Powered by Deep Web Technologies
Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Exotic decay model and alpha decay studies  

SciTech Connect

In exotic decay studies, the lifetime of alpha emission occurs crucially in the branching ratio calculation. In this work, we extend our previous exotic decay model to calculate the same. But, in this case unlike in the exotic decay, the redistribution of charge for given masses of the fragments has to be taken into account since the charge-to-mass ratio of the alpha fragment differs from that of the parent nucleus. We have therefore modified the Yukawa-plus-exponential potential in the post-scission region in our model suitably so as to allow the required charge redistribution among the fragments in the region between sharp contact and the point up to which the finite-range effects persist. The success of this model for alpha decay is as good as for the exotic decay studies.

Shanmugam, G.; Kamalaharan, B. (Department of Physics, Presidency College, Madras 600005, India (IN))



Alpha-decay half-lives, alpha-capture and alpha-nucleus potential  

E-Print Network (OSTI)

The alpha-decay half-lives and the alpha-capture cross-sections are evaluated in the framework of unified model for alpha-decay and alpha-capture. In the framework of this model the alpha-decay and alpha-capture are considered as penetration of the alpha-particle through the potential barrier formed by nuclear, Coulomb and centrifugal interactions between alpha-particle and nucleus. The spins and the parities of parent and daughter nuclei as well as the quadrupole and hexadecapole deformations of daughter nuclei are taken into account for evaluation of the alpha-decay half-lives. The alpha-decay half-lives for 344 nuclei and the alpha-capture cross-sections of 40Ca, 44Ca, 59Co, 208Pb and 209Bi agree well with the experimental data. The evaluated alpha-decay half-lives within the range 10^{-9} alpha-emitters are tabulated.

V. Yu. Denisov; A. A. Khudenko



Alpha decay of Fr215  

Science Journals Connector (OSTI)

The ?-decay property of Fr215 has been studied by the pulsed-beam method, in which Fr215 was produced in the Bi209(C12,?2n) reaction and its ? decay was measured between natural beam bursts of the cyclotron. The ground state of Fr215 was found to decay with E?=9.355±0.010 MeV and t12=0.12±0.02 ?sec. The reduced ? width of Fr215 is shown to fit the systematical trend of N=128 isotones very well and to agree with the simple shell-model calculation. Distributions of recoil angles for reaction products in the (C12,?xn) reaction were found to be quite different from those for (C12,xn) products, giving a convenient method of distinguishing these reaction products.[NUCLEAR REACTIONS Bi209(C12,xn), Bi209(C12,?xn), E=73-80 MeV; measured ? decay and W(?) of reaction products, E?, t12; deduced ?-decay width of Fr215.

T. Nomura; K. Hiruta; M. Yoshie; O. Hashimoto




E-Print Network (OSTI)

231, Curium-242, and Americium-241 (Thesis), AECU-2757 (rimental Results A. Alpha Decay of Americium-243 L Alpha-Particle Energy of Americium-243 New Alpha Groups of

Hummel, John Philip



Alpha decay from fission isomeric states  

Science Journals Connector (OSTI)

Alpha-decay half-lives from shape isomeric states of some even-even isotopes of U, Pu and Cm nuclei are calculated by using fission theory in the parametrisation of a spheroid intersected with a sphere. The potential barrier was calculated in the framework of the liquid-drop model of Myers and Swiatecki (1967) extended for systems with different charge densities; a phenomenological shell correction was introduced. The WKB computed lifetimes are many orders of magnitude longer than that of the spontaneous fission process, in agreement with experimental results.

D N Poenaru; M Ivascu



Complex-Energy Shell-Model Description of Alpha Decay  

SciTech Connect

In his pioneering work of alpha decay, Gamow assumed that the alpha particle formed inside the nucleus tunnels through the barrier of the alpha-daughter potential. The corresponding metastable state can be viewed as a complex-energy solution of the time-independent Schroedinger equation with the outgoing boundary condition. The formation of the alpha cluster, missing in the original Gamow formulation, can be described within the R-matrix theory in terms of the formation amplitude. In this work, the alpha decay process is described by computing the formation amplitude and barrier penetrability in a large complex-energy configuration space spanned by the complex-energy eigenstates of the finite Woods-Saxon (WS) potential. The proper normalization of the decay channel is essential as it strongly modifies the alpha-decay spectroscopic factor. The test calculations are carried out for the ^{212}Po alpha decay.

Id Betan, R. [Rosario Physics Institute, Rosario, Argentina] [Rosario Physics Institute, Rosario, Argentina; Nazarewicz, Witold [ORNL] [ORNL



Time?dependent theory of alpha decay  

Science Journals Connector (OSTI)

Using Green’s function techniques a time?dependent theory of ? decay in the standard one?body model is developed. Formulas are obtained for the decay rate and ? energy. These formulas are combined with experimental information to show that to a good approximation the i n i t i a l ??particle wave function vanishes on or near the nuclear surface.

Michael G. Fuda



E-Print Network 3.0 - alpha-decay recoil products Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Summary: .A., Sherriff, B.L., Fleet, M.E., McCammon, C., 1991. Alpha-decay damage in titanite: American Mineralogist, 76... , G.R., Ewing, R.C., 1988. Alpha decay damage in...


Alpha Decay of the Isomers of Fr214  

Science Journals Connector (OSTI)

Alpha decay from the ground state and an isomeric state of Fr214 has been observed. The ground state has a half-life of 5.0±0.2 msec, and the isomeric state, 3.35±0.05 msec, at an excitation energy of 123 keV. A level scheme for At210 based on several ? transitions observed is presented. The similarity of the energy levels of Bi208 with those of At210 suggests that the addition of a proton pair to Bi208 does not significantly alter the nature of the particle-hole interactions observed for Bi208.

David F. Torgerson; Richard A. Gough; Ronald D. Macfarlane



Alpha-decay Rates of Yb and Gd in Solar Neutrino Detectors  

E-Print Network (OSTI)

The $\\alpha$-decay rates for the nuclides $^{168,170,171,172,173,174,176}$Yb and $^{148,150,152,154}$Gd have been estimated from transmission probabilities in a systematic $\\alpha$-nucleus potential and from an improved fit to $\\alpha$-decay rates in the rare-earth mass region. Whereas ${\\alpha}$-decay of $^{152}$Gd in natural gadolinium is a severe obstacle for the use of gadolinium as a low-energy solar-neutrino detector, we show that ${\\alpha}$-decay does not contribute significantly to the background in a ytterbium detector. An extremely long ${\\alpha}$-decay lifetime of $^{168}$Yb is obtained from calculation, which may be close to the sensitivity limit in a low-background solar neutrino detector.

M. Fujiwara; T. Kawabata; P. Mohr



Alpha Backgrounds and Their Implications for Neutrinoless Double-Beta Decay Experiments Using HPGe Detectors  

E-Print Network (OSTI)

Alpha Backgrounds and Their Implications for Neutrinoless Double-Beta Decay Experiments Using HPGe and Their Implications for Neutrinoless Double-Beta Decay Experiments Using HPGe Detectors Robert A. Johnson Chair of the Supervisory Committee: Professor John F. Wilkerson Physics The observation of neutrinoless double-beta decay

Washington at Seattle, University of - Department of Physics, Electroweak Interaction Research Group


Measurements of Charmless B Decays Related to alpha at BaBar  

SciTech Connect

We report recent measurements of the CKM angle {alpha} using data collected by the BABAR detector at the PEP-II asymmetric-energy e{sup +}e{sup -} collider at the SLAC National Accelerator Laboratory. In addition to improved constraints on {alpha} from the decays B{sup {+-}} {yields} {rho}{sup {+-}}{rho}{sup 0}, we also present preliminary results of neutral and charged B meson decays to K{sub 1}(1270){pi} and K{sub 1}(1400){pi} and its impact on the estimate for the CKM angle {alpha} based on time-dependent analysis of CP-violating asymmetries in B{sup 0} {yields} a{sub 1}(1260){sup {+-}} {pi}{sup {-+}}. Moreover we report the first observation of the decay B {yields} a{sub 1}(1260){sup {+-}}a{sub 1}(1260){sup {-+}}; this mode can be used, in principle, to provide an independent measurement of {alpha}.

Lombardo, Vincenzo; /INFN, Milan



Alpha Backgrounds for HPGe Detectors in Neutrinoless Double-Beta Decay Experiments  

E-Print Network (OSTI)

The Majorana Experiment will use arrays of enriched HPGe detectors to search for the neutrinoless double-beta decay of 76Ge. Such a decay, if found, would show lepton-number violation and confirm the Majorana nature of the neutrino. Searches for such rare events are hindered by obscuring backgrounds which must be understood and mitigated as much as possible. A potentially important background contribution to this and other double-beta decay experiments could come from decays of alpha-emitting isotopes in the 232Th and 238U decay chains on or near the surfaces of the detectors. An alpha particle emitted external to an HPGe crystal can lose energy before entering the active region of the detector, either in some external-bulk material or within the dead region of the crystal. The measured energy of the event will only correspond to a partial amount of the total kinetic energy of the alpha and might obscure the signal from neutrinoless double-beta decay. A test stand was built and measurements were performed to quantitatively assess this background. We present results from these measurements and compare them to simulations using Geant4. These results are then used to measure the alpha backgrounds in an underground detector in situ. We also make estimates of surface contamination tolerances for double-beta decay experiments using solid-state detectors.

R. A. Johnson; T. H. Burritt; S. R. Elliott; V. M. Gehman; V. E. Guiseppe; J. F. Wilkerson



X rays following the alpha decay of Pa231  

Science Journals Connector (OSTI)

More detailed information is presented concerning the L and K x-ray spectra due to internal conversion of the electromagnetic transitions following the ? decay of Pa231. Some of the difficulties discussed in Ref. 1 are clarified by the new results.[RADIOACTIVITY Pa231; measured L and K Ac x-ray components, ?? and ?XL coin Ac227 deduced levels, ICC.

A. G. de Pinho; L. T. Auler; A. G. da Silva



Alpha-decay properties of Fr205,206,207,208: Identification of Frm206  

Science Journals Connector (OSTI)

Alpha-particle and ?-ray spectral measurements were made for Fr205-208. A new ? emitter (T12=0.7±0.1 sec and E?=6.930±0.005 MeV) was observed and identified with the decay of a previously unknown isomer in Fr206. From the ? particle and ? ray intensities, ? decay branching ratios were deduced for Fr205-208 utilizing available information concerning the nuclides' (electron capture + positron) decay properties. Reduced widths were calculated and compared with those of neighboring nuclei.RADIOACTIVITY Fr205,206,207,208, measured E?, I?, E?, I?; deduced ?-branching ratios; identified Frm206. Mass separation.

B. G. Ritchie; K. S. Toth; H. K. Carter; R. L. Mlekodaj; E. H. Spejewski



Measurement of alpha / phi_2 from B to pi pi decays  

E-Print Network (OSTI)

The current results on B to pipi decays and SU2 constraints on the Unitarity Triangle angle alpha or phi_2 from the B-factories are summarised. Based on these measurements, predictions of the isospin analysis constraints at the end of the lifetime of both B-factories are given.

A. J. Bevan



Plutonium-238 alpha-decay damage study of the ceramic waste form.  

SciTech Connect

An accelerated alpha-decay damage study of a glass-bonded sodalite ceramic waste form has recently been completed. The purpose of this study was to investigate the physical and chemical durability of the waste form after significant exposure to alpha decay. This accelerated alpha-decay study was performed by doping the ceramic waste form with {sup 238}Pu which has a much greater specific activity than {sup 239}Pu that is normally present in the waste form. The alpha-decay dose at the end of the four year study was approximately 1 x 10{sup 18} alpha-decays/gram of material. An equivalent time period for a similar dose of {sup 239}Pu would require approximately 1100 years. After four years of exposure to {sup 238}Pu alpha decay, the investigation observed little change to the physical or chemical durability of the ceramic waste form (CWF). Specifically, the {sup 238}Pu-loaded CWF maintained it's physical integrity, namely that the density remained constant and no cracking or phase de-bonding was observed. The materials chemical durability and phase stability also did not change significantly over the duration of the study. The only significant measured change was an increase of the unit-cell lattice parameters of the plutonium oxide and sodalite phases of the material and an increase in the release of salt components and plutonium of the waste form during leaching tests, but, as mentioned, these did not lead to any overall loss of waste form durability. The principal findings from this study are: (1) {sup 238}Pu-loaded CWF is similar in microstructure and phase composition to referenced waste form. (2) Pu was observed primarily as oxide comprised of aggregates of nano crystals with aggregates ranging in size from submicron to twenty microns in diameter. (3) Pu phases were primarily found in the intergranular glassy regions. (4) PuO phase shows expected unit cell volume expansion due to alpha decay damage of approximately 0.7%, and the sodalite phase unit cell volume has expanded slightly by 0.3% again, presumably due to alpha-decay damage. (5) No bulk sample swelling was observed. (6) No amorphization of sodalite or actinide bearing phases was observed after four years of alpha-decay damage. (7) No microcracks or phase de-bonding were observed in waste form samples aged for four years. (8) In some areas of the {sup 238}Pu doped ceramic waste form material bubbles and voids were found. Bubbles and voids with similar size and density were also found in ceramic waste form samples without actinide. These bubbles and voids are interpreted as pre-existing defects. However, some contribution to these bubbles and voids from helium gas can not be ruled out. (9) Chemical durability of {sup 238}Pu CWF has not changed significantly after four years of alpha-decay exposure except for an increase in the release of salt components and Pu. Still, the plutonium release from CWF is very low at less than 0.005 g/m{sup 2}.

Frank, S M [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Barber, T L [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Cummings, D G [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; DiSanto, T [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Esh, D W [U.S. Nuclear Regulatory Commission, Washington, DC 20555-0001; Giglio, J J [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Goff, K M [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Johnson, S G [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Kennedy, J R [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Jue, J-F [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Noy, M [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; O'Holleran, T P [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Sinkler, W [UOP LLC, 25 E Algonquin Road, Des Plaines, IL 60017



Measurement of the CKM angle alpha/phi2 with B -> rho rho decays at Belle and BABAR  

E-Print Network (OSTI)

We overview recent measurements in B -> rho rho decays which are based on data samples collected at the PEP-II and KEKB asymmetric-energy e+e- colliders with the BABAR and Belle detectors. Special emphasis is given to the determination of the CP-violating coefficients A and S from an analysis of B -> rho+ rho- decays. The values of A and S, branching fractions, and longitudinal polarization fractions of B -> rho rho decays are used to constrain the Cabibbo-Kobayashi-Maskawa phase alpha/phi2 using an isospin analysis; the solution consistent with the standard model is 71 deg. < alpha < 113 deg. at 68 C.L.

A. Somov



Effects of alpha beam on the parametric decay of a parallel propagating circularly polarized Alfven wave: Hybrid simulations  

SciTech Connect

Alfven waves with a finite amplitude are found to be unstable to a parametric decay in low beta plasmas. In this paper, the parametric decay of a circularly polarized Alfven wave in a proton-electron-alpha plasma system is investigated with one-dimensional (1-D) hybrid simulations. In cases without alpha particles, with the increase of the wave number of the pump Alfven wave, the growth rate of the decay instability increases and the saturation amplitude of the density fluctuations slightly decrease. However, when alpha particles with a sufficiently large bulk velocity along the ambient magnetic field are included, at a definite range of the wave numbers of the pump wave, both the growth rate and the saturation amplitude of the parametric decay become much smaller and the parametric decay is heavily suppressed. At these wave numbers, the resonant condition between the alpha particles and the daughter Alfven waves is satisfied, therefore, their resonant interactions might play an important role in the suppression of the parametric decay instability.

Gao, Xinliang; Lu, Quanming; Tao, Xin; Hao, Yufei; Wang, Shui [CAS Key Laboratory of Geospace Environment, Department of Geophysics and Planetary Science, University of Science and Technology of China, Hefei 230026 (China)] [CAS Key Laboratory of Geospace Environment, Department of Geophysics and Planetary Science, University of Science and Technology of China, Hefei 230026 (China)



Directional correlation between. alpha. particles and L x rays in the decay of sup 238 Pu and sup 244 Cm  

SciTech Connect

Anisotropy in the directional correlation of nuclear radiations and {ital L} x rays has been clearly identified for the first time. {ital L}{sub 3} x-ray groups, {ital L}{sub {ital l}} and {ital L}{alpha}, are observed to be directionally correlated with {alpha} particles in the decays of {sup 238}Pu and {sup 244}Cm. The ratio of anisotropy for {ital L}{sub {ital l}} and {ital L}{alpha} is consistent with the recent observation that {ital L}{sub {ital l}} has a much greater admixture of {ital M}2 than predicted by relativistic calculations.

Johnston, P.N. (Department of Applied Physics, Royal Melbourne Institute of Technology, G.P.O. Box 2476V, Melbourne 3001 (Australia))


Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Measurement of the decay rate and form factor parameter $\\alpha_{K}*$ in the decay $K_{L} \\rightarrow e^{+}e^{-}\\gamma$  

E-Print Network (OSTI)

The decay rate of the neutral K meson $\\mathrm{K_{L} \\rightarrow e^{+}e^{-}\\gamma}$ has been measured with the NA48 detector at the CERN SPS. A total of 6864 events has been observed with an estimated background of 10 events. The branching ratio is $\\mathrm{\\Gamma(K_{L} \\rightarrow e^{+}e^{-}\\gamma)/\\Gamma(K_{L} rightarrow all) = (1.06 \\pm 0.02_{stat.} \\pm 0.02_{sys.} \\pm 0.04_{calc.})\\times 10^{-5}}$. The parameter describing the relative strength of the two contributing amplitudes to this decay through $\\mathrm{\\alpha_{K^{*}}}$ intermediate seudoscalar or vector mesons, was measured to be $\\mathrm{\\alpha_{K^{*}} = -0.36 \\pm 0.06_{stat.} \\pm 0.02_{sys.}}$

Fanti, V; Musa, L; Marras, D; Nappi, A; Hay, B; Moore, R W; Moore, K N; Munday, D J; Needham, M D; Parker, M A; White, T O; Wotton, S A; Barr, Giles David; Bocquet, G; Bremer, J; Ceccucci, Augusto; Cundy, Donald C; Doble, Niels T; Funk, W; Gatignon, L; Gianoli, A; Gonidec, A; Govi, G; Grafström, P; Kubischta, Werner; Lacourt, A; Luitz, S; Kesseler, G; Matheys, J P; Norton, Alan Robert; Palestini, S; Panzer-Steindel, B; Schinzel, D; Taureg, Hans; Velasco, M; Vossnack, O; Wahl, H; Wirrer, G; Kekelidze, V D; Mestvirishvili, A; Potrebenikov, Yu K; Tatishvili, G T; Tkachev, A L; Zinchenko, A I; Boyle, O; Martin, V J; Knowles, I G; Parsons, H; Dalpiaz, Pietro; Duclos, J; Frabetti, P L; Martini, M; Petrucci, F; Porcu, M; Savrié, M; Bizzeti, A; Calvetti, M; Collazuol, G; Graziani, G; Iacopini, E; Lenti, M; Michetti, A; Becker, H G; Blümer, H; Buchholz, P; Coward, D H; Ebersberger, C; Fox, H; Kalter, A; Kleinknecht, K; Koch, U; Köpke, L; Renk, B; Scheidt, J; Schmidt, J; Schönharting, V; Schué, Yu; Wilhelm, R; Winhart, A; Wittgen, M; Chollet, J C; Crépé, S; Iconomidou-Fayard, L; Fayard, Louis; Ocariz, J; Unal, G; Vattolo, D; Wingerter-Seez, I; Anzivino, Giuseppina; Cenci, P; Lubrano, P; Pepé, M; Gorini, B; Calafiura, P; Carosi, R; Cerri, C; Cirilli, M; Costantini, F; Fantechi, R; Giudici, Sergio; Mannelli, I; Marzulli, V M; Pierazzini, G M; Sozzi, M; Chèze, J B; Cogan, J; De Beer, M; Debu, P; Formica, A; Granier de Cassagnac, R; Khristov, P Z; Mazzucato, E; Peyaud, B; Schanne, S; Turlay, René; Vallage, B; Augustin, I; Bender, M; Holder, M; Ziolkowski, M; Arcidiacono, R; Biino, C; Marchetto, F; Menichetti, E; Nassalski, J P; Rondio, Ewa; Szleper, M; Wislicki, W; Wronka, S; Dibon, Heinz; Fischer, G; Jeitler, Manfred; Markytan, Manfred; Mikulec, I; Neuhofer, Günther; Pernicka, Manfred; Taurok, Anton



[alpha]-Decay damage effects in curium-doped titanate ceramic containing sodium-free high-level nuclear waste  

SciTech Connect

A polyphase titanate ceramic incorporating sodium-free simulated high-level nuclear waste was doped with 0.91 wt% of [sup 224]Cm to accelerate the effects of long-term self-irradiation arising from [alpha] decays. The ceramic included three main constituent minerals: hollandite, perovskite, and zirconolite, with some minor phases. Although hollandite showed the broadening of its X-ray diffraction lines and small lattice parameter changes during damage in growth, the unit cell was substantially unaltered. Perovskite and zirconolite, which are the primary hosts of curium, showed 2.7% and 2.6% expansions, respectively, of their unit cell volumes after a dose of 12 [times] 10[sup 17] [alpha] decays[center dot]g[sup [minus]1]. Volume swelling due to damage in growth caused an exponential (almost linear) decrease in density, which reached 1.7% after a dose of 12.4 [times] 10[sup 17] [alpha] decays[center dot]g[sup [minus]1]. Leach tests on samples that had incurred doses of 2.0 [times] 10[sup 17] and 4.5 [times] 10[sup 17] [alpha] decays[center dot]g[sup [minus]1] showed that the rates of dissolution of cesium and barium were similar to analogous leach rates from the equivalent cold ceramic, while strontium and calcium leach rates were 2--15 times higher. Although the cerium, molybdenum, strontium, and calcium leach rates in the present material were similar to those in the curium-doped sodium-bearing titanate ceramic reported previously, the cesium leach rate was 3--8 times lower.

Mitamura, Hisayoshi; Matsumoto, Seiichiro; Tsuboi, Takashi; Hashimoto, Masaaki; Togashi, Yoshihiro; Kanazawa, Hiroyuki (Japan Atomic Energy Research Inst., Ibaraki (Japan)); Stewart, M.W.A.; Vance, E.R.; Hart, K.P.; Ball, C.J. (Australian Nuclear Science and Technology Organization, Lucas Heights, New South Wales (Australia). Lucas Heights Research Labs.); White, T.J.



Alpha-Decay Studies of the N=127 Isotones Fr214, Ra215, and Ac216  

Science Journals Connector (OSTI)

The study of nuclei which are one neutron removed from the N=126 closed shell has shown that the odd-proton N=127 isotones ? decay from both the ground state and a metastable state whose excitation energy decreases between Bi210 and Ac216. The ?-decay daughters of these nuclei show some correspondence in their energy-level spacings which is due to the coupling of specific single-particle configurations near the N=126 closed shell. New information has been obtained for the ? decay of the 1 - isomer of Fr214 to levels in At210, and for the ? decay of Ac216 to levels in Fr212. The decay scheme of Ac216 is markedly different from that reported by others. An experimental and theoretical study of the ? decay of Ra215 has also been made.

David F. Torgerson and Ronald D. Macfarlane



Alpha-decay rates of Yb and Gd in solar-neutrino detectors  

Science Journals Connector (OSTI)

The ?-decay rates for the nuclides 168,170,171,172,173,174,176Yb and 148,150,152,154Gd have been estimated from transmission probabilities in a systematic ?-nucleus potential and from an improved fit to ?-decay rates in the rare-earth mass region. Whereas ?-decay of 152Gd in natural gadolinium is a severe obstacle for the use of gadolinium as a low-energy solar-neutrino detector, we show that ?-decay does not contribute significantly to the background in a ytterbium detector. An extremely long ?-decay lifetime of 168Yb is obtained from calculation, which may be close to the sensitivity limit in a low-background solar-neutrino detector.

M Fujiwara; T Kawabata; P Mohr



Accelerated alpha-decay of 232U isotope achieved by exposure of its aqueous solution with gold nanoparticles to laser radiation  

E-Print Network (OSTI)

Experimental results are presented on laser-induced accelerated alpha-decay of Uranium-232 nuclei under laser exposure of Au nanoparticles in aqueous solutions of its salt. It is demonstrated that the decrease of alpha-activity strongly depends on the peak intensity of the laser radiation in the liquid and is highest at several terawatt per square centimeter. The decrease of alpha-activity of the exposed solutions is accompanied by the deviation of gamma-activities of daughter nuclides of Uranium-232 from their equilibrium values. Possible mechanisms of the laser influence on the alpha-activity are discussed on the basis of the amplification of the electric field of laser wave on metallic nanoparticles.

A. V. Simakin; G. A. Shafeev



Measurement of the parity-violating asymmetry parameter alpha_b and the helicity amplitudes for the decay Lambda_b->J/psi+Lambda with the ATLAS detector  

E-Print Network (OSTI)

A measurement of the parity-violating decay asymmetry parameter, alpha_b, and the helicity amplitudes for the decay Lambda_b->J/psi(mu mu)+Lambda(p pi) is reported. The analysis is based on 1400 Lambda_b and anti-Lambda_b baryons selected in 4.6/fb of proton-proton collision data with a center-of-mass energy of 7 TeV recorded by the ATLAS experiment at the LHC. By combining the Lambda_b and anti-Lambda_b samples under the assumption of CP conservation, the value of alpha_b is measured to be 0.30+/-0.16(stat)+/-0.06(syst). This measurement provides a test of theoretical models based on perturbative QCD or heavy-quark effective theory.

ATLAS Collaboration



First observation of {alpha} decay of {sup 190}Pt to the first excited level (E{sub exc}=137.2 keV) of {sup 186}Os  

SciTech Connect

The {alpha} decays of naturally occurring platinum isotopes, which are accompanied by the emission of {gamma} quanta, have been searched for deep underground (3600 m water equivalent) at the Gran Sasso National Laboratories of the INFN (Italy). A sample of Pt with a mass of 42.5 g and a natural isotopic composition has been measured with a low background HP Ge detector (468 cm{sup 3}) during 1815 h. The {alpha} decay of {sup 190}Pt to the first excited level of {sup 186}Os (J{sup {pi}}=2{sup +}, E{sub exc}=137.2 keV) has been observed for the first time, with the half-life determined as T{sub 1/2}=2.6{sub -0.3}{sup +0.4}(stat.){+-}0.6(syst.)x10{sup 14} yr. The T{sub 1/2} limits for the {alpha} decays of other Pt isotopes have been determined at the level of T{sub 1/2}{approx_equal}10{sup 16}-10{sup 20} yr. These limits have been set for the first time or they are better than those known from earlier experiments.

Belli, P. [INFN, Sezione di Roma Tor Vergata, I-00133 Rome (Italy); Bernabei, R. [INFN, Sezione di Roma Tor Vergata, I-00133 Rome (Italy); Dipartimento di Fisica, Universita di Roma Tor Vergata, I-00133 Rome (Italy); Cappella, F. [INFN, Sezione di Roma La Sapienza, I-00185 Rome (Italy); Dipartimento di Fisica, Universita di Roma La Sapienza, I-00185 Rome (Italy); Cerulli, R.; Laubenstein, M.; Nisi, S. [INFN, Laboratori Nazionali del Gran Sasso, 67010 Assergi (AQ) (Italy); Danevich, F. A.; Nagorny, S. S.; Polischuk, O. G.; Tretyak, V. I. [Institute for Nuclear Research, MSP 03680 Kyiv (Ukraine); Incicchitti, A. [INFN, Sezione di Roma La Sapienza, I-00185 Rome (Italy)



Origin of the Structures in the C-12(o-16,alpha) Reaction - Dominance of Ne-20-Star and O-16-Star Sequential Alpha-Decay Processes  

E-Print Network (OSTI)

of the ' C(' O,a) Mg reaction with good energy resolution in the bombarding energy range of 60 to 100 MeV. It turned out that peaks observed in the Mg excitation energy E =20?30 MeV did not have the same widths and decay branching ratios that the known... publication, " the movement of the structures in terms of the 2 Mg excita- tion as a function of the incident energy is well explained by sequential a-decay processes from Ne* and/or ' 0' through the narrow resonances at E?( Ne)=8. 8, 12.0, 14.3, 16.5, 20...

Murakami, T.; Ungricht, E.; Takahashi, N.; Lui, YW; Mihara, Y.; Neese, R. E.; Takada, E.; Tanner, D. M.; Tribble, Robert E.; Nagatani, K.



E-Print Network 3.0 - alpha reactions Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

resulting from... radioactive decay of the release an alpha particle from its parent isotope (e.g., alpha decay ... Source: Yucca Mountain Project, US EPA Collection:...


E-Print Network 3.0 - accretion-powered millisecond x-ray Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

accretion- powered millisecond pulsars and oscillations from thermonuclear X-ray... bursts. 2.1 Accretion-powered millisecond pulsars Although as early as 1996 the discovery of...


It's Elemental - Isotopes of the Element Radon  

NLE Websites -- All DOE Office Websites (Extended Search)

Astatine Astatine Previous Element (Astatine) The Periodic Table of Elements Next Element (Francium) Francium Isotopes of the Element Radon [Click for Main Data] Most of the isotope data on this site has been obtained from the National Nuclear Data Center. Please visit their site for more information. Naturally Occurring Isotopes Radon has no naturally occurring isotopes. Known Isotopes Mass Number Half-life Decay Mode Branching Percentage 193 1.15 milliseconds Alpha Decay 100.00% 194 0.78 milliseconds Alpha Decay 100.00% 195 6 milliseconds Alpha Decay 100.00% 195m 5 milliseconds Alpha Decay 100.00% 196 4.4 milliseconds Alpha Decay 99.90% Electron Capture ~ 0.10% 197 53 milliseconds Alpha Decay 100.00% 197m 25 milliseconds Alpha Decay 100.00% 198 65 milliseconds Alpha Decay No Data Available


Event counting alpha detector  

DOE Patents (OSTI)

An electrostatic detector is disclosed for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure. 6 figs.

Bolton, R.D.; MacArthur, D.W.




SciTech Connect

The shallow decay phase or plateau phase of early afterglows of gamma-ray bursts (GRBs), discovered by Swift, is currently understood as being due to energy injection to a relativistic blast wave. One natural scenario for energy injection invokes a millisecond magnetar as the central engine of GRBs because the conventional model of a pulsar predicts a nearly constant magnetic-dipole-radiation luminosity within the spin-down timescale. However, we note that significant brightening occurs in some early afterglows, which apparently conflicts with the above scenario. Here we propose a new model to explain this significant brightening phenomena by considering a hyperaccreting fallback disk around a newborn millisecond magnetar. We show that for typical values of the model parameters, sufficient angular momentum of the accreted matter is transferred to the magnetar and spins it up. It is this spin-up that leads to a dramatic increase of the magnetic-dipole-radiation luminosity with time and thus significant brightening of an early afterglow. Based on this model, we carry out numerical calculations and fit well early afterglows of 12 GRBs assuming sufficiently strong fallback accretion. If the accretion is very weak, our model turns out to be the conventional energy-injection scenario of a pulsar. Therefore, our model can provide a unified explanation for the shallow decay phase, plateaus, and significant brightening of early afterglows.

Dai, Z. G.; Liu Ruoyu, E-mail: dzg@nju.edu.cn, E-mail: ryliu@nju.edu.cn [School of Astronomy and Space Science, Nanjing University, Nanjing 210093 (China)



Decay of C-10 excited states above the 2p+2 alpha threshold and the contribution from "democratic" two-proton emission  

E-Print Network (OSTI)

. These include states at 5.18 and 6.54 MeV which decay by sequential two-proton emission through the long-lived ground state of B-9. In addition, states at 5.3 and 6.57 MeV were found in which there is no long-lived intermediate state between the two proton...

Charity, R. J.; Mercurio, K.; Sobotka, L. G.; Elson, J. M.; Famiano, M.; Banu, A.; Fu, C.; Trache, L.; Tribble, Robert E.



Recoil-alpha-fission and recoil-alpha-alpha-fission events observed in the reaction Ca-48 + Am-243  

E-Print Network (OSTI)

Products of the fusion-evaporation reaction Ca-48 + Am-243 were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum f\\"ur Schwerionenforschung. Amongst the detected thirty correlated alpha-decay chains associated with the production of element Z=115, two recoil-alpha-fission and five recoil-alpha-alpha-fission events were observed. The latter are similar to four such events reported from experiments performed at the Dubna gas-filled separator. Contrary to their interpretation, we propose an alternative view, namely to assign eight of these eleven decay chains of recoil-alpha(-alpha)-fission type to start from the 3n-evaporation channel 115-288. The other three decay chains remain viable candidates for the 2n-evaporation channel 115-289.

U. Forsberg; D. Rudolph; L. -L. Andersson; A. Di Nitto; Ch. E. Düllmann; J. M. Gates; P. Golubev; K. E. Gregorich; C. J. Gross; R. -D. Herzberg; F. P. Hessberger; J. Khuyagbaatar; J. V. Kratz; K. Rykaczewski; L. G. Sarmiento; M. Schädel; A. Yakushev; S. Åberg; D. Ackermann; M. Block; H. Brand; B. G. Carlsson; D. Cox; X. Derkx; J. Dobaczewski; K. Eberhardt; J. Even; C. Fahlander; J. Gerl; E. Jäger; B. Kindler; J. Krier; I. Kojouharov; N. Kurz; B. Lommel; A. Mistry; C. Mokry; W. Nazarewicz; H. Nitsche; J. P. Omtvedt; P. Papadakis; I. Ragnarsson; J. Runke; H. Schaffner; B. Schausten; Y. Shi; P. Thörle-Pospiech; T. Torres; T. Traut; N. Trautmann; A. Türler; A. Ward; D. E. Ward; N. Wiehl



Workshop on Precision Measurements of $\\alpha_s$  

SciTech Connect

These are the proceedings of the Workshop on Precision Measurements of {alpha}{sub s} held at the Max-Planck-Institute for Physics, Munich, February 9-11, 2011. The workshop explored in depth the determination of {alpha}{sub s}(m{sub Z}) in the {ovr MS} scheme from the key categories where high precision measurements are currently being made, including DIS and global PDF fits, {tau}-decays, electro-weak precision observables and Z-decays, event-shapes, and lattice QCD. These proceedings contain a short summary contribution from the speakers, as well as the lists of authors, conveners, participants, and talks.

Bethke, Siegfried; /Munich, Max Planck Inst.; Hoang, Andre H.; /Vienna U.; Kluth, Stefan; /Munich, Max Planck Inst.; Schieck, Jochen; /Munich U.; Stewart, Iain W.; Aoki, S.; Beneke, M.; Bethke, S.; Blumlein, J.; Brambilla, N.; Brodsky, S.; /MIT, LNS



Alpha Radiation  

NLE Websites -- All DOE Office Websites (Extended Search)

Basics of Radiation Basics of Radiation Gamma Radiation and X-Rays Beta Radiation Alpha Radiation Irradiation Radioactive Contamination Definitions Detection Measurement Safety Around Radiation Sources Types of Radiation Exposure Managing Radiation Emergencies Basics of Radiation Characteristics of Alpha Radiation 1. Alpha radiation is not able to penetrate skin. 2. Alpha-emitting materials can be harmful to humans if the materials are inhaled, swallowed, or absorbed through open wounds. 3. A variety of instruments have been designed to measure alpha radiation. Special training in use of these instruments is essential for making accurate measurements. 4. A civil defense instrument (CD V-700) cannot detect the presence of radioactive materials that produce alpha radiation unless the radioactive materials also produce beta and/or gamma radiation.


It's Elemental - Isotopes of the Element Francium  

NLE Websites -- All DOE Office Websites (Extended Search)

Radon Radon Previous Element (Radon) The Periodic Table of Elements Next Element (Radium) Radium Isotopes of the Element Francium [Click for Main Data] Most of the isotope data on this site has been obtained from the National Nuclear Data Center. Please visit their site for more information. Naturally Occurring Isotopes Francium has no naturally occurring isotopes. Known Isotopes Mass Number Half-life Decay Mode Branching Percentage 199 12 milliseconds Alpha Decay > 0.00% Electron Capture No Data Available 200 49 milliseconds Alpha Decay 100.00% 201 62 milliseconds Alpha Decay 100.00% 201m 19 milliseconds Alpha Decay 100.00% 202 0.30 seconds Alpha Decay 100.00% 202m 0.29 seconds Alpha Decay 100.00% 203 0.55 seconds Alpha Decay <= 100.00% 204 1.8 seconds Alpha Decay 92.00%


Continuum spectroscopy with a (10)C beam: Cluster structure and three-body decay  

E-Print Network (OSTI)

.29, 6.55, 6.56, 6.57, and 8.4 MeV which decay into the 2p+2 alpha final state. This final state is created via a number of different decay paths, which include prompt and sequential two-proton decay to the ground state of (8)Be, alpha decay to (6)Be...

Charity, R. J.; Wiser, T. D.; Mercurio, K.; Shane, R.; Sobotka, L. G.; Wuosmaa, A. H.; Banu, A.; Trache, L.; Tribble, Robert E.



E-Print Network 3.0 - accreting millisecond x-ray Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

of Technology (MIT) Collection: Physics 16 SEARCHING FOR MILLISECOND PULSARS IN GAMMA-RAY DATA USING THE FERMI LAT Summary: production is less limited (Lyne and Graham-Smith...

Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The Millisecond Magnetar Central Engine in short GRBs  

E-Print Network (OSTI)

One favored progenitor model for short duration gamma-ray bursts (SGRBs) is the coalescence of two neutron stars (NS-NS). One possible outcome of such a merger would be a rapidly spinning, strongly magnetized neutron star (known as a millisecond magnetar). These magnetars may be "supra-massive", implying they would collapse to black holes after losing centrifugal support due to magnetic dipole spindown. By systematically analyzing the BAT-XRT light curves of all short GRBs detected by {\\em swift}, we test how well the data are consistent with this central engine model of short GRBs. We find that the so-called "extended emission" observed with BAT in some short GRBs are fundamentally the same component as the "internal X-ray plateau" as observed in many short GRBs, which is defined as a plateau in the lightcurve followed by a very rapid drop. Based on how likely a short GRB hosts a magnetar, we characterize the entire {\\em Swift} short GRB sample into three categories: the "internal plateau" sample, the "exter...

Lü, Hou-Jun; Lei, Wei-Hua; Li, Ye; Lasky, Paul D



Bremsstrahlung in ? decay  

Science Journals Connector (OSTI)

A quantum mechanical analysis of the bremsstrahlung in ? decay of 210Po is performed in close reference to a semiclassical theory. We clarify the contribution from the tunneling, mixed, outside barrier regions, and from the wall of the inner potential well to the final spectral distribution, and discuss their interplay. We also comment on the validity of semiclassical calculations, and the possibility to eliminate the ambiguity in the nuclear potential between the alpha particle and daughter nucleus using the bremsstrahlung spectrum.

N. Takigawa; Y. Nozawa; K. Hagino; A. Ono; D. M. Brink



Millisecond switching in solid state electrochromic polymer devices fabricated from ionic self-assembled multilayers  

E-Print Network (OSTI)

Millisecond switching in solid state electrochromic polymer devices fabricated from ionic self The electrochromic switching times of solid state conducting polymer devices fabricated by the ionic self shown to decrease with the active area of the electrochromic device suggesting that even faster

Heflin, Randy


Semileptonic B and Lambda_b Decays and Local Duality in QCD  

E-Print Network (OSTI)

The inclusive and exclusive semileptonic decay distributions for b -> c decay are computed in the Shifman-Voloshin limit. The inclusive decay distributions (computed using an operator product expansion) depend on quark masses, and the exclusive decay distributions depend on hadron masses. Nevertheless, we show explicitly how the first two terms in the 1/m expansion match between the inclusive and exclusive decays. Agreement between the inclusive and exclusive decay rates requires a minimum smearing region of size Lambda_QCD before local duality holds in QCD. The alpha_s corrections to the inclusive and exclusive decay rates are also shown to agree to order (log m)/m^2. The alpha_s/m^2 corrections are used to obtain the alpha_s correction to Bjorken's inequality on the slope of the Isgur-Wise function.

C. Glenn Boyd; Benjamin Grinstein; Aneesh V. Manohar



The Particle Adventure | Particle decays and annihiliations | Confusion  

NLE Websites -- All DOE Office Websites (Extended Search)

Confusion about Confusion about decays Confusion about decays Many heavy elements decay into simpler things. But a close observation of these decays reveals several confusing problems. Consider uranium-238 decay. A lump of uranium-238 will decay at a constant rate such that in 4,460,000,000 years -- give or take a few days -- half the uranium will be gone. But there is no way to tell when a specific uranium atom will decay; it could decay five minutes from now, or in ten billion years. Why will an atom decay only according to some probability? Uranium-238 has a mass of 238.0508 atomic mass units (u). It can decay into thorium (234.0436 u) and an alpha particle (4.0026 u). But uranium's mass minus the mass of its decay products is 0.0046 u. Why is there missing mass?


B Decay  

NLE Websites -- All DOE Office Websites (Extended Search)

Decay Decay B mesons are short-lived and decay inside the beam pipe, which is about 2.5 cm (1 inch) in diameter. Physicists project the tracks seen in the detector elements outside the beampipe back to where the particles must have traveled inside the beam pipe. We call a point where particles collide or decay a vertex. A way to identify a B meson is to look for two vertices with a gap between them. On the left is a standard event picture. On the right is a blowup of what happens close to the collision point inside the beam pipe. The vertex is where the B meson along with other particles was created and the secondary vertex is where it decayed. The solid green lines are the actual tracks of the decay particles outside the beam pipe. The dotted lines are the projection of the tracks into the beam pipe. Where they intersect are the vertices. The B travels between the first vertex and the secondary vertex along the black dotted line before it decays. Thus, the gap between the two vertices is a measure of the lifetime of the B meson. We will be looking for this decay length in our data. We will find a minimum or "threshold" value that will tell us to save events for further analysis.


Copper CMP Modeling: Millisecond Scale Adsorption Kinetics of BTA in Glycine-Containing Solutions at pH 4  

E-Print Network (OSTI)

Society H1153 Copper CMP Modeling: Millisecond Scaleon the surface of a micro-copper electrode in pH 4 aqueousa Cu?I?BTA monolayer on the copper surface. Based on these

Choi, Seungchoun; Tripathi, Shantanu; Dornfeld, David; Doyle, F M



The Parkes multibeam pulsar survey: VII. Timing of four millisecond pulsars and the underlying spin period distribution of the Galactic millisecond pulsar population  

E-Print Network (OSTI)

We present timing observations of four millisecond pulsars discovered in the Parkes 20-cm multibeam pulsar survey of the Galactic plane. PSRs J1552-4937 and J1843-1448 are isolated objects with spin periods of 6.28 and 5.47 ms respectively. PSR J1727-2946 is in a 40-day binary orbit and has a spin period of 27 ms. The 4.43-ms pulsar J1813-2621 is in a circular 8.16-day binary orbit around a low-mass companion star with a minimum companion mass of 0.2 solar masses. Combining these results with detections from five other Parkes multibeam surveys, gives a well-defined sample of 56 pulsars with spin periods below 20 ms. We develop a likelihood analysis to constrain the functional form which best describes the underlying distribution of spin periods for millisecond pulsars. The best results were obtained with a log-normal distribution. A gamma distribution is less favoured, but still compatible with the observations. Uniform, power-law and Gaussian distributions are found to be inconsistent with the data. Galactic...

Lorimer, D R; Manchester, R N; Possenti, A; Lyne, A G; McLaughlin, M A; Kramer, M; Hobbs, G; Stairs, I H; Burgay, M; Eatough, R P; Keith, M J; Faulkner, A J; D'Amico, N; Camilo, F; Corongiu, A; Crawford, F



Measurement of the CKM angle alpha with the B-factories  

E-Print Network (OSTI)

B-meson decays involving b->u transitions are sensitive to the Unitarity Triangle angle alpha (or phi_2). The B-factories at SLAC and KEK have made significant progress toward the measurement of alpha in recent years. This paper summarizes the results of the B-factories' constraints on alpha.

A. Bevan



Extreme alpha-clustering in the 18O nucleus  

E-Print Network (OSTI)

The structure of the 18O nucleus at excitation energies above the alpha decay threshold was studied using 14C+alpha resonance elastic scattering. A number of states with large alpha reduced widths have been observed, indicating that the alpha-cluster degree of freedom plays an important role in this N not equal Z nucleus. However, the alpha-cluster structure of this nucleus is very different from the relatively simple pattern of strong alpha-cluster quasi-rotational bands in the neighboring 16O and 20Ne nuclei. A 0+ state with an alpha reduced width exceeding the single particle limit was identified at an excitation energy of 9.9+/-0.3 MeV. We discuss evidence that states of this kind are common in light nuclei and give possible explanations of this feature.

E. D. Johnson; G. V. Rogachev; V. Z. Goldberg; S. Brown; D. Robson; A. M. Crisp; P. D. Cottle; C. Fu; J. Giles; B. W. Green; K. W. Kemper; K. Lee; B. T. Roeder; R. E. Tribble



Hadronic B decays at BaBar and Belle  

SciTech Connect

The authors review recent results of the BABAR and Belle Collaborations on the {alpha} and {gamma} angles of the unitarity triangle, on the B {yields} K{pi}{pi} Dalitz-plot analyses, and on the searches for baryonic B decays and for B {yields} D{bar D} decays.

Lombardo, Vincenzo; /Milan U. /INFN, Milan




SciTech Connect

The recently discovered transitional millisecond pulsar system J1023+0038 exposes a crucial evolutionary phase of recycled neutron stars for multiwavelength study. The system, comprising the neutron star itself, its stellar companion, and the surrounding medium, is visible across the electromagnetic spectrum from the radio to X-ray/gamma-ray regimes and offers insight into the recycling phase of millisecond pulsar evolution. Here, we report on multiple-epoch astrometric observations with the Very Long Baseline Array (VLBA) which give a system parallax of 0.731 {+-} 0.022 milliarcseconds (mas) and a proper motion of 17.98 {+-} 0.05 mas yr{sup -1}. By combining our results with previous optical observations, we are able to use the parallax distance of 1368{sup +42}{sub -{sub 39}} pc to estimate the mass of the pulsar to be 1.71 {+-} 0.16 M{sub Sun }, and we are also able to measure the three-dimensional space velocity of the system to be 126 {+-} 5 km s{sup -1}. Despite the precise nature of the VLBA measurements, the remaining {approx}3% distance uncertainty dominates the 0.16 M{sub Sun} error on our mass estimate.

