National Library of Energy BETA

Sample records for module reads exogenously

  1. Department of Music modules -recommended reading for our two undergraduate courses: BA in Music and BA in Music Technology

    E-Print Network [OSTI]

    Sussex, University of

    Department of Music modules - recommended reading for our two undergraduate courses: BA in Music and BA in Music Technology These books are recommended selected Music Department modules (note that detailed week by week reading lists

  2. Drosophila lifespan enhancement by exogenous bacteria

    E-Print Network [OSTI]

    Seroude, Laurent

    Drosophila lifespan enhancement by exogenous bacteria Ted Brummel*, Alisa Ching*, Laurent Seroude with customary procedure. The experiments revealed that the presence of bacteria during the first week of adult life can enhance lifespan, despite unchanged food intake. Later in life, the presence of bacteria can

  3. Please read through this document to help you access the "Recruitment and Selection" eLearning module. The first screen is your log in screen.

    E-Print Network [OSTI]

    Judd, Martin

    Learning modules which are on offer. You can add eLearning modules into your Training Plan after viewing them). You will see the "Equality and Diversity" eLearning module is already included in your Training Plan. You will need to add the "Recruitment and Selection" eLearning module into your Training Plan before

  4. Exogenous Versus Endogenous for Chaotic Business Cycles

    E-Print Network [OSTI]

    Marat Akhmet; Zhanar Akhmetova; Mehmet Onur Fen

    2015-09-03

    We propose a novel approach to generate chaotic business cycles in a deterministic setting. Rather than producing chaos endogenously, we consider aggregate economic models with limit cycles and equilibriums, subject them to chaotic exogenous shocks and obtain chaotic cyclical motions. Thus, we emphasize that chaotic cycles, which are inevitable in economics, are not only interior properties of economic models, but also can be considered as a result of interaction of several economical systems. This provides a comprehension of chaos (unpredictability, lack of forecasting) and control of chaos as a global economic phenomenon from the deterministic point of view. We suppose that the results of our paper are contribution to the mixed exogenous-endogenous theories of business cycles in classification by P.A. Samuelson [76]. Moreover, they demonstrate that the irregularity of the extended chaos can be structured, and this distinguishes them from the generalized synchronization. The advantage of the knowledge of the structure is that by applying instruments, which already have been developed for deterministic chaos one can control the chaos, emphasizing a parameter or a type of motion. For the globalization of cyclic chaos phenomenon we utilize new mechanisms such that entrainment by chaos, attraction of chaotic cycles by equilibriums and bifurcation of chaotic cycles developed in our earlier papers.

  5. Read: What Kathmandu is Reading?

    E-Print Network [OSTI]

    Fineprint Bookclub

    2011-01-05

    and professionals. Sixty percent of hi s cliental consists of tourists. "Tourists," he says, "buy mostly maps and geography books to know more about the region they are planning to travel to." He adds, "Each single tourist usually buys 5 to 7 fictions to read... to recommend I enjoyed Khalid Hosseini's novel "The Kite Runner" and Samrat Upadhyay's short stories in "The Royal Ghosts". In non-fiction, I liked Suketu Mehta's "Maximum City", a book about Mumbai. I also finished reading Ron Chernow's biography...

  6. ORIGINAL PAPER Autism and urinary exogenous neuropeptides: development

    E-Print Network [OSTI]

    Hammock, Bruce D.

    ORIGINAL PAPER Autism and urinary exogenous neuropeptides: development of an on-line SPE / Published online: 23 May 2007 # Springer-Verlag 2007 Abstract Autism is a complex neurodevelopmental disor- der with unknown etiology. One hypothesis regarding etiology in autism is the "opioid peptide excess

  7. Optimal combined wind power forecasts using exogeneous variables

    E-Print Network [OSTI]

    Optimal combined wind power forecasts using exogeneous variables Fannar ¨Orn Thordarson Kongens to the Klim wind farm using three WPPT forecasts based on different weather forecasting systems. It is shown of the thesis is combined wind power forecasts using informations from meteorological forecasts. Lyngby, January

  8. International Environmental Agreements with Endogenous or Exogenous Risk

    E-Print Network [OSTI]

    Karp, Larry S.

    Agreement (IEA). Exogenous and endogenous risk have different implications for the (expected) level of equilibrium participation in an IEA. Our paper is the first to examine the effect of risk aversion on equilibrium IEA participation under endogenous risk. We also extend and clarify Boucher and Bra- moulle (2010

  9. Module Handbook Module title

    E-Print Network [OSTI]

    . Students learn about selected topics from inorganic chemistry, biochemistry, materials chemistryModule Handbook Module title Module title in English Credits Degree of compulsion Level Learning Theory of Functional Materials 6 Compulsory Basic A systematic foundation for quantum physics

  10. Fundamentals of Chinese Reading 

    E-Print Network [OSTI]

    Nixon, Jessie

    2009-11-26

    A large corpus of data of natural reading in Chinese was explored using linear mixed effects analyses conducted in R....

  11. Introducing a digital library reading appliance into a reading group

    E-Print Network [OSTI]

    Marshall, Cathy

    Introducing a digital library reading appliance into a reading group Catherine C. Marshall, Morgan will we read digital library materials? This paper describes the reading practices of an on-going reading group, and how these practices changed when we introduced XLibris, a digital library reading appliance

  12. Abstract --Most logistics network design models assume exogenous customer demand that is independent of the service

    E-Print Network [OSTI]

    Graves, Stephen C.

    Abstract -- Most logistics network design models assume exogenous customer demand for the network design decision making process. Index Terms -- Logistics Network Design, Demand Classes, Benefits. In most logistics network design models, the customer demand is exogenous and defined as a uniform

  13. Contracting with reading costs and renegotiation costs

    E-Print Network [OSTI]

    Brennan, James R.

    2007-01-01

    Reading Costs, Competition, and ContractReading Costs . . . . . . . . . . . . . . . . C. EquilibriumUnconscionability A?ect Reading Costs . . . . . . . . . .

  14. Leadership Development Readings

    Broader source: Energy.gov [DOE]

    The Leadership Development Readings is a comprehensive list of more than 700 ECQ-related leadership readings organized by ECQ intended to assist all current and aspiring government leaders’ efforts to broaden their organizational and management experience and expand their knowledge in the five Executive Core Qualifications as well as Fundamental Competencies.

  15. IP3 signalling regulates exogenous RNAi in Caenorhabditis elegans

    E-Print Network [OSTI]

    Nagy, Anikó I.; Vázquez-Manrique, Rafael P.; Lopez, Marie; Christov, Christo; Sequedo, María Dolores; Herzog, Mareike; Herlihy, Anna E; Bodak, Maxime; Gatsi, Roxani; Baylis, Howard A.

    2015-01-21

    -proteins acting downstream of GPCRs [34]. Thus signalling through a GPCR may be important to the alterations in RNAi sensitivity. Increased IP3 signalling causes RNAi resistance. To ascertain whether IP3 signalling is capable of modulating the RNAi... : cgcgttcaccactcgaccaccgaac and tttttatgggttttggtaggttttag) [7], a 1.19 kb promoter region of unc-47 (terminal sequences: gatcccggaacagtcg and ctgtaatgaaataaatgt) were amplified from genomic DNA and cloned upstream of the itr-1 cDNA using restriction enzyme splicing...

  16. Effects of Exogenously Applied Indole-3-Acetic Acid (IAA) to Cotton 

    E-Print Network [OSTI]

    Clement, Jenny D.

    2011-08-08

    elongation in cotton fiber development. An increase in IAA at specific fiber developmental stages may promote increased lint percent and longer fibers. Objectives of this research project were to determine how exogenous applications in a field environment...

  17. Barium Titanate Nanoparticles as Exogenous Contrast Agents in Second Harmonic Optical Coherence Tomography 

    E-Print Network [OSTI]

    Pearson, Jeremy T

    2013-05-06

    I propose and demonstrate a method by which barium titanate nanoparticle clusters can be used as exogenous contrast agents in Second Harmonic Optical Coherence Tomography imaging systems to localize and highlight desired ...

  18. Reading context in design

    E-Print Network [OSTI]

    Agrawal, Vivek

    1993-01-01

    This study explores how, in the process of design, the reading of an existing order in the organizing features of a setting potentiates form. For this purpose, a design exercise on a site in the city of Jaipur in India has ...

  19. Power Reading USC Kortschak Center

    E-Print Network [OSTI]

    Zhou, Chongwu

    at the pictures, charts, diagrams, maps, etc. 2. Skim: Read the first sentence of every paragraph; statements and organization. *derived from: williamette.edu/dept/lcenter/study_strategies/reading2remember.html #12;ISR: Input

  20. Endogenous and exogenous dynamics of pressure fluctuations in an impinging entrained-flow gasifier

    E-Print Network [OSTI]

    Niu, Miao-Ren; Zhou, Wei-Xing; Wang, Fu-Chen; Yu, Zun-Hong

    2007-01-01

    On a laboratory-scale testing platform of impinging entrained-flow gasifier with two opposed burners, the pressure fluctuation signals were measured with a stainless steel water-cooled probe. Phenomenological investigations of the endogenous and exogenous dynamics in the fluctuations of pressure were carried out by performing the mean-variance analysis and separating the endogenous and exogenous components of the signals. Non-universal dynamics with power-law behaviors have been found not only in the original signals but also in their components. A new inequality was obtained showing that the exogenous exponent is smallest while the overall dynamic exponent is the largest. The results highlight that the dynamics of pressure fluctuations in the first fifteen minutes of the gasification process is driven dominantly by the ignition process. The method can be readily applied to the other multiphase systems like bubble column, fluidized bed, etc.

  1. Module Configuration

    DOE Patents [OSTI]

    Oweis, Salah (Ellicott City, MD); D'Ussel, Louis (Bordeaux, FR); Chagnon, Guy (Cockeysville, MD); Zuhowski, Michael (Annapolis, MD); Sack, Tim (Cockeysville, MD); Laucournet, Gaullume (Paris, FR); Jackson, Edward J. (Taneytown, MD)

    2002-06-04

    A stand alone battery module including: (a) a mechanical configuration; (b) a thermal management configuration; (c) an electrical connection configuration; and (d) an electronics configuration. Such a module is fully interchangeable in a battery pack assembly, mechanically, from the thermal management point of view, and electrically. With the same hardware, the module can accommodate different cell sizes and, therefore, can easily have different capacities. The module structure is designed to accommodate the electronics monitoring, protection, and printed wiring assembly boards (PWAs), as well as to allow airflow through the module. A plurality of modules may easily be connected together to form a battery pack. The parts of the module are designed to facilitate their manufacture and assembly.

  2. Motivation sharpens exogenous spatial attention Jan B. Engelmann(1) and Luiz Pessoa(2)

    E-Print Network [OSTI]

    Pessoa, Luiz

    1 Motivation sharpens exogenous spatial attention Jan B. Engelmann(1) and Luiz Pessoa(2) (1) Jan B (lpessoa@indiana.edu). #12;2 ABSTRACT Although both attention and motivation affect behavior, how these two participants performed a spatially-cued forced-choice localization task under varying levels of motivation

  3. Poster Session 08: Bystander and other Low Dose Effect Exogenous carbon monoxide suppresses adaptive response induced

    E-Print Network [OSTI]

    Yu, Peter K.N.

    Poster Session 08: Bystander and other Low Dose Effect Exogenous carbon monoxide suppresses; adaptive response; zebrafish embryos Journal of Radiation Research, 2014, 55, i115 Supplement doi: 10 prepared medium with the chemical at different time points after the application of the priming dose. Our

  4. Effects of exogenous carbon monoxide on radiation-induced bystander effect in zebrafish embryos in vivo

    E-Print Network [OSTI]

    Yu, Peter K.N.

    that the dose-response of radiation in the low-dose regime deviated from the LNT model. A notable example radiation are linearly proportional to the absorbed dose, evidence accumulated in the past decades showed as a pharmaceutical agent to release a low dose of exogenous carbon monoxide (CO) to attenuate the effect on bystander

  5. Planning in The Face of Frequent Exogenous Events Christian Fritz and Sheila A. McIlraith

    E-Print Network [OSTI]

    McIlraith, Sheila

    Planning in The Face of Frequent Exogenous Events Christian Fritz and Sheila A. Mc,sheila}@cs.toronto.edu Abstract Generating optimal plans in highly dynamic environments is challenging. Plans are predicated on an assumed initial state, but this state can change unexpectedly during plan genera- tion, potentially

  6. Mutations in yhiT enable utilization of exogenous pyrimidine intermediates in Salmonella enterica

    E-Print Network [OSTI]

    Coller, Jeff

    Mutations in yhiT enable utilization of exogenous pyrimidine intermediates in Salmonella enterica auxotrophs of Salmonella enterica serovar Typhimurium LT2. The gain-of-function phenotypes both resulted from a continual supply of deoxyribo- and ribonucleoside triphosphates. In Escherichia coli and Salmonella enterica

  7. Cryptographic aspects of quantum reading

    E-Print Network [OSTI]

    Gaetana Spedalieri

    2015-09-03

    Besides achieving secure communication between two spatially-separated parties, another important issue in modern cryptography is related to secure communication in time, i.e., the possibility to confidentially store information on a memory for later retrieval. Here we explore this possibility in the setting of quantum reading, which exploits quantum entanglement to efficiently read data from a memory whereas classical strategies (e.g., based on coherent states or their mixtures) cannot retrieve any information. From this point of view, the technique of quantum reading can provide a new form of technological security for data storage.

  8. Reading File Bonneville Power Administration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Reading File Bonneville Power Administration P.O. Box 3621 Portland, Oregon 97208-3621 POWER SERVICES In reply refer to: PG-5 Ms. Renata Kurschner Director, Generation Resource...

  9. Reading Room | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Energy Public Reading Room 1166 Athens Tech Road Elberton, GA 30635-6711 Contact: Joel Seymour Phone: 706-213-3800 Fax: 706-213-3884 Email: joels@sepa.doe.gov Strategic Petroleum...

  10. Thermionic modules

    DOE Patents [OSTI]

    King, Donald B. (Albuquerque, NM); Sadwick, Laurence P. (Salt Lake City, UT); Wernsman, Bernard R. (Clairton, PA)

    2002-06-18

    Modules of assembled microminiature thermionic converters (MTCs) having high energy-conversion efficiencies and variable operating temperatures manufactured using MEMS manufacturing techniques including chemical vapor deposition. The MTCs incorporate cathode to anode spacing of about 1 micron or less and use cathode and anode materials having work functions ranging from about 1 eV to about 3 eV. The MTCs also exhibit maximum efficiencies of just under 30%, and thousands of the devices and modules can be fabricated at modest costs.

  11. Module No: 420244International Humanitarian Module Title

    E-Print Network [OSTI]

    Module No: 420244International Humanitarian law Module Title: Co-requisite:public international law 1Pre-requisite: Module Type: specialization requirementModule level: Second year Evening Study-mailOffice Number Office Phone Academic rank Instructor Name E-mailOffice Number Office Phone Academic rank Module

  12. module.h

    E-Print Network [OSTI]

    /* OS-9 module header definitions */ /* Executable memory module */ typedef struct { unsigned m_sync, /* sync bytes ($87cd) */ m_size, /* module size ...

  13. 11th Grade Students' English Reading Motivation, Language Problems and Reading Achievement in Taiwan 

    E-Print Network [OSTI]

    Su, Jung-Hsuan

    2012-07-16

    ’ English reading motivation and its relationship with perceived language problems and reading achievement. 302 11th grade students from an urban district in southern Taiwan participated in the study. Measures included an English reading comprehension...

  14. Thermoelectric module

    DOE Patents [OSTI]

    Kortier, William E. (Columbus, OH); Mueller, John J. (Columbus, OH); Eggers, Philip E. (Columbus, OH)

    1980-07-08

    A thermoelectric module containing lead telluride as the thermoelectric mrial is encapsulated as tightly as possible in a stainless steel canister to provide minimum void volume in the canister. The lead telluride thermoelectric elements are pressure-contacted to a tungsten hot strap and metallurgically bonded at the cold junction to iron shoes with a barrier layer of tin telluride between the iron shoe and the p-type lead telluride element.

  15. Photovoltaic module and module arrays

    DOE Patents [OSTI]

    Botkin, Jonathan; Graves, Simon; Lenox, Carl J. S.; Culligan, Matthew; Danning, Matt

    2013-08-27

    A photovoltaic (PV) module including a PV device and a frame, The PV device has a PV laminate defining a perimeter and a major plane. The frame is assembled to and encases the laminate perimeter, and includes leading, trailing, and side frame members, and an arm that forms a support face opposite the laminate. The support face is adapted for placement against a horizontal installation surface, to support and orient the laminate in a non-parallel or tilted arrangement. Upon final assembly, the laminate and the frame combine to define a unitary structure. The frame can orient the laminate at an angle in the range of 3.degree.-7.degree. from horizontal, and can be entirely formed of a polymeric material. Optionally, the arm incorporates integral feature(s) that facilitate interconnection with corresponding features of a second, identically formed PV module.

  16. Photovoltaic module and module arrays

    DOE Patents [OSTI]

    Botkin, Jonathan (El Cerrito, CA); Graves, Simon (Berkeley, CA); Lenox, Carl J. S. (Oakland, CA); Culligan, Matthew (Berkeley, CA); Danning, Matt (Oakland, CA)

    2012-07-17

    A photovoltaic (PV) module including a PV device and a frame. The PV device has a PV laminate defining a perimeter and a major plane. The frame is assembled to and encases the laminate perimeter, and includes leading, trailing, and side frame members, and an arm that forms a support face opposite the laminate. The support face is adapted for placement against a horizontal installation surface, to support and orient the laminate in a non-parallel or tilted arrangement. Upon final assembly, the laminate and the frame combine to define a unitary structure. The frame can orient the laminate at an angle in the range of 3.degree.-7.degree. from horizontal, and can be entirely formed of a polymeric material. Optionally, the arm incorporates integral feature(s) that facilitate interconnection with corresponding features of a second, identically formed PV module.

  17. Running head: Reading Mathematical Proofs

    E-Print Network [OSTI]

    Inglis, Matthew

    , and is increasingly seen as essential to a coherent school-level mathematics curriculum (e.g., Cowen, 1991; Hanna, 2007; National Council of Teachers of Mathematics [NCTM], 2000; Selden & Selden, 2003; Weber, 2008. #12;4 In this paper we report the first direct comparison of the proof reading behavior of research

  18. Supported PV module assembly

    SciTech Connect (OSTI)

    Mascolo, Gianluigi; Taggart, David F.; Botkin, Jonathan D.; Edgett, Christopher S.

    2013-10-15

    A supported PV assembly may include a PV module comprising a PV panel and PV module supports including module supports having a support surface supporting the module, a module registration member engaging the PV module to properly position the PV module on the module support, and a mounting element. In some embodiments the PV module registration members engage only the external surfaces of the PV modules at the corners. In some embodiments the assembly includes a wind deflector with ballast secured to a least one of the PV module supports and the wind deflector. An array of the assemblies can be secured to one another at their corners to prevent horizontal separation of the adjacent corners while permitting the PV modules to flex relative to one another so to permit the array of PV modules to follow a contour of the support surface.

  19. Module Embedding Atanas Radenski

    E-Print Network [OSTI]

    Radenski, Atanas

    Module Embedding 1 Atanas Radenski Computer Science Department UNC-WSSU, P. O. Box 19479 Winston module embedding that enables the building of new modules from existing ones through inheritance for this mechanism. Module embedding is beneficial when modules and classes are used in combination and need

  20. The Read Out Controller for the ATLAS New Small Wheel

    E-Print Network [OSTI]

    Coliban, Radu Mihai; The ATLAS collaboration; Tulbure, Traian Tiberiu; Ivanovici, Mihail; Martoiu, Victor Sorin; Levinson, Lorne; Vermeulen, Jos

    2015-01-01

    In the upgrade process of the ATLAS detector, the innermost stations of the endcaps (Small Wheels, SW) will be replaced. The New Small Wheel (NSW) will have two chamber technologies, one for the Level-1 trigger function (small-strip Thin Gap Chambers, sTGC) and one primarily dedicated to precision tracking (Micromegas detectors, MM). Custom front-end Application Specific Integrated Circuits (ASICs) will be used to read and filter information from both the sTGC and MM detectors. In the context of the New Small Wheel data path, we designed the Read Out Controller (ROC) ASIC for handling, preprocessing and formatting the data generated by the NSW VMM upstream chips. The ROC will concentrate the data streams from 8 VMMs, filter data based on the BCID and transmit the data to FELIX via the L1DDC. ROC is composed of 8 VMM Capture modules, a cross-bar and 4 SubROC modules. The output data is sent via 4 high-speed e-links.

  1. Working with Modules within Python

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Using Modules within Python The EnvironmentModules python package gives access to the module system from within python. The EnvironmentModules python package has a single...

  2. Read

    E-Print Network [OSTI]

    Fineprint Bookclub

    2009-01-01

    !I.t" hi. d! ....... gol ""l1:li_8 InoaIpIano: FClrNftj, A l1>li '" Notr\\I'.1rodII - --..... FCIr NioIj, ~­ - ­ """ NoI "Ioo_ ~_. ~ In """ ........ Nod"rIa OM IIIkId ib:lLll ~ .. d~fIII doIILIl, Fhak, and h 1I"OllIw, Amllob~ au_ ta/IIod .r... !I.t" hi. d! ....... gol ""l1:li_8 InoaIpIano: FClrNftj, A l1>li '" Notr\\I'.1rodII - --..... FCIr NioIj, ~­ - ­ """ NoI "Ioo_ ~_. ~ In """ ........ Nod"rIa OM IIIkId ib:lLll ~ .. d~fIII doIILIl, Fhak, and h 1I"OllIw, Amllob~ au_ ta/IIod .r...

  3. Common but impac-ul gene1c polymorphisms in COMT & BDNF are associated strongly with reading and related skills and associated paAerns of neural ac1vity

    E-Print Network [OSTI]

    . · The COMT Val/Met polymorphism alters not only brain func1on but brain structure, but not the Val/Met or Met/Met combina1on, show reading skill modulated paAerns of neural

  4. Asbestos fibers mediate transformation of monkey cells by exogenous plasmid DNA

    SciTech Connect (OSTI)

    Appel, J.D.; Fasy, T.M.; Kohtz, D.S.; Kohtz, J.D.; Johnson, E.M. (Mount Sinai School of Medicine of the City Univ. of New York, NY (USA))

    1988-10-01

    The authors have tested the ability of chrysotile asbestos fibers to introduce plasmid DNA into monkey COS-7 cells and the ability of this DNA to function in both replication and gene expression. Chrysotile fibers are at least as effective as calcium phosphate in standard transfection assays at optimal ratios of asbestos to DNA. After transfection with chrysotile, a minor percentage of introduced plasmid DNA bearing a simian virus 40 origin of replication replicates after 24 hr. Fragmentation of entering DNA is more prominent with asbestos than with calcium phosphate, and after 72 hr most DNA introduced by asbestos is associated with chromosomal DNA. Cells transfected with plasmid p11-4, bearing the p53 protooncogene, express this gene. Cells transfected with pSV2-neo express a gene conferring resistance of antibiotic G418, allowing isolation of colonies of transformed cells after 18 days. The introduction of exogenous DNA into eukaryotic cells could cause mutations in several ways and thus contribute to asbestos-induced oncogenesis.

  5. Ballasted photovoltaic module and module arrays

    DOE Patents [OSTI]

    Botkin, Jonathan (El Cerrito, CA); Graves, Simon (Berkeley, CA); Danning, Matt (Oakland, CA)

    2011-11-29

    A photovoltaic (PV) module assembly including a PV module and a ballast tray. The PV module includes a PV device and a frame. A PV laminate is assembled to the frame, and the frame includes an arm. The ballast tray is adapted for containing ballast and is removably associated with the PV module in a ballasting state where the tray is vertically under the PV laminate and vertically over the arm to impede overt displacement of the PV module. The PV module assembly can be installed to a flat commercial rooftop, with the PV module and the ballast tray both resting upon the rooftop. In some embodiments, the ballasting state includes corresponding surfaces of the arm and the tray being spaced from one another under normal (low or no wind) conditions, such that the frame is not continuously subjected to a weight of the tray.

  6. Shield Module Design Considerations

    E-Print Network [OSTI]

    McDonald, Kirk

    Shield Module Design Considerations Adam Carroll Van Graves July 3, 2014 #12;2 Managed by UT-Battelle for the U.S. Department of Energy Shield Module Design Considerations 3 July 2014 Overview · Capability to remotely remove and reinstall the shield modules is required · Shield module concept is He-cooled tungsten

  7. Deep Packet Filter with Dedicated Logic and Read Only Memories Young H. Cho and William H. Mangione-Smith

    E-Print Network [OSTI]

    Cho, Young Hyun

    Deep Packet Filter with Dedicated Logic and Read Only Memories Young H. Cho and William H. Mangione is a computationally expensive task. The speed of the search pattern module determines the overall performance of deep of deep packet filters to detect application level attacks in the packet payloads. Deep packet filters

  8. Tracking Reading: Dual Task Costs of Oral Reading for Young Versus Older Adults

    E-Print Network [OSTI]

    Kemper, Susan; Bontempo, Daniel; Schmalzried, RaLynn Cheri; McKedy, Whitney; Tagliaferri, Bruno; Kieweg, Doug

    2014-02-01

    A digital pursuit rotor was used to monitor oral reading costs by time-locking tracking performance to the auditory wave form produced as young and older adults were reading out short paragraphs. Multilevel modeling was ...

  9. Interrelationship of endogenous and exogenous prostaglandins with uterine involution and postpartum interval in beef cows and heifers 

    E-Print Network [OSTI]

    Tolleson, Douglas Ray

    1986-01-01

    Interrelationship of Endogenous and Exogenous Prostaglandins with Uterine Involution and Postpartum Interval in Beef Cows and Heifers (August 1986) Douglas Ray Tolleson, B. S. , Texas ALM University Chairman of Advisory Committee: Dr. Ronald D. Randel A review... ALPHA PRODUCTION BY THE INVOLUTING BOVINE UTERUS AT 14 AND 35 DAYS POSTPARTUM: PATTERN OF RELEASE AND RESPONSE TO PHYSICAL MANIPULATION. 26 28 33 44 47 Introduction. . . . . . . . . Materia1s and Methods. Resu1ts. Discussion. CHAPTER V...

