about radiotherapy (RT) use in nonmetastatic colon cancer in the United States. To address the paucity of data regarding RT use in colon cancer management, we examined the RT patterns of care in this patient population. Methods and Materials: Patients with nonmetastatic colon cancer, diagnosed between 1988 and 2005, were identified in the Surveillance, Epidemiology, and End Results (SEER) database. Univariate and multivariate methods were used to identify factors associated with RT use. Results: On univariate analysis, tumor location, age, sex, race, T stage, N stage, and geographic location were each associated with differences in RT use (all p < 0.01). In general, younger patients, male patients, and patients with more advanced disease were more likely to receive RT. On multivariate analysis, tumor location, age, gender, T and N stage, time of diagnosis and geographic location were significantly associated with RT use (all p < 0.001). Race, however, was not associated with RT use. On multivariate analysis, patients diagnosed in 1988 were 2.5 times more likely to receive RT than those diagnosed in 2005 (p = 0.001). Temporal changes in RT use reflect a responsiveness to evolving evidence related to the therapeutic benefits of adjuvant RT. Conclusions: External beam RT is infrequently used for colon cancer, and its use varies according to patient and tumor characteristics. RT use has declined markedly since the late 1980s; however, it continues to be used for nonmetastatic disease in a highly individualized manner.

  13. Upfront Androgen Deprivation Therapy With Salvage Radiation May Improve Biochemical Outcomes in Prostate Cancer Patients With Post-Prostatectomy Rising PSA

    SciTech Connect (OSTI)

    Jang, Joanne W.; Hwang, Wei-Ting; Guzzo, Thomas J.; Wein, Alan J.; Haas, Naomi B.; Both, Stefan; Vapiwala, Neha

    2012-08-01

    Purpose: The addition of androgen deprivation therapy (ADT) to definitive external beam radiation therapy (RT) improves outcomes in higher-risk prostate cancer patients. However, the benefit of ADT with salvage RT in post-prostatectomy patients is not clearly established. Our study compares biochemical outcomes in post-prostatectomy patients who received salvage RT with or without concurrent ADT. Methods and Materials: Of nearly 2,000 post-prostatectomy patients, we reviewed the medical records of 191 patients who received salvage RT at University of Pennsylvania between 1987 and 2007. Follow-up data were obtained by chart review and electronic polling of the institutional laboratory database and Social Security Death Index. Biochemical failure after salvage RT was defined as a prostate-specific antigen of 2.0 ng/mL above the post-RT nadir or the initiation of ADT after completion of salvage RT. Results: One hundred twenty-nine patients received salvage RT alone, and 62 patients received combined ADT and salvage RT. Median follow-up was 5.4 years. Patients who received combined ADT and salvage RT were younger, had higher pathologic Gleason scores, and higher rates of seminal vesicle invasion, lymph node involvement, and pelvic nodal irradiation compared with patients who received salvage RT alone. Patients who received combined therapy had improved biochemical progression-free survival (bPFS) compared with patients who received RT alone (p = 0.048). For patients with pathologic Gleason scores {<=}7, combined RT and ADT resulted in significantly improved bPFS compared to RT alone (p = 0.013). Conclusions: These results suggest that initiating ADT during salvage RT in the post-prostatectomy setting may improve bPFS compared with salvage RT alone. However, prospective randomized data are necessary to definitively determine whether hormonal manipulation should be used with salvage RT. Furthermore, the optimal nature and duration of ADT and the patient subgroups in which ADT could provide the most benefit remain open questions.

  14. Reactions at Polymer Interfaces: Transitions from Chemical to Diffusion-Control and Mixed Order Kinetics

    E-Print Network [OSTI]

    Ben O'Shaughnessy; Dimitrios Vavylonis

    1998-12-21

    We study reactions between end-functionalized chains at a polymer-polymer interface. For small chemical reactivities (the typical case) the number of diblocks formed, $R_t$, obeys 2nd order chemically controlled kinetics, $R_t \\sim t$, until interfacial saturation. For high reactivities (e.g. radicals) a transition occurs at short times to 2nd order diffusion-controlled kinetics, with $R_t \\sim t/\\ln t$ for unentangled chains while $t/\\ln t$ and $t^{1/2}$ regimes occur for entangled chains. Long time kinetics are 1st order and controlled by diffusion of the more dilute species to the interface: $R_t \\sim t^{1/4}$ for unentangled cases, while $R_t \\sim t^{1/4}$ and $t^{1/8}$ regimes arise for entangled systems. The final 1st order regime is governed by center of gravity diffusion, $R_t \\sim t^{1/2}$.

  15. Prediction of Liver Function by Using Magnetic Resonance-based Portal Venous Perfusion Imaging

    SciTech Connect (OSTI)

    Cao Yue; Wang Hesheng; Johnson, Timothy D.; Pan, Charlie; Hussain, Hero; Balter, James M.; Normolle, Daniel; Ben-Josef, Edgar; Ten Haken, Randall K.; Lawrence, Theodore S.; Feng, Mary

    2013-01-01

    Purpose: To evaluate whether liver function can be assessed globally and spatially by using volumetric dynamic contrast-enhanced magnetic resonance imaging MRI (DCE-MRI) to potentially aid in adaptive treatment planning. Methods and Materials: Seventeen patients with intrahepatic cancer undergoing focal radiation therapy (RT) were enrolled in institution review board-approved prospective studies to obtain DCE-MRI (to measure regional perfusion) and indocyanine green (ICG) clearance rates (to measure overall liver function) prior to, during, and at 1 and 2 months after treatment. The volumetric distribution of portal venous perfusion in the whole liver was estimated for each scan. We assessed the correlation between mean portal venous perfusion in the nontumor volume of the liver and overall liver function measured by ICG before, during, and after RT. The dose response for regional portal venous perfusion to RT was determined using a linear mixed effects model. Results: There was a significant correlation between the ICG clearance rate and mean portal venous perfusion in the functioning liver parenchyma, suggesting that portal venous perfusion could be used as a surrogate for function. Reduction in regional venous perfusion 1 month after RT was predicted by the locally accumulated biologically corrected dose at the end of RT (P<.0007). Regional portal venous perfusion measured during RT was a significant predictor for regional venous perfusion assessed 1 month after RT (P<.00001). Global hypovenous perfusion pre-RT was observed in 4 patients (3 patients with hepatocellular carcinoma and cirrhosis), 3 of whom had recovered from hypoperfusion, except in the highest dose regions, post-RT. In addition, 3 patients who had normal perfusion pre-RT had marked hypervenous perfusion or reperfusion in low-dose regions post-RT. Conclusions: This study suggests that MR-based volumetric hepatic perfusion imaging may be a biomarker for spatial distribution of liver function, which could aid in individualizing therapy, particularly for patients at risk for liver injury after RT.

  16. Historical Trends in the Use of Radiation Therapy for Pediatric Cancers: 1973-2008

    SciTech Connect (OSTI)

    Jairam, Vikram; Roberts, Kenneth B.; Yale Cancer Center, New Haven, Connecticut; Cancer Outcomes, Public Policy, and Effectiveness Research Center at Yale, New Haven, Connecticut ; Yu, James B.

    2013-03-01

    Purpose: This study was undertaken to assess historical trends in the use of radiation therapy (RT) for pediatric cancers over the past 4 decades. Methods: The National Cancer Institute's Surveillance, Epidemiology, and End Results database of the 9 original tumor registries (SEER-9) was queried to identify patients aged 0 to 19 years with acute lymphoblastic leukemia, acute myeloid leukemia, bone and joint cancer, cancer of the brain and nervous system, Hodgkin lymphoma, neuroblastoma, non-Hodgkin lymphoma, soft tissue cancer, Wilms tumor, or retinoblastoma from 1973 to 2008. Patients were grouped into 4-year time epochs. The number and percentage of patients who received RT as part of their initial treatment were calculated per epoch by each diagnosis group from 1973 to 2008. Results: RT use for acute lymphoblastic leukemia, non-Hodgkin lymphoma, and retinoblastoma declined sharply from 57%, 57%, and 30% in 1973 to 1976 to 11%, 15%, and 2%, respectively, in 2005 to 2008. Similarly, smaller declines in RT use were also seen in brain cancer (70%-39%), bone cancer (41%-21%), Wilms tumor (75%-53%), and neuroblastoma (60%-25%). RT use curves for Wilms tumor and neuroblastoma were nonlinear with nadirs in 1993 to 1996 at 39% and 19%, respectively. There were minimal changes in RT use for Hodgkin lymphoma, soft tissue cancer, or acute myeloid leukemia, roughly stable at 72%, 40%, and 11%, respectively. Almost all patients treated with RT were given external beam RT exclusively. However, from 1985 to 2008, treatments involving brachytherapy, radioisotopes, or combination therapy increased in frequency, comprising 1.8%, 4.6%, and 11.9% of RT treatments in brain cancer, soft tissue cancer, and retinoblastoma, respectively. Conclusions: The use of RT is declining over time in 7 of 10 pediatric cancer categories. A limitation of this study is a potential under-ascertainment of RT use in the SEER-9 database including the delayed use of RT.

  17. Plant Defense Signaling Mechanisms and Evolution 

    E-Print Network [OSTI]

    Jiang, Shan

    2015-08-13

    for two Salk lines. The positions of RT-PCR primers are labeled with arrows. (B) Genotyping and RT-PCR detection of ASR3 expression in Salk lines. PCR was carried out with genomic DNA or cDNA using either the full-length or RT-PCR primers as indicated... modifications and charge. 7 Supplemental Table 2. Primers used in this study. Cloning and mutation primers Gene Forward primer Reverse primer ASR3 CGGGATCCATGGCTCTGGAACAGTTAGG GAAGGCCTCATCTTATCCGCGATTT TTG ProASR3...

  18. Free Energy Calculation in MD Simulation

    E-Print Network [OSTI]

    Nielsen, Steven O.

    Free Energy Calculation in MD Simulation #12;Basic Thermodynamics Helmoholtz free energy A = U ­ TS + i Ni dA = wrev (reversible, const N V T) eq (22.9) McQuarrie & Simon Gibbs free energy G = U;Implication of Free Energy A B Keq = [A]/[B] Keq = exp (-G0 /RT) G0 = -RT ln Keq G = G0 + RT ln Q G > 0

  19. Effects of Resistance Trainging and -hydroxy--methylbutyrate (HMB) on Muscle Fiber CSA and Lean Body Mass in Aged Rats: A DTI and DEXA Study

    E-Print Network [OSTI]

    McQuade, D. Tyler

    and volumetric measurements. In vivo and prior to sacrifice, pre- and post-RT LBM was assessed by dual energy X

  20. Cars and the City: An Investigation of Transportation and Residential Location Choices in New York City

    E-Print Network [OSTI]

    Salon, Deborah

    2006-01-01

    Weighted) . . . . . . . . . . . . . . .Car Ownership inof Private Car Riding Time . . . . . . . . . . . . . . . .109 4.11 Number of Cars Per Household from the RT-HIS Sample

  1. Is Androgen Deprivation Therapy Necessary in All Intermediate-Risk Prostate Cancer Patients Treated in the Dose Escalation Era?

    SciTech Connect (OSTI)

    Castle, Katherine O.; Hoffman, Karen E.; Levy, Lawrence B.; Lee, Andrew K.; Choi, Seungtaek; Nguyen, Quynh N.; Frank, Steven J.; Pugh, Thomas J.; McGuire, Sean E.; Kuban, Deborah A.

    2013-03-01

    Purpose: The benefit of adding androgen deprivation therapy (ADT) to dose-escalated radiation therapy (RT) for men with intermediate-risk prostate cancer is unclear; therefore, we assessed the impact of adding ADT to dose-escalated RT on freedom from failure (FFF). Methods: Three groups of men treated with intensity modulated RT or 3-dimensional conformal RT (75.6-78 Gy) from 1993-2008 for prostate cancer were categorized as (1) 326 intermediate-risk patients treated with RT alone, (2) 218 intermediate-risk patients treated with RT and ?6 months of ADT, and (3) 274 low-risk patients treated with definitive RT. Median follow-up was 58 months. Recursive partitioning analysis based on FFF using Gleason score (GS), T stage, and pretreatment PSA concentration was applied to the intermediate-risk patients treated with RT alone. The Kaplan-Meier method was used to estimate 5-year FFF. Results: Based on recursive partitioning analysis, intermediate-risk patients treated with RT alone were divided into 3 prognostic groups: (1) 188 favorable patients: GS 6, ?T2b or GS 3+4, ?T1c; (2) 71 marginal patients: GS 3+4, T2a-b; and (3) 68 unfavorable patients: GS 4+3 or T2c disease. Hazard ratios (HR) for recurrence in each group were 1.0, 2.1, and 4.6, respectively. When intermediate-risk patients treated with RT alone were compared to intermediate-risk patients treated with RT and ADT, the greatest benefit from ADT was seen for the unfavorable intermediate-risk patients (FFF, 74% vs 94%, respectively; P=.005). Favorable intermediate-risk patients had no significant benefit from the addition of ADT to RT (FFF, 94% vs 95%, respectively; P=.85), and FFF for favorable intermediate-risk patients treated with RT alone approached that of low-risk patients treated with RT alone (98%). Conclusions: Patients with favorable intermediate-risk prostate cancer did not benefit from the addition of ADT to dose-escalated RT, and their FFF was nearly as good as patients with low-risk disease. In patients with GS 4+3 or T2c disease, the addition of ADT to dose-escalated RT did improve FFF.

  2. Synthesis of the Furanosteroidal Antibiotic Viridin Anderson, E.; Alexanian, E.; Sorenson, E. Angew. Chemie Int. Ed. 2004, 43, 1998-2001.

    E-Print Network [OSTI]

    . Chemie Int. Ed. 2004, 43, 1998-2001. 1. LDA (1 equiv.) THF, -78 °C then TMSCl, -78 °C to rt 2. [Pd(PPh3

  3. OCT-based arterial elastography: robust estimation exploiting tissue

    E-Print Network [OSTI]

    Khalil, Ahmad S.

    and Anatomically-Realistic Models," Journal of Engineering Mathematics 47(3-4), 299-314 (2003). 4. R.T. Lee, F

  4. Distributed Energy Systems in California's Future: A Preliminary Report Volume 2

    E-Print Network [OSTI]

    Balderston, F.

    2010-01-01

    1976. R.T. Tamblyn, " Thermal Storage: June 1977. A Sleepinga flatplate collector and thermal storage system. With thethe collector and thermal storage and its exchange systems

  5. Changes in the Economic Value of Variable Generation at High Penetration Levels: A Pilot Case Study of California

    E-Print Network [OSTI]

    Mills, Andrew

    2013-01-01

    RT deviations impose (i.e. wind forecast errors on averagerelative magnitude of wind forecast errors decreases betweenwith managing DA wind forecast errors steadily increases.

  6. Literacy Progress Monitoring: Efficiency Versus Stability

    E-Print Network [OSTI]

    Garcia, Melissa Jeanne

    2012-01-01

    2011). A systematic view of RTI research: Introduction toPyramid response to intervention: RTI, professional learningis Response to Intervention (RtI), or a Multitiered Systems

  7. A, E.K.Ris Ris-M-OHj Title and authors)

    E-Print Network [OSTI]

    or group Department of fee-«'tor Technology Group's own registration numbers) RT-^-*5 Abstract The work seven of the Department'a graduate

  8. Mobilization of Viable Tumor Cells Into the Circulation During Radiation Therapy

    SciTech Connect (OSTI)

    Martin, Olga A.; Anderson, Robin L.; Russell, Prudence A.; Ashley Cox, R.; Ivashkevich, Alesia; Swierczak, Agnieszka; Doherty, Judy P.; Jacobs, Daphne H.M.; Smith, Jai; Siva, Shankar; Daly, Patricia E.; Ball, David L.; and others

    2014-02-01

    Purpose: To determine whether radiation therapy (RT) could mobilize viable tumor cells into the circulation of non-small cell lung cancer (NSCLC) patients. Methods and Materials: We enumerated circulating tumor cells (CTCs) by fluorescence microscopy of blood samples immunostained with conventional CTC markers. We measured their DNA damage levels using ?-H2AX, a biomarker for radiation-induced DNA double-strand breaks, either by fluorescence-activated cell sorting or by immunofluorescence microscopy. Results: Twenty-seven RT-treated NSCLC patients had blood samples analyzed by 1 or more methods. We identified increased CTC numbers after commencement of RT in 7 of 9 patients treated with palliative RT, and in 4 of 8 patients treated with curative-intent RT. Circulating tumor cells were also identified, singly and in clumps in large numbers, during RT by cytopathologic examination (in all 5 cases studied). Elevated ?-H2AX signal in post-RT blood samples signified the presence of CTCs derived from irradiated tumors. Blood taken after the commencement of RT contained tumor cells that proliferated extensively in vitro (in all 6 cases studied). Circulating tumor cells formed ?-H2AX foci in response to ex vivo irradiation, providing further evidence of their viability. Conclusions: Our findings provide a rationale for the development of strategies to reduce the concentration of viable CTCs by modulating RT fractionation or by coadministering systemic therapies.

  9. Changes in the Economic Value of Variable Generation at High Penetration Levels: A Pilot Case Study of California

    E-Print Network [OSTI]

    Mills, Andrew

    2013-01-01

    System Operator Combined cycle gas turbine Continuousinclude natural gas combined cycle (CCGTs) and combustiona balance in RT. The combined-cycle vintage (CCGT) modeled

  10. Biochemical failure and the temporal kinetics of prostate-specific antigen after radiation therapy with androgen deprivation

    SciTech Connect (OSTI)

    Buyyounouski, Mark K. [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States); Hanlon, Alexandra L. [Department of Biostatistics, Fox Chase Cancer Center, Philadelphia, PA (United States); Horwitz, Eric M. [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States); Uzzo, Robert G. [Department of Surgical Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States); Pollack, Alan [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States)]. E-mail: alan.pollack@fccc.edu

    2005-04-01

    Purpose: The accuracy of the American Society of Therapeutic Radiation Oncology consensus definition of biochemical failure (BF) after radiation therapy (RT) and androgen deprivation (AD) has been questioned, because posttreatment prostate-specific antigen (PSA) levels typically rise after release from AD, and misclassification of BF may be made. The temporal kinetics of posttreatment PSA levels was examined to define the error in the classification of BF. Methods and Materials: Between December 1, 1991 and April 30, 1998, 688 men with T1c-T3 NX/0 M0 prostate cancer received three-dimensional conformal RT alone (n = 586) or in combination with either short-term (STAD: 3 to 12 months, n = 82) or long-term (LTAD: 12 to 36 months, n = 20) AD. Follow-up, calculated from the end of all treatment, was {>=}48 months. The mean posttreatment PSA was calculated in 3-month intervals. Results: The median posttreatment clinical follow-up period was 76 months (range, 48-152 months). The posttreatment PSA values from the end of all treatment for the RT+STAD-BF group showed an initial period of rise followed by a period of decline at 30 months and then a continued rise again. The decline in the mean posttreatment PSA is explained in part by stabilization in PSA level after 3 consecutive rises. Nonbiochemical failures (NBF) after RT+STAD had a relatively constant mean PSA over time of approximately 0.5 ng/mL. Unlike the RT+STAD-NBF profile, the RT+LTAD-NBF profile rose continuously and steadily to a level approaching 1 ng/mL. The RT+LTAD-BF profile rose continuously but at a slower rate over time. Nine RT+STAD-NBF patients (22%) and 2 RT+LTAD-BF (29%) patients experienced 3 consecutive rises followed by a subsequent decline and stabilization of PSA compared to 10 RT-BF patients (5%). Redistributing these misclassified patients to their respective NBF groups changed the mean posttreatment PSA profiles as follows: The RT+LTAD-BF profile rose constantly and steadily with a doubling time of approximately 16 months, and the RT+LAD-NF initially rose to a value of approximately 0.5 ng/mL, then at 36 months began to decline. Conclusions: The temporal kinetics of posttreatment PSA after RT+AD and RT alone are different. The American Society of Therapeutic Radiation Oncology definition for biochemical failure overestimates BF in 20-30% after RT+AD compared to 5% after RT alone.

  11. Improving consumer value through enhanced performance around...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Improving consumer value through enhanced performance around the world LANL statistical tools have helped create Reliability Technology (RT), which increases the overall fraction...

  12. Published: August 02, 2011 r 2011 American Chemical Society 12910 dx.doi.org/10.1021/ja202277h |J. Am. Chem. Soc. 2011, 133, 1291012913

    E-Print Network [OSTI]

    Müller, Peter

    - (trifluoromethyl)phenyl isocyanate, CH2Cl2, rt, 12 h. (ii) Squaric acid, toluene/n-butanol (3:1), r

  13. Impaired angiogenesis in aging myocardial microvascular endothelial cells is associated with reduced importin alpha and decreased nuclear transport of HIF1 alpha: mechanistic implications.

    E-Print Network [OSTI]

    Ahluwalia, A; Narula, J; Jones, M K; Deng, X; Tarnawski, A S

    2010-01-01

    Exercise training improves aging-induced downregulation ofimpaired angiogenesis in aging human dermal microvascularby real time RT-PCR. In aging MMEC importin ?1 and importin

  14. Defining biochemical failure after radiotherapy with and without androgen deprivation for prostate cancer

    SciTech Connect (OSTI)

    Buyyounouski, Mark K. [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States)]. E-mail: mark.buyyounouski@fccc.edu; Hanlon, Alexandra L. [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States); Eisenberg, Debra F. [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States); Horwitz, Eric M. [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States); Feigenberg, Steven J. [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States); Uzzo, Robert G. [Department of Surgical Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States); Pollack, Alan [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States)

    2005-12-01

    Purpose: To compare several characteristics of alternative definitions of biochemical failure (BF) in men with extended follow-up after radiotherapy (RT) with or with androgen deprivation therapy (ADT) for prostate cancer. Methods and Materials: From December 1, 1991, to April 30, 1998, 688 men with Stage T1c-T3NX-N0M0 prostate cancer received RT alone (n = 586) or RT plus ADT (n = 102) with a minimal follow-up of 4 years and five or more 'ADT-free' posttreatment prostate-specific antigen levels. BF was defined by three methods: (1) the ASTRO definition (three consecutive rises in prostate-specific antigen level); (2) a modified American Society for Therapeutic Radiology Oncology (ASTRO) definition requiring two additional consecutive rises when a decline immediately subsequent to three consecutive rises occurred; and (3) the 'Houston' or nadir plus 2-ng/mL definition (a rise of at least 2 ng/mL greater than the nadir). The sensitivity, specificity, positive predictive value, negative predictive value, and overall accuracy were determined for each using clinical progression as the endpoint. Furthermore, the misclassification rates for a steadily rising prostate-specific antigen level, ability to satisfy the proportional hazards (RT with or without ADT), effects of short follow-up, and intervals to the diagnosis of BF were compared. Results: The misclassification rate for BF using the nadir plus 2-ng/mL definition was 2% for RT alone and 0% for RT plus ADT compared with 0% and 0% for the modified ASTRO definition, and 5% and 23% for the ASTRO definition, respectively. The hazard rates for RT alone and RT plus ADT were proportional only for the nadir plus 2 ng/mL definition and seemingly unaffected by the length of follow-up. For RT with or without ADT, the nadir plus 2 ng/mL definition was the most specific (RT, 80% vs. RT plus ADT, 75%) with the greatest positive predictive value (RT, 36% vs. RT plus ADT, 25%) and overall accuracy (RT, 81% vs. RT plus ADT, 77%). A greater proportion of BF was diagnosed in the first 2 years of follow-up with the nadir plus 2 ng/mL definition compared with the ASTRO definition (13% vs. 5%, p = 0.0138, chi-square test). Conclusion: The nadir plus 2 ng/mL definition was the best predictor of sustained, true, biochemical, and clinical failure, and was not affected by the use of ADT or follow-up length.

  15. A molecular line and continuum study of water maser sources

    E-Print Network [OSTI]

    Jenness, Timothy

    1996-12-10

    Bally J., Lada C. J., 1983, ApJ, 265, 824 Benson P. J., et al., 1990, ApJS, 74, 911 Burke B. F., Papa D. C., Papadopoulos G. D., Schwartz P. R., Knowles S. H., Sullivan W. T., Meeks M. L., Moran J. M., 1970, ApJ, 160, L63 Chapman J. M., Cohen R. J., 1986... , MNRAS, 220, 513 Cheung A. C., Rank D. M., Townes C. H., Thornton D. D., Welch W. J., 1969, Nature, 221, 626 Chini R., Elsa¨sser H., Neckel T., 1980, A&A, 91, 186 Cooke B., Elitzur M., 1985, ApJ, 295, 175 Elitzur M., Hollenbach D. J., McKee C. F., 1989...

  16. Magnetic Activity in Stars, Discs and Quasars

    E-Print Network [OSTI]

    Donald Lynden-Bell

    2000-07-14

    Although magnetic fields in interstellar matter were postulated almost fifty years ago, magnetohydrodynamic theory was then much hampered by our inability to see what the magnetic field configurations were like and, after a decade of innovative development, cynics, not without some justification, began to claim that anything can happen when magnetism and an imaginative theorist get together. Thus cosmic lightning in particular received a bad press. More recently great advances in observational techniques that we shall hear of from Title, Beck, Moran and Mirabel have enabled us to see not only the sun's magnetic field with unprecedented clarity but the fields in galaxies, quasars and microquasars are now measured and not merely figments of fertile imaginations.

  17. Comunidades de partidarios en redes sociales: estudio de las elecciones catalanas de 2010 y 2012

    E-Print Network [OSTI]

    Moro, Esteban

    diferentes tipos de comunicación (mención, MT, o retuit, RT), de las palabras utilizadas o de los hashtags, da indicación sobre la formación de grupos (partisanos) que comparten una misma ideología, flujos de populares en este tipo de estudios es el de utilizar el número de RT, MT o número de menciones de los

  18. Required Reading: FP Chapter 3 Suggested Reading: SP Chapter 3

    E-Print Network [OSTI]

    Toohey, Darin W.

    Average thermal energy of collisions: ~ RT = 8.3 J mol-1 K-1 x T RT = 2.5 kJ mol-1 @ 300 K Energy ­ Atmospheric photochemistry #12;2 Importance of Spectroscopy and Photochemistry I · Most chemical processes molecules directly influences the energy balance of the planet ­ Greenhouse effect (CO2, H2O, N2O, CFCs

  19. Surveillance of Craniopharyngioma Cyst Growth in Children Treated With Proton Radiotherapy

    SciTech Connect (OSTI)

    Winkfield, Karen M. [Harvard Radiation Oncology Program, Harvard Medical School, Boston, MA (United States)], E-mail: kwinkfield@partners.org; Linsenmeier, Claudia; Yock, Torunn I. [Department of Radiation Oncology, Massachusetts General Hospital, Boston, MA (United States); Grant, P. Ellen [Department of Radiology, Massachusetts General Hospital, Boston, MA (United States); Yeap, Beow Y. Sc.D. [Department of Medicine, Massachusetts General Hospital, Boston, MA (United States); Butler, William E. [Department of Neurosurgery, Massachusetts General Hospital, Boston, MA (United States); Tarbell, Nancy J. [Department of Radiation Oncology, Massachusetts General Hospital, Boston, MA (United States)

    2009-03-01

    Purpose: Craniopharyngiomas are benign, slow-growing tumors that frequently contain a cystic component. Even with gross total resection, the cyst can reform and cause symptoms. Fluctuations in cyst volume during radiotherapy (RT) can affect treatment planning and delivery. The aim of this study was to report our experience with cyst enlargement during conformal proton RT for children with craniopharyngioma and to make recommendations regarding mid-treatment surveillance. Methods and Materials: Between January 2001 and August 2007, 24 children (aged {<=}18 years) underwent proton RT at the Massachusetts General Hospital for craniopharyngioma. For all 24 patients, tumor size on magnetic resonance imaging and/or computed tomography was measured before and after RT. Surveillance imaging was available for review on 17 patients. During RT, cyst growth was assessed to determine whether the treatment fields needed to be altered. Results: Of the 17 children who underwent repeat imaging during RT, 6 required intervention because of changes in cyst dimensions. Four patients (24%) had cyst growth beyond the original treatment fields, requiring enlargement of the treatment plan. One patient's treatment field was reduced after a decreased in cyst size. Cyst drainage was performed in another patient to avoid enlargement of the treatment fields. Conclusion: In patients undergoing highly conformal RT for craniopharyngiomas with cysts, routine imaging during treatment is recommended. Surveillance imaging should be performed at least every 2 weeks during proton RT in an attempt to avoid marginal failure. Craniopharyngiomas with large cystic components or enlargement during treatment might require weekly imaging.

  20. Energy Efficient Computing with the Low Power, Energy Aware Processing (LEAP) Architecture

    E-Print Network [OSTI]

    McIntire, Dustin Hale

    2012-01-01

    and communications module PWR RT618+RT620 Power module andwith a power supply module (PWR module), and a high fidelityAUX_BUS_CHAIN_OUT EMAP2 +MAG_PWR V5BUS V33BUS V9BUS -V9BUS

  1. by Martin LaMonica 109 retweet Share 9

    E-Print Network [OSTI]

    crafty power-tracking start-up | Green Tech - CNET News James C. Frinak RT @cnet -"Belkin Buys Crafty Power-Tracking Start-up - Martin LaMonica | Green Tech | CNET News - #green MidwestBAS RT @cnet Belkin buys crafty power-tracking start-up | Green Tech - CNET News Auf #Belkin Buys Crafty Power

  2. Jeffrey Sprague, Ph.D. (jeffs@uoregon.edu)

    E-Print Network [OSTI]

    Jeffrey Sprague, Ph.D. (jeffs@uoregon.edu) 1 RTI for Behavior: Applying the RTI Logic Agenda · Welcome and introductions · Overview of RtI for Behavior Support · The challenge of problem students in what tier? · Building your RtI Intervention Menu for Behavior Support · Tier 1, 2, 3, and 4

  3. Real Time PCR for Gene Expression Analysis Isolate RNA using hot acid phenol protocol.

    E-Print Network [OSTI]

    Auble, David

    . Make cDNA Reagents: - DEPC water - Filter tips - Recombinant DNase I (ABgene, catalog # AB-1154/a) - 10M reverse primer - SuperScript II Reverse Transcriptase (Invitrogen, catalog # 18064-014) - 5X FS Buffer (included with RT) - 0.1M DTT (included with RT) - RNaseOUT (Invitrogen, catalog # 10777-019) - RNase H

  4. An Intelligent Battery Controller Using Bias-Corrected Q-learning

    E-Print Network [OSTI]

    Powell, Warren B.

    to renewables requires storage to help smooth short-term variations in energy from wind and solar sources is a fundamental control problem in energy systems, exacerbate the issue to a degree that has not been observed as a Markov decision process with state St = (rt, pt) where rt is the energy level in the battery (the

  5. Directions to the University of Connecticut Storrs Campus From Bradley International Airport

    E-Print Network [OSTI]

    Olshevsky, Vadim

    Directions to the University of Connecticut ­ Storrs Campus From Bradley International Airport on Connecticut Route 195 about 6 miles to the University. (You will come to the intersection of Rt. 195 and Rt of the exit ramp. Travel south on Connecticut Route 195 about 6 miles to the University. (You will come

  6. 2010-2011 Participating Products Products Worth 1 Point

    E-Print Network [OSTI]

    Palmeri, Thomas

    TM Velocity® Roller Triumph® 537R Triumph® 730R Z4+® Gel AITM ReAction® Triumph® 537RT Triumph® 730RT Velocity Kit BIC® EcolutionsTM Glue Stick Mailing Labels Mechanical Pencil ReAction® Ball Pen Round Stic® Ball & Peel BIC® Mechanical Pencils AITM BIC Atlantis® BIC Matic Grip® BIC® Pencil Clic Matic® Quantech® ReAction

  7. Short communication Smooth pursuit under stimulusresponse uncertainty

    E-Print Network [OSTI]

    Bar, Moshe

    reaction times (RTs) are typically faster than choice reaction times and increase with uncertainty­R) uncertainty and reaction times (RTs): RT = a + blog2(N), where a is simple RT, b is the slope of the increase an eye velocity criterion of 1.5j sÀ 1 which was equivalent to 25% of the stimulus velocity

  8. Sexual Function in Males After Radiotherapy for Rectal Cancer

    SciTech Connect (OSTI)

    Bruheim, Kjersti, E-mail: Kjersti.bruheim@medisin.uio.n [Oslo University Hospital, Ulleval Cancer Centre, Oslo (Norway); Guren, Marianne G. [Oslo University Hospital, Ulleval Cancer Centre, Oslo (Norway); Dahl, Alv A. [Oslo University Hospital, Department of Clinical Cancer Research, the Norwegian Radium Hospital, Oslo (Norway); Faculty of Medicine, University of Oslo, Oslo (Norway); Skovlund, Eva [School of Pharmacy, University of Oslo, Oslo (Norway); Balteskard, Lise [University Hospital of Northern Norway, Tromso (Norway); Carlsen, Erik [Oslo University Hospital, Department of Gastrointestinal Surgery, Ulleval, Oslo (Norway); Fossa, Sophie D. [Oslo University Hospital, Department of Clinical Cancer Research, the Norwegian Radium Hospital, Oslo (Norway); Faculty of Medicine, University of Oslo, Oslo (Norway); Tveit, Kjell Magne [Oslo University Hospital, Ulleval Cancer Centre, Oslo (Norway); Faculty of Medicine, University of Oslo, Oslo (Norway)

    2010-03-15

    Purpose: Knowledge of sexual problems after pre- or postoperative radiotherapy (RT) with 50 Gy for rectal cancer is limited. In this study, we aimed to compare self-rated sexual functioning in irradiated (RT+) and nonirradiated (RT-) male patients at least 2 years after surgery for rectal cancer. Methods and Materials: Patients diagnosed with rectal cancer from 1993 to 2003 were identified from the Norwegian Rectal Cancer Registry. Male patients without recurrence at the time of the study. The International Index of Erectile Function, a self-rated instrument, was used to assess sexual functioning, and serum levels of serum testosterone were measured. Results: Questionnaires were returned from 241 patients a median of 4.5 years after surgery. The median age was 67 years at survey. RT+ patients (n = 108) had significantly poorer scores for erectile function, orgasmic function, intercourse satisfaction, and overall satisfaction with sex life compared with RT- patients (n = 133). In multiple age-adjusted analysis, the odds ratio for moderate-severe erectile dysfunction in RT+ patients was 7.3 compared with RT- patients (p <0.001). Furthermore, erectile dysfunction of this degree was associated with low serum testosterone (p = 0.01). Conclusion: RT for rectal cancer is associated with significant long-term effects on sexual function in males.