Deller, A. T. [Netherlands Institute for Radio Astronomy (ASTRON), 7990-AA Dwingeloo (Netherlands); Archibald, A. M.; Kaspi, V. M. [Department of Physics, McGill University, 3600 University Street, Montreal, QC H3A 2T8 (Canada); Brisken, W. F. [National Radio Astronomy Observatory, Socorro, NM 87801 (United States); Chatterjee, S. [Astronomy Department, Cornell University, Ithaca, NY 14853 (United States); Janssen, G. H.; Lyne, A. G.; Stappers, B. [Jodrell Bank Centre for Astrophysics, School of Physics and Astronomy, University of Manchester, Manchester M13 9PL (United Kingdom); Lorimer, D.; McLaughlin, M. A. [Department of Physics, West Virginia University, Morgantown, WV 26506 (United States); Ransom, S. [National Radio Astronomy Observatory, Charlottesville, VA 22903 (United States); Stairs, I. H. [Department of Physics and Astronomy, University of British Columbia, 6224 Agricultural Road, Vancouver, BC V6T 1Z1 (Canada)



Measurement of the CKM angle phi2 (alpha)  

E-Print Network (OSTI)

We present recent measurements of the unitarity triangle angle phi2(alpha) using B -> pi pi, B -> rho rho, and B -> rho pi decays. The measurements are based on data samples collected with the Belle and BaBar detectors at the KEKB and PEP-II e+e- colliders, respectively. We also report on a new measurement of a CP-violating asymmetry in B -> a_1+ pi- decay which will allow to constrain further the angle phi2.

A. Somov



It's Elemental - Isotopes of the Element Rhenium  

NLE Websites -- All DOE Office Websites (Extended Search)

Tungsten Tungsten Previous Element (Tungsten) The Periodic Table of Elements Next Element (Osmium) Osmium Isotopes of the Element Rhenium [Click for Main Data] Most of the isotope data on this site has been obtained from the National Nuclear Data Center. Please visit their site for more information. Naturally Occurring Isotopes Mass Number Natural Abundance Half-life 185 37.40% STABLE 187 62.60% 4.33×10+10 years Known Isotopes Mass Number Half-life Decay Mode Branching Percentage 159 No Data Available No Data Available No Data Available 160 0.82 milliseconds Proton Emission 91.00% Alpha Decay 9.00% 161 0.44 milliseconds Proton Emission 100.00% Alpha Decay <= 1.40% 161m 14.7 milliseconds Alpha Decay 93.00% Proton Emission 7.00% 162 107 milliseconds Alpha Decay 94.00% Electron Capture 6.00%


An alpha scintillation spectrometer  

E-Print Network (OSTI)

investi- gation of the properties of alpha radiation. In his work, the scin- tillations produced by alpha particles impinging on a zinc-sulphide screen were observed and counted visually with the aid of a low power microscope. The scintillations..., the source changing in the proportional counter is inconvenient, requiring a fairly elaborate gas handling and purifying system. Alpha particl s, when passing through a photographic emulsion, ionize the silver halide crystals with which they come...

Yates, Ralph Aaron



The birth of radio millisecond pulsars and their high-energy signature  

E-Print Network (OSTI)

Millisecond pulsars (MSPs) are thought to born in low-mass X-ray binaries when the neutron star has gained enough angular momentum from the accreting materials of its companion star. It is generally believed that a radio MSP is born when the neutron star stops accreting and enters a rotation-powered state. Exactly what happens during the transition time was poorly understood until a year ago. In the past year, observations have revealed a few objects that not only switched from one state to the other (as predicted in the above picture), but also have swung between the two states within weeks to years. In this work, we present observations of two of these transition objects (PSR J1023+0038 and XSS J12270-4859) and a theoretical framework that tries to explain their high-energy radiation.

Tam, P H T; Kong, A K H; Takata, J; Leung, G C K; Cheng, K S; Hui, C Y



? decay in the complex-energy shell model  

Science Journals Connector (OSTI)

Background: Alpha emission from a nucleus is a fundamental decay process in which the alpha particle formed inside the nucleus tunnels out through the potential barrier.Purpose: We describe alpha decay of 212Po and 104Te by means of the configuration interaction approach.Method: To compute the preformation factor and penetrability, we use the complex-energy shell model with a separable T=1 interaction. The single-particle space is expanded in a Woods-Saxon basis that consists of bound and unbound resonant states. Special attention is paid to the treatment of the norm kernel appearing in the definition of the formation amplitude that guarantees the normalization of the channel function.Results: Without explicitly considering the alpha-cluster component in the wave function of the parent nucleus, we reproduce the experimental alpha-decay width of 212Po and predict an upper limit of T1/2=5.5×10?7 sec for the half-life of 104Te.Conclusions: The complex-energy shell model in a large valence configuration space is capable of providing a microscopic description of the alpha decay of heavy nuclei having two valence protons and two valence neutrons outside the doubly magic core. The inclusion of proton-neutron interaction between the valence nucleons is likely to shorten the predicted half-live of 104Te.

R. Id Betan and W. Nazarewicz



Imaging alpha particle detector  

DOE Patents (OSTI)

A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

Anderson, D.F.



Imaging alpha particle detector  

DOE Patents (OSTI)

A method and apparatus for detecting and imaging alpha particles sources is described. A conducting coated high voltage electrode (1) and a tungsten wire grid (2) constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source (3) to be quantitatively or qualitatively analyzed. A thin polyester film window (4) allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

Anderson, David F. (Los Alamos, NM)



Bremsstrahlung emission during $?$-decay of $^{226}{\\rm Ra}$  

E-Print Network (OSTI)

We obtained the spectrum of probability of the bremsstrahlung emission accompanying the $\\alpha$-decay of $^{226}{\\rm Ra}$ (E$_{\\alpha}$=4.8 MeV) by measuring the $\\alpha$-$\\gamma$ coincidences and using the model presented in our previous study on the $\\alpha-$decay of $^{214}{\\rm Po}$ (E$_{\\alpha}$=7.7 MeV). We compare the experimental data with the quantum mechanical calculation and find a good agreement between theory and experiment. We discuss the differences between the photon spectra connected with the $\\alpha$-decay of the $^{226}{\\rm Ra}$ and $^{214}{\\rm Po}$ nuclei. For the two mentioned nuclei we analyze the bremsstrahlung emission contributions from the tunneling and external regions of the nucleus barrier into the total spectrum, and we find the destructive interference between these contributions. We also find that the emission of photons during tunneling of the $\\alpha$-particle gives an important contribution to the bremsstrahlung spectrum in the whole E$_{\\gamma}$ energy range of the studied $^{226}$Ra nucleus.

Giorgio Giardina; Giovanni Fazio; Giuseppe Mandaglio; Marina Manganaro; Serghei P. Maydanyuk; Vladislav S. Olkhovsky; Nikolay V. Eremin; Anton A. Paskhalov; Dmitry A. Smirnov; Carmelo Sacca


Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Semileptonic Decays  

SciTech Connect

The following is an overview of the measurements of the CKM matrix elements |V{sub cb}| and |V{sub ub}| that are based on detailed studies of semileptonic B decays by the BABAR and Belle Collaborations and major advances in QCD calculations. In addition, a new and improved measurement of the ratios R(D{sup (*)}) = {Beta}({bar B} {yields} D{sup (*)}{tau}{sup -}{bar {nu}}{sub {tau}})/{Beta}({bar B} {yields} D{sup (*)}{ell}{sup -}{bar {nu}}{sub {ell}}) is presented. Here D{sup (*)} refers to a D or a D* meson and {ell} is either e or {mu}. The results, R(D) = 0.440 {+-} 0.058 {+-} 0.042 and R(D*) = 0.332 {+-} 0.024 {+-} 0.018, exceed the Standard Model expectations by 2.0{sigma} and 2.7{sigma}, respectively. Taken together, they disagree with these expectations at the 3.4{sigma} level. The excess of events cannot be explained by a charged Higgs boson in the type II two-Higgs-doublet model.

Luth, Vera G.; /SLAC




SciTech Connect

We report the detection of radio emission from PSR J1311-3430, the first millisecond pulsar (MSP) discovered in a blind search of Fermi Large Area Telescope (LAT) gamma-ray data. We detected radio pulsations at 2 GHz, visible for <10% of {approx}4.5 hr of observations using the Green Bank Telescope (GBT). Observations at 5 GHz with the GBT and at several lower frequencies with Parkes, Nancay, and the Giant Metrewave Radio Telescope resulted in non-detections. We also report the faint detection of a steep spectrum continuum radio source (0.1 mJy at 5 GHz) in interferometric imaging observations with the Jansky Very Large Array. These detections demonstrate that PSR J1311-3430 is not radio quiet and provide additional evidence that radio-quiet MSPs are rare. The radio dispersion measure of 37.8 pc cm{sup -3} provides a distance estimate of 1.4 kpc for the system, yielding a gamma-ray efficiency of 30%, typical of LAT-detected MSPs. We see apparent excess delay in the radio pulses as the pulsar appears from eclipse and we speculate on possible mechanisms for the non-detections of the pulse at other orbital phases and observing frequencies.

Ray, P. S.; Wood, K. S. [Space Science Division, Naval Research Laboratory, Washington, DC 20375-5352 (United States); Ransom, S. M. [National Radio Astronomy Observatory (NRAO), Charlottesville, VA 22903 (United States); Cheung, C. C. [National Academy of Sciences, Washington, DC 20001 (United States); Giroletti, M. [INAF Istituto di Radioastronomia, I-40129 Bologna (Italy); Cognard, I. [Laboratoire de Physique et Chimie de l'Environnement, LPCE UMR 6115 CNRS, F-45071 Orleans Cedex 02 (France); Camilo, F. [Columbia Astrophysics Laboratory, Columbia University, New York, NY 10027 (United States); Bhattacharyya, B. [Inter-University Centre for Astronomy and Astrophysics, Pune 411 007 (India); Roy, J. [National Centre for Radio Astrophysics, Tata Institute of Fundamental Research, Pune 411 007 (India); Romani, R. W.; Kerr, M. [W. W. Hansen Experimental Physics Laboratory, Kavli Institute for Particle Astrophysics and Cosmology, Department of Physics and SLAC National Accelerator Laboratory, Stanford University, Stanford, CA 94305 (United States); Ferrara, E. C. [NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Guillemot, L.; Kramer, M. [Max-Planck-Institut fuer Radioastronomie, Auf dem Huegel 69, D-53121 Bonn (Germany); Johnston, S.; Keith, M. [CSIRO Astronomy and Space Science, Australia Telescope National Facility, Epping NSW 1710 (Australia); Pletsch, H. J. [Max-Planck-Institut fuer Gravitationsphysik, Albert-Einstein-Institut, D-30167 Hannover (Germany); Saz Parkinson, P. M., E-mail: Paul.Ray@nrl.navy.mil [Santa Cruz Institute for Particle Physics, Department of Physics and Department of Astronomy and Astrophysics, University of California at Santa Cruz, Santa Cruz, CA 95064 (United States)




SciTech Connect

We present two millisecond pulsar discoveries from the PALFA survey of the Galactic plane with the Arecibo telescope. PSR J1955+2527 is an isolated pulsar with a period of 4.87 ms, and PSR J1949+3106 has a period of 13.14 ms and is in a 1.9 day binary system with a massive companion. Their timing solutions, based on 4 years of timing measurements with the Arecibo, Green Bank, Nancay, and Jodrell Bank telescopes, allow precise determination of spin and astrometric parameters, including precise determinations of their proper motions. For PSR J1949+3106, we can clearly detect the Shapiro delay. From this we measure the pulsar mass to be 1.47{sup +0.43}{sub -0.31} M{sub Sun }, the companion mass to be 0.85{sup +0.14}{sub -0.11} M{sub Sun }, and the orbital inclination to be i = 79.9{sup -1.9}{sub +1.6} deg, where uncertainties correspond to {+-}1{sigma} confidence levels. With continued timing, we expect to also be able to detect the advance of periastron for the J1949+3106 system. This effect, combined with the Shapiro delay, will eventually provide very precise mass measurements for this system and a test of general relativity.

Deneva, J. S.; Camilo, F. [Arecibo Observatory, HC3 Box 53995, Arecibo, PR 00612 (United States); Freire, P. C. C.; Champion, D. J.; Desvignes, G. [Max-Planck-Institut fuer Radioastronomie, D-53121 Bonn (Germany); Cordes, J. M.; Brazier, A.; Chatterjee, S. [Astronomy Department, Cornell University, Ithaca, NY 14853 (United States); Lyne, A. G. [Jodrell Bank Centre for Astrophysics, University of Manchester, Manchester M13 9PL (United Kingdom); Ransom, S. M. [National Radio Astronomy Observatory, Charlottesville, VA 22903 (United States); Cognard, I. [Laboratoire de Physique et Chimie de l'Environnement et de l'Espace, LPC2E, CNRS et Universite d'Orleans, and Station de radioastronomie de Nancay, Observatoire de Paris (France); Nice, D. J. [Department of Physics, Lafayette College, Easton, PA 18042 (United States); Stairs, I. H. [Department of Physics and Astronomy, University of British Columbia, 6224 Agricultural Road, Vancouver, BC V6T 1Z1 (Canada); Allen, B. [Albert-Einstein-Institut, Max-Planck-Institut fuer Gravitationsphysik, D-30167 Hannover (Germany); Bhat, N. D. R. [Center for Astrophysics and Supercomputing, Swinburne University, Hawthorn, Victoria 3122 (Australia); Bogdanov, S. [Columbia Astrophysics Laboratory, Columbia University, New York, NY 10027 (United States); Crawford, F. [Department of Physics and Astronomy, Franklin and Marshall College, P.O. Box 3003, Lancaster, PA 17604 (United States); Hessels, J. W. T. [ASTRON, Netherlands Institute for Radio Astronomy, Postbus 2, 7990 AA Dwingeloo (Netherlands); Jenet, F. A. [Center for Gravitational Wave Astronomy, University of Texas at Brownsville, Brownsville, TX 78520 (United States); Kaspi, V. M. [Department of Physics, McGill University, 3600 rue Universite, Montreal, QC H3A 2T8 (Canada); and others



Magnetic burial and the harmonic content of millisecond oscillations in thermonuclear X-ray bursts  

E-Print Network (OSTI)

Matter accreting onto the magnetic poles of a neutron star spreads under gravity towards the magnetic equator, burying the polar magnetic field and compressing it into a narrow equatorial belt. Steady-state, Grad-Shafranov calculations with a self-consistent mass-flux distribution (and a semi-quantitative treatment of Ohmic diffusion) show that, for $\\Ma \\gtrsim 10^{-5}\\Msun$, the maximum field strength and latitudinal half-width of the equatorial magnetic belt are $B_{\\rm max} = 5.6\\times 10^{15} (\\Ma/10^{-4}\\Msun)^{0.32}$ G and $\\Delta\\theta = \\max[3^{\\circ} (\\Ma/10^{-4}\\Msun)^{-1.5},3^{\\circ} (\\Ma/10^{-4}\\Msun)^{0.5}(\\dot{M}_{\\rm a}/10^{-8}\\Msun {\\rm yr}^{-1})^{-0.5}]$ respectively, where $\\Ma$ is the total accreted mass and $\\dot{M}_{\\rm a}$ is the accretion rate. It is shown that the belt prevents north-south heat transport by conduction, convection, radiation, and ageostrophic shear. This may explain why millisecond oscillations observed in the tails of thermonuclear (type I) X-ray bursts in low-mass X-ray binaries are highly sinusoidal: the thermonuclear flame is sequestered in the magnetic hemisphere which ignites first. The model is also consistent with the occasional occurrence of closely spaced pairs of bursts. Time-dependent, ideal-magnetohydrodynamic simulations confirm that the equatorial belt is not disrupted by Parker and interchange instabilities.

D. J. B. Payne; A. Melatos



Decay Properties of Pu235, Pu237, and a New Isotope Pu233  

Science Journals Connector (OSTI)

Electron-capture and alpha-decay properties of Pu237, Pu235, and the new isotope Pu233 have been measured. The over-all half-lives are 44±2 days for Pu237, 26±2 minutes for Pu235, and 20±2 minutes for Pu233. Two alpha groups, one of 5.65±0.02 Mev and one of 5.36±0.02 Mev, were detected in the decay of Pu237, one group of 5.85±0.02 Mev in the decay of Pu235, and one of 6.30±0.02 Mev in the decay of Pu233. The partial alpha half-lives corresponding to these alpha groups are, for Pu237, (1.7±0.4)×104 years and (4.6±0.6)×103 years, respectively; for Pu235, (1.7±0.4) years; and for Pu233, 11±4 days. On the basis of the experimental data it has been possible to calculate hindrance factors for the alpha decay and logft values for the electron-capture decay of the three isotopes and to correlate their properties with the alpha and electron-capture systematics.

T. Darrah Thomas, Robert Vandenbosch, Richard A. Glass, and Glenn T. Seaborg



It's Elemental - Isotopes of the Element Tungsten  

NLE Websites -- All DOE Office Websites (Extended Search)

Tantalum Tantalum Previous Element (Tantalum) The Periodic Table of Elements Next Element (Rhenium) Rhenium Isotopes of the Element Tungsten [Click for Main Data] Most of the isotope data on this site has been obtained from the National Nuclear Data Center. Please visit their site for more information. Naturally Occurring Isotopes Mass Number Natural Abundance Half-life 180 0.12% >= 6.6×10+17 years 182 26.50% STABLE 183 14.31% > 1.3×10+19 years 184 30.64% STABLE 186 28.43% > 2.3×10+19 years Known Isotopes Mass Number Half-life Decay Mode Branching Percentage 157 275 milliseconds Electron Capture No Data Available 158 1.25 milliseconds Alpha Decay 100.00% 158m 0.143 milliseconds Isomeric Transition No Data Available Alpha Decay No Data Available 159 7.3 milliseconds Alpha Decay ~ 99.90%



SciTech Connect

We present a study of PSR J1723–2837, an eclipsing, 1.86 ms millisecond binary radio pulsar discovered in the Parkes Multibeam survey. Radio timing indicates that the pulsar has a circular orbit with a 15 hr orbital period, a low-mass companion, and a measurable orbital period derivative. The eclipse fraction of ?15% during the pulsar's orbit is twice the Roche lobe size inferred for the companion. The timing behavior is significantly affected by unmodeled systematics of astrophysical origin, and higher-order orbital period derivatives are needed in the timing solution to account for these variations. We have identified the pulsar's (non-degenerate) companion using archival ultraviolet, optical, and infrared survey data and new optical photometry. Doppler shifts from optical spectroscopy confirm the star's association with the pulsar and indicate a pulsar-to-companion mass ratio of 3.3 ± 0.5, corresponding to a companion mass range of 0.4 to 0.7 M{sub ?} and an orbital inclination angle range of between 30° and 41°, assuming a pulsar mass range of 1.4-2.0 M{sub ?}. Spectroscopy indicates a spectral type of G for the companion and an inferred Roche-lobe-filling distance that is consistent with the distance estimated from radio dispersion. The features of PSR J1723–2837 indicate that it is likely a 'redback' system. Unlike the five other Galactic redbacks discovered to date, PSR J1723–2837 has not been detected as a ?-ray source with Fermi. This may be due to an intrinsic spin-down luminosity that is much smaller than the measured value if the unmeasured contribution from proper motion is large.

Crawford, Fronefield [Department of Physics and Astronomy, Franklin and Marshall College, P.O. Box 3003, Lancaster, PA 17604 (United States); Lyne, Andrew G. [Jodrell Bank Centre for Astrophysics, University of Manchester, Manchester M13 9PL (United Kingdom); Stairs, Ingrid H. [Department of Physics and Astronomy, University of British Columbia, 6224 Agricultural Road, Vancouver, BC V6T 1Z1 (Canada); Kaplan, David L. [Physics Department, University of Wisconsin - Milwaukee, Milwaukee, WI 53211 (United States); McLaughlin, Maura A.; Lorimer, Duncan R. [Department of Physics, West Virginia University, Morgantown, WV 26506 (United States); Freire, Paulo C. C.; Kramer, Michael [Max-Planck-Institut für Radioastronomie, auf dem Huegel 69, D-53121 Bonn (Germany); Burgay, Marta; D'Amico, Nichi; Possenti, Andrea [INAF - Osservatorio Astronomico di Cagliari, Poggio dei Pini, I-09012 Capoterra (Italy); Camilo, Fernando [Columbia Astrophysics Laboratory, Columbia University, New York, NY 10027 (United States); Faulkner, Andrew [Cavendish Laboratory, University of Cambridge, J. J. Thompson Avenue, Cambridge, CB3 0HE (United Kingdom); Manchester, Richard N. [CSIRO Astronomy and Space Science, Australia Telescope National Facility, P.O. Box 76, Epping, NSW 1710 (Australia); Steeghs, Danny, E-mail: fcrawfor@fandm.edu [Department of Physics, University of Warwick, Coventry CV4 7AL (United Kingdom)



Measurement of the CKM Angle Alpha at BaBar  

SciTech Connect

We present BABAR experiment studies to measure the CKM angle {alpha} of the Unitarity Triangle. The measurements are based on the B meson decays into the two-body state ({pi}{pi}), the quasi two-body state ({rho}{rho}), and the three-body state ({pi}{sup +}{pi}{sup -}{pi}{sup 0}). The results are obtained from data samples of about 230 million {Upsilon}(4S) {yields} B{bar B} decays collected between 1999 and 2004 with the BABAR detector at the PEP-II asymmetric-energy B Factory at SLAC.

Yeche, C.; /Saclay



Prompt neutron decay constants in uranium diluted with matrix material systems  

SciTech Connect

Rossi-Alpha measurements were performed on uranium diluted with matrix material systems to determine the prompt neutron decay constants. These constants represent an eigenvalue characteristic of these particular critical assemblies, which can be experimentally measured by the Rossi-Alpha or pulse neutron source techniques and calculated by a deterministic or Monte Carlo method. In the measurements presented in this summary, highly enriched foils diluted in various X/{sup 235}U ratios with polyethylene and SiO{sub 2}, and polyethylene and aluminum were assembled to a high multiplication and the prompt neutron decay constants were obtained by the Rossi-Alpha technique.

Sanchez, R. G. (Rene G.); Loaiza, D. J. (David J.); Brunson, G. S. (Glenn S.)



Moduli Decays and Gravitinos  

SciTech Connect

One proposed solution of the moduli problem of string cosmology requires that the moduli are quite heavy, their decays reheating the universe to temperatures above the scale of nucleosynthesis. In many of these scenarios, the moduli are approximately supersymmetric; it is then crucial that the decays to gravitinos are helicity suppressed. In this paper, we discuss situations where these decays are, and are not, suppressed. We also comment on a possible gravitino problem from inaton decay.

Dine, Michael; Kitano, Ryuichiro; Morisse, Alexander; Shirman, Yuri



Decay of Np241  

Science Journals Connector (OSTI)

The decay of a 16-minute neptunium activity attributed to Np241 has been studied with anthracene and sodium iodide scintillation counters. The principal mode of decay appears to be a beta group decaying to the ground state of Pu241 with a beta end-point energy of 1.36±0.10 Mev.

R. Vandenbosch




SciTech Connect

We present a Chandra X-ray Observatory investigation of the millisecond pulsars in the globular cluster M28 (NGC 6626). In what is one of the deepest X-ray observations of a globular cluster, we firmly detect seven and possibly detect two of the 12 known M28 pulsars. With the exception of PSRs B1821-24 and J1824-2452H, the detected pulsars have relatively soft spectra, with X-ray luminosities 10{sup 30}-10{sup 31} erg s{sup -1} (0.3-8 keV), similar to most 'recycled' pulsars in 47 Tucanae and the field of the Galaxy, implying thermal emission from the pulsar magnetic polar caps. We present the most detailed X-ray spectrum to date of the energetic PSR B1821-24. It is well described by a purely non-thermal spectrum with spectral photon index {Gamma} = 1.23 and luminosity 1.4 x 10{sup 33}{Theta}(D/5.5 kpc){sup 2} erg s{sup -1} (0.3-8 keV), where {Theta} is the fraction of the sky covered by the X-ray emission beam(s). We find no evidence for the previously reported line emission feature around 3.3 keV, most likely as a consequence of improvements in instrument calibration. The X-ray spectrum and pulse profile of PSR B1821-24 suggest that the bulk of unpulsed emission from this pulsar is not of thermal origin, and is likely due to low-level non-thermal magnetospheric radiation, an unresolved pulsar wind nebula, and/or small-angle scattering of the pulsed X-rays by interstellar dust grains. The peculiar binary PSR J1824-2452H shows a relatively hard X-ray spectrum and possible variability at the binary period, indicative of an intrabinary shock formed by interaction between the relativistic pulsar wind and matter from its non-degenerate companion star.

Bogdanov, Slavko [Department of Physics, McGill University, 3600 University Street, Montreal, QC H3A 2T8 (Canada); Van den Berg, Maureen; Servillat, Mathieu; Grindlay, Jonathan E. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Heinke, Craig O. [Department of Physics, University of Alberta, 11322 89 Avenue, Edmonton, AB T6G 2G7 (Canada); Stairs, Ingrid H.; Begin, Steve [Department of Physics, University of British Columbia, 6224 Agricultural Road Vancouver, BC V6T 1Z1 (Canada); Ransom, Scott M. [National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA 22901 (United States); Freire, Paulo C. C. [Max-Planck-Institut fuer Radio Astronomie, Auf dem Huegel 69, D-53121 Bonn (Germany); Becker, Werner, E-mail: bogdanov@physics.mcgill.ca [Max-Planck-Institut fuer Extraterrestrische Physik, D-85740 Garching bei Muenchen (Germany)



A Non-radial Oscillation Mode in an Accreting Millisecond Pulsar?  

Science Journals Connector (OSTI)

We present results of targeted searches for signatures of non-radial oscillation modes (such as r- and g-modes) in neutron stars using RXTE data from several accreting millisecond X-ray pulsars (AMXPs). We search for potentially coherent signals in the neutron star rest frame by first removing the phase delays associated with the star's binary motion and computing fast Fourier transform power spectra of continuous light curves with up to 230 time bins. We search a range of frequencies in which both r- and g-modes are theoretically expected to reside. Using data from the discovery outburst of the 435 Hz pulsar XTE J1751–305 we find a single candidate, coherent oscillation with a frequency of 0.5727597 ? ?spin = 249.332609 Hz, and a fractional Fourier amplitude of 7.46 ? 10–4. We estimate the significance of this feature at the 1.6 ? 10–3 level, slightly better than a 3? detection. Based on the observed frequency we argue that possible mode identifications include rotationally modified g-modes associated with either a helium-rich surface layer or a density discontinuity due to electron captures on hydrogen in the accreted ocean. In the latter case the presence of sufficient hydrogen in this ultracompact system with a likely helium-rich donor would present an interesting puzzle. Alternatively, the frequency could be identified with that of an inertial mode or a core r-mode modified by the presence of a solid crust; however, the r-mode amplitude required to account for the observed modulation amplitude would induce a large spin-down rate inconsistent with the observed pulse timing measurements. For the AMXPs XTE J1814–338 and NGC 6440 X–2 we do not find any candidate oscillation signals, and we place upper limits on the fractional Fourier amplitude of any coherent oscillations in our frequency search range of 7.8 ? 10–4 and 5.6 ? 10–3, respectively. We briefly discuss the prospects and sensitivity for similar searches with future, larger X-ray collecting area missions.

Tod Strohmayer; Simin Mahmoodifar



Study of the decay asymmetry parameter and CP violation parameter in the Lambda(c)+ ---> Lambda pi+ decay  

SciTech Connect

Using data from the FOCUS (E831) experiment at Fermilab, we present a new measurement of the weak decay-asymmetry parameter a{sub {Lambda}{sub c}} in {Lambda}{sub c}{sup +} {yields} {Lambda}{pi}{sup +} decay. Comparing particle with antiparticle decays, we obtain the first measurement of the CP violation parameter {Alpha} {triple_bond} a{sub {Lambda}{sub c}} + a{sub {ovr {Lambda}{sub c}}}/a{sub {Lambda}{sub c}} - a{sub {ovr {Lambda}{sub c}}}. We obtain a{sub {Lambda}{sub c}} = -0.78 {+-} 0.16 {+-} 0.13 and {Alpha} = -0.07 {+-} 0.19 {+-} 0.12 where errors are statistical and systematic.

Link, J.M.; Yager, P.M.; /UC, Davis; Anjos, J.C.; Bediaga, I.; Castromonte, C.; Machado, A.A.; Magnin, J.; Massafferri, A.; de Miranda, J.M.; Pepe, I.M.; Polycarpo, E.; dos Reis, A.C.; /Rio de Janeiro, CBPF; Carrillo, S.; Casimiro, E.; Cuautle, E.; Sanchez-Hernandez, A.; Uribe, C.; Vazquez, F.; /CINVESTAV, IPN; Agostino, L.; Cinquini, L.; Cumalat,; /Colorado U. /Fermilab /Frascati /Guanajuato U. /Illinois U., Urbana /Indiana U. /Korea U. /Kyungpook Natl. U. /INFN, Milan /Milan U. /North Carolina U. /Pavia U. /INFN,



Glossary Term - Beta Decay  

NLE Websites -- All DOE Office Websites (Extended Search)

Avogadro's Number Avogadro's Number Previous Term (Avogadro's Number) Glossary Main Index Next Term (Beta Particle) Beta Particle Beta Decay Beta decay results in the emission of an electron and antineutrino, or a positron and neutrino. Beta decay is one process that unstable atoms can use to become more stable. There are two types of beta decay, beta-minus and beta-plus. During beta-minus decay, a neutron in an atom's nucleus turns into a proton, an electron and an antineutrino. The electron and antineutrino fly away from the nucleus, which now has one more proton than it started with. Since an atom gains a proton during beta-minus decay, it changes from one element to another. For example, after undergoing beta-minus decay, an atom of carbon (with 6 protons) becomes an atom of nitrogen (with 7 protons).



SciTech Connect

There are large amounts of heavy alpha-emitters in nuclear waste and nuclear materials inventories stored in various sites around the world. These include plutonium and minor actinides such as americium and curium. In preparation for geological disposal there is a consensus that actinides that have been separated from spent nuclear fuel should be immobilised within mineral-based ceramics rather than glass. Over the long-term, the alpha-decay taking place in these ceramics will severely disrupt their crystalline structure and reduce their durability. A fundamental property in predicting cumulative radiation damage is the number of atoms permanently displaced per alpha–decay. Currently, this number is estimated as 1000-2000 atoms/alpha decay event. Here, we report nuclear magnetic resonance, spin-counting experiments that measure close to 5000 atoms/alpha decay event in radiation damaged natural zircons. New radiological NMR measurements on highly radioactive, 239Pu zircon show damage similar to that created by 238U and 232Th in mineral zircons at the same dose, indicating no significant effect of dose rate. Based on these measurements, the initially crystalline structure of a 10 wt% 239Pu zircon would be amorphous after only 1400 years in a geological repository. These measurements establish a basis for assessing the long-term structural durability of actinide-containing ceramics based on an atomistic understanding of the fundamental damage event.

Farnan, Ian E.; Cho, Herman M.; Weber, William J.




SciTech Connect

Since the discovery of the first eight gamma-ray millisecond pulsars (MSPs) by the Fermi Large Area Telescope, this population has been steadily expanding. Four of the more recent detections, PSR J0034-0534, PSR J1939+2134 (B1937+21; the first MSP ever discovered), PSR J1959+2048 (B1957+20; the first discovery of a black widow system), and PSR J2214+3000, exhibit a phenomenon not present in the original discoveries: nearly phase-aligned radio and gamma-ray light curves (LCs). To account for the phase alignment, we explore models where both the radio and gamma-ray emission originate either in the outer magnetosphere near the light cylinder or near the polar caps. Using a Markov Chain Monte Carlo technique to search for best-fit model parameters, we obtain reasonable LC fits for the first three of these MSPs in the context of 'altitude-limited' outer gap (alOG) and two-pole caustic (alTPC) geometries (for both gamma-ray and radio emission). These models differ from the standard outer gap (OG)/two-pole caustic (TPC) models in two respects: the radio emission originates in caustics at relatively high altitudes compared to the usual conal radio beams, and we allow both the minimum and maximum altitudes of the gamma-ray and radio emission regions to vary within a limited range (excluding the minimum gamma-ray altitude of the alTPC model, which is kept constant at the stellar radius, and that of the alOG model, which is set to the position-dependent null charge surface altitude). Alternatively, phase-aligned solutions also exist for emission originating near the stellar surface in a slot gap scenario ('low-altitude slot gap' (laSG) models). We find that the alTPC models provide slightly better LC fits than the alOG models, and both of these give better fits than the laSG models (for the limited range of parameters considered in the case of the laSG models). Thus, our fits imply that the phase-aligned LCs are likely of caustic origin, produced in the outer magnetosphere, and that the radio emission for these pulsars may come from close to the light cylinder. In addition, we were able to constrain the minimum and maximum emission altitudes with typical uncertainties of {approx}30% of the light cylinder radius. Our results therefore describe a third gamma-ray MSP subclass, in addition to the two previously found by Venter et al.: those with LCs fit by standard OG/TPC models and those with LCs fit by pair-starved polar cap models.

Venter, C. [Centre for Space Research, North-West University, Potchefstroom Campus, Potchefstroom 2520 (South Africa); Johnson, T. J.; Harding, A. K. [Astrophysics Science Division, NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States)



Looking for meson molecules in B decays  

SciTech Connect

We use the QCD sum rule approach to study a {eta} Prime - {pi} molecular current. We consider an isovector-scalar I{sup G}J{sup PC} = 1{sup -}0{sup ++} molecular current. We work at leading order in {alpha}{sub s} and consider the contributions of condensates up to dimension six. We obtain a mass around 1.1 GeV, consistent with a loosely bound state. We discuss the possibility of observing this molecular state in a B threebody hadronic decay.

Nielsen, Marina; Navarra, Fernando S. [Instituto de Fisica, Universidade de Sao Paulo, C.P. 66318, 05389-970 Sao Paulo, SP (Brazil); Bediaga, Ignacio [Centro Brasileiro de Pesquisas Fisicas, Rua Xavier Sigaud 150, 22290-180 Rio de Janeiro, RJ (Brazil)



Decay of accelerated particles  

Science Journals Connector (OSTI)

We study how the decay properties of particles are changed by acceleration. It is shown that under the influence of acceleration (1) the lifetime of particles is modified and (2) new processes (such as the decay of the proton) become possible. This is illustrated by considering scalar models for the decay of muons, pions, and protons. We discuss the close conceptual relation between these processes and the Unruh effect.

Rainer Müller



Neutrinoless Quadruple Beta Decay  

E-Print Network (OSTI)

We point out that lepton number violation is possible even if neutrinos are Dirac particles. We illustrate this by constructing a simple model that allows for lepton number violation by four units only. As a consequence, neutrinoless double beta decay is forbidden, but neutrinoless quadruple beta decay is possible: $(A,Z) \\to (A,Z+4) + 4 e^-$. We identify three candidate isotopes for this decay, the most promising one being Nd-150 due to its high $Q_{0\

Julian Heeck; Werner Rodejohann


Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Development of CaMoO4 crystal scintillators for double beta decay experiment with 100-Mo  

E-Print Network (OSTI)

Energy resolution, alpha/beta ratio, pulse-shape discrimination for gamma rays and alpha particles, temperature dependence of scintillation properties, and radioactive contamination were studied with CaMoO4 crystal scintillators. A high sensitivity experiment to search for neutrinoless double beta decay of 100-Mo by using CaMoO4 scintillators is discussed.

A. N. Annenkov; O. A. Buzanov; F. A. Danevich; A. Sh. Georgadze; S. K. Kim; H. J. Kim; Y. D. Kim; V. V. Kobychev; V. N. Kornoukhov; M. Korzhik; J. I. Lee; O. Missevitch; V. M. Mokina; S. S. Nagorny; A. S. Nikolaiko; D. V. Poda; R. B. Podviyanuk; D. J. Sedlak; O. G. Shkulkova; J. H. So; I. M. Solsky; V. I. Tretyak; S. S. Yurchenko



Chandra X-ray and Gemini near-infrared observations of the eclipsing millisecond pulsar SWIFT J1749.4-2807 in quiescence  

E-Print Network (OSTI)

We report on Chandra X-ray and Gemini-North near-infrared K-band observations of the eclipsing accretion-powered millisecond X-ray pulsar SWIFT J1749.4?2807 in quiescence. Using the Chandra observation we derive a source ...

Chakrabarty, Deepto


E-Print Network 3.0 - alpha-alpha interaction contribution Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

of Alberta Collection: Computer Technologies and Information Sciences 55 Join The Gator Nation GENERAL INFORMATION 2011-12 Summary: Pi Alpha Gamma Rho Alpha Kappa Alpha...


Uncertainties on alpha_S in global PDF analyses  

E-Print Network (OSTI)

We determine the uncertainty on the strong coupling alpha_S due to the experimental errors on the data fitted in global analysis of hard-scattering data, within the standard framework of leading-twist fixed-order collinear factorisation in the MSbar scheme, finding that alpha_S(M_Z^2) = 0.1202^{+0.0012}_{-0.0015} at next-to-leading order and alpha_S(M_Z^2) = 0.1171^{+0.0014}_{-0.0014} at next-to-next-to-leading order. We investigate the interplay between uncertainties on alpha_S and uncertainties on parton distribution functions (PDFs). We show, for the first time, how both these sources of uncertainty can be accounted for simultaneously in calculations of cross sections, and we provide eigenvector PDF sets with different fixed alpha_S values to allow further studies by the general user. We illustrate the application of these PDF sets by calculating cross sections for W, Z, Higgs boson and inclusive jet production at the Tevatron and LHC.

Martin, A D; Thorne, R S; Watt, G



Majorons and muon decay  

Science Journals Connector (OSTI)

The existence of a massless Goldstone boson coupling to neutrinos in theories with spontaneous violation of a global B-L symmetry may be consequential in precision measurements of the parameters in muon decay. We calculate the decay parameters for ??eMM, where the Majoron M is the Goldstone boson, and discuss limits on the Majoron-neutrino coupling.

T. Goldman; Edward W. Kolb; G. J. Stephenson; Jr.



Muon Decay Deep Underground  

Science Journals Connector (OSTI)

A measurement of delayed coincidences characteristic of muon decay has been made at a depth of 1440-hg/cm2 standard rock with a 200-liter liquid scintillation detector. These results are consistent with the decay rate predicted from the depth-intensity curve for the penetrating component of the cosmic rays, providing independent evidence that this component is energetic muons.

W. R. Kropp; Jr.; F. Reines; R. M. Woods; Jr.



Rare hadronic B decays  

E-Print Network (OSTI)

Rare hadronic B-meson decays allow us to study CP violation. The class of B decays final states containing two vector mesons provides a rich set of angular correlation observables to study. This article reviews some of the recent experimental results from the BaBar and Belle collaborations.

A. J. Bevan



Neutrinoless double beta decay  

Science Journals Connector (OSTI)

Present status of the search for 0??? decay and of the related theoretical questions is reviewed. The mechanism of the decay and how to recognize it is discussed first followed by the relation of the effective neutrino Majorana mass and the oscillation parameters and the problems of nuclear matrix elements. The planned ? 100 kg experiments are briefly described.

Petr Vogel



Non-statistical decay and $?$-correlations in the $^{12}$C+$^{12}$C fusion-evaporation reaction at 95 MeV  

E-Print Network (OSTI)

Multiple alpha coincidence and correlations are studied in the reaction $^{12}$C+$^{12}$C at 95 MeV for fusion-evaporation events completely detected in charge. Two specific channels with Carbon and Oxygen residues in coincidence with $\\alpha$-particles are addressed, which are associated with anomalously high branching ratios with respect the predictions by Hauser-Feshbach calculations. Triple alpha emission appears kinematically compatible with a sequential emission from a highly excited Mg. The phase space distribution of $\\alpha$-$\\alpha$ coincidences suggests a correlated emission from a Mg compound, leaving an Oxygen residue excited above the threshold for neutron decay. These observations indicate a preferential $\\alpha$ emission of $^{24}$Mg at excitation energies well above the threshold for $6-\\alpha$ decay.

L. Morelli; G. Baiocco; M. D'Agostino; F. Gulminelli; M. Bruno; U. Abbondanno; S. Appannababu; S. Barlini; M. Bini; G. Casini; M. Cinausero; M. Degerlier; D. Fabris; N. Gelli; F. Gramegna; V. L. Kravchuk; T. Marchi; G. Pasquali; S. Piantelli; S. Valdré; Ad R. Raduta



Spontaneous-fission branching in the decay of 104259  

Science Journals Connector (OSTI)

The nuclide 104259 has been produced in the Cf249(C13,3n) reaction. Alpha particle groups of 8.77±0.01 MeV and 8.87±0.01 MeV were attributed to the decay of 104159, and the measured half-life was found to be 3.0±1.3 s. The branching ratio for spontaneous fission decay was determined to be 0.063±0.037.RADIOACTIVITY, FISSION 104259(sf and ?), measured T12, E?, I?, Isf, ? for Cf249(C13,3n) and Cf249(C13,?2n) reactions; deduced sf? for 104259; enriched target.

C. E. Bemis; Jr.; P. F. Dittner; R. L. Ferguson; D. C. Hensley; F. Plasil; F. Pleasonton



B Decay Length  

NLE Websites -- All DOE Office Websites (Extended Search)

Threshold Decay Length Threshold Decay Length Data from 292 B events are in an Excel spreadsheet that looks like this table. To find the threshold decay length: Sort the data by descending decay lengths, dt. Run Event No. B Mass GeV/c2 ptB GeV/c dt cm Velocity v/c Lab Lifetime sec Rest Lifetime sec Bin 65160 642324 5.277 7.966 0.388 66500 89978 5.274 20.508 0.940 Get the data. Make a histogram of decay lengths. Rather than graphing all the lengths as individual points, physicists group the data. They consider the range of the data and divide it into "bins" of equal size. A histogram is a graph of the number of events in each bin vs. the bin range. We are looking for the smallest decay length that fits the exponential curve. This will indicate the length of the decay as detemined by that experimental run.


Derr Track Storage Bldg Sigma Alpha  

E-Print Network (OSTI)

!( Derr Track Storage Bldg Solar House Entomology Lab Bldg Sigma Alpha Epsilon 11 MEAS Ocean Lab & Storage Avent Ferry Complex Building Sigma Phi Epsilon 7 Pi Kappa Alpha 10 Sigma Alpha Mu 4 Tau Kappa

Reeves, Douglas S.


Characterization of ZnSe scintillating bolometers for Double Beta Decay  

E-Print Network (OSTI)

ZnSe scintillating bolometers are good candidates for future Double Beta Decay searches, because of the 82Se high Q-value and thanks to the possibility of alpha background rejection on the basis of the scintillation signal. In this paper we report the characteristics and the anomalies observed in an extensive study of these devices. Among them, an unexpected high emission from alpha particles, accompanied with an unusual pattern of the light vs. heat scatter plot. The perspectives for the application of this kind of detectors to search for the Neutrinoless Double Beta Decay of 82Se are presented.

C. Arnaboldi; S. Capelli; O. Cremonesi; L. Gironi; M. Pavan; G. Pessina; S. Pirro



Charmless B Decays  

SciTech Connect

Rare charmless hadronic B decays are a good testing ground for the standard model. The dominant amplitudes contributing to this class of B decays are CKM suppressed tree diagrams and b {yields} s or b {yields} d loop diagrams (''penguins''). These decays can be used to study interfering standard model (SM) amplitudes and CP violation. They are sensitive to the presence of new particles in the loops, and they provide valuable information to constrain theoretical models of B decays. The B factories BABAR at SLAC and Belle at KEK produce B mesons in the reaction e{sup +}e{sup -} {yields} {Upsilon}(4S) {yields} B{bar B}. So far they have collected integrated luminosities of about 406 fb{sup -1} and 600 fb{sup -1}, respectively. The results presented here are based on subsets of about 200-500 fb{sup -1} and are preliminary unless a journal reference is given.

Gradl, Wolfgang; /Edinburgh U.



Neutrinoless Double $?$-Decay  

E-Print Network (OSTI)

The neutrinoless double $\\beta$-decay is reviewed. Model independent evidence in favor of neutrino masses and mixing is briefly summarized. The data of the recent experiments on the search for $0\

S. M. Bilenky



Decay of Np93232  

Science Journals Connector (OSTI)

The decay of Np93232 has been studied by ? spectroscopy with a Ge(Li) spectrometer. The energies and relative intensities of 24 ? peaks have been determined. A decay scheme with two new energy levels at 1098.2 and 1146.3 keV is proposed. The level at 1193.9 keV has been confirmed. Electron-capture branching intensities are given.

R. Weiss-Reuter; H. Münzel; G. Pfennig



Double Beta Decay  

E-Print Network (OSTI)

The motivation, present status, and future plans of the search for the neutrinoless double beta decay are reviewed. It is argued that, motivated by the recent observations of neutrino oscillations, there is a reasonable hope that neutrinoless double beta decay corresponding to the neutrino mass scale suggested by oscillations, of about 50 meV, actually exists. The challenges to achieve the sensitivity corresponding to this mass scale, and plans to overcome them, are described.

Steven R. Elliott; Petr Vogel



Odd p isotope 113In: Measurement of alpha-induced reactions  

E-Print Network (OSTI)

One of the few p nuclei with an odd number of protons is 113In. Reaction cross sections of 113In(alpha,gamma)117Sb and 113In(alpha,n)116Sb have been measured with the activation method at center-of-mass energies between 8.66 and 13.64 MeV, close to the astrophysically relevant energy range. The experiments were carried out at the cyclotron accelerator of ATOMKI. The activities were determined by off-line detection of the decay gamma rays with a HPGe detector. Measured cross sections and astrophysical S factor results are presented and compared with statistical model calculations using three different alpha+nucleus potentials. The comparison indicates that the standard rates used in the majority of network calculations for these reactions were too fast due to the energy dependence of the optical alpha potential at low energy.