  10. Global warming debates: the reading course

    E-Print Network [OSTI]

    Huybers, Peter

    Global warming debates: the reading course Spring 2014 Instructors: Peter Huybers and Eli Tziperman of global warming", please prepare by reading "the climate of man", IPCC introduction, and Lindzen article. background basics. l 1. Mountain Glaciers: Are mountain glaciers melting? Due to global warming? First, see

  11. Online Reading Lists Instructions for Academic Staff

    E-Print Network [OSTI]

    Brierley, Andrew

    the heading `Subject Guides and Reading Lists') Enter Reading Lists link. Then Sign in (top right) using your will be asked to set up a profile ­ this takes just a minute and enables students to search for lists associated software you will need to install a `Bookmarklet' tool. `Bookmarks' is the term used by the software

  12. Reading for Thursday Emissions scenario summary

    E-Print Network [OSTI]

    Schweik, Charles M.

    emissions, for year 2000 #12;USA ­ CO2 emissions from fossil fuel combustion (2005) US EPA #12;#12;#12;Decreasing 13C strongly suggests that the source of atmospheric CO2 is fossil carbon #12;Line of evidence #1Reading for Thursday · Emissions scenario summary: ­ Read pages 3-6 · IPCC Chapter 11 (Regional

  13. REGISTRATION FORM CUNY GRADUATE CENTER LANGUAGE READING PROGRAM

    E-Print Network [OSTI]

    Johnson Jr.,, Ray

    REGISTRATION FORM CUNY GRADUATE CENTER LANGUAGE READING PROGRAM First name order payable to CUNY GRADUATE CENTER and send it to the CUNY Graduate Center Language Reading Program: ________________________________________ Date: ____________________ If a course is cancelled by the Language Reading Program, registrants

  14. Exogenous contrast agents for thermoacoustic imaging: An investigation into the underlying sources of contrast

    SciTech Connect (OSTI)

    Ogunlade, Olumide Beard, Paul

    2015-01-15

    Purpose: Thermoacoustic imaging at microwave excitation frequencies is limited by the low differential contrast exhibited by high water content tissues. To overcome this, exogenous thermoacoustic contrast agents based on gadolinium compounds, iron oxide, and single wall carbon nanotubes have previously been suggested and investigated. However, these previous studies did not fully characterize the electric, magnetic, and thermodynamic properties of these agents thus precluding identification of the underlying sources of contrast. To address this, measurements of the complex permittivity, complex permeability, DC conductivity, and Grüneisen parameter have been made. These measurements allowed the origins of the contrast provided by each substance to be identified. Methods: The electric and magnetic properties of the contrast agents were characterized at 3 GHz using two rectangular waveguide cavities. The DC conductivity was measured separately using a conductivity meter. Thermoacoustic signals were then acquired and compared to those generated in water. Finally, 3D electromagnetic simulations were used to decouple the different contributions to the absorbed power density. Results: It was found that the gadolinium compounds provided appreciable electric contrast but not originating from the gadolinium itself. The contrast was either due to dissociation of the gadolinium salt which increased ionic conductivity or its nondissociated polar fraction which increased dielectric polarization loss or a combination of both. In addition, very high concentrations were required to achieve appreciable contrast, to the extent that the Grüneisen parameter increased significantly and became a source of contrast. Iron oxide particles were found to produce low but measurable dielectric contrast due to dielectric polarization loss, but this is attributed to the coating of the particles not the iron oxide. Single wall carbon nanotubes did not provide measurable contrast of any type. Conclusions: It is concluded that gadolinium based contrast agents, iron oxide particles, and single walled carbon nanotubes have little intrinsic merit as thermoacoustic contrast agents. Simple electrolytes such as saline which yield high contrast based on ionic conductivity provide much higher dielectric contrast per unit solute concentration and are likely to be significantly more effective as contrast agents.

  15. Advanced silicon photonic modulators

    E-Print Network [OSTI]

    Sorace, Cheryl M

    2010-01-01

    Various electrical and optical schemes used in Mach-Zehnder (MZ) silicon plasma dispersion effect modulators are explored. A rib waveguide reverse biased silicon diode modulator is designed, tested and found to operate at ...

  16. Modulating lignin in plants

    DOE Patents [OSTI]

    Apuya, Nestor; Bobzin, Steven Craig; Okamuro, Jack; Zhang, Ke

    2013-01-29

    Materials and methods for modulating (e.g., increasing or decreasing) lignin content in plants are disclosed. For example, nucleic acids encoding lignin-modulating polypeptides are disclosed as well as methods for using such nucleic acids to generate transgenic plants having a modulated lignin content.

  17. Quantum Reading of Unitary Optical Devices

    E-Print Network [OSTI]

    Michele Dall'Arno; Alessandro Bisio; Giacomo Mauro D'Ariano

    2015-02-20

    We address the problem of quantum reading of optical memories, namely the retrieving of classical information stored in the optical properties of a media with minimum energy. We present optimal strategies for ambiguous and unambiguous quantum reading of unitary optical memories, namely when one's task is to minimize the probability of errors in the retrieved information and when perfect retrieving of information is achieved probabilistically, respectively. A comparison of the optimal strategy with coherent probes and homodyne detection shows that the former saves orders of magnitude of energy when achieving the same performances. Experimental proposals for quantum reading which are feasible with present quantum optical technology are reported.

  18. "Big data" workshop Digital Reading Network

    E-Print Network [OSTI]

    Bradstock, Burton

    change issues across science, politics, environment, etc. · Harvested the complete content of about 3 change politics": climate, change, countries, world, environmental, international, development, global of readings `social class theory ideology political production ideological historical marxist marx bourgeois

  19. De Novo Sequencing with Short Reads: Does the Read Length Matter? (2009 JGI User Meeting)

    ScienceCinema (OSTI)

    Pezner, Pavel A

    2011-04-25

    Pavel Pevzner of UC San Diego spoke about "De Novo Sequencing with Short Reads" on March 26, 2009 during the 4th Annual User Meeting

  20. Bracket for photovoltaic modules

    DOE Patents [OSTI]

    Ciasulli, John; Jones, Jason

    2014-06-24

    Brackets for photovoltaic ("PV") modules are described. In one embodiment, a saddle bracket has a mounting surface to support one or more PV modules over a tube, a gusset coupled to the mounting surface, and a mounting feature coupled to the gusset to couple to the tube. The gusset can have a first leg and a second leg extending at an angle relative to the mounting surface. Saddle brackets can be coupled to a torque tube at predetermined locations. PV modules can be coupled to the saddle brackets. The mounting feature can be coupled to the first gusset and configured to stand the one or more PV modules off the tube.

  1. Module No: 410336Personal Statutes for Non-Module Title

    E-Print Network [OSTI]

    Module No: 410336Personal Statutes for Non- Muslims Module Title: Co-requisite:Introduction of Islamic Jurisprudence Pre-requisite: Module Type: specialization requirementModule level: Third Year Academic rank Module coordinator 307384Assistant Professor Dr. Fuad Sartawi ResearchTutorial Guidance

  2. Module No: 410319Copyrights and Neighboring Module Title

    E-Print Network [OSTI]

    Module No: 410319Copyrights and Neighboring Rights Module Title: Co-requisite:Effects of ObligationsPre-requisite: Module Type: specialization elective requirementModule level: Third Year Evening Academic rank Module coordinator e-bataineh@philadelphia.edu.joAssistant Professor Dr. Iyad Bataineh

  3. Approved Module Information for PD2003, 2014/5 Module Title/Name: Engineering Principles 2 Module Code: PD2003

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PD2003, 2014/5 Module Title/Name: Engineering Principles 2 Module Code: PD2003 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module? No Module Dependancies Pre-requisites: Engineering Principles (PD1803). Co-requisites: None Specified Module

  4. Approved Module Information for BF2210, 2014/5 Module Title/Name: Making Managerial Decisions Module Code: BF2210

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BF2210, 2014/5 Module Title/Name: Making Managerial Decisions Module Code: BF2210 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 20 Module Management Information Module Leader Name Florian Gebreiter Email Address gebreif1

  5. Approved Module Information for LPM040, 2014/5 Module Title/Name: Rethinking European Integration Module Code: LPM040

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LPM040, 2014/5 Module Title/Name: Rethinking European Integration Module Code: LPM040 School: Languages and Social Sciences Module Type: Standard Module New Module? Yes Module Credits: 20 Module Management Information Module Leader Name Nathaniel Copsey Email Address n

  6. Approved Module Information for LEM039, 2014/5 Module Title/Name: Grammar Module Code: LEM039

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LEM039, 2014/5 Module Title/Name: Grammar Module Code: LEM039 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 20 Module Management Information Module Leader Name Urszula Clark Email Address u

  7. Approved Module Information for LS3006, 2014/5 Module Title/Name: Hispanic Film Module Code: LS3006

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LS3006, 2014/5 Module Title/Name: Hispanic Film Module Code: LS3006 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 10 Module Management Information Module Leader Name Raquel Medina Email Address r

  8. Approved Module Information for LT2102, 2014/5 Module Title/Name: Inventory Control Module Code: LT2102

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LT2102, 2014/5 Module Title/Name: Inventory Control Module Code: LT2102 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name James Stone Email Address j

  9. Approved Module Information for PY2217, 2014/5 Module Title/Name: Personality Practical (JH) Module Code: PY2217

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PY2217, 2014/5 Module Title/Name: Personality Practical (JH) Module Code: PY2217 School: Life and Health Sciences Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Ed Walford Email Address e

  10. Approved Module Information for BS3347, 2014/5 Module Title/Name: Economics of Entrepreneurship Module Code: BS3347

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BS3347, 2014/5 Module Title/Name: Economics of Entrepreneurship Module Code: BS3347 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Anna Rebmann Email Address rebmanna

  11. Approved Module Information for PY3351, 2014/5 Module Title/Name: Child Development Module Code: PY3351

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PY3351, 2014/5 Module Title/Name: Child Development Module Code: PY3351 School: Life and Health Sciences Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Claire Farrow Email Address farrowc

  12. Approved Module Information for CE2110, 2014/5 Module Title/Name: Process Laboratory Module Code: CE2110

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CE2110, 2014/5 Module Title/Name: Process Laboratory Module Code: CE2110 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name John Brammer Email Address brammejg

  13. Approved Module Information for LK2004, 2014/5 Module Title/Name: Global Society Module Code: LK2004

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LK2004, 2014/5 Module Title/Name: Global Society Module Code: LK2004 School: Languages and Social Sciences Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Demelza Jones Email Address jonesd4@aston

  14. Approved Module Information for CH3117, 2014/5 Module Title/Name: Literature Research Project Module Code: CH3117

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CH3117, 2014/5 Module Title/Name: Literature Research Project Module Code: CH3117 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Andrew James Sutherland Email Address

  15. Approved Module Information for LE1008, 2014/5 Module Title/Name: Grammar & Meaning Module Code: LE1008

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LE1008, 2014/5 Module Title/Name: Grammar & Meaning Module Code: LE1008 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 10 Module Management Information Module Leader Name Jack Grieve Email Address grievej1

  16. Approved Module Information for BN3385, 2014/5 Module Title/Name: Effective Project Delivery Module Code: BN3385

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BN3385, 2014/5 Module Title/Name: Effective Project Delivery Module Code: BN3385 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 20 Module Management Information Module Leader Name Panagiotis Petridis Email Address petridip

  17. Approved Module Information for BS1163, 2014/5 Module Title/Name: Introduction to Microeconomics Module Code: BS1163

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BS1163, 2014/5 Module Title/Name: Introduction to Microeconomics Module Code: BS1163 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name David Morris Email Address morrisd5@aston

  18. Approved Module Information for LEM016, 2014/5 Module Title/Name: Methodology Module Code: LEM016

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LEM016, 2014/5 Module Title/Name: Methodology Module Code: LEM016 School: Languages and Social Sciences Module Type: Standard Module New Module? No Module Credits: 20 Module Management Information Module Leader Name Muna Morris-Adams Email Address adamsmm

  19. Approved Module Information for BF2251, 2014/5 Module Title/Name: Financial Management Module Code: BF2251

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BF2251, 2014/5 Module Title/Name: Financial Management Module Code: BF2251 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 20 Module Management Information Module Leader Name Colin Chapman Email Address chapmac1@aston

  20. Approved Module Information for LT2315, 2014/5 Module Title/Name: Rail Transport Module Code: LT2315

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LT2315, 2014/5 Module Title/Name: Rail Transport Module Code: LT2315 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name P Connor Email Address connorp

  1. Approved Module Information for ME2018, 2014/5 Module Title/Name: Quality Engineering Module Code: ME2018

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for ME2018, 2014/5 Module Title/Name: Quality Engineering Module Code: ME2018 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name David Upton Email Address uptondp

  2. Approved Module Information for LI2008, 2014/5 Module Title/Name: Communication across Cultures Module Code: LI2008

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LI2008, 2014/5 Module Title/Name: Communication across Cultures Module Code: LI2008 School: Languages and Social Sciences Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Olga Castro Email Address o

  3. Approved Module Information for CE4018, 2014/5 Module Title/Name: Advanced Particle Processing Module Code: CE4018

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CE4018, 2014/5 Module Title/Name: Advanced Particle Processing Module Code: CE4018 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Mark Leaper Email Address m

  4. Approved Module Information for SE4031, 2014/5 Module Title/Name: Extended Integrative Option Module Code: SE4031

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for SE4031, 2014/5 Module Title/Name: Extended Integrative Option Module Code: SE4031 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 30 Module Management Information Module Leader Name Trevor Oliver Email Address t

  5. Approved Module Information for LT1312, 2014/5 Module Title/Name: Literature Review Project Module Code: LT1312

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LT1312, 2014/5 Module Title/Name: Literature Review Project Module Code: LT1312 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name David Carpenter Email Address d

  6. Approved Module Information for LS2017, 2014/5 Module Title/Name: Contemporary Latin America Module Code: LS2017

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LS2017, 2014/5 Module Title/Name: Contemporary Latin America Module Code: LS2017 School: Languages and Social Sciences Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Stephanie Panichelli-Batalla Email Address

  7. Approved Module Information for CE3013, 2014/5 Module Title/Name: Particle Processing Module Code: CE3013

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CE3013, 2014/5 Module Title/Name: Particle Processing Module Code: CE3013 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Mark Leaper Email Address m

  8. Approved Module Information for LE2057, 2014/5 Module Title/Name: Computer Mediated Communication Module Code: LE2057

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LE2057, 2014/5 Module Title/Name: Computer Mediated Communication Module Code: LE2057 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 20 Module Management Information Module Leader Name Nur Hooton Email Address n

  9. Approved Module Information for BS3325, 2014/5 Module Title/Name: Competition Policy -Theory Module Code: BS3325

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BS3325, 2014/5 Module Title/Name: Competition Policy - Theory Module Code: BS3325 School: Aston Business School Module Type: Standard Module New Module? Yes Module Credits: 10 Module Management Information Module Leader Name Matt Olczak Email Address olczakm

  10. Approved Module Information for BL1179, 2014/5 Module Title/Name: Accounting for Law Module Code: BL1179

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BL1179, 2014/5 Module Title/Name: Accounting for Law Module Code: BL1179 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Angela Stanhope Email Address a

  11. Approved Module Information for BFM120, 2014/5 Module Title/Name: Investment Management Module Code: BFM120

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BFM120, 2014/5 Module Title/Name: Investment Management Module Code: BFM120 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 15 Module Management Information Module Leader Name Colin Chapman Email Address chapmac1@aston

  12. Approved Module Information for PY2216, 2014/5 Module Title/Name: Neuroscience Practicals Module Code: PY2216

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PY2216, 2014/5 Module Title/Name: Neuroscience Practicals Module Code: PY2216 School: Life and Health Sciences Module Type: Standard Module New Module? Yes Module Credits: 10 Module Management Information Module Leader Name Ed Walford Email Address e

  13. Approved Module Information for BHM348, 2014/5 Module Title/Name: Employee Relations & Counselling Module Code: BHM348

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BHM348, 2014/5 Module Title/Name: Employee Relations & Counselling Module Code: BHM348 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 15 Module Management Information Module Leader Name M Carter Email Address cartermr

  14. Approved Module Information for LT1307, 2014/5 Module Title/Name: Principles of Economics Module Code: LT1307

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LT1307, 2014/5 Module Title/Name: Principles of Economics Module Code: LT1307 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name David Carpenter Email Address d

  15. Approved Module Information for ME2050, 2014/5 Module Title/Name: Dynamics and Control Module Code: ME2050

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for ME2050, 2014/5 Module Title/Name: Dynamics and Control Module Code: ME2050 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Xianghong Ma Email Address max

  16. Approved Module Information for BHM328, 2014/5 Module Title/Name: Strategic Business Sustainability Module Code: BHM328

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BHM328, 2014/5 Module Title/Name: Strategic Business Sustainability Module Code: BHM328 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 15 Module Management Information Module Leader Name H Borland Email Address borlanhm

  17. Approved Module Information for BF2244, 2014/5 Module Title/Name: Strategic Finance Module Code: BF2244

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BF2244, 2014/5 Module Title/Name: Strategic Finance Module Code: BF2244 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Colin Chapman Email Address chapmac1@aston

  18. Approved Module Information for CE3102, 2014/5 Module Title/Name: Reaction Engineering Module Code: CE3102

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CE3102, 2014/5 Module Title/Name: Reaction Engineering Module Code: CE3102 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Feroz Kabir Email Address kabirf

  19. Approved Module Information for LE2053, 2014/5 Module Title/Name: Variations of English Module Code: LE2053

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LE2053, 2014/5 Module Title/Name: Variations of English Module Code: LE2053 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 20 Module Management Information Module Leader Name Jack Grieve Email Address grievej1

  20. Approved Module Information for BF3314, 2014/5 Module Title/Name: Derivatives Module Code: BF3314

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BF3314, 2014/5 Module Title/Name: Derivatives Module Code: BF3314 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Winifred Huang-Meier Email Address w

  1. Approved Module Information for PY3472, 2014/5 Module Title/Name: Autistic Spectrum Module Code: PY3472

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PY3472, 2014/5 Module Title/Name: Autistic Spectrum Module Code: PY3472 School: Life and Health Sciences Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Gina Rippon Email Address rippong@aston.ac.uk Telephone

  2. Approved Module Information for CE3112, 2014/5 Module Title/Name: Nanomaterials Module Code: CE3112

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CE3112, 2014/5 Module Title/Name: Nanomaterials Module Code: CE3112 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Qingchun Yuan Email Address q.yuan@aston.ac.uk Telephone

  3. Approved Module Information for CE1002, 2014/5 Module Title/Name: Design and Build Module Code: CE1002

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CE1002, 2014/5 Module Title/Name: Design and Build Module Code: CE1002 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Paul Andrew Tack Email Address tackpa

  4. Approved Module Information for LG2018, 2014/5 Module Title/Name: Metropolis Berlin Module Code: LG2018

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LG2018, 2014/5 Module Title/Name: Metropolis Berlin Module Code: LG2018 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 10 Module Management Information Module Leader Name Uwe Schütte Email Address u

  5. Approved Module Information for PD2002, 2014/5 Module Title/Name: Commercial Practice Module Code: PD2002

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PD2002, 2014/5 Module Title/Name: Commercial Practice Module Code: PD2002 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 20 Module Management Information Module Leader Name Jon Hewitt Email Address Not Specified

  6. Approved Module Information for BN2290, 2014/5 Module Title/Name: Operational Research Techniques Module Code: BN2290

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BN2290, 2014/5 Module Title/Name: Operational Research Techniques Module Code: BN2290 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Ozren Despic Email Address o

  7. Approved Module Information for LT1319, 2014/5 Module Title/Name: Air Transport Module Code: LT1319

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LT1319, 2014/5 Module Title/Name: Air Transport Module Code: LT1319 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name James Stone Email Address j.stone@aston.ac.uk Telephone

  8. Module Descriptor 2012/13 School of Computer Science and Statistics.

    E-Print Network [OSTI]

    O'Mahony, Donal E.

    Contact Hours Lecture hours:22 Lab hours: Tutorial hours:11 Total hours:33 Module Personnel Lecturing retrieval on the web: o First generation search engines; o The HITS algorithm; o Google; Scamming Google; o The next generation of search engines. Recommended Reading List 1. Fundamentals of Database Systems

  9. Encapsulation of High Temperature Thermoelectric Modules | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Encapsulation of High Temperature Thermoelectric Modules Encapsulation of High Temperature Thermoelectric Modules Presents concept for hermetic encapsulation of TE modules...

  10. Membrane module assembly

    DOE Patents [OSTI]

    Kaschemekat, J.

    1994-03-15

    A membrane module assembly is described which is adapted to provide a flow path for the incoming feed stream that forces it into prolonged heat-exchanging contact with a heating or cooling mechanism. Membrane separation processes employing the module assembly are also disclosed. The assembly is particularly useful for gas separation or pervaporation. 2 figures.

  11. Membrane module assembly

    DOE Patents [OSTI]

    Kaschemekat, Jurgen (Palo Alto, CA)

    1994-01-01

    A membrane module assembly adapted to provide a flow path for the incoming feed stream that forces it into prolonged heat-exchanging contact with a heating or cooling mechanism. Membrane separation processes employing the module assembly are also disclosed. The assembly is particularly useful for gas separation or pervaporation.

  12. Module Safety Issues (Presentation)

    SciTech Connect (OSTI)

    Wohlgemuth, J.

    2012-02-01

    Description of how to make PV modules so that they are less likely to turn into safety hazards. Making modules inherently safer with minimum additional cost is the preferred approach for PV. Safety starts with module design to ensure redundancy within the electrical circuitry to minimize open circuits and proper mounting instructions to prevent installation related ground faults. Module manufacturers must control the raw materials and processes to ensure that that every module is built like those qualified through the safety tests. This is the reason behind the QA task force effort to develop a 'Guideline for PV Module Manufacturing QA'. Periodic accelerated stress testing of production products is critical to validate the safety of the product. Combining safer PV modules with better systems designs is the ultimate goal. This should be especially true for PV arrays on buildings. Use of lower voltage dc circuits - AC modules, DC-DC converters. Use of arc detectors and interrupters to detect arcs and open the circuits to extinguish the arcs.

  13. Module Handbook Fernstudium

    E-Print Network [OSTI]

    Berns, Karsten

    Module Handbook Fernstudium postgradual Nanotechnology (Master of Science) Infineon Technology, Munich Distance studies postgraduate #12;Module name Fundamentals of Quantum Mechanics Lecturer apl. Prof is to present the fundamental concepts of quantum physics in a way that a clear understanding of the theoretical

  14. DOE-ID FOIA Reading Room

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation Current HAB Packet HanfordDOE Project TapsofofDoubleReading Room READING ROOM

  15. Photovoltaic module and interlocked stack of photovoltaic modules

    DOE Patents [OSTI]

    Wares, Brian S.

    2014-09-02

    One embodiment relates to an arrangement of photovoltaic modules configured for transportation. The arrangement includes a plurality of photovoltaic modules, each photovoltaic module including a frame. A plurality of individual male alignment features and a plurality of individual female alignment features are included on each frame. Adjacent photovoltaic modules are interlocked by multiple individual male alignment features on a first module of the adjacent photovoltaic modules fitting into and being surrounded by corresponding individual female alignment features on a second module of the adjacent photovoltaic modules. Other embodiments, features and aspects are also disclosed.

  16. Module bay with directed flow

    SciTech Connect (OSTI)

    Torczynski, John R. (Albuquerque, NM)

    2001-02-27

    A module bay requires less cleanroom airflow. A shaped gas inlet passage can allow cleanroom air into the module bay with flow velocity preferentially directed toward contaminant rich portions of a processing module in the module bay. Preferential gas flow direction can more efficiently purge contaminants from appropriate portions of the module bay, allowing a reduced cleanroom air flow rate for contaminant removal. A shelf extending from an air inlet slit in one wall of a module bay can direct air flowing therethrough toward contaminant-rich portions of the module bay, such as a junction between a lid and base of a processing module.

  17. Global warming debates: the reading course

    E-Print Network [OSTI]

    Huybers, Peter

    Global warming debates: the reading course spring 2012 Instructors: Eli Tziperman and Peter Huybers Hurricanes due to global warming? Apr 7: Stratospheric cooling: Why is the stratosphere cooling? Apr 14: Mid will be the impact of global warming on agriculture? Apr 28: Final Debate: Take sides! Should we act to curb global

  18. Global warming debates: the reading course

    E-Print Network [OSTI]

    Huybers, Peter

    Global warming debates: the reading course spring 2010 Instructors: Eli Tziperman and Peter Huybers Hurricanes due to global warming? Apr 7: Stratospheric cooling: Why is the stratosphere cooling? Apr 14: Mid will be the impact of global warming on agriculture? Apr 28: Final Debate: Take sides! Should we act to curb global

  19. Problem Solving Framework Read the problem carefully.

    E-Print Network [OSTI]

    Minnesota, University of

    Problem Solving Framework Read the problem carefully. Draw a useful picture (sketch) that shows how identified in Step 1. 1. Understand the Problem 2. Analyze the Problem 3. Construct a Solution Apply constraint equations) to eliminate the unwanted unknowns? Use math (algebra/calculus) to solve for target

  20. Automatic Object Colocation Based on Read Barriers

    E-Print Network [OSTI]

    Mössenböck, Hanspeter

    matches their access order in the program. We implemented this optimization for Sun Microsystems' Java HotSpotTM VM. The garbage collector, which moves objects during collection, assigns consecutive ad- dresses-called hot-field tables, which are then used by the garbage collector for colocation decisions. Read barriers

  1. Earth Minerals Did you read chapter 29

    E-Print Network [OSTI]

    Hart, Gus

    1 Chapter 29 Earth Minerals Did you read chapter 29 before coming to class? A. Yes B. No Lets play that begins in Hawaii Other "Hot Spots" around the world The interior structure of Earth has been determined outer core #12;2 What is different on earth (as opposed to other planets)? Continents Why does

  2. Classical Mechanics (Prof. P. L. Read)

    E-Print Network [OSTI]

    Read, Peter L.

    Classical Mechanics (Prof. P. L. Read) Lecture 1 Photograph © Andrew Dunn, 5 November 2004. #12;What is Classical Mechanics? · .. rational mechanics will be the science of motion resulting from any Mechanics? · System of mathematical physics developed since the time of Galileo, Newton & Kepler · Concerned

  3. Water heater control module

    DOE Patents [OSTI]

    Hammerstrom, Donald J

    2013-11-26

    An advanced electric water heater control system that interfaces with a high temperature cut-off thermostat and an upper regulating thermostat. The system includes a control module that is electrically connected to the high-temperature cut-off thermostat and the upper regulating thermostat. The control module includes a switch to open or close the high-temperature cut-off thermostat and the upper regulating thermostat. The control module further includes circuitry configured to control said switch in response to a signal selected from the group of an autonomous signal, a communicated signal, and combinations thereof.