  9. Phytologia (February 2013) 95(1)10 Chemosystematics of Juniperus: Effects of leaf drying on the essential oil composition of

    E-Print Network [OSTI]

    Adams, Robert P.

    on the essential oil composition of Juniperus pinchotii Robert P. Adams Biology Department, Baylor University, Box. at 22ºC (room temperature, RT). The oils were distilled and analyzed from fresh, 0.5, 1, 2, 4, 8, 16, and 24 mos. storage at RT. The oil yields showed a slight decline initially, but remained fairly constant

  10. Specification and Analysis of Attribute-based Authorization Policy

    E-Print Network [OSTI]

    Sandhu, Ravi

    Policy The Big Goal Flexible, scalable authorization for decentralized, collaborative environments policy to support collaboration in open systems RT: A Role-based Trust-management* framework Need © William H. Winsborough 6 Role-based Trust Management (RT) A family of credential / policy languages

  11. Epigenetic modifications and conserved, non-coding DNA play a role in regulation of type IV collagen gene expression 

    E-Print Network [OSTI]

    Moody, Jessica Ashley

    2009-05-15

    Summary of diseases involving the type IV collagens .............................. 2 2 Summary of histone post-translational modifications................................ 13 3 Primers for TaqMan? q...RT-PCR ............................................................... 22 4 Primers for Syber Green qRT-PCR............................................................ 23 5 Primers to amplify conserved, non-coding sequences ............................... 25 6 Primers for ChIP analysis...

  12. Introduction Initial analysis See you next Wednesday It'll be alright by Friday Rerouting model Conclusions and further work Empirical studies on road traffic response to

    E-Print Network [OSTI]

    Clegg, Richard G.

    ) the recurrence rate (churn) R(T1, T2) is defined below. Recurrence Rate R(T1, T2) = # vehicles seen in T1 and T2 and further work Recurrence rate definition Given two time periods T1 and T2, (eg Mon am peak and Tue am peak

  13. Three Dimensional Radiative Transfer

    E-Print Network [OSTI]

    Tom Abel

    2000-05-09

    Radiative Transfer (RT) effects play a crucial role in the thermal history of the intergalactic medium. Here I discuss recent advances in the development of numerical methods that introduce RT to cosmological hydrodynamics. These methods can also readily be applied to time dependent problems on interstellar and galactic scales.

  14. Impact of {sup 18}F-Fluorodeoxyglucose Positron Emission Tomography Before and After Definitive Radiation Therapy in Patients With Apparently Solitary Plasmacytoma

    SciTech Connect (OSTI)

    Kim, Paul J.; Hicks, Rodney J.; Wirth, Andrew; Ryan, Gail; Seymour, John F.; Prince, H. Miles

    2009-07-01

    Purpose: To evaluate the impact of {sup 18}F-fluorodeoxyglucose positron emission tomography (FDG-PET) on management of patients with apparently isolated plasmacytoma. Methods and Materials: Twenty-one patients with apparently solitary plasmacytoma who underwent FDG-PET for staging or restaging were identified from a central PET database. They were either candidates for or had received definitive radiation therapy (RT). Results: Seventeen patients had initial staging scans for bone (n = 11) or soft tissue (n = 6) plasmacytomas, and 11 had PET scans after RT. Only 1 of 14 known untreated sites of plasmacytoma was not identified on staging PET (lesion sensitivity = 93%). Three plasmacytomas were excised before PET. Staging PET influenced management in 6 of 17 patients (35%) by showing multiple myeloma (n = 1), discouraging RT after complete resection (n = 1), excluding plasmacytoma at a second site (n = 1), by increasing RT fields (n = 2), or by suggesting sarcoidosis (n = 1). Fifteen of 17 patients with initial staging PET scans received definitive RT. Restaging PET scans after RT showed complete metabolic response in 8 of 11 cases and progressive disease in 2. Two patients with either no response or partial metabolic response had late responses. Staging sestamibi and PET scans were concordant in five of six occasions (one sestamibi scan was false negative). Conclusions: FDG-PET has value for staging and RT planning in plasmacytoma and potentially could have a role in response-assessment after RT. Slow resolution of FDG uptake posttreatment does not necessarily imply an adverse prognosis.

  15. JOURNAL OF VIROLOGY, 0022-538X/00/$04.00 0

    E-Print Network [OSTI]

    Brown, Andrew Leigh

    Immunodeficiency Virus Type 1 (HIV-1) from Patients with Primary HIV Infection to Nonnucleoside Reverse% of such antiretroviral-naive individuals was shown to have a susceptibility to nonnucleoside reverse transcriptase (RT by these strains. We have analyzed by logistic regression 46 variable amino acid sites in RT for their effect

  16. The Influence of Radiation Modality and Lymph Node Dissection on Survival in Early-Stage Endometrial Cancer

    SciTech Connect (OSTI)

    Chino, Junzo P., E-mail: junzo.chino@duke.edu [Department of Radiation Oncology, Duke University Medical Center, Durham, NC (United States); Jones, Ellen [Department of Radiation Oncology, University of North Caroline, Chapel Hill, NC (United States); Berchuck, Andrew; Secord, Angeles Alvarez; Havrilesky, Laura J. [Division of Gynecologic Oncology, Duke University Medical Center, Durham, NC (United States)

    2012-04-01

    Background: The appropriate uses of lymph node dissection (LND) and adjuvant radiation therapy (RT) for Stage I endometrial cancer are controversial. We explored the impact of specific RT modalities (whole pelvic RT [WPRT], vaginal brachytherapy [VB]) and LND status on survival. Materials and Methods: The Surveillance Epidemiology and End Results dataset was queried for all surgically treated International Federation of Gynecology and Obstetrics (FIGO) Stage I endometrial cancers; subjects were stratified into low, intermediate and high risk cohorts using modifications of Gynecologic Oncology Group (GOG) protocol 99 and PORTEC (Postoperative Radiation Therapy in Endometrial Cancer) trial criteria. Five-year overall survival was estimated, and comparisons were performed via the log-rank test. Results: A total of 56,360 patients were identified: 70.4% low, 26.2% intermediate, and 3.4% high risk. A total of 41.6% underwent LND and 17.6% adjuvant RT. In low-risk disease, LND was associated with higher survival (93.7 LND vs. 92.7% no LND, p < 0.001), whereas RT was not (91.6% RT vs. 92.9% no RT, p = 0.23). In intermediate-risk disease, LND (82.1% LND vs. 76.5% no LND, p < 0.001) and RT (80.6% RT vs. 74.9% no RT, p < 0.001) were associated with higher survival without differences between RT modalities. In high-risk disease, LND (68.8% LND vs. 54.1% no LND, p < 0.001) and RT (66.9% RT vs. 57.2% no RT, p < 0.001) were associated with increased survival; if LND was not performed, VB alone was inferior to WPRT (p = 0.01). Conclusion: Both WPRT and VB alone are associated with increased survival in the intermediate-risk group. In the high-risk group, in the absence of LND, only WPRT is associated with increased survival. LND was also associated with increased survival.

  17. The Rosenfeld-Tarazona expression for liquids' specific heat: A numerical investigation of eighteen systems

    E-Print Network [OSTI]

    Trond S. Ingebrigtsen; Arno A. Veldhorst; Thomas B. Schrøder; Jeppe C. Dyre

    2013-05-08

    We investigate the accuracy of the expression of Rosenfeld and Tarazona (RT) for the excess isochoric heat capacity, C_V^{ex} \\propto T^{-2/5}, for eighteen model liquids. Previous investigations have reported no unifying features of breakdown for the RT expression. Here liquids with different stoichiometric composition, molecular topology, chemical interactions, degree of undercooling, and environment are investigated. We find that the RT expression is a better approximation for liquids with strong correlations between equilibrium fluctuations of virial and potential energy, i.e., Roskilde simple liquids [Ingebrigtsen et al., Phys. Rev. X 2, 011011 (2012)]. This observation holds even for molecular liquids under severe nanoscale confinement, the physics of which is completely different from the original RT bulk hard-sphere fluid arguments. The density dependence of the specific heat is predicted from the isomorph theory for Roskilde simple liquids, which in combination with the RT expression provides a complete description of the specific heat's density and temperature dependence.

  18. Disparities in the Use of Radiation Therapy in Patients With Local-Regionally Advanced Breast Cancer

    SciTech Connect (OSTI)

    Martinez, Steve R., E-mail: steve.martinez@ucdmc.ucdavis.ed [Department of Surgery, Division of Surgical Oncology, University of California Davis, Sacramento, CA (United States); Beal, Shannon H.; Chen, Steven L.; Canter, Robert J.; Khatri, Vijay P. [Department of Surgery, Division of Surgical Oncology, University of California Davis, Sacramento, CA (United States); Chen, Allen [Department of Radiation Oncology, University of California Davis, Sacramento, CA (United States); Bold, Richard J. [Department of Surgery, Division of Surgical Oncology, University of California Davis, Sacramento, CA (United States)

    2010-11-01

    Background: Radiation therapy (RT) is indicated for the treatment of local-regionally advanced breast cancer (BCa). Hypothesis: We hypothesized that black and Hispanic patients with local-regionally advanced BCa would receive lower rates of RT than their white counterparts. Methods: The Surveillance Epidemiology and End Results database was used to identify white, black, Hispanic, and Asian patients with invasive BCa and {>=}10 metastatic lymph nodes diagnosed between 1988 and 2005. Univariate and multivariate logistic regression evaluated the relationship of race/ethnicity with use of RT. Multivariate models stratified for those undergoing mastectomy or lumpectomy. Results: Entry criteria were met by 12,653 patients. Approximately half of the patients did not receive RT. Most patients were white (72%); the remainder were Hispanic (10.4%), black (10.3%), and Asian (7.3%). On univariate analysis, Hispanics (odd ratio [OR] 0.89; 95% confidence interval [CI], 0.79-1.00) and blacks (OR 0.79; 95% CI, 0.70-0.89) were less likely to receive RT than whites. On multivariate analysis, blacks (OR 0.76; 95% CI, 0.67-0.86) and Hispanics (OR 0.80; 95% CI, 0.70-0.90) were less likely than whites to receive RT. Disparities persisted for blacks (OR 0.74; 95% CI, 0.64-0.85) and Hispanics (OR 0.77; 95% CI, 0.67-0.89) who received mastectomy, but not for those who received lumpectomy. Conclusions: Many patients with local-regionally advanced BCa do not receive RT. Blacks and Hispanics were less likely than whites to receive RT. This disparity was noted predominately in patients who received mastectomy. Future efforts at improving rates of RT are warranted. Efforts at eliminating racial/ethnic disparities should focus on black and Hispanic candidates for postmastectomy RT.

  19. Patterns of Practice in Palliative Radiotherapy for Painful Bone Metastases: A Survey in Japan

    SciTech Connect (OSTI)

    Nakamura, Naoki; Shikama, Naoto; Wada, Hitoshi; Harada, Hideyuki; Nozaki, Miwako; Nagakura, Hisayasu; Tago, Masao; Oguchi, Masahiko; Uchida, Nobue

    2012-05-01

    Purpose: To determine the current patterns of practice in Japan and to investigate factors that may make clinicians reluctant to use single-fraction radiotherapy (SF-RT). Methods and Materials: Members of the Japanese Radiation Oncology Study Group (JROSG) completed an Internet-based survey and described the radiotherapy dose fractionation they would recommend for four hypothetical cases describing patients with painful bone metastasis (BM). Case 1 described a patient with an uncomplicated painful BM in a non-weight-bearing site from non-small-cell lung cancer. Case 2 investigated whether management for a case of uncomplicated spinal BM would be different from that in Case 1. Case 3 was identical with Case 2 except for the presence of neuropathic pain. Case 4 investigated the prescription for an uncomplicated painful BM secondary to oligometastatic breast cancer. Radiation oncologists who recommended multifraction radiotherapy (MF-RT) for Case 2 were asked to explain why they considered MF-RT superior to SF-RT. Results: A total of 52 radiation oncologists from 50 institutions (36% of JROSG institutions) responded. In all four cases, the most commonly prescribed regimen was 30 Gy in 10 fractions. SF-RT was recommended by 13% of respondents for Case 1, 6% for Case 2, 0% for Case 3, and 2% for Case 4. For Case 4, 29% of respondents prescribed a high-dose MF-RT regimen (e.g., 50 Gy in 25 fractions). The following factors were most often cited as reasons for preferring MF-RT: 'time until first increase in pain' (85%), 'incidence of spinal cord compression' (50%), and 'incidence of pathologic fractures' (29%). Conclusions: Japanese radiation oncologists prefer a schedule of 30 Gy in 10 fractions and are less likely to recommend SF-RT. Most Japanese radiation oncologists regard MF-RT as superior to SF-RT, based primarily on the time until first increase in pain.

  20. Declining Use of Radiotherapy in Stage I and II Hodgkin's Disease and Its Effect on Survival and Secondary Malignancies

    SciTech Connect (OSTI)

    Koshy, Matthew, E-mail: mkoshy@radonc.uchicago.edu [Department of Radiation and Cellular Oncology, University of Chicago Pritzker School of Medicine, Chicago, IL (United States); Department of Radiation Oncology, University of Illinois at Chicago, Chicago, IL (United States); Rich, Shayna E. [Department of Epidemiology and Preventive Medicine, University of Maryland School of Medicine, Baltimore, MD (United States); Mahmood, Usama; Kwok, Young [Department of Radiation Oncology, University of Maryland School of Medicine, Baltimore, MD (United States)

    2012-02-01

    Purpose: Concerns regarding long-term toxicities have led some to withhold radiotherapy (RT) for the treatment of Stage I and II Hodgkin's disease (HD). The present study was undertaken to assess the use of RT for HD and its effect on overall survival and the development of secondary malignancies. Methods and Materials: The present study included data from the Surveillance, Epidemiology, and End Results database from patients aged {>=}20 years who had been diagnosed with Stage I or II HD between 1988 and 2006. Overall survival was estimated using the Kaplan-Meier method, and the Cox multivariate regression model was used to analyze trends. Results: A total of 12,247 patients were selected, and 51.5% had received RT. The median follow-up for the present cohort was 4.9 years, with 21% of the cohort having >10 years of follow-up. Between 1988 and 1991, 62.9% had undergone RT, but between 2004 and 2006, only 43.7% had undergone RT (p < .001). The 5-year overall survival rate was 76% for patients who had not received RT and 87% for those who had (p < .001). The hazard ratio adjusted for other variables in the regression model showed that patients who had not undergone RT (hazard ratio, 1.72; 95% confidence interval, 1.72-2.02) was associated with significantly worse survival compared with patients who had received RT. The actuarial rate of developing a second malignancy was 14.6% vs. 15.0% at 15 years for those who had and had not undergone RT, respectively (p = .089). Conclusions: The present study is one of the largest studies to examine the role of RT for Stage I and II HD. Our results revealed a survival benefit with the addition of RT with no increase in the development of secondary malignancies compared with patients who had not received RT. Furthermore, the present nationwide study revealed a >20% absolute decrease in the use of RT from 1988 to 2006.

  1. Sequencing of Local Therapy Affects the Pattern of Treatment Failure and Survival in Children With Atypical Teratoid Rhabdoid Tumors of the Central Nervous System

    SciTech Connect (OSTI)

    Pai Panandiker, Atmaram S., E-mail: atmaram.pai-panandiker@stjude.org [Department of Radiological Sciences, St. Jude Children's Research Hospital, Memphis, TN (United States); Merchant, Thomas E.; Beltran, Chris [Department of Radiological Sciences, St. Jude Children's Research Hospital, Memphis, TN (United States); Wu, Shengjie [Department of Biostatistics, St. Jude Children's Research Hospital, Memphis, TN (United States); Sharma, Shelly [Department of Radiological Sciences, St. Jude Children's Research Hospital, Memphis, TN (United States); Boop, Frederick A. [Department of Surgery, St. Jude Children's Research Hospital, Memphis, TN (United States); Jenkins, Jesse J. [Department of Pathology, St. Jude Children's Research Hospital, Memphis, TN (United States); Helton, Kathleen J. [Department of Radiological Sciences, St. Jude Children's Research Hospital, Memphis, TN (United States); Wright, Karen D.; Broniscer, Alberto [Department of Oncology, St. Jude Children's Research Hospital, Memphis, TN (United States); Kun, Larry E. [Department of Radiological Sciences, St. Jude Children's Research Hospital, Memphis, TN (United States); Gajjar, Amar [Department of Oncology, St. Jude Children's Research Hospital, Memphis, TN (United States)

    2012-04-01

    Purpose: To assess the pattern of treatment failure associated with current therapeutic paradigms for childhood atypical teratoid rhabdoid tumors (AT/RT). Methods and Materials: Pediatric patients with AT/RT of the central nervous system treated at our institution between 1987 and 2007 were retrospectively evaluated. Overall survival (OS), progression-free survival, and cumulative incidence of local failure were correlated with age, sex, tumor location, extent of disease, and extent of surgical resection. Radiotherapy (RT) sequencing, chemotherapy, dose, timing, and volume administered after resection were also evaluated. Results: Thirty-one patients at a median age of 2.3 years at diagnosis (range, 0.45-16.87 years) were enrolled into protocols that included risk- and age-stratified RT. Craniospinal irradiation with focal tumor bed boost (median dose, 54 Gy) was administered to 18 patients. Gross total resection was achieved in 16. Ten patients presented with metastases at diagnosis. RT was delayed more than 3 months in 20 patients and between 1 and 3 months in 4; 7 patients received immediate postoperative irradiation preceding high-dose alkylator-based chemotherapy. At a median follow-up of 48 months, the cumulative incidence of local treatment failure was 37.5% {+-} 9%; progression-free survival was 33.2% {+-} 10%; and OS was 53.5% {+-} 10%. Children receiving delayed RT ({>=}1 month postoperatively) were more likely to experience local failure (hazard ratio [HR] 1.23, p = 0.007); the development of distant metastases before RT increased the risk of progression (HR 3.49, p = 0.006); and any evidence of disease progressionbefore RT decreased OS (HR 20.78, p = 0.004). Disease progression occurred in 52% (11/21) of children with initially localized tumors who underwent gross total resection, and the progression rate increased proportionally with increasing delay from surgery to RT. Conclusions: Delayed RT is associated with a higher rate of local and metastatic disease progression in children with AT/RT. Current treatment regimens for pediatric patients with AT/RT are distinctly age stratified; novel protocols investigating RT volumes and sequencing are needed.

  2. Patterns of Practice of Palliative Radiotherapy in Africa, Part 1: Bone and Brain Metastases

    SciTech Connect (OSTI)

    Sharma, Vinay Gaye, Papa Macoumba M.Med.; Wahab, Sherif Abdel; Ndlovu, Ntokozo; Ngoma, Twalib; Vanderpuye, Verna; Sowunmi, Anthonia; Kigula-Mugambe, Joseph; Jeremic, Branislav

    2008-03-15

    Purpose: To provide data on the pattern of practice of palliative radiotherapy (RT) on the African continent. Methods and Materials: A questionnaire was distributed to participants in a regional training course of the International Atomic Energy Agency in palliative cancer care and sent by e-mail to other institutions in Africa. Requested information included both infrastructure and human resources available and the pattern of RT practice for metastatic and locally advanced cancers. Results: Of 35 centers contacted, 24 (68%) completed the questionnaire. Although RT is used by most centers for most metastatic cancers, liver and lung metastases are treated with chemotherapy. Of 23 centers, 14 (61%) had a single RT regimen as an institutional policy for treating painful bone metastases, but only 5 centers (23%) of 23 used 8 Gy in 1 fraction. Brain metastases were being treated by RT to the whole brain to 30 Gy in 10 fractions, either exclusively (n = 13, 56%) or in addition to the use of 20 Gy in 5 fractions (n = 3, 14%). Conclusion: Radiotherapy is a major component of treatment of cancer patients in African countries. There is consensus among few centers for treatment schedules for almost all sites regarding time and dose-fractionation characteristics of RT regimens used and/or indications for the use of RT in this setting.

  3. Reirradiation After Radical Radiation Therapy: A Survey of Patterns of Practice Among Canadian Radiation Oncologists

    SciTech Connect (OSTI)

    Joseph, Kurian Jones [Cross Cancer Institute and University of Alberta, Edmonton, Alberta (Canada)], E-mail: kurianjo@cancerboard.ab.ca; Al-Mandhari, Zahid; Pervez, Nadeem; Parliament, Matthew [Cross Cancer Institute and University of Alberta, Edmonton, Alberta (Canada); Wu, Jackson [Tom Baker Cancer Center and University of Calgary, Calgary, Alberta (Canada); Ghosh, Sunita [Cross Cancer Institute and University of Alberta, Edmonton, Alberta (Canada); Tai, Patricia [Allan Blair Cancer Centre and University of Saskatchewan, Saskatchewan (Canada); Lian Jidong [Cross Cancer Institute and University of Alberta, Edmonton, Alberta (Canada); Levin, Wilfred [University of Toronto and Princess Margaret Hospital, Toronto (Canada)

    2008-12-01

    Purpose: The objective of this study was to survey the use of reirradiation (Re-RT) for in-field failures after previous radical radiation treatment (RT) among Canadian radiation oncologists (ROs). Methods and Materials: An electronic survey was sent to 271 ROs in Canada. The completed surveys were received electronically via e-mail and the data were analyzed using SAS 9.1.3 software. Results: A total of 183 ROs (67.5%) completed and returned the survey. The majority of the respondents were involved in the practice of either breast (48%) or genitourinary (43%) tumor sites. A total of 49% of the participants were interested in using Re-RT for the management of in-field recurrences. The goals of the therapy would be improvement of quality of life (99%), locoregional control (80%), or cure (32%). Most of the physicians believed that patients should have a minimum Karnofsky performance status of 50 or Eastern Cooperative Oncology Group performance status of 3, a minimum life expectancy of 3 months, and a minimum interval from initial treatment of 3 months if Re-RT were to be given with curative intent. Conclusions: This survey showed that a wide variation existed among ROs in their approach to Re-RT. Newer technologies in RT planning and delivery would be employed to facilitate normal tissue avoidance. The results of this study suggested that a consensus meeting was needed to establish guidelines for the practice and prospective evaluation of Re-RT.

  4. Rayleigh-Taylor Unstable Flames -- Fast or Faster?

    E-Print Network [OSTI]

    Hicks, E P

    2015-01-01

    Rayleigh-Taylor (RT) unstable flames play a key role in the explosions of Type Ia supernovae. However, the dynamics of these flames is still not well-understood. RT unstable flames are affected by both the RT instability of the flame front and by RT-generated turbulence. The coexistence of these factors complicates the choice of flame speed subgrid models for full-star Type Ia simulations. Both processes can stretch and wrinkle the flame surface, increasing its area and, therefore, the burning rate. In past research, subgrid models have been based on either the RT instability or turbulence setting the flame speed. We evaluate both models, checking their assumptions and their ability to correctly predict the turbulent flame speed. Specifically, we analyze a large parameter study of 3D direct numerical simulations of RT unstable model flames. This study varies both the simulation domain width and the gravity in order to probe a wide range of flame behaviors. We show that RT unstable flames are different from tr...

  5. Risk of Cerebrovascular Events in Elderly Patients After Radiation Therapy Versus Surgery for Early-Stage Glottic Cancer

    SciTech Connect (OSTI)

    Hong, Julian C.; Kruser, Tim J.; Gondi, Vinai; Mohindra, Pranshu; Cannon, Donald M.; Harari, Paul M.; Bentzen, Søren M.

    2013-10-01

    Purpose: Comprehensive neck radiation therapy (RT) has been shown to increase cerebrovascular disease (CVD) risk in advanced-stage head-and-neck cancer. We assessed whether more limited neck RT used for early-stage (T1-T2 N0) glottic cancer is associated with increased CVD risk, using the Surveillance, Epidemiology, and End Results (SEER)-Medicare linked database. Methods and Materials: We identified patients ?66 years of age with early-stage glottic laryngeal cancer from SEER diagnosed from 1992 to 2007. Patients treated with combined surgery and RT were excluded. Medicare CPT codes for carotid interventions, Medicare ICD-9 codes for cerebrovascular events, and SEER data for stroke as the cause of death were collected. Similarly, Medicare CPT and ICD-9 codes for peripheral vascular disease (PVD) were assessed to serve as an internal control between treatment groups. Results: A total of 1413 assessable patients (RT, n=1055; surgery, n=358) were analyzed. The actuarial 10-year risk of CVD was 56.5% (95% confidence interval 51.5%-61.5%) for the RT cohort versus 48.7% (41.1%-56.3%) in the surgery cohort (P=.27). The actuarial 10-year risk of PVD did not differ between the RT (52.7% [48.1%-57.3%]) and surgery cohorts (52.6% [45.2%-60.0%]) (P=.89). Univariate analysis showed an increased association of CVD with more recent diagnosis (P=.001) and increasing age (P=.001). On multivariate Cox analysis, increasing age (P<.001) and recent diagnosis (P=.002) remained significantly associated with a higher CVD risk, whereas the association of RT and CVD remained not statistically significant (HR=1.11 [0.91-1.37,] P=.31). Conclusions: Elderly patients with early-stage laryngeal cancer have a high burden of cerebrovascular events after surgical management or RT. RT and surgery are associated with comparable risk for subsequent CVD development after treatment in elderly patients.

  6. Postoperative Radiation Therapy With or Without Concurrent Chemotherapy for Node-Positive Thoracic Esophageal Squamous Cell Carcinoma

    SciTech Connect (OSTI)

    Chen, Junqiang; Pan, Jianji; Liu, Jian; Li, Jiancheng; Zhu, Kunshou; Zheng, Xiongwei; Chen, Mingqiang; Chen, Ming; Liao, Zhongxing

    2013-07-15

    Purpose: To retrospectively compare the efficacy of radiation therapy (RT) and chemotherapy plus RT (CRT) for the postoperative treatment of node-positive thoracic esophageal squamous cell carcinoma (TESCC) and to determine the incidence and severity of toxic reactions. Methods and Materials: We retrospectively reviewed data from 304 patients who had undergone esophagectomy with 3-field lymph node dissection for TESCC and were determined by postoperative pathology to have lymph node metastasis without distant hematogenous metastasis. Of these patients, 164 underwent postoperative chemotherapy (cisplatin 80 mg/m{sup 2}, average days 1-3, plus paclitaxel 135 mg/m{sup 2}, day 1; 21-day cycle) plus RT (50 Gy), and 140 underwent postoperative RT alone. Results: The 5-year overall survival rates for the CRT and RT groups were 47.4% and 38.6%, respectively (P=.030). The distant metastasis rate, the mixed (regional lymph node and distant) metastasis rate, and the overall recurrence rate were significantly lower in the CRT group than in the RT group (P<.05). However, mild and severe early toxic reactions, including neutropenia, radiation esophagitis, and gastrointestinal reaction, were significantly more common in the CRT group than in the RT group (P<.05). No significant differences in incidence of late toxic reactions were found between the 2 groups. Conclusions: Our results show that in node-positive TESCC patients, postoperative CRT is significantly more effective than RT alone at increasing the overall survival and decreasing the rates of distant metastasis, mixed metastasis, and overall recurrence. Severe early toxic reactions were more common with CRT than with RT alone, but patients could tolerate CRT.

  7. Combination of Vessel-Targeting Agents and Fractionated Radiation Therapy: The Role of the SDF-1/CXCR4 Pathway

    SciTech Connect (OSTI)

    Chen, Fang-Hsin; Fu, Sheng-Yung [Department of Biomedical Engineering and Environmental Sciences, National Tsing Hua University, Taiwan (China)] [Department of Biomedical Engineering and Environmental Sciences, National Tsing Hua University, Taiwan (China); Yang, Ying-Chieh [Department of Radiation Oncology, National Taiwan University Hospital Hsin-Chu Branch, Taiwan (China)] [Department of Radiation Oncology, National Taiwan University Hospital Hsin-Chu Branch, Taiwan (China); Wang, Chun-Chieh [Department of Radiation Oncology, Chang Gung Memorial Hospital-LinKou, Taiwan (China) [Department of Radiation Oncology, Chang Gung Memorial Hospital-LinKou, Taiwan (China); Department of Medical Imaging and Radiological Science, Chang Gung University, Taiwan (China); Chiang, Chi-Shiun, E-mail: cschiang@mx.nthu.edu.tw [Department of Biomedical Engineering and Environmental Sciences, National Tsing Hua University, Taiwan (China)] [Department of Biomedical Engineering and Environmental Sciences, National Tsing Hua University, Taiwan (China); Hong, Ji-Hong, E-mail: jihong@adm.cgmh.org.tw [Department of Radiation Oncology, Chang Gung Memorial Hospital-LinKou, Taiwan (China) [Department of Radiation Oncology, Chang Gung Memorial Hospital-LinKou, Taiwan (China); Department of Medical Imaging and Radiological Science, Chang Gung University, Taiwan (China)

    2013-07-15

    Purpose: To investigate vascular responses during fractionated radiation therapy (F-RT) and the effects of targeting pericytes or bone marrow-derived cells (BMDCs) on the efficacy of F-RT. Methods and Materials: Murine prostate TRAMP-C1 tumors were grown in control mice or mice transplanted with green fluorescent protein-tagged bone marrow (GFP-BM), and irradiated with 60 Gy in 15 fractions. Mice were also treated with gefitinib (an epidermal growth factor receptor inhibitor) or AMD3100 (a CXCR4 antagonist) to examine the effects of combination treatment. The responses of tumor vasculatures to these treatments and changes of tumor microenvironment were assessed. Results: After F-RT, the tumor microvascular density (MVD) was reduced; however, the surviving vessels were dilated, incorporated with GFP-positive cells, tightly adhered to pericytes, and well perfused with Hoechst 33342, suggesting a more mature structure formed primarily via vasculogenesis. Although the gefitinib+F-RT combination affected the vascular structure by dissociating pericytes from the vascular wall, it did not further delay tumor growth. These tumors had higher MVD and better vascular perfusion function, leading to less hypoxia and tumor necrosis. By contrast, the AMD3100+F-RT combination significantly enhanced tumor growth delay more than F-RT alone, and these tumors had lower MVD and poorer vascular perfusion function, resulting in increased hypoxia. These tumor vessels were rarely covered by pericytes and free of GFP-positive cells. Conclusions: Vasculogenesis is a major mechanism for tumor vessel survival during F-RT. Complex interactions occur between vessel-targeting agents and F-RT, and a synergistic effect may not always exist. To enhance F-RT, using CXCR4 inhibitor to block BM cell influx and the vasculogenesis process is a better strategy than targeting pericytes by epidermal growth factor receptor inhibitor.