C. Yalç?n; R. T. Güray; N. Özkan; S. Kutlu; Gy. Gyürky; J. Farkas; G. G. Kiss; Zs. Fülöp; A. Simon; E. Somorjai; T. Rauscher



Gravitational-wave spin-down and stalling lower limits on the electrical resistivity of the accreted mountain in a millisecond pulsar  

E-Print Network (OSTI)

The electrical resistivity of the accreted mountain in a millisecond pulsar is limited by the observed spin-down rate of binary radio millisecond pulsars (BRMSPs) and the spins and X-ray fluxes of accreting millisecond pulsars (AMSPs). We find $\\eta \\ge 10^{-28}\\,\\mathrm{s}\\, (\\tau_\\mathrm{SD}/1\\,\\mathrm{Gyr})^{-0.8}$ (where $\\tau_\\mathrm{SD}$ is the spin-down age) for BRMSPs and $\\eta \\ge 10^{-25}\\,\\mathrm{s}\\,(\\dot{M}_\\mathrm{a}/\\dot{M}_\\mathrm{E})^{0.6}$ (where $\\dot{M}_\\mathrm{a}$ and $\\dot{M}_\\mathrm{E}$ are the actual and Eddington accretion rates) for AMSPs. These limits are inferred assuming that the mountain attains a steady state, where matter diffuses resistively across magnetic flux surfaces but is replenished at an equal rate by infalling material. The mountain then relaxes further resistively after accretion ceases. The BRMSP spin-down limit approaches the theoretical electron-impurity resistivity at temperatures $\\ga 10^5$ K for an impurity concentration of $\\sim 0.1$, while the AMSP stalling limit falls two orders of magnitude below the theoretical electron-phonon resistivity for temperatures above $10^8$ K. Hence BRMSP observations are already challenging theoretical resistivity calculations in a useful way. Next-generation gravitational-wave interferometers will constrain $\\eta$ at a level that will be competitive with electromagnetic observations.

Matthias Vigelius; Andrew Melatos




SciTech Connect

We report the detection of pulsed gamma-ray emission from the fast millisecond pulsars (MSPs) B1937+21 (also known as J1939+2134) and B1957+20 (J1959+2048) using 18 months of survey data recorded by the Fermi Large Area Telescope and timing solutions based on radio observations conducted at the Westerbork and Nancay radio telescopes. In addition, we analyzed archival Rossi X-ray Timing Explorer and XMM-Newton X-ray data for the two MSPs, confirming the X-ray emission properties of PSR B1937+21 and finding evidence ({approx}4{sigma}) for pulsed emission from PSR B1957+20 for the first time. In both cases the gamma-ray emission profile is characterized by two peaks separated by half a rotation and are in close alignment with components observed in radio and X-rays. These two pulsars join PSRs J0034-0534 and J2214+3000 to form an emerging class of gamma-ray MSPs with phase-aligned peaks in different energy bands. The modeling of the radio and gamma-ray emission profiles suggests co-located emission regions in the outer magnetosphere.

Guillemot, L.; Kramer, M.; Freire, P. C. C.; Noutsos, A. [Max-Planck-Institut fuer Radioastronomie, 53121 Bonn (Germany); Johnson, T. J.; Harding, A. K. [NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Venter, C. [Centre for Space Research, North-West University, Potchefstroom Campus, 2520 Potchefstroom (South Africa); Kerr, M.; Michelson, P. F. [W. W. Hansen Experimental Physics Laboratory, Kavli Institute for Particle Astrophysics and Cosmology, Department of Physics and SLAC National Accelerator Laboratory, Stanford University, Stanford, CA 94305 (United States); Pancrazi, B. [CNRS, IRAP, F-31028 Toulouse Cedex 4 (France); Livingstone, M. [Department of Physics, McGill University, Montreal, PQ H3A 2T8 (Canada); Janssen, G. H.; Jaroenjittichai, P.; Stappers, B. W.; Espinoza, C. M. [Jodrell Bank Centre for Astrophysics, School of Physics and Astronomy, University of Manchester, M13 9PL (United Kingdom); Cognard, I. [Laboratoire de Physique et Chimie de l'Environnement, LPCE UMR 6115 CNRS, F-45071 Orleans Cedex 02 (France); Camilo, F. [Columbia Astrophysics Laboratory, Columbia University, New York, NY 10027 (United States); Gargano, F. [Istituto Nazionale di Fisica Nucleare, Sezione di Bari, 70126 Bari (Italy); Grove, J. E. [Space Science Division, Naval Research Laboratory, Washington, DC 20375-5352 (United States); Johnston, S., E-mail: guillemo@mpifr-bonn.mpg.de, E-mail: tyrel.j.johnson@gmail.com, E-mail: Christo.Venter@nwu.ac.za, E-mail: kerrm@stanford.edu [CSIRO Astronomy and Space Science, Australia Telescope National Facility, Epping NSW 1710 (Australia); and others


Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



SciTech Connect

We have discovered five millisecond pulsars (MSPs) in a survey of 14 unidentified Fermi Large Area Telescope sources in the southern sky using the Parkes radio telescope. PSRs J0101-6422, J1514-4946, and J1902-5105 reside in binaries, while PSRs J1658-5324 and J1747-4036 are isolated. Using an ephemeris derived from timing observations of PSR J0101-6422 (P = 2.57 ms, DM = 12 pc cm{sup -3}), we have detected {gamma}-ray pulsations and measured its proper motion. Its {gamma}-ray spectrum (a power law of {Gamma} = 0.9 with a cutoff at 1.6 GeV) and efficiency are typical of other MSPs, but its radio and {gamma}-ray light curves challenge simple geometric models of emission. The high success rate of this survey-enabled by selecting {gamma}-ray sources based on their detailed spectral characteristics-and other similarly successful searches indicate that a substantial fraction of the local population of MSPs may soon be known.

Kerr, M. [W. W. Hansen Experimental Physics Laboratory, Kavli Institute for Particle Astrophysics and Cosmology, Department of Physics and SLAC National Accelerator Laboratory, Stanford University, Stanford, CA 94305 (United States); Camilo, F. [Columbia Astrophysics Laboratory, Columbia University, New York, NY 10027 (United States); Johnson, T. J. [National Academy of Sciences, Washington, DC 20001 (United States); Ferrara, E. C.; Harding, A. K. [NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Guillemot, L.; Kramer, M. [Max-Planck-Institut fuer Radioastronomie, Auf dem Huegel 69, 53121 Bonn (Germany); Hessels, J. [Netherlands Institute for Radio Astronomy (ASTRON), Postbus 2, 7990 AA Dwingeloo (Netherlands); Johnston, S.; Keith, M.; Reynolds, J. E. [CSIRO Astronomy and Space Science, Australia Telescope National Facility, Epping, NSW 1710 (Australia); Ransom, S. M. [National Radio Astronomy Observatory (NRAO), Charlottesville, VA 22903 (United States); Ray, P. S.; Wood, K. S. [Space Science Division, Naval Research Laboratory, Washington, DC 20375-5352 (United States); Sarkissian, J., E-mail: kerrm@stanford.edu, E-mail: fernando@astro.columbia.edu, E-mail: tyrel.j.johnson@gmail.com [CSIRO Parkes Observatory, Parkes, NSW 2870 (Australia)




SciTech Connect

We report the discovery of X-ray eclipses in the recently discovered accreting millisecond X-ray pulsar SWIFT J1749.4-2807. This is the first detection of X-ray eclipses in a system of this type and should enable a precise neutron star mass measurement once the companion star is identified and studied. We present a combined pulse and eclipse timing solution that enables tight constraints on the orbital parameters and inclination and shows that the companion mass is in the range 0.6-0.8 M{sub sun} for a likely range of neutron star masses, and that it is larger than a main-sequence star of the same mass. We observed two individual eclipse egresses and a single ingress. Our timing model shows that the eclipse features are symmetric about the time of 90{sup 0} longitude from the ascending node, as expected. Our eclipse timing solution gives an eclipse duration (from the mid-points of ingress to egress) of 2172 {+-} 13 s. This represents 6.85% of the 8.82 hr orbital period. This system also presents a potential measurement of 'Shapiro' delay due to general relativity; through this technique alone, we set an upper limit to the companion mass of 2.2 M{sub sun}.

Markwardt, C. B. [Department of Astronomy, University of Maryland, College Park, MD 20742 (United States); Strohmayer, T. E., E-mail: Craig.Markwardt@nasa.go [X-ray Astrophysics Laboratory, Mail Code 662, NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States)



Measurement of the cross section of charmed hadrons and the nuclear dependence alpha  

SciTech Connect

With data from the SELEX experiment we study charm hadro-production. We report the differential production cross sections as function of the longitudinal and transverse momentum, as well as for two different target materials, of 14 charmed hadron and/or their decay modes. This is the most extensive study to date. SELEX is a fixed target experiment at Fermilab with high forward acceptance; it took data during 1996-1997 with 600 GeV/c {Sigma}{sup -} and {pi}{sup -}, and 540 GeV/c proton and {pi}{sup +} beams. It used 5 target foils (two copper and three diamond). We use the results to determine {alpha}, used in parametrizing the production cross section as {infinity} A{sup {alpha}}, where A is the mass number of the target nuclei. We found within our statistics that {alpha} is independent of the longitudinal momentum fraction x{sub F} in the interval 0.1 < x{sub F} < 1.0, with {alpha} = 0.778 {+-} 0.014. The average value of {alpha} for charm production by pion beams is {alpha}{sub meson} = 0.850 {+-} 0.028. This is somewhat larger than the corresponding average {alpha}{sub baryon} = 0.755 {+-} 0.016 for charm production by baryon beams ({Sigma}{sup -} and protons).

Blanco-Covarrubias, E.Alejandro; /San Luis Potosi U.



Giant resonance decay  

SciTech Connect

Decay studies of giant multipole resonances are discussed, emphasizing the role of Coulomb excitation with intermediate energy heavy ions, which can provide very large cross sections for both isoscalar and isovector resonances. We discuss measurement of the photon decay of one and two phonon giant resonances, reporting results where available. It is pointed out throughout the presentation that the use of E1 photons as a tag'' provides a means to observe weakly excited resonances that cannot be observed in the singles spectra. 30 refs., 16 figs., 1 tab.

Beene, J.R.; Bertrand, F.E.




E-Print Network (OSTI)

the search for neutrinoless double beta decay may prove verySearching for neutrinoless double beta decay is the onlysensitivity of neutrinoless double beta decay. The potential

Kayser, B.



Noncharacteristic half-lives in radioactive decay  

Science Journals Connector (OSTI)

Half-lives of radionuclides span more than 50 orders of magnitude. We characterize the probability distribution of this broad-range data set at the same time that we explore a method for fitting power laws and testing goodness-of-fit. It is found that the procedure proposed recently by Clauset et al. [SIAM Rev. 51, 661 (2009)] does not perform well as it rejects the power-law hypothesis even for power-law synthetic data. In contrast, we establish the existence of a power-law exponent with a value around 1.1 for the half-life density, which can be explained by the sharp relationship between decay rate and released energy, for different disintegration types. For the case of alpha emission, this relationship constitutes an original mechanism of power-law generation.

Álvaro Corral; Francesc Font; Juan Camacho



? decay of Fr216 and At212  

Science Journals Connector (OSTI)

The alpha and coincident gamma decays of Fr216 and At212 in secular equilibrium with 0.8 s Pa224 and 26.1 ms Ac220 have been studied with emphasis on the level scheme of At212. The level structure has been interpreted in terms of the shell model configurations ?(h9/2)9/23?(g9/2), ?(h9/2)0+2(f7/2)?(g9/2), and ?(h9/2)9/23?(i11/2). These configurations are then compared with the calculated configurations in At212 and with the corresponding experimental configurations in Bi210 and Bi212. In all three cases plots of the experimental energies vs the spin show the expected inverted parabola shape, but as we move farther away from the Pb208 closed shells, the inverted parabolas become more compressed. © 1996 The American Physical Society.

C. F. Liang; P. Paris; R. K. Sheline; P. Alexa; A. Gizon



Vacuum Energy Decay  

E-Print Network (OSTI)

The problem of the vacuum energy decay is studied through the analysis of the vacuum survival amplitude ${\\mathcal A}(z, z')$. Transition amplitudes are computed for finite time-span, $Z\\equiv z^\\prime-z$, and their {\\em late time} behavior is discussed up to first order in the coupling constant, $\\l$.

Enrique Álvarez; Roberto Vidal



Theory of Beta Decay  

Science Journals Connector (OSTI)

......pseudoscalar coupling constant, (13 1) Schwarzschild gave the data on He6 (Sc57b). thesis...data of ft values in the beta decay of mirror transitions between doubly closed shell...Ann. of Phys. 2 (1957), 407. A. Schwarzschild, Ph. D. Thesis, Columbia University......

M. Morita




SciTech Connect

PSR J1910-5959A is a binary pulsar with a helium white dwarf (HeWD) companion located about 6 arcmin from the center of the globular cluster NGC 6752. Based on 12 years of observations at the Parkes radio telescope, the relativistic Shapiro delay has been detected in this system. We obtain a companion mass M{sub C} = 0.180 {+-} 0.018 M {sub Sun} (1{sigma}) implying that the pulsar mass lies in the range 1.1 M {sub Sun} {<=} M{sub P} {<=} 1.5 M {sub Sun }. We compare our results with previous optical determinations of the companion mass and examine prospects for using this new measurement for calibrating the mass-radius relation for HeWDs and for investigating their evolution in a pulsar binary system. Finally, we examine the set of binary systems hosting a millisecond pulsar and a low-mass HeWD for which the mass of both stars has been measured. We confirm that the correlation between the companion mass and the orbital period predicted by Tauris and Savonije reproduces the observed values but find that the predicted M{sub P} -P{sub B} correlation overestimates the neutron star mass by about 0.5 M {sub Sun} in the orbital period range covered by the observations. Moreover, a few systems do not obey the observed M{sub P} -P{sub B} correlation. We discuss these results in the framework of the mechanisms that inhibit the accretion of matter by a neutron star during its evolution in a low-mass X-ray binary.

Corongiu, A.; Burgay, M.; Possenti, A.; D'Amico, N. [INAF-Osservatorio Astronomico di Cagliari, Loc. Poggio dei Pini, Strada 54, I-09012 Capoterra (Italy); Camilo, F. [Columbia Astrophysics Laboratory, Columbia University, 550 West, 120th Street, New York, NY 10027 (United States); Lyne, A. G.; Kramer, M. [Jodrell Bank Centre for Astrophysics, School of Physics and Astronomy, University of Manchester, Manchester M13 9PL (United Kingdom); Manchester, R. N.; Johnston, S. [CSIRO Astronomy and Space Science, Australia Telescope National Facility, P.O. Box 76, Epping, NSW 1710 (Australia); Sarkissian, J. M. [Australia Telescope National Facility, CSIRO, Parkes Observatory, P.O. Box 276, Parkes, NSW 2870 (Australia); Bailes, M.; Van Straten, W. [Centre for Astrophysics and Supercomputing, Swinburne University of Technology, P.O. Box 218 Hawthorn, VIC 3122 (Australia)



Surface Radiography with Alpha Rays  

Science Journals Connector (OSTI)

... , and Câ² are deposited on the surfaces of objects which come in contact with radon. Three of them, namely, radium A, C and Câ², emit alpha rays ... two hours in a vessel (volume 70 c.c.) containing 1 me. of radon. Afterwards the wing was put for 8 min. on the emulsion of a photographic ...




Latest results of NEXT-DEMO, the prototype of the NEXT 100 double beta decay experiment  

E-Print Network (OSTI)

NEXT-DEMO is a 1:4.5 scale prototype of the NEXT100 detector, a high-pressure xenon gas TPC that will search for the neutrinoless double beta decay of $^{136}$Xe. X-ray energy depositions produced by the de-excitation of Xenon atoms after the interaction of gamma rays from radioactive sources have been used to characterize the response of the detector obtaining the spatial calibration needed for close-to-optimal energy resolution. Our result, 5.5% FWHM at 30 keV, extrapolates to 0.6% FWHM at the Q value of $^{136}$Xe. Additionally, alpha decays from radon have been used to measure several detection properties and parameters of xenon gas such as electron-ion recombination, electron drift velocity, diffusion and primary scintillation light yield. Alpha spectroscopy is also used to quantify the activity of radon inside the detector, a potential source of background for most double beta decay experiments.

Serra, L; Martin-Albo, J; Sorel, M; Gomez-Cadenas, J J



Handbook on string decay  

E-Print Network (OSTI)

We explain simple semi-classical rules to estimate the lifetime of any given highly-excited quantum state of the string spectrum in flat spacetime. We discuss both the decays by splitting into two massive states and by massless emission. As an application, we study a solution describing a rotating and pulsating ellipse which becomes folded at an instant of time -- the ``squashing ellipse''. This string interpolates between the folded string with maximum angular momentum and the pulsating circular string. We explicitly compute the quantum decay rate for the corresponding quantum state, and verify the basic rules that we propose. Finally, we give a more general (4-parameter) family of closed string solutions representing rotating and pulsating elliptical strings.

Roberto Iengo; Jorge G. Russo



Production and decay properties of the 1.9-s isomeric state in {sup 261}Rf  

SciTech Connect

The 1.9-s isomeric state ({sup 261}Rf{sup b}) in {sup 261}Rf was directly populated in the {sup 248}Cm({sup 18}O,5n){sup 261}Rf{sup b} reaction. Alpha and spontaneous fission (SF) decays of {sup 261}Rf{sup b}, as well as the 68-s state {sup 261}Rf{sup a}, was investigated with a rotating wheel apparatus under low background conditions attained by a gas-jet transport system coupled to the RIKEN gas-filled recoil ion separator. An identification of {sup 261}Rf{sup b} was based on {alpha}-{alpha} correlations linking {alpha} decays of {sup 261}Rf{sup b} and its daughter {sup 257}No. The {alpha}-particle energy of {sup 261}Rf{sup b} was measured to be 8.52 {+-} 0.05 MeV. The half-life was determined to be 1.9 {+-} 0.4 s based on both 8.52-MeV {alpha} and SF decays. The {alpha} and SF branches are 0.27 {+-} 0.06 and 0.73 {+-} 0.06, respectively. The cross section for the {sup 248}Cm({sup 18}O,5n){sup 261}Rf{sup b} reaction is {sigma}({sup 261}Rf{sup b}) = 11 {+-} 2 nb at 95.1 MeV, which gives a cross-section ratio of {sigma}({sup 261}Rf{sup a})/{sigma}({sup 261}Rf{sup b}) = 1.1 {+-} 0.2.

Haba, H.; Kaji, D.; Kikunaga, H.; Kudou, Y.; Morimoto, K.; Morita, K.; Ozeki, K.; Sumita, T.; Yoneda, A.; Kasamatsu, Y.; Komori, Y.; Ooe, K.; Shinohara, A. [Nishina Center for Accelerator-Based Science, RIKEN, Wako, Saitama 351-0198 (Japan); Graduate School of Science, Osaka University, Toyonaka, Osaka 560-0043 (Japan)



Higgs boson decay into b-quarks at NNLO accuracy  

E-Print Network (OSTI)

We compute the fully differential decay rate of the Standard Model Higgs boson into b-quarks at next-to-next-to-leading order (NNLO) accuracy in alpha_S. We employ a general subtraction scheme developed for the calculation of higher order perturbative corrections to QCD jet cross sections, which is based on the universal infrared factorization properties of QCD squared matrix elements. We show that the subtractions render the various contributions to the NNLO correction finite. In particular, we demonstrate analytically that the sum of integrated subtraction terms correctly reproduces the infrared poles of the two-loop double virtual contribution to this process. We present illustrative differential distributions obtained by implementing the method in a parton level Monte Carlo program. The basic ingredients of our subtraction scheme, used here for the first time to compute a physical observable, are universal and can be employed for the computation of more involved processes.

Del Duca, Vittorio; Somogyi, Gabor; Tramontano, Francesco; Trocsanyi, Zoltan




SciTech Connect

A massive millisecond magnetar may survive the merger of a neutron star (NS) binary, which would continuously power the merger ejecta. We develop a generic dynamic model for the merger ejecta with energy injection from the central magnetar. The ejecta emission (the {sup m}erger-nova{sup )} powered by the magnetar peaks in the UV band and the peak of the light curve, progressively shifts to an earlier epoch with increasing frequency. A magnetar-powered merger-nova could have an optical peak brightness comparable to a supernova, which is a few tens or hundreds times brighter than the radioactive-powered merger-novae (the so-called macro-nova or kilo-nova). On the other hand, such a merger-nova would peak earlier and have a significantly shorter duration than that of a supernova. An early collapse of the magnetar could suppress the brightness of the optical emission and shorten its duration. Such millisecond-magnetar-powered merger-novae may be detected from NS-NS merger events without an observed short gamma-ray burst, and could be a bright electromagnetic counterpart for gravitational wave bursts due to NS-NS mergers. If detected, it suggests that the merger leaves behind a massive NS, which has important implications for the equation-of-state of nuclear matter.

Yu, Yun-Wei [Institute of Astrophysics, Central China Normal University, Wuhan 430079 (China)] [Institute of Astrophysics, Central China Normal University, Wuhan 430079 (China); Zhang, Bing; Gao, He, E-mail: yuyw@mail.ccnu.edu.cn, E-mail: zhang@physics.unlv.edu [Department of Physics and Astronomy, University of Nevada, Las Vegas, NV 89154 (United States)] [Department of Physics and Astronomy, University of Nevada, Las Vegas, NV 89154 (United States)



Search for the double beta decay of sup 244 Pu  

SciTech Connect

We have searched for the ingrowth of {sup 244}Cm in a 1.45-g sample of {sup 244}Pu. We isolated a curium fraction after an ingrowth period of 1.03 yr; during this time the {sup 244}Pu sample produced {le}0.24 alpha disintegrations per day of {sup 244}Cm (95% C.L.), corresponding to a half-life for the double beta decay of {sup 244}Pu of {ge}1.1{times}10{sup 18} yr.

Moody, K.J.; Lougheed, R.W.; Hulet, E.K. (Nuclear Chemistry Division, Lawrence Livermore National Laboratory, University of California, Livermore, California 94551 (United States))



Application of a cubic barrier in exotic decay studies  

SciTech Connect

In exotic decay studies, the branching ratios for spontaneous emissions of fragments heavier than alpha particle have been found to be very sensitive to the shape of the potential barrier. In order to fix the top of barrier correctly, finite range effects are included in our calculations. Experimental Q values for different decay modes are chosen so as to incorporate the shell effects. The shape of the barrier in the overlapping region is approximated by a third-order polynomial suggested by Nix. The cubic barrier is found to be more suitable near the penetrating region. This model is applied to calculate the branching ratios for the spontaneous emission of heavier fragments. The results obtained compare well with those of other theoretical models and experimental values.

Shanmugam, G.; Kamalaharan, B.



CP violations in ?± meson decay  

Science Journals Connector (OSTI)

We study the pion decays with intermediate on-shell neutrinos N into two electrons and a muon, ?± ? e±N ? e±e±??. We investigate the branching ratios Br± = [?(?? ? e?e??+?) ± ?(?+ ? e+e+???)]/?(?? ? all) and the CP asymmetry ratio for such decays, in the scenario with two different on-shell neutrinos. If N is Dirac, only the lepton number conserving (LC) decays contribute (LC: ? = ?e or ); if N is Majorana, both LC and lepton number violating (LV) decays contribute (LV: or ? = ??). The results show that the CP asymmetry is in general very small, but increases and becomes ~1 when the masses of the two intermediate neutrinos get closer to each other, i.e., when their mass difference becomes comparable with their decay width, . The observation of CP violation in pion decays would be consistent with the existence of the well-motivated ?MSM model with two almost degenerate heavy neutrinos.

Gorazd Cveti?; C S Kim; Jilberto Zamora-Saá




NLE Websites -- All DOE Office Websites (Extended Search)

is on the order of the torus major radius. Let us now consider, following Similon and Sudan, 17 an Alfve n wave packet, with a characteristic perpendicular wave number k 0...

Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Measurement of the $\\Xi^0 \\rightarrow \\Lambda\\gamma$ Decay Asymmetry and Branching Fraction  

E-Print Network (OSTI)

In data taken with the NA48 experiment at the CERN SPS in 1999, 730 candidates of the weak radiative hyperon decay Xi0 -> Lambda gamma have been found with an estimated background of 58 +- 8 events. From these events the Xi0 -> Lambda gamma decay asymmetry has been determined to alpha(Xi0 -> Lambda gamma) = -0.78 +- 0.18_stat +- 0.06_syst, which is the first evidence of a decay asymmetry in Xi0 -> Lambda gamma. The branching fraction of the decay has been measured to be Br(Xi0 -> Lambda gamma) = (1.16 +- 0.05_stat +- 0.06_syst) x 10^-3.

Lai, A; Bevan, A; Dosanjh, R S; Gershon, T J; Hay, B; Kalmus, George Ernest; Lazzeroni, C; Munday, D J; Olaiya, E; Parker, M A; White, T O; Wotton, S A; Barr, G; Bocquet, G; Ceccucci, Augusto; Çuhadar-Dönszelmann, T; Cundy, Donald C; D'Agostini, Giulio; Doble, Niels T; Falaleev, V P; Gatignon, L; Gonidec, A; Gorini, B; Govi, G; Grafström, P; Kubischta, Werner; Lacourt, A; Norton, A; Palestini, S; Panzer-Steindel, B; Taureg, Hans; Velasco, M; Wahl, H; Cheshkov, C; Gaponenko, A N; Khristov, P Z; Kekelidze, V D; Madigozhin, D T; Molokanova, N A; Potrebenikov, Yu K; Tatishvili, G T; Tkachev, A L; Zinchenko, A I; Knowles, I; Martin, V; Sacco, R; Walker, A; Contalbrigo, M; Dalpiaz, Pietro; Duclos, J; Frabetti, P L; Gianoli, A; Martini, M; Petrucci, F; Savrié, M; Bizzeti, A; Calvetti, M; Collazuol, G; Graziani, G; Iacopini, E; Lenti, M; Martelli, F; Veltri, M; Becker, H G; Eppard, K; Eppard, M; Fox, H; Kalter, A; Kleinknecht, K; Koch, U; Köpke, L; Lopes da Silva, P; Marouelli, P; Pellmann, I A; Peters, A; Renk, B; Schmidt, S A; Schönharting, V; Schué, Yu; Wanke, R; Winhart, A; Wittgen, M; Chollet, J C; Fayard, L; Iconomidou-Fayard, L; Ocariz, J; Unal, G; Wingerter-Seez, I; Anzivino, Giuseppina; Cenci, P; Imbergamo, E; Lubrano, P; Mestvirishvili, A; Nappi, A; Pepé, M; Piccini, M; Bertanza, L; Carosi, R; Casali, R; Cerri, C; Cirilli, M; Costantini, F; Fantechi, R; Giudici, Sergio; Mannelli, I; Pierazzini, G M; Sozzi, M; Chèze, J B; Cogan, J; De Beer, M; Debu, P; Formica, A; Granier de Cassagnac, R; Mazzucato, E; Peyaud, B; Turlay, René; Vallage, B; Holder, M; Maier, A; Ziolkowski, M; Arcidiacono, R; Biino, C; Cartiglia, N; Guida, R; Marchetto, F; Menichetti, E; Pastrone, N; Nassalski, J P; Rondio, Ewa; Szleper, M; Wislicki, W; Wronka, S; Dibon, Heinz; Fischer, G; Jeitler, Manfred; Markytan, Manfred; Mikulec, I; Neuhofer, Günther; Pernicka, Manfred; Taurok, Anton; Widhalm, L



Formation of $??$ atoms in $K_{?4} decay  

E-Print Network (OSTI)

We derive the decay rate of $\\pi\\mu$ atom formation in $K_{\\mu 4}$ decay. Using the obtained expressions we calculate the decay rate of atom formation and point out that considered decay can give a noticeable contribution as a background to the fundamental decay $K^+\\to \\pi^+\

S. R. Gevorkyan; A. V. Tarasov; O. O. Voskresenskaya



Targeted alpha therapy for cancer  

Science Journals Connector (OSTI)

Targeted alpha therapy (TAT) offers the potential to inhibit the growth of micrometastases by selectively killing isolated and preangiogenic clusters of cancer cells. The practicality and efficacy of TAT is tested by in vitro and in vivo studies in melanoma, leukaemia, colorectal, breast and prostate cancers, and by a phase 1 trial of intralesional TAT for melanoma. The alpha-emitting radioisotope used is Bi-213, which is eluted from the Ac-225 generator and chelated to a cancer specific monoclonal antibody (mab) or protein (e.g. plasminogen activator inhibitor-2 PAI2) to form the alpha-conjugate (AC). Stable alpha-ACs have been produced which have been tested for specificity and cytotoxicity in vitro against melanoma (9.2.27 mab), leukaemia (WM60), colorectal (C30.6), breast (PAI2, herceptin), ovarian (PAI2, herceptin, C595), prostate (PAI2, J591) and pancreatic (PAI2, C595) cancers. Subcutaneous inoculation of 1–1.5 million human cancer cells into the flanks of nude mice causes tumours to grow in all mice. Tumour growth is compared for untreated controls, nonspecific AC and specific AC, for local (subcutaneous) and systemic (tail vein or intraperitoneal) injection models. The 213Bi-9.2.27 AC is injected into secondary skin melanomas in stage 4 patients in a dose escalation study to determine the effective tolerance dose, and to measure kinematics to obtain the equivalent dose to organs. In vitro studies show that TAT is one to two orders of magnitude more cytotoxic to targeted cells than non-specific ACs, specific beta emitting conjugates or free isotopes. In vivo local TAT at 2 days post-inoculation completely prevents tumour formation for all cancers tested so far. Intra-lesional TAT can completely regress advanced sc melanoma but is less successful for breast and prostate cancers. Systemic TAT inhibits the growth of sc melanoma xenografts and gives almost complete control of breast and prostate cancer tumour growth. Intralesional doses up to 450 µCi in human patients are effective in regressing melanomas, with no concomitant complications. These results point to the application of local and systemic TAT in the management of secondary cancer. Results of the phase 1 clinical trial of TAT of subcutaneous, secondary melanoma indicate proof of the principle that TAT can make tumours in patients regress.

Barry J Allen; Chand Raja; Syed Rizvi; Yong Li; Wendy Tsui; David Zhang; Emma Song; Chang Fa Qu; John Kearsley; Peter Graham; John Thompson



Decay of Ar41  

Science Journals Connector (OSTI)

A weak gamma ray has been found in the decay of Ar41 to K41. The energy of the gamma ray is 1.664±0.007 MeV; and its intensity, relative to that of the strong 1.293-MeV gamma ray, is (5±2)×10-4. It is concluded from the results of conincidence measurements that this gamma ray is the result of a beta-ray branch from Ar41 leading to an excited state in K41 at 1.664 MeV. The associated logft value is found to be 7.7±0.3. The spin and parity of the 1.664-MeV state in K41 are most probably 52+ or 72+.

William W. Pratt



Local Varying-Alpha Theories  

E-Print Network (OSTI)

In a recent paper we demonstrated how the simplest model for varying alpha may be interpreted as the effect of a dielectric material, generalized to be consistent with Lorentz invariance. Unlike normal dielectrics, such a medium cannot change the speed of light, and its dynamics obey a Klein-Gordon equation. This work immediately suggests an extension of the standard theory, even if we require compliance with Lorentz invariance. Instead of a wave equation, the dynamics may satisfy a local algebraic relation involving the permittivity and the properties of the electromagnetic field, in analogy with more conventional dielectric (but still preserving Lorentz invariance). We develop the formalism for such theories and investigate some phenomenological implications. The problem of the divergence of the classical self-energy can be solved, or at least softened, in this framework. Some interesting new cosmological solutions for the very early universe are found, including the possibility of a bounce, inflation and expansion with a loitering phase, all of which are induced by early variations in alpha.

John D. Barrow; Joao Magueijo



Radiative Decay of the Muon  

Science Journals Connector (OSTI)

The radiative decay of the muon, ?+?e++?+?e+?¯?, has been measured using muons from the Columbia University Nevis synchrocyclotron. The decay products e+ and ? were observed at relative angles near 180°, using scintillation counters and two 9-in.×10-in. NaI crystals, which enabled simultaneous measurement of the positron and ? energies. The pulses from the crystals were displayed on oscilloscopes and photographed, and the measured amplitudes of these pulses were calibrated using the positron spectrum of the nonradiative decay. The two-dimensional energy spectrum for positrons and ?'s was obtained for about 900 events, after subtraction of background. This spectrum and the measured rate, obtained by normalizing to the nonradiative decay, were compared with theoretical predictions for the radiative decay. The results were in good agreement with the theory, within statistics, for the case of pure V-A coupling.

E. Bogart; E. DiCapua; P. Némethy; A. Strelzoff



Beta/alpha continuous air monitor  

DOE Patents (OSTI)

A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinquishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts. 7 figs.

Becker, G.K.; Martz, D.E.



Search for neutrinoless decays of the ? lepton  

E-Print Network (OSTI)

We have searched for neutrinoless ? decays into three charged particles. Evidence of such decays would demonstrate nonconservation of lepton flavor and, in some cases, lepton number. We see no signal for any such neutrinoless ? decays and set upper...

Baringer, Philip S.




Energy Science and Technology Software Center (OSTI)

002913MLTPL00 Sandia Higher Order Elements (SHOE) v 0.5 alpha  http://midas3.kitware.com/midas/folder/10328 


Alpha Technologies | Open Energy Information  

Open Energy Info (EERE)

Technologies Technologies Jump to: navigation, search Name Alpha Technologies Place Bellingham, Washington State Zip 98226 Sector Services, Solar Product Bellingham (WA)-based firm offering, among other products, power conversion products designed specifically for the PV market, plus installation services for solar systems. Coordinates 48.75235°, -122.471219° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.75235,"lon":-122.471219,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Vus and neutron beta decay  

E-Print Network (OSTI)

We discuss the effect of the recent change of $V_{\\rm us}$ by three standard deviations on the standard model predictions for neutron beta decay observables. We also discuss the effect the experimental error bars of $V_{\\rm us}$ have on such predictions. Refined precision tests of the standard model will be made by a combined effort to improve measurements in neutron beta decay and in strangeness-changing decays. By itself the former will yield very precise measurements of $V_{\\rm ud}$ and make also very precise predictions for $V_{\\rm us}$.

A. Garcia; G. Sanchez-Colon



Derr Track Storage Bldg Sigma Alpha  

E-Print Network (OSTI)

!( Derr Track Storage Bldg Japan Center Memorial Bell Tower Solar House Primrose Chancellor & Storage Bio. Sci Avent Ferry Complex Building Sigma Phi Epsilon 7 Welch Pi Kappa Alpha 10 Sigma Alpha Mu 4 and Visitor's Center Thompson Admin II Bostian Library Storage Facility Winston Clark Ricks Robertson Harris

Reeves, Douglas S.


Elementary Processes Underlying Alpha Channeling in Tokamaks  

SciTech Connect

Alpha channeling in tokamaks is speculative, but also extraordinarily attractive. Waves that can accomplish this effect have been identified. Key aspects of the theory now enjoy experimental confirmation. This paper will review the elementary processes of wave-particle interactions in plasma that underlie the alpha channeling effect

NM.J. Fisch



Alpha Renewable Energy | Open Energy Information  

Open Energy Info (EERE)

Renewable Energy Renewable Energy Jump to: navigation, search Name Alpha Renewable Energy Place Atlanta, Georgia Sector Biomass Product Manufacturer of biomass wood gas stoves and standalone power generators for rural areas. References Alpha Renewable Energy[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Alpha Renewable Energy is a company located in Atlanta, Georgia . References ↑ "Alpha Renewable Energy" Retrieved from "http://en.openei.org/w/index.php?title=Alpha_Renewable_Energy&oldid=342033" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties


Computer code for double beta decay QRPA based calculations  

E-Print Network (OSTI)

. The Enriched Xenon Observatory for neutrinoless double beta decay (EXO) will search for the rare decays

Bertulani, Carlos A. - Department of Physics and Astronomy, Texas A&M University


CP violation in sbottom decays  

E-Print Network (OSTI)

We study CP asymmetries in two-body decays of bottom squarks into charginos and tops. These asymmetries probe the SUSY CP phases of the sbottom and the chargino sector in the Minimal Supersymmetric Standard Model. We identify the MSSM parameter space where the CP asymmetries are sizeable, and analyze the feasibility of their observation at the LHC. As a result, potentially detectable CP asymmetries in sbottom decays are found, which motivates further detailed experimental studies for probing the SUSY CP phases.

Frank F. Deppisch; Olaf Kittel



Neutrinoless Double Beta-Decay  

E-Print Network (OSTI)

The neutrinoless double $\\beta$-decay of nuclei is reviewed. We discuss neutrino mixing and 3x3 PMNS neutrino mixing matrix. Basic theory of neutrinoless double $\\beta$-decay is presented in some details. Results of different calculations of nuclear matrix element are discussed. Experimental situation is considered. The Appendix is dedicated to E. Majorana (brief biography and his paper in which the theory of Majorana particles is given)

S. M. Bilenky




E-Print Network (OSTI)

number violation in nature and what is its magnitude. The neutrinoless double beta decay experiment can

U. Sarkar; Utpal Sarkar


Bacterial Alpha Amylase Paper Disc Tests on Starch Agar  

Science Journals Connector (OSTI)

...Articles Bacterial Alpha Amylase Paper Disc Tests on Starch Agar Egon Stark Ralph...Mass. Bacterial Alpha Amylase Paper Disc Tests on Starch Agar EGON STARK...hydrolysis of soluble starch by a bacterial alpha-amylase preparation, so...

Egon Stark; Ralph Wellerson Jr.; Philip A. Tetrault; Carl F. Kossack



Constraining Majorana CP Phase in Precision Era of Cosmology and Double Beta Decay Experiment  

E-Print Network (OSTI)

We show that precision measurement of (1) sum of neutrino masses by cosmological observation and (2) lifetime of neutrinoless double beta decay in ton-scale experiments, with supplementary use of (3) effective mass measured in single beta decay experiment, would allow us to obtain information on the Majorana phase of neutrinos. To quantify the sensitivity to the phase we use, in addition to the conventional allowed region plots, the CP exclusion fraction, a fraction of the CP phase parameter space that can be excluded for a given set of assumed input parameters, a global measure for CP violation. We illustrate the sensitivity under varying assumptions, from modest to optimistic ones, on experimental errors and theoretical uncertainty of nuclear matrix elements. We find that in the latter case one of the two Majorana phases (denoted as alpha_{21} can be constrained rather strongly by excluding \\simeq 10-50% of the phase space at 3 sigma CL for the lowest neutrino mass of 0.1 eV. The characteristic features of the sensitivity to alpha_{21}, such as dependences on the other phase alpha_{31} and on the true values of alpha_{21}, are addressed. We also raise the question of whether the uncertainties of nuclear matrix elements could be constrained by consistency of such measurement.

Hisakazu Minakata; Hiroshi Nunokawa; Alexander A. Quiroga


Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Experimental charmonium decay results from BES  

E-Print Network (OSTI)

Based on 14 million psi(2S) and 58 million J/psi events collected by the BESII detector, the leptonic decay of psi(2S) into $\\tau^+\\tau^-$, psi(2S) multi-body decays, chi_cJ decays, and J/psi hadronic decays are studied, and the branching fractions of these decays are reported. These results may shed light on the understanding of QCD.

Ping Rong-Gang; F. A. Harris; for BES collaboration



CRAD, Safety Basis - Oak Ridge National Laboratory TRU ALPHA...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Safety Basis - Oak Ridge National Laboratory TRU ALPHA LLWT Project CRAD, Safety Basis - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of Appendix C...


CRAD, Quality Assurance - Oak Ridge National Laboratory TRU ALPHA...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT Project CRAD, Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of...


CRAD, Management - Oak Ridge National Laboratory TRU ALPHA LLWT...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Management - Oak Ridge National Laboratory TRU ALPHA LLWT Project CRAD, Management - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of Appendix C to...


E-Print Network 3.0 - alpha-gamma decay studies Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

i in? Your unit is determined by your program of ... Source: Collection: Engineering 8 Advisor: Clay Torset Contact Email: clay.torset@oregonstate.edu Summary: in a national...


E-Print Network 3.0 - alpha decay radioisotopes Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Collection: Engineering ; Materials Science 4 Darwinian Definition of Life Self-sustaining and reproducing Summary: (cosmic rays) Transcription errors 12;Particulate...


New Phase-Transfer Decay Mechanism for Persistent Currents in He-3-Alpha  

E-Print Network (OSTI)

. The corresponding entities have been known as a vortex line and a vortex ring, respectively, and the process as vortex flow (or flux-flow in the supercon- ductivity literature). %e are now ready to show that a generalization of the above analysis can apply to 3... the same way that vortex flow takes place in a one- phase superfluid. Again the curve y must either end on the surface of the channel, or form a closed loop. It is not difficult to see that the line case is related, but not identical, to the coreless...

Hu, Chia-Ren.



Extension of Alpha- and Beta-Decay Systematics of Protactinium Isotopes  

E-Print Network (OSTI)

W„ Wayne Meinke and Glenn T. Seaborg January 30, 1950W. Wayne Ifeinke and Glenn T. Seaborg Radiation Laboratory

Meinke, W. Wayne; Seaborg, Glenn T.



Nuclear diagnostic for fast alpha particles  

DOE Patents (OSTI)

This invention relates generally to high energy confined plasmas and more particularly is directed to measuring the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a confined energetic plasma.

Grisham, L.R.; Post, D.E. Jr.; Dawson, J.M.



Thermodynamics of decaying vacuum cosmologies  

Science Journals Connector (OSTI)

The thermodynamic behavior of decaying vacuum cosmologies is investigated within a manifestly covariant formulation. Such a process corresponds to a continuous, irreversible energy flow from the vacuum component to the created matter constituents. It is shown that if the specific entropy per particle remains constant during the process, the equilibrium relations are preserved. In particular, if the vacuum decays into photons, the energy density ? and average number density of photons n scale with the temperature as ??T4 and n?T3. The temperature law is determined and a generalized Planckian-type form of the spectrum, which is preserved in the course of the evolution, is also proposed. Some consequences of these results for decaying vacuum FRW-type cosmologies as well as for models with "adiabatic" photon creation are discussed.

J. A. S. Lima



Current Algebras and Meson Decays  

Science Journals Connector (OSTI)

By using quark-algebra equal-time commutation relations and a smooth pole-dominated form for the vector-vector-axial-vector vertex in the high-energy limit, one can describe the radiative decays of the vector mesons and the ??3? decay in excellent agreement with experimental data. It is shown, however, that if we exploit all equations this procedure gives, we get into contradictions. By introducing a non-smooth amplitude, the contradictions can be eliminated in such a way that the good predictions of the smooth case remain unaltered. The various aspects of the results are discussed.

Tibor Nagy



Interference Effects in Leptonic Decays  

Science Journals Connector (OSTI)

It is proven that in any leptonic decay experiment in which the lepton masses and charges may be neglected, and in which no pseudoscalar correlations are measured, all V·A interference terms will be antisymmetric under exchange of the two leptons, while the pure V and A terms will be symmetric. If the experiment measures a pseudoscalar correlation, these conclusions are reversed. Even if the lepton masses cannot be ignored (e.g., for ?0??-+?¯+p, or low-energy ? decay) it is still true that no V·A interference may appear when scalars are measured, and only V·A interference may contribute when pseudoscalars are measured, providing that the lepton spins and momenta are not directly observed. Thus experiments can be devised that involve no interference effects, or only interference effects. This theorem holds independently of the strangeness change, spin change, energy transfer, or of any particular assumptions about the form of the V and A currents. It proves most useful when it is difficult or tedious to calculate transition rates directly. Applications are discussed, including possible tests of the Feynman-Gell-Mann theory in nonunique forbidden ? decay, of the nature of the leptonic ?0 and K0 decay interaction, and of the charge symmetry properties of weak interactions.

Steven Weinberg



?-Meson Decay into Three Electrons  

Science Journals Connector (OSTI)

The decay ?-?e-+e-+e+ via internal conversion is computed using a phenomenological matrix element for the ?e? interaction. The result is compared with present experimental limits for this process and the results concerning the form factors in the matrix element are discussed. The energy distribution of the emitted electrons is also computed.

M. Bander and G. Feinberg



Beta decay of Ga-62  

E-Print Network (OSTI)

We report a study of the beta decay of Ga-62, whose dominant branch is a superallowed 0(+)-->0(+) transition to the ground state of Zn-62. We find the total half-life to be 115.84+/-0.25 ms. This is the first time that the Ga-62 half-life has been...

Hyman, BC; Iacob, VE; Azhari, A.; Gagliardi, Carl A.; Hardy, John C.; Mayes, VE; Neilson, RG; Sanchez-Vega, M.; Tang, X.; Trache, L.; Tribble, Robert E.



Alpha Channeling in Rotating Plasma with Stationary Waves  

SciTech Connect

An extension of the alpha channeling effect to supersonically rotating mirrors shows that the rotation itself can be driven using alpha particle energy. Alpha channeling uses radiofrequency waves to remove alpha particles collisionlessly at low energy. We show that stationary magnetic fields with high n? can be used for this purpose, and simulations show that a large fraction of the alpha energy can be converted to rotation energy.

A. Fetterman and N.J. Fisch



Bragg scattering measurement of atmospheric plasma decay  

Science Journals Connector (OSTI)

The decay processes of the plasma layers generated by two intersecting microwave pulses in 1 torr dry air are investigated by Bragg scattering method. The results of measurement show that the electrons decay i...

Y. S. Zhang; S. P. Kuo



Causes and Control of Wood Decay,  

E-Print Network (OSTI)

1 Causes and Control of Wood Decay, Degradation & Stain #12;2 Contents Moisture .................................................................................3 Wood Degradation: Causes and Control..............................4 Weathering......................................................................................................4 Naturally Decay-resistant Species...........................................................5 Wood



E-Print Network (OSTI)

subsequently published arguments, non-observation of neutrinoless double beta decay has, to date, no bearing on

Clemens A. Heusch; Peter Minkowski



Neutrinoless Double Beta Decay and CP Violation  

E-Print Network (OSTI)

neutrinoless double beta decay in the case of two neutrino generations (or when the third generation leptons do

Patrick J. O’donnell; Utpal Sarkar



Decays of near BPS heterotic strings  

Science Journals Connector (OSTI)

The decay of highly excited massive string states in compactified heterotic string theories is discussed. We calculate the decay rate and spectrum of states carrying momentum and winding in the compactified direction. The longest lived states in the spectrum are near Bogomol’nyi-Prasad-Sommerfield (BPS) states whose decay is dominated by a single decay channel of massless radiation which brings the state closer to being BPS.