  4. Sonication standard laboratory module

    DOE Patents [OSTI]

    Beugelsdijk, Tony (Los Alamos, NM); Hollen, Robert M. (Los Alamos, NM); Erkkila, Tracy H. (Los Alamos, NM); Bronisz, Lawrence E. (Los Alamos, NM); Roybal, Jeffrey E. (Santa Fe, NM); Clark, Michael Leon (Menan, ID)

    1999-01-01

    A standard laboratory module for automatically producing a solution of cominants from a soil sample. A sonication tip agitates a solution containing the soil sample in a beaker while a stepper motor rotates the sample. An aspirator tube, connected to a vacuum, draws the upper layer of solution from the beaker through a filter and into another beaker. This beaker can thereafter be removed for analysis of the solution. The standard laboratory module encloses an embedded controller providing process control, status feedback information and maintenance procedures for the equipment and operations within the standard laboratory module.

  5. Modulated curvaton decay

    SciTech Connect (OSTI)

    Assadullahi, Hooshyar; Wands, David [Institute of Cosmology and Gravitation, University of Portsmouth, Dennis Sciama Building, Burnaby Road, Portsmouth PO1 3FX (United Kingdom); Firouzjahi, Hassan [School of Astronomy, Institute for Research in Fundamental Sciences (IPM), P. O. Box 19395-5531, Tehran (Iran, Islamic Republic of); Namjoo, Mohammad Hossein, E-mail: hooshyar.assadullahi@port.ac.uk, E-mail: firouz@mail.ipm.ir, E-mail: mh.namjoo@mail.ipm.ir, E-mail: david.wands@port.ac.uk [Yukawa Institute for theoretical Physics, Kyoto University, Kyoto 606-8502 (Japan)

    2013-03-01

    We study primordial density perturbations generated by the late decay of a curvaton field whose decay rate may be modulated by the local value of another isocurvature field, analogous to models of modulated reheating at the end of inflation. We calculate the primordial density perturbation and its local-type non-Gaussianity using the sudden-decay approximation for the curvaton field, recovering standard curvaton and modulated reheating results as limiting cases. We verify the Suyama-Yamaguchi inequality between bispectrum and trispectrum parameters for the primordial density field generated by multiple field fluctuations, and find conditions for the bound to be saturated.

  6. Approved Module Information for CS2020, 2014/5 Module Title/Name: Software Engineering Module Code: CS2020

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CS2020, 2014/5 Module Title/Name: Software Engineering Module Code: CS2020 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Electronic Engineering and Computer Science. Available to Exchange Students? Yes Module Dependancies Pre

  7. Approved Module Information for BMM645, 2014/5 Module Title/Name: International Marketing Management Module Code: BMM645

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Management Module Code: BMM645 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 15 Module Management Information Module Leader Name Aarti Sood Email Address a.sood3 are expected to attend lectures and seminars as well as to take part in classroom discussions. The module

  8. A survey of reading services provided to students with reading disabilities 

    E-Print Network [OSTI]

    Christen, Margaret Harding

    2009-05-15

    of special education services provided. Results showed that there was minimal provision of special education services for reading disabled students. When the results were analyzed by degree of disability the correlation was weak while the analysis...

  9. Module Title: Project Module Code: OPTO6005

    E-Print Network [OSTI]

    Molinari, Marc

    Ibsen, Dr Ping Hua, Prof James Wilkinson Contact (email ID) sm@orc.soton.ac.uk, mi@orc.soton.ac.uk, ph2@orc.soton.ac.uk, jsw@orc.soton.ac.uk Is the module subject to external accreditation? No If yes and optical labs of the ORC 3. Train in technical and hands-on research skills to gain technical insight

  10. Module No: 410121Introduction to Commercial Module Title

    E-Print Network [OSTI]

    Module No: 410121Introduction to Commercial Law Module Title: Co-requisite: Commercial Papers/ Companies and Bankruptcy/International Trade Law- Maritime Law Introduction to LawPre-requisite: Module Type: department prerequisiteModule level: First year Evening StudyDaytime StudyCredit Hours: 3 Credit Hours

  11. The Evaluation and Use of Extensive Reading Materials 

    E-Print Network [OSTI]

    Tignanelli, Rosana

    2007-06-29

    The current investigation is based on the topic of “The evaluation and use of extensive reading materials”. Throughout this research, I attempted to find out whether a theory-based exploration on the evaluation and use of extensive reading...

  12. How to Read Your Electric Meter | Department of Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Your Electric Meter How to Read Your Electric Meter July 2, 2012 - 8:21pm Addthis The difference between one month's reading and the next is the amount of energy units that have...

  13. How to Read Residential Electric and Natural Gas Meters | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    How to Read Residential Electric and Natural Gas Meters How to Read Residential Electric and Natural Gas Meters An electromechanical electric meter on the side of a house. | Photo...

  14. Approved Module Information for BF3358, 2014/5 Module Title/Name: Investments Module Code: BF3358

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 10 Module learned how to measure the performance of an investment strategy. ? Transferable Skill ? have conducted performance measurement Portfolio return measurement. Risk adjusted performance measures. Attribution analysis

  15. GREET Pretreatment Module

    SciTech Connect (OSTI)

    Adom, Felix K.; Dunn, Jennifer B.; Han, Jeongwoo

    2014-09-01

    A wide range of biofuels and biochemicals can be produced from biomass via different pretreatment technologies that yield sugars. This report documents the material and energy flows that occur when fermentable sugars from four lignocellulosic feedstocks (corn stover, miscanthus, switchgrass, and poplar) are produced via dilute acid pretreatment and ammonia fiber expansion. These flows are documented for inclusion in the pretreatment module of the Greenhouses Gases, Regulated Emissions, and Energy Use in Transportation (GREET) model. Process simulations of each pretreatment technology were developed in Aspen Plus. Material and energy consumption data from Aspen Plus were then compiled in the GREET pretreatment module. The module estimates the cradle-to-gate fossil energy consumption (FEC) and greenhouse gas (GHG) emissions associated with producing fermentable sugars. This report documents the data and methodology used to develop this module and the cradle-to-gate FEC and GHG emissions that result from producing fermentable sugars.

  16. Digital optical conversion module

    DOE Patents [OSTI]

    Kotter, D.K.; Rankin, R.A.

    1988-07-19

    A digital optical conversion module used to convert an analog signal to a computer compatible digital signal including a voltage-to-frequency converter, frequency offset response circuitry, and an electrical-to-optical converter. Also used in conjunction with the digital optical conversion module is an optical link and an interface at the computer for converting the optical signal back to an electrical signal. Suitable for use in hostile environments having high levels of electromagnetic interference, the conversion module retains high resolution of the analog signal while eliminating the potential for errors due to noise and interference. The module can be used to link analog output scientific equipment such as an electrometer used with a mass spectrometer to a computer. 2 figs.

  17. Photovoltaic module reliability workshop

    SciTech Connect (OSTI)

    Mrig, L. (ed.)

    1990-01-01

    The paper and presentations compiled in this volume form the Proceedings of the fourth in a series of Workshops sponsored by Solar Energy Research Institute (SERI/DOE) under the general theme of photovoltaic module reliability during the period 1986--1990. The reliability Photo Voltaic (PV) modules/systems is exceedingly important along with the initial cost and efficiency of modules if the PV technology has to make a major impact in the power generation market, and for it to compete with the conventional electricity producing technologies. The reliability of photovoltaic modules has progressed significantly in the last few years as evidenced by warranties available on commercial modules of as long as 12 years. However, there is still need for substantial research and testing required to improve module field reliability to levels of 30 years or more. Several small groups of researchers are involved in this research, development, and monitoring activity around the world. In the US, PV manufacturers, DOE laboratories, electric utilities and others are engaged in the photovoltaic reliability research and testing. This group of researchers and others interested in this field were brought together under SERI/DOE sponsorship to exchange the technical knowledge and field experience as related to current information in this important field. The papers presented here reflect this effort.

  18. Evolving and Packaging Reading Technologies Victor R. Basili

    E-Print Network [OSTI]

    Basili, Victor R.

    . The experiments range from early read- ing vs. testing experiments to various Cleanroom ex- periments, such as the Cleanroom development approach, which is highly dependent on reading techniques and meth- ods. That is, reading technology is fundamental to Cleanroom development. In what follows, we will discuss the evolution

  19. WORD READING AND PICTURE NAMING IN ITALIAN Elizabeth Bates

    E-Print Network [OSTI]

    2 WORD READING AND PICTURE NAMING IN ITALIAN Elizabeth Bates University of California, San Diego ("Cross- linguistic studies of aphasia" -- NIH DC00216). The word-reading portion was supported Jolla, CA 92093-0526 (USA); bates@crl.ucsd.edu. #12;3 WORD READING AND PICTURE NAMING IN ITALIAN

  20. THE RELATIONSHIP OF READING STRATEGIES AND SELF-EFFICACY WITH THE READING COMPREHENSION OF HIGH SCHOOL STUDENTS IN INDONESIA

    E-Print Network [OSTI]

    Tobing, Irene Rebecca Angela

    2013-08-31

    The purpose of this study was to investigate the relationship of reading strategies and self-efficacy with the reading comprehension of high school students in Indonesia. A convenience sample of 138 high school students from a state high school...

  1. Thermoelectrics Partnership: Automotive Thermoelectric Modules...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    More Documents & Publications Novel Nanostructured Interface Solution for Automotive Thermoelectric Modules Application Thermoelectrics Partnership: Automotive...

  2. INJECTIVE MODULES FOR UNIFORM ALGEBRAS

    E-Print Network [OSTI]

    White, Michael C.

    of right Banach A-modules as mod-A and the class of Banach A-bimodules as A-mod-A. We shall refer to the module maps in each case as morphisms. Modules will be denoted by upper-case Roman letters, morphisms ), bounded linear maps are denoted by lower-case Roman letters. The assumption that all modules

  3. Approved Module Information for PH2502, 2014/5 Module Title/Name: Pharmaceutical

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PH2502, 2014/5 Module Title/Name: Pharmaceutical Microbio Credits: 20 Module Management Information Module Leader Name Deborah Lowry Email Address lowryd to Exchange Students? Not Specified Module Learning Information Module Aims: Pharmaceutical Microbiology

  4. Secure Compressed Reading in Smart Grids

    E-Print Network [OSTI]

    Cai, Sheng; Chen, Minghua; Yan, Jianxin; Jaggi, Sidharth

    2012-01-01

    Smart Grids measure energy usage in real-time and tailor supply and delivery accordingly, in order to improve power transmission and distribution. For the grids to operate effectively, it is critical to collect readings from massively-installed smart meters to control centers in an efficient and secure manner. In this paper, we propose a secure compressed reading scheme to address this critical issue. We observe that our collected real-world meter data express strong temporal correlations, indicating they are sparse in certain domains. We adopt Compressed Sensing technique to exploit this sparsity and design an efficient meter data transmission scheme. Our scheme achieves substantial efficiency offered by compressed sensing, without the need to know beforehand in which domain the meter data are sparse. This is in contrast to traditional compressed-sensing based scheme where such sparse-domain information is required a priori. We then design specific dependable scheme to work with our compressed sensing based ...

  5. Method and apparatus for reading thermoluminescent phosphors

    DOE Patents [OSTI]

    Braunlich, Peter F. (SW. 730 City View, Pullman, WA 99163); Tetzlaff, Wolfgang (Pullman, WA)

    1987-01-01

    An apparatus and method for rapidly reading thermoluminescent phosphors to determine the amount of luminescent energy stored therein. The stored luminescent energy is interpreted as a measure of the total exposure of the thermoluminescent phosphor to ionizing radiation. The thermoluminescent phosphor reading apparatus uses a laser to generate a laser beam. The laser beam power level is monitored by a laser power detector and controlled to maintain the power level nearly constant. A shutter or other laser beam interrupting means is used to control exposure of the thermoluminescent phosphor to the laser beam. The laser beam can be equalized using an optical equalizer so that the laser beam has an approximately uniform power density across the beam. The heated thermoluminescent phosphor emits a visible or otherwise detectable luminescent emission which is measured as an indication of the radiation exposure of the thermoluminescent phosphors. Also disclosed are preferred signal processing and control circuits.

  6. Approved Module Information for BHM346, 2014/5 Module Title/Name: Organisational Behaviour: Theory &

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BHM346, 2014/5 Module Title/Name: Organisational Behaviour: Theory & Practice Module Code: BHM346 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 15 Module Management Information Module Leader Name Yves Guillaume Email Address guilyrf2

  7. Approved Module Information for CE2106, 2014/5 Module Title/Name: Reaction Kinetics & Equilibrium

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CE2106, 2014/5 Module Title/Name: Reaction Kinetics & Equilibrium Thermodynamics Module Code: CE2106 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Mark Leaper Email Address

  8. Approved Module Information for BNM803, 2014/5 Module Title/Name: Developing Business Systems

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BNM803, 2014/5 Module Title/Name: Developing Business Systems Workshop Module Code: BNM803 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 15 Module Management Information Module Leader Name Email Address Not Specified Telephone

  9. Approved Module Information for ME3023, 2014/5 Module Title/Name: Energy Efficiency Module Code: ME3023

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    for assessing thermal processes in industry. Key issues associated with energy usage and reduction includingApproved Module Information for ME3023, 2014/5 Module Title/Name: Energy Efficiency Module Code: ME3023 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits

  10. Approved Module Information for ME2045, 2014/5 Module Title/Name: Solid Mechanics Module Code: ME2045

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    and comprehensive theory as well as practical application of the fundamental principles of mechanics and materialsApproved Module Information for ME2045, 2014/5 Module Title/Name: Solid Mechanics Module Code: ME2045 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits

  11. Approved Module Information for BHM347, 2014/5 Module Title/Name: Assessment Performance & Reward Module Code: BHM347

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BHM347, 2014/5 Module Title/Name: Assessment Performance & Reward Module Code: BHM347 School: Aston Business School Module Type: Standard Module New Module? No Module Practitioners: Recruitment and Selection (including Selection Assessment) Performance Measurement Management

  12. Approved Module Information for ME2502, 2014/5 Module Title/Name: Engineering for Industry Module Code: ME2502

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for ME2502, 2014/5 Module Title/Name: Engineering for Industry Module Code: ME2502 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module) Programmes in which available: BEng Design Engineering. BSc Industrial Product Design. BSc Product Design

  13. Approved Module Information for PD1803, 2014/5 Module Title/Name: Engineering Principles Module Code: PD1803

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PD1803, 2014/5 Module Title/Name: Engineering Principles Module Code: PD1803 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module; * have a knowledge and understanding of and be able to apply the basic engineering principles

  14. Approved Module Information for ME1601, 2014/5 Module Title/Name: Engineering Science Module Code: ME1601

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for ME1601, 2014/5 Module Title/Name: Engineering Science Module Code: ME1601 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module/MEng Mechanical Engineering. BEng/MEng Electromechanical Engineering. BEng Design Engineering. BEng

  15. Photovoltaic module and interlocked stack of photovoltaic modules

    DOE Patents [OSTI]

    Wares, Brian S.

    2012-09-04

    One embodiment relates to an arrangement of photovoltaic modules configured for transportation. The arrangement includes a plurality of photovoltaic modules, each photovoltaic module including a frame having at least a top member and a bottom member. A plurality of alignment features are included on the top member of each frame, and a plurality of alignment features are included on the bottom member of each frame. Adjacent photovoltaic modules are interlocked by the alignment features on the top member of a lower module fitting together with the alignment features on the bottom member of an upper module. Other embodiments, features and aspects are also disclosed.

  16. Power module assembly

    DOE Patents [OSTI]

    Campbell, Jeremy B. (Torrance, CA); Newson, Steve (Redondo Beach, CA)

    2011-11-15

    A power module assembly of the type suitable for deployment in a vehicular power inverter, wherein the power inverter has a grounded chassis, is provided. The power module assembly comprises a conductive base layer electrically coupled to the chassis, an insulating layer disposed on the conductive base layer, a first conductive node disposed on the insulating layer, a second conductive node disposed on the insulating layer, wherein the first and second conductive nodes are electrically isolated from each other. The power module assembly also comprises a first capacitor having a first electrode electrically connected to the conductive base layer, and a second electrode electrically connected to the first conductive node, and further comprises a second capacitor having a first electrode electrically connected to the conductive base layer, and a second electrode electrically connected to the second conductive node.

  17. Approved Module Information for EE3WSN, 2014/5 Module Title/Name: Wireless Sensor Networks Module Code: EE3WSN

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for EE3WSN, 2014/5 Module Title/Name: Wireless Sensor Networks Module Code: EE3WSN School: Engineering and Applied Science Module Type: Standard Module New Module? No Module

  18. Long Pulse Modulators

    E-Print Network [OSTI]

    Eckoldt, J

    2015-01-01

    Long pulse modulators are used to produce high-voltage, high-power pulses with durations of several hundred microseconds up to some milliseconds. The loads are one or more klystrons for producing RF power to accelerate the particle beam in superconducting cavities. After years of development and improvements in different institutes a variety of topologies exist, and are presented. The basics of modulators, pulse requirements and klystrons are explained. Additionally, the charging of internal energy storage will be addressed. The outlook for future developments is given.

  19. Method of monolithic module assembly

    DOE Patents [OSTI]

    Gee, James M. (Albuquerque, NM); Garrett, Stephen E. (Albuquerque, NM); Morgan, William P. (Albuquerque, NM); Worobey, Walter (Albuquerque, NM)

    1999-01-01

    Methods for "monolithic module assembly" which translate many of the advantages of monolithic module construction of thin-film PV modules to wafered c-Si PV modules. Methods employ using back-contact solar cells positioned atop electrically conductive circuit elements affixed to a planar support so that a circuit capable of generating electric power is created. The modules are encapsulated using encapsulant materials such as EVA which are commonly used in photovoltaic module manufacture. The methods of the invention allow multiple cells to be electrically connected in a single encapsulation step rather than by sequential soldering which characterizes the currently used commercial practices.

  20. Module Title: Metamaterials, Nanophotonics and Plasmonics Module Code: OPTO6004

    E-Print Network [OSTI]

    Molinari, Marc

    1 Module Title: Metamaterials, Nanophotonics and Plasmonics Module Code: OPTO6004 Core introduction to the three cornerstones of future photonic technologies, namely metamaterials, plasmonics. Comprehend the concept of metamaterials and underlying principles of their operation A3. Learn about

  1. Detailed Course Module Description | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Detailed Course Module Description Detailed Course Module Description This document lists the course modules for building science courses offered at Cornell's Collaborator...

  2. Formed photovoltaic module busbars

    DOE Patents [OSTI]

    Rose, Douglas; Daroczi, Shan; Phu, Thomas

    2015-11-10

    A cell connection piece for a photovoltaic module is disclosed herein. The cell connection piece includes an interconnect bus, a plurality of bus tabs unitarily formed with the interconnect bus, and a terminal bus coupled with the interconnect bus. The plurality of bus tabs extend from the interconnect bus. The terminal bus includes a non-linear portion.

  3. TruRead | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013)OpenEnergyTrailTrosky, Minnesota: EnergyMichigan:Ohio:TruRead

  4. READING FILE COPY F-e

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMassR&D100 Winners * Impacts on Global Technology OUTSIDEContract No.Proposed toREADING

  5. Reading Room | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia4)9 Federal Register / Vol. 76,EXAMPLE 4Reading Room |

  6. NEPA Reading Room | National Nuclear Security Administration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJessework usesof Energy Moving Forward tocomponentStatementsReading Room

  7. Reading the Cosmic Writing on the Wall

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation of Fe(II) by Carbon-RichProton DeliveryRadioactiveRare | National NuclearReading

  8. Policy Implications: Replacing the Reading TAKS Cut Scores with the Common Core Curriculum Reading Cut Scores on Three Middle School Campuses 

    E-Print Network [OSTI]

    Thaemlitz, Kristi

    2013-07-30

    reading rigor to ensure academic success is key for educators. Although Texas opted not to adopt the Common Core Curriculum Standards and the accompanying Stretch Lexile measures for reading that require higher reading levels at each grade, Texas educators...

  9. Module Handbook Specialisation Biomass Energy

    E-Print Network [OSTI]

    Damm, Werner

    Module Handbook Specialisation Biomass Energy 2nd Semester for the Master Programme REMA/EUREC Course 2008/2009 University of Zaragoza Specialisation Provider: Biomass Energy #12;Specialisation Biomass Energy, University of Zaragoza Modul: Introduction and Basic Concepts

  10. Hierarchical classification of modulation signals 

    E-Print Network [OSTI]

    Kim, Nam Jin

    2002-01-01

    This thesis addresses the problem of classifying both analog and digital modulation signals using different kinds of classifiers. The classification of modulation signals has both civilian and military applications. A total of 31 statistical signal...

  11. the university of reading chaplaincy including location maps for central Reading

    E-Print Network [OSTI]

    Wirosoetisno, Djoko

    Street 3.30pm, 6pm www.stlaurencereading.com Welcome to Reading A very warm welcome from the University. The Chaplaincy Centre The Chaplains run a drop-in centre on the Whiteknights campus in Park House Lodge, behind the main library. Our library, kitchen, quiet room and common room are open every week day during office

  12. Topic 2: Backtracking andTopic 2: Backtracking and Recommended ReadingsRecommended Readings

    E-Print Network [OSTI]

    Stephenson, Ben

    Recommended Readings ·· Chapter 3 from Programming in PrologChapter 3 from Programming in Prolog 2 Searching for the AnswerSearching for the Answer ·· Two notions of correctnessTwo notions of correctness ­­ Logical conjunction shouldn't matter ·· In practice, Prolog searches for an answerIn practice, Prolog searches

  13. Approved Module Information for LE3028, 2014/5 Module Title/Name: Corpus Linguistics Module Code: LE3028

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    from primary sources (i.e. corpora) and secondary sources (e.g. dictionaries) Carrying outApproved Module Information for LE3028, 2014/5 Module Title/Name: Corpus Linguistics Module Code Module Credits: 20 Module Management Information Module Leader Name Garry Plappert Email Address g

  14. Approved Module Information for LE1083, 2014/5 Module Title/Name: Words & Meaning Module Code: LE1083

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    and use data and information from primary sources (e.g. corpora) and secondary sources (e.g. dictionariesApproved Module Information for LE1083, 2014/5 Module Title/Name: Words & Meaning Module Code: LE Module Credits: 20 Module Management Information Module Leader Name Garry Plappert Email Address g

  15. Approved Module Information for BM2243, 2014/5 Module Title/Name: Digital Marketing Module Code: BM2243

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BM2243, 2014/5 Module Title/Name: Digital Marketing Module Code: BM School & Subject Groups(and %): Pre-requisites for this module are: BM1134 Introduction to Marketing OR BM2257 Marketing Available to Exchange Students? Not Specified Module Learning Information Module

  16. Approved Module Information for BMM604, 2014/5 Module Title/Name: Marketing Strategy Module Code: BMM604

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BMM604, 2014/5 Module Title/Name: Marketing Strategy Module Code: Masters Available to Exchange Students? Not Specified Module Dependancies Pre-requisites: Marketing Management (BMM601). Co-requisites: None Specified Module Learning Information Module Aims: The Marketing

  17. Approved Module Information for BMM656, 2014/5 Module Title/Name: Marketing Consultancy Module Code: BMM656

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BMM656, 2014/5 Module Title/Name: Marketing Consultancy Module Code: MSc in Market Research and Consultancy. Available to Exchange Students? Not Specified Module Learning Information Module Aims: The Marketing Consultancy module offers a unique learning experience

  18. Approved Module Information for BF2262, 2014/5 Module Title/Name: Management Accounting Module Code: BF2262

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BF2262, 2014/5 Module Title/Name: Management Accounting Module Code Accounting (BF1101). Co-requisites: None Specified Module Learning Information Module Aims: This module aims to provide you with an overview of the management accounting function within business, enabling you

  19. Approved Module Information for BFM204, 2014/5 Module Title/Name: Management Accounting Module Code: BFM204

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BFM204, 2014/5 Module Title/Name: Management Accounting Module Code in Accounting and Finance. Available to Exchange Students? Not Specified Module Learning Information Module Aims: This module studies the functions and techniques of cost and management accounting. Students will examine

  20. Module isolation devices

    DOE Patents [OSTI]

    Carolan, Michael Francis; Cooke, John Albert; Buzinski, Michael David

    2010-04-27

    A gas flow isolation device includes a gas flow isolation valve movable from an opened condition to a closed condition. The module isolation valve in one embodiment includes a rupture disk in flow communication with a flow of gas when the module isolation valve is in an opened condition. The rupture disk ruptures when a predetermined pressure differential occurs across it causing the isolation valve to close. In one embodiment the valve is mechanically linked to the rupture disk to maintain the valve in an opened condition when the rupture disk is intact, and which permits the valve to move into a closed condition when the rupture disk ruptures. In another embodiment a crushable member maintains the valve in an open condition, and the flow of gas passed the valve upon rupturing of the rupture disk compresses the crushable member to close the isolation valve.

  1. Model documentation, Coal Market Module of the National Energy Modeling System

    SciTech Connect (OSTI)

    NONE

    1998-01-01

    This report documents the objectives and the conceptual and methodological approach used in the development of the National Energy Modeling System`s (NEMS) Coal Market Module (CMM) used to develop the Annual Energy Outlook 1998 (AEO98). This report catalogues and describes the assumptions, methodology, estimation techniques, and source code of CMM`s two submodules. These are the Coal Production Submodule (CPS) and the Coal Distribution Submodule (CDS). CMM provides annual forecasts of prices, production, and consumption of coal for NEMS. In general, the CDS integrates the supply inputs from the CPS to satisfy demands for coal from exogenous demand models. The international area of the CDS forecasts annual world coal trade flows from major supply to major demand regions and provides annual forecasts of US coal exports for input to NEMS. Specifically, the CDS receives minemouth prices produced by the CPS, demand and other exogenous inputs from other NEMS components, and provides delivered coal prices and quantities to the NEMS economic sectors and regions.

  2. Detailed Course Module Description

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum Based| Department8, 20153Danielthrough theKDesertDesigningCourse Module

  3. Reading Tea Leaves: How Humans Interpret Topic Models

    E-Print Network [OSTI]

    Boyd-Graber, Jordan

    Reading Tea Leaves: How Humans Interpret Topic Models Jonathan Chang Jordan Boyd-Graber Sean, Blei Reading Tea Leaves #12;Topic Models in a Nutshell From an input corpus words to topics Forget Red Light, Green Light: A 2-Tone L.E.D. to Simplify Screens Corpus Chang, Boyd-Graber, Wang, Gerrish

  4. Read-out electronics for DC squid magnetic measurements

    DOE Patents [OSTI]

    Ganther, Jr., Kenneth R. (Olathe, KS); Snapp, Lowell D. (Independence, MO)

    2002-01-01

    Read-out electronics for DC SQUID sensor systems, the read-out electronics incorporating low Johnson noise radio-frequency flux-locked loop circuitry and digital signal processing algorithms in order to improve upon the prior art by a factor of at least ten, thereby alleviating problems caused by magnetic interference when operating DC SQUID sensor systems in magnetically unshielded environments.