  8. Timing of Radiotherapy and Outcome in Patients Receiving Adjuvant Endocrine Therapy

    SciTech Connect (OSTI)

    Karlsson, Per, E-mail: per.karlsson@oncology.gu.s [Department of Oncology, Sahlgrenska University Hospital, Gothenburg (Sweden); Cole, Bernard F. [Department of Mathematics and Statistics, University of Vermont College of Engineering and Mathematical Sciences, Burlington, VT (United States); International Breast Cancer Study Group Statistical Center, Department of Biostatistics and Computational Biology, Dana-Farber Cancer Institute, Boston, MA (United States); Colleoni, Marco [Department of Medicine, Research Unit in Medical Senology, European Institute of Oncology, Milan (Italy); Roncadin, Mario [Department of Radiotherapy, Centro di Riferimento Oncologico, Aviano (Italy); Chua, Boon H. [Department of Radiation Oncology, Peter MacCallum Cancer Centre, Melbourne (Australia); Murray, Elizabeth [Department of Radiation Oncology, Groote Shuur Hospital and University of Cape Town, Cape Town (South Africa); Price, Karen N. [International Breast Cancer Study Group Statistical Center, Frontier Science and Technology Research Foundation, Boston, MA (United States); Castiglione-Gertsch, Monica [International Breast Cancer Study Group Coordinating Center, Bern (Switzerland); Goldhirsch, Aron [European Institute of Oncology, Milan (Italy); Oncology Institute of Southern Switzerland, Bellinzona (Switzerland); Gruber, Guenther [Institut fuer Radiotherapie, Klinik Hirslanden, Zuerich (Switzerland)

    2011-06-01

    Purpose: To evaluate the association between the interval from breast-conserving surgery (BCS) to radiotherapy (RT) and the clinical outcome among patients treated with adjuvant endocrine therapy. Patients and Methods: Patient information was obtained from three International Breast Cancer Study Group trials. The analysis was restricted to 964 patients treated with BCS and adjuvant endocrine therapy. The patients were divided into two groups according to the median number of days between BCS and RT and into four groups according to the quartile of time between BCS and RT. The endpoints were the interval to local recurrence, disease-free survival, and overall survival. Proportional hazards regression analysis was used to perform comparisons after adjustment for baseline factors. Results: The median interval between BCS and RT was 77 days. RT timing was significantly associated with age, menopausal status, and estrogen receptor status. After adjustment for these factors, no significant effect of a RT delay {<=}20 weeks was found. The adjusted hazard ratio for RT within 77 days vs. after 77 days was 0.94 (95% confidence interval [CI], 0.47-1.87) for the interval to local recurrence, 1.05 (95% CI, 0.82-1.34) for disease-free survival, and 1.07 (95% CI, 0.77-1.49) for overall survival. For the interval to local recurrence the adjusted hazard ratio for {<=}48, 49-77, and 78-112 days was 0.90 (95% CI, 0.34-2.37), 0.86 (95% CI, 0.33-2.25), and 0.89 (95% CI, 0.33-2.41), respectively, relative to {>=}113 days. Conclusion: A RT delay of {<=}20 weeks was significantly associated with baseline factors such as age, menopausal status, and estrogen-receptor status. After adjustment for these factors, the timing of RT was not significantly associated with the interval to local recurrence, disease-free survival, or overall survival.

  9. TU-C-17A-03: An Integrated Contour Evaluation Software Tool Using Supervised Pattern Recognition for Radiotherapy

    SciTech Connect (OSTI)

    Chen, H; Tan, J; Kavanaugh, J; Dolly, S; Gay, H; Thorstad, W; Anastasio, M; Altman, M; Mutic, S; Li, H

    2014-06-15

    Purpose: Radiotherapy (RT) contours delineated either manually or semiautomatically require verification before clinical usage. Manual evaluation is very time consuming. A new integrated software tool using supervised pattern contour recognition was thus developed to facilitate this process. Methods: The contouring tool was developed using an object-oriented programming language C# and application programming interfaces, e.g. visualization toolkit (VTK). The C# language served as the tool design basis. The Accord.Net scientific computing libraries were utilized for the required statistical data processing and pattern recognition, while the VTK was used to build and render 3-D mesh models from critical RT structures in real-time and 360° visualization. Principal component analysis (PCA) was used for system self-updating geometry variations of normal structures based on physician-approved RT contours as a training dataset. The inhouse design of supervised PCA-based contour recognition method was used for automatically evaluating contour normality/abnormality. The function for reporting the contour evaluation results was implemented by using C# and Windows Form Designer. Results: The software input was RT simulation images and RT structures from commercial clinical treatment planning systems. Several abilities were demonstrated: automatic assessment of RT contours, file loading/saving of various modality medical images and RT contours, and generation/visualization of 3-D images and anatomical models. Moreover, it supported the 360° rendering of the RT structures in a multi-slice view, which allows physicians to visually check and edit abnormally contoured structures. Conclusion: This new software integrates the supervised learning framework with image processing and graphical visualization modules for RT contour verification. This tool has great potential for facilitating treatment planning with the assistance of an automatic contour evaluation module in avoiding unnecessary manual verification for physicians/dosimetrists. In addition, its nature as a compact and stand-alone tool allows for future extensibility to include additional functions for physicians’ clinical needs.

  10. Can We Predict Plan Quality for External Beam Partial Breast Irradiation: Results of a Multicenter Feasibility Study (Trans Tasman Radiation Oncology Group Study 06.02)

    SciTech Connect (OSTI)

    Kron, Tomas; Willis, David; Link, Emma; Lehman, Margot; Campbell, Gillian; O'Brien, Peter; Chua, Boon

    2013-11-15

    Purpose: Partial breast irradiation (PBI) after lumpectomy may be an option for selected patients with early breast cancer. A feasibility study of accelerated PBI delivered using external beam 3-dimensional conformal radiation therapy (RT) was undertaken at 8 Australasian centers. The present study evaluated the impact of patient, tumor, and RT technique-related factors on the quality of RT plans as determined by the dose–volume parameters of organs at risk. Methods and Materials: Forty-eight patients were enrolled in the study. All RT plans were centrally reviewed using predefined dosimetric criteria before commencement and after completion of protocol therapy. The RT plans of 47 patients met the dose–volume constraints, and all 47 patients received PBI to a prescribed dose of 38.5 Gy in 10 fractions. The RT plan quality was determined by volumes of the ipsilateral whole breast, lung, and heart that received 50% and 95%; 30%; and 5% of the prescribed dose, respectively. Patient, tumor, and RT technique-related factors were investigated for association with the parameters of RT plan quality. Results: The ratio of the planning target volume to the ipsilateral whole-breast volume was significantly associated with the ipsilateral breast doses on multiple variable analyses. The distance of the postlumpectomy surgical cavity from the heart and lung were predictive for heart and lung doses, respectively. A distance between surgical cavity and heart of >4 cm typically resulted in <1% of the heart volume receiving 5 Gy or less. It was more difficult to meet the heart dose constraint for left-sided and medially located tumors. Conclusions: Partial breast irradiation using 3-dimensional conformal RT was feasible within the study constraints. The ratio of planning target volume to ipsilateral whole-breast volume and the distance of surgical cavity from the heart were significant predictors of the quality of treatment plan for external beam PBI.

  11. Valproic Acid Use During Radiation Therapy for Glioblastoma Associated With Improved Survival

    SciTech Connect (OSTI)

    Barker, Christopher A.; Bishop, Andrew J.; Chang, Maria; Beal, Kathryn; Chan, Timothy A.

    2013-07-01

    Purpose: Valproic acid (VA) is an antiepileptic drug (AED) and histone deacetylase (HDAC) inhibitor taken by patients with glioblastoma (GB) to manage seizures, and it can modulate the biologic effects of radiation therapy (RT). We investigated whether VA use during RT for GB was associated with overall survival (OS). Methods and Materials: Medical records of 544 adults with GB were retrospectively reviewed. Analyses were performed to determine the association of Radiation Therapy Oncology Group recursive partitioning analysis (RTOG RPA) class, seizure history, and concurrent temozolomide (TMZ) and AED use during RT with OS. Results: Seizures before the end of RT were noted in 217 (40%) patients, and 403 (74%) were taking an AED during RT; 29 (7%) were taking VA. Median OS in patients taking VA was 16.9 months (vs 13.6 months taking another AED, P=.16). Among patients taking an AED during RT, OS was associated with VA (P=.047; hazard ratio [HR], 0.67; 95% confidence interval [CI], 0.27-1.07), and RTOG RPA class (P<.0001; HR, 1.49; 95% CI, 1.37-1.61). Of the 5 most common AEDs, only VA was associated with OS. Median OS of patients receiving VA and TMZ during RT was 23.9 months (vs 15.2 months for patients taking another AED, P=.26). When the analysis was restricted to patients who received concurrent TMZ, VA use was marginally associated with OS (P=.057; HR, 0.54; 95% CI, ?0.09 to 1.17), independently of RTOG RPA class and seizure history. Conclusions: VA use during RT for GB was associated with improved OS, independently of RTOG RPA, seizure history, and concurrent TMZ use. Further studies of treatment that combines HDAC inhibitors and RT are warranted.

  12. Adjuvant Radiation Therapy and Survival for Pure Tubular Breast Carcinoma-Experience From the SEER Database

    SciTech Connect (OSTI)

    Li Baoqing, E-mail: bal9018@med.cornell.edu [Department of Radiation Oncology, Weill Cornell Medical College, New York, New York (United States); Chen, Margaret [Department of Surgery, Weill Cornell Medical College, New York, New York (United States)] [Department of Surgery, Weill Cornell Medical College, New York, New York (United States); Nori, Dattatreyudu; Chao, K.S. Clifford [Department of Radiation Oncology, Weill Cornell Medical College, New York, New York (United States)] [Department of Radiation Oncology, Weill Cornell Medical College, New York, New York (United States); Chen, Allen M. [Department of Radiation Oncology, University of California Davis Cancer Center, Sacramento, California (United States)] [Department of Radiation Oncology, University of California Davis Cancer Center, Sacramento, California (United States); Chen, Steven L. [Department of Surgery, University of California Davis Cancer Center, Sacramento, California (United States)] [Department of Surgery, University of California Davis Cancer Center, Sacramento, California (United States)

    2012-09-01

    Purpose: Pure tubular carcinoma of the breast (PTCB) represents a distinct subtype of invasive ductal carcinoma (IDC) that is generally thought to be associated with better prognosis than even low-grade IDC. There has been controversy as to the role of adjuvant radiation therapy (RT) in this population. We hypothesized that adjuvant RT would demonstrate a survival improvement. Methods and Materials: We queried the Surveillance, Epidemiology and End Results database for the years 1992-2007 to identify patients with pure tubular carcinomas of the breast. Patient demographics, tumor characteristics, and surgical and RT treatments were collected. Survival analysis was performed using the Kaplan-Meier method for univariate comparisons and Cox proportional hazards modeling for multivariate comparisons, stratifying on the basis of age with a cutoff age of 65. Results: A total of 6465 patients were identified: 3624 (56.1%) patients underwent lumpectomy with RT (LUMP+RT), 1525 (23.6%) patients underwent lumpectomy alone (LUMP), 1266 (19.6%) patients received mastectomy alone (MAST), and 50 (0.8%) patients underwent mastectomy with RT (MAST+RT). When we compared the LUMP+RT and LUMP groups directly, those receiving adjuvant RT tended to be younger and were less likely to be hormone receptor-positive. Overall survival was 95% for LUMP+RT and 90% for LUMP patients at 5 years. For those 65 or younger, the absolute overall survival benefit of LUMP+RT over LUMP was 1% at 5 years and 3% at 10 years. On stratified multivariate analysis, adjuvant RT remained a significant predictor in both age groups (P=.003 in age {<=}65 and P=.04 in age >65 patients). Other significant unfavorable factors were older age and higher T stage (age >65 only). Conclusions: Since sufficiently powered large scale clinical trials are unlikely, we would recommend that adjuvant radiation be considered in PTCB patients age 65 or younger, although consideration of the small absolute survival benefit is important. Adjuvant radiation can be omitted for patients older than 65.

  13. Ultrastructural analysis of chemical synapses and gap junctions between Drosophila brain neurons in culture.

    E-Print Network [OSTI]

    Oh, Hyun-Woo; Campusano, Jorge M; Hilgenberg, Lutz G W; Sun, Xicui; Smith, Martin A; O'Dowd, Diane K

    2008-01-01

    h. Cells were contrasted in 1% uranyl acetate at RT for 1 h,were stained again in 2% uranyl acetate for 2 min, followedthe omission of the ?rst uranyl acetate staining. After thin

  14. Implementation and Validation of the BHR Turbulence Model in...

    Office of Scientific and Technical Information (OSTI)

    density mixing in the KH, RT, and RM cases in an Eulerian framework 7. The primary motivation of the present work is to implement the BHR-2 turbulence model in the Arbitrary...

  15. Your name Your TA's name MA 16500 EXAM I INSTRUCTIONS ...

    E-Print Network [OSTI]

    Sep 23, 2014 ... limxng m - sin (i) = [liming re] - [lime—m Si“ (in. Since limxngx : 0, the limit we want to compute is also equal to 0. . limmng a: - sin (i) = [limmqo rt] ...

  16. Grammar, Epistemics and Action: An epistemic analysis of talk about the self and others

    E-Print Network [OSTI]

    Turner, Patricia

    2012-01-01

    not -> with it all. ->> ?mh[hhh Is 'e: feeding alright? [Example 2.23 Heritage N: =°hhh Dz he ‘av ‘iz own apa:rt [r you workin’ for. 2 B: °hhh Well I’m working through the

  17. PHOTOVOLTAIC PROPERTIES OF METAL-MEROCYANINE-TiO2 SANDWICH CELLS

    E-Print Network [OSTI]

    Skotheim, Terje Asbjorn

    2011-01-01

    used in making the photovoltaic cells. Figure 3. Diagram ofused in making the photovoltaic cells. HO HO ,5 di -t rt.organic compounds in photovoltaic cells. It lies more in the

  18. WHO report on the global tobacco epidemic, 2015: Raising taxes on tobacco

    E-Print Network [OSTI]

    World Health Organization

    2015-01-01

    Estimates not available Comoros adveRtIsIng bans: bans onRepublic XOF Chad ** XAF Comoros KMF Congo ** XAF CôteAfrican Republic Chad Comoros Congo Côte d'Ivoire Democratic

  19. THE CIRCULATORY SYSTEM AND BLOOD General charectertllUCIL______ _ _______ 23ll

    E-Print Network [OSTI]

    ·system is compensated by thepulsa..ting vesaelsof the mantle and by the contractions of two aeeessery hea.rt8on from which the heart has been re- moved; after the material has l!8t, the plaster molds

  20. Rayleigh-Taylor Instability within Sediment Layers Due to Gas Retention: Preliminary Theory and Experiments

    SciTech Connect (OSTI)

    Gauglitz, Phillip A.; Wells, Beric E.; Buchmiller, William C.; Rassat, Scot D.

    2013-03-21

    In Hanford underground waste storage tanks, a typical waste configuration is settled beds of waste particles beneath liquid layers. The settled beds are typically composed of layers, and these layers can have different physical and chemical properties. One postulated configuration within the settled bed is a less-dense layer beneath a more-dense layer. The different densities can be a result of different gas retention in the layers or different degrees of settling and compaction in the layers. This configuration can experience a Rayleigh-Taylor (RT) instability where the less dense lower layer rises into the upper layer. Previous studies of gas retention and release have not considered potential buoyant motion within a settle bed of solids. The purpose of this report is to provide a review of RT instabilities, discuss predictions of RT behavior for sediment layers, and summarize preliminary experimental observations of RT instabilities in simulant experiments.

  1. PHOTOVOLTAIC PROPERTIES OF METAL-MEROCYANINE-TiO2 SANDWICH CELLS

    E-Print Network [OSTI]

    Skotheim, Terje Asbjorn

    2011-01-01

    67 3.6 Photovoltaic Action Spectrum . . . . 3.7dye used in making the photovoltaic cells. Figure 3. Diagramused in making the photovoltaic cells. HO HO ,5 di -t rt.

  2. Nanodiamond-rich layer across three continents consistent with major cosmic impact at 12,800 cal BP

    E-Print Network [OSTI]

    2014-01-01

    Nanodiamond-Rich Layer across Three Continents Consistent2010. Discovery of a nanodiamond-rich layer in the Greenlandand Conditions A RT I C L E S Nanodiamond-Rich Layer across

  3. Proteasome Inhibitors Block DNA Repair and Radiosensitize Non-Small Cell Lung Cancer

    E-Print Network [OSTI]

    Cron, Kyle R.

    Despite optimal radiation therapy (RT), chemotherapy and/or surgery, a majority of patients with locally advanced non-small cell lung cancer (NSCLC) fail treatment. To identify novel gene targets for improved tumor control, ...

  4. SECTION E

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    - NOC & Sanitary Sewer PI-24590-01-00153 A2 - Incomplete WTP Conceptual Design - SAP & CAR PI-24590-01-00153 B - Incomplete R&T WTP Conceptual Design work (5 Pis) 19...

  5. Monte Carlo radiative transfer simulation for the near-ocean-surface high-resolution downwelling irradiance statistics

    E-Print Network [OSTI]

    Xu, Zao

    We present a numerical study of the near-surface underwater solar light statistics using the state-of-the-art Monte Carlo radiative transfer (RT) simulations in the coupled atmosphere-ocean system. Advanced variance-reduction ...

  6. Microsoft Word - qa_plan1.doc

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    SJ-RT Smith Jones Rapid Transit Software Quality Assurance Plan February 1997 U. S. DEPARTMENT OF ENERGY Replace with appropriate organization name qaplan1.doc ii 022707 Change...

  7. Ecology 2005 19, 166172

    E-Print Network [OSTI]

    , adopts a fundamentally different strategy, taking virtually the opposite tack. It begins they are just approxima- tions. Physicists still use Boyle's Law, PV = nRT (pres- sure P times volume V

  8. Effects of Single Mode Initial Conditions in Rayleigh-Taylor Turbulent Mixing 

    E-Print Network [OSTI]

    Doron, Yuval

    2011-02-22

    The effect of single mode initial conditions at the interface of Rayleigh-Taylor(RT) mixing are experimentally examined utilizing the low Atwood number water channel facility at Texas A&M. The water channel convects two separated stratified flows...

  9. PROCEEDINGS OF 1976 SUMMER WORKSHOP ON AN ENERGY EXTENSION SERVICE

    E-Print Network [OSTI]

    Authors, Various

    2010-01-01

    intensive fashion (on energy supply). Thus the net number ofx J rt ) minus the jobs lost in energy supply (glven by themoney dlverted from energy supply x J , where J is the labor

  10. Turbulence-Flame Interactions in Type Ia Supernovae

    E-Print Network [OSTI]

    Aspden, Andrew J; Lawrence Berkeley National Laboratory, 1 Cyclotron Road, MS 50A-1148, Berkeley, CA 94720 (Authors 1, 2 & 3); Department of Astronomy and Astrophysics, University of California at Santa Cruz, Santa Cruz, CA 95064 (Author 4); Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794 (Author 5)

    2008-01-01

    Interactions in Type Ia Supernovae A. J. Aspden 1 , J. B.involved in type Ia supernovae (SN Ia) requires the use of ?generated by RT in type Ia supernovae should obey Bolgiano-

  11. Abstract--In this work, we first introduced a reorganized form of the Novikov's inversion formula for the attenuated Radon

    E-Print Network [OSTI]

    for the attenuated Radon transform with parallel-beam geometry which utilizes the conventional filters (such the attenuated Radon transform (AtRT). A closed- form inversion formula for parallel-beam (PB) geometry

  12. The Revenger's Tragedy

    E-Print Network [OSTI]

    Grim, Elizabeth Lynn

    2010-04-27

    Prosc. Boom 6 306 26º S4 575W Side Light L026 SR Prosc. Boom 7 307 26º S4 575W L738 SR Prosc. Boom 8 308 26º S4 575W L218 SR Prosc. Boom 9 309 26º S4 575W Side Light L026 SR Prosc. Boom 10 310 26º S4 575W L738 SR Prosc. Boom 11 311 26º S4 575W L218 SR... Act I Scene 3 CL TO SCENESHOP TO DRESSING AND GREEN ROOMS SL Prosc. BoomSR Prosc. Boom Lft Box 4 Lft Box 3 Lft Box 2 Lft Bo x 1 Rt Bo x 1 Rt Box 2 Rt Box 3 Rt Box 4 US Storage Platform 50 40 35 30 20 15 10 5 4 1 GR. DRAPE Elec-7 18...

  13. Communicating Evolution as Science

    E-Print Network [OSTI]

    Thanukos, Anastasia

    2010-01-01

    thuringiensis toxins. Science. 1992;258(5087):1451–5. MillerRT, Ruse M. But is it science? Amherst, NY: Prometheusto the philosophy of science: theory and reality. Chicago:

  14. A. E. K. Ris Ris-M -CUE] Title and author(s)

    E-Print Network [OSTI]

    - tageous . Copies to Library 100 G.K. Kristiansen 1( RT 12 I Available on request from: Risø Library, are considered for 2-dimensional geometries xy, rz, and r6. There are 3 types of problems, 1) A » 1/K

  15. Space-frequency correlation of classical waves in disordered media: high-frequency and small scale asymptotics

    E-Print Network [OSTI]

    Albert C. Fannjiang

    2007-06-25

    Two-frequency radiative transfer (2f-RT) theory is developed for geometrical optics in random media. The space-frequency correlation is described by the two-frequency Wigner distribution (2f-WD) which satisfies a closed form equation, the two-frequency Wigner-Moyal equation. In the RT regime it is proved rigorously that 2f-WD satisfies a Fokker-Planck-like equation with complex-valued coefficients. By dimensional analysis 2f-RT equation yields the scaling behavior of three physical parameters: the spatial spread, the coherence length and the coherence bandwidth. The sub-transport-mean-free-path behavior is obtained in a closed form by analytically solving a paraxial 2f-RT equation.

  16. ATOC/CHEM 5151 Problem 2 Atmospheric Number Density at Sea Level

    E-Print Network [OSTI]

    Toohey, Darin W.

    of moles and A is Avogadro's number. Methodology: Use Ideal Gas Law, find "R" in units that are close in Avogadro's number for molecules cm-3) [M] = N/V = P/RT Source of information: Wikipedia ("Gas Constant") R

  17. ARPA-E Celebrates Five Years of Changing What's Possible | Department...

    Energy Savers [EERE]

    front). Image: Sarah Gerrity, Energy Department. AutoGrid 2 of 5 AutoGrid Known as the Demand Response Optimization and Management System - Real-Time (DROMS-RT), AutoGrid's...

  18. "Safety Concrete" A Material Designed to Fail

    E-Print Network [OSTI]

    High sand/binder ratio Introduces stress-concentrating defects Low-slump water/binder ratio Ideal for rapid molding and demolding, increases strength Controlled hydration time at RT or 60°C Balance

  19. An Investigation into the Historical Distribution, Prevalence, and Host Community of Monkeypox Virus (MPXV) Among Funisciurus Museum Skin Specimens from Central Africa

    E-Print Network [OSTI]

    Tiee, Madeline

    2015-01-01

    VERIFICATION RESULTS TO FLUORESCENCE LEVELS OF HRM PUTATIVEPCR, high-resolution melting (HRM) analysis was performed ons. The combination of RT-PCR and HRM analysis allows for the

  20. Uniform Quantifier Elimination and Constraint Query Processing

    E-Print Network [OSTI]

    2015-08-29

    tics. However, this is not always the case. Consider the. query,. Q= (9T1):R(T1): Clearly, the natural and active domain semantics give dif-. ferent interpretation to

  1. 1498 Biochemical Society Transactions (2014) Volume 42, part 6 Imaging tumour heterogeneity of the

    E-Print Network [OSTI]

    Coolen, ACC "Ton"

    2014-01-01

    , University of Oxford, Old Road Campus Research Building, Roosevelt Drive, Oxford OX3 7DQ, U.K. Biomaterials, Biomimetics and Biophotonics Division, King's College London Dental Institute, London SE1 9RT, U

  2. MSI | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Blog Home content Social Media MSI MSI RT @FrankKlotzNNSA: Many thanks to our outstanding MSI interns-the future leaders of our nuclear enterprise http:1.usa.govXNfDhk...

  3. Spectral residual method without gradient information for solving large-scale nonlinear systems of equations: Theory

    E-Print Network [OSTI]

    Martínez, José Mario

    Universidad Central de Venezuela Caracas, Venezuela. E-mail: wlacruz@elecrisc.ing.ucv.ve Jos´e Mario Mart Venezuela Apartado 47002, Caracas 1041-A, Venezuela E-mail: mraydan@reacciun.ve Technical Report RT-04

  4. 894 Volume 55, Number 7, 2001 APPLIED SPECTROSCOPY0003-7028 / 01 / 5507-0894$2.00 / 0 q 2001 Society for Applied Spectroscopy

    E-Print Network [OSTI]

    Hastings, Gary

    that has been stripped of the iron sulfur clusters FA and FB; RC, reaction center; RT, room temperature; S. INTRODUCTION The primary solar capture and conversion processes in oxygen-evolving organisms (OEOs) occur

  5. Lesson 19: The Fundamental Thoerem of Line Integrals

    E-Print Network [OSTI]

    2015-07-19

    Jul 20, 2015 ... Conservation of Energy. Suppose F is a force field moving an object along a curve C given by r(t), a ? t ? b. By Newton's Second Law of ...

  6. Prepaid Forward and Forward Prices.pdf

    E-Print Network [OSTI]

    jeffb_000

    2013-12-02

    December 2, 2013. Prepaid Forward. Forward. General Formula. 0,. 0. Present Value of Dividends. P. T. F. S. = -. 0,. 0,. 0, (1 ). P. rT. P. T. T. T. T. F. F e. F.

  7. WHO report on the global tobacco epidemic, 2015: Raising taxes on tobacco

    E-Print Network [OSTI]

    World Health Organization

    2015-01-01

    yugoslav Republic of Macedonia, and West Bank and Gazaformer Yugoslav Republic of Macedonia adveRtIsIng bans: bansYugoslav Republic of Macedonia ** ALL EUR AMD EUR AZN BYR

  8. Quantitation of RNA with RiboGreenTM Stain using the The quantitation of RNA samples is a prerequisite for many different techniques in

    E-Print Network [OSTI]

    Raizada, Manish N.

    as reverse transcriptase PCR (RT-PCR), and differential display PCR. Traditionally, quantitation of RNA RNA ranging from 0 to 10 µg/ml with a 4-parameter logistic best fit to describe the data. (B

  9. Shock convergence and mix dynamics in inertial confinement fusion

    E-Print Network [OSTI]

    Rygg, James Ryan

    2006-01-01

    Understanding the phenomena of shock propagation and of turbulent mix induced by Rayleigh-Taylor (RT) instability growth is of critical importance for ignition and high gain in inertial confinement fusion (ICF). Capsule ...

  10. Effect of Heat and Electricity Storage and Reliability on Microgrid Viability: A Study of Commercial Buildings in California and New York States

    E-Print Network [OSTI]

    Stadler, Michael

    2009-01-01

    SOFC)..Viability PVPS R&D RT SCE SoCal SOFC tC TOU UL UPS VRB WACSolid-Oxide Fuel Cell (SOFC) SOFC is a promising technology

  11. Effect of Heat and Electricity Storage and Reliability on Microgrid Viability: A Study of Commercial Buildings in California and New York States

    E-Print Network [OSTI]

    Stadler, Michael

    2009-01-01

    SOFC) .Viability PVPS R&D RT SCE SoCal SOFC tC TOU UL UPS VRB WACSolid-Oxide Fuel Cell (SOFC) SOFC is a promising technology

  12. Investigation into resistance to experimental Salmonella challenge in neonatal leghorn chickens 

    E-Print Network [OSTI]

    Farnell, Morgan Brian

    1999-01-01

    -immune lymphokine (SE-ILK) or recombinant turkey interferon gamma (rtIFN?), for efficacy in protecting neonatal Leghorn chickens from experimental Salmonella challenge. Additionally, our laboratories have observed a seasonal pattern of apparent maternal...

  13. Plasma kinetics, tissue distribution, and cerebrocortical sources of reverse triiodothyronine in the rat

    SciTech Connect (OSTI)

    Obregon, M.J.; Larsen, P.R.; Silva, J.E.

    1985-06-01

    Studies in vitro have shown that rT3 is a potent and competitive inhibitor of T4 5'-deiodination (5'D). Recent studies in vivo have shown that cerebrocortical (Cx) T4 5'D-type II (5'D-II) activity (propylthiouracil (PTU) insensitive pathway), is reduced by T4 and rT3, the latter being more potent than T3 in Cx 5'D-II suppression. Some other reports had described rT3 production in rat brain as a very active pathway of thyroid hormone metabolism. To examine the possibility that rT3 plays a physiological role in regulating Cx 5'D-II, we have explored rT3 plasma kinetics, plasma to tissue exchange, and uptake by tissues in the rat, as well as the metabolic routes of degradation and the sources of rT3 in cerebral cortex (Cx). Plasma and tissue levels were assessed with tracer (/sup 125/I)rT3. Two main compartments were defined by plasma disappearance curves in euthyroid rats (K/sub 1/ = -6.2 h-1 and K/sub 2/ = -0.75 h-1). In Cx of euthyroid rats, (/sup 125/I)rT3 peaked 10 min after iv injection, tissue to plasma ratio being 0.016 +/- 0.004 (SE). In thyroidectomized rats, plasma and tissue (/sup 125/I)rT3 concentrations were higher than in euthyroid rats, except for the Cx that did not change. PTU caused further increases in all the tissues studied, except for the Cx and the pituitaries of thyroidectomized rats. From the effect of blocking 5'D-I with PTU or reducing its activity by making the animals hypothyroid, we concluded that 5'D-I accounts for most of the rT3 clearance from plasma. In contrast, in Cx and pituitary the levels of rT3 seem largely affected by 5'D-II activity. Since the latter results suggest that plasma rT3 does not play a major role in determining rT3 levels in these tissues, we explored the sources of rT3 in Cx using (/sup 125/I)T4. The (/sup 125/I)rT3 (T4) to (/sup 125/I)T4 ratio remained constant at 0.03 from 1 up to 5 h after injection of (/sup 125/I)T4.