Michael Gutperle and Darya Krym


Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Imperfect World of $??$-decay Nuclear Data Sets  

E-Print Network (OSTI)

The precision of double-beta ($\\beta\\beta$) decay experimental half lives and their uncertainties is reanalyzed. The method of Benford's distributions has been applied to nuclear reaction, structure and decay data sets. First-digit distribution trend for $\\beta\\beta$-decay T$_{1/2}^{2\

B. Pritychenko



Double beta decay: experiments and theory review  

E-Print Network (OSTI)

Neutrinoless double beta decay is one of the most powerful tools to set the neutrino mass absolute scale and establish whether the neutrino is a Majorana particle. After a summary of the neutrinoless double beta decay phenomenology, the present status of the experimental search for this rare decay is reported and the prospects for next generation experiments are reviewed.

A. Nucciotti



The Energy Cascade from Warm Dark Matter Decays  

E-Print Network (OSTI)

We use a set of Monte Carlo simulations to follow the cascade produced by a primary electron of energy E_in in the intergalactic medium. We choose E_in=3-10 keV as expected from the decay of one of the most popular Warm Dark Matter (WDM) candidates, sterile neutrinos. Our simulation takes into account processes previously neglected such as free-free interactions with ions and recombinations and uses the best available cross sections for collisional ionizations and excitations with H and He and for electron-electron collisions. We precisely derive the fraction of the primary electron energy that heats the gas, ionizes atoms and produces line and continuum photons as a function of the ionization fraction. Handy fitting formulae for all the above energy depositions are provided. By keeping track of the individual photons we can distinguish between photons in the Ly-alpha resonance and those with energy E gas. This separation is important because a Ly-alpha background can heat or cool the gas depending on the nature of the photons, and can have effects on the 21 cm radiation emitted by neutral H, which will probably become detectable at z > 6 in the near future by the next generation radio interferometers.

M. Valdés; A. Ferrara



A First Look at Tree Decay An Introduction to How Injury and Decay Affect Trees  

E-Print Network (OSTI)

A First Look at Tree Decay An Introduction to How Injury and Decay Affect Trees by Kevin T. Smith Look at Tree Decay Photosynthesis and decay are the two most essential processes in nature. Photosynthesis by green plants captures and stores energy from the sun. This energy is used to form wood


AlphaWatt Ltd | Open Energy Information  

Open Energy Info (EERE)

AlphaWatt Ltd AlphaWatt Ltd Jump to: navigation, search Name AlphaWatt Ltd Place London, United Kingdom Zip EC1V 4PY Sector Solar Product Solar project developer, plans to become an independent power provider. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Energy production in varying {\\alpha} theories  

E-Print Network (OSTI)

Aims. On the basis the theoretical model proposed by Bekenstein for {\\alpha}'s variation, we analyze the equations that describe the energy exchange between matter and both the electromagnetic and the scalar fields. Methods. We determine how the energy flow of the material is modified by the presence of a scalar field. We estimate the total magnetic energy of matter from the "sum rules techniques". We compare the results with data obtained from the thermal evolution of the Earth and other planets. Results. We obtain stringent upper limits to the variations in {\\alpha} that are comparable with those obtained from atomic clock frequency variations. Conclusions. Our constraints imply that the fundamental length scale of Bekenstein's theory "lB" cannot be larger than Planck's length "lP".

Kraiselburd, Lucila; Sisterna, Pablo; Vucetich, Héctor; 10.1051/0004-6361/201015970



Neganov-Luke amplified cryogenic light detectors for the background discrimination in neutrinoless double beta decay search with TeO$_{2}$ bolometers  

E-Print Network (OSTI)

We demonstrate that Neganov-Luke amplified cryogenic light detectors with Transition Edge Sensor read-out can be applied for the background suppression in cryogenic experiments searching for the neutrinoless double beta decay of $^{130}\\text{Te}$ with TeO$_{2}$ based bolometers. Electron and gamma induced events can be discriminated from $\\alpha$ events by detecting the Cherenkov light produced by the $\\beta$ particles emitted in the decay. We use the Cherenkov light produced by events in the full energy peak of $^{208}\\text{Tl}$ and by events from a $^{147}\\text{Sm}$ source to show that at the Q-value of the neutrinoless double beta decay of $^{130}\\text{Te}$ ($Q_{\\beta \\beta} = 2.53 \\,\\text{MeV}$), a separation of $e^{-}/\\gamma$ events from $\\alpha$ events can be achieved on an event-by-event basis with practically no reduction in signal acceptance.

M. Willers; F. v. Feilitzsch; A. Giuliani; A. Gütlein; A. Münster; J. -C. Lanfranchi; L. Oberauer; W. Potzel; S. Roth; S. Schönert; M. v. Sivers; S. Wawoczny; A. Zöller



Radiological hazards of alpha-contaminated waste  

SciTech Connect

The radiological hazards of alpha-contaminated wastes are discussed in this overview in terms of two components of hazard: radiobiological hazard, and radioecological hazard. Radiobiological hazard refers to human uptake of alpha-emitters by inhalation and ingestion, and the resultant dose to critical organs of the body. Radioecological hazard refers to the processes of release from buried wastes, transport in the environment, and translocation to man through the food chain. Besides detailing the sources and magnitude of hazards, this brief review identifies the uncertainties in their estimation, and implications for the regulatory process.

Rodgers, J.C.



Bioprospecting metagenomics of decaying wood: mining for new glycoside hydrolases  

SciTech Connect

To efficiently deconstruct recalcitrant plant biomass to fermentable sugars in industrial processes, biocatalysts of higher performance and lower cost are required. The genetic diversity found in the metagenomes of natural microbial biomass decay communities may harbor such enzymes. Our goal was to discover and characterize new glycoside hydrolases (GHases) from microbial biomass decay communities, especially those from unknown or never previously cultivated microorganisms. From the metagenome sequences of an anaerobic microbial community actively decaying poplar biomass, we identified approximately 4,000 GHase homologs. Based on homology to GHase families/activities of interest and the quality of the sequences, candidates were selected for full-length cloning and subsequent expression. As an alternative strategy, a metagenome expression library was constructed and screened for GHase activities. These combined efforts resulted in the cloning of four novel GHases that could be successfully expressed in Escherichia coli. Further characterization showed that two enzymes showed significant activity on p-nitrophenyl-{alpha}-L-arabinofuranoside, one enzyme had significant activity against p-nitrophenyl-{beta}-D-glucopyranoside, and one enzyme showed significant activity against p-nitrophenyl-{beta}-D-xylopyranoside. Enzymes were also tested in the presence of ionic liquids. Metagenomics provides a good resource for mining novel biomass degrading enzymes and for screening of cellulolytic enzyme activities. The four GHases that were cloned may have potential application for deconstruction of biomass pretreated with ionic liquids, as they remain active in the presence of up to 20% ionic liquid (except for 1-ethyl-3-methylimidazolium diethyl phosphate). Alternatively, ionic liquids might be used to immobilize or stabilize these enzymes for minimal solvent processing of biomass.

Li L. L.; van der Lelie D.; Taghavi, S.; McCorkle, S. M.; Zhang, Y.-B.; Blewitt, M. G.; Brunecky, R.; Adney, W. S.; Himmel, M. E.; Brumm, P.; Drinkwater, C.; Mead, D. A.; Tringe, S. G.




SciTech Connect

We report our multi-band infrared (IR) imaging of the transitional millisecond pulsar system J1023+0038, a rare pulsar binary known to have an accretion disk in 2000-2001. The observations were carried out with ground-based and space telescopes from near-IR to far-IR wavelengths. We detected the source in near-IR JH bands and Spitzer 3.6 and 4.5 {mu}m mid-IR channels. Combined with the previously reported optical spectrum of the source, the IR emission is found to arise from the companion star, with no excess emission detected in the wavelength range. Because our near-IR fluxes are nearly equal to those obtained by the 2MASS all-sky survey in 2000 February, the result indicates that the binary did not contain the accretion disk at the time, whose existence would have raised the near-IR fluxes to twice larger values. Our observations have thus established the short-term nature of the interacting phase seen in 2000-2001: the accretion disk existed for at most 2.5 yr. The binary was not detected by the WISE all-sky survey carried out in 2010 at its 12 and 22 {mu}m bands and our Herschel far-IR imaging at 70 and 160 {mu}m. Depending on the assumed properties of the dust, the resulting flux upper limits provide a constraint of <3 Multiplication-Sign 10{sup 22}-3 Multiplication-Sign 10{sup 25} g on the mass of the dust grains that possibly exist as the remnants of the previously seen accretion disk.

Wang, Xuebing; Wang, Zhongxiang [Key Laboratory for Research in Galaxies and Cosmology, Shanghai Astronomical Observatory, Chinese Academy of Sciences, 80 Nandan Road, Shanghai 200030 (China)] [Key Laboratory for Research in Galaxies and Cosmology, Shanghai Astronomical Observatory, Chinese Academy of Sciences, 80 Nandan Road, Shanghai 200030 (China); Morrell, Nidia [Las Campanas Observatory, Observatories of the Carnegie Institution of Washington, La Serena (Chile)] [Las Campanas Observatory, Observatories of the Carnegie Institution of Washington, La Serena (Chile)



Search for the second forbidden beta decay of 8B to the ground state of 8Be  

E-Print Network (OSTI)

A significant decay branch of 8B to the ground state of 8Be would extend the solar neutrino spectrum to higher energies than anticipated in the standard solar models. These high-energy neutrinos would affect current neutrino oscillation results and also would be a background to measurements of the hep process. We have measured the delayed alpha particles from the decay of 8B, with the goal of observing the two 46-keV alpha particles arising from the ground-state decay. The 8B was produced using an in-flight radioactive beam technique. It was implanted in a silicon PIN-diode detector that was capable of identifying the alpha-particles from the 8Be ground state. From this measurement we find an upper limit (at 90% confidence level) of 7.3 x 10^{-5} for the branching ratio to the ground state. In addition to describing this measurement, we present a theoretical calculation for this branching ratio.

M. K. Bacrania; N. M. Boyd; R. G. H. Robertson; D. W. Storm



Production of alpha-amylase by yeast  

SciTech Connect

The enzyme alpha-amylase confers to an organism the enzymatic activity for the degradation of polyglucosides with alpha-1,4 glycosidic bonds such as starch and glycogen which are among the major storage compounds in plants and animals. Most alpha-amylases are single polypeptides of molecular weights around 50,000 dalton. They are generally found in the digestive tract of animals and in germinating seeds. Among the products released upon enzymatic degradation of polyglucosides maltose, a sugar that can be utilized as carbon source by yeast, is a major constituent. A cDNA segment complementary to mouse salivary amylase messenger RNA has been inserted into the yeast expression vector pMA56 behind the promoter of the gene encoding alcohol dehydrogenase I of yeast. Yeast transformants harboring plasmids with the normal orientation of the promoter and the mouse amylase cDNA gene produce amylase and release the enzyme in free form into the culture medium. Approximately 90% of the amylase activity is found in the medium. Yeast strains carrying MAL allele and transformed with a plasmid which directed the synthesis of mouse alpha-amylase were tested on plates containing starch and in batch fermentations using different high molecular weight sugars and oligosaccharides as carbon source. The results of these experiments will be discussed. (Refs. 21).

Thomse, K.K.



The SimCore/Alpha Functional Simulator  

Science Journals Connector (OSTI)

We have developed a function-level processor simulator, SimCore/Alpha Functional Simulator Version 2.0 (SimCore Version 2.0), for processor architecture research and processor education. This paper describes the design and implementation of SimCore Version ...

Kenji Kise; Takahiro Katagiri; Hiroki Honda; Toshitsugu Yuba



H-alpha observations of zeta Tauri  

E-Print Network (OSTI)

We report H-alpha observations of zeta Tauri, taken between late 2000 and early 2006. Next to extending existing long-term montioring of the disk state of this star we report an intermediate timescale of about 69 days to be present in the V/R variations of the Halpha line. The observational data will be published together with this manuscript.

E. Pollmann; Th. Rivinius



Performance of ZnMoO4 crystal as cryogenic scintillating bolometer to search for double beta decay of molybdenum  

E-Print Network (OSTI)

Zinc molybdate (ZnMoO4) single crystals were grown for the first time by the Czochralski method and their luminescence was measured under X ray excitation in the temperature range 85-400 K. Properties of ZnMoO4 crystal as cryogenic low temperature scintillator were checked for the first time. Radioactive contamination of the ZnMoO4 crystal was estimated as <0.3 mBq/kg (228-Th) and 8 mBq/kg (226-Ra). Thanks to the simultaneous measurement of the scintillation light and the phonon signal, the alpha particles can be discriminated from the gamma/beta interactions, making this compound extremely promising for the search of neutrinoless Double Beta Decay of 100-Mo. We also report on the ability to discriminate the alpha-induced background without the light measurement, thanks to a different shape of the thermal signal that characterizes gamma/beta and alpha particle interactions.

L. Gironi; C. Arnaboldi; J. W. Beeman; O. Cremonesi; F. A. Danevich; V. Ya. Degoda; L. I. Ivleva; L. L. Nagornaya; M. Pavan; G. Pessina; S. Pirro; V. I. Tretyak; I. A. Tupitsyna



E-Print Network 3.0 - alpha hnf-3alpha negatively Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Manchester Collection: Biology and Medicine 4 VANDERBILT UNIVERSITY OFFICE OF CAMPUS RECREATION Summary: 1 Alpha Delta Pi III 2 Ankurage I II 3 Don't Haze Me Bro 2 II I 4 Gram...


E-Print Network 3.0 - alpha cap alpha Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Pi Greek Woman of the Year Ann... Marie Frappier - Rho Gamma Greek Man of the Year Jordan Fischette - Alpha Tau Omega Greek Professor... of the Year Carl Braunlich Philanthropy...


E-Print Network 3.0 - alpha-1-antitrypsin augmentation therapy...  

NLE Websites -- All DOE Office Websites (Extended Search)

Alpha-1-Antitrypsin Alpha-Hydroxybutyrate Dehydrogenase (aHBDH) ALTSGPT Amylase Amylase (Alpha) Amylase Source: Rodriguez, Carlos - Department of Mathematics and Statistics, State...


E-Print Network 3.0 - alpha-1 antitrypsin deficiency Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Alpha-1-Antitrypsin Alpha-Hydroxybutyrate Dehydrogenase (aHBDH) ALTSGPT Amylase Amylase (Alpha) Amylase Source: Rodriguez, Carlos - Department of Mathematics and Statistics, State...


E-Print Network 3.0 - alpha chi sigma Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Alpha: 2515 Leon Street KS...Kappa Sigma: 1002 West 26th Street LCA...Lambda Chi Alpha... ACW...Alpha Chi Omega: 2420 Nueces Street ADP...

Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


E-Print Network 3.0 - alpha-radiation construction calibration...  

NLE Websites -- All DOE Office Websites (Extended Search)

Alpha Radiation - An alpha particle is identical... of only an inch or so. Naturally occurring radioactive elements such as radon emit alpha radiation... to Construct PE Plant...


The splitted laser beam filamentation in interaction of laser and an exponential decay inhomogeneous underdense plasma  

SciTech Connect

The splitted beam filamentation in interaction of laser and an exponential decay inhomogeneous underdense plasma is investigated. Based on Wentzel-Kramers-Brillouin (WKB) approximation and paraxial/nonparaxial ray theory, simulation results show that the steady beam width and single beam filamentation along the propagation distance in paraxial case is due to the influence of ponderomotive nonlinearity. In nonparaxial case, the influence of the off-axial of {alpha}{sub 00} and {alpha}{sub 02} (the departure of the beam from the Gaussian nature) and S{sub 02} (the departure from the spherical nature) results in more complicated ponderomotive nonlinearity and changing of the channel density and refractive index, which led to the formation of two/three splitted beam filamentation and the self-distortion of beam width. In addition, influence of several parameters on two/three splitted beam filamentation is discussed.

Xia Xiongping; Yi Lin [Department of Physics, Huazhong University of Science and Technology, Wuhan 430074 (China); Xu Bin [Department of Mathematics and Information Sciences, North China Institute of Water Conservancy and Hydroelectric Power, Zhengzhou 450011 (China); Lu Jianduo [Department of Physics, Huazhong University of Science and Technology, Wuhan 430074 (China); Hubei Province Key Laboratory of Systems Science in Metallurgical Process, Wuhan University of Science and Technology, Wuhan 430081 (China)



CRAD, Training - Oak Ridge National Laboratory TRU ALPHA LLWT...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Training - Oak Ridge National Laboratory TRU ALPHA LLWT Project CRAD, Training - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of Appendix C to DOE G...


The effects of alpha particle irradiation on stainless steel  

E-Print Network (OSTI)

A Monte Carlo code was developed to calculate the alpha particle emission rate from WGPu. It yielded information pertaining to the alpha particle source strength at the WGPU and stainless steel interface as well as the damage production and He...

Shipp, John Douglas



Measurements of $\\psi$ 2S decays to octet baryon-antibaryon pairs  

E-Print Network (OSTI)

With a sample of 14 million psi(2S) events collected by the BESII detector at the Beijing Electron Positron Collider (BEPC), the decay channels psi(2S)->p p-bar, Lambda Lambda-bar, Sigma0 Sigma0-bar, Xi Xi-bar are measured, and their branching ratios are determined to be (3.36+-0.09+-0.24)*10E-4, (3.39+-0.20+-0.32)*10E-4, (2.35+-0.36+-0.32)*10E-4, (3.03+-0.40+-0.32)*10E-4, respectively. In the decay psi(2S)->p p-bar, the angular distribution parameter alpha is determined to be 0.82+-0.17+-0.04.

Ablikim, M; Bai, J Z; Ban, Y; Cai, X; Chen, H F; Chen, H S; Chen, H X; Chen, J C; Jin Chen; Chen, Y B; Chu, Y P; Dai, Y S; Diao, L Y; Deng, Z Y; Dong, Q F; Du, S X; Fang, J; Fanga, S S; Fu, C D; Gao, C S; Gao, Y N; Gu, S D; Gu, Y T; Guo, Y N; Guob, Z J; Harris, F A; He, K L; He, M; Heng, Y K; Hou, J; Hu, H M; Hu, J H; Hu, T; Huang, X T; Ji, X B; Jiang, X S; Jiang, X Y; Jiao, J B; Jin, D P; Jin, S; Lai, Y F; Lic, G; Li, H B; Li, J; Li, R Y; Li, S M; Li, W D; Li, W G; Li, X L; Li, X N; Li, X Q; Liang, Y F; Liao, H B; Liu, B J; Liu, C X; Liu, F; Fang Liu; Liu, H H; Liu, H M; Liud, J; Liu, J B; Liu, J P; Liu, J; Liu, Q; Liu, R G; Liu, Z A; Lou, Y C; Lu, F; Lu, G R; Lu, J G; Luo, C L; Ma, F C; Ma, H L; Mae, L L; Ma, Q M; Mao, Z P; Mo, X H; Nie, J; Olsen, S L; Ping, R G; Qi, N D; Qin, H; Qiu, J F; Ren, Z Y; Rong, G; Shan, L Y; Ruan, X D; Shang, L; Shen, C P; Shen, D L; Shen, X Y; Sheng, H Y; Sun, H S; Sun, S S; Sun, Y Z; Sun, Z J; Tang, X; Tong, G L; Varner, G S; Wangf, D Y; Wang, L; Wang, L L; Wang, L S; Wang, M; Wang, P; Wang, P L; Wang, Y F; Wang, Z; Wang, Z Y; Zheng, W; Wei, C L; Wei, D H; Wiedner, U; Weng, Y; Wu, N; Xia, X M; Xie, X X; Xu, G F; Xu, X P; Xu, Y; Yan, M L; Yang, H X; Yang, Y X; Ye, M H; Ye, Y X; Yu, G W; Yuan, C Z; Yuan, Y; Zang, S L; Zeng, Y; Zhang, B X; Zhang, B Y; Zhang, C C; Zhang, D H; Zhang, H Q; Zhang, H Y; Zhang, J W; Zhang, J Y; Zhang, S H; Zhang, X Y; Yiyun, Z; Zhang, Z X; Zhang, Z P; Zhao, D X; Zhao, J W; Zhao, M G; Zhao, P P; Zhao, W R; Zhaog, Z G; Zheng, H Q; Zheng, J P; Zheng, Z P; Zhou, L; Zhu, K J; Zhu, Q M; Zhu, Y C; Zhu, Y S; Zhu, Z A; Zhuang, B A; Zhuang, X A; Zou, B S; al, et



Z decay confronts nonstandard scenarios  

Science Journals Connector (OSTI)

We show that recent data from the CERN e+e- collider LEP on the Z line shape and decays give stringent new constraints on mixing of e and ? with exotics and Z-Z’ mixing. Even in nonstandard models, where both the visible and the invisible part of the Z width are modified, a fourth light neutrino is unlikely unless substantial mixings between neutrinos and exotics are allowed. If the gluino is detectable at the Fermilab Tevatron then the lighter-chargino mass is tightly constrained (>42 GeV).

Gautam Bhattacharyya; Amitava Raychaudhuri; Amitava Datta; S. N. Ganguli



Nonspectator contributions to inclusive charmless B decays  

Science Journals Connector (OSTI)

The light quarks inside B mesons are usually treated as spectators and do not affect the decay rates which are assumed to be purely due to b quark decays. In this paper we calculate the nonspectator contributions to inclusive charmless B decays due to the spectator effects. We find that the nonspectator contributions to the branching ratio for B0 are small (<2×10-4), but the contributions to ?S=0 and ?S=-1, B- decay branching ratios can be as large as -7.5×10-4 and 2×10-3, and can modify the main three-body spectator b decay branching ratios by 10% and 20%, respectively. These contributions may play an important role in rare charmless B decays.

Wu-Sheng Dai; Xiao-Gang He; Xue-Qian Li; Gang Zhao



Charged track multiplicity in B meson decay  

Science Journals Connector (OSTI)

We have used the CLEO II detector to study the multiplicity of charged particles in the decays of B mesons produced at the ?(4S) resonance. Using a sample of 1.5×106 B meson pairs, we find the mean inclusive charged particle multiplicity to be 10.71±0.02-0.15+0.21 for the decay of the pair. This corresponds to a mean multiplicity of 5.36±0.01-0.08+0.11 for a single B meson. Using the same data sample, we have also extracted the mean multiplicities in semileptonic and nonleptonic decays. We measure a mean of 7.82±0.05-0.19+0.21 charged particles per BB¯ decay when both mesons decay semileptonically. When neither B meson decays semileptonically, we measure a mean charged particle multiplicity of 11.62±0.04-0.18+0.24 per BB¯ pair.

G. Brandenburg et al. (CLEO Collaboration)



??? Decay Mode of Neutral K Mesons  

Science Journals Connector (OSTI)

The decay K??++?-+?, ??e++e- has been observed in the film of the UCRL 72-in. hydrogen bubble chamber exposed to a beam of 1325-MeV/c momentum negative pions. This event unambiguously fits only the decay mode K??+?+?, but because the K's life span is almost exactly one K10 lifetime it is impossible to say whether it is a direct ??? or inner bremsstrahlung accompanying normal K10?2? decay.

D. Stern



Direct CP violation in B decays  

E-Print Network (OSTI)

We review recent experimental results on direct CP violation. The hot topic is a measurement in charmless two-body decays of B0, B+. In connection to this the first analogous measurements in Bs0 and Lambda_b0 decays are now available. Furthermore first evidence for direct CP violation in B+ decays is obtained from Dalitz plot analyzes of the K+pi-pi+ final state at B-factories. The last group of discussed results probes the b -> c\\bar{c}d transition in attempt to resolve the discrepancy between Belle and BABAR experiments in CP violation in the B0 -> D+D- decays.

M. Kreps



Nuclear beta-decay measurements and |Vud|  

E-Print Network (OSTI)

Some recent work in nuclear beta decay related to the value of |Vud| is described along with some near-term goals for future measurements.

Dan Melconian



New limits for neutrinoless tau decays  

E-Print Network (OSTI)

double beta decays, neutrino oscillations, Z!l11l22 decays, and other rare pro- cesses. In particular, there are strict limits on muon neutrino- less decays: B(m!eg),4.9310211 and B(m!eee),2.4 310212 at 90% confidence level @18#. However, lepton num- ber... particles and on the new coupling constants. The most optimistic branching fraction predictions are at the level of about 1026. Constraints on lepton flavor violation come from studies of rare and forbidden K , p, and m decays, e-m conversions, neutrinoless...

Ammar, Raymond G.; Baringer, Philip S.; Bean, Alice; Besson, David Zeke; Coppage, Don; Darling, C.; Davis, Robin E. P.; Kotov, S.; Kravchenko, I.; Kwak, Nowhan; Zhou, L.



Review of double beta decay experiments  

E-Print Network (OSTI)

The brief review of current experiments on search and studying of double beta decay processes is done. Best present limits on $\\langle m_{\

A. S. Barabash



Spectroscopy of element 115 decay chains  

SciTech Connect

A high-resolution a, X-ray and -ray coincidence spectroscopy experiment was conducted at the GSI Helmholtzzentrum fu r Schwerionenforschung. Thirty correlated a-decay chains were detected following the fusion-evaporation reaction 48Ca + 243Am. The observations are consistent with previous assignments of similar decay chains to originate from element Z = 115. The data includes first candidates of fingerprinting the decay step Mt --> Bh with characteristic X rays. For the first time, precise spectroscopy allows the derivation of excitation schemes of isotopes along the decay chains starting with elements Z > 112. Comprehensive Monte-Carlo simulations accompany the data analysis. Nuclear structure models provide a first level interpretation.

Rudolph, Dirk [Lund University, Sweden; Forsberg, U. [Lund University, Sweden; Golubev, P. [Lund University, Sweden; Sarmiento, L. G. [Lund University, Sweden; Yakushev, A. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Andersson, L.-L. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Di Nitto, A. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Duehllmann, Ch. E. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Gates, J. M. [Lawrence Berkeley National Laboratory (LBNL); Gregorich, K. E. [Lawrence Berkeley National Laboratory (LBNL); Gross, Carl J [ORNL; Hessberger, F. P. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Herzberg, R.-D [University of Liverpool; Khuyagbaatar, J. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Kratz, J. V. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Rykaczewski, Krzysztof Piotr [ORNL; Schaedel, M. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Aberg, S. [Lund University, Sweden; Ackermann, D. [GSI-Hemholtzzentrum fur Schwerionenforschung, Darmstadt, Germany; Block, M. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Brand, H. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Carlsson, B. G. [Lund University, Sweden; Cox, D. [University of Liverpool; Derkx, X. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Eberhardt, K. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Even, J. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Fahlander, C. [Lund University, Sweden; Gerl, J. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Jaeger, E. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Kindler, B. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Krier, J. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Kojouharov, I. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Kurz, N. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Lommel, B. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Mistry, A. [University of Liverpool; Mokry, C. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Nitsche, H. [Lawrence Berkeley National Laboratory (LBNL); Omtvedt, J. P. [Paul Scherrer Institut, Villigen, Switzerland; Papadakis, P. [University of Liverpool; Ragnarsson, I. [Lund University, Sweden; Runke, J. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Schaffner, H. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Schausten, B. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Thoerle-Pospiech, P. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Torres, T. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Traut, T. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Trautmann, N. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Tuerler, A. [Paul Scherrer Institut, Villigen, Switzerland; Ward, A. [University of Liverpool; Ward, D. E. [Lund University, Sweden; Wiehl, N. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany



Phenomenology of charmless hadronic B decays  

E-Print Network (OSTI)

The decays of $B$ mesons to a pair of charmless pseudoscalar mesons ($PP$ decays) or to a vector and pseudoscalar meson ($VP$ decays) have been analyzed within the framework of flavor SU(3) symmetry and the Kobayashi-Maskawa mechanism of CP violation. Separate $PP$ and $VP$ fits proved to be successful in describing the experimental data (branching ratios, CP asymmetries and time-dependent parameters). Decay magnitudes and relative weak and strong phases have been extracted from the fits. Values of the weak phase $\\gamma$ were found to be consistent with the current indirect bounds from other analyses of CKM parameters.

Suprun, D A



Phenomenology of charmless hadronic B decays  

E-Print Network (OSTI)

The decays of $B$ mesons to a pair of charmless pseudoscalar mesons ($PP$ decays) or to a vector and pseudoscalar meson ($VP$ decays) have been analyzed within the framework of flavor SU(3) symmetry and the Kobayashi-Maskawa mechanism of CP violation. Separate $PP$ and $VP$ fits proved to be successful in describing the experimental data (branching ratios, CP asymmetries and time-dependent parameters). Decay magnitudes and relative weak and strong phases have been extracted from the fits. Values of the weak phase $\\gamma$ were found to be consistent with the current indirect bounds from other analyses of CKM parameters.

Denis A. Suprun



Review of double beta decay experiments  

E-Print Network (OSTI)

The brief review of current experiments on search and studying of double beta decay processes is done. Best present limits on $\\langle m_{\

Barabash, A S



Electrical Resistance of Alpha Hydrogen?Palladium  

Science Journals Connector (OSTI)

Electrical resistancemeasurements of gas?charged alpha hydrogen?palladium alloys have been made in the range 100° to 400°C. The fractional increase of palladiumresistance caused by addition of hydrogen is proportional to hydrogen concentration. The constant of proportionality is independent of temperature indicating that Matthiessen's rule is inapplicable to this system. When the results of this work are combined with those of previous authors all of the data can be adequately represented in the range 75° to 400°C by the equation (R/R 0) — 1 = (2.41±0.04) m where R is the resistance of alpha hydrogen?palladium R 0 is the resistance of hydrogen?free palladium and m is the hydrogen?to?palladium atom ratio.

W. T. Lindsay Jr.; F. W. Pement



Alternate Alpha Induced Reactions for NIF Radiochemistry  

SciTech Connect

Radiochemical analysis of NIF capsule residues has been identified as a potential diagnostic of NIF capsule performance. In particular, alpha-induced nuclear reactions that occur on tracer elements added to the NIF capsule have been shown through simulation to be a very sensitive diagnostic for mix. The short range of the alpha particles makes them representative of the hot spot where they are created through the fusion of deuterium and tritium. Reactions on elements doped into the innermost part of the capsule ablator would therefore be sensitive to material that had mixed into the hot spot. Radiochemical determinations of activated detector elements may perhaps be the only true measure of mix that occurs in a NIF capsule, particularly in cases when the capsule fails.

Shaughnessy, D A; Moody, K J; Bernstein, L A



Strong Corrections to Inclusive B to X tau nu Decays  

E-Print Network (OSTI)

We calculate the $\\alpha_s$ corrections to the form factors which parameterize the hadronic tensor relevant for inclusive semileptonic $B \\rightarrow X \\tau\\bar\

C. G. Boyd; Z. Guralnik; M. Schmaltz; F. J. Vegas


Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Cosmic recycling of millisecond pulsars  

E-Print Network (OSTI)

We compare the rotation rate of neutron stars in low-mass X-ray binaries (LMXBs) with the orbital period of the binaries. We find that, while short orbital period LMXBs span a range of neutron star rotation rates, all the long period LMXBs have fast rotators. We also find that the rotation rates are highest for the systems with the highest mean mass accretion rates, as can be expected if the accretion rate correlates with the orbital period. We show that these properties can be understood by a balance between spin-up due to accretion and spin-down due to gravitational radiation. Our scenario indicates that the gravitational radiation emitted by these systems may be detectable by future ground-based gravitational wave detectors.

Wynn C. G. Ho; Thomas J. Maccarone; Nils Andersson



$\\alpha$ Centauri A in the far infrared  

E-Print Network (OSTI)

Chromospheres and coronae are common phenomena on solar-type stars. Understanding the energy transfer to these heated atmospheric layers requires direct access to the relevant empirical data. Study of these structures has, by and large, been limited to the Sun thus far. The region of the temperature reversal can be directly observed only in the far infrared and submm. We aim at the determination of the characteristics of the atmosphere in the region of the temperature minimum of the solar sister star alpha Cen A. For the nearby binary system alpha Centauri, stellar parameters are known with high accuracy from measurements. For the basic model parameters Teff, log g and [Fe/H], we interpolate in the grid of GAIA/PHOENIX stellar model atmospheres and compute the corresponding model for the G2 V star alpha Cen A. Comparison with photometric measurements shows excellent agreement between observed photospheric data in the optical and infrared. For longer wavelengths, the modelled spectral energy distribution is co...

Liseau, R; Olofsson, G; Bryden, G; Marshall, J P; Ardila, D; Aran, A Bayo; Danchi, W C; del Burgo, C; Eiroa, C; Ertel, S; Fridlund, M C W; Krivov, A V; Pilbratt, G L; Roberge, A; Thébault, P; Wiegert, J; White, G J



Alpha Particle Physics Experiments in the Tokamak Fusion Test Reactor  

SciTech Connect

Alpha particle physics experiments were done on the Tokamak Fusion Test Reactor (TFTR) during its deuterium-tritium (DT) run from 1993-1997. These experiments utilized several new alpha particle diagnostics and hundreds of DT discharges to characterize the alpha particle confinement and wave-particle interactions. In general, the results from the alpha particle diagnostics agreed with the classical single-particle confinement model in magnetohydrodynamic (MHD) quiescent discharges. Also, the observed alpha particle interactions with sawteeth, toroidal Alfvén eigenmodes (TAE), and ion cyclotron resonant frequency (ICRF) waves were roughly consistent with theoretical modeling. This paper reviews what was learned and identifies what remains to be understood.

Budny, R.V.; Darrow, D.S.; Medley, S.S.; Nazikian, R.; Zweben, S.J.; et al.



Characteristics of potential repository wastes. Volume 3, Appendix 3A, ORIGEN2 decay tables for immobilized high-level waste; Appendix 3B, Interim high-level waste forms  

SciTech Connect

This appendix presents the results of decay calculations using the ORIGEN2 code to determine the radiological properties of canisters of immobilized high-level waste as a function of decay time for decay times up to one million years. These calculations were made for the four HLW sites (West Valley Demonstration Project, Savannah River Site, Hanford Site, and Idaho National Engineering Laboratory) using the composition data discussed in the HLW section of this report. Calculated ({alpha},n) neutron production rates are also shown.

Not Available



Gross Theory of ?-Decay and Shell Effects  

Science Journals Connector (OSTI)

......nuclear final state measured fr:orn the parent. Although actual decays pro- Gross Theory of f3-Decay and Shell Effects 137 ceed only to the region of negative values of E, we extend our consideration to the positive region. Now, we can regard the whole......

Takayoshi Kondoh; Masami Yamada



Spectroscopy and decays of charm and bottom  

SciTech Connect

After a brief review of the quark model, we discuss our present knowledge of the spectroscopy of charm and bottom mesons and baryons. We go on to review the lifetimes, semileptonic, and purely leptonic decays of these particles. We conclude with a brief discussion B and D mixing and rare decays.

Butler, J.N.



Observing Nucleon Decay in Lead Perchlorate  

E-Print Network (OSTI)

Lead perchlorate, part of the OMNIS supernova neutrino detector, contains two nuclei, 208Pb and 35Cl, that might be used to study nucleon decay. Both would produce signatures that will make them especially useful for studying less-well-studied neutron decay modes, e.g., those in which only neutrinos are emitted.

R. N. Boyd; T. Rauscher; S. D. Reitzner; P. Vogel



Strong effects in weak nonleptonic decays  

SciTech Connect

In this report the weak nonleptonic decays of kaons and hyperons are examined with the hope of gaining insight into a recently proposed mechanism for the ..delta..I = 1/2 rule. The effective Hamiltonian for ..delta..S = 1 weak nonleptonic decays and that for K/sup 0/-anti K/sup 0/ mixing are calculated in the six-quark model using the leading logarithmic approximation. These are used to examine the CP violation parameters of the kaon system. It is found that if Penguin-type diagrams make important contributions to K ..-->.. ..pi pi.. decay amplitudes then upcoming experiments may be able to distinguish the six-quark model for CP violation from the superweak model. The weak radiative decays of hyperons are discussed with an emphasis on what they can teach us about hyperon nonleptonic decays and the ..delta..I = 1/2 rule.

Wise, M.B.



Magnetic field decay in model SSC dipoles  

SciTech Connect

We have observed that some of our model SSC dipoles have long time constant decays of the magnetic field harmonics with amplitudes large enough to result in significant beam loss, if they are not corrected. The magnets were run at constant current at the SSC injection field level of 0.3 tesla for one to three hours and changes in the magnetic field were observed. One explanation for the observed field decay is time dependent superconductor magnetization. Another explanation involves flux creep or flux flow. Data are presented on how the decay changes with previous flux history. Similar magnets with different Nb-Ti filament spacings and matrix materials have different long time field decay. A theoretical model using proximity coupling and flux creep for the observed field decay is discussed. 10 refs., 5 figs., 2 tabs.

Gilbert, W.S.; Althaus, R.F.; Barale, P.J.; Benjegerdes, R.W.; Green, M.A.; Green, M.I.; Scanlan, R.M.



What can we learn from neutrinoless double beta decay experiments?  

E-Print Network (OSTI)

312 P. Vogel, “Limits From Neutrinoless Double-Beta Decay (Assumptions No detected neutrinoless double ?-decay lightestscale (1 ± 0.05 eV), No neutrinoless double ?-decay lightest

Bahcall, John N.



Neutrinoless Double Beta Decay in Light of SNO Salt Data  

E-Print Network (OSTI)

14] P. Vogel, “Limits From Neutrinoless Double-Beta Decay (Higgs, can also cause neutrinoless double-beta decay (seeLBNL-53996 Neutrinoless Double Beta Decay in Light of SNO

Murayama, Hitoshi



Neutrinoless double beta decay and nuclear matrix elements  

Science Journals Connector (OSTI)

The fundamental importance of searching for neutrinoless double?beta decay (0????decay) is widely recognized. Observation of the decay would tell us that the total lepton number is not conserved and that consequently neutrinos are massive Majorana fermions. The 0????decay is discussed in context of neutrino oscillation data. The perspectives of the experimental 0????decay searches are analyzed. The importance of reliable determination of the 0????decay nuclear matrix elements is pointed out.



Photoproduction and Decay of Light Mesons in CLAS  

SciTech Connect

We present preliminary experimental results on photoproduction and decay of light mesons measured with CLAS setup at JLAB . This include Dalitz decay of pseudoscalar and vector mesons, radiative decay of pseudoscalar mesons as well hadronic decays of pseudoscalar and vector mesons. The collected high statistics in some of decay channels exceeds the world data by an order of magnitude and some other decay modes are observed for the first time. It is shown how the CLAS data will improve the world data on transition form factors of light mesons, Dalitz plot analyses, branching ratios of rare decay modes and other fundamental properties potentially accessible through the light meson decays.

Amaryan, Moskov Jamalovich [Old Dominion University



A Search for Neutrinoless Double Beta Decay of Te-130.  

E-Print Network (OSTI)

??This dissertation describes an experimental search for neutrinoless double beta (0???) decay of 130Te. An observation of 0??? decay would establish that neutrinos are Majorana… (more)

Bryant, Adam Douglas



Search for: "neutrinoless double beta decay" | DOE PAGES  

Office of Scientific and Technical Information (OSTI)

neutrinoless double beta decay" Find + Advanced Search Advanced Search All Fields: "neutrinoless double beta decay" Title: Full Text: Bibliographic Data: Creator Author: Name...


A Precise Determination of $\\alpha_s$ from the C-parameter Distribution  

E-Print Network (OSTI)

We present a global fit for $\\alpha_s(m_Z)$, analyzing the available C-parameter data measured at center-of-mass energies between $Q=35$ and $207$ GeV. The experimental data is compared to a N$^3$LL$^\\prime$ + $\\mathcal{O}(\\alpha_s^3)$ + $\\Omega_1$ theoretical prediction (up to the missing 4-loop cusp anomalous dimension), which includes power corrections coming from a field theoretical nonperturbative soft function. The dominant hadronic parameter is its first moment $\\Omega_1$, which is defined in a scheme which eliminates the $\\mathcal{O}(\\Lambda_{\\rm QCD})$ renormalon ambiguity. The resummation region plays a dominant role in the C-parameter spectrum, and in this region a fit for $\\alpha_s(m_Z)$ and $\\Omega_1$ is sufficient. We find $\\alpha_s(m_Z)=0.1123\\pm 0.0015$ and $\\Omega_1=0.421\\pm 0.063\\,{\\rm GeV}$ with $\\chi^2/\\rm{dof}=0.988$ for $404$ bins of data. These results agree with the prediction of universality for $\\Omega_1$ between thrust and C-parameter within 1-$\\sigma$.

Hoang, André H; Mateu, Vicent; Stewart, Iain W



B, D and K Decays  

SciTech Connect

The present report documents the results of Working Group 2: B, D and K decays, of the workshop on Flavor in the Era of the LHC, held at CERN from November 2005 through March 2007. With the advent of the LHC, we will be able to probe New Physics (NP) up to energy scales almost one order of magnitude larger than it has been possible with present accelerator facilities. While direct detection of new particles will be the main avenue to establish the presence of NP at the LHC, indirect searches will provide precious complementary information, since most probably it will not be possible to measure the full spectrum of new particles and their couplings through direct production. In particular, precision measurements and computations in the realm of flavor physics are expected to play a key role in constraining the unknown parameters of the Lagrangian of any NP model emerging from direct searches at the LHC. The aim of Working Group 2 was twofold: on one hand, to provide a coherent, up-to-date picture of the status of flavor physics before the start of the LHC; on the other hand, to initiate activities on the path towards integrating information on NP from high-p{sub T} and flavor data. This report is organized as follows. In Sec. 1, we give an overview of NP models, focusing on a few examples that have been discussed in some detail during the workshop, with a short description of the available computational tools for flavor observables in NP models. Sec. 2 contains a concise discussion of the main theoretical problem in flavor physics: the evaluation of the relevant hadronic matrix elements for weak decays. Sec. 3 contains a detailed discussion of NP effects in a set of flavor observables that we identified as 'benchmark channels' for NP searches. The experimental prospects for flavor physics at future facilities are discussed in Sec. 4. Finally, Sec. 5 contains some assessments on the work done at the workshop and the prospects for future developments.

Artuso, M.; Asner, D.M.; Ball, P.; Baracchini, E.; Bell, G.; Beneke, M.; Berryhill, J.; Bevan, A.; Bigi, I.I.; Blanke, M.; Bobeth, Ch.; Bona, M.; Borzumati, F.; Browder, T.; Buanes, T.; Buchalla, G.; Buchmuller, O.; Buras, A.J.; Burdin, S.; Cassel, D.G.; Cavanaugh, R.; /Syracuse U. /Carleton U. /Durham U., IPPP /Rome U. /INFN, Rome /Karlsruhe U. /RWTH Aachen U. /Fermilab /Queen Mary, U. of London /Notre Dame U. /Munich, Tech. U. /Munich, Max Planck Inst. /Dortmund U. /Annecy, LAPP /ICTP, Trieste /Taiwan, Natl. Central U. /Hawaii U. /Bergen U. /Munich U. /CERN /Liverpool U.



CRAD, Training - Oak Ridge National Laboratory TRU ALPHA LLWT Project |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

TRU ALPHA LLWT TRU ALPHA LLWT Project CRAD, Training - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of Appendix C to DOE G 226.1-2 "Federal Line Management Oversight of Department of Energy Nuclear Facilities." Consists of Criteria Review and Approach Documents (CRADs) used for a November 2003 assessment of the Training Program portion of an Operational Readiness Review of the Oak Ridge National Laboratory TRU ALPHA LLWT Project. CRADs provide a recommended approach and the types of information to gather to assess elements of a DOE contractor's programs. CRAD, Training - Oak Ridge National Laboratory TRU ALPHA LLWT Project More Documents & Publications CRAD, Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT Project


Power Corrections in Charmless Nonleptonic B Decays: Annihilationis Factorizable and Real  

SciTech Connect

We classify {Lambda}{sub QCD}/m{sub b} power corrections to nonleptonic B {yields} M{sub 1}M{sub 2} decays, where M{sub 1,2} are charmless non-isosinglet mesons. Using recent developments in soft-collinear effective theory, we prove that the leading contributions to annihilation amplitudes of order {alpha}{sub s}(m{sub b}) {Lambda}{sub QCD}/m{sub b} are real. The leading annihilation amplitudes depend on twist-2 and the twist-3 three parton distributions. A complex nonperturbative parameter from annihilation first appears at {Omega}[{alpha}{sub s}{sup 2}({radical}{Lambda}m{sub b}){Lambda}{sub QCD}/m{sub b}]. 'Chirally enhanced' contributions are also factorizable and real at lowest order. Thus, incalculable strong phases are suppressed in annihilation amplitudes, unless the {alpha}{sub s}({radical}{Lambda}m{sub b}) expansion breaks down. Modeling the distribution functions, we find that (11 {+-} 9)% and (15 {+-} 11)% of the absolute values of the measured {bar B}{sup 0} {yields} K{sup -}{pi}{sup +} and B{sup -} {yields} K{sup -}K{sup 0} penguin amplitudes come from annihilation. This is consistent with the expected size of power corrections.

Arnesen, Christian M.; Ligeti, Zoltan; Rothstein, Ira Z.; Stewart, Iain W.



Radioactive Decay of Lutetium-174  

Science Journals Connector (OSTI)

Ytterbium oxide enriched to 98.4% in the 174 mass number was irradiated with 6-Mev protons. An activity of approximately 165-day half-life was produced and assigned to Lu174 by the identification of the ytterbium K x-ray and of the activities produced by similar proton irradiations of the other enriched isotopes of ytterbium. The observed activity of Lu174 consists of the L and K x-rays of ytterbium and 76.6- and 1228-kev gamma rays which are in coincidence. Because no beta radiation exists in the activity of Lu174, the mode of decay is solely by electron capture to Yb174. Approximately 31% of the disintegrations of Lu174 are to the ground state of Yb174. In addition to the 76.6-kev level of Yb174, there is a 1305-kev level with a spin of 0+. The transitions of Lu174 to the 1305-kev level of Yb174 are by L capture only and the percentages of electron capture to the 76.6- and 1305-kev levels of Yb174 are approximately 59 and 10, respectively. A spin of 1- is assigned to the ground state of Lu174.