  5. M.A. IN ROMANCE LANGUAGES READING LIST

    E-Print Network [OSTI]

    Li, X. Rong

    Río) 9. Florencia Pinar (in Miguel Angel Pérez Priego, (ed.) Poesía femenina en los cancioneros). SUGGESTED READINGS: Francisco Rico. Historia y crítica de la literatura española, 1/1 (primer suplemento. Historia crítica de la literatura española. N.B. * Indicates works to be read in their entirety. "Del Río

  6. "Hot little prophets": reading, mysticism, and Walt Whitman's disciples 

    E-Print Network [OSTI]

    Marsden, Steven Jay

    2004-11-15

    ??????????????????? 25 A Pr?cis of Chapters?????????????????????? 36 II ?A WOMAN WAITS FOR ME?: ANNE GILCHRIST AND LEAVES OF GRASS?????????????????????. 39 III ?SO SACRED?THE EXPLICATING NOTE?: DOCTOR RICHARD MAURICE BUCKE READING ?COSMIC... Illuminations????????????????????????? 128 Man?s Moral Nature?????????????????????? 140 Biography and Exegesis????????????????????.. 148 Comparative Readings and a Community of Believers????????.. 155 Cosmic Consciousness...

  7. Dalhousie Libraries e-Reserves Service Library Readings in OWL

    E-Print Network [OSTI]

    Dellaire, Graham

    will look like this: #12;Dalhousie Libraries can Provide URLs to these Types of Electronic MaterialDalhousie Libraries e-Reserves Service Library Readings in OWL #12;Course Reserves Faculty now have 2 options for Reserve materials: NEW Option: Upload a course reading list and Library staff will

  8. Processing module operating methods, processing modules, and communications systems

    DOE Patents [OSTI]

    McCown, Steven Harvey; Derr, Kurt W.; Moore, Troy

    2014-09-09

    A processing module operating method includes using a processing module physically connected to a wireless communications device, requesting that the wireless communications device retrieve encrypted code from a web site and receiving the encrypted code from the wireless communications device. The wireless communications device is unable to decrypt the encrypted code. The method further includes using the processing module, decrypting the encrypted code, executing the decrypted code, and preventing the wireless communications device from accessing the decrypted code. Another processing module operating method includes using a processing module physically connected to a host device, executing an application within the processing module, allowing the application to exchange user interaction data communicated using a user interface of the host device with the host device, and allowing the application to use the host device as a communications device for exchanging information with a remote device distinct from the host device.

  9. Phase modulation in RF tag

    DOE Patents [OSTI]

    Carrender, Curtis Lee; Gilbert, Ronald W.

    2007-02-20

    A radio frequency (RF) communication system employs phase-modulated backscatter signals for RF communication from an RF tag to an interrogator. The interrogator transmits a continuous wave interrogation signal to the RF tag, which based on an information code stored in a memory, phase-modulates the interrogation signal to produce a backscatter response signal that is transmitted back to the interrogator. A phase modulator structure in the RF tag may include a switch coupled between an antenna and a quarter-wavelength stub; and a driver coupled between the memory and a control terminal of the switch. The driver is structured to produce a modulating signal corresponding to the information code, the modulating signal alternately opening and closing the switch to respectively decrease and increase the transmission path taken by the interrogation signal and thereby modulate the phase of the response signal. Alternatively, the phase modulator may include a diode coupled between the antenna and driver. The modulating signal from the driver modulates the capacitance of the diode, which modulates the phase of the response signal reflected by the diode and antenna.

  10. Approved Module Information for BFM223, 2014/5 Module Title/Name: Sustainability Accounting &

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BFM223, 2014/5 Module Title/Name: Sustainability Accounting & Accountability Module Code: BFM223 School: Aston Business School Module Type: Standard Module New Module of this module is to introduce students to the different theories that underpin sustainability accounting

  11. Approved Module Information for LIM016, 2014/5 Module Title/Name: The EU: A Web of Institutions Module Code: LIM016

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LIM016, 2014/5 Module Title/Name: The EU: A Web of Institutions Module Code: LIM016 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 10 Module Management Information Module Leader Name Helena Farrand-Carrapico Email

  12. Approved Module Information for CS2410, 2014/5 Module Title/Name: Internet Applications and Techniques Module Code: CS2410

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CS2410, 2014/5 Module Title/Name: Internet Applications and Techniques Module Code: CS2410 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Hongxia (Helen) Wang Email

  13. Approved Module Information for CH3102, 2014/5 Module Title/Name: Advances in Biomaterials Science Module Code: CH3102

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CH3102, 2014/5 Module Title/Name: Advances in Biomaterials Science Module Code: CH3102 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Brian J Tighe Email Address tighebj

  14. Approved Module Information for LK3004, 2014/5 Module Title/Name: Corporate Power in a Globalised World Module Code: LK3004

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LK3004, 2014/5 Module Title/Name: Corporate Power in a Globalised World Module Code: LK3004 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 10 Module Management Information Module Leader Name Gary Fooks Email Address g

  15. Approved Module Information for LG2025, 2014/5 Module Title/Name: The Legacy of National Socialism Module Code: LG2025

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LG2025, 2014/5 Module Title/Name: The Legacy of National Socialism Module Code: LG2025 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 10 Module Management Information Module Leader Name Uwe Schütte Email Address u

  16. Approved Module Information for LP2007, 2014/5 Module Title/Name: Comparative Government and Politics Module Code: LP2007

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LP2007, 2014/5 Module Title/Name: Comparative Government and Politics Module Code: LP2007 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 20 Module Management Information Module Leader Name Ed Turner Email Address e

  17. Approved Module Information for LT2F09, 2014/5 Module Title/Name: Data Analysis Module Code: LT2F09

    E-Print Network [OSTI]

    Rebollo-Neira, Laura

    Approved Module Information for LT2F09, 2014/5 Module Title/Name: Data Analysis Module Code: LT2F09 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Constant Iannacci Email Address c

  18. Approved Module Information for AM20CP, 2014/5 Module Title/Name: Numerical Methods II Module Code: AM20CP

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for AM20CP, 2014/5 Module Title/Name: Numerical Methods II Module Code: AM20CP School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Juan Neirotti Email Address neirotjp

  19. Approved Module Information for LP3024, 2014/5 Module Title/Name: Political Parties and Party Systems Module Code: LP3024

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LP3024, 2014/5 Module Title/Name: Political Parties and Party Systems Module Code: LP3024 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 10 Module Management Information Module Leader Name Ed Turner Email Address e

  20. Approved Module Information for BHM349, 2014/5 Module Title/Name: Employee Relations in Context Module Code: BHM349

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BHM349, 2014/5 Module Title/Name: Employee Relations in Context Module Code: BHM349 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 15 Module Management Information Module Leader Name Vidu Badigannavar Email Address badiganv

  1. Approved Module Information for AM30PD, 2014/5 Module Title/Name: Partial Differential Equations Module Code: AM30PD

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for AM30PD, 2014/5 Module Title/Name: Partial Differential Equations Module Code: AM30PD School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 20 Module Management Information Module Leader Name David Saad Email Address saadd

  2. Approved Module Information for LYM002, 2014/5 Module Title/Name: Globalisation and Social Change Module Code: LYM002

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LYM002, 2014/5 Module Title/Name: Globalisation and Social Change Module Code: LYM002 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 20 Module Management Information Module Leader Name Christian Bolsmann Email

  3. Approved Module Information for EE3DTR, 2014/5 Module Title/Name: Digital Transmission Module Code: EE3DTR

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for EE3DTR, 2014/5 Module Title/Name: Digital Transmission Module Code: EE3DTR School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Sonia Boscolo Email Address s

  4. Approved Module Information for LPM027, 2014/5 Module Title/Name: International Ethics and Literature Module Code: LPM027

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LPM027, 2014/5 Module Title/Name: International Ethics and Literature Module Code: LPM027 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 20 Module Management Information Module Leader Name Amanda Beattie Email Address a

  5. Approved Module Information for LG3015, 2014/5 Module Title/Name: East Germany on Film Module Code: LG3015

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LG3015, 2014/5 Module Title/Name: East Germany on Film Module Code: LG3015 School: Languages and Social Sciences Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Claudia Gremler Email Address c

  6. Approved Module Information for AM30AT, 2014/5 Module Title/Name: Approximation Theory and Methods Module Code: AM30AT

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for AM30AT, 2014/5 Module Title/Name: Approximation Theory and Methods Module Code: AM30AT School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Roberto Alamino Email Address

  7. Approved Module Information for BFM102B, 2014/5 Module Title/Name: Valuation of Investments Module Code: BFM102B

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BFM102B, 2014/5 Module Title/Name: Valuation of Investments Module Code: BFM102B School: Aston Business School Module Type: Standard Module New Module? Not Specified Module Credits: 15 Module Management Information Module Leader Name Leonidas Tsiaras Email Address

  8. Approved Module Information for BNM805, 2014/5 Module Title/Name: Foundations in Business Systems Module Code: BNM805

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BNM805, 2014/5 Module Title/Name: Foundations in Business Systems Module Code: BNM805 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 15 Module Management Information Module Leader Name Andreas Schroeder Email Address schroeda

  9. Approved Module Information for LP2029, 2014/5 Module Title/Name: Introduction to Political Economy I Module Code: LP2029

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LP2029, 2014/5 Module Title/Name: Introduction to Political Economy I Module Code: LP2029 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 10 Module Management Information Module Leader Name Balazs Szent-Ivanyi Email

  10. Approved Module Information for AM20LM, 2014/5 Module Title/Name: Linear Mathematics Module Code: AM20LM

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for AM20LM, 2014/5 Module Title/Name: Linear Mathematics Module Code: AM20LM School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Tomas Johansson Email Address johansst

  11. Approved Module Information for BFM102A, 2014/5 Module Title/Name: Valuation of Investments Module Code: BFM102A

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BFM102A, 2014/5 Module Title/Name: Valuation of Investments Module Code: BFM102A School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 15 Module Management Information Module Leader Name Hugh Colaco Email Address colacoh

  12. Approved Module Information for AM20MC, 2014/5 Module Title/Name: Multi Variate Calculus Module Code: AM20MC

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for AM20MC, 2014/5 Module Title/Name: Multi Variate Calculus Module Code: AM20MC School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Sotos C Generalis Email Address generasc

  13. Approved Module Information for BFM114, 2014/5 Module Title/Name: Quantitative Methods for Finance Module Code: BFM114

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BFM114, 2014/5 Module Title/Name: Quantitative Methods for Finance Module Code: BFM114 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 15 Module Management Information Module Leader Name D Gilder Email Address gilderd

  14. Approved Module Information for LEM032, 2014/5 Module Title/Name: Linguistic Investigation and Evidence Module Code: LEM032

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LEM032, 2014/5 Module Title/Name: Linguistic Investigation and Evidence Module Code: LEM032 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 20 Module Management Information Module Leader Name Tim Grant Email Address t

  15. Approved Module Information for BS2209, 2014/5 Module Title/Name: International Business Environment 2 Module Code: BS2209

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BS2209, 2014/5 Module Title/Name: International Business Environment 2 Module Code: BS2209 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Yama Temouri Email Address temoury1

  16. Approved Module Information for BN1115, 2014/5 Module Title/Name: Foundations of Business Analytics Module Code: BN1115

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BN1115, 2014/5 Module Title/Name: Foundations of Business Analytics Module Code: BN1115 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Ozren Despic Email Address o

  17. Approved Module Information for AM20VR, 2014/5 Module Title/Name: Vector Calculus Module Code: AM20VR

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for AM20VR, 2014/5 Module Title/Name: Vector Calculus Module Code: AM20VR School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Roberto Alamino Email Address alaminrc

  18. Approved Module Information for LE1088, 2014/5 Module Title/Name: Theories of Language and Identities Module Code: LE1088

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LE1088, 2014/5 Module Title/Name: Theories of Language and Identities Module Code: LE1088 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 10 Module Management Information Module Leader Name Urszula Clark Email Address u

  19. Approved Module Information for AM20IM, 2014/5 Module Title/Name: Numerical Methods I Module Code: AM20IM

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for AM20IM, 2014/5 Module Title/Name: Numerical Methods I Module Code: AM20IM School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Michael Stich Email Address stichm

  20. Approved Module Information for LG3013, 2014/5 Module Title/Name: German-Jewish Biographies Module Code: LG3013

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LG3013, 2014/5 Module Title/Name: German-Jewish Biographies Module Code: LG3013 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 10 Module Management Information Module Leader Name Gertrud Reershemius Email

  1. Approved Module Information for LK1009, 2014/5 Module Title/Name: Understanding Social Divisions A Module Code: LK1009

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LK1009, 2014/5 Module Title/Name: Understanding Social Divisions A Module Code: LK1009 School: Languages and Social Sciences Module Type: Standard Module New Module? No Module Credits: 15 Module Management Information Module Leader Name Anton Popov Email Address popova

  2. Approved Module Information for EE404B, 2014/5 Module Title/Name: Introductory Programming Module Code: EE404B

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for EE404B, 2014/5 Module Title/Name: Introductory Programming Module Code: EE404B School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name E Turitsyna Email Address e

  3. Approved Module Information for CE4014, 2014/5 Module Title/Name: Advanced Reaction Engineering II Module Code: CE4014

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CE4014, 2014/5 Module Title/Name: Advanced Reaction Engineering II Module Code: CE4014 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Feroz Kabir Email Address kabirf

  4. Approved Module Information for EE401B, 2014/5 Module Title/Name: Digital Transmission Module Code: EE401B

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for EE401B, 2014/5 Module Title/Name: Digital Transmission Module Code: EE401B School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Sonia Boscolo Email Address s

  5. Approved Module Information for AM10IM, 2014/5 Module Title/Name: Introduction to Matlab Module Code: AM10IM

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for AM10IM, 2014/5 Module Title/Name: Introduction to Matlab Module Code: AM10IM School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Tomas Johansson Email Address johansst

  6. Approved Module Information for AM11FM, 2014/5 Module Title/Name: Fundamental Mathematics Module Code: AM11FM

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for AM11FM, 2014/5 Module Title/Name: Fundamental Mathematics Module Code: AM11FM School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Harry Flynn Email Address flynnh

  7. Approved Module Information for LT2F08, 2014/5 Module Title/Name: Management Accounting Module Code: LT2F08

    E-Print Network [OSTI]

    Rebollo-Neira, Laura

    Approved Module Information for LT2F08, 2014/5 Module Title/Name: Management Accounting Module Code: LT2F08 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Constant Iannacci Email Address c

  8. Approved Module Information for BN1116, 2014/5 Module Title/Name: Introduction to Business Analytics Module Code: BN1116

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BN1116, 2014/5 Module Title/Name: Introduction to Business Analytics Module Code: BN1116 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Leonidas Anastasakis Email Address

  9. Approved Module Information for AM30OT, 2014/5 Module Title/Name: Option Theory Module Code: AM30OT

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for AM30OT, 2014/5 Module Title/Name: Option Theory Module Code: AM30OT School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Sudhir Jain Email Address jains@aston.ac.uk Telephone

  10. Approved Module Information for LEM067, 2014/5 Module Title/Name: Research Methods in ELT Module Code: LEM067

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LEM067, 2014/5 Module Title/Name: Research Methods in ELT Module Code: LEM067 School: Languages and Social Sciences Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Sue Garton Email Address s

  11. Cycles and cycle modulations

    E-Print Network [OSTI]

    Brandenburg, Axel

    2011-01-01

    Some selected concepts for the solar activity cycle are briefly reviewed. Cycle modulations through a stochastic alpha effect are being identified with limited scale separation ratios. Three-dimensional turbulence simulations with helicity and shear are compared at two different scale separation ratios. In both cases the level of fluctuations shows relatively little variation with the dynamo cycle. Prospects for a shallow origin of sunspots are discussed in terms of the negative effective magnetic pressure instability. Tilt angles of bipolar active regions are discussed as a consequence of shear rather than the Coriolis force.

  12. Transportation Sector Module

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal,Demand Module of the National Energy Modeling System: Model Documentation7)

  13. Modulated preheating and isocurvature perturbations

    SciTech Connect (OSTI)

    Enqvist, Kari; Rusak, Stanislav, E-mail: kari.enqvist@helsinki.fi, E-mail: stanislav.rusak@helsinki.fi [Department of Physics and Helsinki Institute of Physics, University of Helsinki, P.O. Box 64, FIN-00014 University of Helsinki (Finland)

    2013-03-01

    We consider a model of preheating where the coupling of the inflaton to the preheat field is modulated by an additional scalar field which is light during inflation. We establish that such a model produces the observed curvature perturbation analogously to the modulated reheating scenario. The contribution of modulated preheating to the power spectrum and to non-Gaussianity can however be significantly larger compared to modulated perturbative reheating. We also consider the implications of the current constraints on isocurvature perturbations in case where the modulating field is responsible for cold dark matter. We find that existing bounds on CDM isocurvature perturbations imply that modulated preheating is unlikely to give a dominant contribution to the curvature perturbation and that the same bounds suggest important constraints on non-Gaussianity and the amount of primordial gravitational waves.

  14. International Energy Module - NEMS Documentation

    Reports and Publications (EIA)

    2014-01-01

    Summarizes the overall structure of the International Energy Model and its interface with other NEMS modules, mathematical specifications of behavioral relationships, and data sources and estimation methods.

  15. Thermoelectrics Partnership: Automotive Thermoelectric Modules...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ace067goodson2011o.pdf More Documents & Publications Thermoelectrics Partnership: Automotive Thermoelectric Modules with Scalable Thermo- and Electro-Mechanical Interfaces Novel...

  16. Approved Module Information for BSM929, 2014/5 Module Title/Name: Strategic Management Module Code: BSM929

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BSM929, 2014/5 Module Title/Name: Strategic Management Module Code foundation and a good working knowledge of the analytic frameworks of strategic management. The course Module Management Information Module Leader Name Carola Wolf Email Address wolfc@aston.ac.uk Telephone

  17. Approved Module Information for CS1320, 2014/5 Module Title/Name: Problem Solving Module Code: CS1320

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CS1320, 2014/5 Module Title/Name: Problem Solving Module Code: CS to Exchange Students? Not Specified Module Learning Information Module Aims: To teach generic problem solving skills and meta-level reflection in the context of computer programming. Problem solving skills

  18. Approved Module Information for CE4503, 2014/5 Module Title/Name: Advanced Process Design Module Code: CE4503

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Code: CE4503 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module available: BEng/MEng Chemical Engineering. Available to Exchange Students? Not Specified Module Dependancies. The Design Problem is intended to test the students ability to apply the principles of Chemical Engineering

  19. Approved Module Information for CS2010, 2014/5 Module Title/Name: Group Project Module Code: CS2010

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    School: Engineering and Applied Science Module Type: Project New Module? No Module Credits: 20 Module-requisites: Java Program Development (CS1410). Co-requisites: Software Engineering (CS2020). Module Learning, developing and demonstrating necessary project management, team working and software engineering skills

  20. Approved Module Information for CE2105, 2014/5 Module Title/Name: Process Simulation Module Code: CE2105

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    : CE2105 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module processes with solids * Coal drying * Coal combustion Module Delivery Methods of Delivery & Learning Hours weighting (including approaches to formative assessment as well as summative): Assessment Type Category

  1. Approved Module Information for EM4031, 2014/5 Module Title/Name: Logistics and Transportation Module Code: EM4031

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for EM4031, 2014/5 Module Title/Name: Logistics and Transportation Module Learning Information Module Aims: This module will explore the role of logistics, applications and systems in all aspects of logistics (e.g. inventory management, warehousing) - Analyse supply

  2. Approved Module Information for PH3603, 2014/5 Module Title/Name: Pharmaceutical Formulation III Module Code: PH3603

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PH3603, 2014/5 Module Title/Name: Pharmaceutical Formulation III Credits: 20 Module Management Information Module Leader Name Raj Badhan Email Address badharks Students? Not Specified Module Dependancies Pre-requisites: Pharmaceutical Calculations (PH1403). Medicines

  3. Department of Mechanical Engineering MODULE DESCRIPTION FORM

    E-Print Network [OSTI]

    Mottram, Nigel

    the students will encounter may include (in addition to those mentioned above): refrigeration and power systems th and 5 th year classes. Recommended Reading ****Purchase essential; ***Purchase recommended; **Highly recommended reading; *Simply for reference (do NOT purchase) Class reading to be recommended

  4. Adding a Learning Module -1 Adding a Learning Module

    E-Print Network [OSTI]

    Cui, Yan

    Items focused on a specific subject that students can navigate at their own pace. For example or No for Enforce Sequential Viewing for the Learning Module. Selecting Yes will require students to view the Learning Module within a Table of Contents, which students can also use to navigate through the Learning

  5. Taught Masters Module Guide LEC Taught Masters Module Guide

    E-Print Network [OSTI]

    Sengun, Mehmet Haluk

    ;MODULE NUMBER: BIOL 405 MODULE TITLE: BIOLOGICAL EFFECTS OF AIR POLLUTION AND CLIMATE CHANGE Number warming, ozone depletion, elevated CO2, tropospheric air pollution) and an in-depth analysis health: impacts, adaptation and mitigation Week 2 Air pollutants: plants as our garbage chutes

  6. Proposal for New Module Module Title: Photonic Materials

    E-Print Network [OSTI]

    Molinari, Marc

    Information Academic Unit responsible for the module ORC Core/Compulsory/Optional Compulsory Programme, Dr. S. M. Ganapathy, Dr. G. Brambilla Contact (email ID) acp@orc.soton.ac.uk; smg@orc.soton.ac.uk; gb2@orc.soton.ac.uk Will the module be subject to external accreditation? No If yes, by which body

  7. Quantum reading under a local energy constraint

    E-Print Network [OSTI]

    Gaetana Spedalieri; Cosmo Lupo; Stefano Mancini; Samuel L. Braunstein; Stefano Pirandola

    2015-09-03

    Nonclassical states of light play a central role in many quantum information protocols. Their quantum features have been exploited to improve the readout of information from digital memories, modelled as arrays of microscopic beam splitters [S. Pirandola, Phys. Rev. Lett. 106, 090504 (2011)]. In this model of quantum reading, a nonclassical source of light with Einstein-Podolski-Rosen correlations has been proven to retrieve more information than any classical source. In particular, the quantum-classical comparison has been performed under a global energy constraint, i.e., by fixing the mean total number of photons irradiated over each memory cell. In this paper we provide an alternative analysis which is based on a local energy constraint, meaning that we fix the mean number of photons per signal mode irradiated over the memory cell. Under this assumption, we investigate the critical number of signal modes after which a nonclassical source of light is able to beat any classical source irradiating the same number of signals.

  8. Approved Module Information for CS1260, 2014/5 Module Title/Name: Mathematics for Computing

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Module? No Module Credits: 10 Module Management Information Module Leader Name Thomas Davenport Email Address t.davenport@aston.ac.uk Telephone Number Not Specified Office Not Specified Level Description

  9. Photovoltaic module mounting system

    DOE Patents [OSTI]

    Miros, Robert H. J. (Fairfax, CA); Mittan, Margaret Birmingham (Oakland, CA); Seery, Martin N. (San Rafael, CA); Holland, Rodney H. (Novato, CA)

    2012-04-17

    A solar array mounting system having unique installation, load distribution, and grounding features, and which is adaptable for mounting solar panels having no external frame. The solar array mounting system includes flexible, pedestal-style feet and structural links connected in a grid formation on the mounting surface. The photovoltaic modules are secured in place via the use of attachment clamps that grip the edge of the typically glass substrate. The panel mounting clamps are then held in place by tilt brackets and/or mid-link brackets that provide fixation for the clamps and align the solar panels at a tilt to the horizontal mounting surface. The tilt brackets are held in place atop the flexible feet and connected link members thus creating a complete mounting structure.

  10. Photovoltaic module mounting system

    SciTech Connect (OSTI)

    Miros, Robert H. J.; Mittan, Margaret Birmingham; Seery, Martin N; Holland, Rodney H

    2012-09-18

    A solar array mounting system having unique installation, load distribution, and grounding features, and which is adaptable for mounting solar panels having no external frame. The solar array mounting system includes flexible, pedestal-style feet and structural links connected in a grid formation on the mounting surface. The photovoltaic modules are secured in place via the use of attachment clamps that grip the edge of the typically glass substrate. The panel mounting clamps are then held in place by tilt brackets and/or mid-link brackets that provide fixation for the clamps and align the solar panels at a tilt to the horizontal mounting surface. The tilt brackets are held in place atop the flexible feet and connected link members thus creating a complete mounting structure.

  11. Module Handbook Specialisation Wind Energy

    E-Print Network [OSTI]

    Habel, Annegret

    Module Handbook Specialisation Wind Energy 2nd Semester for the Master Programme REMA/EUREC Course 2008/2009 NTU Athens Specialisation Provider: Wind Energy #12;Specialisation Wind Energy, NTU Athens, 2nd Semester Module 1/Wind Energy: Wind potential, Aerodynamics & Loading

  12. Argonne's SpEC Module

    ScienceCinema (OSTI)

    Harper, Jason

    2014-06-05

    Jason Harper, an electrical engineer in Argonne National Laboratory's EV-Smart Grid Interoperability Center, discusses his SpEC Module invention that will enable fast charging of electric vehicles in under 15 minutes. The module has been licensed to BTCPower.

  13. Argonne's SpEC Module

    SciTech Connect (OSTI)

    Harper, Jason

    2014-05-05

    Jason Harper, an electrical engineer in Argonne National Laboratory's EV-Smart Grid Interoperability Center, discusses his SpEC Module invention that will enable fast charging of electric vehicles in under 15 minutes. The module has been licensed to BTCPower.