  14. Association Between White Blood Cell Count Following Radiation Therapy With Radiation Pneumonitis in Non-Small Cell Lung Cancer

    SciTech Connect (OSTI)

    Tang, Chad; Gomez, Daniel R. [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Wang, Hongmei [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Department of Radiation Oncology, Nanfang Hospital, Southern Medical University, Guangzhou (China); Levy, Lawrence B. [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Zhuang, Yan [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Department of Radiation Physics, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Xu, Ting; Nguyen, Quynh; Komaki, Ritsuko [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Liao, Zhongxing, E-mail: zliao@mdanderson.org [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States)

    2014-02-01

    Purpose: Radiation pneumonitis (RP) is an inflammatory response to radiation therapy (RT). We assessed the association between RP and white blood cell (WBC) count, an established metric of systemic inflammation, after RT for non-small cell lung cancer. Methods and Materials: We retrospectively analyzed 366 patients with non-small cell lung cancer who received ?60 Gy as definitive therapy. The primary endpoint was whether WBC count after RT (defined as 2 weeks through 3 months after RT completion) was associated with grade ?3 or grade ?2 RP. Median lung volume receiving ?20 Gy (V{sub 20}) was 31%, and post-RT WBC counts ranged from 1.7 to 21.2 × 10{sup 3} WBCs/?L. Odds ratios (ORs) associating clinical variables and post-RT WBC counts with RP were calculated via logistic regression. A recursive-partitioning algorithm was used to define optimal post-RT WBC count cut points. Results: Post-RT WBC counts were significantly higher in patients with grade ?3 RP than without (P<.05). Optimal cut points for post-RT WBC count were found to be 7.4 and 8.0 × 10{sup 3}/?L for grade ?3 and ?2 RP, respectively. Univariate analysis revealed significant associations between post-RT WBC count and grade ?3 (n=46, OR=2.6, 95% confidence interval [CI] 1.4?4.9, P=.003) and grade ?2 RP (n=164, OR=2.0, 95% CI 1.2?3.4, P=.01). This association held in a stepwise multivariate regression. Of note, V{sub 20} was found to be significantly associated with grade ?2 RP (OR=2.2, 95% CI 1.2?3.4, P=.01) and trended toward significance for grade ?3 RP (OR=1.9, 95% CI 1.0-3.5, P=.06). Conclusions: Post-RT WBC counts were significantly and independently associated with RP and have potential utility as a diagnostic or predictive marker for this toxicity.

  15. Physical Constants g = 9.80 m/s2

    E-Print Network [OSTI]

    Wysin, Gary

    , Heat Pumps: W = QH - QL, refrigerators: COP = QL W , heat pumps: COP = QH W , QL QH = TL TH for ideal, V = V0T. Ideal Gas Law: PV = nRT, or PV = NkT, R = 8.314 J/mol·K, k = R NA = 1.38 × 10-23 J Internal Energy: U = 3 2 NkT = 3 2 nRT, for ideal monatomic gases. Mechanical Equivalent of Heat, Specific

  16. Management of Pediatric Myxopapillary Ependymoma: The Role of Adjuvant Radiation

    SciTech Connect (OSTI)

    Agbahiwe, Harold C.; Wharam, Moody; Batra, Sachin; Cohen, Kenneth; Terezakis, Stephanie A.

    2013-02-01

    Introduction: Myxopapillary ependymoma (MPE) is a rare tumor in children. The primary treatment is gross total resection (GTR), with no clearly defined role for adjuvant radiation therapy (RT). Published reports, however, suggest that children with MPE present with a more aggressive disease course. The goal of this study was to assess the role of adjuvant RT in pediatric patients with MPE. Methods: Sixteen patients with MPE seen at Johns Hopkins Hospital (JHH) between November 1984 and December 2010 were retrospectively reviewed. Fifteen of the patients were evaluable with a mean age of 16.8 years (range, 12-21 years). Kaplan-Meier curves and descriptive statistics were used for analysis. Results: All patients received surgery as the initial treatment modality. Surgery consisted of either a GTR or a subtotal resection (STR). The median dose of adjuvant RT was 50.4 Gy (range, 45-54 Gy). All patients receiving RT were treated at the involved site. After a median follow-up of 7.2 years (range, 0.75-26.4 years), all patients were alive with stable disease. Local control at 5 and 10 years was 62.5% and 30%, respectively, for surgery alone versus 100% at both time points for surgery and adjuvant RT. Fifty percent of the patients receiving surgery alone had local failure. All patients receiving STR alone had local failure compared to 33% of patients receiving GTR alone. One patient in the surgery and adjuvant RT group developed a distant site of recurrence 1 year from diagnosis. No late toxicity was reported at last follow-up, and neurologic symptoms either improved or remained stable following surgery with or without RT. Conclusions: Adjuvant RT improved local control compared to surgery alone and should be considered after surgical resection in pediatric patients with MPE.

  17. Intern experience at the Texas Transportation Institute: an internship report 

    E-Print Network [OSTI]

    Andersen, Donald A.

    2013-03-13

    OIEX ADEC CTfA EUxRT& yOIEX ADEC yOIEX ADEC CTfA EUxRT yaMavav yaMaMav yaMa&a& yaMava& yaMaMa& Ppqs v qFGFqsq 19 Ppqs 8 iFGsm 2js c:h1s" pn srupm:"sm "s(:F"sq 2p u"smsc2...

  18. Acute Toxicity in High-Risk Prostate Cancer Patients Treated With Androgen Suppression and Hypofractionated Intensity-Modulated Radiotherapy

    SciTech Connect (OSTI)

    Pervez, Nadeem, E-mail: nadeempe@cancerboard.ab.c [Division of Radiation Oncology, Cross Cancer Institute, Edmonton, Alberta (Canada); Small, Cormac [Division of Radiation Oncology, Cross Cancer Institute, Edmonton, Alberta (Canada); MacKenzie, Marc [Division of Medical Physics, Cross Cancer Institute, Edmonton, Alberta (Canada); Yee, Don; Parliament, Matthew [Division of Radiation Oncology, Cross Cancer Institute, Edmonton, Alberta (Canada); Ghosh, Sunita [Division of Experimental Oncology, Cross Cancer Institute, Edmonton, Alberta (Canada); Mihai, Alina; Amanie, John; Murtha, Albert [Division of Radiation Oncology, Cross Cancer Institute, Edmonton, Alberta (Canada); Field, Colin [Division of Medical Physics, Cross Cancer Institute, Edmonton, Alberta (Canada); Murray, David [Division of Experimental Oncology, Cross Cancer Institute, Edmonton, Alberta (Canada); Fallone, Gino [Division of Medical Physics, Cross Cancer Institute, Edmonton, Alberta (Canada); Pearcey, Robert, E-mail: robertpe@cancerboard.ab.c [Division of Radiation Oncology, Cross Cancer Institute, Edmonton, Alberta (Canada)

    2010-01-15

    Purpose: To report acute toxicity resulting from radiotherapy (RT) dose escalation and hypofractionation using intensity-modulated RT (IMRT) treatment combined with androgen suppression in high-risk prostate cancer patients. Methods and Materials: Sixty patients with a histological diagnosis of high-risk prostatic adenocarcinoma (having either a clinical Stage of >=T3a or an initial prostate-specific antigen [PSA] level of >=20 ng/ml or a Gleason score of 8 to 10 or a combination of a PSA concentration of >15 ng/ml and a Gleason score of 7) were enrolled. RT prescription was 68 Gy in 25 fractions (2.72 Gy/fraction) over 5 weeks to the prostate and proximal seminal vesicles. The pelvic lymph nodes and distal seminal vesicles concurrently received 45 Gy in 25 fractions. The patients were treated with helical TomoTherapy-based IMRT and underwent daily megavoltage CT image-guided verification prior to each treatment. Acute toxicity scores were recorded weekly during RT and at 3 months post-RT, using Radiation Therapy Oncology Group acute toxicity scales. Results: All patients completed RT and follow up for 3 months. The maximum acute toxicity scores were as follows: 21 (35%) patients had Grade 2 gastrointestinal (GI) toxicity; 4 (6.67%) patients had Grade 3 genitourinary (GU) toxicity; and 30 (33.33%) patients had Grade 2 GU toxicity. These toxicity scores were reduced after RT; there were only 8 (13.6%) patients with Grade 1 GI toxicity, 11 (18.97%) with Grade 1 GU toxicity, and 5 (8.62%) with Grade 2 GU toxicity at 3 months follow up. Only the V60 to the rectum correlated with the GI toxicity. Conclusion: Dose escalation using a hypofractionated schedule to the prostate with concurrent pelvic lymph node RT and long-term androgen suppression therapy is well tolerated acutely. Longer follow up for outcome and late toxicity is required.

  19. Effects of Heat Stress and Increased Protein Fed in Milk Replacers on the Health and Growth Parameters of Neonatal Holstein Bull Calves 

    E-Print Network [OSTI]

    Krenek, Andrew

    2012-10-19

    , respectively). CMR had a greater SI and FC (P < 0.05) than HPMR (0.942 vs. 0.437, and 1.99 vs. 1.78, respectively). HS had a higher RT AM, RT PM, RR AM, and RR PM (P<0.01) than NHS (38.87 vs. 38.77, 39.03 vs. 38.79, 35.79 vs. 32.77, and 55.73 vs. 38...

  20. Jo~ao A.C. Martins Antonio Pinto da Costa

    E-Print Network [OSTI]

    Kanno, Yoshihiro

    rn rtut 2 : µrn rt , n ut µrn rt n ut = 0 SOCCP ­ p.11/18 #12;2 Ku = r + f : : u, r : µrni rti , ni uti , (µrni, rti) · (ni, uti) = 0 : gi - uni 0, rni 0, (gi - uni)rni = 0 : SOCCP ­ p.12/18 #12 D SOCCP ­ p.17/18 #12; - stuck · - free : rni : rti/µ SOCCP ­ p.17/18 #12;, , Coulomb , 2 : , , 2 2

  1. Muddy Water? Variation in Reporting Receipt of Breast Cancer Radiation Therapy by Population-Based Tumor Registries

    SciTech Connect (OSTI)

    Walker, Gary V.; Giordano, Sharon H.; Williams, Melanie; Jiang, Jing; Niu, Jiangong; MacKinnon, Jill; Anderson, Patricia; Wohler, Brad; Sinclair, Amber H.; Boscoe, Francis P.; Schymura, Maria J.; Buchholz, Thomas A.; Smith, Benjamin D.

    2013-07-15

    Purpose: To evaluate, in the setting of breast cancer, the accuracy of registry radiation therapy (RT) coding compared with the gold standard of Medicare claims. Methods and Materials: Using Surveillance, Epidemiology, and End Results (SEER)–Medicare data, we identified 73,077 patients aged ?66 years diagnosed with breast cancer in the period 2001-2007. Underascertainment (1 - sensitivity), sensitivity, specificity, ?, and ?{sup 2} were calculated for RT receipt determined by registry data versus claims. Multivariate logistic regression characterized patient, treatment, and geographic factors associated with underascertainment of RT. Findings in the SEER–Medicare registries were compared with three non-SEER registries (Florida, New York, and Texas). Results: In the SEER–Medicare registries, 41.6% (n=30,386) of patients received RT according to registry coding, versus 49.3% (n=36,047) according to Medicare claims (P<.001). Underascertainment of RT was more likely if patients resided in a newer SEER registry (odds ratio [OR] 1.70, 95% confidence interval [CI] 1.60-1.80; P<.001), rural county (OR 1.34, 95% CI 1.21-1.48; P<.001), or if RT was delayed (OR 1.006/day, 95% CI 1.006-1.007; P<.001). Underascertainment of RT receipt in SEER registries was 18.7% (95% CI 18.6-18.8%), compared with 44.3% (95% CI 44.0-44.5%) in non-SEER registries. Conclusions: Population-based tumor registries are highly variable in ascertainment of RT receipt and should be augmented with other data sources when evaluating quality of breast cancer care. Future work should identify opportunities for the radiation oncology community to partner with registries to improve accuracy of treatment data.

  2. Management of Adenoid Cystic Carcinoma of the Breast: A Rare Cancer Network Study

    SciTech Connect (OSTI)

    Khanfir, Kaouthar, E-mail: kaouthar.khanfir@rsv-gnw.ch [Hopital de Sion, CHCVs, Sion (Switzerland); Kallel, Adel [Institut Gustave Roussy, Villejuif (France); Villette, Sylviane [Centre Rene Huguenin, Paris (France); Belkacemi, Yazid [CHU Henri Mondor, Centre Oscar Lambret, Lille (France); Vautravers, Claire [Centre George Francois Leclerc, Dijon (France); Nguyen, TanDat [Institut Jean Gaudinot, Reims (France); Miller, Robert [Mayo Clinic, Rochester, Minnesota (United States); Li Yexiong [Peking Union Medical College, Beijing (China); Taghian, Alphonse G. [Massachusetts General Hospital, Boston, Massachusetts (United States); Boersma, Liesbeth [Maastricht University Medical Center (MAASTRO clinic), Maastricht (Netherlands); Poortmans, Philip [Dr. Bernard Verbeeten Institute, Tilburg (Netherlands); Goldberg, Hadassah [Western Galilee Hospital-Nahariya, Nahariya (Israel); Vees, Hansjorg [Hopitaux Universitaires de Geneve, Geneva (Switzerland); Senkus, Elzbieta [Medical University of Gdansk, Gdansk (Poland); Igdem, Sefik; Ozsahin, Mahmut [Istanbul Bilim University, Istanbul (Turkey); Jeanneret Sozzi, Wendy [Centre Hospitalier Universitaire Vaudois, Lausanne (Switzerland)

    2012-04-01

    Background: Mammary adenoid cystic carcinoma (ACC) is a rare breast cancer. The aim of this retrospective study was to assess prognostic factors and patterns of failure, as well as the role of radiation therapy (RT), in ACC. Methods: Between January 1980 and December 2007, 61 women with breast ACC were treated at participating centers of the Rare Cancer Network. Surgery consisted of lumpectomy in 41 patients and mastectomy in 20 patients. There were 51(84%) stage pN0 and 10 stage cN0 (16%) patients. Postoperative RT was administered to 40 patients (35 after lumpectomy, 5 after mastectomy). Results: With a median follow-up of 79 months (range, 6-285), 5-year overall and disease-free survival rates were 94% (95% confidence interval [CI], 88%-100%) and 82% (95% CI, 71%-93%), respectively. The 5-year locoregional control (LRC) rate was 95% (95% CI, 89%-100%). Axillary lymph node dissection or sentinel node biopsy was performed in 84% of cases. All patients had stage pN0 disease. In univariate analysis, survival was not influenced by the type of surgery or the use of postoperative RT. The 5-year LRC rate was 100% in the mastectomy group versus 93% (95% CI, 83%-100%) in the breast-conserving surgery group, respectively (p = 0.16). For the breast-conserving surgery group, the use of RT significantly correlated with LRC (p = 0.03); the 5-year LRC rates were 95% (95% CI, 86%-100%) for the RT group versus 83% (95% CI, 54%-100%) for the group receiving no RT. No local failures occurred in patients with positive margins, all of whom received postoperative RT. Conclusion: Breast-conserving surgery is the treatment of choice for patients with ACC breast cancer. Axillary lymph node dissection or sentinel node biopsy might not be recommended. Postoperative RT should be proposed in the case of breast-conserving surgery.

  3. Radiotherapy Improves Survival in Unresected Stage I-III Bronchoalveolar Carcinoma

    SciTech Connect (OSTI)

    Urban, Damien [Department of Oncology, Sheba Medical Center, Ramat Gan (Israel)] [Department of Oncology, Sheba Medical Center, Ramat Gan (Israel); Mishra, Mark [Department of Radiation Oncology, Jefferson Medical College of Thomas Jefferson University, Philadelphia, Pennsylvania (United States)] [Department of Radiation Oncology, Jefferson Medical College of Thomas Jefferson University, Philadelphia, Pennsylvania (United States); Onn, Amir [Department of Oncology, Sheba Medical Center, Ramat Gan (Israel)] [Department of Oncology, Sheba Medical Center, Ramat Gan (Israel); Dicker, Adam P. [Department of Radiation Oncology, Jefferson Medical College of Thomas Jefferson University, Philadelphia, Pennsylvania (United States)] [Department of Radiation Oncology, Jefferson Medical College of Thomas Jefferson University, Philadelphia, Pennsylvania (United States); Symon, Zvi; Pfeffer, M. Raphael [Department of Oncology, Sheba Medical Center, Ramat Gan (Israel) [Department of Oncology, Sheba Medical Center, Ramat Gan (Israel); Sackler School of Medicine, Tel Aviv University, Tel Aviv (Israel); Lawrence, Yaacov Richard, E-mail: yaacovla@gmail.com [Department of Oncology, Sheba Medical Center, Ramat Gan (Israel); Department of Radiation Oncology, Jefferson Medical College of Thomas Jefferson University, Philadelphia, Pennsylvania (United States); Sackler School of Medicine, Tel Aviv University, Tel Aviv (Israel)

    2012-11-01

    Purpose: To test the hypothesis that radiotherapy (RT) improves the outcome of patients with unresected, nonmetastatic bronchoalveolar carcinoma (BAC) by performing a population-based analysis within the Surveillance, Epidemiology, and End Results (SEER) registry. Methods and Materials: Inclusion criteria were as follows: patients diagnosed with BAC, Stage I-III, between 2001 and 2007. Exclusion criteria included unknown stage, unknown primary treatment modality, Stage IV disease, and those diagnosed at autopsy. Demographic data, treatment details, and overall survival were retrieved from the SEER database. Survival was analyzed using the Kaplan-Meier method and log-rank test. Results: A total of 6933 patients with Stage I-III BAC were included in the analysis. The median age at diagnosis was 70 years (range, 10-101 years). The majority of patients were diagnosed with Stage I (74.4%); 968 patients (14%) did not undergo surgical resection. Unresected patients were more likely to be older (p < 0.0001), male (p = 0.001), black (p < 0.0001), and Stage III (p < 0.0001). Within the cohort of unresected patients, 300 (31%) were treated with RT. The estimated 2-year overall survival for patients with unresected, nonmetastatic BAC was 58%, 44%, and 27% in Stage I, II, and III, respectively. Factors associated with improved survival included female sex, earlier stage at diagnosis, and use of RT. Median survival in those not receiving RT vs. receiving RT was as follows: Stage I, 28 months vs. 33 months (n = 364, p = 0.06); Stage II, 18 months vs. not reached (n = 31, nonsignificant); Stage III, 10 months vs. 17 months (n = 517, p < 0.003). Conclusions: The use of RT is associated with improved prognosis in unresected Stage I-III BAC. Less than a third of patients who could have potentially benefited from RT received it, suggesting that the medical specialists involved in the care of these patients underappreciate the importance of RT.

  4. Impact of Preoperative Radiotherapy on General and Disease-Specific Health Status of Rectal Cancer Survivors: A Population-Based Study

    SciTech Connect (OSTI)

    Thong, Melissa S.Y., E-mail: M.Thong@uvt.nl [Center of Research on Psychology in Somatic Diseases (CoRPS), Tilburg University (Netherlands); Comprehensive Cancer Centre South, Eindhoven (Netherlands); Mols, Floortje [Center of Research on Psychology in Somatic Diseases (CoRPS), Tilburg University (Netherlands); Comprehensive Cancer Centre South, Eindhoven (Netherlands); Lemmens, Valery E.P.P. [Comprehensive Cancer Centre South, Eindhoven (Netherlands); Department of Public Health, Erasmus University Medical Centre, Rotterdam (Netherlands); Rutten, Harm J.T. [Department of Surgery, Catharina Hospital, Eindhoven (Netherlands); Roukema, Jan A. [Department of Surgery, St. Elisabeth Hospital, Tilburg (Netherlands); Martijn, Hendrik [Department of Radiotherapy, Catharina Hospital, Eindhoven (Netherlands); Poll-Franse, Lonneke V. van de [Center of Research on Psychology in Somatic Diseases (CoRPS), Tilburg University (Netherlands); Comprehensive Cancer Centre South, Eindhoven (Netherlands)

    2011-11-01

    Purpose: To date, few studies have evaluated the impact of preoperative radiotherapy (pRT) on long-term health status of rectal cancer survivors. Using a population-based sample, we assessed the impact of pRT on general and disease-specific health status of rectal cancer survivors up to 10 years postdiagnosis. The health status of older ({>=}75 years old at diagnosis) pRT survivors was also compared with that of younger survivors. Methods and Materials: Survivors identified from the Eindhoven Cancer Registry treated with surgery only (SU) or with pRT between 1998 and 2007 were included. Survivors completed the Short Form-36 (SF-36) health survey questionnaire and the European Organization for Research and Treatment of Cancer Quality of Life Questionnaire-Colorectal 38 (EORTC QLQ-CR38) questionnaire. The SF-36 and EORTC QLQ-CR38 (sexuality subscale) scores of the survivors were compared to an age- and sex-matched Dutch normal population. Results: A total of 340 survivors (response, 85%; pRT survivors, 71%) were analyzed. Overall, survivors had similar general health status. Both short-term (<5 years) and long-term ({>=}5 years) pRT survivors had significantly poorer body image and more problems with gastrointestinal function, male sexual dysfunction, and defecation than SU survivors. Survivors had comparable general health status but greater sexual dysfunction than the normal population. Older pRT survivors had general and disease-specific health status comparable to that of younger pRT survivors. Conclusions: For better survivorship care, rectal cancer survivors could benefit from increased clinical and psychological focus on the possible long-term morbidity of treatment and its effects on health status.

  5. Dermatofibrosarcoma Protuberans: Long-term Outcomes of 53 Patients Treated With Conservative Surgery and Radiation Therapy

    SciTech Connect (OSTI)

    Castle, Katherine O. [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States)] [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Guadagnolo, B. Ashleigh, E-mail: aguadagn@mdanderson.org [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Tsai, C. Jillian [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States)] [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Feig, Barry W. [Department of Surgical Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States)] [Department of Surgical Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Zagars, Gunar K. [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States)] [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States)

    2013-07-01

    Purpose: To evaluate outcomes of conservative surgery and radiation therapy (RT) treatment in patients with dermatofibrosarcoma protuberans. Methods and Materials: We retrospectively reviewed the medical records of 53 consecutive dermatofibrosarcoma protuberans patients treated with surgery and preoperative or postoperative radiation therapy between 1972 and 2010. Median tumor size was 4 cm (range, 1-25 cm). Seven patients (13%) were treated with preoperative RT (50-50.4 Gy) and 46 patients (87%) with postoperative RT (60-66 Gy). Of the 46 patients receiving postoperative radiation, 3 (7%) had gross disease, 14 (30%) positive margins, 26 (57%) negative margins, and 3 (7%) uncertain margin status. Radiation dose ranged from 50 to 66 Gy (median dose, 60 Gy). Results: At a median follow-up time of 6.5 years (range, 0.5 months-23.5 years), 2 patients (4%) had disease recurrence, and 3 patients (6%) had died. Actuarial overall survival was 98% at both 5 and 10 years. Local control was 98% and 93% at 5 and 10 years, respectively. Disease-free survival was 98% and 93% at 5 and 10 years, respectively. The presence of fibrosarcomatous change was not associated with increased risk of local or distant relapse (P=.43). One of the patients with a local recurrence had gross residual disease at the time of RT and despite RT to 65 Gy developed both an in-field recurrence and a nodal and distant recurrence 3 months after RT. The other patient with local recurrence was found to have in-field recurrence 10 years after initial treatment. Thirteen percent of patients had an RT complication at 5 and 10 years, and 9% had a moderate or severe complication at 5 and 10 years. Conclusions: Dermatofibrosarcoma protuberans is a radioresponsive disease with excellent local control after conservative surgery and radiation therapy. Adjuvant RT should be considered for patients with large or recurrent tumors or when attempts at wide surgical margins would result in significant morbidity.

  6. The Efficacy of Radiation Therapy in the Treatment of Graves' Orbitopathy

    SciTech Connect (OSTI)

    Matthiesen, Chance, E-mail: chance-matthiesen@ouhsc.edu [Department of Radiation Oncology, University of Oklahoma Health Sciences Center, Oklahoma City, OK (United States); Thompson, J. Spencer [Department of Radiation Oncology, University of Oklahoma Health Sciences Center, Oklahoma City, OK (United States); Thompson, David [Department of Biostatistics and Epidemiology, University of Oklahoma Health Sciences Center, Oklahoma City, OK (United States); Farris, Bradley; Wilkes, Byron [Dean A. McGee Eye Institute, Oklahoma City, OK (United States); Ahmad, Salahuddin; Herman, Terence; Bogardus, Carl [Department of Radiation Oncology, University of Oklahoma Health Sciences Center, Oklahoma City, OK (United States)

    2012-01-01

    Purpose: To review our institutional outcomes of patients treated with radiation therapy (RT) for Graves' orbitopathy (GO), assess the role of orbital reirradiation, and identify prognostic factors of complete response (CR). Methods and Materials: This is a retrospective review of 211 patients who presented with a diagnosis of GO and received RT between January 2000-2010. RT dose was 20 Gy in 10 fractions. Patient median age was 51 years (range, 15-84 years), median follow-up was 11 months (range, 1-88 months). Patient symptoms included any combination of proptosis (90.9%), extraocular muscle dysfunction (78.9%), soft tissue signs (68.4%), and diplopia (58.4%). Corticosteroids were used as first-line therapy in 20.6% of patients. Among those who achieved either CR or partial response (PR), prognostic factors were evaluated. Results: Stabilization of disease without recurrence was clinically achieved overall in 202 patients (96.7%). At the completion of RT, 176 patients (84.2%) reported a symptomatic improvement of pretreatment symptoms. CR of GO symptoms was achieved using multiple treatment modalities, including RT by 93 patients (44.5%), of which 32 patients received RT only. Corticosteroids were discontinued in 97.8% of patients who received them as initial therapy. Surgical intervention following radiotherapy was required for 144 (68.9%) of all patients. Fourteen patients received orbital reirradiation for persistent or recurrent symptoms. Five of these achieved a CR, and the other nine achieved disease stabilization but retained persistent ocular symptoms. Long-term side effects of RT included dry eyes (12%). Of the prognostic factors we investigated, only gender predicted CR, which was less common in men (33.9%) than in women (49.7%) p = 0.0471. Conclusions: Orbital radiation for GO is an established treatment modality for patients. Orbital reirradiation is beneficial for patients who do not respond to initial RT or experience symptom recurrence without an apparent risk of increased morbidity.

  7. Expression of Candidate Genes for Horn Growth in Early Bovine Development 

    E-Print Network [OSTI]

    Vitanza, Sarah M.

    2011-02-22

    .................................................................................... 3.4Primer Design.......................4 3.5 Polymerase Chain Reaction ................................................................ 14 6Reverse Transcriptase Polymerase Chain Reaction.............................18 3.7 Analysis of Real... Page 3.1 Gene specific primers used for qualitative RT-PCR.................................. 15 3.2 Gene specific PCR primers for real-time RT-.................................... 16 3.3 Primers for each exon of C21orf66...

  8. The World of Dark Shadows Issue 2 

    E-Print Network [OSTI]

    Multiple Contributors

    1976-01-01

    ~ll.'· ~~c W~. 1n thu .:r..:wint; r.,;.:..t. when tb61 vnt ...ru2 tbu OlJ Hc UKG • . _· :,,~·:.=::'uJ, aho quickly :..o~" thll li~n of thlJ oru... "Y... u'ru u:.:::.:'I" : _ .. ;::::18;;4.1'- .:lnu 8t~rt"J to.. run. Bomatca' 01". o~ue:t:t bvrs in :l l...

  9. The determination of compressibility factors of gaseous propane-nitrogen mixtures 

    E-Print Network [OSTI]

    Hodges, Don

    1952-01-01

    ??IxTURE AS CALO:LATM& "RO? PRE BEAT I. - ~RIl, ), El AN &', gi)ATIOR OR STATE (liters por ~rr I ) RT(1 - o/vT3) (Cr. mole atm ). er liter v Bo(1 - b) (liters per r oIe) Ao(1 - a) vs v (p 8rrrp at?sos tpr ur*, atmos (Pv RT 0 0900 0 1050...

  10. Role of Adjuvant Radiotherapy in Granulosa Cell Tumors of the Ovary

    SciTech Connect (OSTI)

    Hauspy, Jan; Beiner, Mario E.; Harley, Ian; Rosen, Barry; Murphy, Joan; Chapman, William; Le, Lisa W.; Fyles, Anthony; Levin, Wilfred

    2011-03-01

    Purpose: To review the role of adjuvant radiotherapy (RT) in the outcome and recurrence patterns of granulosa cell tumors (GCTs) of the ovary. Methods and Materials: The records of all patients with GCTs referred to the Princess Margaret Hospital University Health Network between 1961 and 2006 were retrospectively reviewed. The patient, tumor, and treatment factors were assessed by univariate and multivariate analyses using disease-free survival (DFS) as the endpoint. Results: A total of 103 patients with histologically confirmed GCTs were included in the present study. The mean duration of follow-up was 100 months (range, 1-399). Of the 103 patients, 31 received adjuvant RT. A total of 39 patients developed tumor recurrence. The tumor size, incidence of intraoperative rupture, and presence of concurrent endometrial cancer were not significant risk factors for DFS. The median DFS was 251 months for patients who underwent adjuvant RT compared with 112 months for patients who did not (p = .02). On multivariate analysis, adjuvant RT remained a significant prognostic factor for DFS (p = .004). Of the 103 patients, 12 had died and 44 were lost to follow-up. Conclusion: Ovarian GCTs can be indolent, with patients achieving long-term survival. In our series, adjuvant RT resulted in a significantly longer DFS. Ideally, randomized trials with long-term follow-up are needed to define the role of adjuvant RT for ovarian GCTs.

  11. Salvage Treatment for Recurrent Intracranial Germinoma After Reduced-Volume Radiotherapy: A Single-Institution Experience and Review of the Literature

    SciTech Connect (OSTI)

    Hu, Yu-Wen [Cancer Center, Taipei Veterans General Hospital, Taipei, Taiwan (China) [Cancer Center, Taipei Veterans General Hospital, Taipei, Taiwan (China); Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); Huang, Pin-I [Cancer Center, Taipei Veterans General Hospital, Taipei, Taiwan (China) [Cancer Center, Taipei Veterans General Hospital, Taipei, Taiwan (China); Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); Institute of Clinical Medicine, National Yang-Ming University, Taipei, Taiwan (China); Wong, Tai-Tong [Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China) [Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); Division of Pediatric Neurosurgery, Neurological Institute, Taipei Veterans General Hospital, Taipei, Taiwan (China); Ho, Donald Ming-Tak [Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China) [Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); Department of Pathology, Taipei Veterans General Hospital, Taipei, Taiwan (China); Chang, Kai-Ping [Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China) [Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); Department of Pediatrics, Taipei Veterans General Hospital, Taipei, Taiwan (China); Guo, Wan-Yuo; Chang, Feng-Chi [Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China) [Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); Department of Radiology, Taipei Veterans General Hospital, Taipei, Taiwan (China); Shiau, Cheng-Yin [Cancer Center, Taipei Veterans General Hospital, Taipei, Taiwan (China) [Cancer Center, Taipei Veterans General Hospital, Taipei, Taiwan (China); Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); Liang, Muh-Lii; Lee, Yi-Yen [Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China) [Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); Institute of Clinical Medicine, National Yang-Ming University, Taipei, Taiwan (China); Division of Pediatric Neurosurgery, Neurological Institute, Taipei Veterans General Hospital, Taipei, Taiwan (China); and others

    2012-11-01

    Purpose: Intracranial germinomas (IGs) are highly curable with radiotherapy (RT). However, recurrence still occurs, especially when limited-field RT is applied, and the optimal salvage therapy remains controversial. Methods and Materials: Between January 1989 and December 2010, 14 patients with clinically or pathologically diagnosed recurrent IGs after RT were reviewed at our institution. Of these, 11 received focal-field RT, and the other 3 received whole-brain irradiation, whole-ventricle irradiation, and Gamma Knife radiosurgery as the respective first course of RT. In addition, we identified from the literature 88 patients with recurrent IGs after reduced-volume RT, in whom the details of salvage therapy were recorded. Results: The median time to recurrence was 30.3 months (range, 3.8-134.9 months). One patient did not receive further treatment and was lost during follow-up. Of the patients, 7 underwent salvage with craniospinal irradiation (CSI) plus chemotherapy (CT), 4 with CSI alone, 1 with whole-brain irradiation plus CT, and 1 with Gamma Knife radiosurgery. The median follow-up time was 105.1 months (range, 24.2-180.9 months). Three patients died without evidence of disease progression: two from second malignancies and one from unknown cause. The others remained disease free. The 3-year survival rate after recurrence was 83.3%. A total of 102 patients from our study and the literature review were analyzed to determine the factors affecting prognosis and outcomes. After recurrence, the 5-year survival rates were 71% and 92.9% for all patients and for those receiving salvage CSI, respectively. Univariate analysis showed that initial RT volume, initial RT dose, initial CT, and salvage RT type were significant prognostic predictors of survival. On multivariable analysis, salvage CSI was the most significant factor (p = 0.03). Conclusions: Protracted follow-up is recommended because late recurrence is not uncommon. CSI with or without CT is an effective salvage treatment for recurrence after reduced-volume RT.