R. G. Wilson and M. L. Pool


Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Catalyzing Alpha-Channeling by Minority Ion Injection in Mirror...  

NLE Websites -- All DOE Office Websites (Extended Search)

Maintaining fuel ions hotter than electrons would greatly facilitate controlled nuclear fusion. Alpha channeling is a technique that can potentially extract energy from fusion...


Alpha-particle optical potential proofs at astrophysically relevant energies  

E-Print Network (OSTI)

$(\\alpha,\\gamma)$ and $(\\alpha$,n) reaction cross sections recently measured close to the reaction thresholds are rather well described by a previously developed regional optical potential. Thus, particular features of the $\\alpha$-particle optical potential at energies below the Coulomb barrier, besides parameters describing $\\alpha$-particle elastic scattering at higher energies are confirmed. Additional limitations of similar statistical model calculations for minor reaction channels are shown to be most likely due to an overlooked process or critical values of statistical model parameters around closed nuclear shells.

M. Avrigeanu; V. Avrigeanu



Can Dark Matter Decay in Dark Energy?  

E-Print Network (OSTI)

We analyze the interaction between Dark Energy and Dark Matter from a thermodynamical perspective. By assuming they have different temperatures, we study the possibility of occurring a decay from Dark Matter into Dark Energy, characterized by a negative parameter $Q$. We find that, if at least one of the fluids has non vanishing chemical potential, for instance $\\mu_x0$, the decay is possible, where $\\mu_x$ and $\\mu_{dm}$ are the chemical potentials of Dark Energy and Dark Matter, respectively. Using recent cosmological data, we find that, for a fairly simple interaction, the Dark Matter decay is favored with a probability of $\\sim 93%$ over the Dark Energy decay. This result comes from a likelihood analysis where only background evolution has been considered.

S. H. Pereira; J. F. Jesus



Double Beta Decay Constraint on Composite Neutrinos  

Science Journals Connector (OSTI)

......Constraint on Composite Neutrinos Eiichi Takasugi Department of Physics, Osaka University, Toyonaka 560 Neutrinoless double beta decay (betabeta)0v occurs through the magnetic coupling of dimension five operator whose coupling constant is......

Eiichi Takasugi



27 contribution to weak electromagnetic decays  

Science Journals Connector (OSTI)

We notice that the assumption of octet dominance of the Cabibbo weak Hamiltonian is not required to explain the weak electromagnetic decays. In order to explain large asymmetry parameter ?(?+?p?) we consider ?7 contribution to the parity-violating Hamiltonian.

Ramesh C. Verma and M. P. Khanna



Probing QCD with Rare Charmless $B$ Decays  

SciTech Connect

Rare charmless hadronic B decays are a good testing ground for QCD. In this paper we describe a selection of new measurements made by the BABAR and BELLE collaborations.

Gradl, Wolfgang



Uncertainty evaluation of delayed neutron decay parameters  

E-Print Network (OSTI)

parameters fit their individual measurement data well in spite of these differences. This dissertation focuses on evaluation of the errors and methods of delayed neutron relative yields and decay constants for thermal fission of U-235. Various numerical...

Wang, Jinkai



Theory of top quark production and decay  

SciTech Connect

Direct and indirect information on the top quark mass and its decay modes is reviewed. The theory of top production in hadron- and electron-positron-colliders is presented.

Kuehn, J.H. [Universitaet Karlsruhe (Germany)



Rare decays at the LHCb experiment  

E-Print Network (OSTI)

Rare decays of beauty and charm hadrons offer a rich playground to make precise tests of the Standard Model and look for New Physics at the level of quantum corrections. A review of recent LHCb results will be presented.

Luca Pescatore



Three-body decay of (6)Be  

E-Print Network (OSTI)

Three-body correlations for the ground-state decay of the lightest two-proton emitter (6)Be are studied both theoretically and experimentally. Theoretical studies are performed in a three-body hyperspherical-harmonics cluster model...

Grigorenko, L. V.; Wiser, T. D.; Mercurio, K.; Charity, R. J.; Shane, R.; Sobotka, L. G.; Elson, J. M.; Wuosmaa, A. H.; Banu, A.; McCleskey, M.; Trache, L.; Tribble, Robert E.; Zhukov, M. V.



Phenomenology of neutrinoless double beta decay  

E-Print Network (OSTI)

This paper reviews the current status and future outlook of neutrinoless double beta decay searches, which try to provide an answer to the fundamental question of whether neutrinos are Dirac or Majorana particles.

Gómez-Cadenas, J J



Phenomenology of neutrinoless double beta decay  

E-Print Network (OSTI)

This paper reviews the current status and future outlook of neutrinoless double beta decay searches, which try to provide an answer to the fundamental question of whether neutrinos are Dirac or Majorana particles.

J. J. Gómez-Cadenas; Justo Martín-Albo



Electrical Analogs of Atomic Radiative Decay Processes  

E-Print Network (OSTI)

Simple electrical circuits are analyzed, and the results show that for high frequencies they have frequency and time responses identical to the spontaneous radiative decays of atoms. As an illustration of the analogy a ...

Fontana, Peter R.; Srivastava, Rajendra P.



CP Violation in Other Bs Decays  

E-Print Network (OSTI)

The recent experimental results of CP violation in Bs decays other than in the J/psi phi final state are discussed. Included are the resonant components and $\\phi_s$ determination in Bs -> J/psi pi+ pi-, CP asymmetries in Bs -> h+ h'- decays, and the Bs effective lifetimes in the CP-even state K+ K- and the CP-odd state J/psi f0(980).

L. Zhang; for the LHCb Collaboration



Neutrinoless double beta decay with scalar bilinears  

E-Print Network (OSTI)

One possible probe to physics beyond the standard model is to look for scalar bilinears, which couple to two fermions of the standard model. We point out that the scalar bilinears allow new diagrams contributing to the neutrinoless double beta decay. The upper bound on the neutrinoless double beta decay lifetime would then give new constraints on the ratio of the masses of these scalars to their couplings to the fermions.

H. V. Klapdor-Kleingrothaus; U. Sarkar



Recent Results on Semileptonic Decays at Babar  

SciTech Connect

Some recent BABAR results on semileptonic decays are presented. They focus on the determination of the CKM matrix elements |V{sub ub}| and |V{sub cb}| in inclusive and exclusive b {yields} u{ell}v and b {yields} c{ell}v decays, and on form factors measurement in exclusive c {yields} s{ell}v decays. Semileptonic decays play a crucial role in the determination of the unitarity triangle parameters: decays of the b quark give access to the CKM matrix elements |V{sub ub}| and |V{sub cb}|, while charm decays provide a way to validate lattice QCD computations through form factors measurements. Such calculations provide theoretical inputs that are used, especially, in the b sector. A lot of new results have been obtained by the BABAR collaboration during the last years, thanks to the large b{bar b} and c{bar c} production cross-sections and to the large recorded statistics. Some of these measurements are presented here.

Serrano, Justine; /Orsay, LAL



Optical Counterparts to Damped Lyman Alpha Systems  

E-Print Network (OSTI)

Previously we have shown (Maller et al, 1998) that the kinematics of Damped Lyman Alpha Systems (DLAS) as measured by Prochaska and Wolfe (1998) can be reproduced in a multiple disk model (MDM) if the gaseous disks are of sufficient radial extent. Here we discuss this model's predictions for the relationship between DLAS and Lyman break galaxies (LBGs), which we here take to be objects at z~3 brighter than R=25.5. We expect that future observations of the correlations between DLAS and LBGs will provide a new data set able to discriminate between different theoretical models of the DLAS. Djorgovski (1997) has already detected a few optical counterparts and more studies are underway.

Ariyeh H. Maller; Jason X. Prochaska; Rachel S. Somerville; Joel R. Primack



Observables in the decays of B to two vector mesons  

Science Journals Connector (OSTI)

In general there are nine observables in the decay of a B meson to two vector mesons defined in terms of polarization correlations of these mesons. Only six of these can be detected via the subsequent decay angular distributions because of parity conservation in those decays. The remaining three require the measurement of the spin polarization of one of the decay products.

Cheng-Wei Chiang and Lincoln Wolfenstein



Decays of intermediate vector bosons, radiative corrections and QCD jets  

Science Journals Connector (OSTI)

We investigate decay properties of the intermediate vector bosons W± and Z0. QED and QCD radiative corrections to leptonic and hadronic decay modes are calculated. Implications of the results for decay widths, branching ratios, determination of the number of neutrino species, e-?-? universality and properties of hadronic jets produced in W± and Z0 decays are examined.

David Albert; William J. Marciano; Daniel Wyler; Zohreh Parsa



Calculated final state probability distributions for T2 -decay measurements  

E-Print Network (OSTI)

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19 1.6.1 Neutrinoless double beta decay . . . . . . . . . . . . . . . . . . . . 19 1.6.2 Cosmological

Washington at Seattle, University of - Department of Physics, Electroweak Interaction Research Group

Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Jet Production in ep Collisions at Low Q^2 and Determination of $\\alpha_{s}$  

E-Print Network (OSTI)

The production of jets is studied in deep-inelastic e+p scattering at low negative four momentum transfer squared 5alpha_s.

Aaron, FD; Alexa, C; Andreev, V; Antunovic, B; Backovic, S; Baghdasaryan, A; Barrelet, E; Bartel, W; Begzsuren, K; Belousov, A; Bizot, J C; Boudry, V; Bozovic-Jelisavcic, I; Bracinik, J; Brandt, G; Brinkmann, M; Brisson, V; Bruncko, D; Bunyatyan, A; Buschhorn, G; Bystritskaya, L; Campbell, A J; Cantun Avila, K B; Cerny, K; Cerny, V; Chekelian, V; Cholewa, A; Contreras, J G; Coughlan, J A; Cozzika, G; Cvach, J; Dainton, J B; Daum, K; Deak, M; Delcourt, B; Delvax, J; De Wolf, E A; Diaconu, C; Dodonov, V; Dossanov, A; Dubak, A; Eckerlin, G; Efremenko, V; Egli, S; Eliseev, A; Elsen, E; Falkiewicz, A; Favart, L; Fedotov, A; Felst, R; Feltesse, J; Ferencei, J; Fischer, D J; Fleischer, M; Fomenko, A; Gabathuler, E; Gayler, J; Ghazaryan, Samvel; Glazov, A; Glushkov, I; Goerlich, L; Gogitidze, N; Gouzevitch, M; Grab, C; Greenshaw, T; Grell, B R; Grindhammer, G; Habib, S; Haidt, D; Helebrant, C; Henderson, R C W; Hennekemper, E; Henschel, H; Herbst, M; Herrera, G; Hildebrandt, M; Hiller, K H; Hoffmann, D; Horisberger, R; Hreus, T; Jacquet, M; Janssen, X; Jonsson, L; Jung, A W; Jung, H; Kapichine, M; Katzy, J; Kenyon, I R; Kiesling, C; Klein, M; Kleinwort, C; Kluge, T; Knutsson, A; Kogler, R; Kosior, E; Kostka, P; Kraemer, M; Krastev, K; Kretzschmar, J; Kropivnitskaya, A; Kruger, K; Kutak, K; Landon, M P J; Lange, W; Lastovicka-Medin, G; Laycock, P; Lebedev, A; Lendermann, V; Levonian, S; Li, G; Lipka, K; Liptaj, A; List, B; List, J; Loktionova, N; Lopez-Fernandez, R; Lubimov, V; Makankine, A; Malinovski, E; Marage, P; Marti, Ll; Martyn, H U; Maxfield, S J; Mehta, A; Meyer, A B; Meyer, H; Meyer, H; Meyer, J; Mikocki, S; Milcewicz-Mika, I; Moreau, F; Morozov, A; Morris, J V; Mozer, M U; Mudrinic, M; Muller, K; Murin, P; Naumann, Th; Newman, P R; Niebuhr, C; Nikiforov, A; Nikitin, D; Nowak, G; Nowak, K; Olsson, J E; Osman, S; Ozerov, D; Palichik, V; Panagoulias, I; Pandurovic, M; Papadopoulou, Th; Pascaud, C; Patel, G D; Pejchal, O; Perez, E; Petrukhin, A; Picuric, I; Piec, S; Pitzl, D; Placakyte, R; Pokorny, B; Polifka, R; Povh, B; Radescu, V; Rahmat, A J; Raicevic, N; Raspiareza, A; Ravdandorj, T; Reimer, P; Rizvi, E; Robmann, P; Roland, B; Roosen, R; Rostovtsev, A; Rotaru, M; Tabasco, J E Ruiz; Rusakov, S; Salek, D; Sankey, D P C; Sauter, M; Sauvan, E; Schmitt, S; Schoeffel, L; Schoning, A; Schultz-Coulon, H C; Sefkow, F; Shaw-West, R N; Shtarkov, L N; Shushkevich, S; Sloan, T; Smiljanic, Ivan; Soloviev, Y; Sopicki, P; South, D; Spaskov, V; Specka, A; Staykova, Z; Steder, M; Stella, B; Stoicea, G; Straumann, U; Sunar, D; Sykora, T; Tchoulakov, V; Thompson, G; Thompson, P D; Toll, T; Tomasz, F; Tran, T H; Traynor, D; Trinh, T N; Truol, P; Tsakov, I; Tseepeldorj, B; Turnau, J; Urban, K; Valkarova, A; Vallee, C; Van Mechelen, P; Trevino, A Vargas; Vazdik, Y; Vinokurova, S; Volchinski, V; von den Driesch, M; Wegener, D; Wissing, Ch; Wunsch, E; Zacek, J; Zalesak, J; Zhang, Z; Zhokin, A; Zimmermann, T; Zohrabyan, H; Zomer, F



It's Elemental - Isotopes of the Element Boron  

NLE Websites -- All DOE Office Websites (Extended Search)

Beryllium Beryllium Previous Element (Beryllium) The Periodic Table of Elements Next Element (Carbon) Carbon Isotopes of the Element Boron [Click for Main Data] Most of the isotope data on this site has been obtained from the National Nuclear Data Center. Please visit their site for more information. Naturally Occurring Isotopes Mass Number Natural Abundance Half-life 10 19.9% STABLE 11 80.1% STABLE Known Isotopes Mass Number Half-life Decay Mode Branching Percentage 6 No Data Available Double Proton Emission (suspected) No Data Available 7 3.255×10-22 seconds Proton Emission No Data Available Alpha Decay No Data Available 8 770 milliseconds Electron Capture 100.00% Electron Capture with delayed Alpha Decay 100.00% 9 8.439×10-19 seconds Proton Emission 100.00% Double Alpha Decay 100.00%


Escherichia coli produces a cytoplasmic alpha-amylase, AmyA.  

Science Journals Connector (OSTI)

...liquefying alpha-amylases of bacilli...digested amylose, starch, amylopectin, and maltodextrins...specific for the alpha-anomeric...an alpha-amylase rather than...digested amylose, starch, amylopectin, and maltodextrins...specific for the alpha-anomeric...an alpha-amylase rather than...

M Raha; I Kawagishi; V Müller; M Kihara; R M Macnab



New Advances in Alpha-Beta Searching Jonathan Schaeffer  

E-Print Network (OSTI)

New Advances in Alpha-Beta Searching Jonathan Schaeffer Dept. of Computing Science Alpha-Beta has been the algorithm of choice for game-tree search for over three decades. Its suc- cess the search efficiency. Although state-of- the-art game-playing programs build trees that are close in size

Dumas, Jean-Guillaume


Elastic alpha scattering experiments and the alpha-nucleus optical potential at low energies  

E-Print Network (OSTI)

High precision angular distribution data of ($\\alpha$,$\\alpha$) elastic scattering are presented for the nuclei $^{89}$Y, $^{92}$Mo, $^{106,110,116}$Cd, $^{112,124}$Sn, and $^{144}$Sm at energies around the Coulomb barrier. Such data with small experimental uncertainties over the full angular range (20-170 degrees) are the indispensable prerequisite for the extraction of local optical potentials and for the determination of the total reaction cross section $\\sigma_{\\rm{reac}}$. A systematic fitting procedure was applied to the presented experimental scattering data to obtain comprehensive local potential parameter sets which are composed of a real folding potential and an imaginary potential of Woods-Saxon surface type. The obtained potential parameters were used in turn to construct a new systematic $\\alpha$-nucleus potential with very few parameters. Although this new potential cannot reproduce the angular distributions with the same small deviations as the local potential, the new potential is able to predict the total reaction cross sections for all cases under study.

P. Mohr; G. G. Kiss; Zs. Fülöp; D. Galaviz; Gy. Gyürky; E. Somorjai



CRAD, Radiological Controls - Oak Ridge National Laboratory TRU ALPHA LLWT  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

TRU TRU ALPHA LLWT Project CRAD, Radiological Controls - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of Appendix C to DOE G 226.1-2 "Federal Line Management Oversight of Department of Energy Nuclear Facilities." Consists of Criteria Review and Approach Documents (CRADs) used for a November 2003 assessment of the Radiation Protection Program portion of an Operational Readiness Review of the Oak Ridge National Laboratory TRU ALPHA LLWT Project. CRADs provide a recommended approach and the types of information to gather to assess elements of a DOE contractor's programs. CRAD, Radiological Controls - Oak Ridge National Laboratory TRU ALPHA LLWT Project More Documents & Publications CRAD, Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT


CRAD, Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Quality Assurance - Oak Ridge National Laboratory TRU ALPHA Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT Project CRAD, Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of Appendix C to DOE G 226.1-2 "Federal Line Management Oversight of Department of Energy Nuclear Facilities." Consists of Criteria Review and Approach Documents (CRADs) used for a November 2003 assessment of the Quality Assurance Program portion of an Operational Readiness Review of the Oak Ridge National Laboratory TRU ALPHA LLWT Project. CRADs provide a recommended approach and the types of information to gather to assess elements of a DOE contractor's programs. CRAD, Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT Project More Documents & Publications


The alpha-cluster model applied to {sup 96}Ru  

SciTech Connect

The states of {sup 96}Ru are investigated in terms of the a alpha+ core structure. The ground state band of the alpha+{sup 92}Mo system is obtained through a local cluster-core potential which includes a fixed set of parameters employed in other mass regions. The calculated spectrum gives a good general description of the experimental {sup 96}Ru levels. The reduced alpha-widths, B(E2) transition rates and rms intercluster separations are determined for the members of the ground state band. The results show that the model can reproduce the order of magnitude of the experimental B(E2) values without the use of effective charges and indicate that the first members of the ground state band present a stronger alpha-cluster character. Predictions concerning a negative parity band of the alpha+{sup 92}Mo system are also shown.

Souza, M. A.; Miyake, H. [Institute of Physics, Universidade de Sao Paulo, Sao Paulo-SP (Brazil)



Radiative Decay Modes of the Muon  

Science Journals Connector (OSTI)

A 5-in. freon bubble chamber was used to search for the following decay modes of the ?+ meson: (1) ?+?e++?, (2) ?+?e++e-+e+, (3) ?+?e++?0+?¯0+?, (4) ?+?e++?0+?¯0+e++e-. Two exposures were made at the Carnegie Institute of Technology synchrocyclotron. A total of 200 000 pictures were taken yielding 3.3×105 ?+ meson decays.A total of 3×105 ?+ decays were examined for mode (1). No decays consistent with this mode were found. The upper limit on the branching ratio Rrad was found to be Rrad=(?+?e++?)(?+?e++?0+?¯0)<2.5×10-5.A total of 3.3×105 ?+ decays were scanned for mode (2) and no such decays were observed. The limit on the branching ratio R3e was found to be R3e=(?+?e++e-+e+)(?+?e++?0+?¯0)<4×10-6.The internal bremsstrahlung rate (mode 3) was measured for two values of E?0 (the minimum photon energy detected). The results were RIB=(?+?e++?0+?¯0+?)(?+?e++?0+?¯0), RIB=(1.4±0.4)×10-2, E?0=10 Mev, RIB=(3.3±1.3)×10-3, E?0=20 Mev.The rate of internal conversion of internal bremsstrahlung [mode (4)] was found to be RIC=(?+?e++?0+?¯0+e++e-)(?+?e++?0+?¯0)=(2.2±1.5)×10-5, E0=10 Mev, where E0 is the minimum energy of the internally converted ? ray.A summary is given of previous experiments on these decay modes and results are discussed with special reference to the intermediate boson scheme of weak four-fermion interactions.

R. R. Crittenden; W. D. Walker; J. Ballam



12. CP violation in meson decays 1 12. CP VIOLATION IN MESON DECAYS  

E-Print Network (OSTI)

12. CP violation in meson decays 1 12. CP VIOLATION IN MESON DECAYS Revised May 2012 by D. Kirkby (UC Irvine) and Y. Nir (Weizmann Institute). The CP transformation combines charge conjugation C, for example, a left-handed electron e- L is transformed under CP into a right-handed positron, e+ R. If CP


12. CP violation in meson decays 1 12. CP VIOLATION IN MESON DECAYS  

E-Print Network (OSTI)

12. CP violation in meson decays 1 12. CP VIOLATION IN MESON DECAYS Revised August 2009 by D. Kirkby (UC Irvine) and Y. Nir (Weizmann Institute). The CP transformation combines charge conjugation C, for example, a left-handed electron e- L is transformed under CP into a right-handed positron, e+ R. If CP


Antihydrogen Trapped in the ALPHA Experiment  

ScienceCinema (OSTI)

In 2010 the ALPHA collaboration succeeded in trapping antihydrogen atoms for the first time.[i]  Stored antihydrogen promises to be a unique tool for making high precision measurements of the structure of this first anti-atom. Achieving this milestone presented several substantial experimental challenges and this talk will describe how they were overcome.   The unique design features of the ALPHA apparatus will be explained.[ii]  These allow a high intensity positron source and an antiproton imaging detector similar to the one used in the ATHENA[iii] experiment to be combined with an innovative magnet design of the anti-atom trap. This seeks to minimise the perturbations to trapped charged particles which may cause particle loss and heating[iv].   The diagnostic techniques used to measure the diameter, number, density, and temperatures of both plasmas will be presented as will the methods developed to actively compress and cool of both plasma species to sizes and temperatures [v],[vi], [vii] where trapping attempts with a reasonable chance of success can be tried.   The results of the successful trapping experiments will be outlined as well as some subsequent experiments to improve the trapping rate and storage time. [i] 'Trapped antihydrogen' G.B. Andresen et al., Nature 468, 673 (2010) [ii]'A Magnetic Trap for Antihydrogen Confinement' W. Bertsche et al., Nucl. Instr. Meth. Phys. Res. A566, 746 (2006) [iii] Production and detection of cold antihydrogen atoms M.Amoretti et al., Nature 419, 456 (2002). [iv]' Antihydrogen formation dynamics in a multipolar neutral anti-atom trap' G.B. Andresen et al., Phys. Lett. B 685, 141 (2010) [v]' Evaporative Cooling of Antiprotons to Cryogenic Temperatures',                                   G.B. Andresen et al. Phys. Rev. Lett 105, 013003 (2010) [vi]'Compression of Antiproton Clouds for Antihydrogen Trapping' G. B. Andresen et al. Phys. Rev. Lett 100, 203401 (2008) [vii]  'Autoresonant Excitation of Antiproton Plasmas' G.B. Andresen et al., Phys. Rev. Lett. 106, 025002 (2011) Organizer: Ferdinand Hahn PH/DT Detector Seminar webpage  




Rare and forbidden decays of D Mesons  

SciTech Connect

The authors summarize the results of two recent searches for flavor-changing neutral current, lepton-flavor violating, and lepton-number violating decays of D{sup +}, D{sub s}{sup +}, and D{sup 0} mesons (and their antiparticles) into modes containing muons and electrons. using data from Fermilab charm hadroproduction experiment E791, they examined D{sup +} and D{sub s}{sup +} {pi}{ell}{ell} and {Kappa}{ell}{ell} decay modes and the D{sup 0} dilepton decay modes containing either {ell}{sup +}{ell}{sup {minus}}, a {rho}{sup 0}, {bar {Kappa}}*{sup 0}, or {phi} vector meson, or a non-resonant {pi}{pi}, {Kappa}{pi}, or {Kappa}{Kappa} pair of pseudoscalar mesons. No evidence for any of these decays was found. Therefore, the authors presented branching-fraction upper limits at 90% confidence level for the 51 decay modes examined. Twenty-six of these modes had no previously reported limits, and eighteen of the remainder were reported with significant improvements over previously published results.

David A. Sanders et al.



Random matrix description of decaying quantum systems  

E-Print Network (OSTI)

This contribution describes a statistical model for decaying quantum systems (e.g. photo-dissociation or -ionization). It takes the interference between direct and indirect decay processes explicitely into account. The resulting expressions for the partial decay amplitudes and the corresponding cross sections may be considered a many-channel many-resonance generalization of Fano's original work on resonance lineshapes [Phys. Rev 124, 1866 (1961)]. A statistical (random matrix) model is then introduced. It allows to describe chaotic scattering systems with tunable couplings to the decay channels. We focus on the autocorrelation function of the total (photo) cross section, and we find that it depends on the same combination of parameters, as the Fano-parameter distribution. These combinations are statistical variants of the one-channel Fano parameter. It is thus possible to study Fano interference (i.e. the interference between direct and indirect decay paths) on the basis of the autocorrelation function, and thereby in the regime of overlapping resonances. It allows us, to study the Fano interference in the limit of strongly overlapping resonances, where we find a persisting effect on the level of the weak localization correction.

T. Gorin



Leptonic B Decays at BaBar  

SciTech Connect

The authors will present the most recent results on leptonic B decays B{sup {+-}(0)} {yields} K*{sup {+-}(0)} {nu}{bar {nu}} and B{sup {+-}} {yields} {mu}{sup {+-}}{nu}, based on the data collected by the BaBar detector at PEP-II, an asymmetric e{sup +}e{sup -} collider at the center of mass energy of the {Upsilon}(4S) resonance. Rare B decays have always been a standard probe for New Physics (NP) searches. The very low Standard Model (SM) rate of these decays often make them unaccessible with the present experimental datasets, unless NP effects enhance the rate up to the current experimental sensitivity. Moreover, as NP effects can modify the decay kinematic, particular attention must be payed in order to perform a model independent analysis. A B-Factory provides an unique environment where to investigate these processes. The high number of B{bar B} pairs produced by a B-Factory often allows to approach the needed experimental sensitivity. Moreover, the clean environment and the closed kinematic of the initial state enable to obtaining a very pure sample where to look for these decays.

Monorchio, Diego; /INFN, Naples /Naples U.



Neutron decay beyond the standard model.  

SciTech Connect

The authors discuss {beta} decay interactions in extensions of the Standard Model, and the role of {beta} decay experiments in obtaining information on them. Nuclear and neutron {beta} decay played an important role in the development of the Standard Model (SM). Today a major motivation for their further experimental study is the importance of searching for new-interactions. Despite the remarkable success of the SM, for many theoretical reasons the existence of new physics is expected. In fact, we have already the first strong experimental evidence, in the form of neutrino oscillations, that some extension of the SM is required. In this talk we shall discuss {beta} decay interactions in extensions of the SM [1]. We shall review the existing bounds on new interactions provided by {beta} decay experiments, and consider the constraints on them from other sources. In the next section we focus on time-reversal (T) invariant contributions. In Section 3 we discuss briefly the contributions from the T-violating components of the new interactions. Section 4 contains our conclusions.

Herczeg, P. (Peter)



E-Print Network 3.0 - alpha gamma sur Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Johnson Alpha Delta Pi Summary: Marie Frappier - Rho Gamma Greek Man of the Year Jordan Fischette - Alpha Tau Omega Greek Professor... : Sigma Gamma Rho 3.13 PHC: Alpha Xi...


Thalamocortical Mechanisms for the Anteriorization of Alpha Rhythms during Propofol-Induced Unconsciousness  

E-Print Network (OSTI)

As humans are induced into a state of general anesthesia via propofol, the normal alpha rhythm (8–13 Hz) in the occipital cortex disappears and a frontal alpha rhythm emerges. This spatial shift in alpha activity is called ...

Vijayan, Sujith


Measurement of microbial alpha-amylases with p-nitrophenyl glycosides as the substrate complex.  

Science Journals Connector (OSTI)

...Starch is acted on by alpha-amylase to yield alpha-amylose plus amylopectin. This enzymatic hydrolysis...on straight-chain amylose than on branched amylopectin. Fur- thermore, the alpha-amylase is not thought to...

R W Trepeta; S C Edberg



The atmospheric reactivity of. alpha. -methyltetrahydrofuran  

SciTech Connect

Biomass-derived {alpha}-methyltetrahydrofuran (MTHF) has been proposed as an automotive fuel additive. Since MTHF is a volatile organic compound, the environmental impact of evaporation to the atmosphere needs to be considered. The major loss process of MTHF in the atmosphere is expected to occur via reaction with hydroxyl radical; hence we have conducted a study of the kinetics of the reaction OH + MTHF {yields} products using both absolute (flash photolysis resonance fluorescence) and relative rate techniques. The absolute rate experiments were performed over the temperature range 240-400 K at total pressures of 35 Torr (4.7 kPa) argon; the relative rate experiments were conducted at 295 K in 740 Torr (99 kPa) synthetic air. The results from both techniques were in good agreement and yield k{sub 1} = (2.52 {plus minus} 0.74) {times} 10{sup {minus}12} exp-((650 {plus minus} 80)/T) cm{sup 3} molecule{sup {minus}1} s{sup {minus}1}, with k{sub 1} (298 K) = 2.2 {times} 10{sup {minus}11} cm{sup 3} molecule{sup {minus}1}. The implications of these results for the atmospheric chemistry of MTHF are discussed.

Wallington, T.J.; Siegl, W.O. (Ford Motor Company, Dearborn, MI (USA)); Liu, Renzhang; Zhang, Zhengyu; Huie, R.E.; Kurylo, M.J. (National Institute of Standards and Technology, Gaithersburg, MD (USA))


Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Measurements of B?Ds(+)X decays  

E-Print Network (OSTI)

. THE B?DS ?*?1D¯ ?*? DECAY RATES In the dominant process leading to a two-body decay of the type B!Ds(*)1D (*), shown in Fig. 1, the Ds(*)1 is pro- duced from the fragmentation of the W1. The analogous b!u transitions lead to final states like Ds1p2...*5280 MeV, Vcb50.038, tB51.52 ps , and ua1u51.07 @14#, which was derived from B0!D (*)1p2/r2 decays. The CLEO II values are the values of Table VIII with all of the errors added in quadrature. Model Ds 1D¯ Ds* 1D¯ Ds 1D¯* Ds* 1D¯* BSW @19# 1.69 0.99 0...

Baringer, Philip S.



Factorization in B ---> V gamma decays  

SciTech Connect

The factorization properties of the radiative decays B {yields} V{gamma} are analyzed at leading order in 1/m{sub b} using the soft-collinear effective theory. It is shown that the decay amplitudes can be expressed in terms of a B {yields} V form factor evaluated at q{sup 2} = 0, light-cone distribution amplitudes of the B and V mesons, and calculable hard-scattering kernels. The renormalization-group equations in the effective theory are solved to resum perturbative logarithms of the different scales in the decay process. Phenomenological implications for the B {yields} K*{gamma} branching ratio, isospin asymmetry, and CP asymmetries are discussed, with particular emphasis on possible effects from physics beyond the Standard Model.

Becher, Thomas; /Fermilab; Hill, Richard J.; /SLAC; Neubert, Matthias; /Cornell U., LEPP



BES Results on Charmonium Decays and Transitions  

E-Print Network (OSTI)

Results are reported based on samples of 58 million $J/\\psi$ and 14 million $\\psi(2S)$ decays obtained by the BESII experiment. Improved branching fraction measurements are determined, including branching fractions for $J/\\psi\\to\\pi^+\\pi^-\\pi^0$, $\\psi(2S)\\to \\pi^0 J/\\psi$, $\\eta J/\\psi$, $\\pi^0 \\pi^0 J/\\psi$, anything $J/\\psi$, and $\\psi(2S)\\to\\gamma\\chi_{c1},\\gamma\\chi_{c2}\\to\\gamma\\gamma\\jpsi$. Using 14 million $\\psi(2S)$ events, $f_0(980)f_0(980)$ production in $\\chi_{c0}$ decays and $K^*(892)^0\\bar K^*(892)^0$ production in $\\chi_{cJ}~(J=0,1,2)$ decays are observed for the first time, and branching ratios are determined.

Frederick A. Harris



Rare K decays: Challenges and Perspectives  

E-Print Network (OSTI)

At this stage of the LHC program, the prospect for a new physics signal in the very rare K ---> pi nu nu bar decays may be dented, but remains well alive thanks to their intrinsic qualities. First, these decays are among the cleanest observables in the quark flavor sector. When combined with their terrible suppression in the Standard Model, they thus offer uniquely sensitive probes. Second, the LHC capabilities are not ideal for all kinds of new physics, even below the TeV scale. For example, rather elusive scenarios like natural-SUSY-like hierarchical spectrum, baryon number violation, or new very light but very weakly interacting particles may well induce deviations in rare K decays. Even though experimentalists should brace themselves for tiny deviations, these modes thus have a clear role to play in the LHC era.

Christopher Smith



Correlations and the neutrinoless double beta decay  

Science Journals Connector (OSTI)

We explore the influence of the deformation on the nuclear matrix elements of the neutrinoless double beta decay (NME) concluding that the difference in deformation ?or more generally on the amount of quadrupole correlations? between parent and grand daughter nuclei quenchs strongly the decay. We discuss how varies the nuclear matrix element of 76 Ge decay when the wave functions of the two nuclei involved in the transition are constrained to reproduce the experimental occupancies. In the Interacting Shell Model description the value of the NME is enhanced about 15% compared to previous calculations whereas in the QRPA the NME’s are reduced by 20%–30% thus the discrepancies between both approaches diminish.

J. Menéndez; A. Poves; E. Caurier; F. Nowacki



Factorization in B to V gamma Decays  

SciTech Connect

The factorization properties of the radiative decays B {yields} V{gamma} are analyzed at leading order in 1/mb using the soft-collinear effective theory. It is shown that the decay amplitudes can be expressed in terms of a B {yields} V form factor evaluated at q{sup 2} = 0, light-cone distribution amplitudes of the B and V mesons, and calculable hard-scattering kernels. The renormalization-group equations in the effective theory are solved to resume perturbative logarithms of the different scales in the decay process. Phenomenological implications for the B {yields} K*{gamma} branching ratio, isospin asymmetry, and CP asymmetries are discussed, with particular emphasis on possible effects from physics beyond the Standard Model.

Becher, T



E-Print Network 3.0 - alpha particle emission Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

(or, positron-- the anti-particle to the beta-- emission) or alpha particle... Different types of radiation (alpha, beta, gammas, and neutrons) have different ways in which they...


E-Print Network 3.0 - alpha -bungarotoxin binding Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Limited Keywords: binding sites; protein structure; geometry; alpha... CPA, 4CPA, 5CPA, alpha-amylase 6TAA) their ... Source: Engelman, Donald M.- Department of Molecular...


Thick-Target Neutron Yield from the 19F(alpha,n) Reaction  

E-Print Network (OSTI)

Thick-target neutron yields from the 19F(alpha,n) reaction are reported for E(alpha) = 3.5 - 10.0 MeV.

E. B. Norman; T. E. Chupp; K. T. Lesko; G. L. Woodruff; P. J. Grant



E-Print Network 3.0 - alpha particle energy Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

to mirror machines can benefit this concept by efficiently redirecting alpha particle energy... -transverse wave propagation. As a result, modes suitable for alpha particle...


E-Print Network 3.0 - alpha particle effects Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

to mirror machines can benefit this concept by efficiently redirecting alpha particle energy... -transverse wave propagation. As a result, modes suitable for alpha particle...


Sensitive Immunoassay of a Biomarker TumorNecrosis Factor-[alpha...  

NLE Websites -- All DOE Office Websites (Extended Search)

Biomarker TumorNecrosis Factor-alpha Based on Poly(guanine)-Functionalized Silica Nanoparticle Sensitive Immunoassay of a Biomarker TumorNecrosis Factor-alpha Based on...


Thick-Target Neutron Yield from the 19F(alpha,n) Reaction  

E-Print Network (OSTI)

Thick-target neutron yields from the 19F(alpha,n) reaction are reported for E(alpha) = 3.5 - 10.0 MeV.

Norman, E B; Lesko, K T; Woodruff, G L; Grant, P J



E-Print Network 3.0 - alpha2-adrenoceptor antagonists studied...  

NLE Websites -- All DOE Office Websites (Extended Search)

Physiology & Behavior (2002) 76... . amic alpha1 and alpha2adrenoceptors and food intake in rats. 39. Dglucose 40. 41... nervous system in the regulation of these ......


E-Print Network 3.0 - alpha fetoprotein radioimmunoassay Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

test Alpha-fetoprotein (AFP), Estriol, h... , Benefits for Alpha-Fetoprotein IV Screening Test, Benefits for Treatment of Genetic Errors of Metabolism Source: Lammers, Peter J. -...


Generating long streams of $1/f^alpha$ noise  

E-Print Network (OSTI)

We review existing methods for generating long streams of 1/f^alpha noise ($0generator (white outside some bounds) in order to generate very long streams of noise without an exhaustive computer memory load. For $\\alpha=2$ it is shown why the process is equivalent to a random-walk and can be obtained simply by a first order filtering of white noise. As soon as $\\alphagenerators with $\\alpha>2$. The software is available from http://planck.lal.in2p3.fr/article.php3?id\\_article=8

S. Plaszczynski



Non-resonant triple alpha reaction rate at low temperature  

SciTech Connect

Our experimental goal is to study the non-resonant triple alpha reaction rate at low temperture (T < 10{sup 8} K). The {sup 13}C(p,d) reaction at 66 MeV has been used to probe the alpha-unbound continuum state in {sup 12}C just below the 2{sup nd} 0{sup +} state at 7.65 MeV. The transition strength to the continuum state is predicted to be sensitive to the non-resonant triple alpha reaction rate. The experiment has been performed at iThemba LABS. We report the present status of the experiment.

Itoh, T.; Tamii, A.; Aoi, N.; Fujita, H.; Hashimoto, T.; Miki, K.; Ogata, K. [Research Center for Nuclear Physics, Osaka University, Ibaraki, Osaka 567-0047 (Japan); Carter, J.; Donaldson, L.; Sideras-Haddad, E. [Schools of Physics, University of Witwatersrand, Johannesburg 2050 (South Africa); Furuno, T.; Kawabata, T. [Departments of Physics, Kyoto University, Sakyo, Kyoto, 606-8502 (Japan); Kamimura, M. [RIKEN Nishina Center, Wako, Saitama, 351-0198 (Japan); Nemulodi, F.; Neveling, R.; Smit, F. D.; Swarts, C. [iThemba Laboratory for Accelerator Based Sciences Somerset, West, 7129 (South Africa)



Nonfactorization in Cabibbo-favored B decays  

Science Journals Connector (OSTI)

We assume universal values for the color-singlet (?1) and color-octet (?8) nonfactorization parameters in B decays. Two sets of color-favored processes and one set of color-suppressed processes were used to give quantitative estimates of these parameters. It has been found (by calculating the branching ratios for a large number of Cabibbo-favored B decays) that the values ?1(?0)=-0.06±0.03 and ?8(?0)=0.12±0.02 improve significantly the predictions of the factorization model.

F. M. Al-Shamali and A. N. Kamal



One-particle inclusive semileptonic B decays  

Science Journals Connector (OSTI)

We propose a method for a QCD based calculation of one-particle inclusive decays of the form B?D¯X or B?D*X. It is based on the heavy mass limit and a short distance expansion of the amplitudes, which yield a power series in the parameter 1/MX2 for the spectra and in ?QCDmb/(mb-mc)2 for the rates. We study the leading term of this expansion for the case of the semileptonic decays B?D¯Xl+?.

Christopher Balzereit and Thomas Mannel



On the neutrinoless double ?{sup +}/EC decays  

SciTech Connect

The neutrinoless double positron-emission/electron-capture (0??{sup +}/EC) decays are studied for the magnitudes of the involved nuclear matrix elements (NMEs). Decays to the ground state, 0{sub gs}{sup +}, and excited 0{sup +} states are discussed. The participant many-body wave functions are evaluated in the framework of the quasiparticle random-phase approximation (QRPA). Effective, G-matrix-derived nuclear forces are used in realistic single-particle model spaces. The channels ?{sup +}?{sup +}, ?{sup +}EC, and the resonant neutrinoless double electron capture (R0?ECEC) are discussed.

Suhonen, Jouni [Department of Physics, P.O. Box 35 (YFL), FI-40014 University of Jyväskylä (Finland)


Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Fission decay in intermediate heavy ion reactions  

SciTech Connect

Results are presented on cross sections, parallel and perpendicular momentum transfers, charge loss and velocity systematics for fission following reactions of Fe and Nb projectiles at 50--100 MeV/A on targets of Ta, Au, and Th. The results at 100 MeV/A are compared to a detailed multistage deexcitation model. The initial collision is modeled with an intranuclear cascade. The resultant excited target residues then undergo a fast preequilibrium decay stage followed by a statistical decay involving nucleon evaporation and fission. Results from this modeling are in reasonable agreement with experimental data. 14 refs., 11 figs.

Britt, H.C.



Decay study of Inm104,g  

Science Journals Connector (OSTI)

The Ing104 and Inm104 nuclei have been produced by means of the following reactions: Cd106(p,3n), Mo92(14N,2n), Mo92(16O,p3n), Mo92(20Ne,3p5n). Their decay has been investigated after mass separation. From ?+, ?, and x direct spectra and ?-?-T, ?-x-T, and ?-?-T coincidences, a Cd104 level scheme has been constructed. The observation of an intense background of statistical ? rays, emitted after strong ? decay to high energy levels, resolves the problems of previously published work concerning ?-ray intensities, spin determinations, and QEC values.

J. Vanhorenbeeck; E. Coenen; P. Decrock; P. Dendooven; K. Deneffe; M. Huyse; G. Reusen; P. Van Duppen; J. Wauters; P. del Marmol



A1-?-? System and ??l?? Decay  

Science Journals Connector (OSTI)

It is pointed out that an accurate experimental determination of the ratio r of the structure-dependent axial-vector to the vector contribution in ??l?? decay can settle the question of subtraction in the dispersion relation for the relevant amplitude which determines the axial-vector contribution in this decay, as well as in the electromagnetic form factor of the pion. Further, it is shown that the value of r is sensitive to the value of the parameter ? which enters into the A1-?-? system for theoretical determination of the A1??? and ??2? widths.

Riazuddin and Fayyazuddin



BaBar: Rare Charmless B Decays  

SciTech Connect

Three two body and two resonance decays of the B mesons have been measured using data from the BABAR detector: B{sup 0} {yields} {pi}{sup {+-}}, K{sup {-+}}, K{sup +}K{sup -}, K{sub S}{sup 0}{pi}{sup +}{pi}{sup -} and B{sup 0} {yields} a{sub 1}{sup +}(1260){pi}{sup -}. The branching ratio and that of some intermediate resonances are presented along with the Cp asymmetry of the decay B{sup 0} {yields} K*{sup +}{pi}{sup -}.

Hutchcroft, D.; /Liverpool U.



Electromagnetic corrections to pseudoscalar decay constants  

E-Print Network (OSTI)

The effects of electromagnetic interactions on pseudoscalar decay constants are investigated. Using a compact QED and QCD action we are able to resolve differences of about 0.1 MeV. We obtain the preliminary results f_pi^0-f_pi^+/- =0.09(3) MeV and f_D^0-f_D^+/- =0.79(11) MeV for light and charmed pseudoscalar decay constants on a N_f=2 nonperturbatively improved Sheikholeslami-Wohlert ensemble.

Benjamin Glaessle; Gunnar S. Bali



Neutrinoless double beta decay and neutrino masses  

Science Journals Connector (OSTI)

Neutrinoless double beta decay (0???) is a promising test for lepton number violating physics beyond the standard model (SM) of particle physics. There is a deep connection between this decay and the phenomenon of neutrino masses. In particular we will discuss the relation between 0??? and Majorana neutrino masses provided by the so-called Schechter-Valle theorem in a quantitative way. Furthermore we will present an experimental cross check to discriminate 0??? from unknown nuclear background using only one isotope i.e. within one experiment.

Michael Duerr



Neutrinoless double beta decay in deformed nuclei: its implications in particle and nuclear physics .  

E-Print Network (OSTI)

??In my thesis, we calculated the Nuclear Matrix Elements (NME) for neutrinoless double beta decay (0??? decay). Neutrinoless double beta decay is a rare nuclear… (more)

Fang, DongLiang



Methods of Using Alpha Channeling Together with Transformer Recharging |  

NLE Websites -- All DOE Office Websites (Extended Search)

Methods of Using Alpha Channeling Together with Transformer Recharging Methods of Using Alpha Channeling Together with Transformer Recharging A tokamak current can be sustained using rf waves for transformer recharging at low density and high-Z with high efficiency if the resistivity is kept high enough during the radio frequency recharging stage. At the same time, operation in the hot ion mode via alpha channeling increases the effective fusion reactivity. The two separate inventions can be made to work synergistically. Specifically, by operating the tokamak in a low-density recharge phase, the lower hybrid wave penetrates the plasma more effectively. High reactivity is obtained by operation in the hot ion mode through the alpha channeling technique. Then, by using a high temperature relaxation stage, not only is the plasma current sustained


City of Alpha, Minnesota (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Alpha, Minnesota (Utility Company) Alpha, Minnesota (Utility Company) Jump to: navigation, search Name City of Alpha Place Minnesota Utility Id 266 Utility Location Yes Ownership M NERC Location MRO Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Commercial Residential Residential Average Rates Residential: $0.0758/kWh Commercial: $0.0957/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=City_of_Alpha,_Minnesota_(Utility_Company)&oldid=409261" Categories:


Energetics of [alpha]-helix formation in peptides and proteins  

E-Print Network (OSTI)

This thesis focuses on the energetics of !-helix formation in peptides and proteins. The [alpha]-helix is the most prevalent type of secondary structure found in proteins, and has arguably dominated our thinking about ...