  14. Short Manual Software Modules for

    E-Print Network [OSTI]

    Ould Ahmedou, Mohameden

    1 Short Manual Software Modules for Format Conversion, Transformation, and Synthesis 1 Introduction This document includes a short description of calling syntax and handling of the software modules developed describes the software installation process, chapter 3 shows the calling syntax of the SIF-to-CDFG format

  15. Macroeconomic Activity Module - NEMS Documentation

    Reports and Publications (EIA)

    2014-01-01

    Documents the objectives, analytical approach, and development of the National Energy Modeling System (NEMS) Macroeconomic Activity Module (MAM) used to develop the Annual Energy Outlook for 2014 (AEO2014). The report catalogues and describes the module assumptions, computations, methodology, parameter estimation techniques, and mainframe source code

  16. Reading the Tea Leaves: How Utilities in the West Are Managing Carbon Regulatory Risk in their Resource Plans

    E-Print Network [OSTI]

    Barbose, Galen

    2008-01-01

    ATIONAL L ABORATORY Reading the Tea Leaves: How Utilities inemployer. LBNL-44E Reading the Tea Leaves: How Utilities in

  17. Approved Module Information for EE1F06, 2014/5 Module Title/Name: Mathematics Module Code: EE1F06

    E-Print Network [OSTI]

    Rebollo-Neira, Laura

    Approved Module Information for EE1F06, 2014/5 Module Title/Name: Mathematics Module Code: EE1F06 School: Engineering and Applied Science Module Type: Foundation New Module? No Module Credits: 20 Module Management Information Module Leader Name Mike Stephenson Email Address Not Specified Telephone Number

  18. Approved Module Information for LT2F04, 2014/5 Module Title/Name: Inventory Module Code: LT2F04

    E-Print Network [OSTI]

    Rebollo-Neira, Laura

    Approved Module Information for LT2F04, 2014/5 Module Title/Name: Inventory Module Code: LT2F04 School: Engineering and Applied Science Module Type: Foundation New Module? No Module Credits: 20 Module Management Information Module Leader Name Constant Iannacci Email Address c.iannacci@aston.ac.uk Telephone

  19. Approved Module Information for ME2F33, 2014/5 Module Title/Name: Elements of Gas Engineering Module Code: ME2F33

    E-Print Network [OSTI]

    Rebollo-Neira, Laura

    Approved Module Information for ME2F33, 2014/5 Module Title/Name: Elements of Gas Engineering Module Code: ME2F33 School: Engineering and Applied Science Module Type: Foundation New Module? No Module Credits: 20 Module Management Information Module Leader Name Lee Jenkins Email Address jenkinl1@aston

  20. Approved Module Information for ME2F66, 2014/5 Module Title/Name: Mathematical Methods in Engineering Module Code: ME2F66

    E-Print Network [OSTI]

    Rebollo-Neira, Laura

    Approved Module Information for ME2F66, 2014/5 Module Title/Name: Mathematical Methods in Engineering Module Code: ME2F66 School: Engineering and Applied Science Module Type: Foundation New Module? No Module Credits: 10 Module Management Information Module Leader Name Lee Jenkins Email Address jenkinl1

  1. Approved Module Information for LT1F05, 2014/5 Module Title/Name: Legal and Environmental Aspects Module Code: LT1F05

    E-Print Network [OSTI]

    Rebollo-Neira, Laura

    Approved Module Information for LT1F05, 2014/5 Module Title/Name: Legal and Environmental Aspects Module Code: LT1F05 School: Engineering and Applied Science Module Type: Foundation New Module? No Module Credits: 20 Module Management Information Module Leader Name Constant Iannacci Email Address c

  2. Approved Module Information for LT2F05, 2014/5 Module Title/Name: Sourcing and Procurement Module Code: LT2F05

    E-Print Network [OSTI]

    Rebollo-Neira, Laura

    Approved Module Information for LT2F05, 2014/5 Module Title/Name: Sourcing and Procurement Module Code: LT2F05 School: Engineering and Applied Science Module Type: Foundation New Module? No Module Credits: 20 Module Management Information Module Leader Name Constant Iannacci Email Address c

  3. Approved Module Information for LT2F06, 2014/5 Module Title/Name: Retail Logistics Module Code: LT2F06

    E-Print Network [OSTI]

    Rebollo-Neira, Laura

    Approved Module Information for LT2F06, 2014/5 Module Title/Name: Retail Logistics Module Code: LT2F06 School: Engineering and Applied Science Module Type: Foundation New Module? No Module Credits: 20 Module Management Information Module Leader Name Constant Iannacci Email Address c

  4. Approved Module Information for LT1F04, 2014/5 Module Title/Name: Warehousing Module Code: LT1F04

    E-Print Network [OSTI]

    Rebollo-Neira, Laura

    Approved Module Information for LT1F04, 2014/5 Module Title/Name: Warehousing Module Code: LT1F04 School: Engineering and Applied Science Module Type: Foundation New Module? No Module Credits: 20 Module Management Information Module Leader Name Constant Iannacci Email Address c.iannacci@aston.ac.uk Telephone

  5. Approved Module Information for ME1F18, 2014/5 Module Title/Name: Materials & Processes Module Code: ME1F18

    E-Print Network [OSTI]

    Rebollo-Neira, Laura

    Approved Module Information for ME1F18, 2014/5 Module Title/Name: Materials & Processes Module Code: ME1F18 School: Engineering and Applied Science Module Type: Foundation New Module? No Module Credits: 10 Module Management Information Module Leader Name Lee Jenkins Email Address jenkinl1@aston

  6. Approved Module Information for EE1F02, 2014/5 Module Title/Name: Business Environment Module Code: EE1F02

    E-Print Network [OSTI]

    Rebollo-Neira, Laura

    Approved Module Information for EE1F02, 2014/5 Module Title/Name: Business Environment Module Code: EE1F02 School: Engineering and Applied Science Module Type: Foundation New Module? No Module Credits: 20 Module Management Information Module Leader Name Jill Mustard Email Address Not Specified

  7. Approved Module Information for LP3030, 2014/5 Module Title/Name: The Far Right in Europe Module Code: LP3030

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LP3030, 2014/5 Module Title/Name: The Far Right in Europe Module Credits: 10 Module Management Information Module Leader Name Jim Shields Email Address shieldjg Students? Not Specified Module Learning Information Module Aims: The module aims to equip students

  8. Approved Module Information for LE3025, 2014/5 Module Title/Name: Leadership & Management

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    . Students will continue to learn how to: select and use data and information from primary sources (eApproved Module Information for LE3025, 2014/5 Module Title/Name: Leadership & Management Module? Not Specified Module Credits: 20 Module Management Information Module Leader Name Judith Baxter

  9. Approved Module Information for LE3024, 2014/5 Module Title/Name: Leadership & Management

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    will learn how to: select and use data and information from primary sources (e.g. authentic dataApproved Module Information for LE3024, 2014/5 Module Title/Name: Leadership & Management Module? Not Specified Module Credits: 20 Module Management Information Module Leader Name Judith Baxter

  10. Approved Module Information for PH3704, 2014/5 Module Title/Name: Quality Assured Pharmaceutical

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PH3704, 2014/5 Module Title/Name: Quality Assured Pharmaceutical? No Module Credits: 10 Module Management Information Module Leader Name Andrew Ingham Email Address inghamaj? Not Specified Module Dependancies Pre-requisites: Cell and Molecular Biology (PH1402). Pharmaceutical

  11. READING LIST Microeconomics Theory 1: 26:220:501

    E-Print Network [OSTI]

    ., "Collective Labor Supply and Welfare," Journal of Political Economy 100 (3, June 1992): 437-67. Hirshleifer, J. and Savage, L., "The Utility Analysis of Choices Involving Risk," in AEA, Readings in Price Theory. *Pauly, M

  12. How to Read Residential Electric and Natural Gas Meters | Department...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    courtesy of iStockphotofstockfoto You can read your own meters to help monitor your electric or gas energy use. During the heating season, your energy use should be compared...

  13. Exploring Reading and Mathematics Integration in Preschool-Aged Children 

    E-Print Network [OSTI]

    Godwin, Amber Joyce

    2015-07-23

    research had already been conducted on the effects of using reading and mathematics instruction concurrently with young children. The results of this meta-synthesis indicated that although that type of symbiotic instruction is gathering research interest...

  14. Relations among musical skills, phonological processing, and early reading

    E-Print Network [OSTI]

    Trainor, Laurel J.

    analysis skills used in the processing of language, such as blending and segmenting sounds, are similar & Gregory, 1993). If early read- ing skill is closely linked to skill in processing the auditory components

  15. Call Description cread highspeed, synchronous read from a CFS file

    E-Print Network [OSTI]

    Torczon, Virginia

    Call Description cread high­speed, synchronous read from a CFS file cwrite high­speed, synchronous write to a CFS file gilow global MIN operation used for integer scalars gopf make a global operation

  16. High School Reading Intervention in the Special Education Classroom

    E-Print Network [OSTI]

    Goodwin, Vanessa Anne

    2011-01-01

    California. Mission employed an RTI model to provide readinguse of a Response to Intervention (RTI) model in the generalof adopting a multi-tiered RTI model to provide reading

  17. CENTRIFUGAL FORCES: READING RUSSIA'S REGIONAL IDENTITIES AND INITIATIVES

    E-Print Network [OSTI]

    Huang, Wei

    CENTRIFUGAL FORCES: READING RUSSIA'S REGIONAL IDENTITIES AND INITIATIVES Thursday, March 26 and Natural Heritage, Moscow, Russia), " : , " ("The Centrifugality of the Centripetal: Space, Identity and Industry as Centrifugal Forces in Tsarist Transcaucasia" Helen Hundley (History, Wichita State U

  18. Reading Municipal Light Department- Residential Renewable Energy Rebates

    Broader source: Energy.gov [DOE]

    Reading Municipal Light Department (RMLD) offers rebates of $1.00/watt for solar photovoltaic and small wind installations for residential customers. A $0.25/watt adder is available for using local...

  19. Approved Module Information for BL1178, 2014/5 Module Title/Name: Introduction to Jurisprudence & Legal

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BL1178, 2014/5 Module Title/Name: Introduction to Jurisprudence & Legal Theory Module Code: BL1178 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 20 Module Management Information Module Leader Name James Brown Email Address brownjp1

  20. Approved Module Information for PD3003, 2014/5 Module Title/Name: Professional Preparation for Industry

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PD3003, 2014/5 Module Title/Name: Professional Preparation for Industry (Business Focus) Module Code: PD3003 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 20 Module Management Information Module Leader Name Christian

  1. Approved Module Information for BSM922, 2014/5 Module Title/Name: Public Policy, CRS & Sustainable

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BSM922, 2014/5 Module Title/Name: Public Policy, CRS & Sustainable Development Module Code: BSM922 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 15 Module Management Information Module Leader Name Josephine Kelly Email Address j

  2. Approved Module Information for PY1117, 2014/5 Module Title/Name: Cognitive Psychology 1a -Learning &

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PY1117, 2014/5 Module Title/Name: Cognitive Psychology 1a - Learning & Memory Module Code: PY1117 School: Life and Health Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 10 Module Management Information Module Leader Name Martin Juttner

  3. Approved Module Information for LE2012, 2014/5 Module Title/Name: Teaching English to Speakers of Other

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LE2012, 2014/5 Module Title/Name: Teaching English to Speakers of Other Languages Module Code: LE2012 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 10 Module Management Information Module Leader Name Sue

  4. Approved Module Information for SE4025, 2014/5 Module Title/Name: Further Topics in Engineering

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for SE4025, 2014/5 Module Title/Name: Further Topics in Engineering Management Module Code: SE4025 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 15 Module Management Information Module Leader Name Robin Clark Email Address

  5. Approved Module Information for LG1011, 2014/5 Module Title/Name: The German Language -Past and

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LG1011, 2014/5 Module Title/Name: The German Language - Past and Present Module Code: LG1011 School: Languages and Social Sciences Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Gertrud Reershemius Email Address g

  6. Approved Module Information for EM4006, 2014/5 Module Title/Name: Management of New Product

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for EM4006, 2014/5 Module Title/Name: Management of New Product Development Module Code: EM4006 School: Engineering and Applied Science Module Type: Standard Module New Module? No Module Credits: 15 Module Management Information Module Leader Name Brian Price Email Address

  7. Approved Module Information for BSM934, 2014/5 Module Title/Name: Advanced Topics in International

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BSM934, 2014/5 Module Title/Name: Advanced Topics in International Business Module Code: BSM934 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 15 Module Management Information Module Leader Name Yama Temouri Email Address temoury1

  8. Approved Module Information for LG1038, 2014/5 Module Title/Name: Introduction to the German-speaking

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LG1038, 2014/5 Module Title/Name: Introduction to the German-speaking Countries Module Code: LG1038 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 10 Module Management Information Module Leader Name Uwe Schütte Email Address u

  9. Approved Module Information for BH3392, 2014/5 Module Title/Name: Learning, Training and Development in

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BH3392, 2014/5 Module Title/Name: Learning, Training and Development in Organisations Module Code: BH3392 School: Aston Business School Module Type: Standard Module New Module? No Module Credits: 10 Module Management Information Module Leader Name Alison J. Glaister

  10. Force Modulator System

    SciTech Connect (OSTI)

    Redmond Clark

    2009-04-30

    Many metal parts manufacturers use large metal presses to shape sheet metal into finished products like car body parts, jet wing and fuselage surfaces, etc. These metal presses take sheet metal and - with enormous force - reshape the metal into a fully formed part in a manner of seconds. Although highly efficient, the forces involved in forming metal parts also damage the press itself, limit the metals used in part production, slow press operations and, when not properly controlled, cause the manufacture of large volumes of defective metal parts. To date, the metal-forming industry has not been able to develop a metal-holding technology that allows full control of press forces during the part forming process. This is of particular importance in the automotive lightweighting efforts under way in the US automotive manufacturing marketplace. Metalforming Controls Technology Inc. (MC2) has developed a patented press control system called the Force Modulator that has the ability to control these press forces, allowing a breakthrough in stamping process control. The technology includes a series of hydraulic cylinders that provide controlled tonnage at all points in the forming process. At the same time, the unique cylinder design allows for the generation of very high levels of clamping forces (very high tonnages) in very small spaces; a requirement for forming medium and large panels out of HSS and AHSS. Successful production application of these systems testing at multiple stamping operations - including Ford and Chrysler - has validated the capabilities and economic benefits of the system. Although this technology has been adopted in a number of stamping operations, one of the primary barriers to faster adoption and application of this technology in HSS projects is system cost. The cost issue has surfaced because the systems currently in use are built for each individual die as a custom application, thus driving higher tooling costs. This project proposed to better marry the die-specific Force Modulator technology with stamping presses in the form of a press cushion. This system would be designed to operate the binder ring for multiple parts, thus cutting the per-die cost of the technology. This study reports the results of technology field application. This project produced the following conclusions: (1) The Force Modulator system is capable of operating at very high tempos in the stamping environment; (2) The company can generate substantial, controlled holding tonnage (binder ring pressure) necessary to hold high strength steel parts for proper formation during draw operations; (3) A single system can be designed to operate with a family of parts, thus significantly reducing the per-die cost of a FM system; (4) High strength steel parts made with these systems appear to show significant quality improvements; (5) The amounts of steel required to make these parts is typically less than the amounts required with traditional blank-holding technologies; and (6) This technology will aid in the use of higher strength steels in auto and truck production, thus reducing weight and improving fuel efficiency.

  11. Ice Bear® Storage Module | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Ice Bear Storage Module Ice Bear Storage Module Thermal Energy Storage for Light Commercial Refrigerant-Based Air Conditioning Units The Ice Bear storage technology was...

  12. Module Encapsulation Materials, Processing and Testing (Presentation...

    Office of Scientific and Technical Information (OSTI)

    Module Encapsulation Materials, Processing and Testing (Presentation) Pern, J. 14 SOLAR ENERGY; 36 MATERIALS SCIENCE; ENCAPSULATION; PROCESSING; RELIABILITY; TESTING PV; MODULE...

  13. Lateral electrodeposition of compositionally modulated metal layers

    DOE Patents [OSTI]

    Hearne, Sean J

    2014-03-25

    A method for making a laterally modulated metallic structure that is compositionally modulated in the lateral direction with respect to a substrate.

  14. Alternative Energy Sources -- An Interdisciplinary Module for...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    - An Interdisciplinary Module for Energy Education Alternative Energy Sources -- An Interdisciplinary Module for Energy Education Find activities focused on renewable energy...

  15. Module Encapsulation Materials, Processing and Testing (Presentation)

    SciTech Connect (OSTI)

    Pern, J.

    2008-12-01

    Study of PV module encapsulation materials, processing, and testing shows that overall module reliability is determined by all component materials and processing factors.

  16. Alternative Energy Sources - An Interdisciplinary Module for...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Energy Sources - An Interdisciplinary Module for Energy Education Alternative Energy Sources - An Interdisciplinary Module for Energy Education Below is information about the...

  17. Characterizing the thermal efficiency of thermoelectric modules

    E-Print Network [OSTI]

    Phillips, Samuel S

    2009-01-01

    An experimental setup was designed and utilized to measure the thermoelectric properties as functions of temperature of a commercially available, bismuth telluride thermoelectric module. Thermoelectric modules are solid ...

  18. Quantum modulation against electromagnetic interference

    E-Print Network [OSTI]

    Juan Carlos Garcia-Escartin

    2014-11-26

    Periodic signals in electrical and electronic equipment can cause interference in nearby devices. Randomized modulation of those signals spreads their energy through the frequency spectrum and can help to mitigate electromagnetic interference problems. The inherently random nature of quantum phenomena makes them a good control signal. I present a quantum modulation method based on the random statistics of quantum light. The paper describes pulse width modulation schemes where a Poissonian light source acts as a random control that spreads the energy of the potential interfering signals. I give an example application for switching-mode power supplies and comment the further possibilities of the method.

  19. Photovoltaic module with adhesion promoter

    DOE Patents [OSTI]

    2013-10-08

    Photovoltaic modules with adhesion promoters and methods for fabricating photovoltaic modules with adhesion promoters are described. A photovoltaic module includes a solar cell including a first surface and a second surface, the second surface including a plurality of interspaced back-side contacts. A first glass layer is coupled to the first surface by a first encapsulating layer. A second glass layer is coupled to the second surface by a second encapsulating layer. At least a portion of the second encapsulating layer is bonded directly to the plurality of interspaced back-side contacts by an adhesion promoter.

  20. Approved Module Information for PH4705, 2014/5 Module Title/Name: Interprofessional Learning Module Code: PH4705

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Code: PH4705 School: Life and Health Sciences Module Type: Standard Module New Module? No Module: Students will: ? engage in learning with students of other professions (medicine, podiatry and audiology;and prescribers from various professions (medicine, podiatry, audiology), and will be responsible

  1. Approved Module Information for EM4002, 2014/5 Module Title/Name: Strategic Management Module Code: EM4002

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for EM4002, 2014/5 Module Title/Name: Strategic Management Module Code: The purpose of this module is to introduce students to the concepts and techniques of strategic management: * demonstrate their understanding of key terms and concepts of strategic management * undertake strategic

  2. Approved Module Information for LK3011, 2014/5 Module Title/Name: Contemporary Social Movements Module Code: LK3011

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LK3011, 2014/5 Module Title/Name: Contemporary Social Movements? Yes Module Learning Information Module Aims: Social movements are widely recognised as key mechanisms a programme of lectures and seminars, we will examine what social movements are, how they are organised, what

  3. Approved Module Information for BM2257, 2014/5 Module Title/Name: Marketing Module Code: BM2257

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BM2257, 2014/5 Module Title/Name: Marketing Module Code: BM2257 Aims: This module aims to introduce students to the principles and practices of marketing to develop a sound working knowledge of marketing concepts and theories which they will be able to apply

  4. Approved Module Information for BMM644, 2014/5 Module Title/Name: Services Marketing Module Code: BMM644

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BMM644, 2014/5 Module Title/Name: Services Marketing Module Code? Not Specified Module Dependancies Pre-requisites: Marketing Management (BMM600). Co-requisites: None Specified the key concepts involved in services marketing Understand and analyse differences between product

  5. Approved Module Information for PD4002, 2014/5 Module Title/Name: Product Design Innovation Module Code: PD4002

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PD4002, 2014/5 Module Title/Name: Product Design Innovation Module: . MSc Product Design Innovation. Available to Exchange Students? Not Specified Module Learning to initiate Innovation or Entrepreneurial skills to create product or enterprise proposals and development

  6. Approved Module Information for ME1502, 2014/5 Module Title/Name: Prototyping and Development Module Code: ME1502

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Module Code: ME1502 School: Engineering and Applied Science Module Type: Standard Module New Module in which available: BEng/MEng Mechanical Engineering. BEng/MEng Electromechanical Engineering. BEng Design Engineering. BSc Transport Product Design. BSc Industrial Product Design. BSc Product Design and Management

  7. Approved Module Information for BNM806, 2014/5 Module Title/Name: Information Systems Management Module Code: BNM806

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BNM806, 2014/5 Module Title/Name: Information Systems Management/D/MSc in Information Systems & Business Analysis. Available to Exchange Students? Yes Module Learning Information Module Aims: Today, information systems are an integral part of almost all business activities

  8. Approved Module Information for BFM236, 2014/5 Module Title/Name: Financial Accounting & Reporting Module Code: BFM236

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BFM236, 2014/5 Module Title/Name: Financial Accounting & Reporting: Masters Programmes in which available: MSc in Accounting and Finance. MSc in Finance and Financial accounts. Module Learning Outcomes: The first part of the module concentrates on the preparation

  9. Approved Module Information for BF2211, 2014/5 Module Title/Name: Financial Accounting Module Code: BF2211

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BF2211, 2014/5 Module Title/Name: Financial Accounting Module Code Students? Yes Module Dependancies Pre-requisites: Introduction to Financial Accounting (BF1100). Co accounting principles and procedures 2. Demonstrate an understanding of the preparation of accounting

  10. Approved Module Information for LT1301, 2014/5 Module Title/Name: Introduction to Logistics Module Code: LT1301

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LT1301, 2014/5 Module Title/Name: Introduction to Logistics Module in which available: BSc Logistics with Supply Chain Management. BSc Logistics with Purchasing Management. BSc Logistics with Transport Management. Available to Exchange Students? Not Specified Module Learning

  11. Approved Module Information for LT3101, 2014/5 Module Title/Name: Inbound Logistics Module Code: LT3101

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LT3101, 2014/5 Module Title/Name: Inbound Logistics Module Code: LT in which available: BSc Logistics Management. BSc Construction Project Management. Available to Exchange with an understanding of Inbound Logistics theory and management practice. Module Learning Outcomes: * Evaluate

  12. Approved Module Information for PH1403, 2014/5 Module Title/Name: Pharmaceutical Calculations Module Code: PH1403

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PH1403, 2014/5 Module Title/Name: Pharmaceutical Calculations Credits: 10 Module Management Information Module Leader Name Dan Kirby Email Address D.J.KIRBY1@aston knowledge of the fundamentals of mathematical principles as applied to pharmaceutical calculations, may

  13. Engagement in Reading and Access to Print: The Relationship of Home and School to Overall Reading Achievement Among Fourth Grade English Speakers 

    E-Print Network [OSTI]

    Allaith, Zainab A.

    2013-04-05

    The present study puts forward two models which examine the relationship between at home at school variables of (1) engagement in shared and independent reading and (2) access to print with reading achievement. Participants were fourth grade English...

  14. Residential Demand Module - NEMS Documentation

    Reports and Publications (EIA)

    2014-01-01

    Model Documentation - Documents the objectives, analytical approach, and development of the National Energy Modeling System (NEMS) Residential Sector Demand Module. The report catalogues and describes the model assumptions, computational methodology, parameter estimation techniques, and FORTRAN source code.

  15. Photovoltaic Module Qualification Plus Testing

    SciTech Connect (OSTI)

    Kurtz, S.; Wohlgemuth, J.; Kempe, M.; Bosco, N.; Hacke, P.; Jordan, D.; Miller, D. C.; Silverman, T. J.; Phillips, N.; Earnest, T.; Romero, R.

    2013-12-01

    This report summarizes a set of test methods that are in the midst of being incorporated into IEC 61215 for certification of a module design or other tests that go beyond certification to establish bankability.

  16. Renewable Fuels Module - NEMS Documentation

    Reports and Publications (EIA)

    2014-01-01

    This report documents the objectives, analytical approach, and design of the National Energy Modeling System (NEMS) Renewable Fuels Module (RFM) as it relates to the production of the Annual Energy Outlook forecasts.

  17. Compact magnetic energy storage module

    DOE Patents [OSTI]

    Prueitt, M.L.

    1994-12-20

    A superconducting compact magnetic energy storage module in which a plurality of superconducting toroids, each having a toroidally wound superconducting winding inside a poloidally wound superconducting winding, are stacked so that the flow of electricity in each toroidally wound superconducting winding is in a direction opposite from the direction of electrical flow in other contiguous superconducting toroids. This allows for minimal magnetic pollution outside of the module. 4 figures.

  18. Compact magnetic energy storage module

    DOE Patents [OSTI]

    Prueitt, Melvin L. (Los Alamos, NM)

    1994-01-01

    A superconducting compact magnetic energy storage module in which a plurality of superconducting toroids, each having a toroidally wound superconducting winding inside a poloidally wound superconducting winding, are stacked so that the flow of electricity in each toroidally wound superconducting winding is in a direction opposite from the direction of electrical flow in other contiguous superconducting toroids. This allows for minimal magnetic pollution outside of the module.

  19. Solar cell module lamination process

    DOE Patents [OSTI]

    Carey, Paul G. (Mountain View, CA); Thompson, Jesse B. (Brentwood, CA); Aceves, Randy C. (Tracy, CA)

    2002-01-01

    A solar cell module lamination process using fluoropolymers to provide protection from adverse environmental conditions and thus enable more extended use of solar cells, particularly in space applications. A laminate of fluoropolymer material provides a hermetically sealed solar cell module structure that is flexible and very durable. The laminate is virtually chemically inert, highly transmissive in the visible spectrum, dimensionally stable at temperatures up to about 200.degree. C. highly abrasion resistant, and exhibits very little ultra-violet degradation.

  20. Approved Module Information for AM21EM, 2014/5 Module Title/Name: Engineering Mathematics 2 Module Code: AM21EM

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for AM21EM, 2014/5 Module Title/Name: Engineering Mathematics 2 Module Code: AM21EM School: Engineering and Applied Science Module Type: Standard Module New Module? No Module) Programmes in which available: BEng Design Engineering. BEng/MEng Mechanical Engineering. BEng

  1. Approved Module Information for EE404A, 2014/5 Module Title/Name: Software Engineering Module Code: EE404A

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for EE404A, 2014/5 Module Title/Name: Software Engineering Module Code: EE404A School: Engineering and Applied Science Module Type: Standard Module New Module? No Module: MSc Telecommunications Systems. MSc Data Communications Networks. MSc Photonic Networks Engineering

  2. NSM Secure UI Crypto Module Security Policy

    E-Print Network [OSTI]

    NSM Secure UI Crypto Module Security Policy Version: 1.4 Revision Date: April 1, 2010 This document. #12;McAfee, Inc NSM Secure UI Crypto Module Security Policy Page 2 of 15 CHANGE RECORD Revision Date Module Security Policy Page 3 of 15 Contents 1 Module Overview

  3. Approved Module Information for LT1F02, 2014/5 Module Title/Name: Personal Development and Leading

    E-Print Network [OSTI]

    Rebollo-Neira, Laura

    Approved Module Information for LT1F02, 2014/5 Module Title/Name: Personal Development and Leading People Module Code: LT1F02 School: Engineering and Applied Science Module Type: Foundation New Module? No Module Credits: 20 Module Management Information Module Leader Name Constant Iannacci Email Address c

  4. Approved Module Information for LS2022, 2014/5 Module Title/Name: Human Rights in Contemporary Latin

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LS2022, 2014/5 Module Title/Name: Human Rights in Contemporary Module? No Module Credits: 10 Module Management Information Module Leader Name Stephanie Panichelli (Foundation Degree/Dip He) Available to Exchange Students? Not Specified Module Learning Information Module

  5. Apparatus for encapsulating a photovoltaic module

    DOE Patents [OSTI]

    Albright, Scot P. (El Paso, TX); Dugan, Larry M. (Boulder, CO)

    1995-10-24

    The subject inventions concern various photovoltaic module designs to protect the module from horizontal and vertical impacts and degradation of solar cell efficiency caused by moisture. In one design, a plurality of panel supports that are positioned adjacent to the upper panel in a photovoltaic module absorb vertical forces exerted along an axis perpendicular to the upper panel. Other designs employ layers of glass and tempered glass, respectively, to protect the module from vertical impacts. A plurality of button-shaped channels is used around the edges of the photovoltaic module to absorb forces applied to the module along an axis parallel to the module and direct moisture away from the module that could otherwise penetrate the module and adversely affect the cells within the module. A spacer is employed between the upper and lower panels that has a coefficient of thermal expansion substantially equivalent to the coefficient of thermal expansion of at least one of the panels.