  12. Predictors of Severe Acute and Late Toxicities in Patients With Localized Head-and-Neck Cancer Treated With Radiation Therapy

    SciTech Connect (OSTI)

    Meyer, Francois, E-mail: francois.meyer@chuq.qc.ca [Laval University Cancer Research Center, Centre hospitalier universitaire de Quebec - L'Hotel-Dieu de Quebec, Quebec (Canada); Fortin, Andre; Wang, Chang Shu [Radiation Therapy Department, Centre hospitalier universitaire de Quebec - L'Hotel-Dieu de Quebec, Quebec (Canada); Liu, Geoffrey [Applied Molecular Oncology, Ontario Cancer Institute/Princess Margaret Hospital, Toronto (Canada); Bairati, Isabelle [Laval University Cancer Research Center, Centre hospitalier universitaire de Quebec - L'Hotel-Dieu de Quebec, Quebec (Canada)

    2012-03-15

    Purpose: Radiation therapy (RT) causes acute and late toxicities that affect various organs and functions. In a large cohort of patients treated with RT for localized head and neck cancer (HNC), we prospectively assessed the occurrence of RT-induced acute and late toxicities and identified characteristics that predicted these toxicities. Methods and Materials: We conducted a randomized trial among 540 patients treated with RT for localized HNC to assess whether vitamin E supplementation could improve disease outcomes. Adverse effects of RT were assessed using the Radiation Therapy Oncology Group Acute Radiation Morbidity Criteria during RT and one month after RT, and the Radiation Therapy Oncology Group/European Organization for Research and Treatment of Cancer Late Radiation Morbidity Scoring Scheme at six and 12 months after RT. The most severe adverse effect among the organs/tissues was selected as an overall measure of either acute or late toxicity. Grade 3 and 4 toxicities were considered as severe. Stepwise multivariate logistic regression models were used to identify all independent predictors (p < 0.05) of acute or late toxicity and to estimate odds ratios (OR) for severe toxicity with their 95% confidence intervals (CI). Results: Grade 3 or 4 toxicity was observed in 23% and 4% of patients, respectively, for acute and late toxicity. Four independent predictors of severe acute toxicity were identified: sex (female vs. male: OR = 1.72, 95% confidence interval [CI]: 1.06-2.80), Karnofsky Performance Status (OR = 0.67 for a 10-point increment, 95% CI: 0.52-0.88), body mass index (above 25 vs. below: OR = 1.88, 95% CI: 1.22-2.90), TNM stage (Stage II vs. I: OR = 1.91, 95% CI: 1.25-2.92). Two independent predictors were found for severe late toxicity: female sex (OR = 3.96, 95% CI: 1.41-11.08) and weight loss during RT (OR = 1.26 for a 1 kg increment, 95% CI: 1.12-1.41). Conclusions: Knowledge of these predictors easily collected in a clinical setting could help tailoring therapies to reduce toxicities among patients treated with RT for HNC.

  13. Fulvestrant radiosensitizes human estrogen receptor-positive breast cancer cells

    SciTech Connect (OSTI)

    Wang, Jing; Department of Oncology, Affiliated Hospital of Qingdao University Medical College, Shandong Province ; Yang, Qifeng; Haffty, Bruce G.; Li, Xiaoyan; Moran, Meena S.

    2013-02-08

    Highlights: ? Fulvestrant radiosensitizes MCF-7 cells. ? Fulvestrant increases G1 arrest and decreases S phase in MCF-7 cells. ? Fulvestrant down-regulates DNA-PKcs and RAD51 in MCF-7 cells. -- Abstract: The optimal sequencing for hormonal therapy and radiation are yet to be determined. We utilized fulvestrant, which is showing promise as an alternative to other agents in the clinical setting of hormonal therapy, to assess the cellular effects of concomitant anti-estrogen therapy (fulvestrant) with radiation (F + RT). This study was conducted to assess the effects of fulvestrant alone vs. F + RT on hormone-receptor positive breast cancer to determine if any positive or negative combined effects exist. The effects of F + RT on human breast cancer cells were assessed using MCF-7 clonogenic and tetrazolium salt colorimetric (MTT) assays. The assays were irradiated with a dose of 0, 2, 4, 6 Gy ± fulvestrant. The effects of F + RT vs. single adjuvant treatment alone on cell-cycle distribution were assessed using flow cytometry; relative expression of repair proteins (Ku70, Ku80, DNA-PKcs, Rad51) was assessed using Western Blot analysis. Cell growth for radiation alone vs. F + RT was 0.885 ± 0.013 vs. 0.622 ± 0.029 @2 Gy, 0.599 ± 0.045 vs. 0.475 ± 0.054 @4 Gy, and 0.472 ± 0.021 vs. 0.380 ± 0.018 @6 Gy RT (p = 0.003). While irradiation alone induced G2/M cell cycle arrest, the combination of F + RT induced cell redistribution in the G1 phase and produced a significant decrease in the proportion of cells in G2 phase arrest and in the S phase in breast cancer cells (p < 0.01). Furthermore, levels of repair proteins DNA-PKcs and Rad51 were significantly decreased in the cells treated with F + RT compared with irradiation alone. F + RT leads to a decrease in the surviving fraction, increased cell cycle arrest, down regulating of nonhomologous repair protein DNA-PKcs and homologous recombination repair protein RAD51. Thus, our findings suggest that F + RT increases breast cancer cell radiosensitivity compared with radiation alone. These findings have salient implications for designing clinical trials using fulvestrant and radiation therapy.

  14. Self-Reported Cognitive Outcomes in Patients With Brain Metastases Before and After Radiation Therapy

    SciTech Connect (OSTI)

    Cole, Ansa Maer; Scherwath, Angela; Ernst, Gundula; Lanfermann, Heinrich; Bremer, Michael; Steinmann, Diana

    2013-11-15

    Purpose: Patients with brain metastases may experience treatment-related cognitive deficits. In this study, we prospectively assessed the self-reported cognitive abilities of patients with brain metastases from any solid primary cancer before and after irradiation of the brain. Methods and Materials: The treatment group (TG) consisted of adult patients (n=50) with brain metastases who received whole or partial irradiation of the brain without having received prior radiation therapy (RT). The control group (CG) consisted of breast cancer patients (n=27) without cranial involvement who were treated with adjuvant RT. Patients were recruited between May 2008 and December 2010. Self-reported cognitive abilities were acquired before RT and 6 weeks, 3 months, and 6 months after irradiation. The information regarding the neurocognitive status was collected by use of the German questionnaires for self-perceived deficits in attention (FEDA) and subjectively experienced everyday memory performance (FEAG). Results: The baseline data showed a high proportion of self-perceived neurocognitive deficits in both groups. A comparison between the TG and the CG regarding the course of self-reported outcomes after RT showed significant between-group differences for the FEDA scales 2 and 3: fatigue and retardation of daily living activities (P=.002) and decrease in motivation (P=.032) with an increase of attention deficits in the TG, but not in the CG. There was a trend towards significance in FEDA scale 1: distractibility and retardation of mental processes (P=.059) between the TG and the CG. The FEAG assessment presented no significant differences. An additional subgroup analysis within the TG was carried out. FEDA scale 3 showed significant differences in the time-related progress between patients with whole-brain RT and those receiving hypofractionated stereotactic RT (P=.025), with less decrease in motivation in the latter group. Conclusion: Self-reported attention declined in patients with brain metastases after RT to the brain, whereas it remained relatively stable in breast cancer patients.

  15. RTOG 0211: A Phase 1/2 Study of Radiation Therapy With Concurrent Gefitinib for Newly Diagnosed Glioblastoma Patients

    SciTech Connect (OSTI)

    Chakravarti, Arnab; Wang, Meihua; Robins, H. Ian; Lautenschlaeger, Tim; Curran, Walter J.; Brachman, David G.; Schultz, Christopher J.; Choucair, Ali; Dolled-Filhart, Marisa; Christiansen, Jason; Gustavson, Mark; Molinaro, Annette; Ludwig Institute for Cancer Research, University of California–San Diego, La Jolla, California ; Mischel, Paul; Dicker, Adam P.; and others

    2013-04-01

    Purpose: To determine the safety and efficacy of gefitinib, an epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor, in combination with radiation for newly diagnosed glioblastoma (GBM) patients. Methods and Materials: Between March 21, 2002, and May 3, 2004, Radiation Therapy Oncology Group (RTOG) 0211 enrolled 31 and 147 GBM patients in the phase 1 and 2 arms, respectively. Treatment consisted of daily oral gefinitnib started at the time of conventional cranial radiation therapy (RT) and continued post RT for 18 months or until progression. Tissue microarrays from 68 cases were analyzed for EGFR expression. Results: The maximum tolerated dose (MTD) of gefitinib was determined to be 500 mg in patients on non-enzyme-inducing anticonvulsant drugs (non-EIAEDs). All patients in the phase 2 component were treated at a gefitinib dose of 500 mg; patients receiving EIADSs could be escalated to 750 mg. The most common side effects of gefitinib in combination with radiation were dermatologic and gastrointestinal. Median survival was 11.5 months for patients treated per protocol. There was no overall survival benefit for patients treated with gefitinib + RT when compared with a historical cohort of patients treated with RT alone, matched by RTOG recursive partitioning analysis (RPA) class distribution. Younger age was significantly associated with better outcome. Per protocol stratification, EGFR expression was not found to be of prognostic value for gefitinib + RT-treated patients. Conclusions: The addition of gefitinib to RT is well tolerated. Median survival of RTOG 0211 patients treated with RT with concurrent and adjuvant gefitinib was similar to that in a historical control cohort treated with radiation alone.

  16. The mitigating effect of magnetic fields on Rayleigh-Taylor unstable inertial confinement fusion plasmas

    SciTech Connect (OSTI)

    Srinivasan, Bhuvana; Tang, Xian-Zhu

    2013-05-15

    Rayleigh-Taylor (RT) instabilities at interfaces of disparate mass densities have long been known to generate magnetic fields during inertial confinement fusion implosions. An externally applied magnetic field can also be efficiently amplified by RT instabilities. The focus here is on magnetic field generation and amplification at the gas-ice interface which is RT unstable during the deceleration phase of the implosion. RT instabilities lead to undesirable mix of hot and cold plasmas which enhances thermal energy loss and tends to produce a more massive warm-spot instead of a hot-spot. Two mechanisms are shown here to mitigate the thermal energy loss from the hot-spot. The first mechanism is the reduction of electron thermal conductivity with interface-aligned magnetic fields. This can occur through self-generated magnetic fields via the Biermann battery effect as well as through externally applied magnetic fields that undergo an exponential growth via the stretch-and-fold magnetohydrodynamic dynamo. Self-generated magnetic fields during RT evolution can result in a factor of 2?10 decrease in the electron thermal conductivity at the gas-ice interface, while externally applied magnetic fields that are compressed to 6–1000 T at the onset of deceleration (corresponding to pre-implosion external fields of 0.06–10 T) could result in a factor of 2–500 reduction in electron thermal conductivity at the gas-ice interface. The second mechanism to mitigate thermal energy loss from the hot-spot is to decrease the interface mixing area between the hot and cold plasmas. This is achieved through large external magnetic fields of 1000 T at the onset of deceleration which damp short-wavelength RT modes and long-wavelength Kelvin-Helmholtz modes thus significantly slowing the RT growth and reducing mix.

  17. Imaging Biomarker Dynamics in an Intracranial Murine Glioma Study of Radiation and Antiangiogenic Therapy

    SciTech Connect (OSTI)

    Chung, Caroline; Jalali, Shahrzad; Foltz, Warren; Burrell, Kelly; Wildgoose, Petra; Lindsay, Patricia; Graves, Christian; Camphausen, Kevin; Milosevic, Michael; Jaffray, David; Zadeh, Gelareh; Ménard, Cynthia

    2013-03-01

    Purpose: There is a growing need for noninvasive biomarkers to guide individualized spatiotemporal delivery of radiation therapy (RT) and antiangiogenic (AA) therapy for brain tumors. This study explored early biomarkers of response to RT and the AA agent sunitinib (SU), in a murine intracranial glioma model, using serial magnetic resonance imaging (MRI). Methods and Materials: Mice with MRI-visible tumors were stratified by tumor size into 4 therapy arms: control, RT, SU, and SU plus RT (SURT). Single-fraction conformal RT was delivered using MRI and on-line cone beam computed tomography (CT) guidance. Serial MR images (T2-weighted, diffusion, dynamic contrast-enhanced and gadolinium-enhanced T1-weighted scans) were acquired biweekly to evaluate tumor volume, apparent diffusion coefficient (ADC), and tumor perfusion and permeability responses (K{sub trans}, K{sub ep}). Results: Mice in all treatment arms survived longer than those in control, with a median survival of 35 days for SURT (P<.0001) and 30 days for RT (P=.009) and SU (P=.01) mice vs 26 days for control mice. At Day 3, ADC rise was greater with RT than without (P=.002). Sunitinib treatment reduced tumor perfusion/permeability values with mean K{sub trans} reduction of 27.6% for SU (P=.04) and 26.3% for SURT (P=.04) mice and mean K{sub ep} reduction of 38.1% for SU (P=.01) and 27.3% for SURT (P=.02) mice. The magnitude of individual mouse ADC responses at Days 3 and 7 correlated with subsequent tumor growth rate R values of ?0.878 (P=.002) and ?0.80 (P=.01), respectively. Conclusions: Early quantitative changes in diffusion and perfusion MRI measures reflect treatment responses soon after starting therapy and thereby raise the potential for these imaging biomarkers to guide adaptive and potentially individualized therapy approaches in the future.

  18. Aspirin and Statin Nonuse Associated With Early Biochemical Failure After Prostate Radiation Therapy

    SciTech Connect (OSTI)

    Zaorsky, Nicholas G.; Buyyounouski, Mark K.; Li, Tianyu; Horwitz, Eric M.

    2012-09-01

    Purpose: To present the largest retrospective series investigating the effect of aspirin and statins, which are hypothesized to have antineoplastic properties, on biochemical failure (nadir plus 2 ng/mL) after prostate radiation therapy (RT). Methods and Materials: Between 1989 and 2006, 2051 men with clinically localized prostate cancer received definitive RT alone (median dose, 76 Gy). The rates of aspirin use and statin use (defined as any use at the time of RT or during follow-up) were 36% and 34%, respectively. The primary endpoint of the study was an interval to biochemical failure (IBF) of less than 18 months, which has been shown to be the single strongest predictor of distant metastasis, prostate cancer survival, and overall survival after RT. Patient demographic characteristics and tumor staging factors were assessed with regard to associations with the endpoint. Univariate analysis was performed with the {chi}{sup 2} test for categorical variables and the Wilcoxon test for continuous variables. Multivariable analysis was performed with a multiple logistic regression. Results: The median follow-up was 75 months. Univariate analysis showed that an IBF of less than 18 months was associated with aspirin nonuse (P<.0001), statin nonuse (P<.0001), anticoagulant nonuse (P=.0006), cardiovascular disease (P=.0008), and prostate-specific antigen (continuous) (P=.008) but not with Gleason score, age, RT dose, or T stage. On multivariate analysis, only aspirin nonuse (P=.0012; odds ratio, 2.052 [95% confidence interval, 1.328-3.172]) and statin nonuse (P=.0002; odds ratio, 2.465 [95% confidence interval, 1.529-3.974]) were associated with an IBF of less than 18 months. Conclusions: In patients who received RT for prostate cancer, aspirin or statin nonuse was associated with early biochemical failure, a harbinger of distant metastasis and death. Further study is needed to confirm these findings and to determine the optimal dosing and schedule, as well as the relative benefits and risks, of both therapies in combination with RT.

  19. PSA Response to Neoadjuvant Androgen Deprivation Therapy Is a Strong Independent Predictor of Survival in High-Risk Prostate Cancer in the Dose-Escalated Radiation Therapy Era

    SciTech Connect (OSTI)

    McGuire, Sean E.; Lee, Andrew K.; Cerne, Jasmina Z.; Munsell, Mark F.; Levy, Lawrence B.; Kudchadker, Rajat J.; Choi, Seungtaek L.; Nguyen, Quynh N.; Hoffman, Karen E.; Pugh, Thomas J.; Frank, Steven J.; Corn, Paul G.; Logothetis, Christopher J.; Kuban, Deborah A.

    2013-01-01

    Purpose: The aim of the study was to evaluate the prognostic value of prostate-specific antigen (PSA) response to neoadjuvant androgen deprivation therapy (ADT) prior to dose-escalated radiation therapy (RT) and long-term ADT in high-risk prostate cancer. Methods and Materials: We reviewed the charts of all patients diagnosed with high-risk prostate cancer and treated with a combination of long-term ADT (median, 24 months) and dose-escalated (median, 75.6 Gy) RT between 1990 and 2007. The associations among patient, tumor, and treatment characteristics with biochemical response to neoadjuvant ADT and their effects on failure-free survival (FFS), time to distant metastasis (TDM), prostate cancer-specific mortality (PCSM) and overall survival (OS) were examined. Results: A total of 196 patients met criteria for inclusion. Median follow-up time for patients alive at last contact was 7.0 years (range, 0.5-18.1 years). Multivariate analysis identified the pre-RT PSA concentration (<0.5 vs {>=}0.5 ng/mL) as a significant independent predictor of FFS (P=.021), TDM (P=.009), PCSM (P=.039), and OS (P=.037). On multivariate analysis, pretreatment PSA (iPSA) and African-American race were significantly associated with failure to achieve a pre-RT PSA of <0.5 ng/mL. Conclusions: For high-risk prostate cancer patients treated with long-term ADT and dose-escalated RT, a pre-RT PSA level {>=}0.5 ng/mL after neoadjuvant ADT predicts for worse survival measures. Both elevated iPSA and African-American race are associated with increased risk of having a pre-RT PSA level {>=}0.5 ng/mL. These patients should be considered for clinical trials that test newer, more potent androgen-depleting therapies such as abiraterone and MDV3100 in combination with radiation.

  20. Extreme-Risk Prostate Adenocarcinoma Presenting With Prostate-Specific Antigen (PSA) >40 ng/ml: Prognostic Significance of the Preradiation PSA Nadir

    SciTech Connect (OSTI)

    Alexander, Abraham S. [British Columbia Cancer Agency, Vancouver Island Centre, Radiation Therapy Program, Victoria, British Columbia (Canada); University of British Columbia, Vancouver, British Columbia (Canada); Mydin, Aminudin; Jones, Stuart O.; Christie, Jennifer [British Columbia Cancer Agency, Vancouver Island Centre, Radiation Therapy Program, Victoria, British Columbia (Canada); Lim, Jan T.W. [British Columbia Cancer Agency, Vancouver Island Centre, Radiation Therapy Program, Victoria, British Columbia (Canada); University of British Columbia, Vancouver, British Columbia (Canada); Truong, Pauline T., E-mail: ptruong@bccancer.bc.ca [British Columbia Cancer Agency, Vancouver Island Centre, Radiation Therapy Program, Victoria, British Columbia (Canada); University of British Columbia, Vancouver, British Columbia (Canada); Ludgate, Charles M. [British Columbia Cancer Agency, Vancouver Island Centre, Radiation Therapy Program, Victoria, British Columbia (Canada); University of British Columbia, Vancouver, British Columbia (Canada)

    2011-12-01

    Purpose: To examine the impact of patient, disease, and treatment characteristics on survival outcomes in patients treated with neoadjuvant androgen deprivation therapy (ADT) and radical external-beam radiotherapy (RT) for clinically localized, extreme-risk prostate adenocarcinoma with a presenting prostate-specific antigen (PSA) concentration of >40 ng/ml. Methods and Materials: A retrospective chart review was conducted of 64 patients treated at a single institution between 1991 and 2000 with ADT and RT for prostate cancer with a presenting PSA level of >40 ng/ml. The effects of patient age, tumor (presenting PSA level, Gleason score, and T stage), and treatment (total ADT duration and pre-RT PSA level) characteristics on rates of biochemical disease-free survival (bDFS), prostate cancer-specific survival (PCSS), and overall survival (OS) were examined. Results: Median follow-up time was 6.45 years (range, 0.09-15.19 years). Actuarial bDFS, PCSS, and OS rates at 5 years were 39%, 87%, and 78%, respectively, and 17%, 64%, and 45%, respectively, at 10 years. On multivariate analysis, the pre-RT PSA level ({<=}0.1 versus >0.1 ng/ml) was the single most significant prognostic factor for bDFS (p = 0.033) and OS (p = 0.018) rates, whereas age, T stage, Gleason score, and ADT duration ({<=}6 versus >6 months) were not predictive of outcomes. Conclusion: In prostate cancer patients with high presenting PSA levels, >40 ng/ml, treated with combined modality, neoadjuvant ADT, and RT, the pre-RT PSA nadir, rather than ADT duration, was significantly associated with improved survival. This observation supports the use of neoadjuvant ADT to drive PSA levels to below 0.1 ng/ml before initiation of RT, to optimize outcomes for patients with extreme-risk disease.

  1. Impact of Neoadjuvant Radiation on Survival in Stage III Non-Small-Cell Lung Cancer

    SciTech Connect (OSTI)

    Koshy, Matthew, E-mail: mkoshy@umm.ed [Department of Radiation Oncology, University of Maryland School of Medicine and University of Maryland Marlene and Stewart Greenebaum Cancer Center, Baltimore, MD (United States); Goloubeva, Olga; Suntharalingam, Mohan [Department of Radiation Oncology, University of Maryland School of Medicine and University of Maryland Marlene and Stewart Greenebaum Cancer Center, Baltimore, MD (United States)

    2011-04-01

    Purpose: The role of surgery in Stage III non-small-cell lung cancer (NSCLC) is controversial. This study was undertaken to assess the impact of neoadjuvant radiation therapy for Stage III NSCLC. Methods and Materials: This was a retrospective study from the Surveillance, Epidemiology, and End Results (SEER) database that included patients who were 18 years and older with NSCLC classified as Stage III and who underwent definitive therapy from 1988 to 2004. Patients were characterized by type of treatment received. Survival functions were estimated by the Kaplan-Meier method, and Cox regression model was used to analyze trends in overall (OS) and cause-specific survival (CSS). Results: A total of 48,131 patients were selected, with a median follow-up of 10 months (range, 0-203 months). By type of treatment, the 3-year OS was 10% with radiation therapy (RT), 37% with surgery (S), 34% with surgery and postoperative radiation (S-RT), and 45% with neoadjuvant radiation followed by surgery (Neo-RT) (p = 0.0001). Multivariable Cox model identified sex, race, laterality, T stage, N stage, and type of treatment as factors affecting survival. Estimated hazard ratios (HR) adjusted for other variables in regression model showed the types of treatment: S (HR, 1.3; 95% confidence interval [CI], 1.2-1.4), S-RT (HR, 1.2; 95% CI, 1.1-1.3), and RT (HR, 2.3; 95% CI, 2.15-2.53) were associated with significantly worse overall survival when compared with Neo-RT (p = 0.0001). Conclusion: This population based study demonstrates that patients with Stage III NSCLC receiving Neo-RT had significantly improved overall survival when compared with other treatment groups.

  2. Late Patient-Reported Toxicity After Preoperative Radiotherapy or Chemoradiotherapy in Nonresectable Rectal Cancer: Results From a Randomized Phase III Study

    SciTech Connect (OSTI)

    Braendengen, Morten, E-mail: mortbrae@medisin.uio.no [Oslo University Hospital, Ulleval, Cancer Centre, Oslo (Norway); Department of Oncology and Pathology, Karolinska Institutet, Stockholm (Sweden); Tveit, Kjell Magne [Oslo University Hospital, Ulleval, Cancer Centre, Oslo (Norway); Faculty of Medicine, University of Oslo, Oslo (Norway); Bruheim, Kjersti [Oslo University Hospital, Ulleval, Cancer Centre, Oslo (Norway); Cvancarova, Milada [Department of Clinical Cancer Research, Oslo University Hospital, Radiumhospitalet, Oslo (Norway); Berglund, Ake [Department of Oncology, Radiology and Clinical Immunology, University of Uppsala, Uppsala (Sweden); Glimelius, Bengt [Department of Oncology and Pathology, Karolinska Institutet, Stockholm (Sweden); Department of Oncology, Radiology and Clinical Immunology, University of Uppsala, Uppsala (Sweden)

    2011-11-15

    Purpose: Preoperative chemoradiotherapy (CRT) is superior to radiotherapy (RT) in locally advanced rectal cancer, but the survival gain is limited. Late toxicity is, therefore, important. The aim was to compare late bowel, urinary, and sexual functions after CRT or RT. Methods and Materials: Patients (N = 207) with nonresectable rectal cancer were randomized to preoperative CRT or RT (2 Gy Multiplication-Sign 25 {+-} 5-fluorouracil/leucovorin). Extended surgery was often required. Self-reported late toxicity was scored according to the LENT SOMA criteria in a structured telephone interview and with questionnaires European Organisation for Research and Treatment of Cancer (EORTC) Quality of Life Questionnaire (QLQ-C30), International Index of Erectile Function (IIEF), and sexual function -vaginal changes questionnaire (SVQ). Results: Of the 105 patients alive in Norway and Sweden after 4 to 12 years of follow-up, 78 (74%) responded. More patients in the CRT group had received a stoma (73% vs. 52%, p = 0.09). Most patients without a stoma (7 of 12 in CRT group and 9 of 16 in RT group) had incontinence for liquid stools or gas. No stoma and good anal function were seen in 5 patients (11%) in the CRT group and in 11 (30%) in the RT group (p = 0.046). Of 44 patients in the CRT group, 12 (28%) had had bowel obstruction compared with 5 of 33 (15%) in the RT group (p = 0.27). One-quarter of the patients reported urinary incontinence. The majority of men had severe erectile dysfunction. Few women reported sexual activity during the previous month. However, the majority did not have concerns about their sex life. Conclusions: Fecal incontinence and erectile dysfunction are frequent after combined treatment for locally advanced rectal cancer. There was a clear tendency for the problems to be more common after CRT than after RT.

  3. Hypofractionated Radiation Therapy for Breast Ductal Carcinoma In Situ

    SciTech Connect (OSTI)

    Hathout, Lara [Department of Radiation Oncology, Hôpital Maisonneuve-Rosemont, Centre affilié à l'Université de Montréal, Montreal, Quebec (Canada); Hijal, Tarek [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada); Théberge, Valérie [Department of Radiation Oncology, Centre hospitalier universitaire de Québec, L'Hôtel-Dieu de Québec, Quebec (Canada); Centre des maladies du sein Deschênes-Fabia, Quebec (Canada); Fortin, Bernard [Department of Radiation Oncology, Hôpital Maisonneuve-Rosemont, Centre affilié à l'Université de Montréal, Montreal, Quebec (Canada); Vulpe, Horia [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada); Hogue, Jean-Charles [Centre des maladies du sein Deschênes-Fabia, Quebec (Canada); Centre hospitalier universitaire de Québec, Hôpital St-Sacrement, Quebec (Canada); Lambert, Christine [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada); Bahig, Houda [Department of Radiation Oncology, Hôpital Maisonneuve-Rosemont, Centre affilié à l'Université de Montréal, Montreal, Quebec (Canada); and others

    2013-12-01

    Purpose: Conventional radiation therapy (RT) administered in 25 fractions after breast-conserving surgery (BCS) is the standard treatment for ductal carcinoma in situ (DCIS) of the breast. Although accelerated hypofractionated regimens in 16 fractions have been shown to be equivalent to conventional RT for invasive breast cancer, few studies have reported results of using hypofractionated RT in DCIS. Methods and Materials: In this multicenter collaborative effort, we retrospectively reviewed the records of all women with DCIS at 3 institutions treated with BCS followed by hypofractionated whole-breast RT (WBRT) delivered in 16 fractions. Results: Between 2003 and 2010, 440 patients with DCIS underwent BCS followed by hypofractionated WBRT in 16 fractions for a total dose of 42.5 Gy (2.66 Gy per fraction). Boost RT to the surgical bed was given to 125 patients (28%) at a median dose of 10 Gy in 4 fractions (2.5 Gy per fraction). After a median follow-up time of 4.4 years, 14 patients had an ipsilateral local relapse, resulting in a local recurrence-free survival of 97% at 5 years. Positive surgical margins, high nuclear grade, age less than 50 years, and a premenopausal status were all statistically associated with an increased occurrence of local recurrence. Tumor hormone receptor status, use of adjuvant hormonal therapy, and administration of additional boost RT did not have an impact on local control in our cohort. On multivariate analysis, positive margins, premenopausal status, and nuclear grade 3 tumors had a statistically significant worse local control rate. Conclusions: Hypofractionated RT using 42.5 Gy in 16 fractions provides excellent local control for patients with DCIS undergoing BCS.

  4. Spatial autocorrelation approaches to testing residuals from least squares regression

    E-Print Network [OSTI]

    Chen, Yanguang

    2015-01-01

    In statistics, the Durbin-Watson test is always employed to detect the presence of serial correlation of residuals from a least squares regression analysis. However, the Durbin-Watson statistic is only suitable for ordered time or spatial series. If the variables comprise cross-sectional data coming from spatial random sampling, the Durbin-Watson will be ineffectual because the value of Durbin-Watson's statistic depends on the sequences of data point arrangement. Based on the ideas from spatial autocorrelation, this paper presents two new statistics for testing serial correlation of residuals from least squares regression based on spatial samples. By analogy with the new form of Moran's index, an autocorrelation coefficient is defined with a standardized residual vector and a normalized spatial weight matrix. Then on the analogy of the Durbin-Watson statistic, a serial correlation index is constructed. As a case, the two statistics are applied to the spatial sample of 29 China's regions. These results show th...

  5. In-Born Radio Frequency Identification Devices for Safeguards Use at Gas-Centrifuge Enrichment Plants

    SciTech Connect (OSTI)

    Ward,R.; Rosenthal,M.