Schubert, Christian Reinhold



Use of S-. alpha. diagram for representing tokamak equilibrium  

SciTech Connect

A use of the S-{alpha} diagram is proposed as a tool for representing the plasma equilibrium with a qualitative characterization of its stability through pattern recognition. The diagram is an effective tool for visually presenting the relationship between the shear and dimensionless pressure gradient of an equilibrium. In the PBX-M tokamak, an H-mode operating regime with high poloidal {beta} and L-mode regime with high toroidal {beta}, obtained using different profile modification techniques, are found to have distinct S-{alpha} trajectory patterns. Pellet injection into a plasma in the H-mode regime with high toroidal {beta}, obtained using different profile modification techniques, are found to have distinct S-{alpha} trajectory patterns. Pellet injection into a plasma in the H-mode regime results in favorable qualities of both regimes. The {beta} collapse process and ELM event also manifest themselves as characteristic changes in the S-{alpha} pattern.

Takahashi, H.; Chance, M.; Kessel, C.; LeBlanc, B.; Manickam, J.; Okabayashi, M.



Slepton Discovery in Electroweak Cascade Decay  

E-Print Network (OSTI)

The LHC studies on the MSSM slepton sector have mostly been focused on direct slepton Drell-Yan pair production. In this paper, we analyze the case when the sleptons are lighter than heavy neutralinos and can appear in the on-shell decay of neutralino states. In particular, we have studied the \\chi_1^\\pm \\chi_2^0 associated production, with the consequent decays of \\chi_1^\\pm and \\chi_2^0 via on-shell sleptons. The invariant mass of the lepton pairs, m_{\\ell\\ell}, from the neutralino decay has a distinctive triangle shape with a sharp kinematic cutoff. We discuss the utilization of this triangle shape in m_{\\ell\\ell} distribution to identify the slepton signal. We studied the trilepton plus missing E_T signal and obtained the effective cross section, \\sigma \\times BR \\times acceptance, that is needed for a 5\\sigma discovery as a function of the cutoff mass for the LHC with center of mass energy 14 TeV and 100 fb^{-1} integrated luminosity. Our results are model independent such that they could be applied to other models with similar decay topology. When applied to the MSSM under simple assumptions, it is found that with 100 fb^{-1} integrated luminosity, a discovery reach in the left-handed slepton mass of about 600 GeV could be reached, which extends far beyond the slepton mass reach in the usual Drell-Yan studies.

Jonathan Eckel; William Shepherd; Shufang Su



CP violation in charged-kaon decay  

Science Journals Connector (OSTI)

The CP-violating asymmetry [?(K+??+?+?-) -?(K-??-?-?+)]/[? (K+??+?+?-)+?(K- ??-?-?+)] is determined by CP violation in kaon decay amplitudes. We derive an expression for this asymmetry in the standard six-quark model including CP violation from both strong and electromagnetic penguin-type diagrams.

B. Grinstein; Soo-Jong Rey; Mark B. Wise



Nuclear physics aspects of double beta decay  

E-Print Network (OSTI)

Comprehensive description of the phenomenology of the $\\beta\\beta$ decay is given, with emphasis on the nuclear physics aspects. After a brief review of the neutrino oscillation results and of motivation to test the lepton number conservation, the mechanism of the $0\

Petr Vogel



Radioactivity: Olympic Games: dirty and decaying?  

Science Journals Connector (OSTI)

Radioactivity: Olympic Games: dirty and decaying? Awards: SciCast rewards the best in scientific short films Conference: Teachers conference is big in Boston Workshop: Experts and teachers mingle in Mexico Awards: Olympiad holds lavish ceremony Cinema: Indiana Jones has a skull full of physics Conference: ESERA announces Turkish delight for 2009 Forthcoming Events


Muon decay in a laser field  

Science Journals Connector (OSTI)

We investigate the change in the decay rate of a muon caused by embedding it in the field of a laser. A previous paper found that the change could be large, as much as an order of magnitude. We find the more intuitive result that the change is small and give analytic expressions for the small corrections.

Duane A. Dicus; Arsham Farzinnia; Wayne W. Repko; Todd M. Tinsley



Neutrinoless Double $?$-Decay: Status and Future  

E-Print Network (OSTI)

A brief summary of the status of neutrino masses, mixing and oscillations is presented. Neutrinoless double $\\beta$-decay is considered. Predictions for the effective Majorana mass are reviewed. A possible test of the calculations of nuclear matrix elements of the $0\

S. M. Bilenky



Study of Michel spectrum of tau decay  

E-Print Network (OSTI)

This thesis is the beginning of a larger project to use BaBar to examine weak couplings through leptonic [tau] decay. I will use the ratio of Br... and Br... and the Michel parameters [rho] and [eta]. which describe the ...

Ackerman, Nicole (Nicole L.)



Search for rare and forbidden eta ' decays  

E-Print Network (OSTI)

We have searched for rare and forbidden decays of the eta' meson in hadronic events at the CLEO II detector. The search is conducted on 4.80 fb(-1) of e(+)e(-) collisions at 10.6 GeV center-of-mass energy at the Cornell Electron Storage Ring. We...

Ammar, Raymond G.; Baringer, Philip S.; Bean, Alice; Besson, David Zeke; Coppage, Don; Davis, Robin E. P.; Kotov, S.; Kravchenko, I.; Kwak, Nowhan; Zhou, X.



Search for neutrinoless ? decays: ??e? and ????  

E-Print Network (OSTI)

A search for the lepton-family-number-violating decays ??e? and ???? has been performed using CLEO II data. No evidence of a signal has been found and the corresponding upper limits are B(??e?)<2.7×10(-6) and B(????)<3.0×10(-6) at 90% C.L....

Baringer, Philip S.


Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


O?[]O? nuclear ?-decay of ?²Ga  

E-Print Network (OSTI)

The branching ratio for the ?-Decay of ?²Ga to the first excited O? state in ?²Zn has been measured. It is possible to use this branching ratio to test the theoretical method of calculating the [] component of the charge correction term [], which...

Hyman, Bruce Carl



Neutrinoless Double Beta Decay and ??Mass Determination  

Science Journals Connector (OSTI)

The search for Neutrinoless Double Beta Decay could improve our knowledge on neutrino properties. After a brief discussion on the implications of the observation of this rare process I will introduce the experimental approaches and review the prospects of the search for this nuclear transition.

M. Pedretti



Quantum Monte Carlo calculations of neutron-alpha scattering  

E-Print Network (OSTI)

We describe a new method to treat low-energy scattering problems in few-nucleon systems, and we apply it to the five-body case of neutron-alpha scattering. The method allows precise calculations of low-lying resonances and their widths. We find that a good three-nucleon interaction is crucial to obtain an accurate description of neutron-alpha scattering.

Kenneth M. Nollett; Steven C. Pieper; R. B. Wiringa; J. Carlson; G. M. Hale



Characterization of salivary alpha-amylase binding to Streptococcus sanguis  

SciTech Connect

The purpose of this study was to identify the major salivary components which interact with oral bacteria and to determine the mechanism(s) responsible for their binding to the bacterial surface. Strains of Streptococcus sanguis, Streptococcus mitis, Streptococcus mutans, and Actinomyces viscosus were incubated for 2 h in freshly collected human submandibular-sublingual saliva (HSMSL) or parotid saliva (HPS), and bound salivary components were eluted with 2% sodium dodecyl sulfate. By sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western transfer, alpha-amylase was the prominent salivary component eluted from S. sanguis. Studies with {sup 125}I-labeled HSMSL or {sup 125}I-labeled HPS also demonstrated a component with an electrophoretic mobility identical to that of alpha-amylase which bound to S. sanguis. Purified alpha-amylase from human parotid saliva was radiolabeled and found to bind to strains of S. sanguis genotypes 1 and 3 and S. mitis genotype 2, but not to strains of other species of oral bacteria. Binding of ({sup 125}I)alpha-amylase to streptococci was saturable, calcium independent, and inhibitable by excess unlabeled alpha-amylases from a variety of sources, but not by secretory immunoglobulin A and the proline-rich glycoprotein from HPS. Reduced and alkylated alpha-amylase lost enzymatic and bacterial binding activities. Binding was inhibited by incubation with maltotriose, maltooligosaccharides, limit dextrins, and starch.

Scannapieco, F.A.; Bergey, E.J.; Reddy, M.S.; Levine, M.J. (State Univ. of New York, Buffalo (USA))



Measuring CP violation in 3- and 4-body decays  

E-Print Network (OSTI)

Multibody charm decays have a rich phenomenology and potentially unique sensitivity to CP violation. In these proceedings we discuss recent results, challenges and prospects in searches for CP violation in three and four body charm decays.

Jonas Rademacker



Leptonic $D_s$ decays at $B$-factories  

E-Print Network (OSTI)

We review recent measurements of leptonic $D_s$-meson decays performed by Belle and BaBar collaborations. Described measurements enable experimental extraction of the $D_s$-meson decay constant which can be compared with lattice QCD calculations.

A. Zupanc



Sensitivity of CUORE to Neutrinoless Double-Beta Decay  

E-Print Network (OSTI)

Sensitivity of CUORE to Neutrinoless Double-Beta Decay b c,:Results of the Search for Neutrinoless D o u b l e - B e t ah e i n a , Evidence for neutrinoless double beta decay, M o

Alessandria, F.



A Search for Neutrinoless Double Beta Decay of Te-130  

E-Print Network (OSTI)

Bolometric experiments for neutrinoless double beta 3.2.1A Search for Neutrinoless Double Beta Decay of Te by AdamSpring 2010 A Search for Neutrinoless Double Beta Decay of

Bryant, Adam Douglas



Hybrid meson decay from lattice QCD  

E-Print Network (OSTI)

Besides the conventional hadrons containing valence quarks and valence antiquarks, quantum chromodynamics (QCD) suggests the existence of the hybrid hadrons containing valence gluons in addition to the quarks and antiquarks, and some experiments may have found some. A decisive experimental confirmation of its existence, however, is still needed. At present, lattice simulations have offered the practicable ways of theoretically guiding us to search for the hybrid states. In this dissertation, we study the spectroscopy and the decay rate of the heavy hybrid mesons made of a heavy $b$ quark, a heavy $\\bar b$ antiquark, and a gluon ($b\\bar{b}g$) to selected channels, and use lattice methods to extract the transition matrix elements in full QCD. We are particular interested in the spin-exotic hybrid mesons. For sufficiently heavy quarks (e.g., $b$ quark), we use the leading Born-Oppenheimer (LBO) approximation to calculate the static potential energy at all $b\\bar{b}$ separations. Then, by solving the Schr\\"odinger equation with this potential, we reconstruct the motion of the heavy quarks. In a similar way we can determine decay rates. In this dissertation, we use the numerical lattice method to calculate the mass of the $f_0$ meson at a single lattice spacing and light quark mass, namely, $m_{f_0} = (768 \\pm 136)$ MeV. Most of all we consider the decay channels involving the production of a scalar meson. We obtain the partial decay rate ($\\Gamma$) for the channel $ H \\rightarrow \\chi_b + \\pi + \\pi $, namely, $ \\Gamma = 3.62(98)$ MeV. All of our results are consistent with those of other researchers. Knowledge of the masses and the decay rates should help us considerably in experimental searches for the hybrid mesons.

Ziwen Fu



/ Search for Neutrinoless Double Beta Decay with CUORE  

E-Print Network (OSTI)

neutrinoless double beta decay (??0?) in 130 Te and other rare processes. The observation of ??0? would

Elena Ferri


CP violation in fermion pair decays of neutral boson particles  

Science Journals Connector (OSTI)

We study CP violation in fermion pair decays of neutral boson particles with spin 0 or 1. We study a new asymmetry to measure CP violation in ?, KL??+?- decays and discuss the possibility of measuring it experimentally. For the spin-1 particles case, we study CP violation in the decays of J/? to SU(3) octet baryon pairs. We show that these decays can be used to put stringent constraints on the electric dipole moments of ?, ?, and ?.

Xiao-Gang He; J. P. Ma; Bruce McKellar



CP violation for neutral charmed meson decays into CP eigenstates  

Science Journals Connector (OSTI)

The CP asymmetries for the decays of the neutral charmed meson into CP eigenstates are carefully studied. Formulas and numerical...

Dong-Sheng Du



Hadronic B_u and B_d decays  

E-Print Network (OSTI)

I present latest measurements from the B factories of branching fractions for B meson decays to hadronic two- and three-body final states. These include the rate of doubly Cabibbo-suppressed charge states of charmed mesons in two-body decays, charmed baryons and other structure seen in baryonic B decays, and charmless mesonic two-body decays in comparison with estimates from theory.

W. T. Ford



Search for neutrinoless decays of the tau lepton  

E-Print Network (OSTI)

. The upper limits obtained for 22 decay branching fractions are several times more stringent than those set previously....

Ammar, Raymond G.; Ball, S.; Baringer, Philip S.; Bean, Alice; Besson, David Zeke; Coppage, Don; Copty, N.; Davis, Robin E. P.; Hancock, N.; Kelly, M.; Kotov, S.; Kravchenko, I.; Kwak, Nowhan; Lam, H.



Threshold resummed spectra in semi-inclusive B decays  

E-Print Network (OSTI)

I discuss some aspects of the universality of soft gluon dynamics in semileptonic and radiative decays at the threshold region.

Giulia Ricciardi



Norepinephrine infusion with and without alpha-adrenergic blockade by phentolamine increases salivary alpha amylase in healthy men  

Science Journals Connector (OSTI)

AbstractBackground Mental stress reliably induces increases in salivary alpha amylase (sAA), a suggested surrogate marker for sympathetic nervous system (SNS) reactivity. While stress-induced sAA increases correlate with norepinephrine (NE) secretion, a potential mediating role of noradrenergic mechanisms remains unclear. In this study, we investigated for the first time in humans whether a NE-stress-reactivity mimicking NE-infusion with and without alpha-adrenergic blockade by phentolamine would induce changes in sAA. Methods In a single-blind placebo-controlled within-subjects design, 21 healthy men (29–66 years) took part in three different experimental trials varying in terms of substance infusion with a 1-min first infusion followed by a 15-min second infusion: saline-infusion (trial-1), NE-infusion (5 ?g/min) without alpha-adrenergic blockade (trial-2), and with phentolamine-induced non-selective blockade of alpha1- and alpha2-adrenergic receptors (trial-3). Saliva samples were collected immediately before, during, and several times after substance infusion in addition to blood pressure and heart rate readings. Results Experimental trials significantly differed in sAA reactivity to substance-infusion (p = .001) with higher sAA reactivity following NE-infusion with (trial-3; p = .001) and without alpha-adrenergic-blockade (trial-2; p = .004) as compared to placebo-infusion (trial-1); sAA infusion reactivity did not differ between trial-2 and trial-3 (p = .29). Effective phentolamine application was verified by blood pressure and heart rate infusion reactivity. Salivary cortisol was not affected by NE, either with or without alpha-adrenergic-blockade. Conclusions We found that NE-infusion stimulates sAA secretion, regardless of co-administered non-selective alpha-adrenergic blockade by phentolamine, suggesting that the mechanism underlying stress-induced sAA increases may involve NE.

Ulrike Kuebler; Roland von Känel; Nadja Heimgartner; Claudia Zuccarella-Hackl; Guido Stirnimann; Ulrike Ehlert; Petra H. Wirtz



Search for Invisibly Decaying Higgs Bosons with Large Decay Width Using the OPAL Detector at LEP  

E-Print Network (OSTI)

This paper describes a topological search for an invisibly decaying Higgs boson,H, produced via the Bjorken process (e+e- -> HZ). The analysis is based on data recorded using the OPAL detector at LEP at centre-of-mass energies from 183 to 209 GeV corresponding to a total integrated luminosity of 629pb-1. In the analysis only hadronic decays of the Z boson are considered. A scan over Higgs boson masses from 1 to 120 GeV and decay widths from 1 to 3000 GeV revealed no indication for a signal in the data. From a likelihood ratio of expected signal and Standard Model background we determine upper limits on cross-section times branching ratio to an invisible final state. For moderate Higgs boson decay widths, these range from about 0.07pb Mh = 60GeV) to 0.57pb (Mh = 114GeV). For decay widths above 200GeV the upper limits are of the order of 0.15pb. The results can be interpreted in general scenarios predicting a large invisible decay width of the Higgs boson. As an example we interpret the results in the so-called stealthy Higgs scenario. The limits from this analysis exclude a large part of the parameter range of this scenario experimentally accessible at LEP2.

The OPAL collaboration



Measurement of CP Violation in B[0 over s] ? ?? decays  

E-Print Network (OSTI)

A measurement of the decay time-dependent CP-violating asymmetry in B[0 over s] ? ?? decays is presented, along with measurements of the T-odd triple-product asymmetries. In this decay channel, the CP-violating weak phase ...

Counts, Ian Thomas Hunt


Effect of resonance decays on hadron elliptic flows  

E-Print Network (OSTI)

Within the quark coalescence model, we study effects of resonance decays, and of the quark momentum distribution in hadrons, on the elliptic flows of stable hadrons. We find that, with the exception of rho-meson decays, the resonance decays could...

Greco, V.; Ko, Che Ming.



The Majorana Neutrinoless Double-Beta Decay Experiment  

E-Print Network (OSTI)

The Majorana Neutrinoless Double-Beta Decay Experiment Pre-conceptual Design Proposal November 22 Motivation for Neutrinoless Double-Beta Decay Experiments . . . . . . . . . 4 2.1.1 Community Guidance Neutrinoless Double-Beta Decay Results . . . . . . . . . . . . . . . . . . . . 12 2.5 Next

Washington at Seattle, University of - Department of Physics, Electroweak Interaction Research Group

Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Sensitivity of CUORE to Neutrinoless Double-Beta Decay  

E-Print Network (OSTI)

of CUORE to Neutrinoless Double-Beta Decay b c,:L d e f F .s t results on neutrinoless double beta decay of T e w i t hthe study of neutrinoless double beta decay, J . C r y s t .

Alessandria, F.



Purification and characterization of the extracellular alpha-amylase from Streptococcus bovis JB1.  

Science Journals Connector (OSTI)

...alpha-amylase. alpha-Amylase activity on...active on amylopectin as on amylose. The major...extracellular alpha-amylase from Streptococcus...active on amylopectin as on amylose. The major...2.1.1 alpha-Amylases | Amino Acid...

S N Freer



Jet Production in ep Collisions at High $Q^2$ and Determination of $\\alpha_s$  

E-Print Network (OSTI)

The production of jets is studied in deep-inelastic ep scattering at large negative four momentum transfer squared 150alpha_s(M_Z) = 0.1168 +/-0.0007 (exp.) +0.0046/-0.0030 (th.) +/-0.0016(pdf).

Aaron, FD; Alimujiang, K; Andreev, V; Antunovic, B; Asmone, A; Backovic, S; Baghdasaryan, A; Barrelet, E; Bartel, W; Begzsuren, K; Belousov, A; Bizot, J C; Boudry, V; Bozovic-Jelisavcic, I; Bracinik, J; Brandt, G; Brinkmann, M; Brisson, V; Bruncko, D; Bunyatyan, A; Buschhorn, G; Bystritskaya, L; Campbell, A J; Cantun Avila, K B; Cassol-Brunner, F; Cerny, K; Cerny, V; Chekelian, V; Cholewa, A; Contreras, J G; Coughlan, J A; Cozzika, G; Cvach, J; Dainton, J B; Daum, K; Deak, M; de Boer, Y; Delcourt, B; Del Degan, M; Delvax, J; De Roeck, A; De Wolf, E A; Diaconu, C; Dodonov, V; Dossanov, A; Dubak, A; Eckerlin, G; Efremenko, V; Egli, S; Eliseev, A; Elsen, E; Falkiewicz, A; Faulkner, P J W; Favart, L; Fedotov, A; Felst, R; Feltesse, J; Ferencei, J; Fischer, D -J; Fleischer, M; Fomenko, A; Gabathuler, E; Gayler, J; Ghazaryan, Samvel; Glazov, A; Glushkov, I; Goerlich, L; Gogitidze, N; Gouzevitch, M; Grab, C; Greenshaw, T; Grell, B R; Grindhammer, G; Habib, S; Haidt, D; Helebrant, C; Henderson, R C W; Hennekemper, E; Henschel, H; Herbst, M; Herrera, G; Hildebrandt, M; Hiller, K H; Hoffmann, D; Horisberger, R; Hreus, T; Jacquet, M; Janssen, M E; Janssen, X; Jemanov, V; Jonsson, L; Jung, Andreas Werner; Jung, H; Kapichine, M; Katzy, J; Kenyon, I R; Kiesling, C; Klein, M; Kleinwort, C; Kluge, T; Knutsson, A; Kogler, R; Korbel, V; Kostka, P; Kraemer, M; Krastev, K; Kretzschmar, J; Kropivnitskaya, A; Kruger, K; Kutak, K; Landon, M P J; Lange, W; Lastovicka-Medin, G; Laycock, P; Lebedev, A; Leibenguth, G; Lendermann, V; Levonian, S; Li, G; Lipka, K; Liptaj, A; List, B; List, J; Loktionova, N; Lopez-Fernandez, R; Lubimov, V; Lytkin, L; Makankine, A; Malinovski, E; Marage, P; Marti, Ll; Martyn, H -U; Maxfield, S J; Mehta, A; Meyer, A B; Meyer, H; Meyer, H; Meyer, J; Michels, V; Mikocki, S; Milcewicz-Mika, I; Moreau, F; Morozov, A; Morris, J V; Mozer, Matthias Ulrich; Mudrinic, M; Muller, K; Murin, P; Naroska, B; Naumann, Th; Newman, P R; Niebuhr, C; Nikiforov, A; Nowak, G; Nowak, K; Nozicka, M; Olivier, B; Olsson, J E; Osman, S; Ozerov, D; Palichik, V; Panagoulias, I; Pandurovic, M; Papadopoulou, Th; Pascaud, C; Patel, G D; Pejchal, O; Perez, E; Petrukhin, A; Picuric, I; Piec, S; Pitzl, D; Placakyte, R; Pokorny, B; Polifka, R; Povh, B; Preda, T; Radescu, V; Rahmat, A J; Raicevic, N; Raspiareza, A; Ravdandorj, T; Reimer, P; Rizvi, E; Robmann, P; Roland, B; Roosen, R; Rostovtsev, A; Rotaru, M; Ruiz Tabasco, J E; Rurikova, Z; Rusakov, S; Salek, D; Sankey, D P C; Sauter, M; Sauvan, E; Schmitt, S; Schmitz, C; Schoeffel, L; Schoning, A; Schultz-Coulon, H -C; Sefkow, F; Shaw-West, R N; Sheviakov, I; Shtarkov, L N; Shushkevich, S; Sloan, T; Smiljanic, Ivan; Soloviev, Y; Sopicki, P; South, D; Spaskov, V; Specka, Arnd E; Staykova, Z; Steder, M; Stella, B; Stoicea, G; Straumann, U; Sunar, D; Sykora, T; Tchoulakov, V; Thompson, G; Thompson, P D; Toll, T; Tomasz, F; Tran, T H; Traynor, D; Trinh, T N; Truol, P; Tsakov, I; Tseepeldorj, B; Turnau, J; Urban, K; Valkarova, A; Vallee, C; Van Mechelen, P; Vargas Trevino, A; Vazdik, Y; Vinokurova, S; Volchinski, V; von den Driesch, M; Wegener, D; Wissing, Ch; Wunsch, E; Zacek, J; Zalesak, J; Zhang, Z; Zhokin, A; Zimmermann, T; Zohrabyan, H; Zomer, F; Zus, R



Optical Emission Lines from Warm Interstellar Clouds - a Decisive Test of the Decaying Neutrino Theory  

E-Print Network (OSTI)

Recently developed instruments such as the Taurus Tunable Filter and WHAM should be able to detect some or all of the optical emission lines H$\\alpha$, [OI] $\\lambda$6300, [SII] $\\lambda$6717, [NI] $\\lambda$ 5200 and [NII] $\\lambda$6584 from warm interstellar clouds such as those observed by Spitzer $&$ Fitzpatrick (1993) (SF) along the line of sight to the halo star HD93521. The strengths of these lines should resolve the debate as to whether the free electrons, which SF held responsible for the observed excitation of CII in the clouds, are located mainly in the skins of the clouds or in their interiors. If the free electrons are indeed mainly located in the cloud interiors, then the substantial electron density derived by SF, and its constancy from cloud to cloud for the slow-moving clouds, when combined with their opacity to Lyman continuum radiation, lend strong support to the decaying neutrino theory for the ionisation of the interstellar medium (Sciama 1990, 1993 a, b, 1997). If the [OI] and [NI] lines are relatively strong but the [NII] line is weak, then this would lend further, decisive, support to this theory, since decay photons are unable to ionise N, although its ionisation potential is only 0.9 eV greater than that of H.

D. W. Sciama



CP violation in neutral-B decays to CP eigenstates  

Science Journals Connector (OSTI)

CP asymmetries in neutral-B decays to CP eigenstates are studied in the standard model. Whereas usually one assumes a single decay amplitude which induces CP violation via B-B¯ mixing, we investigate additional effects due to two interfering decay amplitudes. We estimate these effects in characteristic cases and suggest ways to experimentally distinguish between these two sources of asymmetries. The effects, which show up as time-integrated asymmetries at symmetric e+e- colliders operating at the ?(4S), are quite small in Kobayashi-Maskawa- (KM) allowed decays such as as Bd0?KS? and become large in KM-suppressed decays.

Michael Gronau



The Isospin Model prediction for multi-pion tau decays  

E-Print Network (OSTI)

The predictions of an isospin model are compared with the branching ratios of the 5 and 6 pion decays of the tau lepton. In both cases, the isospin model suggests that the tau favours decays in which there is an omega resonance. Recent measurements of such tau decays confirm this hypothesis. If the decay of the tau to 7 pions also proceeds through an intermediate omega, then the isospin model predicts that the branching ratio of the tau to seven charged pions should be small when compared with other 7 pion decays. New limits on this mode appear to support this argument.

Randall J. Sobie



What is interesting in eta and eta' Meson Decays?  

E-Print Network (OSTI)

An introduction to the physics of eta and eta' meson decays is given. A historical account of the discovery of the mesons is presented. It is followed by an overview and classification of the common decay modes and the relevance of the mesons for modern hadron and particle physics. In more detail the hadronic decay modes are discussed and in particular some interesting features of the eta-> 3pi0 decay are presented. The last section briefly reviews and compares reactions used to produce the eta and eta' mesons for the studies of their decays.

Andrzej Kupsc



Probing the XYZ states through radiative decays  

Science Journals Connector (OSTI)

In this work, we adopt the spin rearrangement scheme in the heavy quark limit and extensively investigate three classes of the radiative decays: M?(bb¯)+?, (bb¯)?M+?, M?M?+? corresponding to the electromagnetic transitions between one molecular (resonant) state and bottomonium, one bottomonium and molecular (resonant) state, and two molecular (resonant) states, respectively. We also extend the same formalism to study the radiative decays of the molecular (resonant) states with hidden charm. We derive some model-independent ratios when the initial or final states belong to the same spin-flavor multiplet. Future experimental measurement of these ratios will test the molecular picture and explore the underlying structures of the XYZ states.

Li Ma; Zhi-Feng Sun; Xiao-Hai Liu; Wei-Zhen Deng; Xiang Liu; Shi-Lin Zhu



Search for Rare K+ Decays. I. K+??+??¯?  

Science Journals Connector (OSTI)

In a counter experiment at the LBL Bevatron, we have searched for the process K+??+??¯? and have found no evidence for its existence. We have recorded ten events which could be examples of this decay mode, but could also be examples of K+??+?? in which the ? was not detected. Treating these as unidentified events and assuming the ?+ spectrum proposed by Bardin, Bilenky, and Pontecorvo, we obtain a decay rate ?(K+??+??¯?)?6×10-6?(K+?all) (90% confidence level). The data are presented in such a way as to allow calculation of rates for any assumed spectrum. The experiment provides a test for higher-order weak processes and sets constraints on certain first-order models.

C. Y. Pang; R. H. Hildebrand; G. D. Cable; R. Stiening



Search for Neutrinoless Double-Beta Decay  

E-Print Network (OSTI)

After the pioneering work of the Heidelberg-Moscow (HDM) and International Germanium Experiment (IGEX) groups, the second round of neutrinoless double-$\\beta$ decay searches currently underway has or will improve the life-time limits of double-$\\beta$ decay candidates by a factor of two to three, reaching in the near future the $T_{1/2} = 3 \\times 10^{25}$ yr level. This talk will focus on the large-scale experiments GERDA, EXO-200, and KamLAND-Zen, which have reported already lower half-life time limits in excess of $10^{25}$ yr. Special emphasis is given to KamLAND-Zen, which is expected to approach the inverted hierarchy regime before future 1-ton experiments probe completely this life-time or effective neutrino-mass regime, which starts at $\\approx 2 \\times 10^{26}$ yr or $\\approx 50$ meV.

Tornow, Werner



Baryon number violation in particle decays  

Science Journals Connector (OSTI)

It has been argued in the past that in baryogenesis via out-of-equilibrium decays one must consider loop diagrams that contain more than one baryon number violating coupling. In this paper we argue that the requirement with regard to baryon number violating couplings in loop diagrams is that the interaction between the intermediate on-shell particles and the final particles should correspond to a net change in baryon number and that this can be satisfied even if the loop diagram contains only one baryon number violating coupling. Put simply, we show that to create a baryon asymmetry there should be net B violation to the right of the “cut” in the loop diagram. This is of relevance to some works involving the out-of-equilibrium decay scenario.

Rathin Adhikari and Raghavan Rangarajan



Searches for very rare decays of kaons  

SciTech Connect

The physics motivation for searches for very rare kaon decays, either forbidden or suppressed within the Standard Model, is briefly discussed. Simple arguments conclude that such searches probe possible new forces at a 200 TeV mass scale or constitute a precision test of the electroweak model. The examples of such process are decays of K{sub L}{sup 0} {yields} {mu} {sup {+-}}e{sup -+}, K{sup +} {yields} {pi}{sup +} {mu}{sup +} e{sup -}, K{sub L}{sup 0} {yields} {mu}{sup +} {mu}{sup -}, and K{sup +} {yields} {pi} {yields} {pi}{sup +}{nu}{bar {nu}}. We present the current experimental status and describe the new efforts to reach sensitivities down to one part in 10{sup 12}. The discussion is focused on the experimental program at the Alternating Gradient Synchrotron at Brookhaven National Laboratory, where intense beams make such studies possible.

Lang, K. [Univ. of Texas, Austin, TX (United States)



Search for ? mesons in ? lepton decay  

E-Print Network (OSTI)

f b21 of data collected with the CLEO II detector. We find model-dependent upper limits on the branching fractions in the range B(t2!fp2n t ),(1.222.0)31024 and B(t2!fK2n t ),(5.426.7)31025 at 90% confidence level. @S0556-2821~97!50603-5# PACS number...~s!: 13.35.Dx, 12.39.2x, 12.40.Vv, 14.40.Cs I. INTRODUCTION A measurement of the decay t2!fp2n t @1# is of inter- est as it may provide clues to the workings of QCD at the 1 GeV/c2 mass scale. This decay mode may serve @2# as a valuable source...

Baringer, Philip S.



Invisible Decays of Supersymmetric Higgs Bosons  

Science Journals Connector (OSTI)

We study the detection of the complete spectrum of Higgs bosons of the minimal supersymmetric standard model through their decays into chargino (?? i ± ) and neutralinos (?? i o ) for several parametric scenarios. In the minimal supersymmetric model there are two charginos and four neutralinos and the Higgs boson spectrum contains three neutral scalars two CP?even ( h 0 and H 0 with m H 0 >m h 0 ) and one CP?odd ( A 0 with m A 0 as a free parameter); as well as a charged pair (H ± ). An interesting signal comes from the decays of the Higgs bosons into invisible SUSY modes ( h 0 H 0 A 0 ??? 1 o ?? 1 o ) which could be detected at present and future high energy machines.

M. del R. Aparicio Méndez; J. E. Barradas Guevara; O. Félix Beltrán



Axions from cosmic string and wall decay  

SciTech Connect

If inflation occurred with a reheat temperature > T{sub PQ}, axions from the decay of global axion strings and domain walls would make an important contribution to the cosmological energy density, comparable to that from vacuum misalignment. Several groups have numerically studied the evolution of axion strings and walls in the past, however substantial uncertainties remain in their contribution to the present density {Omega}{sub a,string+wall} {approx} 1-100 (f{sub a}/10{sup 12} GeV){sup 7/6}, where f{sub a} is the axion decay constant. I will describe the numerical methods used in our simulations and show results for several string and wall configurations.

Hagmann, C A



Electroweak Corrections to the Top Quark Decay  

E-Print Network (OSTI)

We have calculated the one-loop electroweak corrections to the decay t-> bW+, including the counterterm for the CKM matrix elements V(tb). Previous calculations used an incorrect delta V(tb) that led to a gauge dependent amplitude. However, since the contribution stemming from delta V(tb) is small, those calculations only underestimate the width by roughly one part in 10^5.

S. M. Oliveira; L. Bruecher; R. Santos; A. Barroso



New Constraints on the 18F(p,alpha) 15O Rate in Novae from the (d,p) Reaction  

E-Print Network (OSTI)

The degree to which the (p,gamma) and (p,alpha) reactions destroy 18F at temperatures 1-4x10^8 K is important for understanding the synthesis of nuclei in nova explosions and for using the long-lived radionuclide 18F, a target of gamma-ray astronomy, as a diagnostic of nova mechanisms. The reactions are dominated by low-lying proton resonances near the 18F+p threshold (E_x=6.411 MeV in 19Ne). To gain further information about these resonances, we have used a radioactive 18F beam from the Holifield Radioactive Ion Beam Facility to selectively populate corresponding mirror states in 19F via the inverse d(18F,p)19F neutron transfer reaction. Neutron spectroscopic factors were measured for states in 19F in the excitation energy range 0-9 MeV. Widths for corresponding proton resonances in 19Ne were calculated using a Woods-Saxon potential. The results imply significantly lower 18F(p,gamma)19Ne and 18F(p,alpha)15O reaction rates than reported previously, thereby increasing the prospect of observing the 511-keV annihilation radiation associated with the decay of 18F in the ashes ejected from novae.

R. L. Kozub; D. W. Bardayan; J. C. Batchelder; J. C. Blackmon; C. R. Brune; A. E. Champagne; J. A. Cizewski; T. Davinson; U. Greife; C. J. Gross; C. C. Jewett; R. J. Livesay; Z. Ma; B. H. Moazen; C. D. Nesaraja; L. Sahin; J. P. Scott; D. Shapira; M. S. Smith; J. S. Thomas; P. J. Woods



3alpha clustering in the excited states of 16C  

E-Print Network (OSTI)

The alpha cluster states of 16C are investigated by using the antisymmetrized molecular dynamics. It is shown that two different types of alpha cluster states exist: triangular and linear-chain states. The former has an approximate isosceles triangular configuration of alpha particles surrounded by four valence neutrons occupying sd-shell, while the latter has the linearly aligned alpha particles with two sd-shell neutrons and two pf-shell neutrons. It is found that the structure of the linear-chain state is qualitatively understood in terms of the 3/2 pi- and 1/2 sigma- molecular orbit as predicted by molecular-orbital model, but there exists non-negligible Be+alpha+2n correlation. The band-head energies of the triangular and linear-chain rotational bands are 8.0 and 15.5 MeV, and the latter is close to the He+Be threshold energy. It is also shown that the linear-chain state becomes the yrast sstate at J=10 with excitation energy 27.8 MeV owing to its very large moment-of-inertia comparable with hyperdeformation.

T. Baba; Y. Chiba; M. Kimura



The Particle Adventure | Particle decays and annihiliations | Neutron beta  

NLE Websites -- All DOE Office Websites (Extended Search)

Particle decays and annihiliations > Neutron beta Particle decays and annihiliations > Neutron beta decays Neutron beta decays A neutron (udd) decays to a proton (uud), an electron, and an antineutrino. This is called neutron beta decay. (The term beta ray was used for electrons in nuclear decays because they didn't know they were electrons!) Frame 1: The neutron (charge = 0) made of up, down, down quarks. Frame 2: One of the down quarks is transformed into an up quark. Since the down quark has a charge of -1/3 and and the up quark has a charge of 2/3, it follows that this process is mediated by a virtual W- particle, which carries away a (-1) charge (thus charge is conserved!) Frame 3: The new up quark rebounds away from the emitted W-. The neutron now has become a proton. Frame 4: An electron and antineutrino emerge from the virtual W- boson.


Calculated secondary yields for proton broadband using DECAY TURTLE  

SciTech Connect

The calculations for the yields were done by Al Sondgeroth and Anthony Malensek. The authors used the DECAY deck called PBSEC{_}E.DAT from the CMS DECKS library. After obtaining the run modes and calibration modes from the liaison physicist, they made individual decay runs, using DECAY TURTLE from the CMS libraries and a production spectrum subroutine which was modified by Anthony, for each particle and decay mode for all particle types coming out of the target box. Results were weighted according to branching ratios for particles with more than one decay mode. The production spectra were produced assuming beryllium as the target. The optional deuterium target available to broadband will produce slightly higher yields. It should be noted that they did not include pion yields from klong decays because they could not simulate three body decays. Pions from klongs would add a very small fraction to the total yield.

Sondgeroth, A.


Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Resummed hadronic spectra of inclusive B decays  

Science Journals Connector (OSTI)

In this paper we investigate the hadronic mass spectra of inclusive B decays. Specifically, we study how an upper cut on the invariant mass spectrum, which is necessary to extract Vub, results in the breakdown of the standard perturbative expansion due to the existence of large infrared logs. We first show how the decay rate factorizes at the level of the double differential distribution. Then, we present closed form expressions for the resummed cut rate for the inclusive decays B?Xs? and B?Xue? at next-to-leading order in the infrared logs. Using these results, we determine the range of cuts for which resummation is necessary, as well as the range for which the resummed expansion itself breaks down. We also use our results to extract the leading and next to leading infrared log contribution to the two loop differential rate. We find that for the phenomenologically interesting cut values, there is only a small region where the calculation is under control. Furthermore, the size of this region is sensitive to the parameter ?¯. We discuss the viability of extracting Vub from the hadronic mass spectrum.

Adam K. Leibovich; Ian Low; I. Z. Rothstein



Formation and decay of a spheromak plasma  

Science Journals Connector (OSTI)

The magnetic properties of the spheromak configuration produced by a combination of slow theta and Z discharges in the University of Maryland Spheromak experiment (MS) are reported. The magnetic structure of the plasma in MS has been mapped out by arrays of passive magnetic pickup coils. The Taylor relaxation process is observed during the formation phase. The magnetic profile evolves in such a way that the ratio of poloidal current I p to poloidal flux ? in the plasma approaches a constant value where ?0 I p =k el ?. When the spheromak is formed the magnetic field configuration is close to Taylor’s minimum energy state ?0 j=kB. This constant k is related to the size of the spheromak produced. A spheromak with 1.0 T maximum field corresponding to 650 kA poloidal current has been produced in MS. However due to the high plasma density (6–8×1020 m?3) and the presence of low?Z impurities (mainly carbon and oxygen) the plasma is radiation dominated with electron temperature ?15 eV. The magnetic field decays exponentially during the decay phase. Axisymmetric equilibrium states that could exist in the configuration are calculated with a Grad–Shafranov equilibrium code. Comparison of the numerical calculation with the experimental measurements indicates that the magnetic?field structure stays close to the equilibrium state as the plasma decays.

C. Chin?Fatt; A. W. DeSilva; G. C. Goldenbaum; R. Hess; C. Coté; A. Filuk; J.?L. Gauvreau; F. K. Hwang



Age-dependent decay in the landscape  

E-Print Network (OSTI)

The picture of the "multiverse" arising in diverse cosmological scenarios involves transitions between metastable vacuum states. It was pointed out by Krauss and Dent that the transition rates decrease at very late times, leading to a dependence of the transition probability between vacua on the age of each vacuum region. I investigate the implications of this non-Markovian, age-dependent decay on the global structure of the spacetime in landscape scenarios. I show that the fractal dimension of the eternally inflating domain is precisely equal to 3, instead of being slightly below 3 in scenarios with purely Markovian, age-independent decay. I develop a complete description of a non-Markovian landscape in terms of a nonlocal master equation. Using this description I demonstrate by an explicit calculation that, under some technical assumptions about the landscape, the probabilistic predictions of our position in the landscape are essentially unchanged, regardless of the measure used to extract these predictions. I briefly discuss the physical plausibility of realizing non-Markovian vacuum decay in cosmology in view of the possible decoherence of the metastable quantum state.

Sergei Winitzki



Neutralino decays at the CERN LHC  

Science Journals Connector (OSTI)

We study the distribution of lepton pairs from the second lightest neutralino decay ??20???10l+l-. This decay mode is important to measure the mass difference between ??20 and the lightest neutralino ??10, which helps to determine the parameters of the minimal supersymmetric standard model at the CERN LHC. We found that the decay distribution strongly depends on the values of underlying MSSM parameters. For some extreme cases, the amplitude near the end point of the lepton invariant mass distribution can be suppressed so strongly that one needs the information of the whole mll distribution to extract m??20-m??10. On the other hand, if systematic errors on the acceptance can be controlled, this distribution can be used to constrain slepton masses and the Z??20??10 coupling. Measurements of the velocity distribution of ??20 from samples near the end point of the mll distribution, and of the asymmetry of the pT of leptons, would be useful to reduce the systematic errors.

Mihoko M. Nojiri and Youichi Yamada



It's Elemental - Isotopes of the Element Magnesium  

NLE Websites -- All DOE Office Websites (Extended Search)

Sodium Sodium Previous Element (Sodium) The Periodic Table of Elements Next Element (Aluminum) Aluminum Isotopes of the Element Magnesium [Click for Main Data] Most of the isotope data on this site has been obtained from the National Nuclear Data Center. Please visit their site for more information. Naturally Occurring Isotopes Mass Number Natural Abundance Half-life 24 78.99% STABLE 25 10.00% STABLE 26 11.01% STABLE Known Isotopes Mass Number Half-life Decay Mode Branching Percentage 19 4.0 picoseconds Double Proton Emission 100.00% 20 90.8 milliseconds Electron Capture 100.00% Electron Capture with delayed Proton Emission ~ 27.00% 21 122 milliseconds Electron Capture 100.00% Electron Capture with delayed Proton Emission 32.60% Electron Capture with delayed Alpha Decay < 0.50%


Ly-alpha emission from GRB host galaxies  

E-Print Network (OSTI)

Ly-alpha emission is indicative of on-going star formation in a dust-poor environment. Ly-alpha imaging is therefore a probe of the star formation rate and of the dust-content of Gamma-Ray Burst host galaxies. Both of these parameters are central to our understanding of GRB progenitors and of how the environments affect the propagation of afterglow emission out of host galaxies. We have started a program aimed at imaging high redshift (z>2) host galaxies of GRBs at the Ly-alpha resonance line from neutral hydrogen. Here were report the results from imaging of the fields of GRB 000301C and GRB 000926 and outline upcoming observations of further hosts.

J. P. U. Fynbo; P. Moller; B. Thomsen; J. Hjorth; J. Gorosabel; M. I. Andersen; M. P. Egholm; S. Holland; B. L Jensen; H. Pedersen; M. Weidinger



Continuous air monitor for alpha-emitting aerosol particles  

SciTech Connect

A new alpha Continuous Air Monitor (CAM) sampler is being developed for use in detecting the presence of alpha-emitting aerosol particles. The effort involves design, fabrication and evaluation of systems for the collection of aerosol and for the processing of data to speciate and quantify the alpha emitters of interest. At the present time we have a prototype of the aerosol sampling system and we have performed wind tunnel tests to characterize the performance of the device for different particle sizes, wind speeds, flow rates and internal design parameters. The results presented herein deal with the aerosol sampling aspects of the new CAM sampler. Work on the data processing, display and alarm functions is being done in parallel with the particle sampling work and will be reported separately at a later date. 17 refs., 5 figs., 3 tabs.

McFarland, A.R.; Ortiz, C.A. (Texas A and M Univ., College Station, TX (USA). Dept. of Mechanical Engineering); Rodgers, J.C.; Nelson, D.C. (Los Alamos National Lab., NM (USA))



Indirect Measurements for (p,{alpha}) Reactions Involving Boron Isotopes  

SciTech Connect

Light elements lithium, beryllium and boron (LiBeB) were used in the last years as 'possible probe' for a deeper understanding of some extra-mixing phenomena occurring in young Main-Sequence stars. They are mainly destroyed by (p,{alpha}) reactions and cross section measurements for such channels are then needed. The Trojan Horse Method (THM) allows one to extract the astrophysical S(E)-factor without the experience of tunneling through the Coulomb barrier. In this work a resume of the recent results about the {sup 11}B(p,{alpha}{sub 0}){sup 8}Be and {sup 10}B(p,{alpha}){sup 7}Be reactions is shown.

Lamia, L.; Spitaleri, C.; Romano, S.; Cherubini, S.; Crucilla, V.; Gulino, M.; La Cognata, M.; Pizzone, R. G.; Puglia, S. M. R.; Sergi, M. L.; Tudisco, S.; Tumino, A. [Laboratori Nazionali del Sud, Catania (Italy); Dipartimento di Metodologie Fisiche e Chimiche per l'Ingegneria, Universita di Catania, Catania (Italy); Carlin, N.; Szanto, M. G. del; Liguori Neto, R.; Moura, M. M. de; Munhoz, M. G.; Souza, F. A.; Suaide, A. A. P.; Szanto, E. [Departamento de Fisica Nuclear, Universitade de Sao Paulo, Sao Paulo (Brazil)] (and others)



Automated docking of {alpha}-(1,4)- and {alpha}-(1,6)-linked glucosyl trisaccharides in the glucoamylase active site  

SciTech Connect

Low-energy conformers of five {alpha}-(1,4)- and {alpha}-(1,6)-linked glucosyl trisaccharides were flexibly docked into the glucoamylase active site using AutoDock 2.2. To ensure that all significant conformational space was searched, the starting trisaccharide conformers for docking were all possible combinations of the corresponding disaccharide low-energy conformers. All docked trisaccharides occupied subsites {minus}1 and +1 in very similar modes to those of corresponding nonreducing-end disaccharides. For linear substrates, full binding at subsite +2 occurred only when the substrate reducing end was {alpha}-(1,4)-linked, with hydrogen-bonding with the hydroxy-methyl group being the only polar interaction there. Given the absence of other important interactions at this subsite, multiple substrate conformations are allowed. For the one docked branched substrate, steric hindrance in the {alpha}-(1,6)-glycosidic oxygen suggests that the active-site residues have to change position for hydrolysis to occur. Subsite +1 of the glucoamylase active site allows flexibility in binding but, at least in Aspergillus glucoamylases, subsite +2 selectively binds substrates {alpha}-(1,4)-linked between subsites +1 and +2. Enzyme engineering to limit substrate flexibility at subsite +2 could improve glucoamylase industrial properties.