  6. Module No: 420150Human RightsModule Title: Pre-requisite

    E-Print Network [OSTI]

    Module No: 420150Human RightsModule Title: Pre-requisite: Module Type: university elective requirementModule level: First Year Evening StudyDaytime StudyCredit Hours: 3 Credit Hours Lecture Time-mailOffice Number Office Phone Academic rank Module coordinator jo.edu.idabbah@philadelphia310397Assistant professor

  7. Module No: 420262Administrative Law 2Module Title: Co-requisite: administrative

    E-Print Network [OSTI]

    Module No: 420262Administrative Law 2Module Title: Co-requisite: administrative Judiciary Administrative Law 1Pre-requisite: Module Type: specialization requirementModule level: Fourth Year Evening Study-mailOffice Number Office Phone Academic rank Instructor Name E-mailOffice Number Office Phone Academic rank Module

  8. Module No: 410314Nominated ContractsModule Title: Co-requisite: Real Rights, Private

    E-Print Network [OSTI]

    Module No: 410314Nominated ContractsModule Title: Co-requisite: Real Rights, Private International Law, Insurance Contract Introduction to LawPre-requisite: Module Type: Department PrerequisiteModule Office Phone Academic rank Module coordinator E-bataineh@philadelphia.edu.joAssistant Professor Eyad

  9. Module No: 420444Graduation ProjectModule Title: Co-requisite:the completion of 100 credit

    E-Print Network [OSTI]

    Module No: 420444Graduation ProjectModule Title: Co-requisite:the completion of 100 credit hours Pre-requisite: Module Type: specialization requirementModule level: fourth year Evening Study-mailOffice Number Office Phone Academic rank Instructor Name E-mailOffice Number Office Phone Academic rank Module

  10. Module No: 410331International Trade LawModule Title: Pre-requisite

    E-Print Network [OSTI]

    Module No: 410331International Trade LawModule Title: Pre-requisite: Module Type: specialization requirementModule level: Third year Evening StudyDaytime StudyCredit Hours: 3 Credit Hours Lecture Time-mailOffice Number Office Phone Academic rank Module coordinator b-tarawneh@philadelphia.edu.jo313375Assistant

  11. Module No: 420272Crimes against personsModule Title: Law of criminal proceduresPre-requisite

    E-Print Network [OSTI]

    Module No: 420272Crimes against personsModule Title: Law of criminal proceduresPre-requisite: Module Type: specialization requirementModule level: Second Year Evening StudyDaytime StudyCredit Hours Phone Academic rank Instructor Name E-mailOffice Number Office Phone Academic rank Module coordinator

  12. Module No: 420141Public International Law (1)Module Title: public international law 2, international

    E-Print Network [OSTI]

    Module No: 420141Public International Law (1)Module Title: public international law 2, international human law and international organizations Pre-requisite: Module Type: Department requirementModule Office Phone Academic rank Module coordinator jo.edu.idabbah@philadelphia310397Assistant professor Dr

  13. Module No: 420335Expression and legal draftingModule Title: Co-requisite:Pre-requisite

    E-Print Network [OSTI]

    Module No: 420335Expression and legal draftingModule Title: Co-requisite:Pre-requisite: Module Type: specialization requirement electiveModule level: Third level Evening StudyDaytime StudyCredit Hours: 3 Credit rank Instructor Name E-mailOffice Number Office Phone Academic rank Module coordinator F

  14. Module No: 420281Finance and TaxationModule Title: Co-requisite:Pre-requisite

    E-Print Network [OSTI]

    Module No: 420281Finance and TaxationModule Title: Co-requisite:Pre-requisite: Module Type: department requirementModule level: First Year Evening StudyDaytime StudyCredit Hours: 3 Credit Hours Lecture Instructor Name E-mailOffice Number Office Phone Academic rank Module coordinator O

  15. Module No: 420363Administrative JudiciaryModule Title: Co-requisite: administrative

    E-Print Network [OSTI]

    Module No: 420363Administrative JudiciaryModule Title: Co-requisite: administrative Judiciary Administrative law 2Pre-requisite: Module Type: specialization requirementModule level: Fourth Year Evening Study-mailOffice Number Office Phone Academic rank Instructor Name E-mailOffice Number Office Phone Academic rank Module

  16. Module No: 410391Law of Civil ProcedureModule Title: Co-requisite: Evidence and

    E-Print Network [OSTI]

    Module No: 410391Law of Civil ProcedureModule Title: Co-requisite: Evidence and Procedural Law Effects of ObligationsPre-requisite: Module Type: specialization requirementModule level: Third Year Academic rank Module coordinator 309396Assistant Professor Dr. Sabri Thyabat ResearchTutorial Guidance

  17. Module No: 410330Commercial and Industrial PropertyModule Title: Pre-requisite

    E-Print Network [OSTI]

    Module No: 410330Commercial and Industrial PropertyModule Title: Pre-requisite: Module Type: specialization requirementModule level: First year Evening StudyDaytime StudyCredit Hours: 3 Credit Hours Lecture Instructor Name E-mailOffice Number Office Phone Academic rank Module coordinator b

  18. Module No: 410325Insurance ContractsModule Title: Co-requisite:Nominated ContractsPre-requisite

    E-Print Network [OSTI]

    Module No: 410325Insurance ContractsModule Title: Co-requisite:Nominated ContractsPre-requisite: Module Type: specialization requirementModule level: Third Year Evening StudyDaytime StudyCredit Hours: 3-mailOffice Number Office Phone Academic rank Instructor Name E-mailOffice Number Office Phone Academic rank Module

  19. Module No: 410236Environmental protectionModule Title: Introduction to LawPre-requisite

    E-Print Network [OSTI]

    Module No: 410236Environmental protectionModule Title: Introduction to LawPre-requisite: Module Type: elective specialization requirementModule level: Second year Evening StudyDaytime Study Office Phone Academic rank Instructor Name E-mailOffice Number Office Phone Academic rank Module

  20. Module No: 420151Political systems and constitutional lawModule Title: Constitutional lawPre-requisite

    E-Print Network [OSTI]

    Module No: 420151Political systems and constitutional lawModule Title: Constitutional lawPre-requisite: Module Type: department requirementModule level: First Year Evening StudyDaytime StudyCredit Hours: 3 Academic rank Instructor Name E-mailOffice Number Office Phone Academic rank Module coordinator jo

  1. Module No: 420252The Jordanian ConstitutionModule Title: Co-requisite:Political Systems and

    E-Print Network [OSTI]

    Module No: 420252The Jordanian ConstitutionModule Title: Co-requisite:Political Systems and Constitutional Law Pre-requisite: Module Type: specialization requirementModule level: Second year Evening Study-mailOffice Number Office Phone Academic rank Instructor Name E-mailOffice Number Office Phone Academic rank Module

  2. Module No: 410436Principles of JurisprudenceModule Title: Co-requisite:Introduction to Islamic

    E-Print Network [OSTI]

    Module No: 410436Principles of JurisprudenceModule Title: Co-requisite:Introduction to Islamic Jurisprudence Pre-requisite: Module Type: specialization elective requirementModule level: Fourth year Evening Academic rank Module coordinator F-sartawe@philadelphia.edu.jo307384Assistant professor Dr. Fuad Alsartawi

  3. Module No: 420273Crimes against propertyModule Title: Co-requisite: Criminal Law

    E-Print Network [OSTI]

    Module No: 420273Crimes against propertyModule Title: Co-requisite: Criminal Law (General part) Law of criminal proceduresPre-requisite: Module Type: specialization requirementModule level: Second Year Evening Academic rank Module coordinator khzoubi@philadelphia.edu.jo309396Assistant professor Dr. Khaled Alzu

  4. Module No: 420243International OrganizationsModule Title: Co-requisite: administrative

    E-Print Network [OSTI]

    Module No: 420243International OrganizationsModule Title: Co-requisite: administrative Judiciary Public International Law 1Pre-requisite: Module Type: specialization requirementModule level: Second Year Academic rank Module coordinator idabbah@philadelphia.edu.jo310397Assistant professor Dr. Issa Dabbah

  5. Module No: 420253NationalityModule Title: Introduction to LawPre-requisite

    E-Print Network [OSTI]

    Module No: 420253NationalityModule Title: Introduction to LawPre-requisite: Module Type: elective specialization requirementModule level: Second year Evening StudyDaytime StudyCredit Hours: 3 Credit Hours Instructor Name E-mailOffice Number Office Phone Academic rank Module coordinator jo

  6. Module No: 410416Real RightsModule Title: Co-requisite:Nominal ContractPre-requisite

    E-Print Network [OSTI]

    Module No: 410416Real RightsModule Title: Co-requisite:Nominal ContractPre-requisite: Module Type: department prerequisiteModule level: Fourth year Evening StudyDaytime StudyCredit Hours: 3 Credit Hours Instructor Name E-mailOffice Number Office Phone Academic rank Module coordinator Assistant Professor Dr

  7. Module No: 410424Maritime LawModule Title: Co-requisite:Introduction to Commercial

    E-Print Network [OSTI]

    Module No: 410424Maritime LawModule Title: Co-requisite:Introduction to Commercial Law Pre-requisite: Module Type: specialization requirementModule level: Fourth Year Evening StudyDaytime StudyCredit Hours Phone Academic rank Instructor Name E-mailOffice Number Office Phone Academic rank Module coordinator B

  8. Module No: 410222Companies and BankruptcyModule Title: Pre-requisite

    E-Print Network [OSTI]

    Module No: 410222Companies and BankruptcyModule Title: Pre-requisite: Module Type: specialization requirementModule level: Second Year Evening StudyDaytime StudyCredit Hours: 3 Credit Hours Lecture Time-mailOffice Number Office Phone Academic rank Module coordinator Bassam-taraeneh@yahoo.com313375Assistant professor

  9. Approved Module Information for PH1407, 2014/5 Module Title/Name: Introduction to Pharmaceutical Patient

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for PH1407, 2014/5 Module Title/Name: Introduction to Pharmaceutical? No Module Credits: 10 Module Management Information Module Leader Name Anna Durkin Email Address durkina

  10. Holographic Labeling And Reading Machine For Authentication And Security Appications

    DOE Patents [OSTI]

    Weber, David C. (Rancho Santa Margarita, CA); Trolinger, James D. (Costa Mesa, CA)

    1999-07-06

    A holographic security label and automated reading machine for marking and subsequently authenticating any object such as an identification badge, a pass, a ticket, a manufactured part, or a package is described. The security label is extremely difficult to copy or even to read by unauthorized persons. The system comprises a holographic security label that has been created with a coded reference wave, whose specification can be kept secret. The label contains information that can be extracted only with the coded reference wave, which is derived from a holographic key, which restricts access of the information to only the possessor of the key. A reading machine accesses the information contained in the label and compares it with data stored in the machine through the application of a joint transform correlator, which is also equipped with a reference hologram that adds additional security to the procedure.

  11. Laser frequency modulator for modulating a laser cavity

    DOE Patents [OSTI]

    Erbert, Gaylen V. (Livermore, CA)

    1992-01-01

    The present invention relates to a laser frequency modulator for modulating a laser cavity. It is known in the prior art to utilize a PZT (piezoelectric transducer) element in combination with a mirror to change the cavity length of a laser cavity (which changes the laser frequency). Using a PZT element to drive the mirror directly is adequate at frequencies below 10 kHz. However, in high frequency applications (100 kHz and higher) PZT elements alone do not provide a sufficient change in the cavity length. The present invention utilizes an ultrasonic concentrator with a PZT element and mirror to provide modulation of the laser cavity. With an ultrasonic concentrator, the mirror element at the end of a laser cavity can move at larger amplitudes and higher frequencies.

  12. NEMS integrating module documentation report

    SciTech Connect (OSTI)

    Not Available

    1993-12-14

    The National Energy Modeling System (NEMS) is a computer modeling system that produces a general equilibrium solution for energy supply and demand in the US energy markets. The model achieves a supply and demand balance in the end-use demand regions, defined as the nine Census Divisions, by solving for the prices of each energy type such that the quantities producers are willing to supply equal the quantities consumers wish to consume. The system reflects market economics, industry structure, and energy policies and regulations that influence market behavior. The NEMS Integrating Module is the central integrating component of a complex modeling system. As such, a thorough understanding of its role in the modeling process can only be achieved by placing it in the proper context with respect to the other modules. To that end, this document provides an overview of the complete NEMS model, and includes brief descriptions of the modules with which the Integrating Module interacts. The emphasis and focus, however, is on the structure and function of the Integrating Module of NEMS.

  13. "TAKE FIVE PROGRAM" BLACKBOARD MODULE Instructions for enrolling in the module

    E-Print Network [OSTI]

    Cantlon, Jessica F.

    "TAKE FIVE PROGRAM" BLACKBOARD MODULE Instructions for enrolling in the module: On the "MAIN" page to the "TAKE FIVE PROGRAM" module every time you login to Blackboard. Access it on the right side under "My

  14. Active combustion flow modulation valve

    DOE Patents [OSTI]

    Hensel, John Peter; Black, Nathaniel; Thorton, Jimmy Dean; Vipperman, Jeffrey Stuart; Lambeth, David N; Clark, William W

    2013-09-24

    A flow modulation valve has a slidably translating hollow armature with at least one energizable coil wound around and fixably attached to the hollow armature. The energizable coil or coils are influenced by at least one permanent magnet surrounding the hollow armature and supported by an outer casing. Lorentz forces on the energizable coils which are translated to the hollow armature, increase or decrease the flow area to provide flow throttling action. The extent of hollow armature translation depends on the value of current supplied and the direction of translation depends on the direction of current flow. The compact nature of the flow modulation valve combined with the high forces afforded by the actuator design provide a flow modulation valve which is highly responsive to high-rate input control signals.

  15. Solid-state membrane module

    DOE Patents [OSTI]

    Gordon, John Howard (Salt Lake City, UT); Taylor, Dale M. (Murray, UT)

    2011-06-07

    Solid-state membrane modules comprising at least one membrane unit, where the membrane unit has a dense mixed conducting oxide layer, and at least one conduit or manifold wherein the conduit or manifold comprises a dense layer and at least one of a porous layer and a slotted layer contiguous with the dense layer. The solid-state membrane modules may be used to carry out a variety of processes including the separating of any ionizable component from a feedstream wherein such ionizable component is capable of being transported through a dense mixed conducting oxide layer of the membrane units making up the membrane modules. For ease of construction, the membrane units may be planar.

  16. Programmable Multi-Chip Module

    DOE Patents [OSTI]

    Kautz, David (Lenexa, KS); Morgenstern, Howard (Lee's Summit, MO); Blazek, Roy J. (Overland Park, KS)

    2005-05-24

    A multi-chip module comprising a low-temperature co-fired ceramic substrate having a first side on which are mounted active components and a second side on which are mounted passive components, wherein this segregation of components allows for hermetically sealing the active components with a cover while leaving accessible the passive components, and wherein the passive components are secured using a reflow soldering technique and are removable and replaceable so as to make the multi-chip module substantially programmable with regard to the passive components.

  17. Programmable Multi-Chip Module

    DOE Patents [OSTI]

    Kautz, David (Lenexa, KS); Morgenstern, Howard (Lee's Summit, MO); Blazek, Roy J. (Overland Park, KS)

    2004-11-16

    A multi-chip module comprising a low-temperature co-fired ceramic substrate having a first side on which are mounted active components and a second side on which are mounted passive components, wherein this segregation of components allows for hermetically sealing the active components with a cover while leaving accessible the passive components, and wherein the passive components are secured using a reflow soldering technique and are removable and replaceable so as to make the multi-chip module substantially programmable with regard to the passive components.

  18. Programmable multi-chip module

    DOE Patents [OSTI]

    Kautz, David; Morgenstern, Howard; Blazek, Roy J.

    2004-03-02

    A multi-chip module comprising a low-temperature co-fired ceramic substrate having a first side on which are mounted active components and a second side on which are mounted passive components, wherein this segregation of components allows for hermetically sealing the active components with a cover while leaving accessible the passive components, and wherein the passive components are secured using a reflow soldering technique and are removable and replaceable so as to make the multi-chip module substantially programmable with regard to the passive components.

  19. Module title Financial Management Module code INT3605

    E-Print Network [OSTI]

    Mumby, Peter J.

    accounting in monitoring, controlling and planning an organisation's activities. You will develop: Module-specific skills 1. demonstrate understanding of internal management accounts and a company for application in future work place situations #12;ILO: Discipline-specific skills 3. analyse critically

  20. Energy From the Sun ( Rookie Read About Science)

    E-Print Network [OSTI]

    Ohta, Shigemi

    Energy From the Sun ( Rookie Read About Science) By Alan Fowler Age Range: 5 and up Grade Level Series: Green Power Hardcover: 64 pages Bibliography Solar Power (Energy for Today) Age Range: 7 and up Grade Level: 2 and up Series: Energy for Today Paperback: 24 pages Done In The Sun Anne Hillerman Age

  1. Urban Pollution Control Strategies Reading: pages 422-437

    E-Print Network [OSTI]

    Toohey, Darin W.

    ATOC 3500 Urban Pollution Control Strategies Reading: pages 422-437 Details to come #12;#12;Urban Pollution Control Strategies What we know so far: · Different regions have different issues, but two types, warm, NOx, HCs, ozone, CO) · Pollution is made worse by meteorological conditions called "inversions

  2. Readings for Artificial Intelligence CS63 Fall 2007

    E-Print Network [OSTI]

    Meeden, Lisa A.

    Readings for Artificial Intelligence CS63 Fall 2007 1. A proposal for the Dartmouth Summer Research Project on Artificial Intelligence, John McCarthy, Marvin Minsky, Nathaniel Rochester, and Claude Shannon Norvig (2003). Chapter 3 from Artificial Intelligence: A modern approach, Second edition, Prentice Hall

  3. the university of reading chaplaincy Places of worship

    E-Print Network [OSTI]

    Wirosoetisno, Djoko

    to Reading A very warm welcome from the University Chaplains! This leaflet includes the majority of places-in centre on the Whiteknights campus in Park House Lodge, behind the main library, which is open to all. Our library, kitchen, quiet room and common room are open every week day during office hours. Student Faith

  4. The University of Reading Helen Dacre Evaluating pollution transport in

    E-Print Network [OSTI]

    Dacre, Helen

    and PM10 concentrations for 16 urban areas and 16 UK regions Forecast for East (last updated at 10 Outline Air pollution forecasting Offline forecasting Online forecasting Aim Overview of ETEX 2 case Conclusions and future work #12;The University of Reading Helen Dacre Offline Air Pollution Forecasting

  5. Functional Genomics: It's All How You Read It

    E-Print Network [OSTI]

    Boguski, Mark S.

    Functional Genomics: It's All How You Read It Philip Hieter and Mark Boguski "Functional genomics to functional genomics? An informal poll of colleagues indicates that the term is widely used, but has many genomics websites that have sprung up over the last 12 months clearly demonstrates that interpretations

  6. Why Advertise The Age (Mon) is read by

    E-Print Network [OSTI]

    Peters, Richard

    OVERVIEW EDUCATION #12;Why Advertise The Age (Mon) is read by: ·358,000 tertiary qualified: 659,000 Education Advertising Contact Information Liza Kwaks ­ Account Manager Ph: 03 8667 4243 Email opportunities for advertisers to reach parents, students, teacher and education professionals. Profile* 44% 56

  7. Light and Matter: Reading Messages from the Cosmos

    E-Print Network [OSTI]

    Crenshaw, Michael

    1 Chapter 5 Light and Matter: Reading Messages from the Cosmos How do we experience light? · The warmth of sunlight tells us that light is a form of energy · We can measure the amount of energy emitted ) Colors of Light · White light is made up of many different colors How do light and matter interact

  8. Ab Initio Whole Genome Shotgun Assembly With Mated Short Reads

    E-Print Network [OSTI]

    Toronto, University of

    Ab Initio Whole Genome Shotgun Assembly With Mated Short Reads Paul Medvedev1 and Michael Brudno1 these technologies are already being used for rese- quencing individuals once a reference genome exists, it has not been shown if it is possible to use them for ab initio genome assembly. In this paper, we give a novel

  9. Supplementary Material: Large Scale Read Classification for Next Generation Sequencing

    E-Print Network [OSTI]

    Liang, Huizhi "Elly"

    genomics. 1 Introduction This document provides a list of sequences used in the study Large Scale Read.3 Bordetella bronchiseptica RB50 chromosome, complete genome 2 Negative NC_009495.1 Clostridium botulinum A str. ATCC 3502 chromosome, complete genome 2 Negative NC_022121.1 Chlamydia trachomatis strain J/31

  10. Reading and Collaboration in a Digital Age Cathy Marshall

    E-Print Network [OSTI]

    Marshall, Cathy

    for storage, in a few years at least some high-end appliances will house hundreds, if not thousands, of books simultaneously, and certainly laptops with software book readers will house thousands or tends of thousands, and technology interventions #12;#12;Reading. is it: Private? Individual? Stationary? Passive? Immersive? Soggy

  11. Optical fuel pin scanner. [Patent application; for reading identifications

    DOE Patents [OSTI]

    Kirchner, T.L.; Powers, H.G.

    1980-12-09

    This patent relates to an optical identification system developed for post-irradiation disassembly and analysis of fuel bundle assemblies. The apparatus is designed to be lowered onto a stationary fuel pin to read identification numbers or letters imprinted on the circumference of the top fuel pin and cap. (DLC)

  12. School of Geography, Earth and Environmental Sciences Module Descriptions

    E-Print Network [OSTI]

    Birmingham, University of

    (sedimentology) ­ Nichols, G. D. (2009) Sedimentology and stratigraphy. Oxford: Wiley-Blackwell Other Reading

  13. Approved Module Information for CS3210, 2014/5 Module Title/Name: Geographic Information Systems Module Code: CS3210

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    investigation of a particular issue: eg choose where to site a wind farm, assess the impact of a new road to construct abstract representations (models) of the real world. Indicative Module Content: The module covers

  14. Approved Module Information for LT2317, 2014/5 Module Title/Name: Road Transport Module Code: LT2317

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    performance measurement - Fleet optimization (managing return load, empty runs) 2 - Operating staff management: 10 Module Management Information Module Leader Name Constant Iannacci Email Address c in which available: BSc Logistics Management. BSc Logistics and Operations Management. BSc Logistics

  15. Approved Module Information for PH3605, 2014/5 Module Title/Name: Medicinal Chemistry Module Code: PH3605

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    : 20 Module Management Information Module Leader Name Dan Rathbone Email Address rathbodl of autoxidation, including its pharmaceutical significance and methods to suppress it. ? Understand the overall; pharmaceutical consequences of drug metabolism; details of cytochrome P450, reactive metabolites, toxicity

  16. Approved Module Information for LYM005, 2014/5 Module Title/Name: Social Theory and Social Change Module Code: LYM005

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    progressive about grassroots and popular movements for transformation? How can social theory help usApproved Module Information for LYM005, 2014/5 Module Title/Name: Social Theory and Social Change Module Code: LYM005 School: Languages and Social Sciences Module Type: Standard Module New Module

  17. Approved Module Information for CE1102, 2014/5 Module Title/Name: Organic Chemistry for Engineers Module Code: CE1102

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CE1102, 2014/5 Module Title/Name: Organic Chemistry for Engineers Module Code: CE1102 School: Engineering and Applied Science Module Type: Standard Module New Module chemistry. Part 2: Introduction to Laboratory Skills To enable the student to develop good practical skills

  18. Approved Module Information for BD1N12, 2014/5 Module Title/Name: Information Technology for Business Module Code: BD1N12

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BD1N12, 2014/5 Module Title/Name: Information Technology Credits: 10 Module Management Information Module Leader Name Roy Mcclean Email Address t) Available to Exchange Students? Not Specified Module Learning Information Module Aims: ? To provide

  19. Approved Module Information for BN3320, 2014/5 Module Title/Name: Managing Information Technology in a

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BN3320, 2014/5 Module Title/Name: Managing Information Technology? No Module Credits: 10 Module Management Information Module Leader Name Andreas Schroeder Email Address Learning Information Module Aims: This module demonstrates the role of Information Technology (IT

  20. High Heat Flux Thermoelectric Module Using Standard Bulk Material...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Heat Flux Thermoelectric Module Using Standard Bulk Material High Heat Flux Thermoelectric Module Using Standard Bulk Material Presents high heat flux thermoelectric module design...

  1. Intro to mixed Hodge modules

    E-Print Network [OSTI]

    2011-08-15

    differential operators DX(U) on U consists of C-linear endomorphisms of. OX(U) defined .... characteristic variety of i+M is Tp. A submodule of a holonomic module is ..... 14. Donu Arapura. Exercise 3.4 An n dimensional nilpotent orbit of weight m consists of. • a filtered complex ... with the same asymptotic behaviour. Thus the ...

  2. Module name: Seminar Abbreviation MSEM

    E-Print Network [OSTI]

    Ahlers, Volker - Fakultät IV

    research/development. Because these topics can also come from related fields, students will also expandModule name: Seminar Abbreviation MSEM Study semester: 3rd semester (WS), frequency: once a year in curriculum: Master Compulsory subject 3rd semester Teaching methods/SWS: 2 SWS seminar with approx. 15

  3. Mock Modular Mathieu Moonshine Modules

    E-Print Network [OSTI]

    Miranda C. N. Cheng; Xi Dong; John F. R. Duncan; Sarah Harrison; Shamit Kachru; Timm Wrase

    2015-08-10

    We construct super vertex operator algebras which lead to modules for moonshine relations connecting the four smaller sporadic simple Mathieu groups with distinguished mock modular forms. Starting with an orbifold of a free fermion theory, any subgroup of Co_0 that fixes a 3-dimensional subspace of its unique non-trivial 24-dimensional representation commutes with a certain N=4 superconformal algebra. Similarly, any subgroup of Co_0 that fixes a 2-dimensional subspace of the 24-dimensional representation commutes with a certain N=2 superconformal algebra. Through the decomposition of the corresponding twined partition functions into characters of the N=4 (resp. N=2) superconformal algebra, we arrive at mock modular forms which coincide with the graded characters of an infinite-dimensional Z-graded module for the corresponding group. The Mathieu groups are singled out amongst various other possibilities by the moonshine property: requiring the corresponding weak Jacobi forms to have certain asymptotic behaviour near cusps. Our constructions constitute the first examples of explicitly realized modules underlying moonshine phenomena relating mock modular forms to sporadic simple groups. Modules for other groups, including the sporadic groups of McLaughlin and Higman--Sims, are also discussed.