    2009-07-12

    Global expansion of nuclear power has made the need for improved safeguards measures at Gas Centrifuge Enrichment Plants (GCEPs) imperative. One technology under consideration for safeguards applications is Radio Frequency Identification Devices (RFIDs). RFIDs have the potential to increase IAEA inspector"s efficiency and effectiveness either by reducing the number of inspection visits necessary or by reducing inspection effort at those visits. This study assesses the use of RFIDs as an integral component of the "Option 4" safeguards approach developed by Bruce Moran, U.S. Nuclear Regulatory Commission (NRC), for a model GCEP [1]. A previous analysis of RFIDs was conducted by Jae Jo, Brookhaven National Laboratory (BNL), which evaluated the effectiveness of an RFID tag applied by the facility operator [2]. This paper presents a similar evaluation carried out in the framework of Jo’s paper, but it is predicated on the assumption that the RFID tag is applied by the manufacturer at the birth of the cylinder, rather than by the operator. Relevant diversion scenarios are examined to determine if RFIDs increase the effectiveness and/ or efficiency of safeguards in these scenarios. Conclusions on the benefits offered to inspectors by using in-born RFID tagging are presented.

  6. Prevention of Gynecomastia and Breast Pain Caused by Androgen Deprivation Therapy in Prostate Cancer: Tamoxifen or Radiotherapy?

    SciTech Connect (OSTI)

    Arruda Viani, Gustavo; Bernardes da Silva, Lucas Godoi; Stefano, Eduardo Jose

    2012-07-15

    Purpose: To determine, in a meta-analysis, whether gynecomastia and breast pain rates in men with prostate cancer treated with androgen deprivation therapy (ADT) are reduced if treated with prophylactic radiotherapy (RT) or tamoxifen (TMX). Methods and Materials: The MEDLINE, EMBASE, CANCERLIT, and Cochrane Library databases, as well as proceedings of annual meetings, were systematically searched to identify randomized, controlled studies comparing RT or TMX with observation for men with prostate cancer using ADT. Results: Six RCTs (three RT trials and three TMX trials, N = 777 patients total) were identified that met the study criteria. Pooled results from these RCTs comparing RT vs. observation showed a significant reduction in the incidence of gynecomastia and breast pain rates in patients treated with RT (odds ratio [OR] = 0.21, 95% confidence interval [CI] = 0.12-0.37, p < 0.0001, and OR = 0.34, 95% CI 0.20-0.57, p < 0.0001, respectively). Use of RT resulted in an absolute risk reduction (ARR) of 29.4% and 19.9%, with a number needed to treat (NNT) of 3.4 and 5 to avoid one case of gynecomastia and breast pain, respectively. Pooled results from trials comparing TMX vs. observation showed a statistical benefit for breast pain and gynecomastia in favor of TMX arms (OR = 0.04, 95% CI = 0.02-0.08, p < 0.0001 and OR = 0.07, 95% CI = 0.0-0.14, p < 0.00001). TMX resulted in an ARR = 64.1% and 47.6%, with an NNT of 1.56 and 2.1 to avoid one case of gynecomastia and breast pain, respectively. Considering adverse effects, TMX was 6 times more adverse effects than RT. Conclusions: Our data have shown that both TMX and RT prevented gynecomastia and breast pain in patients with prostate cancer receiving ADT for prostate cancer. Although TMX was two times more effective in preventing gynecomastia, RT should represent an effective and safe treatment option, to take into account mainly in patients with cardiovascular risk factors or thrombotic diathesis.

  7. Dentofacial development in long-term survivors of acute lymphoblastic leukemia. A comparison of three treatment modalities

    SciTech Connect (OSTI)

    Sonis, A.L.; Tarbell, N.; Valachovic, R.W.; Gelber, R.; Schwenn, M.; Sallan, S. (Children's Hospital, Boston, MA (USA))

    1990-12-15

    Ninety-seven children who were diagnosed with acute lymphoblastic leukemia before 10 years of age and treated with chemotherapy alone, chemotherapy plus 1800-cGy cranial irradiation (RT), or chemotherapy plus 2400-cGy RT were evaluated for effects of therapy on dentofacial development. All patients were seen at least 5 years postdiagnosis. Dental abnormalities were determined from panoramic radiographs, and craniofacial evaluations were made from lateral cephalometric radiographs. Ninety-one (94%) of all patients and 41 (100%) of patients younger than 5 years of age at diagnosis had abnormal dental development. The severity of these abnormalities was greater in children who received treatment before 5 years of age and in those who received RT. Observed dental abnormalities included tooth agenesis, arrested root development, microdontia, and enamel dysplasias. Craniofacial abnormalities occurred in 18 of 20 (90%) of those patients who received chemotherapy plus 2400-cGy RT before 5 years of age. Mean cephalometric values of this group showed significant deficient mandibular development. The results of this study suggest that the severity of dentofacial-developmental abnormalities secondary to antileukemia therapy are related to the age of the patient at the initiation of treatment and the use of cranial RT.

  8. A survey of methods concerning the effects of impurities on the thermophysical properties of pure components 

    E-Print Network [OSTI]

    Phillips, Tony Lee

    1980-01-01

    and the r esu' ts compared to measurements . Table 1. DOS Used to Determine the Dew-Rubble Gap. v d'I(1 P =R /! v-b) - a/ v a=?7R /(64P ) 2 2 b=RT /(8P ) C C P=R /( , v-b)-a/I v( v+b) ] a=O. 42747F, T P b=0. 08664RT /P C C SRK P=RT/( v ? b...)-a/[v( v+b) ] a=O. 42747R . s /P s=1+(0. 480+1 . 574w-0. 176~ ) (1 ? ' ) 2 1/2 b=0. 08664RT /P C C PR P=R /( v-b) ? a/[v( v ? b)+b( v-b) ] a=O. 45724(R T /. ) t C C t=1+(0. 37464+1. 54226m-0. 2699m ) (1- ?) 2 1/2 b=0. 07780RT /P C C I D '. A L S Y...

  9. Probing the Room Temperature Spatial Distribution of Hydrogen in Nanoporous Carbon by Use of Small-Angle Neutron Scattering

    SciTech Connect (OSTI)

    Tsao, Cheng-Si [Massachusetts Institute of Technology (MIT); Li, Mingda [ORNL; Zhang, Yang [ORNL; Leao, Juscelino B [ORNL; Chiang, Wei-Shan [ORNL; Chung, Tsui-Yun [Institute of Nuclear Energy Research, Taiwan; Tzeng, Yi-Ren [Institute of Nuclear Energy Research, Taiwan; Chen, Sow-hsin H [ORNL

    2010-01-01

    The spatial distribution of hydrogen physically adsorbed in a nanoporous carbon at room temperature (RT) as a function of H2 gas pressure is investigated for the first time using small-angle neutron scattering (SANS). A hierarchical pore structure consisting of micropores and a fractal mesopore network of the used activated carbon is also studied to correlate the relationship between the spatial distribution of hydrogen and the pore confinement. The cylinder-like cluster of aggregated hydrogen is formed and is confined in the disklike micropore. The evolution of spatial structures of adsorbed hydrogen with hydrogen pressure is elucidated. A direct experimental observation of the spatial distribution and the behavior of hydrogen adsorbed in the porous materials at RT is still scarce to date. The analysis results obtained by SANS provide new information for the future investigations of the RT storage mechanism of hydrogen in the nanoporous materials developed for the purpose of on-board hydrogen storage.

  10. Electron Scattering in InSb Quantum Wells due to Micro-twin Defects

    SciTech Connect (OSTI)

    Mishima, T. D.; Santos, M. B. [Homer L. Dodge Department of Physics and Astronomy, and Center for Semiconductor Physics in Nanostructure University of Oklahoma, 440 W. Brooks St., Norman, OK 73019 (United States)

    2011-12-26

    The transport electron scattering due to micro-twin (MT) defects in InSb quantum wells (QWs) has been investigated at room temperature (RT). A linear-regression-based scattering analysis showed that Matthiessen's rule is applicable to the RT electron mobility in 20-nm-thick InSb QWs that contain MTs (whose density is 5.6x10{sup 2}-1.2x10{sup 4} /cm) and threading dislocations (8.7x10{sup 8}-3.2x10{sup 9} /cm{sup 2}) as dominant structural defects. For such an InSb QW whose local electron mobility in its non-MT regions is 2.8x10{sup 4}-4.5x10{sup 4} cm{sup 2}/(Vs), the MT-originated energy barrier against the electron transport is deduced to be 0.081-0.093 eV at RT.

  11. Final Report - ILAW PCT, VHT, Viscosity, and Electrical Conductivity Model Development, VSL-07R1230-1

    SciTech Connect (OSTI)

    Kruger, Albert A.; Cooley, S. K.; Joseph, I.; Pegg, I. L.; Piepel, G. F.; Gan, H.; Muller, I.

    2013-12-17

    This report describes the results of work and testing specified by the Test Specifications (24590-LAW-TSP-RT-01-013 Rev.1 and 24590-WTP-TSP-RT-02-001 Rev.0), Test Plans (VSL-02T4800-1 Rev.1 & TP-RPP-WTP-179 Rev.1), and Text Exception (24590-WTP-TEF-RT-03-040). The work and any associated testing followed established quality assurance requirements and conducted as authorized. The descriptions provided in this test report are an accurate account of both the conduct of the work and the data collected. Results required by the Test Plans are reported. Also reported are any unusual or anomalous occurrences that are different from the starting hypotheses. The test results and this report have been reviewed and verified.

  12. Effects of laser energy fluence on the onset and growth of the Rayleigh-Taylor instabilities and its influence on the topography of the Fe thin film grown in pulsed laser deposition facility

    SciTech Connect (OSTI)

    Mahmood, S. [National Institute of Education, Nanyang Technological University, 1 Nanyang Walk, Singapore 637616 (Singapore); Department of Physics, University of Karachi, Karachi 75270 (Pakistan); Rawat, R. S.; Wang, Y.; Lee, S.; Tan, T. L.; Springham, S. V.; Lee, P. [National Institute of Education, Nanyang Technological University, 1 Nanyang Walk, Singapore 637616 (Singapore); Zakaullah, M. [Department of Physics, Quaid-i-Azam University, 45320 Islamabad (Pakistan)

    2012-10-15

    The effect of laser energy fluence on the onset and growth of Rayleigh-Taylor (RT) instabilities in laser induced Fe plasma is investigated using time-resolved fast gated imaging. The snow plow and shock wave models are fitted to the experimental results and used to estimate the ablation parameters and the density of gas atoms that interact with the ablated species. It is observed that RT instability develops during the interface deceleration stage and grows for a considerable time for higher laser energy fluence. The effects of RT instabilities formation on the surface topography of the Fe thin films grown in pulsed laser deposition system are investigated (i) using different laser energy fluences for the same wavelength of laser radiation and (ii) using different laser wavelengths keeping the energy fluence fixed. It is concluded that the deposition achieved under turbulent condition leads to less smooth deposition surfaces with bigger sized particle agglomerates or network.

  13. Study of Rayleigh–Taylor growth in laser irradiated planar SiO{sub 2} targets at ignition-relevant conditions

    SciTech Connect (OSTI)

    Hager, J. D.; Collins, T. J. B.; Knauer, J. P.; Meyerhofer, D. D.; Sangster, T. C. [Laboratory for Laser Energetics, University of Rochester, 250 East River Road, Rochester, New York 14623-1299 (United States)] [Laboratory for Laser Energetics, University of Rochester, 250 East River Road, Rochester, New York 14623-1299 (United States); Smalyuk, V. A. [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States)] [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States)

    2013-07-15

    Rayleigh–Taylor (RT) growth experiments were performed on the OMEGA laser [T. R. Boehly et al., Opt. Commun. 133, 495 (1997)] using planar SiO{sub 2} targets seeded with a single mode 60-?m wavelength perturbation driven at peak laser intensities up to 9 × 10{sup 14} W/cm{sup 2}. These are the first RT measurements in SiO{sub 2} at conditions relevant to direct-drive inertial confinement fusion ignition. The measured average modulation growth rates agree with the 2-D hydrodynamics code DRACO, providing an important step in the development of target ablators that are robust to RT growth and hot- electron preheat considerations when driven at the intensities required to achieve thermonuclear ignition.

  14. Synthesis of Fluorosugar Reagents for the Construction of Well-Defined Fluoroglycoproteins

    E-Print Network [OSTI]

    Salvadó, Míriam; Amgarten, Beatrice; Castillón, Sergio; Bernardes, Gonçalo J. L.; Boutureira, Omar

    2015-05-22

    Na2CO3 aq (0.04 M), rt, from 1 h up to 7 days unless otherwise indicated. b Determined by 19 F NMR of the crude reaction mixture. c 2-F- ?-galactosyl bromide 2b (1 equiv), Nu (2 equiv), TBAB (2 equiv) in 3:2 CH2Cl2–5% NaOH aq (0.02 M), rt, 14... –22 h. d 2-F- ?-galactosyl bromide 2b (2 equiv), estrone (1 equiv), 60% NaH in mineral oil (1.5 equiv) in dry 1,4-dioxane (0.08 M), rt, 24 h. Nu = nucleophile. TBAHS = tetrabutylammonium hydrogen sulfate. TBAB = tetrabutylammonium bromide. Next...

  15. Prospective Study Evaluating Postoperative Radiotherapy Plus 2-Year Androgen Suppression for Post-Radical Prostatectomy Patients With Pathologic T3 Disease and/or Positive Surgical Margins

    SciTech Connect (OSTI)

    Choo, Richard [Department of Radiation Oncology, Mayo Clinic, Rochester, MN (United States)], E-mail: choo.c@mayo.edu; Danjoux, Cyril; Gardner, Sandra; Morton, Gerard; Szumacher, Ewa; Loblaw, D. Andrew; Cheung, Patrick [Department of Radiation Oncology, Odette Cancer Centre, University of Toronto, Toronto, ON (Canada); Pearse, Maria [Department of Radiation Oncology, Auckland Hospital, Auckland (New Zealand)

    2009-10-01

    Purpose: To determine the efficacy of a combined approach of postoperative radiotherapy (RT) plus 2-year androgen suppression (AS) for patients with pathologic T3 disease (pT3) and/or positive surgical margins (PSM) after radical prostatectomy (RP). Methods and Materials: A total of 78 patients with pT3 and/or PSM after RP were treated with RT plus 2-year AS, as per a pilot, prospective study. Androgen suppression started within 1 month after the completion of RT and consisted of nilutamide for 4 weeks and buserelin acetate depot subcutaneously every 2 months for 2 years. Relapse-free rate, including freedom from prostate-specific antigen (PSA) relapse, was estimated using the Kaplan-Meier method. A Cox regression analysis was performed to evaluate prognostic factors for relapse. Prostate-specific antigen relapse was defined as a PSA rise above 0.2 ng/mL, with two consecutive increases over a minimum of 3 months. Results: The median age was 61 years at the time of RP. The median interval between RP and postoperative RT was 4.2 months. Forty-nine patients had undetectable PSA (<0.2 ng/mL), and 29 had persistently detectable postoperative PSA at the time of the protocol treatment. Median follow-up from RT was 6.4 years. Relapse-free rates at 5 and 7 years were 94.4% and 86.3%, respectively. Survival rates were 96% at 5 years and 93.1% at 7 years. On Cox regression analysis, persistently detectable postoperative PSA and pT3b-T4 were significant predictors for relapse. Conclusion: The combined treatment of postoperative RT plus 2-year AS yielded encouraging results for patients with pT3 and/or PSM and warrants a confirmatory study.

  16. Consideration of Dose Limits for Organs at Risk of Thoracic Radiotherapy: Atlas for Lung, Proximal Bronchial Tree, Esophagus, Spinal Cord, Ribs, and Brachial Plexus

    SciTech Connect (OSTI)

    Kong, Feng-Ming; Ritter, Timothy; Quint, Douglas J.; Senan, Suresh; Gaspar, Laurie E.; Komaki, Ritsuko U.; Hurkmans, Coen W.; Timmerman, Robert; Bezjak, Andrea; Bradley, Jeffrey D.; Movsas, Benjamin; Marsh, Lon; Okunieff, Paul; Choy, Hak; Curran, Walter J.

    2011-12-01

    Purpose: To review the dose limits and standardize the three-dimenional (3D) radiographic definition for the organs at risk (OARs) for thoracic radiotherapy (RT), including the lung, proximal bronchial tree, esophagus, spinal cord, ribs, and brachial plexus. Methods and Materials: The present study was performed by representatives from the Radiation Therapy Oncology Group, European Organization for Research and Treatment of Cancer, and Soutwestern Oncology Group lung cancer committees. The dosimetric constraints of major multicenter trials of 3D-conformal RT and stereotactic body RT were reviewed and the challenges of 3D delineation of these OARs described. Using knowledge of the human anatomy and 3D radiographic correlation, draft atlases were generated by a radiation oncologist, medical physicist, dosimetrist, and radiologist from the United States and reviewed by a radiation oncologist and medical physicist from Europe. The atlases were then critically reviewed, discussed, and edited by another 10 radiation oncologists. Results: Three-dimensional descriptions of the lung, proximal bronchial tree, esophagus, spinal cord, ribs, and brachial plexus are presented. Two computed tomography atlases were developed: one for the middle and lower thoracic OARs (except for the heart) and one focusing on the brachial plexus for a patient positioned supine with their arms up for thoracic RT. The dosimetric limits of the key OARs are discussed. Conclusions: We believe these atlases will allow us to define OARs with less variation and generate dosimetric data in a more consistent manner. This could help us study the effect of radiation on these OARs and guide high-quality clinical trials and individualized practice in 3D-conformal RT and stereotactic body RT.

  17. SU-E-T-85: Comparison of Treatment Plans Calculated Using Ray Tracing and Monte Carlo Algorithms for Lung Cancer Patients Having Undergone Radiotherapy with Cyberknife

    SciTech Connect (OSTI)

    Pennington, A; Selvaraj, R; Kirkpatrick, S; Oliveira, S [21st Century Oncology, Deerfield Beach, FL (United States); Leventouri, T [Florida Atlantic University, Boca Raton, FL (United States)

    2014-06-01

    Purpose: The latest publications indicate that the Ray Tracing algorithm significantly overestimates the dose delivered as compared to the Monte Carlo (MC) algorithm. The purpose of this study is to quantify this overestimation and to identify significant correlations between the RT and MC calculated dose distributions. Methods: Preliminary results are based on 50 preexisting RT algorithm dose optimization and calculation treatment plans prepared on the Multiplan treatment planning system (Accuray Inc., Sunnyvale, CA). The analysis will be expanded to include 100 plans. These plans are recalculated using the MC algorithm, with high resolution and 1% uncertainty. The geometry and number of beams for a given plan, as well as the number of monitor units, is constant for the calculations for both algorithms and normalized differences are compared. Results: MC calculated doses were significantly smaller than RT doses. The D95 of the PTV was 27% lower for the MC calculation. The GTV and PTV mean coverage were 13 and 39% less for MC calculation. The first parameter of conformality, as defined as the ratio of the Prescription Isodose Volume to the PTV Volume was on average 1.18 for RT and 0.62 for MC. Maximum doses delivered to OARs was reduced in the MC plans. The doses for 1000 and 1500 cc of total lung minus PTV, respectively were reduced by 39% and 53% for the MC plans. The correlation of the ratio of air in PTV to the PTV with the difference in PTV coverage had a coefficient of ?0.54. Conclusion: The preliminary results confirm that the RT algorithm significantly overestimates the dosages delivered confirming previous analyses. Finally, subdividing the data into different size regimes increased the correlation for the smaller size PTVs indicating the MC algorithm improvement verses the RT algorithm is dependent upon the size of the PTV.

  18. Decision Regret in Men Undergoing Dose-Escalated Radiation Therapy for Prostate Cancer

    SciTech Connect (OSTI)

    Steer, Anna N.; Aherne, Noel J.; Gorzynska, Karen; Hoffman, Matthew; Last, Andrew; Hill, Jacques; Shakespeare, Thomas P.; Rural Clinical School Faculty of Medicine, University of New South Wales, Coffs Harbour

    2013-07-15

    Purpose: Decision regret (DR) is a negative emotion associated with medical treatment decisions, and it is an important patient-centered outcome after therapy for localized prostate cancer. DR has been found to occur in up to 53% of patients treated for localized prostate cancer, and it may vary depending on treatment modality. DR after modern dose-escalated radiation therapy (DE-RT) has not been investigated previously, to our knowledge. Our primary aim was to evaluate DR in a cohort of patients treated with DE-RT. Methods and Materials: We surveyed 257 consecutive patients with localized prostate cancer who had previously received DE-RT, by means of a validated questionnaire. Results: There were 220 responses (85.6% response rate). Image-guided intensity modulated radiation therapy was given in 85.0% of patients and 3-dimensional conformal radiation therapy in 15.0%. Doses received included 73.8 Gy (34.5% patients), 74 Gy (53.6%), and 76 Gy (10.9%). Neoadjuvant androgen deprivation (AD) was given in 51.8% of patients and both neoadjuvant and adjuvant AD in 34.5%. The median follow-up time was 23 months (range, 12-67 months). In all, 3.8% of patients expressed DR for their choice of treatment. When asked whether they would choose DE-RT or AD again, only 0.5% probably or definitely would not choose DE-RT again, compared with 8.4% for AD (P<.01). Conclusion: Few patients treated with modern DE-RT express DR, with regret appearing to be lower than in previously published reports of patients treated with radical prostatectomy or older radiation therapy techniques. Patients experienced more regret with the AD component of treatment than with the radiation therapy component, with implications for informed consent. Further research should investigate regret associated with individual components of modern therapy, including AD, radiation therapy and surgery.

  19. Intensity Modulated Radiation Therapy With Dose Painting to Treat Rhabdomyosarcoma

    SciTech Connect (OSTI)

    Yang, Joanna C.; Dharmarajan, Kavita V.; Wexler, Leonard H.; La Quaglia, Michael P.; Happersett, Laura; Wolden, Suzanne L.

    2012-11-01

    Purpose: To examine local control and patterns of failure in rhabdomyosarcoma patients treated with intensity modulated radiation therapy (RT) with dose painting (DP-IMRT). Patients and Methods: A total of 41 patients underwent DP-IMRT with chemotherapy for definitive treatment. Nineteen also underwent surgery with or without intraoperative RT. Fifty-six percent had alveolar histologic features. The median interval from beginning chemotherapy to RT was 17 weeks (range, 4-25). Very young children who underwent second-look procedures with or without intraoperative RT received reduced doses of 24-36 Gy in 1.4-1.8-Gy fractions. Young adults received 50.4 Gy to the primary tumor and lower doses of 36 Gy in 1.8-Gy fractions to at-risk lymph node chains. Results: With 22 months of median follow-up, the actuarial local control rate was 90%. Patients aged {<=}7 years who received reduced overall and fractional doses had 100% local control, and young adults had 79% (P=.07) local control. Three local failures were identified in young adults whose primary target volumes had received 50.4 Gy in 1.8-Gy fractions. Conclusions: DP-IMRT with lower fractional and cumulative doses is feasible for very young children after second-look procedures with or without intraoperative RT. DP-IMRT is also feasible in adolescents and young adults with aggressive disease who would benefit from prophylactic RT to high-risk lymph node chains, although dose escalation might be warranted for improved local control. With limited follow-up, it appears that DP-IMRT produces local control rates comparable to those of sequential IMRT in patients with rhabdomyosarcoma.

  20. Outcomes of Patients With Revised Stage I Clear Cell Sarcoma of Kidney Treated in National Wilms Tumor Studies 1-5

    SciTech Connect (OSTI)

    Kalapurakal, John A., E-mail: j-kalapurakal@northwestern.edu [Northwestern University, Chicago, Illinois (United States); Perlman, Elizabeth J. [Northwestern University, Chicago, Illinois (United States)] [Northwestern University, Chicago, Illinois (United States); Seibel, Nita L. [Cancer Therapy and Evaluation Program, Bethesda, Maryland (United States)] [Cancer Therapy and Evaluation Program, Bethesda, Maryland (United States); Ritchey, Michael [Phoenix Children's Hospital, Phoenix, Arizona (United States)] [Phoenix Children's Hospital, Phoenix, Arizona (United States); Dome, Jeffrey S. [Children's National Medical Center, Washington, District of Columbia (United States)] [Children's National Medical Center, Washington, District of Columbia (United States); Grundy, Paul E. [University of Alberta, Edmonton, AB (Canada)] [University of Alberta, Edmonton, AB (Canada)

    2013-02-01

    Purpose: To report the clinical outcomes of children with revised stage I clear cell sarcoma of the kidney (CCSK) using the National Wilms Tumor Study Group (NWTS)-5 staging criteria after multimodality treatment on NWTS 1-5 protocols. Methods and Materials: All CCSK patients enrolled in the National Wilms Tumor Study Group protocols had their pathology slides reviewed, and only those determined to have revised stage I tumors according to the NWTS-5 staging criteria were included in the present analysis. All patients were treated with multimodality therapy according to the NWTS 1-5 protocols. Results: A total of 53 children were identified as having stage I CCSK. All patients underwent primary surgery with radical nephrectomy. The chemotherapy regimens used were as follows: regimen A, C, F, or EE in 4 children (8%); regimen DD or DD4A in 33 children (62%); regimen J in 4 children (8%); and regimen I in 12 children (22%). Forty-six patients (87%) received flank radiation therapy (RT). Seven children (13%) did not receive flank RT. The median delay between surgery and the initiation of RT was 9 days (range, 3-61). The median RT dose was 10.8 Gy (range, 10-36). The flank RT doses were as follows: 10.5 or 10.8 Gy in 25 patients (47%), 11-19.9 Gy in 2 patients (4%), 20-29.9 Gy in 9 patients (17%), and 30-40 Gy in 10 patients (19%). The median follow-up for the entire group was 17 years (range, 2-36). The relapse-free and cancer-specific survival rate was 100% at the last follow-up examination. Conclusions: The present results have demonstrated that children with revised stage I CCSK using the NWTS-5 staging criteria have excellent survival rates despite the use of varying RT doses and chemotherapy regimens in the NWTS 1-5 protocols.

  1. Molecular analysis of endothelial progenitor cell (EPC) subtypes reveals two distinct cell populations with different identities

    E-Print Network [OSTI]

    Medina, Reinhold J.; O'Neill, Christina L.; Sweeney, Mark; Guduric-Fuchs, Jasenka; Gardiner, Tom A.; Simpson, David A.; Stitt, Alan W.

    2010-05-13

    products were resolved by 2% agarose gel electrophoresis. Real time RT-PCR Quantitative real time RT-PCR reactions were performed in a 10 ?l volume containing 2 ?l of 1:15 diluted cDNA template, 0.5 ?M of sense and anti-sense primers (Invit- rogen), and 5... stepwise fashion (Step 1: 500 volts, 1 mA, 5 watts(W) and 5 volt hours (Vhrs); step 2: 3500 volts, 1 mA, 5 W and 5200 Vhrs; and step 3: 3000 volts, 1 mA, 5 W and 3500 Vhrs). After IEF, reduction and alkylation of thiol groups was performed by immersing...

  2. Instabilities and Mixing in SN 1993J

    E-Print Network [OSTI]

    K. Iwamoto; T. R. Young; N. Nakasato; T. Shigeyama; K. Nomoto; I. Hachisu; H. Saio

    1997-01-15

    Rayleigh-Taylor (R-T) instabilities in the explosion of SN 1993J are investigated by means of two-dimensional hydrodynamical simulations. It is found that the extent of mixing is sensitive to the progenitor's core mass and the envelope mass. Because the helium core mass (3 - 4 \\ms) is smaller than that of SN 1987A, R-T instabilities at the He/C+O interfaces develop to induce a large scale mixing in the helium core, while the instability is relatively weak at the H/He interface due to the small envelope mass. The predicted abundance distribution, in particular the amount of the \

  3. Enhanced Radiation Tolerance of Ceramic Thin Films by Nano-structural Design 

    E-Print Network [OSTI]

    Jiao, Liang

    2015-04-28

    -dep ZrN film, (f) RT-dep/rad ZrN film, (g) 500-dep ZrN film, (h) 500-dep/rad ZrN film. ................................................................ 88 Figure 16 (a1) Bright field TEM image of RT-dep/rad ZrN with arrows indicating moiré fringes..., (d) Dark-field image of the MgO multilayer after irradiation, (e) MgO grain size in the thin layer before irradiation, (f) MgO grain size in the thin layer after irradiation, (g) MgO grain size in the thick layer before irradiation, (h) MgO grain...

  4. Phase I Three-Dimensional Conformal Radiation Dose Escalation Study in Newly Diagnosed Glioblastoma: Radiation Therapy Oncology Group Trial 98-03

    SciTech Connect (OSTI)

    Tsien, Christina Moughan, Jennifer; Michalski, Jeff M.; Gilbert, Mark R.; Purdy, James; Simpson, Joseph; Kresel, John J.; Curran, Walter J.; Diaz, Aidnag; Mehta, Minesh P.

    2009-03-01

    Purpose: To evaluate in a Phase I trial the feasibility and toxicity of dose-escalated three-dimensional conformal radiotherapy (3D-CRT) concurrent with chemotherapy in patients with primary supratentorial glioblastoma (GBM). Methods and Materials: A total of 209 patients were enrolled. All received 46 Gy in 2-Gy fractions to the first planning target volume (PTV{sub 1}), defined as the gross tumor volume (GTV) plus 1.8 cm. A subsequent boost was given to PTV{sub 2}, defined as GTV plus 0.3 cm. Patients were stratified into two groups (Group 1: PTV{sub 2} <75 cm{sup 3}; Group 2: PTV{sub 2} {>=}75 cm{sup 3}). Four RT dose levels were evaluated: 66, 72, 78, and 84 Gy. Carmustine 80 mg/m{sup 2} was given during RT, then every 8 weeks for 6 cycles. Pretreatment characteristics were well balanced. Results: Acute and late Grade 3/4 RT-related toxicities were no more frequent at higher RT dose or with larger tumors. There were no dose-limiting toxicities (acute Grade {>=}3 irreversible central nervous system toxicities) observed on any dose level in either group. On the basis of the absence of dose-limiting toxicities, dose was escalated to 84 Gy in both groups. Late RT necrosis was noted at 66 Gy (1 patient), 72 Gy (2 patients), 78 Gy (2 patients), and 84 Gy (3 patients) in Group 1. In Group 2, late RT necrosis was noted at 78 Gy (1 patient) and 84 Gy (2 patients). Median time to RT necrosis was 8.8 months (range, 5.1-12.5 months). Median survival in Group 1 was 11.6-19.3 months. Median survival in Group 2 was 8.2-13.9 months. Conclusions: Our study shows the feasibility of delivering higher than standard (60 Gy) RT dose with concurrent chemotherapy for primary GBM, with an acceptable risk of late central nervous system toxicity.

  5. Blockade of chemokine-induced signalling inhibits CCR5-dependent HIV infection in vitrowithout blocking gp120/CCR5 interaction

    E-Print Network [OSTI]

    Grainger, David J.; Lever, Andrew M. L.

    2005-04-04

    the Potts Mini RT assay as previously described [32]. THP-1 cells were differentiated prior to infection with hydrocortisone and PMA in 8-well chamber slides. Sixteen hours prior to infection, TNF? was added (100 ng/ml). Twelve hours later, the medium... of potent anti-HIV agents, are targeted at the HIV coreceptor fusin/CXCR-4. Antiviral Res 1997, 35:147-156. 32. Potts BJ: 'Mini' reverse transcriptase (RT) assay. In Techniques in HIV research Edited by: Aldovini A, Walker BD. New York: Stockton Press; 1990...

  6. Role of Salvage Radiation Therapy for Patients With Relapsed or Refractory Hodgkin Lymphoma Who Failed Autologous Stem Cell Transplant

    SciTech Connect (OSTI)

    Goda, Jayant S.; Massey, Christine; Kuruvilla, John; Gospodarowicz, Mary K.; Wells, Woodrow; Hodgson, David C.; Sun, Alexander; Keating, Armand; Crump, Michael; Tsang, Richard W.