Countinho, P.M.; Reilly, P.J. [Iowa State Univ., Ames, IA (United States). Dept. of Chemical Engineering; Dowd, M.K. [Dept. of Agriculture, New Orleans, LA (United States). Southern Regional Research Center



Study of the Pygmy Dipole Resonance in {sup 124}Sn by means of the ({alpha},{alpha}'{gamma}) reaction  

SciTech Connect

In recent years {alpha}-{gamma} coincidence experiments at 136 MeV incident energy on {sup 48}Ca, {sup 140}Ce, {sup 138}Ba and {sup 124}Sn were performed at the KVI in Groningen to study the isospin character of electric dipole excitations below the particle threshold, frequently called Pygmy Dipole Resonance (PDR). An array of HPGe {gamma}-detectors has been used in coincidence with the Big-Bite Spectrometer (BBS) and a resolution of about 10 keV in the {gamma}-ray energy has been achieved. The results show that the excitation patterns of the PDR in the ({alpha},{alpha}') reaction seem to differ significantly from results obtained in Nuclear Resonance Fluorescence (NRF)({gamma},{gamma}') measurements. The PDR, which until now has been assigned to one excitation mode, splits up into two parts: One that is excited in ({alpha},{alpha}'{gamma}) and ({gamma},{gamma}') reactions (denoting a dominant isoscalar character), and one that is only excited in ({gamma},{gamma}')(denoting a dominant isovector character). This indicates that two different excitation mechanisms produce these low-lying E1 excitations [1], The preliminary results of the latest measurements on the N = 82 nucleus {sup 138}Ba and the Z = 50 nucleus {sup 124}Sn show that this break up into two parts is a common feature of the PDR in semi-magic nuclei.

Endres, J.; Zilges, A. [Institut fuer Kernphysik, Universitaet zu Koeln (Germany); Pietralla, N.; Savran, D.; Sonnabend, K. [Institut fuer Kernphysik, TU Darmstadt (Germany); Harakeh, M. N.; Stoica, V.; Woertche, H. [Kernfysisch Versneller Instituut, University of Groningen (Netherlands); Butler, P.; Herzberg, R. D.; Scheck, M. [Department of Physics, University of Liverpool (United Kingdom); Kruecken, R. [Physik-Department E12, TU Muenchen (Germany); Popescu, L. [SCK-CEN, Mol (Belgium); Harissopulos, S.; Lagoyannis, A. [I.N.P. NCSR Demokritos, Athens (Greece)



Evaluation of Melt-Grown, ZnO Single Crystals for Use as Alpha-Particle Detectors  

SciTech Connect

As part of an ongoing investigation of the scintillation properties of zinc-oxide-based scintillators, several melt-grown, ZnO single crystals have been characterized using -particle excitation, infrared reflectance, and room temperature photoluminescence. The crystals, grown by Cermet, Inc. using a pressurized melt growth process, were doped with Group 1 elements (Li), Group 2 elements (Mg), Group 3 elements (Ga, In) and Lanthanides (Gd, Er, Tm). The goals of these studies are to better understand the scintillation mechanisms associated with various members of the ZnO scintillator family and to then use this knowledge to improve the radiation detection capabilities of ZnO-based scintillators. One application for which ZnO is particularly well suited as a scintillator is as the associated particle detector in a deuterium-tritium (D-T) neutron generator. Application requirements include the exclusion of organic materials, outstanding timing resolution, and high radiation resistance. ZnO(Ga) and ZnO(In) have demonstrated fast (sub-nanosecond) decay times with relatively low light yields, and ZnO(Ga) has been used in a powder form as the associated particle detector for a D-T neutron generator. Four promising candidate materials, ZnO, ZnO:Ga, ZnO:In,Li, and ZnO:Er,Li, were identified in this study. These four samples demonstrated sub-nanosecond decay times and alpha particle excited luminescence comparable to BC-400 fast plastic scintillator. The ZnO:Mg,Ga, ZnO:Gd, and ZnO:Li samples demonstrated appreciable slow (microsecond) decay components that would be incompatible with high-counting-rate applications.

Neal, John S [ORNL; Giles, N. C. [West Virginia University; Yang, Xiaocheng [West Virginia University; Wall, R. Andrew [Wake Forest University, Winston-Salem, NC; Ucer, Burak [Wake Forest University, Winston-Salem, NC; Williams, Richard T. [Wake Forest University, Winston-Salem, NC; Wisniewski, Dariusz J [ORNL; Boatner, Lynn A [ORNL; Rengarajan, Varatharajan [ORNL; Nause, Jeff E [ORNL; Nemeth, Bell [Cermet, Inc., Atlanta



Inclusive-jet photoproduction at HERA and determination of alphas  

E-Print Network (OSTI)

Inclusive-jet cross sections have been measured in the reaction ep->e+jet+X for photon virtuality Q2 energies in the region 142 energy, ETjet, and pseudorapidity, etajet, for jets with ETjet > 17 GeV and -1 energy-scale dependence of the coupling was determined. The value of alphas(Mz) extracted from the measurements based on the kT jet algorithm is alphas(Mz) = 0.1206 +0.0023 -0.0022 (exp.) +0.0042 -0.0035 (th.); the results from the anti-kT and SIScone algorithms are compatible with this value and have a similar precision.

ZEUS Collaboration; H. Abramowicz; I. Abt; L. Adamczyk; M. Adamus; R. Aggarwal; S. Antonelli; P. Antonioli; A. Antonov; M. Arneodo; V. Aushev; Y. Aushev; O. Bachynska; A. Bamberger; A. N. Barakbaev; G. Barbagli; G. Bari; F. Barreiro; N. Bartosik; D. Bartsch; M. Basile; O. Behnke; J. Behr; U. Behrens; L. Bellagamba; A. Bertolin; S. Bhadra; M. Bindi; C. Blohm; V. Bokhonov; T. Bold; K. Bondarenko; E. G. Boos; K. Borras; D. Boscherini; D. Bot; I. Brock; E. Brownson; R. Brugnera; N. Brummer; A. Bruni; G. Bruni; B. Brzozowska; P. J. Bussey; B. Bylsma; A. Caldwell; M. Capua; R. Carlin; C. D. Catterall; S. Chekanov; J. Chwastowski; J. Ciborowski; R. Ciesielski; L. Cifarelli; F. Cindolo; A. Contin; A. M. Cooper-Sarkar; N. Coppola; M. Corradi; F. Corriveau; M. Costa; G. D'Agostini; F. Dal Corso; J. del Peso; R. K. Dementiev; S. De Pasquale; M. Derrick; R. C. E. Devenish; D. Dobur; B. A. Dolgoshein; G. Dolinska; A. T. Doyle; V. Drugakov; L. S. Durkin; S. Dusini; Y. Eisenberg; P. F. Ermolov; A. Eskreys; S. Fang; S. Fazio; J. Ferrando; M. I. Ferrero; J. Figiel; M. Forrest; B. Foster; G. Gach; A. Galas; E. Gallo; A. Garfagnini; A. Geiser; I. Gialas; A. Gizhko; L. K. Gladilin; D. Gladkov; C. Glasman; O. Gogota; Yu. A. Golubkov; P. Gottlicher; I. Grabowska-Bold; J. Grebenyuk; I. Gregor; G. Grigorescu; G. Grzelak; O. Gueta; M. Guzik; C. Gwenlan; T. Haas; W. Hain; R. Hamatsu; J. C. Hart; H. Hartmann; G. Hartner; E. Hilger; D. Hochman; R. Hori; K. Horton; A. Huttmann; Z. A. Ibrahim; Y. Iga; R. Ingbir; M. Ishitsuka; H. -P. Jakob; F. Januschek; T. W. Jones; M. Jungst; I. Kadenko; B. Kahle; S. Kananov; T. Kanno; U. Karshon; F. Karstens; I. I. Katkov; M. Kaur; P. Kaur; A. Keramidas; L. A. Khein; J. Y. Kim; D. Kisielewska; S. Kitamura; R. Klanner; U. Klein; E. Koffeman; N. Kondrashova; O. Kononeko; P. Kooijman; Ie. Korol; I. A. Korzhavina; A. Kotanski; U. Kotz; H. Kowalski; O. Kuprash; M. Kuze; A. Lee; B. B. Levchenko; A. Levy; V. Libov; S. Limentani; T. Y. Ling; M. Lisovyi; E. Lobodzinska; W. Lohmann; B. Lohr; E. Lohrmann; K. R. Long; A. Longhin; D. Lontkovskyi; O. Yu. Lukina; J. Maeda; S. Magill; I. Makarenko; J. Malka; R. Mankel; A. Margotti; G. Marini; J. F. Martin; A. Mastroberardino; M. C. K. Mattingly; I. -A. Melzer-Pellmann; S. Mergelmeyer; S. Miglioranzi; F. Mohamad Idris; V. Monaco; A. Montanari; J. D. Morris; K. Mujkic; B. Musgrave; K. Nagano; T. Namsoo; R. Nania; A. Nigro; Y. Ning; T. Nobe; U. Noor; D. Notz; R. J. Nowak; A. E. Nuncio-Quiroz; B. Y. Oh; N. Okazaki; K. Oliver; K. Olkiewicz; Yu. Onishchuk; K. Papageorgiu; A. Parenti; E. Paul; J. M. Pawlak; B. Pawlik; P. G. Pelfer; A. Pellegrino; W. Perlanski; H. Perrey; K. Piotrzkowski; P. Plucinski; N. S. Pokrovskiy; A. Polini; A. S. Proskuryakov; M. Przybycien; A. Raval; D. D. Reeder; B. Reisert; Z. Ren; J. Repond; Y. D. Ri; A. Robertson; P. Roloff; I. Rubinsky; M. Ruspa; R. Sacchi; U. Samson; G. Sartorelli; A. A. Savin; D. H. Saxon; M. Schioppa; S. Schlenstedt; P. Schleper; W. B. Schmidke; U. Schneekloth; V. Schonberg; T. Schorner-Sadenius; J. Schwartz; F. Sciulli; L. M. Shcheglova; R. Shehzadi; S. Shimizu; I. Singh; I. O. Skillicorn; W. Slominski; W. H. Smith; V. Sola; A. Solano; D. Son; V. Sosnovtsev; A. Spiridonov; H. Stadie; L. Stanco; N. Stefaniuk; A. Stern; T. P. Stewart; A. Stifutkin; P. Stopa; S. Suchkov; G. Susinno; L. Suszycki; J. Sztuk-Dambietz; D. Szuba; J. Szuba; A. D. Tapper; E. Tassi; J. Terron; T. Theedt; H. Tiecke; K. Tokushuku; J. Tomaszewska; V. Trusov; T. Tsurugai; M. Turcato; O. Turkot; T. Tymieniecka; M. Vazquez; A. Verbytskyi; O. Viazlo; N. N. Vlasov; R. Walczak; W. A. T. Wan Abdullah; J. J. Whitmore; L. Wiggers; M. Wing; M. Wlasenko; G. Wolf; H. Wolfe; K. Wrona; A. G. Yagues-Molina; S. Yamada; Y. Yamazaki; R. Yoshida; C. Youngman; O. Zabiegalov; A. F. Zarnecki; L. Zawiejski; O. Zenaiev; W. Zeuner; B. O. Zhautykov; N. Zhmak; C. Zhou; A. Zichichi; Z. Zolkapli; D. S. Zotkin



Taking the Band Function Too Far: A Tale of Two $\\alpha$'s  

E-Print Network (OSTI)

The long standing problem of identifying the emission mechanism operating in gamma-ray bursts (GRBs) has produced a myriad of possible models that have the potential of explaining the observations. Generally, the empirical Band function is fit to the observed gamma-ray data and the fit parameters are used to infer which radiative mechanisms are at work in GRB outflows. In particular, the distribution of the Band function's low-energy power law index, $\\alpha$, has led to the so-called synchrotron "line-of-death" (LOD) which is a statement that the distribution cannot be explained by the simplest of synchrotron models alone. As an alternatively fitting model, a combination of a blackbody in addition to the Band function is used, which in many cases provide a better or equally good fit. It has been suggested that such fits would be able to alleviate the LOD problem for synchrotron emission in GRBs. However, these conclusions rely on the Band function's ability to fit a synchrotron spectrum within the observed e...

Burgess, J Michael; Yu, Hoi-Fung




SciTech Connect

It is well known that nonideal magnetohydrodynamic (MHD) effects are important in the dynamics of molecular clouds: both ambipolar diffusion and possibly the Hall effect have been identified as significant. We present the results of a suite of simulations with a resolution of 512{sup 3} of turbulent decay in molecular clouds, incorporating a simplified form of both ambipolar diffusion and the Hall effect simultaneously. The initial velocity field in the turbulence is varied from being super-Alfvenic and hypersonic, through to trans-Alfvenic but still supersonic. We find that ambipolar diffusion increases the rate of decay of the turbulence increasing the decay from t {sup -1.25} to t {sup -1.4}. The Hall effect has virtually no impact in this regard. The power spectra of density, velocity, and the magnetic field are all affected by the nonideal terms, being steepened significantly when compared with ideal MHD turbulence with exponents. The density power-spectra components change from {approx}1.4 to {approx}2.1 for the ideal and nonideal simulations respectively, and power spectra of the other variables all show similar modifications when nonideal effects are considered. Again, the dominant source of these changes is ambipolar diffusion rather than the Hall effect. There is also a decoupling between the velocity field and the magnetic field at short length scales. The Hall effect leads to enhanced magnetic reconnection, and hence less power, at short length scales. The dependence of the velocity dispersion on the characteristic length scale is studied and found not to be power law in nature.

Downes, T. P. [School of Cosmic Physics, Dublin Institute for Advanced Studies, 31 Fitzwilliam Place, Dublin 2 (Ireland); O'Sullivan, S. [National Centre for Plasma Science and Technology, Dublin City University, Glasnevin, Dublin 9 (Ireland)], E-mail: turlough.downes@dcu.ie



Production and decay of heavy top quarks  

SciTech Connect

Experimental evidence indicates that the top quark exists and has a mass between 50 and 200 GeV/c{sup 2}. The decays of a top quark with a mass in this range are studied with emphasis placed on the mass region near the threshold for production of real W bosons. Topics discussed are: (1) possible enhancement of strange quark production when M{sub W} + m{sub s} < m{sub t} < M{sub W} + m{sub b}; (2) exclusive decays of T mesons to B and B{asterisk} mesons using the non-relativistic quark model; (3) polarization of intermediate W's in top quark decay as a source of information on the top quark mass. The production of heavy top quarks in an e{sup +}e{sup {minus}} collider with a center-of-mass energy of 2 TeV is studied. The effective-boson approximation for photons, Z{sup 0}'s and W's is reviewed and an analogous approximation for interfaces between photons and Z{sup 0}'s is developed. The cross sections for top quark pair production from photon-photon, photon-Z{sup 0}, Z{sup 0}Z{sup 0}, and W{sup +}W{sup {minus}} fusion are calculated using the effective-boson approximation. Production of top quarks along with anti-bottom quarks via {gamma}W{sup +} and Z{sup 0}W{sup +} fusion is studied. An exact calculation of {gamma}e{sup +} {yields} {bar {nu}}t{bar b} is made and compared with the effective-W approximation. 31 refs., 46 figs.

Kauffman, R.P.



Chapter Advisor E-mail Alpha Delta Pi Courtney O'Neill-Chapter Advisor courtneyoneill2004@yahoo.com  

E-Print Network (OSTI)

Chapter Advisor E-mail Alpha Delta Pi Courtney O'Neill- Chapter Advisor courtneyoneill2004@yahoo.com Alpha Delta Pi Kendra Stewart-On Campus stewartk@cofc.edu Alpha Epsilon Pi Alex Green - Chapter Advisor Magwood- Chapater Advisor graymag7@bellsouth.net Alpha Kappa Alpha Debbie Counts-On-Campus countsd

Kunkle, Tom


First in-beam observation of excited states in {sup 156}{sub 72}Hf{sub 84} using the recoul-decay tagging method  

SciTech Connect

Excited states in the proton rich nuclide {sup 156}{sub 72}Hf{sub 84} were observed for the first time using the {sup 102}({sup 58}Ni, 2p2n){sup 156}Hf reaction at 270 MeV. Gamma rays were detected with the AYEBALL array of Compton suppressed Ge detectors, placed in front of the Fragment Mass Analyzer, and were assigned to individual reaction charmers using the Recoil-Decay Tagging Method. Prompt {gamma}-ray cascades were associated with the alpha decay of both the ground state and the 8{sup +} isomeric state in {sup 156}Hf. The level scheme constructed for {sup 156}Hf is compared with level schemes of lighter even-even N=84 isotones and is discussed within the framework of the Shell Model.

Seweryniak, D.; Ahmad, H.; Amro, D.J. [and others



Rare b hadron decays at the LHC  

E-Print Network (OSTI)

With the completion of Run~I of the CERN Large Hadron Collider, particle physics has entered a new era. The production of unprecedented numbers of heavy-flavoured hadrons in high energy proton-proton collisions allows detailed studies of flavour-changing processes. The increasingly precise measurements allow to probe the Standard Model with a new level of accuracy. Rare $b$ hadron decays provide some of the most promising approaches for such tests, since there are several observables which can be cleanly interpreted from a theoretical viewpoint. In this article, the status and prospects in this field are reviewed, with a focus on precision measurements and null tests.

Blake, T; Hiller, G



Neutrinoless Double Beta Decay with Composite Neutrinos.  

E-Print Network (OSTI)

We study in detail the contribution of heavy composite Majorana neutrinos to neutrino-less double beta decay (0???). Our analysis confirms the result of a previous estimate by two of the authors. Excited neutrinos couple to the electroweak gauge bosons through a magnetic type effective Lagrangian. The relevant nuclear matrix element is related to matrix elements available in the literature and current bounds on the half-life of 0??? are converted into bounds on the compositeness scale and/or the heavy neutrino mass. Our bounds are of the same order of magnitude as those available from accelerator experiments.

O. Panella (a; C. Carimalo (b; Y. N. Srivastava (a; A. Widom (c



Dental Decay Among Texas School Children.  

E-Print Network (OSTI)

or five decades. A vast amount of attention especially in the past ten years has been given to the subject of dental defects and their causes. Investigations include both numerous surveys and many experiments for which usually animals, but nes human... physicians and elementary super- visors knew of no hygenic program in the school at or prior to the time of this study there that might have had an influence on the dental conditions found. The marked susceptibility of the 6-year molar to decay...

Whitacre, Jessie (Jessie Opal)


Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Measurements of Relative K Radiative Decay Rates  

Science Journals Connector (OSTI)

Relative radiative decay rates were measured for K-shell vacancies for elements between Z=62 and 92 with a high-resolution Ge(Li) spectrometer. The ratios ?2?1, ?1??1, and ?2??1 (Siegbahn notation) were determined, with ?2?1 significantly higher (4-14%) than those reported by Beckman but in excellent agreement with recent Hartree-Slater calculations of Scofield. The ratios ?1??1 and ?2??1 do not agree with either Beckman's experiment or Scofield's calculations.

P. J. Ebert and V. W. Slivinsky



Neutrino Oscillations, Neutrinoless Double Beta Decay  

Science Journals Connector (OSTI)

We review the experimental evidence for neutrino mixing and neutrino mass. Searches for possible branches into heavy neutrinos do not reveal evidence for static mixing with branching ratios larger than 10?4 to 10?6. Similarly neutrino oscillation experiments show no evidence for dynamic mixing in various oscillation channels. Stringent limits for ? e disappearance from a recent reactor experiment are presented. Results from neutrinoless double beta decay provide sensitive test for Majorana mass and right?hand couplings the present limits being 3–10 eV and 10?5 respectively.

F. Boehm



Neutrinoless double ? decay with composite neutrinos  

Science Journals Connector (OSTI)

We study in detail the contribution of heavy composite Majorana neutrinos to neutrinoless double beta decay (0???). Our analysis confirms the result of a previous estimate by two of the authors. Excited neutrinos couple to the electroweak gauge bosons through a magnetic-type effective Lagrangian. The relevant nuclear matrix element is related to matrix elements available in the literature and current bounds on the half-life of 0??? are converted into bounds on the compositeness scale and/or the heavy neutrino mass. Our bounds are of the same order of magnitude as those available from accelerator experiments.

O. Panella; C. Carimalo; Y. N. Srivastava; A. Widom



Inclusive B decays from resummed perturbation theory.  

E-Print Network (OSTI)

ar X iv :h ep -p h/ 07 03 03 6v 1 4 M ar 2 00 7 Inclusive B decays from resummed perturbation theory Einan Gardi Cavendish Laboratory, University of Cambridge, J J Thomson Avenue, Cambridge, CB3 0HE, UK and Department of Applied Mathematics... for the experimentally–relevant branching fractions can be derived from resummed perturbation theory and explain the way in which the resummation further provides guidance in parametrizing non-perturbative Fermi–motion effects. Finally I address the comparison between...

Gardi, Einan


BRIDGE: Branching Ratio Inquiry/Decay Generated Events  

E-Print Network (OSTI)

We present the manual for the program BRIDGE: Branching Ratio Inquiry/Decay Generated Events. The program is designed to operate with arbitrary models defined within matrix element generators, so that one can simulate events with small final-state multiplicities, decay them with BRIDGE, and then pass them to showering and hadronization programs. BRI can automatically calculate widths of two and three body decays. DGE can decay unstable particles in any Les Houches formatted event file. DGE is useful for the generation of event files with long decay chains, replacing large matrix elements by small matrix elements followed by sequences of decays. BRIDGE is currently designed to work with the MadGraph/MadEvent programs for implementing and simulating new physics models. In particular, it can operate with the MadGraph implementation of the MSSM. In this manual we describe how to use BRIDGE, and present a number of sample results to demonstrate its accuracy.

Patrick Meade; Matthew Reece



Bulk Viscosity, Decaying Dark Matter, and the Cosmic Acceleration  

E-Print Network (OSTI)

We discuss a cosmology in which cold dark-matter particles decay into relativistic particles. We argue that such decays could lead naturally to a bulk viscosity in the cosmic fluid. For decay lifetimes comparable to the present hubble age, this bulk viscosity enters the cosmic energy equation as an effective negative pressure. We investigate whether this negative pressure is of sufficient magnitude to account fo the observed cosmic acceleration. We show that a single decaying species in a flat, dark-matter dominated cosmology without a cosmological constant cannot reproduce the observed magnitude-redshift relation from Type Ia supernovae. However, a delayed bulk viscosity, possibly due to a cascade of decaying particles may be able to account for a significant fraction of the apparent cosmic acceleration. Possible candidate nonrelativistic particles for this scenario include sterile neutrinos or gauge-mediated decaying supersymmetric particles.

James R. Wilson; Grant J. Mathews; George M. Fuller



Young alpha-enriched giant stars in the solar neighbourhood  

E-Print Network (OSTI)

We derive age constraints for 1639 red giants in the APOKASC sample for which seismic parameters from Kepler, as well as effective temperatures, metallicities and [{\\alpha}/Fe] values from APOGEE DR12 are available. We investigate the relation between age and chemical abundances for these stars, using a simple and robust approach to obtain ages. We first derive stellar masses using standard seismic scaling relations, then determine the maximum possible age for each star as function of its mass and metallicity, independently of its evolutionary stage. While the overall trend between maximum age and chemical abundances is a declining fraction of young stars with increasing [{\\alpha}/Fe], at least 14 out of 241 stars with [{\\alpha}/Fe]>0.13 are younger than 6 Gyr. Five stars with [{\\alpha}/Fe]>0.2 have ages below 4 Gyr. We examine the effect of modifications in the standard seismic scaling relations, as well as the effect of very low helium fractions, but these changes are not enough to make these stars as old a...

Martig, Marie; Aguirre, Victor Silva; Hekker, Saskia; Mosser, Benoit; Elsworth, Yvonne; Bovy, Jo; Stello, Dennis; Anders, Friedrich; García, Rafael A; Tayar, Jamie; Rodrigues, Thaíse S; Basu, Sarbani; Carrera, Ricardo; Ceillier, Tugdual; Chaplin, William J; Chiappini, Cristina; Frinchaboy, Peter M; García-Hernández, D A; Hearty, Fred R; Holtzman, Jon; Johnson, Jennifer A; Mathur, Savita; Mészáros, Szabolcs; Miglio, Andrea; Nidever, David; Pinsonneault, Marc; Schiavon, Ricardo P; Schneider, Donald P; Serenelli, Aldo; Shetrone, Matthew; Zamora, Olga



Zinc oxide nanoparticles as novel alpha-amylase inhibitors  

Science Journals Connector (OSTI)

Amylase inhibitors also known as starch blockers contain substances that prevent dietary starches from being absorbed by the body via inhibiting breakdown of complex sugars to simpler ones. In this sense these materials are projected as having potential applications in diabetes control. In this context we report on zinc oxide nanoparticles as possible alpha-amylase inhibitors. Zinc oxide nanoparticles have been synthesized using soft-chemistry approach and 1-thioglycerol was used as a surfactant to yield polycrystalline nanoparticles of size ? 18 ? nm stabilized in wurtzite structure. Conjugation study and structural characterization have been done using x-ray diffraction technique Fourier transform infrared spectroscopy UV-visible spectroscopy and transmission electron microscopy. Cytotoxicity studies on human fibrosarcoma (HT-1080) and skin carcinoma (A-431) cell lines as well as mouse primary fibroblast cells demonstrate that up to a dose of 20 ? ? g / ml ZnOnanoparticles are nontoxic to the cells. We report for the first time the alpha-amylase inhibitory activity of ZnOnanoparticles wherein an optimum dose of 20 ? ? g / ml was sufficient to exhibit 49% glucose inhibition at neutral p H and 35 ? ° C temperature. This inhibitory activity was similar to that obtained with acarbose (a standard alpha-amylase inhibitor) thereby projecting ZnOnanoparticles as novel alpha-amylase inhibitors.

Sandip Dhobale; Trupti Thite; S. L. Laware; C. V. Rode; Soumya J. Koppikar; Ruchika-Kaul Ghanekar; S. N. Kale



CRAD, Management- Oak Ridge National Laboratory TRU ALPHA LLWT Project  

Energy.gov (U.S. Department of Energy (DOE))

A section of Appendix C to DOE G 226.1-2 "Federal Line Management Oversight of Department of Energy Nuclear Facilities." Consists of Criteria Review and Approach Documents (CRADs) used for a November 2003 assessment of the Management Program portion of an Operational Readiness Review of the Oak Ridge National Laboratory TRU ALPHA LLWT Project.



SciTech Connect

High-resolution spectroscopic observations of {alpha} Hya were acquired between 2003 and 2010. Analysis of line shifts, differential shifts, line widths, and line bisectors points to two regimes of velocity fields in the photosphere of {alpha} Hya: (1) normal granulation embedded in (2) large convection cells. Variations occur on a wide range of timescales, from several years on down. Radial velocity variations, which are irregular and span 786 m s{sup -1}, have a distribution consistent with a true mean rise velocity of the large cells of {approx}725 m s{sup -1} and a dispersion of {approx}220 m s{sup -1}. The distribution of granulation velocities, as measured from the widths of spectral lines, shows only small variations, consistent with the two regime concepts. On the multi-year timescale, radial velocity changes, small temperature variations ({approx}10 K), and small line-width variations ({approx}<0.8%) track each other, possibly with phase shifts. The granulation velocity gradient for {alpha} Hya is about half as large as the Sun's and no variation with time was seen, implying that any variation in velocity gradient from one large cell to the next must be less than a few percent. The asymmetry in the granulation velocity distribution, as specified in the flux deficit, is smaller than expected for {alpha} Hya's position in the HR diagram and appears to be variable.

Gray, David F., E-mail: dfgray@uwo.ca [Department of Physics and Astronomy, University of Western Ontario, London, Ontario N6A 3K7 (Canada)



The coronal Ne/O abundance of alpha Centauri  

E-Print Network (OSTI)

Recent improvements in the modeling of solar convection and line formation led to downward revisions of the solar photospheric abundances of the lighter elements, which in turn led to changes in the radiative opacity of the solar interior and hence to conflicts with the solar convection zone depth as inferred from helioseismic oscillation frequencies. An increase of the solar Ne/O abundance to values as observed for nearby stars has been proposed as a solution. Because of the absence of strong neon lines in the optical, neon abundances are difficult to measure and the correct solar and stellar Ne/O abundances are currently hotly debated. Based on X-ray spectra obtained with XMM-Newton, we determine a reference value of Ne/O for the inactive, solar-like star alpha Cen (primarily alpha Cen B, which is the dominant component in X-rays), with three independent, line-based methods, using differential emission measure reconstruction and an emission measure-independent method. Our results indicate a value of approx. 0.28 for Ne/O in alpha Cen, approximately twice the value measured for the Sun, but still below the average value obtained for other stars. The low Ne/O abundance of the Sun is peculiar when compared to alpha Cen and other stars; our results emphasize the necessity to obtain more and accurate Ne/O abundance measurements of low activity stars.

C. Liefke; J. H. M. M. Schmitt



Physics of alpha channelling and related TFTR experiments  

E-Print Network (OSTI)

Physics of alpha channelling and related TFTR experiments N.J. Fisch Princeton Plasma Physics in magnetic fusion research centred on attaining plasmas close to thermonuclear condi- tions. Of particular interest was the heating of the plasma to thermonuclear temperatures, say, to at least 10 ke


Preparation of {alpha},{beta}-unsaturated carboxylic acids and esters  

DOE Patents (OSTI)

Disclosed is a process for the preparation of {alpha},{beta}-unsaturated carboxylic acids and esters thereof which comprises contacting formaldehyde or a source of formaldehyde with a carboxylic acid, ester or anhydride in the presence of a catalyst comprising an oxide of niobium.

Gogate, M.R.; Spivey, J.J.; Zoeller, J.R.



Probing Alpha-Vacua of Black Holes in LHC  

E-Print Network (OSTI)

Motivated by the idea of alpha-vacua in Schwarzschild spacetime, we studied the deformed spectrum of Hawking radiation. Such a deformation would leave signatures on the small black hole evaporation in LHC because their vacuum deviates from the Unruh state.

Tower Wang



Turtle With Mad Input (trace Unlimited Rays Through Lumped Elements) -- A Computer Program For Simulating Charged Particle Beam Transport Systems And Decay Turtle Including Decay Calculations  

E-Print Network (OSTI)

Turtle With Mad Input (trace Unlimited Rays Through Lumped Elements) -- A Computer Program For Simulating Charged Particle Beam Transport Systems And Decay Turtle Including Decay Calculations

Carey, D C



On the Alpha Activity of Natural Tungsten Isotopes  

E-Print Network (OSTI)

The indication for the ? decay of 180W with a half-life T ? 1/2 =1.1+0.8 ?0.4(stat)±0.3(syst)×1018 yr has been observed for the first time with the help of the super-low background 116CdWO4 crystal scintillators. In conservative approach the lower limit on half-life of 180W has been established as T ? 1/2 (180W) ? 0.7×1018 yr at 90 % C.L. Besides, new T ? 1/2 bounds were set for ? decay of

F. A. Danevich A; A. Sh. Georgadze A; V. V. Kobychev A; S. S. Nagorny A; A. S. Nikolaiko A; W


Preparation of NIF Scale Poly ((alpha)-METHYLSTYRENE) Mandrels  

SciTech Connect

All planned National Ignition Facility (NIF) capsule targets except machined beryllium require a plastic mandrel upon which the ablator is applied. This mandrel must at least meet if not exceed the symmetry and surface finish requirements of the final capsule. The mandrels are produced by a two-step process. In the first step a thin-walled poly({alpha}-methylstyrene)(P{alpha}MS) shell is produced using microencapsulation techniques. This shell is overcoated with 10 to 15 {micro}m of glow discharge polymer (GDP) and then pyrolyzed at 300 C. This pyrolysis causes the P{alpha}MS to depolymerize to gas phase monomer that diffuses away through the more thermally stable plasma polymer shell, which retains all the symmetry of the original P{alpha}MS shell. Thus our challenge has been to produce 2-mm-diameter P{alpha}MS shells to serve as these initial ''decomposable'' mandrels that meet or exceed the current NIF design specifications. The basic microencapsulation process used in producing P{alpha}MS mandrels involves using a droplet generator to produce a water droplet (Wl) encapsulated by a fluorobenzene solution of P{alpha}MS (O), this compound droplet being suspended in a stirred aqueous bath (W2). Historically this bath has contained poly(vinyl alcohol) (PVA, 88% hydrolyzed, mol. wt. {approx}25,000 g/mol) to prevent agglomeration of the initially fluid compound droplets. As the compound droplets are stirred in the bath, the fluorobenzene solvent slowly dissipates leaving a solid P{alpha}MS shell. The internal water is subsequently removed by low temperature drying. We found using these techniques that 2-mm shells could easily be produced, however their low mode sphericity did not meet design specifications. In our last published report we detailed how replacement of the PVA with poly(acrylic acid) (PAA) resulted in a major improvement in sphericity due to a greatly increased interfacial tension between the bath and the compound droplet, relative to the use of PVA as the bath additive. P{alpha}MS mandrels produced using PAA in the bath along with slow curing to suppress Marangoni convection that was perturbing the mode 10 to 20 symmetry resulted in 2-mm-diameter P{alpha}MS shells with mode 2 out-of-round{sup 10} (OOR) of {approx}0.5 {micro}m (as well as non-concentricity (NC) < 1%) which meet the capsule design requirements. A representative set of equatorial traces produced by our AFM-based Spheremapper along with the computed power spectrum is shown in Figure 1 for an average shell. Although the power spectrum is at or below the design specification at nearly all modes one can see in the traces some degree of roughness which manifests itself at the very high modes in the power spectrum.

Takagi, M; Cook, R; McQuillan, B; Elsner, F; Stephens, R; Nikroo, A; Paguio, S



New physics in CP asymmetries and rare B decays  

Science Journals Connector (OSTI)

We review and update the effects of physics beyond the standard model on CP asymmetries in B decays. These asymmetries can be significantly altered if there are important new-physics contributions to Bq0-Bq0¯ mixing. This same new physics will, therefore, also contribute to rare, flavor-changing B decays. Through a study of such decays, we show that it is possible to partially distinguish the different models of new physics.

Michael Gronau and David London



Flavor-changing decays of the Z into heavy neutrinos  

Science Journals Connector (OSTI)

We consider flavor-changing decays of the Z boson to a fourth-generation heavy neutrino and a light neutrino, which are induced at one loop in the standard model. Such decays have a characteristic monojet signature which makes them readily distinguished experimentally, unlike flavor-changing decays involving quarks. Like other such one-loop processes, however, they are very rare when reasonable mixing angles and intermediate fermion masses are considered.

Frederick J. Gilman and Sun H. Rhie



On charm and beauty decays: A theorist's perspective  

SciTech Connect

The present understanding of charm and bottom decays is reviewed. Special emphasis is placed on discussing the theoretical uncertainties in view of the particularly rich harvest of new data from the last year. A semi-quantitative description of D decays has emerged enabling us to address rather detailed and relatively subtle questions there, like on once and twice Cabibbo suppressed decays. Beauty physics having left its infancy is now in its adolescence; its future development towards maturity is analyzed.

Bigi, I.I.


Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Neutrinoless double beta decay search with the NEMO 3 experiment  

Science Journals Connector (OSTI)

The NEMO 3 experiment searches for neutrinoless double beta decay and makes precision measurements of two?neutrino double beta decay in seven isotopes. The latest two?neutrino half?life results are presented together with the limits on neutrinoless half?lives and the corresponding effective Majorana neutrino masses. Also given are the limits obtained on neutrinoless double beta decay mediated by R p ?violating SUSY right?hand currents and different Majoron emission modes.

Irina Nasteva; NEMO collaboration




SciTech Connect

The nearby star {alpha} Oph (Ras Alhague) is a rapidly rotating A5IV star spinning at {approx} 89% of its breakup velocity. This system has been imaged extensively by interferometric techniques, giving a precise geometric model of the star's oblateness and the resulting temperature variation on the stellar surface. Fortuitously, {alpha} Oph has a previously known stellar companion, and characterization of the orbit provides an independent, dynamically based check of both the host star and the companion mass. Such measurements are crucial to constrain models of such rapidly rotating stars. In this study, we combine eight years of adaptive optics imaging data from the Palomar, AEOS, and CFHT telescopes to derive an improved, astrometric characterization of the companion orbit. We also use photometry from these observations to derive a model-based estimate of the companion mass. A fit was performed on the photocenter motion of this system to extract a component mass ratio. We find masses of 2.40{sup +0.23}{sub -0.37} M{sub sun} and 0.85{sup +0.06}{sub -0.04} M{sub sun} for {alpha} Oph A and {alpha} Oph B, respectively. Previous orbital studies of this system found a mass too high for this system, inconsistent with stellar evolutionary calculations. Our measurements of the host star mass are more consistent with these evolutionary calculations, but with slightly higher uncertainties. In addition to the dynamically derived masses, we use IJHK photometry to derive a model-based mass for {alpha} Oph B, of 0.77 {+-} 0.05 M{sub sun} marginally consistent with the dynamical masses derived from our orbit. Our model fits predict a periastron passage on 2012 April 19, with the two components having a 50 mas separation from 2012 March to May. A modest amount of interferometric and radial velocity data during this period could provide a mass determination of this star at the few percent level.

Hinkley, Sasha; Hillenbrand, Lynne; Crepp, Justin R. [Department of Astronomy, California Institute of Technology, 1200 E. California Blvd., MC 249-17, Pasadena, CA 91125 (United States); Monnier, John D. [Astronomy Department, University of Michigan, 941 Dennison Bldg., Ann Arbor, MI 48109-1090 (United States); Oppenheimer, Ben R.; Brenner, Douglas; Sivaramakrishnan, Anand [Astrophysics Department, American Museum of Natural History, Central Park West at 79th Street, New York, NY 10024 (United States); Roberts, Lewis C. Jr; Zhao Ming; Vasisht, Gautam; Pueyo, Laurent [Jet Propulsion Laboratory, California Institute of Technology, 4800 Oak Grove Dr., Pasadena, CA 91109 (United States); Ireland, Michael [School of Physics, University of Sydney, NSW 2006 (Australia); Zimmerman, Neil [Department of Astronomy, Columbia University, 550 West 120th Street, New York, NY 10027 (United States); Parry, Ian R. [Institute of Astronomy, University of Cambridge, Madingley Road, Cambridge CB3 0HA (United Kingdom); Martinache, Frantz [National Astronomical Observatory of Japan, Subaru Telescope, Hilo, HI 96720 (United States); Lai, Olivier [CFHT Corp., 65-1238 Mamalahoa Hwy., Kamuela, HI 96743 (United States); Soummer, Remi [STScI, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Beichman, Charles [NASA Exoplanet Science Institute, California Institute of Technology, Pasadena, CA 91125 (United States); Lloyd, James P.; Bernat, David [Department of Astronomy, Cornell University, Ithaca, NY 14853 (United States)



Searches for Leptonic B Decays at BaBar  

SciTech Connect

Measurements of the branching fractions of purely leptonic decays of B-mesons translate into constraints in the plane of the charged Higgs mass versus tan {beta} which are relatively insensitive to the particular theoretical model. Using the full BABAR dataset of 450 million B-decays we search for these decays. No significant signal is found in the decays into electrons or muons and we set upper limits on the branching fractions of the order of a 10{sup -6} at 90% confidence level. We measure the branching fraction of B {yields} {tau}{mu} to be (1.7 {+-} 0.6) x 10{sup -4}.

Nelson, Silke; /SLAC



Physicists Challenge Reports of Accelerated Decay of Nuclear...  

NLE Websites -- All DOE Office Websites (Extended Search)

Physicists Challenge Reports of Accelerated Decay of Nuclear Excited State LIVERMORE, Calif.-Physicists from the Lawrence Livermore National Laboratory, in collaboration with...


CP violation for neutral charmed meson decays to CP eigenstates  

E-Print Network (OSTI)

CP asymmetries for neutral charmed meson decays to CP eigenstates are carefully studied. The formulas and numerical results are presented. The impact on experiments is briefly discussed.

Dongsheng Du



What can we learn from neutrinoless double beta decay experiments?  

E-Print Network (OSTI)

We assess how well next generation neutrinoless double beta decay and normal neutrino beta decay experiments can answer four fundamental questions. 1) If neutrinoless double beta decay searches do not detect a signal, and if the spectrum is known to be inverted hierarchy, can we conclude that neutrinos are Dirac particles? 2) If neutrinoless double beta decay searches are negative and a next generation ordinary beta decay experiment detects the neutrino mass scale, can we conclude that neutrinos are Dirac particles? 3) If neutrinoless double beta decay is observed with a large neutrino mass element, what is the total mass in neutrinos? 4) If neutrinoless double beta decay is observed but next generation beta decay searches for a neutrino mass only set a mass upper limit, can we establish whether the mass hierarchy is normal or inverted? We base our answers on the expected performance of next generation neutrinoless double beta decay experiments and on simulations of the accuracy of calculations of nuclear matrix elements.

John N. Bahcall; Hitoshi Murayama; Carlos Pena-Garay



Lattice Boltzmann simulations of decaying homogeneous isotropic turbulence  

Science Journals Connector (OSTI)

Decaying homogeneous isotropic turbulence in inertial and rotating reference frames is investigated to evaluate the capability of the lattice Boltzmann method in turbulence. In the inertial frame case, the decay exponents of kinetic energy and dissipation and the low wave-number scaling of the spectrum are studied. The results are in agreement with classical ones. In the frame-rotation case, simulations show that the energy decay rate decreases with decreasing Rossby number as the energy cascade is inhibited by rotation, again in agreement with turbulence physics. These results clearly indicate that the lattice Boltzmann method captures important features of decaying turbulence.

Huidan Yu; Sharath S. Girimaji; Li-Shi Luo



Search for New Physics in Rare Top Decays  

E-Print Network (OSTI)

Top physics provides a fertile ground for new-physics searches. At present, most top observables appear to be in good agreement with the respective Standard Model predictions. However, in the case of decay modes that are suppressed in the Standard Model, new-physics contributions of comparable magnitude may exist and yet go unnoticed because their impact on the total decay width is small. Hence it is interesting to probe rare top decays. This analysis focuses on the decay $t \\to b \\bar b c$. Useful observables are identified and prospects for measuring new-physics parameters are examined.

Pratishruti Saha



Event generator for J/? and ?(2S) decay  

Science Journals Connector (OSTI)

We have developed a Monte Carlo generator for simulating charmonium J/? and ?(2S) inclusive decay. In the model, charmonium decay via gluons is described by the QCD partonic theory, and the partonic hadronization is handled by the LUND model. Extended C- and G-parity conservation are assumed and abnormal suppression effects of charmonium decay are included. This model reproduces the properties of hadronic events in the charmonium inclusive decay, such as the branching ratios of hadronic resonance, the ratios of stable hadrons and the radiative products, and as the global properties of hadronic events.

J. C. Chen, G. S. Huang, X. R. Qi, D. H. Zhang, and Y. S. Zhu




SciTech Connect

The author briefly reviews recent progress in rare kaon decays, where he takes ''rare'' to mean those with {Beta} < {Omicron}(10{sup -7}).




Remarks on the formation and decay of multidimensional shock waves  

E-Print Network (OSTI)

In this paper, we present a formula describing the formation and decay of shock wave type solutions in some special cases.

V. G. Danilov



Role of deformation in exotic decay studies  

SciTech Connect

We have recently constructed a model for exotic decay studies using a cubic potential for the overlapping region that is smoothly connected by a Yukawa-plus-exponential potential for the region after separation. In this model, the zero-point vibration energy is explicitly used without violating the energy conservation and the inertial mass coefficient is made dependent on the center of mass distance, but the deformation effect has not been included. In this work, it is taken into account in both the parent and the daughter nuclei, keeping the emitted nucleus always spherical. This model is applied to the cases of {sup 14}C and {sup 24}Ne emissions and also for the recently reported cases of {sup 26}Ne, {sup 28,30}Mg, and {sup 34}Si emissions. It is found that the effect of the fragment deformation (which is always very small in the above decays) on lifetime is negligible while the parent deformation plays an appreciable role in the lifetime calculations.

Shanmugam, G.; Kamalaharan, B. (Department of Physics, Presidency College, Madras 600 005, India (IN))



Scaling, Intermittency and Decay of MHD Turbulence  

E-Print Network (OSTI)

We discuss a few recent developments that are important for understanding of MHD turbulence. First, MHD turbulence is not so messy as it is usually believed. In fact, the notion of strong non-linear coupling of compressible and incompressible motions along MHD cascade is not tenable. Alfven, slow and fast modes of MHD turbulence follow their own cascades and exhibit degrees of anisotropy consistent with theoretical expectations. Second, the fast decay of turbulence is not related to the compressibility of fluid. Rates of decay of compressible and incompressible motions are very similar. Third, viscosity by neutrals does not suppress MHD turbulence in a partially ionized gas. Instead, MHD turbulence develops magnetic cascade at scales below the scale at which neutrals damp ordinary hydrodynamic motions. Forth, density statistics does not exhibit the universality that the velocity and magnetic field do. For instance, at small Mach numbers the density is anisotropic, but it gets isotropic at high Mach numbers. Fifth, the intermittency of magnetic field and velocity are different. Both depend on whether the measurements are done in local system of reference oriented along the local magnetic field or in the global system of reference related to the mean magnetic field.