  4. WRAP module 1 treatment plan

    SciTech Connect (OSTI)

    Mayancsik, B.A.

    1995-05-01

    This document provides the methodology to treat waste in the Waste Receiving and Processing Module 1 facility to meet the Resource Conservation and Recovery Act (RCRA) land disposal restrictions or the Waste Isolation and Pilot Plant waste acceptance criteria. This includes Low-Level Mixed Waste, Transuranic Waste, and Transuranic Mixed Waste.

  5. Coal Market Module - NEMS Documentation

    Reports and Publications (EIA)

    2014-01-01

    Documents the objectives and the conceptual and methodological approach used in the development of the National Energy Modeling System's (NEMS) Coal Market Module (CMM) used to develop the Annual Energy Outlook 2014 (AEO2014). This report catalogues and describes the assumptions, methodology, estimation techniques, and source code of CMM's two submodules. These are the Coal Production Submodule (CPS) and the Coal Distribution Submodule (CDS).

  6. An Evaluation of Early Reading First on Emergent Literacy Skills: Preschool through Middle of First Grade 

    E-Print Network [OSTI]

    Tani-Prado, Sophia

    2010-10-12

    Early Reading First is a federal initiative that seeks to buffer against the detrimental effects of poverty on children?s academic outcomes by incorporating all of the elements supported by scientifically-based reading ...

  7. Testing a Multicomponent Model of Reading Comprehension for Seventh- and Eighth-Grade Students 

    E-Print Network [OSTI]

    Smith, Stacey Rafferty

    2013-04-27

    Reading is a complex construct with multiple components that have been theorized and empirically tested. Two multicomponent reading comprehension models were tested in this study to extend understanding of the relation of ...

  8. The Unholy Grail: A Social Reading of Chrétien de Troyes's Conte du Graal (review)

    E-Print Network [OSTI]

    Over, Kristen Lee

    1996-01-01

    Z E L L E S , The Unholy Grail: A Social Reading of Chretienthe very vast corpus of Grail scholarship, Brigitte Cazellesunderstandably opens The Unholy Grail: A Social Reading of

  9. Linking Family Background and Home Language with English Reading Comprehension amog Bi/Multilinguals 

    E-Print Network [OSTI]

    Yulia, Astri

    2013-04-24

    The purpose of this study is to examine the links between family background and home language factors on English reading achievement among bi/multilingual students. To explore the potential predictors of English reading achievement among bi...

  10. Screening English Learners with Oral Reading Fluency: The Prevalence of Word Callers

    E-Print Network [OSTI]

    Knight-Teague, Kerri Theresa Colleen

    2011-01-01

    Literacy Instruction, SES, and Word- Reading Achievement in2003). They Can Read the Words, but They Can’t Understand:Teachers' Perceptions of Word Callers and Related Literacy

  11. A study of teacher solicitations and student responses during read-alouds with kindergarten, first grade, and second grade students 

    E-Print Network [OSTI]

    Garcia, Norma Garza

    2009-06-02

    Read-alouds can be very useful in the classroom to assist students in gaining knowledge and improving reading skills. Educational research documents that there is a link between reading aloud to children and successful ...

  12. Approved Module Information for CH3114, 2014/5 Module Title/Name: Advanced NMR Spectroscopy Module Code: CH3114

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Credits: 10 Module Management Information Module Leader Name Rob Evans Email Address evansr2@aston students with an understanding of the underlying principles and knowledge of practical use of well- established, modern nuclear magnetic resonance (NMR) techniques. Module Learning Outcomes: At the end

  13. Approved Module Information for LK2014, 2014/5 Module Title/Name: Environmental Policy Module Code: LK2014

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LK2014, 2014/5 Module Title/Name: Environmental Policy Module Code and evaluate public policies in general and environmental policy in particular; ? to enable students to critically evaluate the development of environmental policy in national, European and international contexts

  14. Approved Module Information for BM3388, 2014/5 Module Title/Name: Strategic Brand Management Module Code: BM3388

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BM3388, 2014/5 Module Title/Name: Strategic Brand Management Module practitioners and aims to : ? Develop an understanding of strategic brand management models and methodologies. ? Place strategic brand management, and its advanced applications, within the context of the marketing

  15. Approved Module Information for BM3399, 2014/5 Module Title/Name: Strategic Management Module Code: BM3399

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BM3399, 2014/5 Module Title/Name: Strategic Management Module Code the inherent differences and similarities o Critique existing strategic management practices within the scope and design strategic plans in a case study based practical application of the taught theory o Manage

  16. Approved Module Information for BMM642, 2014/5 Module Title/Name: Strategic Brand Management Module Code: BMM642

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BMM642, 2014/5 Module Title/Name: Strategic Brand Management Module management models and methodologies. Place strategic brand management, and its advanced applications, within of pitch preparation and delivery. To craft a coherent and persuasive strategic brand management plan

  17. Approved Module Information for CS2230, 2014/5 Module Title/Name: Operating Systems Module Code: CS2230

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CS2230, 2014/5 Module Title/Name: Operating Systems Module Code: CS underlying an operating system and relate these to its function, evolution and design. To describe the different structural components of an operating system and show how they interact to provide a range of user

  18. Module Information for CE3104, 2015/6 -APPROVED Module Title/Name: Process & Pollution Control Module Code: CE3104

    E-Print Network [OSTI]

    Rebollo-Neira, Laura

    - characteristics, variation with source, treatment principles, discharge to sewers and watercourses - Air PollutionModule Information for CE3104, 2015/6 - APPROVED Module Title/Name: Process & Pollution Control on piping and instrumentation diagrams (P&ID). Indicative Module Content: Pollution Prevention and Control

  19. Approved Module Information for BM3326, 2014/5 Module Title/Name: Marketing Strategy Module Code: BM3326

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BM3326, 2014/5 Module Title/Name: Marketing Strategy Module Code Pre-requisites: Introduction to Marketing Management (BM1134). Consumer Behaviour (BM2258). Introduction to Market Research (BM2217). Marketing Communications (BM2282). Co-requisites: None Specified

  20. Approved Module Information for BMM603, 2014/5 Module Title/Name: Marketing Research Module Code: BMM603

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BMM603, 2014/5 Module Title/Name: Marketing Research Module Code in Marketing Management. MSc in Business and Marketing Analytics. Available to Exchange Students? Not Specified understanding of the requirements for successfully conducting marketing research as practiced in today?s dynamic

  1. Approved Module Information for BM3381, 2014/5 Module Title/Name: Services Marketing Management Module Code: BM3381

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BM3381, 2014/5 Module Title/Name: Services Marketing Management Marketing is essential Module Dependancies Pre-requisites: Principles of Services Marketing (BM2249). Co. To help students understand the application of services marketing theories and concepts to real business

  2. Approved Module Information for BMM601, 2014/5 Module Title/Name: Marketing Management Module Code: BMM601

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BMM601, 2014/5 Module Title/Name: Marketing Management Module Code in marketing to guide the development and execution of marketing strategies To develop the skills to critically analyse marketing situations facing organisations To gain understanding of marketing decision options

  3. Approved Module Information for BM3382, 2014/5 Module Title/Name: Advanced Marketing Communications Module Code: BM3382

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BM3382, 2014/5 Module Title/Name: Advanced Marketing Communications in which available: BSc Marketing. BSc Business and Management. Available to Exchange Students? Not Specified Module Dependancies Pre-requisites: (bm1134). Marketing Communications (BM2282). Co

  4. Approved Module Information for LT2320, 2014/5 Module Title/Name: Services Marketing Module Code: LT2320

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LT2320, 2014/5 Module Title/Name: Services Marketing Module Code a knowledge and understanding of the role of services marketing to managing and delivering a transport or logistics service and assess the relevance of a selected transport service marketing topic

  5. Approved Module Information for BM3309, 2014/5 Module Title/Name: International Marketing Module Code: BM3309

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BM3309, 2014/5 Module Title/Name: International Marketing Module conducting international marketing activities as many businesses today have expanded and are continuing to expand in the global arena in search of higher profits and market share. Their success largely depends

  6. Approved Module Information for CS3320, 2014/5 Module Title/Name: Multimedia Information Retrieval Module Code: CS3320

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    in the form of text, audio, image and video?This module will look at the fundamentals of modern information of applying theory to real search engine systems. Feedback Rationale: The assessment for this moduApproved Module Information for CS3320, 2014/5 Module Title/Name: Multimedia Information Retrieval

  7. Approved Module Information for BFM206, 2014/5 Module Title/Name: Business Finance Module Code: BFM206

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    an understanding of the fundamentals of corporate finance theory. In particular, it will be shown how firms. Explain the concept of risk and return. Examine and apply the main theories of asset pricing. OutlineApproved Module Information for BFM206, 2014/5 Module Title/Name: Business Finance Module Code: BFM

  8. Approved Module Information for EM4005, 2014/5 Module Title/Name: Management of Change Module Code: EM4005

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for EM4005, 2014/5 Module Title/Name: Management of Change Module Code: To understand the theory of change and how we can manage it successfully in today?s engineering business environment. To explain the basic ideas behind change management and explore how they impact organizations

  9. Approved Module Information for ME2033, 2014/5 Module Title/Name: Innovation Management Module Code: ME2033

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    property rights. Radical, incremental, product and process based innovation. Assessing organizationApproved Module Information for ME2033, 2014/5 Module Title/Name: Innovation Management Module Code technological innovation in a range of commercial organizations. Case studies will be used to underpin how

  10. Approved Module Information for ME4600, 2014/5 Module Title/Name: MEng Group Project Module Code: ME4600

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    : ME4600 School: Engineering and Applied Science Module Type: Project New Module? No Module Credits: 40 Programmes in which available: BEng/MEng Electromechanical Engineering. Available to Exchange Students the experience of working on a Group Project and to demonstrate a knowledge of emerging engineering technology

  11. Approved Module Information for CS3440, 2014/5 Module Title/Name: Data Mining Module Code: CS3440

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CS3440, 2014/5 Module Title/Name: Data Mining Module Code: CS3440, and scientific databases has far outpaced our ability to interpret and effectively use this data. Data mining: * compare and contrast the main features and characteristics of a wide range of data mining techniques

  12. Approved Module Information for BF1169, 2014/5 Module Title/Name: International Accounting Module Code: BF1169

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BF1169, 2014/5 Module Title/Name: International Accounting Module to the globalisation of accounting practice, the current progress of accounting harmonisation and the problems will be able to: * Understand the historical, cultural and institutional factors affecting the accounting

  13. Approved Module Information for BF3300, 2014/5 Module Title/Name: Advanced Financial Accounting Module Code: BF3300

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BF3300, 2014/5 Module Title/Name: Advanced Financial Accounting? Not Specified Module Dependancies Pre-requisites: Financial Accounting (BF2211). Co-requisites: None Specified of financial accounting and corporate reporting in the context of companies adopting International Financial

  14. Approved Module Information for LK2008, 2014/5 Module Title/Name: Race and Racisms Module Code: LK2008

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LK2008, 2014/5 Module Title/Name: Race and Racisms Module Code: LK?, Racism(s), Racialisation, intersectionality. II Case of studies of how these concepts can racisms, responses to immigration streams, Islamophobia, institutional racism, racist Far Right movements

  15. Approved Module Information for PH4703, 2014/5 Module Title/Name: Practical Therapeutics Module Code: PH4703

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Credits: 40 Module Management Information Module Leader Name Kay Wood Email Address woodkmg the pharmaceutical sciences to dynamic, complex, multi-factorial patient cases and patient groups. Module Learning from other areas of the programme in order to address the pharmaceutical care issues of complex

  16. Approved Module Information for CS4600, 2014/5 Module Title/Name: Diploma Project Module Code: CS4600

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    and Understanding * A practical knowledge of using library databases, Internet facilities, sources of information: Informal feedback will be provided by the supervisor during supervision meetings. Formal feedbackApproved Module Information for CS4600, 2014/5 Module Title/Name: Diploma Project Module Code: CS

  17. Mounting support for a photovoltaic module

    DOE Patents [OSTI]

    Brandt, Gregory Michael; Barsun, Stephan K.; Coleman, Nathaniel T.; Zhou, Yin

    2013-03-26

    A mounting support for a photovoltaic module is described. The mounting support includes a foundation having an integrated wire-way ledge portion. A photovoltaic module support mechanism is coupled with the foundation.

  18. Reliability Issues for Photovoltaic Modules (Presentation)

    SciTech Connect (OSTI)

    Kurtz, S.

    2009-10-01

    Si modules good in field; new designs need reliability testing. CdTe & CIGS modules sensitive to moisture; carefully seal. CPV in product development stage; benefits from expertise in other industries.

  19. PV module mounting method and mounting assembly

    DOE Patents [OSTI]

    Lenox, Carl J.S.; Johnson, Kurt M.

    2013-04-23

    A method for mounting PV modules to a deck includes selecting PV module layout pattern so that adjacent PV module edges are spaced apart. PV mounting and support assemblies are secured to the deck according to the layout pattern using fasteners extending into the deck. The PV modules are placed on the PV mounting and support assemblies. Retaining elements are located over and secured against the upper peripheral edge surfaces of the PV modules so to secure them to the deck with the peripheral edges of the PV modules spaced apart from the deck. In some examples a PV module mounting assembly, for use on a shingled deck, comprises flashing, a base mountable on the flashing, a deck-penetrating fastener engageable with the base and securable to the deck so to secure the flashing and the base to the shingled deck, and PV module mounting hardware securable to the base.

  20. Development of ultra-broadband modulators

    E-Print Network [OSTI]

    Shamir, Orit A

    2008-01-01

    Optical signal modulation is a cornerstone of communication, allowing the transfer of information by electrically encoding data onto an optical carrier. Modulation with ultra-broadband capability enables the generation of ...

  1. Traces on Module Categories over Fusion Categories

    E-Print Network [OSTI]

    Gregor Schaumann

    2015-01-27

    We consider traces on module categories over pivotal fusion categories which are compatible with the module structure. It is shown that such module traces characterise the Morita classes of special haploid symmetric Frobenius algebras. Moreover, they are unique up to a scale factor and they equip the dual category with a pivotal structure. This implies that for each pivotal structure on a fusion category over the complex numbers there exists a conjugate pivotal structure defined by the canonical module trace.

  2. An investigation of concurrent ERP and self-paced reading methodologies

    E-Print Network [OSTI]

    Kuperberg, Gina

    An investigation of concurrent ERP and self-paced reading methodologies TALI DITMAN,a PHILLIP J (ERP) studies of language processing have presented words at a fixed rate using rapid serial visual to read at a natural pace. The present study employed simultaneous self-paced reading and ERP meth

  3. Exploration of Short Reads Genome Mapping in Hardware Edward Fernandez, Walid Najjar

    E-Print Network [OSTI]

    Najjar, Walid A.

    Exploration of Short Reads Genome Mapping in Hardware Edward Fernandez, Walid Najjar Department, such as Illumina/Solexa Genome Analyzer and ABI SOLiD, can generate hundreds of millions of short DNA "reads" from a single run. These reads must be matched against a reference genome to identify their original location

  4. Module Handbook Core Univ. of Oldenburg

    E-Print Network [OSTI]

    Habel, Annegret

    /EUREC Course 2008/2009 #12;EUREC Core Courses at University of Oldenburg, 1st Semester Wind Energy Module Module Description: Wind Energy Field: Core Oldenburg Courses: Wind Energy Wind Energy Technology Wind Energy Conversion (Lab) Excursion Tutorial Study Semester: First Semester Module

  5. Neurofibromin Regulation of ERK Signaling Modulates

    E-Print Network [OSTI]

    Silva, Alcino

    Neurofibromin Regulation of ERK Signaling Modulates GABA Release and Learning Yijun Cui,1 Rui M@mednet.ucla.edu DOI 10.1016/j.cell.2008.09.060 SUMMARY We uncovered a role for ERK signaling in GABA re- lease, long demonstrate that neurofibromin modulates ERK/synapsin I-dependent GABA re- lease, which in turn modulates

  6. Static modules and equivalences Robert Wisbauer

    E-Print Network [OSTI]

    Wisbauer, Robert

    Static modules and equivalences Robert Wisbauer Mathematical Institute of the University 40225 D by the functor HomR(P, -). In R-Mod these are the P-static (= P-solvable) modules. In this context properties" under P S HomR(P, -). Following Nauman [20] and Alperin [3] we call these modules P-static. Other names

  7. Energy consumption in optical modulators for interconnects

    E-Print Network [OSTI]

    Miller, David A. B.

    Energy consumption in optical modulators for interconnects David A. B. Miller* Ginzton Laboratory@ee.stanford.edu Abstract: We analyze energy consumption in optical modulators operated in depletion and intended for low, even conceivably being more energy-efficient than an ideal loss-less modulator. ©2012 Optical Society

  8. A Stability of LCLS Linac Modulators

    SciTech Connect (OSTI)

    Decker, F.-J.; Krasnykh, A.; Morris, B.; Nguyen, M.; /SLAC

    2012-06-13

    Information concerning to a stability of LCLS RF linac modulators is allocated in this paper. In general a 'pulse-to-pulse' modulator stability (and RF phase as well) is acceptable for the LCLS commission and FEL programs. Further modulator stability improvements are possible and approaches are discussed based on our experimental results.

  9. Emittance growth from electron beam modulation

    SciTech Connect (OSTI)

    Blaskiewicz, M.

    2009-12-01

    In linac ring colliders like MeRHIC and eRHIC a modulation of the electron bunch can lead to a modulation of the beam beam tune shift and steering errors. These modulations can lead to emittance growth. This note presents simple formulas to estimate these effects which generalize some previous results.

  10. Workplace Training Module: Enhancing Ecotourism Business Performance

    E-Print Network [OSTI]

    Workplace Training Module: Enhancing Ecotourism Business Performance (Level 5 ­ 10 credits as part of university course) Prescriptor This training module forms part of a broader qualification focused for ecotourism in the region Learning and teaching strategies This training module will be taught

  11. Module No: 420171Penal law (general part)Module Title: Co-requisite: crimes against

    E-Print Network [OSTI]

    Module No: 420171Penal law (general part)Module Title: Co-requisite: crimes against property and persons, crimes against state national security Introduction to LawPre-requisite: Module Type: department requirementModule level: First year Evening StudyDaytime StudyCredit Hours: 3 Credit Hours Lecture Time

  12. Module, Demokratiewissenschaft, 20.01.06 1. Name des Moduls: Kernmodul

    E-Print Network [OSTI]

    Schubart, Christoph

    Module, Demokratiewissenschaft, 20.01.06 DEM ­ M 30 1. Name des Moduls: Kernmodul 2. Fachgebiet, Diplom, Lehramt etc.) 6. Wie häufig wird das Modul angeboten? jedes Semester 7. In welcher Zeit kann das Modul absolviert werden? in zwei Semestern 8. Zusammensetzung: Nr. Veranstaltungen SWS LP

  13. Module No: 410213Effects of ObligationsModule Title: Co-requisite: nominal contracts,

    E-Print Network [OSTI]

    Module No: 410213Effects of ObligationsModule Title: Co-requisite: nominal contracts, Law of civil procedures, copyright and neighboring rights Sources of ObligationsPre-requisite: Module Type: Specialization prerequisiteModule level: Second year Evening StudyDaytime StudyCredit Hours: 3 Credit Hours Lecture Time

  14. Degradation Pathway Models for Photovoltaics Module Lifetime Performance

    E-Print Network [OSTI]

    Rollins, Andrew M.

    Degradation Pathway Models for Photovoltaics Module Lifetime Performance Nicholas R. Wheeler, Laura data from Underwriter Labs, featuring measurements taken on 18 identical photovoltaic (PV) modules in modules and their effects on module performance over lifetime. Index Terms--photovoltaics, statistical

  15. Town of Reading, Massachusetts (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013)OpenEnergy Facilities BiomassInformationTownReading,

  16. Development of GREET Catalyst Module

    SciTech Connect (OSTI)

    Wang, Zhichao; Benavides, Pahola T.; Dunn, Jennifer B.; Cronauer, Donald C.

    2015-09-01

    In this report, we develop energy and material flows for the production of five different catalysts (tar reforming, alcohol synthesis, Zeolite Socony Mobil-5 [ZSM-5], Mo/Co/ ?-Al2O3, and Pt/ ?-Al2O3) and two chemicals (olivine, dimethyl ether of polyethylene glycol [DEPG]). These compounds and catalysts are now included in the Greenhouse Gases, Regulated Emissions and Energy Use in Transportation (GREET™) catalyst module.

  17. Gas separation membrane module assembly

    DOE Patents [OSTI]

    Wynn, Nicholas P (Palo Alto, CA); Fulton, Donald A. (Fairfield, CA)

    2009-03-31

    A gas-separation membrane module assembly and a gas-separation process using the assembly. The assembly includes a set of tubes, each containing gas-separation membranes, arranged within a housing. The housing contains a tube sheet that divides the space within the housing into two gas-tight spaces. A permeate collection system within the housing gathers permeate gas from the tubes for discharge from the housing.

  18. Pulse amplitude modulated chlorophyll fluorometer

    DOE Patents [OSTI]

    Greenbaum, Elias; Wu, Jie

    2015-12-29

    Chlorophyll fluorometry may be used for detecting toxins in a sample because of changes in micro algae. A portable lab on a chip ("LOAC") based chlorophyll fluorometer may be used for toxin detection and environmental monitoring. In particular, the system may include a microfluidic pulse amplitude modulated ("PAM") chlorophyll fluorometer. The LOAC PAM chlorophyll fluorometer may analyze microalgae and cyanobacteria that grow naturally in source drinking water.

  19. Apparatuses and methods for laser reading of thermoluminescent phosphors

    DOE Patents [OSTI]

    Braunlich, Peter F. (SW. 730 City View, Pullman, WA 99163); Tetzlaff, Wolfgang (Pullman, WA)

    1989-01-01

    Apparatuses and methods for rapidly reading thermoluminescent phosphors to determine the amount of luminescent energy stored therein. The stored luminescent energy is interpreted as a measure of the total exposure of the thermoluminescent phosphor to ionizing radiation. The thermoluminescent phosphor reading apparatus uses a laser to generate a laser beam. The laser beam power level is monitored by a laser power detector and controlled to maintain the power level at a desired value or values which can vary with time. A shutter or other laser beam interrupting means is used to control exposure of the thermoluminescent phosphor to the laser beam. The laser beam can be equalized using an opitcal equalizer so that the laser beam has an approximately uniform power density across the beam. The heated thermoluminescent phosphor emits a visible or otherwise detectable luminescent emission which is measured as an indication of the radiation exposure of the thermoluminscent phosphors. Also disclosed are preferred signal processing and control circuits including one system using a digital computer. Also disclosed are time-profiled laser power cycles for pre-anneal, read and post-anneal treatment of phosphors.

  20. MODULE REVIEW 2014-15 To be completed by the Module Leader and submitted to the Academic Development

    E-Print Network [OSTI]

    Daley, Monica A.

    MODULE REVIEW 2014-15 To be completed by the Module Leader and submitted to the Academic in their Annual Quality Improvement Report. 1. MODULE INFORMATION Year(s) of study Term ­ 1, 2 or 3 Course Title Module Title Module Leader(s) 2. MODULE REVIEW 2014-15 2.1 Student Evaluation results You are required

  1. Approved Module Information for EC316C, 2014/5 Module Title/Name: Facilities Management Module Code: EC316C

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    . ? Building Performance and Intelligent Buildings ? Asset and Value Management in Facilities ManagementApproved Module Information for EC316C, 2014/5 Module Title/Name: Facilities Management Module Code Credits: 10 Module Management Information Module Leader Name Yakubu Olawale Email Address olawalya

  2. Approved Module Information for BN2234, 2014/5 Module Title/Name: IT and Web Development Module Code: BN2234

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BN2234, 2014/5 Module Title/Name: IT and Web Development Module Specified Module Learning Information Module Aims: Web systems are an essential business tool in the 21st century, therefore, knowledge of web development methods is a fundamental component of digital literacy

  3. Approved Module Information for EM4023, 2014/5 Module Title/Name: Management in Engineering Enterprises Module Code: EM4023

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for EM4023, 2014/5 Module Title/Name: Management in Engineering Enterprises Module Code: EM4023 School: Engineering and Applied Science Module Type: Standard Module New Programmes in which available: Dip/MSc Engineering Management. MSc Industrial Enterprise Management

  4. Approved Module Information for BF1100, 2014/5 Module Title/Name: Introduction to Financial Accounting Module Code: BF1100

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Accounting Module Code: BF1100 School: Aston Business School Module Type: Standard Module New Module. Level Description: Cert He/Level 4 (Enhanced Honours) Programmes in which available: BSc Accounting of the module is to familiarise intending business managers with financial accounting, so that they can manage

  5. Approved Module Information for BN1160, 2014/5 Module Title/Name: Information Technology in Business Module Code: BN1160

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BN1160, 2014/5 Module Title/Name: Information Technology of information Managerial decision making Competitive advantage & the value chain Drivers for technology adoption? No Module Credits: 10 Module Management Information Module Leader Name Paul Bocij Email Address bocijp

  6. Approved Module Information for LT1F01, 2014/5 Module Title/Name: Introduction to Logistics Module Code: LT1F01

    E-Print Network [OSTI]

    Rebollo-Neira, Laura

    Approved Module Information for LT1F01, 2014/5 Module Title/Name: Introduction to Logistics Module in which available: Foundation Degree in Logistics. Available to Exchange Students? No Module Learning Information Module Aims: To give an understanding of the general principles of logistics as relevant to a wide

  7. Approved Module Information for LS1019, 2014/5 Module Title/Name: Introduction to Latin America Module Code: LS1019

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    sources (music, film, advertising, art, etc.) from a formal point of view as well as from a social oneApproved Module Information for LS1019, 2014/5 Module Title/Name: Introduction to Latin America? No Module Credits: 20 Module Management Information Module Leader Name Stephanie Panichelli-Batalla Email

  8. Modules

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJessework uses concrete7Modifications for Public Comment Tri-Party Agreement

  9. Thermodynamic properties of a magnetically modulated graphene

    E-Print Network [OSTI]

    SK Firoz Islam; Naveen K. Singh; Tarun Kanti Ghosh

    2011-09-12

    The effect of magnetic modulation on thermodynamic properties of a graphene monolayer in presence of a constant perpendicular magnetic field is reported here. One-dimensional spatial electric or magnetic modulation lifts the degeneracy of the Landau levels and converts into bands and their band width oscillates with magnetic field leading to Weiss-type oscillation in the thermodynamic properties. The effect of magnetic modulation on thermodynamic properties of a graphene sheet is studied and then compared with electrically modulated graphene and magnetically modulated conventional two-dimensional electron gas (2DEG). We observe Weiss-type and de Haas-van Alphen (dHvA) oscillations at low and high magnetic field, respectively. There is a definite phase difference in Weiss-type oscillations in thermodynamic quantities of magnetically modulated graphene in compare to electrically modulated graphene. On the other hand, the phase remains same and amplitude of the oscillation is large when compared with the magnetically modulated 2DEG. Explicit asymptotic expressions of density of states and the Helmholtz free energy are provided to understand the phase and amplitude of the Weiss-type oscillations qualitatively. We also study thermodynamic properties when both electric and magnetic modulations are present. The Weiss-type oscillations still exist when the modulations are out-of-phase.