    2012-11-01

    Purpose: To analyze, through chart review, the efficacy of salvage radiation therapy (sRT) for relapsed or progressive Hodgkin lymphoma (HL) patients who failed autologous stem cell transplant (ASCT). Patients and Methods: Among 347 patients with recurrent/refractory HL who received ASCT from 1986-2006, 163 had post-ASCT progression or relapse. Of these, 56 received sRT and form the basis of this report. Median age at sRT was 30 years (range, 17-59 years). Disease was confined to lymph nodes in 27 patients, whereas 24 had both nodal and extranodal disease. Salvage radiation therapy alone was given in 34 patients (61%), and sRT plus chemotherapy was given in 22 (39%). Median interval from ASCT to sRT was 0.8 years (range, 0.1-5.6 years). The median dose was 35 Gy (range, 8-40.3 Gy). The sRT technique was extended-field in 14 patients (25%) and involved-field in 42 (75%). Results: The median follow-up from sRT was 31.3 months (range, 0.2-205.5 months). Overall response rate was 84% (complete response: 36%; partial response: 48%). The median overall survival was 40.8 months (95% confidence interval, 34.2-56.3 months). The 5-year overall survival was 29% (95% confidence interval, 14%-44%). The 2-year progression-free survival (PFS) was 16%; the 2-year local PFS was 65%, whereas the 2-year systemic PFS was 17%. The 1-year PFS was higher in patients in whom all diseased sites were irradiated (49%) compared with those in whom only the symptomatic site was treated (22%, P=.07). Among 20 alive patients, 5 were disease free (at 6.4, 6.8, 7.4, 7.9, and 17.1 years). Conclusion: For patients with HL who fail ASCT, a selective use of RT provides a durable local control rate of 65% at 2 years and should be considered as part of the standard management plan for the palliation of incurable HL. Occasionally irradiation of truly localized disease can lead to long-term survival.

  7. Verified and Validated Calculation of Unsteady Overdriven Hydrogen-Air Detonation

    E-Print Network [OSTI]

    «« + · ,, u ,, e + u · u 2 « + (pI - ) · u + q « = 0, t ` Yi ´ + · ` uYi + ji ´ = Mi i, p = RT NX i=1 Yi Mi , e = e ` T, Yi ´ , i = i ` T, Yi ´ , ji = NX k=1 k=i MiDikYk M yk yk + 1 - Mk M ! p p ! - DT i T T , = µ ,, u + (u) T - 2 3 ( · u) I « , q = -kT + NX i=1 jihi - RT NX i=1 DT i Mi yi yi + 1 - Mi M ! p p

  8. Verified and Validated Inviscid and Viscous Calculation of Hydrogen-Air Detonation

    E-Print Network [OSTI]

    «« + · ,, u ,, e + u · u 2 « + (pI - ) · u + q « = 0, t ` Yi ´ + · ` uYi + ji ´ = Mi i, p = RT NX i=1 Yi Mi , e = e ` T, Yi ´ , i = i ` T, Yi ´ , ji = NX k=1 k=i MiDikYk M yk yk + 1 - Mk M ! p p ! - DT i T T , = µ ,, u + (u) T - 2 3 ( · u) I « , q = -kT + NX i=1 jihi - RT NX i=1 DT i Mi yi yi + 1 - Mi M ! p p

  9. Mid-American Review of Sociology, Volume 11, Number 1 (SPRING, 1986): Front Matter

    E-Print Network [OSTI]

    1986-04-01

    organization. This work is based on an historical analysis of organizational change in one of the largest steel manufac­ turing corporations in the United States. ". JOHN F. WE~SH rec~iv~9hi~~. ~h.D.".irqxp _Qkl.~~rt:l~-. State ~l... organization. This work is based on an historical analysis of organizational change in one of the largest steel manufac­ turing corporations in the United States. ". JOHN F. WE~SH rec~iv~9hi~~. ~h.D.".irqxp _Qkl.~~rt:l~-. State ~l...

  10. Treatment and Outcomes in Patients With Primary Cutaneous B-Cell Lymphoma: The BC Cancer Agency Experience

    SciTech Connect (OSTI)

    Hamilton, Sarah N.; Wai, Elaine S.; Tan, King; Alexander, Cheryl; Gascoyne, Randy D.; Connors, Joseph M.

    2013-11-15

    Purpose: To review the treatment and outcomes of patients with primary cutaneous B-cell lymphoma (CBCL). Methods and Materials: Clinical characteristics, treatment, and outcomes were analyzed for all patients referred to our institution from 1981 through 2011 with primary CBCL without extracutaneous or distant nodal spread at diagnosis (n=136). Hematopathologists classified 99% of cases using the World Health Organization-European Organization for Research and Treatment of Cancer (WHO-EORTC) guidelines. Results: Median age at diagnosis was 62 years. Classification was 18% diffuse large B-cell leg-type (DLBCL-leg), 32% follicle center (FCCL), 45% marginal zone (MZL), and 6% nonclassifiable (OTHER). Of the 111 subjects with indolent lymphoma (FCCL, MZL, OTHER), 79% received radiation alone (RT), 11% surgery alone, 3% chemotherapy alone, 4% chemotherapy followed by RT, and 3% observation. Following treatment, 29% of subjects relapsed. In-field recurrence occurred in 2% treated with RT and in 33% treated with surgery alone. Of the 25 subjects with DLBCL-leg, 52% received chemotherapy followed by RT, 24% chemotherapy, 20% RT, and 4% surgery alone. Seventy-nine percent received CHOP-type chemotherapy (cyclophosphamide, doxorubicin or epirubicin, vincristine, prednisone), 47% with rituximab added. Overall and disease-specific survival and time to progression at 5 years were 81%, 92%, and 69% for indolent and 26%, 61%, and 54% for DLBCL-leg, respectively. On Cox regression analysis of indolent subjects, RT was associated with better time to progression (P=.05). RT dose, chemo, age >60 y, and >1 lesion were not significantly associated with time to progression. For DLBCL-leg, disease-specific survival at 5 years was 100% for those receiving rituximab versus 67% for no rituximab (P=.13). Conclusions: This review demonstrates better outcomes for indolent histology compared with DLBCL-leg, validating the prognostic utility of the WHO-EORTC classification. In the indolent group, RT was associated with 98% local control. DLBCL-leg is a more aggressive disease; the excellent results in the rituximab group suggest it has an important role in management.

  11. Linear study of Rayleigh-Taylor instability in a diffusive quantum plasma

    SciTech Connect (OSTI)

    Momeni, Mahdi

    2013-08-15

    The linear Rayleigh-Taylor (RT) instability in an incompressible quantum plasma is investigated on the basis of quantum magnetohydrodynamic model. It is shown that the occurrence of RT instability depends on density-temperature inhomogeneity (characteristic lengths) on one hand, and the system layer size on the other. It is also observed that the combined effects of external magnetic field, diffusivity, and quantum pressure significantly modify the dispersion properties of system in both the parallel and perpendicular directions. For any case, the imaginary and real parts of dispersion relation are presented and the possibility and conditions for the instability growth rate are discussed.

  12. Transformation and regeneration of Texas cotton 

    E-Print Network [OSTI]

    Luo, Jinhua

    2000-01-01

    probed with nos-nprII and prl probes. Pre-hybridization was carried out overnight and hybridization at 65 C for 1-3 days. The radioactive probe bound to the membrane was visualized by autoradiography after 3-7 days exposure to x- film in -80 C...-PCR Total RNA was extracted from Tl progeny using a kit (RNeasy Plant Mini-Kit, Qiagen), and RT-PCR performed using the primers for nos-nprII and the Access RT- PCR kit (Promega) according to the manufacturer's recommendations. The Sequence for nos-npr...

  13. A frequency referenced digitally self-tuned approach to monolithic filter design 

    E-Print Network [OSTI]

    Fincher, Jeffrey Louis

    1984-01-01

    comparator topology is shown in Figure 4. The test 1'requency clock in- pui, to the phase comparator is a square wave which is exactly in phase with the test input, to the filter during tuning. V'hen the output of the filter is applied to the phase... -/ ? 25~zo of Rt change in resistance about the nominal value of 3Rt/4 v:hich should be adequate to adjust for process varial ious. parasitics. and GB effects in many applications. This is certainly not the onlk tvay to control an RC product with a...

  14. The second virial coefficient of the major atmospheric gases at low temperatures 

    E-Print Network [OSTI]

    Claitor, Lilburn Carroll

    1948-01-01

    that encounters between molecules are rare, the only forces acting on the molecules are those of the retaining vessel. The behavior of a gas under such conditions 's expressed oy the ideal gas law, PV = RT where P is pressure, V is volume, R is the universal..., and, so long as encounters between three or more molecules are rare, the behavior of the gas can be expressed by PV = RT (I + Bj)) where') is the molal density and B is the second viriai coefficient. Th1s equation can also be written, approxi...

  15. Modified Hamiltonian formalism for Regge Teitelboim Cosmology

    E-Print Network [OSTI]

    Pinaki Patra; Md. Raju; Gargi Manna; Jyoti Prasad Saha

    2014-12-10

    The Ostrogradski approach for the Hamiltonian formalism of higher derivative theory is not satisfactory because of the reason that the Lagrangian cannot be viewed as a function on the tangent bundle to coordinate manifold. In this article, we have used an alternative approach which leads directly to the Lagrangian which, being a function on the tangent manifold, gives correct equation of motion; no new coordinate variables need to be added. This approach can be directly used to the singular (in Ostrogradski sense) Lagrangian. We have used this method for the Regge Teitelboim (RT) minisuperspace cosmological model. We have obtained the Hamiltonian of the dynamical equation of the scale factor of RT model.

  16. Steady-State Electrical Conduction in the Periodic Lorentz Gas

    E-Print Network [OSTI]

    N. I. Chernov; G. L. Eyink; J. L. Lebowitz; Ya. G. Sinai

    1993-02-08

    We study nonequilibrium steady states in the Lorentz gas of periodic scatterers when an external field is applied and the particle kinetic energy is held fixed by a ``thermostat'' constructed according to Gauss' principle of least constraint (a model problem previously studied numerically by Moran and Hoover). The resulting dynamics is reversible and deterministic, but does not preserve Liouville measure. For a sufficiently small field, we prove the following results: (1) existence of a unique stationary, ergodic measure obtained by forward evolution of initial absolutely continuous distributions, for which the Pesin entropy formula and Young's expression for the fractal dimension are valid; (2) exact identity of the steady-state thermodyamic entropy production, the asymptotic decay of the Gibbs entropy for the time-evolved distribution, and minus the sum of the Lyapunov exponents; (3) an explicit expression for the full nonlinear current response (Kawasaki formula); and (4) validity of linear response theory and Ohm's transport law, including the Einstein relation between conductivity and diffusion matrices. Results (2) and (4) yield also a direct relation between Lyapunov exponents and zero-field transport (=diffusion) coefficients. Although we restrict ourselves here to dimension $d=2,$ the results carry over to higher dimensions and to some other physical situations: e.g. with additional external magnetic fields. The proofs use a well-developed theory of small perturbations of hyperbolic dynamical systems and the method of Markov sieves, an approximation of Markov partitions. In our context we discuss also the van Kampen objection to linear response theory, which, we point out, overlooks the ``structural stability'' of strongly hyperbolic flows.

  17. Isoform discovery by targeted cloning,`deep-

    E-Print Network [OSTI]

    Roth, Frederick

    Isoform discovery by targeted cloning,`deep- well' pooling and parallel sequencing Kourosh Salehi transcriptase (RT)- PCR recombinational cloning,`deep-well' pooling and a next- generation sequencing platform and demonstrate the ORFeome primer pairs ORFeome minipool arrays Single colony isolates `Deep wells' of pooled

  18. Three Hours Mathematical formula books and statistical tables are to be provided

    E-Print Network [OSTI]

    Lionheart, Bill

    MATH48191 Three Hours Mathematical formula books and statistical tables are to be provided and log return rt at time t in terms of the price Pt > 0 at time t and the price Pt-1 > 0 at time t - 1

  19. Three Hours Mathematical formula books and statistical tables are to be provided

    E-Print Network [OSTI]

    Lionheart, Bill

    MATH68191 Three Hours Mathematical formula books and statistical tables are to be provided and log return rt at time t in terms of the price Pt > 0 at time t and the price Pt-1 > 0 at time t - 1

  20. Mathematical formula books and statistical tables are to be provided THE UNIVERSITY OF MANCHESTER

    E-Print Network [OSTI]

    Lionheart, Bill

    MATH38191 Two Hours Mathematical formula books and statistical tables are to be provided > 0 be the price of an asset at time t, t N = {1, 2, . . .}. Define the (net) return Rt at time? What is the implication on asset prices? [2+2 marks] (d) Under the random walk hypothesis with normal

  1. NOAA TECHNICAL REPORTS National Marine Fisheries Service, Circulars

    E-Print Network [OSTI]

    ,' obtaIn N! I"nl.,. otherwi e not,'dl from [)~, Technical Information Division, Environmental Science Research, Pesticide Field Station. (;ulf Hrp.'ze Fla., fiscal year 1969 By the Laboratory staff August 1970 of Cllmlllll'rt'lal Fi,heries, fiscal year 1969. By Division of EconomIC nesl'arch, Apnl 1470, I + 29 p I~ figs

  2. jean-philippe.babau@insa-lyon.fr Dpartement Informatique INSA de Lyon

    E-Print Network [OSTI]

    Brest, Université de

    jean-philippe.babau@insa-lyon.fr Département Informatique INSA de Lyon SA-RT Structured Analysis for Real-Time Jean-Philippe Babau Département Informatique INSA Lyon jean-philippe.babau@insa-lyon.fr Département Informatique INSA de Lyon #12;jean-philippe.babau@insa-lyon.fr Département Informatique INSA de

  3. Eur. J. Phycol. (2006), 41: 97104 Simple and rapid RNA extraction from freeze-dried tissue

    E-Print Network [OSTI]

    Teixeira, Sara

    2006-01-01

    , macroarray hybridization, RT-PCR analysis, and cDNA library construction. This is often a challenge://www.marine-genomics- europe.org/index.php). In addition, there is a long history of research using fucoid zygotes as a model of these goals will require the development of high-throughput and cost-effective methods of sample processing

  4. NO Computer Work while instrument is in use. Multitasking will cause the current run to crash, and all data will Please NO FLASH DRIVES.

    E-Print Network [OSTI]

    Richardson, David

    Reminders NO Computer Work while instrument is in use. Multitasking will cause the current run: If you mistakenly run Relative Quantification instead of Absolute Quantification SDS 2.4 is available://discovery.genome.duke.edu/express/projects/create To access the RT-PCR Instrument Sign-Up Calendar 1. Go to: http://osforms.genome.duke.edu/ 2. Enter your Net

  5. Physics 123 Equations Winter 2012 Semester I. Equations you should know by heart (but I'm giving them to you anyway)

    E-Print Network [OSTI]

    Hart, Gus

    = Qc/|W| Heat pump: COPHP = Qh/|W| Carnot: emax = (Th ­ Tc)/Th; COPR,max = Tc/(Th ­ Tc); COPHP,max = Th 2 + gy2 (Bernoulli's Law, from energy conservation) Thermodynamics PV = nRT = NkBT Equipartition exerted by balls (atoms) from change in momentum = area under P-V curve First Law: Eint = Qadded + Won

  6. American Mineralogist, Volume 95, pages 104111, 2010 0003-004X/10/0001104$05.00/DOI: 10.2138/am.2010.3241 104

    E-Print Network [OSTI]

    Thompson, Richard Maxwell

    is composed solely of corner-sharing SiO4 silica tetrahedra, a primary building block of many of the Earth interactions in the compression of quartz RichaRd M. ThoMpson* and RobeRT T. downs Department of Geosciences-O interactions in the compression of quartz. Quartz has eight crystallographically nonequivalent tetrahedra, one

  7. Non-Perturbative Contribution to the Thrust Distribution in e+ e- Annihilation.

    E-Print Network [OSTI]

    Davison, R A; Webber, Bryan R

    The perturbative expansion of the normalised thrust cross section has the general form R(t) = 1 + ?¯sR1(t) + ?¯ 2 sR2(t) + ?¯ 3 sR3(t) + . . . , (6) where R1 (t) is the leading order (LO) coefficient, R2 (t) is the next-to-leading order (NLO) coefficient, R3 (t...

  8. Transport and superconducting properties of RNi2B2C (R=Y, Lu) single crystals 

    E-Print Network [OSTI]

    Rathnayaka, KDD; Bhatnagar, AK; Parasiris, A.; Naugle, Donald G.

    1997-01-01

    linearly with temperature near room temperature (RT) but shows nearly quadratic behavior in temperature at low temperatures. The YNi2B2C and LuNi2B2C single-crystal samples exhibit large transverse magnetoresistance (approximate to 6-8% at 45 kOe) in the ab...

  9. WHAT'S GRAPHENE? Mono or few layers of sp2 bonded

    E-Print Network [OSTI]

    Mellor-Crummey, John

    WHAT'S GRAPHENE? · Mono or few layers of sp2 bonded carbon atoms in a honeycomb lattice 105cm2/Vs at RT. 1 Due to its unique transport properties, graphene is suitable for implementation sampling (EOS) timeresolved spectroscopy to optically pump and THz probe exfoliated graphene ribbons (GR

  10. Idaho National Engineering and Environmental Laboratory Low Permeation Liner for H2

    E-Print Network [OSTI]

    . "Conformable" Composite Tanks #12;Polymer Liners are Proposed for Composite H2 Tanks Examples: Nylon 6, XLPE "Conformable" Composite Tanks #12;INEEL's Active Electrochemical Diffusion Barrier Approach Electron-conductive polymer electrodes & proton-conductive electrolyte E = -G/nF = RT/nF {ln[ PH2 (ref) /PH2 (sub

  11. Approach for the 3D-alignment in micro-and nano-scale assembly processes

    E-Print Network [OSTI]

    Boyer, Edmond

    as known from the macro- and meso-scale. Although a lot of similarities exist for both regimes, micro to the f meso-scale p ly machine by human rt and the h her in positi owever, dep an be used outcome h

  12. SuStainability 02 University of Calgary

    E-Print Network [OSTI]

    Calgary, University of

    SuStainability RepoRt 2012-2013 #12;02 University of Calgary Table of Contents What is Sustainability? The University of Calgary Sustainability Policy defines sustainability as articulated: "Sustainable development is development that meets the needs of the present without compromising the ability

  13. Coherent patterns of ice-rafted debris deposits in the Nordic regions during the last glacial (10^60 ka)

    E-Print Network [OSTI]

    ^60 ka) Mary Elliot aYbY *, Laurent Labeyrie bYc , Trond Dokken d , Sandrine Manthe¨ e a LDEO, Rt. 9W-845-365-8768; Fax: +1-845-365-8165. E-mail address: mary@ldeo.columbia.edu (M. Elliot). Earth and Planetary Science

  14. United States Department of the Interior, Fred A , Seaton, Se.

    E-Print Network [OSTI]

    . Red mouth disease in rainbow trout. !! Headquarters: Eastern Fish Disease Lab" Leetown (PSUL' In and around the rT ,.. ,:rtl r" ,.", #12;be inflamed and even eroded as in the" red mouth" disease in rainbow producing deep necrotic cra- ters lined with red or grayish muscle tissue. In some instances these lesions

  15. Evidence for new targets and synergistic effect of metronomic celecoxib/fluvastatin combination in pilocytic astrocytoma

    E-Print Network [OSTI]

    Mercurio, Sandy; Padovani, Laetitia; Colin, Carole; Carré, Manon; Tchoghandjian, Aurélie; Scavarda, Didier; Lambert, Sally; Baeza-Kallee, Nathalie; Fernandez, Carla; Chappé, Céline; André, Nicolas; Figarella-Branger, Dominique

    2013-05-20

    , and IQGAP1) are targets for available drugs: fluvastatin and/or celecoxib. Results Quantification by RT-Q-PCR of the expression of these genes was performed in a series of 51 pilocytic astrocytomas and 10 glioblastomas: they were all significantly...

  16. PHYSICAL REVIEW B VOLUME 43, NUMBER 6 15 FEBRUARY 1991-II Nonlinear feedback oscillations in resonant tunneling through double barriers

    E-Print Network [OSTI]

    Presilla, Carlo

    ) We analyze the dynamical evolution of the resonant tunneling of an ensemble of electrons through the dynamics of RT of ballistic electrons in the presence of the potential created by the charge trapped within in resonant tunneling through double barriers C. Presilla Scuola del Dottorato di Ricerca in Fisica dell

  17. Variation in universal temperature dependence of biological rates

    E-Print Network [OSTI]

    Huey, Raymond B.

    -activity tempera- ture. In fact, he could predict air temper- ature to within 1 °C, merely by measuring ant walking relation- ships (5, 6). They argued (5, 6) the thermal sensitivity of diverse activities can be de- scribed- ical traits (n = 112) in 309 species (plants, microbes, animals) from land, sea, and air. For RT

  18. Overexpression of the JmjC histone demethylase KDM5B in human carcinogenesis: involvement in the proliferation of cancer cells through the E2F/RB pathway

    E-Print Network [OSTI]

    Hayami, Shinya; Yoshimatsu, Masanori; Veerakumarasivam, Abhimanyu; Unoki, Motoko; Iwai, Yukiko; Tsunoda, Tatsuhiko; Field, Helen I.; Kelly, John D.; Neal, David E.; Yamaue, Hiroki; Ponder, Bruce A. J.; Nakamura, Yusuke; Hamamoto, Ryuji

    2010-03-13

    . We investigated the role of KDM5B, a JmjC histone demethylase, in human carcinogenesis. Quantitative RT-PCR and microarray analyses were used to examine the expression profiles of histone demethylases in clinical tissue samples. We also examined...

  19. Nuclear measurements of fuel-shell mix in inertial confinement fusion implosions at OMEGAa...

    E-Print Network [OSTI]

    to small-scale, turbulent eddies and atomic-level mixing of the high-density compressed shell with hot, low of Rayleigh-Taylor RT instability growth at a density interface leads to small-scale, turbulent eddies to understand hydro- dynamic instabilities and mix has been ongoing for many decades, due in large part

  20. Volume10. number 1 CHEMICAL PHYSICS LErrERs 1 July 1971 MOLECULAR RAMSAUER-TOWNSEND EFFECT

    E-Print Network [OSTI]

    Miller, William H.

    energy %?K. Bose statistics plays a crucial role in the existence of the RT effect; i.e., it gannet occur LOW ENERGY 4He-4He SCATTERING * W.H. MILLER ** InofzranicMatenizlsRestnrch Division. Lawrence May 1971 It is shown that a Pamsauer-Townsend effect is possible in very low energy (FJ2°K) collisions

  1. PLANT DIAGNOSTIC LABORATORY The Plant Diagnostic Laboratory is a

    E-Print Network [OSTI]

    Goodman, Robert M.

    Lilac - Fungus and Mold Identification Green - Plant Identification Gray - Nematode Soil Assay 2 Identification · Fungus and Mold Identification · Nematode Assays · Acremonium Endophyte Screening · Fungicide Resistance Screening · Other Services Available by Contract Take the NJ Turnpike to Exit 9. Take Rt. 18 North

  2. Generation of Full-Length cDNA Library

    E-Print Network [OSTI]

    Chuong, Cheng-Ming

    Generation of Full- Length cDNA Library from Single Human Prostate Cancer Cells BioTechniques 27 are performed on fixed and per- meabilized cells. Subsequent RT-PCR generates full-length cDNA libraries. Flowchart of current method for generating a full-length cDNA library from single cells. Cell fixation

  3. Three-Dimensional Dust Radiative Transfer

    E-Print Network [OSTI]

    Baes, Maarten

    data using 3D dust RT codes. We end with an outlook on the bright future of this field. 63 Annu such as the Solar System (Hoppe et al. 2010), comets and meteoroids (K¨uppers et al. 2005), substellar atmospheres

  4. Physics Contribution Nanoparticle-Based Brachytherapy Spacers for

    E-Print Network [OSTI]

    Sridhar, Srinivas

    Physics Contribution Nanoparticle-Based Brachytherapy Spacers for Delivery of Localized Combined of brachytherapy spacers for in situ release of drug eluting nanoparticles to provide tissue residence therapy to enhance the therapeutic ratio Purpose: In radiation therapy (RT), brachytherapy-inert source

  5. The Particle Therapy Cancer Research Institute is a member of

    E-Print Network [OSTI]

    Nova? To deliver a lower-cost, smaller, lighter, more energy efficient solution for Proton Therapy without for commercial distribution at this time #12;Who is ProNova? ProNova has a strong History of Innovation Developed accessible to the cancer community #12;ProNova Design Principles - Workflow Precision, Productivity, Cost RT

  6. 2011Columbia River Basin Fish and Wildlife Program

    E-Print Network [OSTI]

    2011Columbia River Basin Fish and Wildlife Program Costs Report AnnuAl RePoRt to the noRthWest Gove | Northwest Power & Conservation Council Document 2012-11 | September 2012 #12;FIsh & WIlDlIFe Costs ANNUAL REPORt tO thE NORthWESt GOvERNORS costs 08

  7. Human Based Cost from Persistent Homology for Bipedal Walking

    E-Print Network [OSTI]

    Ames, Aaron

    of California, Berkeley Texas A&M University Berkeley, CA 94720 College Station, TX 77843 {ramv in this question is the desire to quantify how human-like a certain domain breakdown truly is. Heel-LiftT Lift 46% Heel LiftToe-Lift [ , ]lh lt 19%17% [ , ]lh lt 18% Heel-StrikeToe-Strike [ ]lt[ , , ]lt rh rt Toe

  8. KV04: Baxter Mountain This route visits

    E-Print Network [OSTI]

    Reiter, Clifford A.

    11 KV04: Baxter Mountain General This route visits Baxter Mountain which is a short hike that has between Hurricane and Green Mountains. The hike is relatively short although there is a good elevation Description The trail begins on Rt9N directly across from Hurricane Mountain Road. From Keene Valley, go north

  9. Materials Science and Engineering A 527 (2010) 61026104 Contents lists available at ScienceDirect

    E-Print Network [OSTI]

    Gubicza, Jenõ

    2010-01-01

    t A reduction of the stored energy in Cu processed by equal-channel angular pressing was observed after 4 years of storage at room temperature. It was found that the decrease of stored energy was most probably caused temperature (RT) partially recovered and/or recrystallized during storage at the temperature of processing

  10. TWOZONE USERS MANUAL

    E-Print Network [OSTI]

    Gadgil, Ashok J.

    2010-01-01

    f-' () 'tl Ql~ c:: rt Ql fURNACE EffICIENCW- FUEL USE- GAS-~ l'P . ::J"3 Ql K8TU l'P FURNACE fUEL- NATURAL GAS. ::JThe heat sources are the furnace, solar heat gain (through

  11. TWOZONE USERS MANUAL

    E-Print Network [OSTI]

    Gadgil, Ashok J.

    2008-01-01

    f-' () 'tl Ql~ c:: rt Ql fURNACE EffICIENCW- FUEL USE- GAS-~ l'P . ::J"3 Ql K8TU l'P FURNACE fUEL- NATURAL GAS. ::JThe heat sources are the furnace, solar heat gain (through

  12. Extended Hartree-Fock study of the single-particle potential: the nuclear symmetry energy, nucleon effective mass, and folding model of the nucleon optical potential

    E-Print Network [OSTI]

    Loan, Doan Thi; Khoa, Dao T

    2015-01-01

    The nucleon mean-field potential has been thoroughly investigated in an extended Hartree-Fock (HF) calculation of nuclear matter (NM) using the CDM3Y3 and CDM3Y6 density dependent versions of the M3Y interaction. The single-particle (s/p) energies of nucleons in NM are determined according to the Hugenholtz-van Hove theorem, which gives rise naturally to a rearrangement term (RT) of the s/p potential at the Fermi momentum. Using the RT obtained exactly at the different NM densities and neutron-proton asymmetries, a consistent method is suggested to take into account effectively the momentum dependence of the RT of the s/p potential within the standard HF scheme. To obtain a realistic momentum dependence of the nucleon optical potential (OP), the high-momentum part of the s/p potential was accurately readjusted to reproduce the observed energy dependence of the nucleon OP over a wide range of energies. The impact of the RT and momentum dependence of the s/p potential on the density dependence of the nuclear sy...

  13. Time-Dependent Nuclear Measurements of Mix in Inertial Confinement Fusion J. R. Rygg, J. A. Frenje, C. K. Li, F. H. Seguin, and R. D. Petrasso*

    E-Print Network [OSTI]

    Time-Dependent Nuclear Measurements of Mix in Inertial Confinement Fusion J. R. Rygg, J. A. Frenje (Received 19 January 2007; published 24 May 2007) The first time-dependent nuclear measurements of turbulent reaction to proceed. The time necessary for Rayleigh-Taylor (RT) growth to induce mix delays peak nuclear

  14. Markov Decision Andrew Schaefer

    E-Print Network [OSTI]

    Grossmann, Ignacio E.

    maximize expected profit over the next year Simplifying Assumptions Instantaneous delivery No backlogging is for j units holding cost sales income amount sold #12;13 4. Rewards: rt(st,at) Expected immediate net income associated with taking a particular action, in a particular state, in a particular epoch analogous

  15. Honorary graduates of the University of Southampton His Royal Highness The Prince Philip, Duke of Edinburgh KG Doctor of Science (1967)

    E-Print Network [OSTI]

    Molinari, Marc

    1967-01-01

    W Buckley Doctor of Science (2012) Dame Jocelyn Bell Burnell FRS Doctor of Science (2008) #12 Doctor of Science (1992) James Cameron Doctor of the University (2004) The Rt Revd Harry James Carpenter (2008) Sir David Cox Doctor of Science (2007) David John Moore Cornwell (John Le Carré) Doctor

  16. Adaptation to Ephemeral Habitat May Overcome Natural Barriers and Severe Habitat Fragmentation in a Fire-

    E-Print Network [OSTI]

    Taylor, Sabrina

    in a Fire- Dependent Species, the Bachman's Sparrow (Peucaea aestivalis) Blain Cerame1 , James A. Cox2 , Robb T. Brumfield3 , James W. Tucker4¤ , Sabrina S. Taylor1 * 1 School of Renewable Natural Resources diversity in highly fragmented habitat. Citation: Cerame B, Cox JA, Brumfield RT, Tucker JW, Taylor SS (2014

  17. Cape Fear River Basin Action Plan for Migratory Fish

    E-Print Network [OSTI]

    Cape Fear River Basin Action Plan for Migratory Fish C ape Fear Rive r Pa rt n er ship developed with a vision of a healthy Cape Fear River for fish and people. The partnership's mission is to restore and demonstrate the value of robust, productive, and self-sustaining stocks of migratory fish in the Cape Fear

  18. Early Clinical Outcomes Using Proton Radiation for Children With Central Nervous System Atypical Teratoid Rhabdoid Tumors

    SciTech Connect (OSTI)

    De Amorim Bernstein, Karen; Sethi, Roshan; Trofimov, Alexei; Zeng, Chuan [Department of Radiation Oncology, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts (United States); Fullerton, Barbara [Department of Otology and Laryngology, Massachusetts Eye and Ear Infirmary, Harvard Medical School, Boston, Massachusetts (United States)] [Department of Otology and Laryngology, Massachusetts Eye and Ear Infirmary, Harvard Medical School, Boston, Massachusetts (United States); Yeap, Beow Y. [Department of Medicine, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts (United States)] [Department of Medicine, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts (United States); Ebb, David [Department of Pediatric Hematology-Oncology, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts (United States)] [Department of Pediatric Hematology-Oncology, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts (United States); Tarbell, Nancy J.; Yock, Torunn I. [Department of Radiation Oncology, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts (United States); MacDonald, Shannon M., E-mail: smacdonald@partners.org [Department of Radiation Oncology, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts (United States)

    2013-05-01

    Purpose: Atypical teratoid/rhabdoid tumor (AT/RT) is an uncommon and aggressive tumor that often affects infants. Irradiation improves survival but has traditionally been avoided in patients under the age of 3 due to the increasing risk of neurocognitive side effects. We report the first cohort of AT/RT patients treated with proton therapy. Methods and Materials: All patients with AT/RT treated at Massachusetts General Hospital (MGH) Frances H. Burr Proton Beam Therapy Benter between July 2004 and November 2011 were included in this study. All patients were treated with 3-dimensional conformal proton therapy (3D-CPT). Results: Ten consecutive patients of a median 2.3 years of age and with a median follow-up of 27.3 months (range, 11.3-99.4 months) were identified. Two patients suffered distant relapse; 1 patient was successfully treated with involved field irradiation and chemotherapy, while the second patient died of disease. At last follow-up, 9 patients were alive without evidence of disease. Proton radiation demonstrated increasing sparing of the cerebrum, temporal lobe, cochlea, and hypothalamus. Conclusions: Initial clinical outcomes with proton therapy are favorable. The advantages of proton therapy are particularly suited to the treatment of AT/RT, a tumor that often requires irradiation treatment at an age when avoiding irradiation to healthy tissues is most desirable.

  19. Reduction of DNA contamination in RNA samples for reverse transcription-polymerase chain reaction using selective precipitation by compaction agents.

    E-Print Network [OSTI]

    Fox, George

    Reduction of DNA contamination in RNA samples for reverse transcription-polymerase chain reaction by reverse transcription-polymerase chain reaction (RT-PCR) is DNA contamination, which can produce artifactually increased mRNA concentration. Current methods to eliminate contaminating DNA can compromise

  20. PROPRIETARY MATERIAL. 2011 The McGraw-Hill Companies, Inc. Limited distribution permitted only to teachers and educators for course preparation. If you are a student using this Manual, you are using it without permission.

    E-Print Network [OSTI]

    Bahrami, Majid

    it without permission. 9-59 9-80E An ideal Stirling engine with air as the working fluid is consideredRT P 9-81 An ideal Stirling engine with air as the working fluid operates between specified pressure. The temperature of the source-energy reservoir, the amount of air contained in the engine, and the maximum air

  1. RELIABILITY COMPARISON MODELS FOR OFFSHORE WIND TURBINES (OWT)

    E-Print Network [OSTI]

    Bernstein, Joseph B.

    RELIABILITY COMPARISON MODELS FOR OFFSHORE WIND TURBINES (OWT) Yizhou Lu, T. M. Delorm, A. Christou of survivor functions R(t) of drive-trains, after 1 year of operation, between Offshore Wind Turbine (OWT) vs of the reliability of these 5 Types Surrogate failure rate data Onshore wind turbines (OT) 1-1.5MW CONCLUSIONS

  2. Comparison of the crystalline structure, morphology, and magnetic properties of -phase Mn/Cu3Au,,100... ultrathin films by varying the growth temperature

    E-Print Network [OSTI]

    Lin, Minn-Tsong

    Comparison of the crystalline structure, morphology, and magnetic properties of -phase Mn/Cu3Au behaviors in the crystalline structure, morphology, and magnetism. RT-Mn films reveal apparent layer the last de- cade, the pure - and -phase Mn films are prepared by epitaxial growth on single-crystalline

  3. Probing Charge Dynamics in Low-Dimensional Systems Damion Campbell, Lionel Cohen and Jiufeng Tu*, The City College of New York, NY 10031

    E-Print Network [OSTI]

    Tu, Jiufeng J.

    .L. Ekinci et al. Phys. Rev. Lett. 82, 1518, 1999.) Figure 1. Evolution of R(T) for a series of Bi films of granular quench condensed Pb films in the mid-infrared region. (P. F. Henning et al. Phys. Rev. Lett. 83, 4880, 1999) Temperature Scaling Frequency Scaling )/,/(),,( /1 z BC TTkfRTBR h=Finite-Size Scaling

  4. ES2A7 -Fluid Mechanics Example Classes Model Answers to Example Questions (Set III)

    E-Print Network [OSTI]

    Thomas, Peter J.

    ES2A7 - Fluid Mechanics Example Classes Model Answers to Example Questions (Set III) Question 1 10610 40031.8 -- ×=×= × × == APN RT d Question 2: Type of Fluid #12;Consider 2 identical vertical tubes are filled with the same height of fluid: A Newtonian fluid is used with tube X whereas a non-Newtonian fluid

  5. Abstract-As a part of an ongoing project, in this paper we introduce the first version of a system which has a novel

    E-Print Network [OSTI]

    Deng, Zhigang

    the feasibility of integrating appropriate computational tools to achieve the volumetric image guidance perception of the surgical field. Specifically, the MIS in the beating heart (off-pump) can substantially for RT guidance is three- dimensional (3D) ultrasound due to its volumetric imaging capabilities and lack

  6. An Experimental and Theoretical Multi-Mbar Study of Ti-6Al-4V

    SciTech Connect (OSTI)

    Tegner, B E; Macleod, S G; CYNN, H; Proctor, J; Evans, W J; McMahon, M I; Ackland, G J

    2011-04-13

    We report results from an experimental and theoretical study of the room temperature (RT) compression of the ternary alloy Ti-6Al-4V. In this work, we have extended knowledge of the equation of state (EOS) from 40 GPa to 221 GPa, and observed a different sequence of phase transitions to that reported previously for pure Ti.

  7. DYNAMICAL ANALYSIS OF RESONANT TUNNELING IN PRESENCE OF A SELF CONSISTENT POTENTIAL DUE TO THE SPACE CHARGE

    E-Print Network [OSTI]

    Presilla, Carlo

    semiconductor double bar- riers1, in recent years many groups have studied the physics and device application of RT in semiconductor nanostructures2 · MBE allows one to control the layer thickness and tune its and demonstrated that the dynamical storage of electrons in the well leads to bistability in the current voltage

  8. JOURNAL DE PHYSIQUE Colloque C6, supplkment au no 8, Tome 39, aotit 1978, page C6-531 NONEQUILIBRIUM PHENOMENA IN SUPERCONDUCTING AR BRIDGES UNDER THE MICROWAVE

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ].randthickness - 1000 A) were evaporated at 1 0 - ~ torr into crystalline quartz substrates at 50°c. We used a and calibrated in each temperature cycle. The absolute value of temperature was measured with an accuracy of % 7 levels of microwave power W. A slight change of the R(T) curve at Tcb= 1.267 K corresponds Fig. 1

  9. FY 2015 Computer Hardware and Software Request Form Last Revision 8/12-2013 -JPW

    E-Print Network [OSTI]

    Portman, Douglas

    -28217-2610 Cost Estimate Date Group 5-28217-2290 Cost Estimate RT# 5-28217-2120 Cost Estimate CIDS# Non CSG Budget Cost Estimate Instructions: Step 1: Fill in the end user's name and group (above) and as much Description MathType Visual Studio Microsoft Project PV-Wave MathCAD VISRAD Visio Graphite

  10. HTS Power Transformers Presented to the

    E-Print Network [OSTI]

    for cooling 80-K shields and lead intercepts (ORNL/SP) Core Yokes Top and Bottom (WES) 80-K Shield (SP Not shown: Vacuum Tank, Bushings, RT Leads (WES) #12;8 ORNL's FY 2004 Plans Include: (from July, 2003 Peer

  11. MSE 3050, Phase Diagrams and Kinetics, Leonid Zhigilei Theoretical calculation of the heat capacity

    E-Print Network [OSTI]

    Zhigilei, Leonid V.

    Principle of equipartition of energy Heat capacity of ideal and real gases Heat capacity of solids: Dulong and internal energy of 3/2kBT. The molar internal energy U=3/2NAkBT=3/2RT and the molar heat capacity under to the heat capacity can be considered classically only if En ~ h Energy leve

  12. Calculations of pH-Dependent Binding of Proteins to Biological Membranes Maja Mihajlovic and Themis Lazaridis*

    E-Print Network [OSTI]

    Lazaridis, Themis

    Lazaridis* Department of Chemistry, City College of the City UniVersity of New York, New York, New York energies. The standard free energy of binding, G, is defined as -RT ln(Pb/Pf), where Pb and Pf free energy are (a) the free energy cost of ionization state changes (Gion), (b) the effective energy

  13. h i l d lli fMathematical Modelling for Excitation Unidirectional DispersiveExcitation Unidirectional Dispersive

    E-Print Network [OSTI]

    Al Hanbali, Ahmad

    Tank signaling at Hydrodynamic Laboratoryg g y y y 5 [m] )(),0( tst =signal Buoy 1 Buoy 2 Assumption passes. #12;SIMULATION Buoy 1 Buoy 2 ABequation 0Xx = 1 ( ) ( ))cos()cos()()(, 210 tatatRtstX +== R(t)1

  14. Belief Revision and the Ramsey Test: A Solution Laura Giordano1

    E-Print Network [OSTI]

    Giordano, Laura

    Belief Revision and the Ramsey Test: A Solution Laura Giordano1 , Valentina Gliozzi2 , and Nicola satisfy the AGM postulates and are compatible with the Ramsey Test. We show that this result does be expressed in terms of belief revision by means of the so-called Ramsey Test (RT). The Ramsey Test suggests

  15. Identification of drought responsive genes in aleppo pine (Pinus halepensis) and loblolly pine (Pinus taeda.L) 

    E-Print Network [OSTI]

    Sathyan, Pratheesh

    2005-02-17

    Drought is a major constraint for attaining economic yield in tree crops. As an initial step to understand molecular response to water-deficit-stress in trees, gene expression in response to water stress was quantified using real-time RT...

  16. ASYMPTOTIC EXPANSION OF THE HOMOCLINIC SPLITTING MATRIX FOR THE RAPIDLY, QUASIPERIODICALLY, FORCED

    E-Print Network [OSTI]

    , and so on. Chirikov's report [Chi79] is a very nice physical account on Arnold diffusion, while Lochak [DGJS97a, DGJS97b,DJSG99,DG03]. Especially [Tre97,LMS03,RW00,Sau01,RT04] emphasize geomet- rical aspects

  17. MINUTES OF UNIVERSITY COURT 25 June 2013

    E-Print Network [OSTI]

    Mottram, Nigel

    , Scottish and other political representatives, including: the Rt Hon. David Willetts MP ­ UK National Salmond MSP ­ Power Network Demonstration Centre, Energy Advisory Board; Graeme Pearson MSP ­ economic with research leaders from across the University International engagements ­ China, Singapore, Dubai, New York

  18. NOAATechnical Report ERL408-GLERL14 Spectral Growthand Nonlinear

    E-Print Network [OSTI]

    .......................................Appendix B Testingfor Stationarity 43 Appendix C. Application of Barnett's Parameterization of Nonlinear in Barnett's parameteri- zation of nonlinear energy transfer that represents the part receiving energy from(w),for data r,(t) source function; also used in Barnett's parameterization to represent the part

  19. technology offer Research and Transfer Support | DI Karin Hofmann

    E-Print Network [OSTI]

    Arnold, Anton

    be reduced Potential applications Desilting within the pressure pipe of a hydropower State of development://www.rt.tuwien.ac.at Sediment Removal by an Axial Hydro Cyclone key words: desilting | axial cyclone | pressure pipe| hydropower plant Silt problems are well known at hydropower plants in alpine areas and cause high damage

  20. Dynamical evolution of Rayleigh-Taylor and Richtmyer-Meshkov mixing fronts Physics Division, Los Alamos National Laboratory, Los Alamos, New Mexico 87545

    E-Print Network [OSTI]

    New York at Stoney Brook, State University of

    derive § an analytic solution for the dynamic evolution of mixing fronts driven by constant acceleration in a multifluid system produce buoyancy and shear driven 8 instabilities at an interface between distinct fluids 9 Rayleigh-T ¨ aylor ©RT ¨ and impulsive acceleration Richtmyer-Meshkov instabilities, from a simple physics

  1. Dynamical evolution of RayleighTaylor and RichtmyerMeshkov mixing fronts Baolian Cheng

    E-Print Network [OSTI]

    New York at Stoney Brook, State University of

    derive an analytic solution for the dynamic evolution of mixing fronts driven by constant acceleration system produce buoyancy and shear driven instabilities at an interface between distinct fluids #1 Rayleigh­Taylor #RT# and impulsive acceleration Richtmyer­Meshkov instabilities, from a simple physics

  2. Structural response of oxidation resistant carbon-carbon composites 

    E-Print Network [OSTI]

    Ashley, Timothy Harold

    1996-01-01

    subjected to thermo-mechanical loading. The analytical models are compared to test data to verify the predictions of the lamina response. The material system studied is HITCO 2D CC137EH, highly inhibited, eight harness satin weave, RT42 CVD SiC coated carbon...

  3. Z .International Journal of Psychophysiology 36 2000 59 68 Modulation of attentional inhibition by norepinephrine

    E-Print Network [OSTI]

    Park, Sohee

    .Salivary measures of the stress hormone CORT and -amylase a correlate of NE were assayed to probe the Z in reaction time RT after the video game. Moreover, -amylase levels increased significantly after the stressor that mild psychological stress can significantly alter attentional processes. Given the increase in -amylase

  4. On the conservation of software defect CISM, University of Kingston

    E-Print Network [OSTI]

    Hatton, Les

    , T the temperature and R the gas constant is astonishingly accurate over a very wide range of pressures, then commonly used defect models for individual components directly im- ply that the distribution of component systems extremely accurately. For example, for a gas, PV = RT where P is the pressure, V the volume

  5. pH-Dependent pKa Values in ProteinssA Theoretical Analysis of Protonation Energies with Practical Consequences for Enzymatic Reactions

    E-Print Network [OSTI]

    Ullmann, G. Matthias

    from the linear relationship Gprot ) RT ln 10 (pH - pKa), where R is the gas constant.e., at standard condition pH ) 0) where R is the gas constant and T the absolute temperature. A linear equation a standard sigmoidal shape, the protonation energy of an individual site in a protein may depend nonlinearly

  6. CO.05.10.01 UNIVERSITY OF BIRMINGHAM

    E-Print Network [OSTI]

    Birmingham, University of

    Elroy (up to item 05/36); Mrs L F Payne; The Rt Rev Dr M Santer; Professor M J H Sterling (Vice and Engineering (minute 05/16 refers) Reported: That Professor P Daniels had been appointed Dean of Engineering

  7. Dimerisation of HIV-2 genomic RNA is linked to efficient RNA packaging, normal particle maturation and viral infectivity

    E-Print Network [OSTI]

    L'Hernault, Anne; Greatorex, Jane S.; Crowther, Anthony; Lever, Andrew M. L.

    2007-12-13

    ' and Psi R 5' AGGTACTTACCTTCACCC 3'. A control without RT was performed with 10 µl of neat RNA. Samples were vis- ualised on a 2% agarose gel. RNA isolation Cytoplasmic and virion RNAs were harvested with the RNAeasy mini kit (Qiagen) and the QIAamp viral...

  8. Alterations in the steroid hormone receptor co-chaperone FKBPL are associated with male infertility: a case-control study

    E-Print Network [OSTI]

    Sunnotel, Olaf; Hiripi, Laszlo; Lagan, Kevin; McDaid, Jennifer R.; De Leon, Johanny M.; Miyagawa, Yasushi; Crowe, Hannah; Kaluskar, Soniya; Ward, Michael; Scullion, Catherine; Campbell, Alan; Downes, C. S.; Hirst, David; Barton, David; Mocanu, Edgar; Tsujimura, Akira; Cox, Marc B.; Robson, Tracy; Walsh, Colum P.

    2010-03-08

    . Analysis of Fkbpl mRNA expression by RT-PCR Total RNA was extracted using the RNeasy Mini Kit, including the optional DNAse treatment, following the manufacturer’s instructions (Qiagen, Crawley, UK) and 1 ?g used to make cDNA in a 12.5 ?l mixture contain...

  9. Highly stable silicon dioxide films deposited by means of rapid thermal -low-pressure chemical vapor deposition onto InP

    E-Print Network [OSTI]

    Florida, University of

    grown by rapid thermal, low-pressure chemical vapor deposition (RT-LPCVD), using pure oxygen (0,) and 2Highly stable silicon dioxide films deposited by means of rapid thermal - low-pressure chemical vapor deposition onto InP A. Katz, A. Feingold, U. K. Chakrabarti, and S. J. Peat-ton AT&T Bell

  10. The influence of ammonia on rapid-ther al low-pressure metalorganic chemical vapor deposited TIN, films from tetrakis (dimethylamido) titanium

    E-Print Network [OSTI]

    Florida, University of

    The influence of ammonia on rapid-ther al low-pressure metalorganic chemical vapor deposited TIN, and stress of rapid- thermal low pressure metalorganic chemical vapor deposited (RT-LPMOCVD) TiN, films on In) liquid precursors, were studied. Enhanced deposition rates of l-3 nm s- ' at total chamber pressures

  11. 95 FERC 61,115 UNITED STATES OF AMERICA

    E-Print Network [OSTI]

    Laughlin, Robert B.

    by the California Independent System Operator and the California Power Exchange, Respondents. Investigation of Practices of the California Independent System Operator and the California Docket No. EL00-98-000 Power Exchange California Independent System Operator Docket No. RT01-85-000 Corporation Investigation

  12. The effect of resistance, endurance, and combination exercise on lipid metabolism and non-traditional cardiovascular disease risk markers in previously untrained men 

    E-Print Network [OSTI]

    Martin, Steven Edward

    2009-05-15

    corresponding to 0 and 12 weeks of training. For acute exercise (pre-training), significant results of a 3 (Group) x 2 (Time) ANOVA, repeated for Time, (p TC, HDL-C, HDL2&3-C were lower 24 h after exercise in the RT group. HDL2-C...

  13. Effect of initial conditions on the development of Rayleigh-Taylor instabilities 

    E-Print Network [OSTI]

    Peart, Freeman Michael

    2009-05-15

    of the bubbles/spikes and the self-similar growth parameter, K ? , of the turbulent kinetic energy at the centerline of the low Atwood RT driven turbulent mixing layer. When initialized with the experimentally measured initial conditions, the BHR model did agree...

  14. Circular Harmonic Decomposition Approach for Numerical Inversion of Circular Radon Transforms

    E-Print Network [OSTI]

    Louis, Alfred K.

    Circular Harmonic Decomposition Approach for Numerical Inversion of Circular Radon Transforms Gaël@num.uni-sb.de ABSTRACT Numerical inversions via circular harmonic decomposition for two classes of circular Radon transforms are established. The first class deals with the Radon transform (RT) de- fined on circular arcs

  15. 162 IEEE TRANSACTIONSONACOUSTICS, SPEECH, ANDSIGNAL PROCESSING, VOL. ASSP-35, NO. 2, FEBRUARY 1987 Discrete Radon Transform

    E-Print Network [OSTI]

    Beylkin, Gregory

    Discrete Radon Transform GREGORY BEYLKIN Abstract-This paper describes the discrete Radon transform (DRT showthattheDRTcan beused tocomputevariousgen- eralizations of the classical Radon transform (RT) and. An interesting observation is that the exact inversion algorithm cannot be obtained directly from Radon

  16. -United StatesI)epar-tiiient of-thelnte-iior~--Y:A~"'1~e;, S8crc-~.,ar7:-- Fish and llildlife Service, Albert M. Day, Director

    E-Print Network [OSTI]

    . YExcerpts from. the Repc;rtP of the Joint Brazil-United States Tech- . nical Connnission, Publication 3487-United ·StatesI)epar-tiiient of-thelnte-iior~--Y:·A~"'1~e;, S8crc-~.,ar7:--· Fish and llildlife .................................._. References .................................... I ntroduction Pa~ 1 3 3 7 10 11 Brazil is not at present 8

  17. technology offer Vienna University of Technology | Research and Transfer Support | Claudia Doubek

    E-Print Network [OSTI]

    Arnold, Anton

    for biomethane production plants, that operate on basis of anaerobic digestion (biogas) and biomass gasification.doubek@tuwien.ac.at | http://www.rt.tuwien.ac.at High-recovery gas upgrading systems Membrane gas permeation | biogas methane recovery in the treatment of biogas. The new 2-compressor membrane permeator configurations

  18. Socioeconomic Data and Applications Center (SEDAC) User Services

    E-Print Network [OSTI]

    Columbia University

    Socioeconomic Data and Applications Center (SEDAC) User Services PO Box 1000, 61 Rt 9W, Palisades Aeronautics and Space Administration www.nasa.gov DATA & APPLICATIONS World Data Center for Human Interactions in the Environment (WDC) Overview CIESIN, the World Data Center for Human Interactions in the Environment (WDC

  19. MFST exam A 424302 23-112011 Short answers 415. a. G = gasoline: pG = yGptot = pGxG = pG, (xG = 1),

    E-Print Network [OSTI]

    Zevenhoven, Ron

    .554 (alternative method: 0.548) g. Extraction with benzene; or membrane separation; for example. #12;G = 1), Ideal gas mass m, moles n, molar mass MG = 111 kg/ kmol: mG = nGMG = MGpGV/(RT) mG = 111

  20. Effects of recombinant turkey interferon-gamma on development of immunity to coccidia in neonatal turkeys 

    E-Print Network [OSTI]

    Beltran, Ruben

    2002-01-01

    experiments (EXP 3, 4, or 5) over time in which rtIFN? was administered to turkey poults one day post-hatch by intraperitoneal injection 30 min prior to per os challenge with Eimeria adenoeides (EA). In EXP 4 and 5, neonatal turkeys received a second...

  1. Transcriptional slippage in the positive-sense RNA virus family Potyviridae

    E-Print Network [OSTI]

    Olspert, Allan; Chung, Betty Y.-W.; Atkins, John F.; Carr, John P.; Firth, Andrew E.

    2015-06-25

    -Sánchez L, Vicente-Carbajosa J (2008) DNA-free RNA isolation protocols for 589 Arabidopsis thaliana, including seeds and siliques. BMC Res Notes 1: 93 590 52. Purcell MK, Hart AS, Kurath G, Wintona JR (2006) Strand-specific, real-time RT-PCR 591 assays...

  2. Solid tumors of childhood display specific serum microRNA profiles

    E-Print Network [OSTI]

    Murray, Matthew J.; Raby, Katie L.; Saini, Harpreet K.; Bailey, Shivani; Wool, Sophie V.; Tunnacliffe, Jane M.; Enright, Anton J.; Nicholson, James C.; Coleman, Nicholas

    2014-11-21

    RNAs in DICER1-mutated pleuropulmonary blastoma. Oncogenesis. 2014;3:e87. 12. Mestdagh P, Van Vlierberghe P, De Weer A, Muth D, Westermann F, Speleman F, et al. A novel and universal method for microRNA RT-qPCR data normalization. Genome Biol. 2009;10:R64...

  3. Algebraen og talteorien bag o entlig n gle kryptering og

    E-Print Network [OSTI]

    Hansen, Johan P.

    Univsersitet #12; Indhold Indledning 1 Kapitel 1. St#28;rste f#26;lles divisor 3 Euklids algoritme 3 Afvikling af eksempler 3 Analyse af Euklids algoritme 4 Bezouts identitet 5 Kapitel 2. Primtal 7 Aritmetikkens. For store tal er det sv#26;rt umiddelbart at #12;nde den st#28;rste f#26;lles divisor. Euklids algoritme

  4. Metachronal waves in the flagellar beating of Volvox and their hydrodynamic origin

    E-Print Network [OSTI]

    Brumley, Douglas R.; Polin, Marco; Pedley, Timothy J.; Goldstein, Raymond E.

    2015-06-03

    . Because the drag is not isotro- pic, the trajectory of an isolated sphere will deviate slightly from the prescribed circle (dr=r0 #2; 0:5% here) to a new limit cycle (r(t), f(t), z(t)) of period T, which we obtain directly from the simulations for each set...

  5. Transport in Porous Media 28: 253284, 1997. 253 1997 Kluwer Academic Publishers. Printed in the Netherlands.

    E-Print Network [OSTI]

    Patzek, Tadeusz W.

    is modeled here with a pore network simulator. We predict the magnitude of the pressure drop leading standard deviation of calculated mobilization pressure gradients (atm/m), B pore shape characteristic [1+rt at pore throat, Pu upstream pressure (Pa), Pd downstream pressure (Pa), rcrit radius of curvature

  6. Iatiku 02

    E-Print Network [OSTI]

    Ostler, Nicholas D M

    1996-01-01

    list f f rt c i COD r r D c e s (i ter rete i el e t i cl e a fil festival), and recent licati s. I f t re iss es I s all e i cl i rea ers' letters, a als literar r isc ssi ieces ic ill start to ake Iatiku a real foru for ndangered...

  7. Turbulent Transport in a Laboratory Magnetospheric Dipole

    E-Print Network [OSTI]

    (1970): Random solar-driven fluctuations cause strong inward pinch and adiabatic heating of radiation solutions to adiabatic transport equations (pV ) t = D (pV ) + H (nV ) t = D (nV ) + S D V n + n and warm collisional plasma... Peak local beta observed ~ 50% ( RT-1 reaches 70% ) Global energy

  8. CMU-ITC-91-059 TRADMYBD -Technical Reference

    E-Print Network [OSTI]

    " place. Trademarks The following trademarks appear in this document: IBM, IBM PC, IBM PC/XT, IBM PC/AT, IBM RT/PC, ACIS 4.2, and AIX are trademarks of International Business Machines. Microsoft and MS right to left with the right-most bit being 0. This is NOT the nomenclature used by IBM in many of its

  9. 11-level Cascaded H-bridge Grid-tied Inverter Interface with Solar Panels

    E-Print Network [OSTI]

    Tolbert, Leon M.

    11-level Cascaded H-bridge Grid-tied Inverter Interface with Solar Panels Faete Filho, Yue Cao multilevel DC-AC grid-tied inverter. Each inverter bridge is connected to a 200 W solar panel. OPAL-RT lab match. A novel SPWM scheme is proposed in this paper to be used with the solar panels that can account

  10. A Signal Processing Model of a Product Development Process Phase

    E-Print Network [OSTI]

    Ford, David N.

    Variables: CTi = CTi0 + 0 T (BWi + RWi - IFi - RTi) dt where #12;i = development phase T = time, weeks CT week RW = Rework rate, tasks per week TRi = TRi0 + 0 T RTi dt where TR = Tasks Released, tasks RT, dimensionless #12;CT = Completed, not Checked stock, tasks QADur = Quality Assurance Minimum Duration, week RTi

  11. Identifying key controls on the behavior of an acidic-U(VI) plume in the Savannah River Site using reactive transport modeling

    E-Print Network [OSTI]

    Hubbard, Susan

    online 1 May 2013 Acidic low-level waste radioactive waste solutions were discharged to three unlined reactive transport modeling Sergio A. Bea a, , Haruko Wainwright a,1 , Nicolas Spycher a,2 , Boris treatments. This paper presents a reactive transport (RT) model and uncertainty quantification (UQ) analyses

  12. Dual Luciferase Assay Lucho Fuentealba 2008

    E-Print Network [OSTI]

    De Robertis, Eddy M.

    -Luciferase Assay System from Promega (Cat# E1960) - Dilute the Passive Lysis Buffer (PLB) Harvesting of cells in each well (for a 12-well plate) - Rock the plate for 15 min at RT - Take the extract and place in microfuge tubes. Keep at -20°C until use - Thaw on water the Luciferase Assay Buffer II (green label

  13. A. E.K.Ris Ris-M-QEI Title and author(s)

    E-Print Network [OSTI]

    management studies a certain knowledge of the power distribution between different fuel types is required; Risø Library, Risø National Laboratory, DK-4000 Roskilde, Denmark. Risø Bibliotek, Forsøgsanlæg Pisø, 4000 Roskilde Telephone: (03) 35 51 01, ext. 334, telex 43116. Copies to Library 100 RT 12 T. Petersen

  14. Impact of Concomitant Chemotherapy on Outcomes of Radiation Therapy for Head-and-Neck Cancer: A Population-Based Study

    SciTech Connect (OSTI)

    Gupta, Shlok; Kong, Weidong; Booth, Christopher M.; Mackillop, William J.

    2014-01-01

    Purpose: Clinical trials have shown that the addition of chemotherapy to radiation therapy (RT) improves survival in advanced head-and-neck cancer. The objective of this study was to describe the effectiveness of concomitant chemoradiation therapy (C-CRT) in routine practice. Methods and Materials: This was a population-based cohort study. Electronic records of treatment from all provincial cancer centers were linked to a population--based cancer registry to describe the adoption of C-CRT for head-and-neck cancer patients in Ontario, Canada. The study population was then divided into pre- and postadoption cohorts, and their outcomes were compared. Results: Between 1992 and 2008, 18,867 patients had diagnoses of head-and-neck cancer in Ontario, of whom 7866 (41.7%) were treated with primary RT. The proportion of primary RT cases that received C-CRT increased from 2.2% in the preadoption cohort (1992-1998) to 39.3% in the postadoption cohort (2003-2008). Five-year survival among all primary RT cases increased from 43.6% in the preadoption cohort to 51.8% in the postadoption cohort (P<.001). Over the same period, treatment-related hospital admissions increased significantly, but there was no significant increase in treatment-related deaths. Conclusions: C-CRT was widely adopted in Ontario after 2003, and its adoption was temporally associated with an improvement in survival.

  15. Transactive Modeling and Simulation Capabilities

    E-Print Network [OSTI]

    In the Loop (HIL) effort between PNNL and NREL using PNNL's EIOC and NREL's ESIF Hardware located in the ESIF model NREL: PV inverter hardware running with control signal received from the GridLAB-D simulation inverters PNNL EOIC NREL ESIF Data API Data API Inverter Control Opal-RT D/A A/D Visualization Visualization

  16. EcoCore Analytical Services | Dept. 1499, Colorado State University, 200 W. Lake St., Fort Collins CO, 80523, USA Tel: +1 970-491-5573 | E-mail: Daniel.Reuss@colostate.edu | http://ecocore.nrel.colostate.edu

    E-Print Network [OSTI]

    MacDonald, Lee

    CO, 80523, USA Tel: +1 970-491-5573 | E-mail: Daniel.Reuss@colostate.edu | http://ecocore.nrel.Reuss@colostate.edu | http://ecocore.nrel.colostate.edu TOC analyzer LECO CN analyzer HPLC Freeze-drier PCR RT-PCR Plate

  17. Differential Equations Lectures INF2320 p. 1/6

    E-Print Network [OSTI]

    Stølen, Ketil

    of Calculus, we get the solution r(t) = r(0)+ t 0 f(s)ds (3) · The integral can then be calculated as accurateDifferential Equations Lectures INF2320 ­ p. 1/6 #12;Differential equations · A differential be determined · In practice, differential equations typically describe quantities that changes in relation

  18. Geometry and Topology Qualifying Exam, August 2012 1. Find curvature of the curve in R3

    E-Print Network [OSTI]

    curve, such as r(t) (you are not asked to calculate it). 2. Evaluate the Fresnel integral lim R R 0 sin differential 2-form on M. Suppose around each point of M we can find local coordinates pj, qj, j = 1, . . . n map (differential) dfx at every point x M is a diffeomorphism. GOOD LUCK! #12;

  19. Anisotropic magnetic and superconducting phase diagrams of RNi[]B[]C (R = Y, Lu, Ho) 

    E-Print Network [OSTI]

    Dumar, Aaron Christopher

    1999-01-01

    Measurements of the upper critical field, H[]?(T), are reported for YNi?B?C, T[] = 15.6 K, and LuNi?B?C, T[] = 16.1 K as well as a metamagnetic phase diagram for HoNi?B?C, T[] = 8.6 K. Resistance measurements, R(T, H), were taken on single crystal...

  20. Third Radiation Transfer Model Intercomparison (RAMI) exercise: Documenting progress in canopy reflectance

    E-Print Network [OSTI]

    Jones, Peter JS

    the scope to include structurally complex 3-D plant architectures with and without background topography/need for RT models to accurately reproduce local estimates of radiative quantities under conditions) to a reassessment of the role, scope, and opportunities of the RAMI project in the future. Citation: Widlowski, J