  10. Power module assemblies with staggered coolant channels

    SciTech Connect (OSTI)

    Herron, Nicholas Hayden; Mann, Brooks S; Korich, Mark D

    2013-07-16

    A manifold is provided for supporting a power module assembly with a plurality of power modules. The manifold includes a first manifold section. The first face of the first manifold section is configured to receive the first power module, and the second face of the first manifold section defines a first cavity with a first baseplate thermally coupled to the first power module. The first face of the second manifold section is configured to receive the second power module, and the second face of the second manifold section defines a second cavity with a second baseplate thermally coupled to the second power module. The second face of the first manifold section and the second face of the second manifold section are coupled together such that the first cavity and the second cavity form a coolant channel. The first cavity is at least partially staggered with respect to second cavity.

  11. An ultrafast carbon nanotube terahertz polarisation modulator

    SciTech Connect (OSTI)

    Docherty, Callum J.; Stranks, Samuel D.; Habisreutinger, Severin N.; Joyce, Hannah J.; Herz, Laura M.; Nicholas, Robin J.; Johnston, Michael B., E-mail: m.johnston@physics.ox.ac.uk [Department of Physics, University of Oxford, Clarendon Laboratory, Parks Road, Oxford OX1 3PU (United Kingdom)

    2014-05-28

    We demonstrate ultrafast modulation of terahertz radiation by unaligned optically pumped single-walled carbon nanotubes. Photoexcitation by an ultrafast optical pump pulse induces transient terahertz absorption in nanowires aligned parallel to the optical pump. By controlling the polarisation of the optical pump, we show that terahertz polarisation and modulation can be tuned, allowing sub-picosecond modulation of terahertz radiation. Such speeds suggest potential for semiconductor nanowire devices in terahertz communication technologies.

  12. A pilot study of reading to improve self-esteem 

    E-Print Network [OSTI]

    Bagnall, Norma Hayes

    1977-01-01

    to Children' s Reading, 3rd ed. (Ne Y rrr: pookeee rs hhoDay anan~o. , 1969), p. 9. Charlotte S. Huck, Children's Literature in the Ele entary Hoh ol, trite VoOr: HHoY, KXne~raan i~ns on, 1976), p. 26. 6 Ruth Strang, "Zvaluation oi Development... from the repressed to the outgoing stage in his relationships with other children. Q estion ~e' ht: "HHo d es he rele*e * ther children in a work/study situation?" measures 17 whether or not the child can be depended on to oarry out assigned tasks...

  13. Port Reading, New Jersey: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland:NPIProtectio1975) |Texas: EnergyOklahoma:Ewen, New York:Reading, New Jersey:

  14. Read Your E-mail | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMassR&D100 Winners * Impacts on GlobalRachel2RateCaseElementsOxide FuelRead Your E-mail

  15. Binary module test. Final report

    SciTech Connect (OSTI)

    Schilling, J.R.; Colley, T.C.; Pundyk, J.

    1980-12-01

    The objective of this project was to design and test a binary loop module representative of and scaleable to commercial size units. The design was based on state-of-the-art heat exchanger technology, and the purpose of the tests was to confirm performance of a supercritical boiling cycle using isobutane and a mixture of isobutane and isopentane as the secondary working fluid. The module was designed as one percent of a 50 MW unit. It was installed at Magma Power's East Mesa geothermal field and tested over a period of approximately 4 months. Most of the test runs were with isobutane but some data were collected for hydrocarbon mixtures. The results of the field tests are reported. In general these results indicate reasonably good heat balances and agreement with overall heat transfer coefficients calculated by current stream analysis methods and available fluid property data; however, measured pressure drops across the heat exchangers were 20 percent higher than estimated. System operation was stable under all conditions tested.

  16. Smart Fan Modules And System

    DOE Patents [OSTI]

    Cipolla, Thomas M. (Katonah, NY); Kaufman, Richard I. (Somers, NY); Mok, Lawrence S. (Brewster, NY)

    2003-07-15

    A fan module including: two or more individual fans, each fan having an air movement means and a motor engaged with the air movement means for accelerating air entering each of the two or more individual fans; a temperature sensor for sensing a temperature associated with the two or more fans and for outputting a first signal corresponding to the temperature; rotational speed sensor for outputting a second signal corresponding to a rotational speed of each of the two or more fans; and a processor for receiving the first and second signals and controlling the two or more individual fans based on the first and second signals. A fan module including: two or more individual fans, each fan having an air movement means and a motor engaged with the air movement means for accelerating air entering each of the two or more individual fans; a temperature sensor for sensing a temperature associated with the two or more fans and for outputting a first signal corresponding to the temperature; rotational speed sensor for outputting a second signal corresponding to a rotational speed of each of the two or more fans; and a processor for receiving the first and second signals and controlling the two or more individual fans based on the first and second signals.

  17. In-line thermoelectric module

    DOE Patents [OSTI]

    Pento, Robert (Algonquin, IL); Marks, James E. (Glenville, NY); Staffanson, Clifford D. (S. Glens Falls, NY)

    2000-01-01

    A thermoelectric module with a plurality of electricity generating units each having a first end and a second end, the units being arranged first end to second end along an in-line axis. Each unit includes first and second elements each made of a thermoelectric material, an electrically conductive hot member arranged to heat one side of the first element, and an electrically conductive cold member arranged to cool another side of the first element and to cool one side of the second element. The hot member, the first element, the cold member and the second element are supported in a fixture, are electrically connected respectively to provide an electricity generating unit, and are arranged respectively in positions along the in-line axis. The individual components of each generating unit and the respective generating units are clamped in their in-line positions by a loading bolt at one end of the fixture and a stop wall at the other end of the fixture. The hot members may have a T-shape and the cold members an hourglass shape to facilitate heat transfer. The direction of heat transfer through the hot members may be perpendicular to the direction of heat transfer through the cold members, and both of these heat transfer directions may be perpendicular to the direction of current flow through the module.

  18. Force Modulation System for Vehicle Manufacturing | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    System for Vehicle Manufacturing Force Modulation System for Vehicle Manufacturing Novel Technology Enables Energy-Efficient Production of High-Strength Steel Automotive Parts...

  19. Module 6 - Metrics, Performance Measurements and Forecasting...

    Broader source: Energy.gov (indexed) [DOE]

    the metrics and performance measurement tools used in Earned Value. This module reviews metrics such as cost and schedule variance along with cost and schedule performance indices....

  20. Advanced Low Temperature Absorption Chiller Module Integrated...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Low Temperature Absorption Chiller Module Integrated with a CHP System at a Distributed Data Center - Presentation by Exergy Partners Corp., June 2011 Advanced Low Temperature...

  1. PV Cell and Module Calibrations at NREL

    SciTech Connect (OSTI)

    Emery, Keith

    2012-10-22

    NREL has equipment to measure any conceivable cell or module technology. The lack of standards for low concentration modules complicates matters. Spectrally adjustable simulators are critical for more than three junctions. NREL's 10-channel fiber optic simulator has shown that the light can be set for each junction within 1% of what it would be under the reference spectrum for up to a five-junction cell. Uncertainty in module simulators dominated by spatial nonuniformity for calibration labs. Manufacturers can mitigate this error by using matched reference modules instead of cells.

  2. Solid State Marx Modulators for Emerging Applications

    SciTech Connect (OSTI)

    Kemp, M.A.; /SLAC

    2012-09-14

    Emerging linear accelerator applications increasingly push the boundaries of RF system performance and economics. The power modulator is an integral part of RF systems whose characteristics play a key role in the determining parameters such as efficiency, footprint, cost, stability, and availability. Particularly within the past decade, solid-state switch based modulators have become the standard in high-performance, high power modulators. One topology, the Marx modulator, has characteristics which make it particularly attractive for several emerging applications. This paper is an overview of the Marx topology, some recent developments, and a case study of how this architecture can be applied to a few proposed linear accelerators.

  3. Integrated Performance Testing Workshop, Modules 6 - 11

    SciTech Connect (OSTI)

    Leach, Janice; Torres, Teresa M.

    2012-10-01

    These modules cover performance testing of: Interior Detection Systems; Access Controls; Exterior Detection Systems; Video Assessment Systems; SNM / Contraband Detection Systems; Access Delay Elements

  4. Approved Module Information for CH1104, 2014/5 Module Title/Name: Molecular Transformations Module Code: CH1104

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Credits: 10 Module Management Information Module Leader Name Sahar Al-Malaika Email Address almalais to help in communicating the knowledge in terms of writing structural formula, chemical equations] * Infrared spectroscopy [IR spectroscopy] * 1H nuclear magnetic resonance spectroscopy [NMR spectroscopy

  5. Approved Module Information for BHM356, 2014/5 Module Title/Name: Workplace Design & Health Module Code: BHM356

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    of design of work environments, ergonomics and the importance of health and safety. The module aims work design, ergonomics and health and safety * Will develop a deeper understanding of how the study;Indicative Module Content: Week 1: Key principles Week 2: Anthropometry and ergonomics methods Week 3: Human

  6. Approved Module Information for PH3601, 2014/5 Module Title/Name: Neuropharmacology Module Code: PH3601

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    and be able to critically evaluate the risks and benefits of specific therapeutic approaches. ? Discuss and evaluate basic clinical scenarios involving drug interactions in CNS disease. Indicative Module Content development (1.5 hours) Tutorials - drug evaluation (self study / assessed by WebCT quiz) Module Delivery

  7. Approved Module Information for BNM745, 2014/5 Module Title/Name: International Operations Module Code: BNM745

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    the concepts of international operations and know why and how organisations start-up and manage manufacturing 12 decision. Debrief year 12 decision. Week 5 : Design and Technology Management in International: 15 Module Management Information Module Leader Name Breno Nunes Email Address nunesb

  8. Approved Module Information for BMM640, 2014/5 Module Title/Name: Integrated Marketing Communications Module Code: BMM640

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BMM640, 2014/5 Module Title/Name: Integrated Marketing available: MSc in Marketing Management. ABS Master Exchange Programme 1 Term. Available to Exchange Students theories and practices used in Integrated Marketing Communications (IMC). To explain the communication

  9. Approved Module Information for PD4008, 2014/5 Module Title/Name: Innovation Business Development Module Code: PD4008

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    in which available: MSc Product Design Innovation. MSc Product Design Enterprise. BEng/MEng Mechanical product and identify potential development include: Innovative design features-possible patents, marketApproved Module Information for PD4008, 2014/5 Module Title/Name: Innovation Business Development

  10. Approved Module Information for CS2130, 2014/5 Module Title/Name: Programming Language Concepts Module Code: CS2130

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for CS2130, 2014/5 Module Title/Name: Programming Language Concepts of and capability with programming languages, leading to: * improved background for choosing an appropriate programming language for a task * increased ability to learn new programming languages * increased capacity

  11. Approved Module Information for LPM023, 2014/5 Module Title/Name: International Political Communication Module Code: LPM023

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    between media, political actors and the public, and considers the extent to which mediated activity has and practical understanding of the actors involved in the production of political news and information. In doingApproved Module Information for LPM023, 2014/5 Module Title/Name: International Political

  12. Approved Module Information for LEM008, 2014/5 Module Title/Name: English Teaching Practice Module Code: LEM008

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    in teaching. Areas covered will include: Classroom interaction and discourse Classroom management Teaching Credits: 20 Module Management Information Module Leader Name Muna Morris-Adams Email Address adamsmm and implementation of classroom procedures, activities, techniques evaluation of language learning and language

  13. Approved Module Information for CE3104, 2014/5 Module Title/Name: Process & Pollution Control Module Code: CE3104

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    , treatment principles, discharge to sewers and watercourses * Air Pollution - effects of pollutants, typesApproved Module Information for CE3104, 2014/5 Module Title/Name: Process & Pollution Control - Understand how a chemical process is controlled safely and efficiently Pollution Control #12;* The impact

  14. Approved Module Information for CH3103, 2014/5 Module Title/Name: Organic Chemistry III Module Code: CH3103

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Credits: 10 Module Management Information Module Leader Name Andrew James Sutherland Email Address. These rapidly evolving areas of chemistry are especially relevant to the pharmaceutical industry but are also Lectures [Part 1] Combinatorial chemistry and its relevance to the pharmaceutical industry Concepts

  15. Approved Module Information for BMM658, 2014/5 Module Title/Name: Digital Marketing Module Code: BMM658

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Environment and history of e-marketing Identifying Internet users Technology ,social inclusion and e-requisites: (bmm601). Co-requisites: None Specified Module Learning Information Module Aims: The internet Learning Objectives and Structure Societal effects and implication of the internet for marketing

  16. Wong & Lok: Theory of Digital Communications 2. Modulation & Demodulation Modulation and Demodulation

    E-Print Network [OSTI]

    Wong, Tan F.

    Wong & Lok: Theory of Digital Communications 2. Modulation & Demodulation Chapter 2 Modulation: Theory of Digital Communications 2. Modulation & Demodulation s ( t )k "0" or "1" h ( t ) T z ( t )k 0 the £lter output at time T0 to provide the decision statistic zk(T0). 2.2 #12;Wong & Lok: Theory of Digital

  17. Approved Module Information for PH2503, 2014/5 Module Title/Name: Medicines Optimisation through

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    ? No Module Credits: 20 Module Management Information Module Leader Name Afzal Mohammed Email Address mohamaur to the preparation and testing of pharmaceutical products required in the optimisation of solid dosage medicines: Describe the pharmaceutical pathway of a drug through the development and clinical appraisal of a dosage

  18. CHARACTERISTIC p ANALOGUE OF MODULES WITH FINITE CRYSTALLINE HEIGHT

    E-Print Network [OSTI]

    Abrashkin, Victor

    CHARACTERISTIC p ANALOGUE OF MODULES WITH FINITE CRYSTALLINE HEIGHT Victor Abrashkin1 Abstract of Galois modules with crystalline height h N. If h = 1 these modules appear as geometric points[K]-modules with crystalline height h. Examples of such modules are given by subquotients of crystalline representations of K

  19. Module No: 410334Personal Status(1) Marriage and Divorce

    E-Print Network [OSTI]

    Module No: 410334Personal Status(1) Marriage and Divorce Module Title: Co-requisite:Introduction to IslamicPre-requisite: Module Type: specialization supporting requirement Module level: fourth year Evening Academic rank Module coordinator F_Sartawi@philadelphia.edu.joAssistant Professor Dr. Fuad Sartawi Research

  20. Module No: 410339Personal statutes(2) Inheritance and Wills

    E-Print Network [OSTI]

    Module No: 410339Personal statutes(2) Inheritance and Wills Module Title: Co-requisite:Introduction to Islamic Jurisprudence Pre-requisite: Module Type: specialization supportive prerequisite Module level Office Phone Academic rank Module coordinator 307384Participant professor Dr. Fuad Sartawi Research

  1. Module No: 410323Commercial Documents and Banking Transactions

    E-Print Network [OSTI]

    Module No: 410323Commercial Documents and Banking Transactions Module Title: Co-requisite:Introduction to Commercial Law Pre-requisite: Module Type: specialization requirementModule level: Third year Evening Study-mailOffice Number Office Phone Academic rank Instructor Name E-mailOffice Number Office Phone Academic rank Module

  2. STUDENT SYSTEMS OFFICE A Training Guide on Courses and Modules

    E-Print Network [OSTI]

    Sussex, University of

    STUDENT SYSTEMS OFFICE A Training Guide on Courses and Modules ­ Module Maintenance: Teaching to Use Module Management System (CMS) Teaching Methods Screen Introduction This training guide will cover select TRAINING) 5 #12;Access to the Database: Programmes and Modules - Module Maintenance Select Courses

  3. Effect of environmental factors on film badge dosimetry readings of dental office personnel

    SciTech Connect (OSTI)

    Collett, W.K.; Kaugars, G.E.; Broga, D.W. (Univ. of Florida, Gainesville (USA))

    1990-12-01

    Inadvertent exposure of film badges to environmental factors may produce fogging of the film and yield higher radiation exposure readings. Common environmental factors in everyday living were studied to assess their effect on film badge readings. Only heat appeared to have any significant effect, because moisture, chemicals, pressure, cold temperature, and non-work-related electromagnetic radiation did not substantially alter film badge readings. Therefore not all unexplained high readings on personnel film badge reports may be due to heat or other common environmental factors evaluated in this study.

  4. Deconnable self-reading pocket dosimeter containment with self-contained light

    DOE Patents [OSTI]

    Stevens, Robyn L. (Idaho Falls, ID); Arnold, Greg N. (Idaho Falls, ID); McBride, Ryan G. (Rexburg, ID)

    1996-01-01

    A container for a self-reading pocket dosimeter includes a transparent tube for receiving the self-reading pocket dosimeter, a light source mounted at one end of the transparent tube, and an eyepiece mounted on an opposite end of the transparent tube for viewing a read-out of the self-reading pocket dosimeter. The container may further include an activation device for selectively supplying power to the light source. The container both protects the dosimeter from being contaminated and provides a light source for viewing the dosimeter.

  5. Identification coding schemes for modulated reflectance systems

    DOE Patents [OSTI]

    Coates, Don M. (Santa Fe, NM); Briles, Scott D. (Los Alamos, NM); Neagley, Daniel L. (Albuquerque, NM); Platts, David (Santa Fe, NM); Clark, David D. (Santa Fe, NM)

    2006-08-22

    An identifying coding apparatus employing modulated reflectance technology involving a base station emitting a RF signal, with a tag, located remotely from the base station, and containing at least one antenna and predetermined other passive circuit components, receiving the RF signal and reflecting back to the base station a modulated signal indicative of characteristics related to the tag.

  6. Modulated optical vortices Jennifer E. Curtis 1

    E-Print Network [OSTI]

    Grier, David

    Modulated optical vortices Jennifer E. Curtis 1 and David G. Grier Dept. of Physics, James Franck-beam optical gradient force traps created by focusing helical modes of light are known as optical vortices. Modulating the helical pitch of such a modes' wavefront yields a new class of optical traps whose dynamically

  7. Development Status of the ILC Marx Modulator

    SciTech Connect (OSTI)

    Nguyen, M.; Beukers, T.; Burkhart, C.; Larsen, R.; Olsen, J.; Tang, T.; /SLAC

    2008-06-16

    The ILC Marx Modulator is under development as a lower cost alternative to the 'Baseline Conceptual Design' (BCD) klystron modulator. Construction of a prototype Marx is complete and testing is underway at SLAC. The Marx employs solid state elements, IGBTs and diodes, to control the charge, discharge and isolation of the modules. The prototype is based on a stack of sixteen modules, each initially charged to {approx}11 kV, which are arranged in a Marx topology. Initially, eleven modules combine to produce the 120 kV output pulse. The remaining modules are switched in after appropriate delays to compensate for the voltage droop that results from the discharge of the energy storage capacitors. Additional elements will further regulate the output voltage to {+-} 0.5%. The Marx presents several advantages over the conventional klystron modulator designs. It is physically smaller; there is no pulse transformer (quite massive at these parameters) and the energy storage capacitor bank is quite small, owing to the active droop compensation. It is oil-free; voltage hold-off is achieved using air insulation. It is air cooled; the secondary air-water heat exchanger is physically isolated from the electronic components. This paper outlines the current developmental status of the prototype Marx. It presents a detailed electrical and mechanical description of the modulator and operational test results. It will discuss electrical efficiency measurements, fault testing, and output voltage regulation.

  8. Development Status of The ILC Marx Modulator

    SciTech Connect (OSTI)

    Nguyen, M; Beukers, T.; Burkhart, C.; Larsen, R.; Olsen, J.; Tang, T.; /SLAC; ,

    2010-06-07

    The ILC Marx Modulator is under development as a lower cost alternative to the 'Baseline Conceptual Design' (BCD) klystron modulator. Construction of a prototype Marx is complete and testing is underway at SLAC. The Marx employs solid state elements, IGBTs and diodes, to control the charge, discharge and isolation of the modules. The prototype is based on a stack of sixteen modules, each initially charged to {approx}11 kV, which are arranged in a Marx topology. Initially, eleven modules combine to produce the 120 kV output pulse. The remaining modules are switched in after appropriate delays to compensate for the voltage droop that results from the discharge of the energy storage capacitors. Additional elements will further regulate the output voltage to {+-}0.5%. The Marx presents several advantages over the conventional klystron modulator designs. It is physically smaller; there is no pulse transformer (quite massive at these parameters) and the energy storage capacitor bank is quite small, owing to the active droop compensation. It is oil-free; voltage hold-off is achieved using air insulation. It is air cooled; the secondary air-water heat exchanger is physically isolated from the electronic components. This paper outlines the current developmental status of the prototype Marx. It presents a detailed electrical and mechanical description of the modulator and operational test results. It will discuss electrical efficiency measurements, fault testing, and output voltage regulation.

  9. Module Catalogue Bachelor of Science Chemistry

    E-Print Network [OSTI]

    Schubart, Christoph

    Module Catalogue Bachelor of Science Chemistry University of Regensburg 13.1.2014 The Bachelor of Science Chemistry at the University of Regensburg comprises the following modules: 1. Compulsory Courses: CHE-BSc-M 1 General Chemistry CHE-BSc-M 2 Mathematics CHE-BSc-M 3 Physics CHE-BSc-M 4 Chemistry

  10. Nutrient Management Module No. 14 Technological

    E-Print Network [OSTI]

    Lawrence, Rick L.

    Nutrient Management Module No. 14 Technological Advances in Nutrient Management by Susan Mc CCA 1 NM CEU #12;Module 14 · Technological Advances in Nutrient Management2 Background Innovations of nutrient management tools. Driving these technological advances is the growing awareness of soil nutrient

  11. Approved Module Information for LF3009, 2014/5 Module Title/Name: French Technology: Inventing Progress

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Module New Module? Not Specified Module Credits: 10 Module Management Information Module Leader Name in the construction and renewal of national life, ranging from the rise of nuclear energy to the explosion views about technology since 1945. *Knowledge of the key arguments cited in a range of debates

  12. Approved Module Information for BMM650, 2014/5 Module Title/Name: Theories in Marketing Management &

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for BMM650, 2014/5 Module Title/Name: Theories in Marketing Management Authors: On the Fundamentals of Publishing in Marketing Journals,? Journal of Marketing Theory? No Module Credits: 15 Module Management Information Module Leader Name David Gilliland Email Address d

  13. Approved Module Information for EE1EPE, 2014/5 Module Title/Name: Engineering Projects and

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for EE1EPE, 2014/5 Module Title/Name: Engineering Projects and Entrepreneurship Module Code: EE1EPE School: Engineering and Applied Science Module Type: Standard Module New (Enhanced Honours) Programmes in which available: BEng Electrical and Electronic Engineering. BEng

  14. Module No: 410318Social Security LawModule Title: Co-requisite:Labor LawPre-requisite

    E-Print Network [OSTI]

    Module No: 410318Social Security LawModule Title: Co-requisite:Labor LawPre-requisite: Module Type: specialization required electiveModule level: Third year Evening StudyDaytime StudyCredit Hours: 3 Credit Hours Instructor Name E-mailOffice Number Office Phone Academic rank Module coordinator S

  15. Module No: 410494Judicial ApplicationsModule Title: Co-requisite:Law of Civil ProceduresPre-requisite

    E-Print Network [OSTI]

    Module No: 410494Judicial ApplicationsModule Title: Co-requisite:Law of Civil ProceduresPre-requisite: Module Type: Specialization requirementModule level: Fourth year Evening StudyDaytime StudyCredit Hours Phone Academic rank Instructor Name E-mailOffice Number Office Phone Academic rank Module coordinator S

  16. Module No: 420475Forensic MedicineModule Title: Co-requisite:Law of Criminal ProcedurePre-requisite

    E-Print Network [OSTI]

    Module No: 420475Forensic MedicineModule Title: Co-requisite:Law of Criminal ProcedurePre-requisite: Module Type: specialization elective requirementModule level: fourth year Evening StudyDaytime Study Office Phone Academic rank Instructor Name E-mailOffice Number Office Phone Academic rank Module

  17. Module No: 420476Crimes Against State SecurityModule Title: Criminal law (general part)Pre-requisite

    E-Print Network [OSTI]

    Module No: 420476Crimes Against State SecurityModule Title: Criminal law (general part)Pre-requisite: Module Type: specialization required electiveModule level: fourth year Evening StudyDaytime Study Office Phone Academic rank Instructor Name E-mailOffice Number Office Phone Academic rank Module

  18. Module No: 410237History of LawModule Title: Co-requisite:Introduction to LawPre-requisite

    E-Print Network [OSTI]

    Module No: 410237History of LawModule Title: Co-requisite:Introduction to LawPre-requisite: Module Type: specialization required electiveModule level: Second year Evening StudyDaytime StudyCredit Hours Phone Academic rank Instructor Name E-mailOffice Number Office Phone Academic rank Module coordinator

  19. On-line Module Selection Student Guidelines On-line module selection opens on Wed 18th

    E-Print Network [OSTI]

    Harman, Neal.A.

    On-line Module Selection Student Guidelines Step 1 On-line module selection opens on Wed 18th March' followed by the tab `Next Year's Module Pre-selections'. Please note that any modules that are compulsory programme, you will need to submit the paper-work for this in-advance of selecting modules as your online

  20. Module No: 420464Local Administration LawModule Title: Co-requisite:Administration Law (2)Pre-requisite

    E-Print Network [OSTI]

    Module No: 420464Local Administration LawModule Title: Co-requisite:Administration Law (2)Pre-requisite: Module Type: specialization elective requirementModule level: Fourth year Evening StudyDaytime Study Office Phone Academic rank Instructor Name E-mailOffice Number Office Phone Academic rank Module