A. Lazarian; J. Cho



Invisible Higgs Decays from Higgs Graviscalar Mixing  

E-Print Network (OSTI)

We recompute the invisible Higgs decay width arising from Higgs-graviscalar mixing in the ADD model, comparing the original derivation in the non-diagonal mass basis to that in a diagonal mass basis. The results obtained are identical (and differ by a factor of 2 from the original calculation) but the diagonal-basis derivation is pedagogically useful for clarifying the physics of the invisible width from mixing. We emphasize that both derivations make it clear that a direct scan in energy for a process such as $WW\\to WW$ mediated by Higgs plus graviscalar intermediate resonances would follow a {\\it single} Breit-Wigner form with total width given by $\\Gamma^{tot}=\\Gamma_h^{SM}+\\Gamma_{invisible}$. We also compute the additional contributions to the invisible width due to direct Higgs to graviscalar pair decays. We find that the invisible width due to the latter is relatively small unless the Higgs mass is comparable to or larger than the effective extra-dimensional Planck mass.

Daniele Dominici; John F. Gunion



E-Print Network 3.0 - alpha particle driven Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

A275A283. Printed in the UK PII: S0741-3335(97)81172-4 Alpha-particle physics in the tokamak fusion test reactor Summary: . 5. Alpha-particle instabilities A search for the...


Trans-chalcone: a novel small molecule inhibitor of mammalian alpha-amylase  

Science Journals Connector (OSTI)

Trans...-chalcone (1,3-diphenyl-2-propen-1-one), a biphenolic core structure of flavonoids precursor was tested for inhibitory activity toward alpha-amylase. Porcine pancreatic alpha-amylase was ...

Mahmoud Najafian; Azadeh Ebrahim-Habibi; Nastaran Hezareh…



E-Print Network 3.0 - alpha 1-adrenoceptor binding Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

of alpha-methyl d-glucopyranoside. Biochem J 109... binding site in hog pancreatic alpha-amylase. Biochemistry 15, 1987-93. 57 Sevilla, N., Steer, M. L... ., Helmreich, E....


Characterization and molecular cloning of thermostable alpha-amylase from Streptomyces sp.To1  

Science Journals Connector (OSTI)

A new thermophilic Streptomyces...sp. TO1, isolated from Tunisian soil, produced a thermostable alpha-amylase and pullulanase. The gene encoding for the alpha-amylase activity was cloned into the multicopy clonin...

Lotfi Mellouli; Raoudha Ghorbel; Alya Kammoun; Monia Mezghani…



Determination of alpha-amylase activity in dextran, ficoll and polyethylene glycol solutions  

Science Journals Connector (OSTI)

A new insoluble chromolytic substrate for the spectrophotometric determination of alpha-amylase activity (starch cross-linked with 1,4 ... phase-forming polymers interfere with some commonly used alpha-amylase as...

Ivo Šafa?ík; Miroslava Šafa?íková


E-Print Network 3.0 - alpha inhibits growth Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Miller,W., and Lipman,D.J. (1997) Summary: of the inhibition of alpha-glucosidase, alpha-amylase, and cyclomaltodextrin glucanosyltransferase by acarbose... ,W., Tanguy,M.,...

Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


EIS-0305: Treating Transuranic (TRU)/Alpha Low-Level at the Oak...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

05: Treating Transuranic (TRU)Alpha Low-Level at the Oak Ridge National Laboratory, Oak Ridge, Tennessee EIS-0305: Treating Transuranic (TRU)Alpha Low-Level at the Oak Ridge...


EIS-0305: Treating Transuranic (TRU)/Alpha Low-Level at the Oak...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

305: Treating Transuranic (TRU)Alpha Low-Level at the Oak Ridge National Laboratory, Oak Ridge, Tennessee EIS-0305: Treating Transuranic (TRU)Alpha Low-Level at the Oak Ridge...


E-Print Network 3.0 - alpha pparalpha protects Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

GTTTTGCTTTCTCAGATCTT GGC P h PPAR-alpha... G 6.83 1.21 + L15702 Complement factor B CFB 4.45 1.18 + X01683 Alpha-1-antitrypsin SERPINA1 2... identifies the NF-kappa...


E-Print Network 3.0 - acid receptor alpha Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

alpha Page: << < 1 2 3 4 5 > >> 1 List of Abbreviations Acknowledgments Summary: jejunum LCA lithocholic acid LRH-1 liver receptor homolog-1 LXR liver X receptor alpha MeOH...


E-Print Network 3.0 - alpha particle loss Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

results for: alpha particle loss Page: << < 1 2 3 4 5 > >> 1 Plasma Phys. Control. Fusion 39 (1997) A275A283. Printed in the UK PII: S0741-3335(97)81172-4 Alpha-particle...


E-Print Network 3.0 - alpha particle analysis Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

results for: alpha particle analysis Page: << < 1 2 3 4 5 > >> 1 Plasma Phys. Control. Fusion 39 (1997) A275A283. Printed in the UK PII: S0741-3335(97)81172-4 Alpha-particle...


Purification and characterization of periplasmic alpha-amylase from Xanthomonas campestris K-11151.  

Science Journals Connector (OSTI)

...9005-82-7 Amylose 9037-22-3 Amylopectin 9057-02-7... alpha-Amylases EC 3.2.1...cyclomaltodextrinase | Amylopectin metabolism Amylose metabolism Cell...purification alpha-Amylases isolation & purification...

J Abe; N Onitsuka; T Nakano; Y Shibata; S Hizukuri; E Entani




Science Journals Connector (OSTI)

...induced biosynthesis of alpha-amylase in Pseudomonas saccharophila...INDUCED BIOSYNTHESIS OF ALPHA-AMYLASE IN PSEUDOMONAS SACCHAROPHILA...proteins of E. coli do not break down to their constituent...amylase synthesis by starch, P. saccharophila also...

Alvin Markovitz; Harold P. Klein



Recovery Cleanup Project at Y-12 Leaves Alpha 5 with an Empty...  

National Nuclear Security Administration (NNSA)

Office NPO News Releases Recovery Cleanup Project at Y-12 Leaves Alpha ... Recovery Cleanup Project at Y-12 Leaves Alpha 5 with an Empty Feeling applicationmsword icon R-10-21...


E-Print Network 3.0 - alpha centauri binary Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

the south later on. Crux the Southern Cross, with Beta and Alpha Centauri... than the sun. It is the fourth brightest star in the sky after Sirius, Canopus and Alpha Centauri....


E-Print Network 3.0 - alpha energy measurements Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

2) in front of two different detectors for alpha spectroscopy. At first, an energy measurement... L-97 On the evidence of high-energy alpha emitters (E 10.6 MeV) in monazite D....


E-Print Network 3.0 - alpha line profile Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

fusion test reactor Summary: -particle confinement and thermalization (solid and dashed lines). The alphas near their birth energy of 3.5 MeV can... of the alpha-energy spectrum...


E-Print Network 3.0 - alpha particle spectroscopy Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

and Isotopes 59 (2003) 363-366 Comparison among alpha-particle energy losses... July 2003 Abstract In the present work, we compare the alpha-particle energy losses in air...


Enhanced production of low energy electrons by alpha particle impact  

Science Journals Connector (OSTI)

...2.5 MV Van-de-Graaff accelerator at the Institut fur Kernphysik...electronic decay driven by nuclear motion . Phys Rev Lett 105 : 173401...Waals Clusters and Impact of Nuclear Motion . Phys Rev Lett 85 : 4490...of Ne 2 by high-resolution vacuum ultraviolet laser spectroscopy...

Hong-Keun Kim; Jasmin Titze; Markus Schöffler; Florian Trinter; Markus Waitz; Jörg Voigtsberger; Hendrik Sann; Moritz Meckel; Christian Stuck; Ute Lenz; Matthias Odenweller; Nadine Neumann; Sven Schössler; Klaus Ullmann-Pfleger; Birte Ulrich; Rui Costa Fraga; Nikos Petridis; Daniel Metz; Annika Jung; Robert Grisenti; Achim Czasch; Ottmar Jagutzki; Lothar Schmidt; Till Jahnke; Horst Schmidt-Böcking; Reinhard Dörner



Morphological characterization of recombinant strains of Aspergillus oryzae producing alpha-amylase during batch cultivations  

Science Journals Connector (OSTI)

Three alpha-amylase producing strains of Aspergillus oryzae used for ... dense mycelium is more efficient in producing ?-amylase.

Anders Spohr; Morten Carlsen; Jens Nielsen; John Villadsen



Attention-modulated Alpha-band Oscillations Protect against Intrusion of Irrelevant Information  

E-Print Network (OSTI)

after a cue to attend to that hand, but shows in- creased power after a cue to attend to the foot alpha power. However, the alpha-band modulation was not simply locked to the cue offset. The tem- poral in the sequence, peri- stimulus alpha power predicted the degree to which that irrel- evant stimulus distorted

Sekuler, Robert


Words number: 25491 Assessment of salivary alpha-amylase -a stress biomarker -in2  

E-Print Network (OSTI)

1 Words number: 25491 Assessment of salivary alpha-amylase - a stress biomarker - in2 pregnant patients.3 4 Running tittle: Salivary alpha-amylase: a stress biomarker in pregnant patients5 6 Jean, Psychological5 Saliva6 Salivary alpha-Amylases7 Caesarean Section8 9 10 inserm-00847842,version1-24Jul2013 #12

Boyer, Edmond


alpha-amylase and Glucose Oxidase as Promising Improvers for Wheat Bread  

Science Journals Connector (OSTI)

The effects of alpha-amylase and glucose oxidase as bread improvers on the textural and thermal properties of bread were evaluated by the rapid viscosity analysis and differential scanning calorimetry. It was found that alpha-amylase and glucose oxidase ... Keywords: alpha-amylase, Glucose oxidase, viscosity, Bread quality

Jie Zeng; Haiyan Gao; Guanglei Li; Xinhong Liang



The Roles of Testosterone and Alpha-Amylase in Exercise-Induced Sexual Arousal in Women  

E-Print Network (OSTI)

The Roles of Testosterone and Alpha-Amylase in Exercise-Induced Sexual Arousal in Women Lisa Dawn EA, and Meston CM. The roles of testosterone and alpha-amylase in exercise-induced sexual arousal; Alpha-Amylase Introduction Dynamic, cardiovascular exercise has many well-documented health benefits

Meston, Cindy


Purification and some properties of an extracellular alpha-amylase from Bacteroides amylophilus.  

Science Journals Connector (OSTI)

...characteristic of alpha-type amylases. The relative...hydrolysis of amylose, soluble starch, amylopectin, and dextrin...characteristic of alpha-type amylases. The relative...hydrolysis of amylose, soluble starch, amylopectin, and dextrin...metabolism Amylopectin metabolism Amylose metabolism...Extracellular Alpha- Amylase from Bacteroides...

S J McWethy; P A Hartman


Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Direct study of the alpha-nucleus optical potential at astrophysical energies using the 64Zn(p,alpha)61Cu reaction  

E-Print Network (OSTI)

In the model calculations of heavy element nucleosynthesis processes the nuclear reaction rates are taken from statistical model calculations which utilize various nuclear input parameters. It is found that in the case of reactions involving alpha particles the calculations bear a high uncertainty owing to the largely unknown low energy alpha-nucleus optical potential. Experiments are typically restricted to higher energies and therefore no direct astrophysical consequences can be drawn. In the present work a (p,alpha) reaction is used for the first time to study the alpha-nucleus optical potential. The measured 64Zn(p,alpha)61Cu cross section is uniquely sensitive to the alpha-nucleus potential and the measurement covers the whole astrophysically relevant energy range. By the comparison to model calculations, direct evidence is provided for the incorrectness of global optical potentials used in astrophysical models.

Gyürky, Gy; Halász, Z; Kiss, G G; Szücs, T



Decay of the resonantly excited states of atomic Kr  

Science Journals Connector (OSTI)

The 3p-1?5s1 resonant excitation energy and decay width of Kr atoms are calculated by an ab initio Green’s-function method. The dipolar relaxation energy shift of the 3p-1?5s1 resonantly excited state of Kr atoms is predominantly due to the 3p-15s1?3d-25s1?f super-Coster-Kronig (sCK) spectator decay process. The calculated excitation energies are overestimated by about 1.0 eV. The decay widths for 3p1/2-1?5s1 and 3p3/2-1?5s1 resonantly excited states are 2.08 and 1.88 eV, respectively. They are larger than the decay widths of the 3p1/2-1 and 3p3/2-1 core-level ionized states. The increase of the decay width is a result of the decrease of 3p-15s1?3d-25s1?f sCK spectator decay and the increase of 3p-15s1?3d-14s(p)-15s1?p(d) CK spectator decay. The changes of the (s)CK decay rates are due to the screening of the final two-hole-state potential by the resonantly excited 5s electron.

Masahide Ohno



Half-lives of Double $\\beta ^+$-decay with Two Neutrinos  

E-Print Network (OSTI)

Nuclear double $\\beta ^-$-decays with two neutrinos were observed for many years and a systematic law describing the relation between their half-lives and decay energies was also proposed recently [Phys. Rev. C89, 064603 (2014)]. However, double $\\beta ^+$-decay ($\\beta ^+\\beta^+)$ with emission of both two positrons and two neutrinos has not been observed up to date. In this article, we perform a systematic analysis on the candidates of double $\\beta ^+$-decay, based on the 2012 nuclear mass table. Eight nuclei are found to be the good candidates for double $\\beta ^+$-decay and their half-lives are predicted according to the generalization of the systematic law to double $\\beta ^+$-decay. As far as we know, there is no theoretical result on double $\\beta ^+$-decay of nucleus $^{154}Dy$ and our result is the first prediction on this nucleus. This is also the first complete research on eight double $\\beta ^+$-decay candidates based on the available data of nuclear masses. It is expected that the calculated hal...

Ren, Yuejiao



Large CP Violation in Bs Decays and Light WR  

Science Journals Connector (OSTI)

......September 1990 research-article Articles Large CP Violation in B s Decays and Light W R Hiroyuki...1) theory, the possibility of large CP violating asymmetries in B S decays is investigated...that a certain class of models where the CP symmetry is violated spontaneously and a......

Hiroyuki Nishiura; Minoru Tanaka; Eiichi Takasugi



Branching ratios for the beta decay of Na-21  

E-Print Network (OSTI)

We have measured the beta-decay branching ratio for the transition from Na-21 to the first excited state of Ne-21. A recently published test of the standard model, which was based on a measurement of the beta-nu correlation in the decay of Na-21...

Iacob, V. E.; Hardy, John C.; Gagliardi, Carl A.; Goodwin, J.; Nica, N.; Park, H. I.; Tabacaru, G.; Trache, L.; Tribble, Robert E.; Zhai, Y.; Towner, I. S.



Search for the decays B-0->D(*)D+(*)(-)  

E-Print Network (OSTI)

Using the CLEO-II data set we have searched for the decays B-0 --> D-(*+)D-(*-) We observe one candidate signal event for the decay B-0 --> D*+D*- with an expected background of 0.022 +/- 0.011 events. This yield corresponds to a branching fraction...

Ammar, Raymond G.; Baringer, Philip S.; Bean, Alice; Besson, David Zeke; Coppage, Don; Darling, C.; Davis, Robin E. P.; Hancock, N.; Kotov, S.; Kravchenko, I.; Kwak, Nowhan



74Exploring Nuclear Decay and Radiation Dose The devastating earthquake  

E-Print Network (OSTI)

74Exploring Nuclear Decay and Radiation Dose The devastating earthquake that struck northern Japan vent radioactive gas and dust clouds into the environment. Although the initial radiation levels were extremely high, the natural decay of the radioactive compounds will cause the radiation levels at any given


First search for CP violation in tau lepton decay  

E-Print Network (OSTI)

We have performed the first search for CP violation in tau lepton decay. CP violation in lepton decay does not occur in the minimal standard model but can occur in extensions such as the multi-Higgs doublet model. It appears as a characteristic...

Ammar, Raymond G.; Baringer, Philip S.; Bean, Alice; Besson, David Zeke; Coppage, Don; Darling, C.; Davis, Robin E. P.; Kotov, S.; Kravchenko, I.; Kwak, Nowhan; Zhou, L.



Comment on the 20-dominance model for charm decays  

Science Journals Connector (OSTI)

From systematic studies of D?K? decay amplitudes, it is pointed out that vital damage to the conventional "mild" 20-dominance model for charm decays is caused by an observation B(D0?K¯0?0)B(D0?K-?+)>0.5 but not by an observation ?(D+)??(D0).

Yoshio Koide



Evidence for the Decay X(3872) ? ?(2S)?  

E-Print Network (OSTI)

Evidence for the decay mode X(3872) ? ?(2S)? in B[superscript +] ? X(3872)K[superscript +] decays is found with a significance of 4.4 standard deviations. The analysis is based on a data sample of proton–proton collisions, ...

Counts, Ian Thomas Hunt


Correlated two-proton decay from (10)C  

E-Print Network (OSTI)

and for a newly found level at E* = 8.4 MeV. A state at E* = 6.57 MeV is shown to undergo two-proton decay to (8)Be(g.s.) with strong p-p correlations consistent with the (1)S phase shift. Based on the lack of such correlations for other two-proton decays...

Mercurio, K.; Charity, R. J.; Shane, R.; Sobotka, L. G.; Elson, J. M.; Famiano, M.; Wuosmaa, A. H.; Banu, A.; Fu, C.; Trache, L.; Tribble, Robert E.; Mukhamedzhanov, A. M.



Internal conversions in Higgs decays to two photons  

SciTech Connect

We evaluate the partial widths for internal conversions in the Higgs decays to two photons. For the Higgs masses of interest at the CERN LHC in the range of 100-150 GeV, the conversions to pairs of fermions represent a significant fraction of Higgs decays.

Firan, Ana; Stroynowski, Ryszard [Department of Physics, Southern Methodist University, Dallas, Texas 75275-0175 (United States)



Strategies for Next Generation Neutrinoless Double-Beta Decay Experiments  

E-Print Network (OSTI)

Strategies for Next Generation Neutrinoless Double-Beta Decay Experiments F. T. Avignone III A brief discussion of the connection between neutrino oscillation data and predictions of neutrinoless the necessary tools for comparative evaluation. 1. INTRODUCTION Neutrinoless double-beta (0)-decay has been


Neutrinoless double-beta decay. A brief review  

E-Print Network (OSTI)

In this brief review we discuss the generation of Majorana neutrino masses through the see-saw mechanism, the theory of neutrinoless double-beta decay, the implications of neutrino oscillation data for the effective Majorana mass, taking into account the recent Daya Bay measurement of theta_13, and the interpretation of the results of neutrinoless double-beta decay experiments.

S. M. Bilenky; C. Giunti



Limit on the electric charge-nonconserving $?^+ \\to invisible$ decay  

E-Print Network (OSTI)

The first limit on the branching ratio of the electric charge-nonconserving invisible muon decay $Br(\\mu^+ \\to invisible) invisible$ decay rate are discussed. These leptonic charge-nonconserving processes may hold in four-dimensional world in models with infinite extra dimensions, thus making their searches complementary to collider experiments probing new physics.

S. N. Gninenko



Search for invisible decays of the (1S)  

E-Print Network (OSTI)

We search for invisible decays of the ?(1S) meson using a sample of 91.4×10[superscript 6] ?(3S) mesons collected at the BABAR/PEP-II B factory. We select events containing the decay ?(3S)??[superscript +]?[superscript ...

Zhao, M.



SciTech Connect

The two RHIC rings are equipped with superconducting dipole magnets. At injection, induced persistent currents in these magnets lead to a sextupole component. As the persistent currents decay with time, the horizontal and vertical chromaticities change. From magnet measurements of persistent current decays, chromaticity changes in the machine are estimated and compared with chromaticity measurements.




Search for baryon number violation in top-quark decays  

E-Print Network (OSTI)

A search for baryon number violation (BNV) in top-quark decays is performed using pp collisions produced by the LHC at [sqrt s]=8 TeV. The top-quark decay considered in this search results in one light lepton (muon or ...

CMS Collaboration


Double Beta Decay and the Absolute Neutrino Mass Scale  

E-Print Network (OSTI)

After a short review of the current status of three-neutrino mixing, the implications for the values of neutrino masses are discussed. The bounds on the absolute scale of neutrino masses from Tritium beta-decay and cosmological data are reviewed. Finally, we discuss the implications of three-neutrino mixing for neutrinoless double-beta decay.

Carlo Giunti



B Decay and CP Violation: CKM Angles and Sides at the BABAR and BELLE B-Factories  

SciTech Connect

A remarkable success has been achieved by the B-Factories, going beyond expectation in some field, like the measurement of {gamma}. BABAR has now finished its data taking, leaving BELLE alone in the 'race', but still many analyses are going on. The CKM UT is constrained by both measurements of CP-conserving and CP-violating quantities, leading to a picture of the CKM sector consistent with the SM. Measurements of semi-leptonic decays benefit from improving experimental techniques and more precise theoretical computations. The angle {beta} is a precision measurement, reaching accuracy of SM calculation. The angle {alpha} will ultimatly be limited by penguin pollution. The measurement of {gamma} is reaching the 13{sup o} precision.

Verderi, Marc; /Ecole Polytechnique


Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


On bulk viscosity and moduli decay  

E-Print Network (OSTI)

This pedagogically intended lecture, one of four under the header "Basics of thermal QCD", reviews an interesting relationship, originally pointed out by Bodeker, that exists between the bulk viscosity of Yang-Mills theory (of possible relevance to the hydrodynamics of heavy ion collision experiments) and the decay rate of scalar fields coupled very weakly to a heat bath (appearing in some particle physics inspired cosmological scenarios). This topic serves, furthermore, as a platform on which a number of generic thermal field theory concepts are illustrated. The other three lectures (on the QCD equation of state and the rates of elastic as well as inelastic processes experienced by heavy quarks) are recapitulated in brief encyclopedic form.

M. Laine



Higgs boson production and decay: Dalitz sector  

Science Journals Connector (OSTI)

Abstract The processes H ? f ¯ f ? ( g ) , p p ? q ¯ + q ? H + ? ( g ) and p p ? q ( q ¯ ) + g ? H + q ( q ¯ ) pose severe challenges to the experimental analysis. They represent rare decays and production mechanisms of the Higgs boson at LHC. However, they are not Yukawa suppressed at next-to-leading order opening a window for the correct definition of pseudo-observables, e.g. a definition of ? ( H ? Z ? ) with universal inherent meaning, that are currently used in extracting information for the couplings of the newly discovered resonance at LHC. The impact of genuinely electroweak NLO corrections is discussed, as well as the comparison of ? ( p p ? g g X ? e + e ? ? ) to its zero-width approximation.

Giampiero Passarino



Progress in computing inclusive B decay spectra.  

E-Print Network (OSTI)

ar X iv :h ep -p h/ 06 01 18 1v 1 2 1 Ja n 20 06 Progress in computing inclusive B decay spectra Einan Gardi and Jeppe R. Andersen Cavendish Laboratory, University of Cambridge, J J Thomson Avenue, Cambridge, CB3 0HE, UK We review the progress... V, M0E =1.7GeV x =1GeV, M0E =1.7GeV, fully diff. x =1GeV, M0E =0.66GeV max + =1GeV, P0E =0.66GeV, fully diff. max + =1GeV, P0E Figure 4. The P? spectrum in B¯ ?? Xul?¯ as calculated by DGE [17], after integration over P+ and El in four different...

Gardi, Einan; Andersen, Jeppe R


Antiproton Limits on Decaying Gravitino Dark Matter  

E-Print Network (OSTI)

We report on constraints on the lifetime of decaying gravitino dark matter in models with bilinear R-parity violation derived from observations of cosmic-ray antiprotons with the PAMELA experiment. Performing a scan over a viable set of cosmic-ray propagation parameters we find lower limits ranging from $8\\times 10^{28}$s to $6\\times 10^{28}$s for gravitino masses from roughly 100 GeV to 10 TeV. Comparing these limits to constraints derived from gamma-ray and neutrino observations we conclude that the presented antiproton limits are currently the strongest and most robust limits on the gravitino lifetime in the considered mass range. These constraints correspond to upper limits on the size of the bilinear R-parity breaking parameter in the range of $10^{-8}$ to $8\\times 10^{-13}$.

Grefe, Michael



Experimental searches of neutrinoless double beta decay  

E-Print Network (OSTI)

Neutrinoless double decay is a unique probe for lepton number conservation and neutrino properties. It allows to investigate the Dirac/Majorana nature of the neutrinos and their absolute mass scale (hierarchy problem) with unprecedented sensitivity. A number of experiments are presently under preparation to cover the quasi-degenerate region of the neutrino mass spectrum. Improved sensitivities are however required to sound the so-called inverted hierarchy region. This is a real challenge faced by a number of new proposed projects, based either on large expansions of the present experiments or on new ideas top improve the technical performance or reduce the background contributions. A review of the most relevant ongoing experiments is given. The most relevant parameters contributing to the experimental sensitivity are discussed and a critical comparison of the future projects is proposed.

Oliviero Cremonesi



It's Elemental - Isotopes of the Element Carbon  

NLE Websites -- All DOE Office Websites (Extended Search)

Boron Boron Previous Element (Boron) The Periodic Table of Elements Next Element (Nitrogen) Nitrogen Isotopes of the Element Carbon [Click for Main Data] Most of the isotope data on this site has been obtained from the National Nuclear Data Center. Please visit their site for more information. Naturally Occurring Isotopes Mass Number Natural Abundance Half-life 12 98.93% STABLE 13 1.07% STABLE Known Isotopes Mass Number Half-life Decay Mode Branching Percentage 8 1.981×10-21 seconds Proton Emission 100.00% Alpha Decay No Data Available 9 126.5 milliseconds Electron Capture 100.00% Electron Capture with delayed Proton Emission 61.60% Electron Capture with delayed Alpha Decay 38.40% 10 19.308 seconds Electron Capture 100.00% 11 20.334 minutes Electron Capture 100.00% 12 STABLE - -


Small-Molecule Inhibition of TNF-alpha  

NLE Websites -- All DOE Office Websites (Extended Search)

Small-Molecule Inhibition of TNF-alpha Tumour necrosis factor is a polypeptide cytokine involved in inflammation and the acute phase response. TNF-alpha is present in larger quantities in persons with rheumatoid arthritis or Crohn's disease. Direct inhibition of TNF-a by the commercial biological agents etanercept (Enbrel), infliximab (Remicade), adalimumab (Humira), has produced significant advances in rheumatoid arthritis treatment and validated the extra-cellular inhibition of this proinflammatory cytokine as an effective therapy. However, despite considerable incentives, viable leads for analogous small-molecule inhibitors of TNF-a have not been reported (1). Such drugs with attendant advantages in manufacturing, patient accessibility, administration, and compliance would represent a major advance in the treatment of TNF-a mediated diseases.


Constraining Mass Spectra with Sterile Neutrinos from Neutrinoless Double Beta Decay, Tritium Beta Decay and Cosmology  

E-Print Network (OSTI)

We analyze the constraints on neutrino mass spectra with extra sterile neutrinos as implied by the LSND experiment. The various mass related observables in neutrinoless double beta decay, tritium beta decay and cosmology are discussed. Both neutrino oscillation results as well as recent cosmological neutrino mass bounds are taken into account. We find that some of the allowed mass patterns are severely restricted by the current constraints, in particular by the cosmological constraints on the total sum of neutrino masses and by the non-maximality of the solar neutrino mixing angle. Furthermore, we estimate the form of the four neutrino mass matrices and also comment on the situation in scenarios with two additional sterile neutrinos.

Srubabati Goswami; Werner Rodejohann



Anomalous loss of DT alpha particles in the Tokamak Fusion Test Reactor  

SciTech Connect

An escaping alpha collector probe has been developed for TFTR`s DT phase. Energy distributions of escaping alphas have been determined by measuring the range of {alpha}-particles implanted into nickel foils located within the alpha collector. Results at 1.0 MA of plasma current are in good agreement with predictions for first orbit alpha loss. Results at 1.8 MA, however, show a significant anomalous loss of partially thermalized alphas (in addition to the expected first orbit loss), which is not observed with the lost alpha scintillator detectors in DT plasmas, but does resemble the anomalous delayed loss seen in DD plasmas. None of the candidate explanations proposed thus far are fully consistent with the anomalous loss observations. An experiment designed to study the effect of plasma major radius shifts on {alpha}-particle loss has led to a better understanding of {alpha}-particle dynamics in tokamaks. Intuitively, one might suppose that confined marginally passing {alpha}-particles forced to move toward higher magnetic field during an inward major radius shift (i.e., compression) would mirror and become trapped particles, leading to increased alpha loss. Such an effect was looked for during the shift experiment, however, no significant changes in alpha loss to the 90{degree} lost alpha scintillator detector were observed during the shifts. It is calculated that the energy gained by an {alpha}-particle during the inward shift is sufficient to explain this result. However, an unexpected loss of partially thermalized {alpha}-particles near the passing/trapped boundary was observed to occur between inward and outward shifts at an intermediate value of plasma current (1.4 MA). This anomalous loss feature is not yet understood.

Herrmann, H.W.



Dark radiation from particle decay: cosmological constraints and opportunities  

SciTech Connect

We study particle decay as the origin of dark radiation. After elaborating general properties and useful parametrisations we provide model-independent and easy-to-use constraints from nucleosynthesis, the cosmic microwave background and structure formation. Bounds on branching ratios and mass hierarchies depend in a unique way on the time of decay. We demonstrate their power to exclude well-motivated scenarios taking the example of the lightest ordinary sparticle decaying into the gravitino. We point out signatures and opportunities in cosmological observations and structure formation. For example, if there are two dark decay modes, dark radiation and the observed dark matter with adjustable free-streaming can originate from the same decaying particle, solving small-scale problems of structure formation. Hot dark matter mimicking a neutrino mass scale as deduced from cosmological observations can arise and possibly be distinguished after a discovery. Our results can be used as a guideline for model building.

Hasenkamp, Jasper; Kersten, Jörn, E-mail: Jasper.Hasenkamp@desy.de, E-mail: Joern.Kersten@desy.de [II. Institute for Theoretical Physics, University of Hamburg, 22761 Hamburg (Germany)



Dark radiation from particle decay: cosmological constraints and opportunities  

E-Print Network (OSTI)

We study particle decay as the origin of dark radiation. After elaborating general properties and useful parametrisations we provide model-independent and easy-to-use constraints from nucleosynthesis, the cosmic microwave background and structure formation. Bounds on branching ratios and mass hierarchies depend in a unique way on the time of decay. We demonstrate their power to exclude well-motivated scenarios taking the example of the lightest ordinary sparticle decaying into the gravitino. We point out signatures and opportunities in cosmological observations and structure formation. For example, if there are two dark decay modes, dark radiation and the observed dark matter with adjustable free-streaming can originate from the same decaying particle, solving small-scale problems of structure formation. Hot dark matter mimicking a neutrino mass scale as deduced from cosmological observations can arise and possibly be distinguished after a discovery. Our results can be used as a guideline for model building.

Jasper Hasenkamp; Jörn Kersten



CP-violating polarizations in semileptonic heavy meson decays  

Science Journals Connector (OSTI)

We study the T-violating lepton transverse polarization (Pl?) in three body semileptonic heavy meson decays to pseudoscalar mesons and to vector mesons. We calculate these polarizations in the heavy quark effective limit, which simplifies the expressions considerably. After examining constraints from CP-conserving (including b?s?) and CP-violating processes, we find that in B decays P? of the muon in multi-Higgs-doublet models can be of order 13%, while P? of the ? can even approach unity. In contrast, P?? in D decays is at most 1.5%. We discuss possibilities for detection of Pl? at current and future B factories. We also show that Pl? in decays to vector mesons, unlike in decays to pseudoscalars, can get contributions from left-right models. Unfortunately, Pl? in that case is proportional to WL-WR mixing, and is thus small.

Robert Garisto



Dissipative phase transitions: Independent versus collective decay and spin squeezing  

E-Print Network (OSTI)

We study the XY model with infinite-range interactions (Lipkin-Meshkov-Glick model) in the presence of dissipation from spontaneous decay. We show that independent and collective decay lead to qualitatively different phase transitions of the steady state, even though the phase boundary is the same. Independent decay leads to a second-order phase transition to a ferromagnet, while collective decay leads to a first-order transition to a time-dependent oscillatory phase. Then we show that the addition of a drive leads to infinite spin squeezing for collective decay in the thermodynamic limit. Our results can be experimentally seen in trapped-ion and cavity-QED experiments.

Tony E. Lee; Ching-Kit Chan; Susanne F. Yelin



Arbitrary mass Majorana neutrinos in neutrinoless double beta decay  

Science Journals Connector (OSTI)

We revisit the mechanism of neutrinoless double beta (0???) decay mediated by the exchange with the heavy Majorana neutrino N of arbitrary mass mN, slightly mixed ?UeN with the electron neutrino ?e. By assuming the dominance of this mechanism, we update the well-known 0???-decay exclusion plot in the mN?UeN plane taking into account recent progress in the calculation of nuclear matrix elements within quasiparticle random phase approximation and improved experimental bounds on the 0???-decay half-life of Ge76 and Xe136. We also consider the known formula approximating the mN dependence of the 0???-decay nuclear matrix element in a simple explicit form. We analyze its accuracy and specify the corresponding parameters, allowing one to easily calculate the 0???-decay half-life for arbitrary mN for all the experimentally interesting isotopes without resorting to real nuclear structure calculations.

Amand Faessler; Marcela González; Sergey Kovalenko; Fedor Šimkovic



Arbitrary mass Majorana neutrinos in neutrinoless double beta decay  

E-Print Network (OSTI)

We revisit the mechanism of neutrinoless double beta (NLDBD) decay mediated by the exchange with the heavy Majorana neutrino N of arbitrary mass mN, slightly mixed with the electron neutrino. By assuming the dominance of this mechanism, we update the well-known NLDBD-decay exclusion plot in the mass-mixing angle plane taking into account recent progress in the calculation of nuclear matrix elements within quasiparticle random phase approximation and improved experimental bounds on the NLDBD-decay half-life of Ge-76 and Xe-136. We also consider the known formula approximating the mN dependence of the NLDBD-decay nuclear matrix element in a simple explicit form. We analyze its accuracy and specify the corresponding parameters, allowing one to easily calculate the NLDBD-decay half-life for arbitrary mN for all the experimentally interesting isotopes without resorting to real nuclear structure calculations.

Amand Faessler; Marcela Gonzalez; Sergey Kovalenko; Fedor Simkovic



The nuclear matrix elements for neutrinoless double beta decay  

Science Journals Connector (OSTI)

The status of calculation of the neutrinoless double beta decay ( 0??? ?decay) nuclear matrix elements (NME's) is reviewed. The spread of published values of NME's is discussed. The main attention is paid to the recent progress achieved in the evaluation of the 0??? ?decay NME's in the framework of the quasiparticle random phase approximation (QRPA). The obtained results are compared with those of the nuclear shell model. The problem of reliable determination of the 0??? ?decay NME's is addressed. The uncertainty in NME's are analyzed and further progress in calculation of the 0??? ?decay NME's is outlined.

Fedor Šimkovic



Automatic alpha-track counting with image analysis systems  

E-Print Network (OSTI)

of Advisory Committee: Dr. Milton E. McLain Integrated measurements of radon gas concentrations in the air environment have been performed in recent years due to dosimetric concerns of the radioactive substance. Proper evaluation of the dose received from... radon, primarily to the lung of the exposed individual, requires accurate measurement of concentrations present in the atmosphere. In response, this project was undertaken to further improve alpha track measurement techniques currently in place...

Shymanski, Michael Joseph



Michrochannel plate for position sensitive alpha particle detection  

SciTech Connect

This paper will describe the use of a microchannel plate (MCP) as the associated particle detector on a sealed tube neutron generator. The generator produces neutrons and associated alpha particles for use as a probe to locate and identify hidden explosives in associated particle imaging (API). The MCP measures the position in two dimensions and precise timing of the incident alpha particle, information which is then used to calculate the emission time and direction of the corresponding neutron. The MCP replaces the position-sensitive photomultipler tube (PSPMT) which, until recently, had been the only detector available for measuring position and timing for alpha particles in neutron generator applications. Where the PSPMT uses charge division for generating position information, a process that requires a first order correction to each pulse, the MCP uses delay-line timing, which requires no correction. The result is a device with an order of magnitude improvement in both position resolution and timing compared to the PSPMT. Hardware and software development and the measurements made to characterize the MCP for API applications are described.

Paul Hurley and James Tinsley



Population synthesis of wide binary millisecond pulsars  

Science Journals Connector (OSTI)

......from our population synthesis code are in good agreement with those...s1, respectively. In model NS2, the maximum amount of mass...using a rapid binary evolution code based on the analytical approximation...adopted in our binary evolution code. We assume mass transfer to......

B. Willems; U. Kolb



The effect of weak magnetism and induced pseudoscalar coupling in neutrinoless double-beta decay  

Science Journals Connector (OSTI)

In calculating the amplitude of the majorana neutrino-mass mechanism of neutrinoless double-beta decay (0???-decay), several approximations of the...pn-rqrpa) for all nuclei undergoing double-beta decay in the re...

G. Pantis; F. Šimkovic


Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


First results on neutrinoless double beta decay of Te-130 with the calorimetric cuoricino experiment  

E-Print Network (OSTI)

Evidence for Neutrinoless Double Beta Decay” arXiv:hep-on “Evidence for neutrinoless double beta decay”- arXiv:hep-Results on Neutrinoless Double Beta Decay of 130 Te with the



Search for di-muon decays of a low-mass Higgs boson in radiative decays of the ?(1S)  

E-Print Network (OSTI)

We search for di-muon decays of a low-mass Higgs boson (A[superscript 0]) produced in radiative ?(1S) decays. The ?(1S) sample is selected by tagging the pion pair in the ?(2S,3S)??[superscript +]?[superscript -]?(1S) ...

Cowan, Ray Franklin


State-of-the-Art Predictions for C-parameter and a Determination of alpha_s  

E-Print Network (OSTI)

The C-parameter event-shape distribution for e+e- annihilation into hadrons is computed in the framework of SCET including input from fixed-order perturbation theory. We calculate all missing ingredients for achieving N3LL resummation accuracy in the cross section, which is then matched onto O(alpha_s^3) fixed-order results. Hadronization power corrections are incorporated as a convolution with a nonperturbative shape function. Wide-angle soft radiation effects introduce an O(Lambda_QCD) renormalon ambiguity in the cross section, which we cure by switching to the Rgap short-distance scheme. We also include hadron mass effects, but find their effect is rather small. Performing fits to the tail of the C-parameter distribution for many center of mass energies we find that the strong coupling constant is alpha_s(mZ) = 0.1123 +-0.0015, with chi^2/dof=0.99.

Hoang, Andre H; Mateu, Vicent; Stewart, Iain W



K{alpha} satellite transitions in elements with 12{<=}Z{<=}30 produced by electron incidence  

SciTech Connect

The emission of x-ray satellite lines in the K{alpha} region of Mg, Si, Sc, Ti, Cr, Fe, Ni, and Zn induced by electron incidence was studied by means of wavelength dispersive spectroscopy. The satellite lines studied were K{alpha}{sup '}, K{alpha}{sub 3}, K{alpha}{sub 4}, K{alpha}{sub 5}, K{alpha}{sub 6}, and two transitions denoted here as K{alpha}{sub 22} and K{alpha}{sub 12}. Energy shifts with respect to the main K{alpha}{sub 1} diagram line and transition probabilities relative to the whole K{alpha} group were determined for a number of lines through a careful spectral processing. The dependence of these parameters, as well as of the K{beta}:K{alpha} intensity ratio, on the atomic number was compared with previous experimental and theoretical determinations when available. A discussion about the different mechanisms responsible for vacancy creation involved in the production of double-ionization satellites was performed in the light of the results obtained. Finally, the behavior of the satellite intensities as a function of the incidence energy was discussed for silicon.

Limandri, Silvina P.; Carreras, Alejo C.; Trincavelli, Jorge C. [Instituto de Fisica Enrique Gaviola, Consejo Nacional de Investigaciones Cientificas y Tecnicas (Argentina); Facultad de Matematica, Astronomia y Fisica, Universidad Nacional de Cordoba, Cordoba (Argentina); Bonetto, Rita D. [Centro de Investigacion y Desarrollo en Ciencias Aplicadas Dr. Jorge Ronco (CINDECA), Consejo Nacional de Investigaciones Cientificas y Tecnicas (Argentina); Facultad de Ciencias Exactas, Facultad de Ingenieria, Universidad Nacional de La Plata, La Plata (Argentina)



Questions and Answers - What are alpha rays? How are they produced?  

NLE Websites -- All DOE Office Websites (Extended Search)

Why do we use radioactivityto destroy cancers? Why do we use radioactivity<br>to destroy cancers? Previous Question (Why do we use radioactivity to destroy cancers?) Questions and Answers Main Index Next Question (What is an alpha particle?) What is an alpha particle? What are alpha rays? How are they produced? Alpha "rays" are actually high speed particles. Early researchers tended to refer to any form of energetic radiation as rays, and the term is still used. An alpha particle is made up of two protons and two neutrons, all held together by the same strong nuclear force that binds the nucleus of any atom. In fact, an alpha particle really is a nucleus - it's the same as the nucleus of a common atom of helium - but it doesn't have any electrons around it, and it's traveling very fast. Alpha particles are a type of


Synthesis and evaluation of novel [alpha]-heteroaryl-phenylpropanoic acid derivatives as PPAR[alpha/gamma] dual agonists  

SciTech Connect

The synthesis of a new series of phenylpropanoic acid derivatives incorporating an heteroaryl group at the {alpha}-position and their evaluation for binding and activation of PPAR{alpha} and PPAR{gamma} are presented in this report. Among the new compounds, (S)-3-{l_brace}4-[3-(5-methyl-2-phenyl-oxazol-4-yl)-propyl]-phenyl{r_brace}-2-1,2,3-triazol-2-yl-propionic acid (17j), was identified as a potent human PPAR{alpha}/{gamma} dual agonist (EC{sub 50} = 0.013 and 0.061 {micro}M, respectively) with demonstrated oral bioavailability in rat and dog. 17j was shown to decrease insulin levels, plasma glucose, and triglycerides in the ZDF female rat model. In the human apolipoprotein A-1/CETP transgenic mouse model 17j produced increases in hApoA1 and HDL-C and decreases in plasma triglycerides. The increased potency for binding and activation of both PPAR subtypes observed with 17j when compared to previous analogs in this series was explained based on results derived from crystallographic and modeling studies.

Casimiro-Garcia, Agustin; Bigge, Christopher F.; Davis, Jo Ann; Padalino, Teresa; Pulaski, James; Ohren, Jeffrey F.; McConnell, Patrick; Kane, Christopher D.; Royer, Lori J.; Stevens, Kimberly A.; Auerbach, Bruce; Collard, Wendy; McGregor, Christine; Song, Kun; Pfizer



Evidence for a Higgs boson in tau decays with the CMS detector .  

E-Print Network (OSTI)

??In this thesis, I describe the search for a Higgs boson through its decay to a pair of tan leptons with the tau-pair subsequently decaying… (more)

Dutta, Valentina



A Search for the Neutrinoless Double Beta Decay of Xenon-136 with Improved Sensitivity from Denoising .  

E-Print Network (OSTI)

??The EXO-200 detector is designed to search for the neutrinoless double beta decay of 136Xe. ??0? decay, if it occurs in nature, would demonstrate the… (more)

Davis, Clayton G.



Measurements of cross sections and decay properties of the isotopes of elements 112, 114, and 116 produced in the fusion reactions {sup 233,238}U, {sup 242}Pu, and {sup 248}Cm+{sup 48}Ca  

SciTech Connect

We have studied the dependence of the production cross sections of the isotopes {sup 282,283}112 and {sup 286,287}114 on the excitation energy of the compound nuclei {sup 286}112 and {sup 290}114. The maximum cross section values of the xn-evaporation channels for the reaction {sup 238}U({sup 48}Ca,xn){sup 286-x}112 were measured to be {sigma}{sub 3n}=2.5{sub -1.1}{sup +1.8} pb and {sigma}{sub 4n}=0.6{sub -0.5}{sup +1.6} pb; for the reaction {sup 242}Pu({sup 48}Ca,xn){sup 290-x}114: {sigma}{sub 2n}{approx}0.5 pb, {sigma}{sub 3n}=3.6{sub -1.7}{sup +3.4} pb, and {sigma}{sub 4n}=4.5{sub -1.9}{sup +3.6} pb. In the reaction {sup 233}U({sup 48}Ca,2-4n){sup 277-279}112 at E*=34.9=2.2 MeV we measured an upper cross section limit of {sigma}{sub xn}{<=}0.6 pb. The observed shift of the excitation energy associated with the maximum sum evaporation residue cross section {sigma}{sub ER}(E*) to values significantly higher than that associated with the calculated Coulomb barrier can be caused by the orientation of the deformed target nucleus in the entrance channel of the reaction. An increase of {sigma}{sub ER} in the reactions of actinide targets with {sup 48}Ca is consistent with the expected increase of the survivability of the excited compound nucleus upon closer approach to the closed neutron shell N=184. In the present work we detected 33 decay chains arising in the decay of the known nuclei {sup 282}112, {sup 283}112, {sup 286}114, {sup 287}114, and {sup 288}114. In the decay of {sup 287}114({alpha}){yields}{sup 283}112({alpha}){yields}{sup 279}110(SF), in two cases out of 22, we observed decay chains of four and five sequential {alpha} transitions that end in spontaneous fission of {sup 271}Sg (T{sub {alpha}}{sub /SF}=2.4{sub -1.0}{sup +4.3} min) and {sup 267}Rf (T{sub SF}{approx}2.3 h), longer decay chains than reported previously. We observed the new nuclide {sup 292}116 (T{sub {alpha}}=18{sub -6}{sup +16} ms,E{sub {alpha}}=10.66{+-}0.07 MeV) in the irradiation of the {sup 248}Cm target at a higher energy than in previous experiments. The observed nuclear decay properties of the nuclides with Z=104-118 are compared with theoretical nuclear mass calculations and the systematic trends of spontaneous fission properties. As a whole, they give a consistent pattern of decay of the 18 even-Z neutron-rich nuclides with Z=104-118 and N=163-177. The experiments were performed with the heavy-ion beam delivered by the U400 cyclotron of the FLNR (JINR, Dubna) employing the Dubna gas-filled recoil separator.

Oganessian, Yu.Ts.; Utyonkov, V.K.; Lobanov, Yu.V.; Abdullin, F.Sh.; Polyakov, A.N.; Shirokovsky, I.V.; Tsyganov, Yu.S.; Gulbekian, G.G.; Bogomolov, S.L.; Gikal, B.N.; Mezentsev, A.N.; Iliev, S.; Subbotin, V.G.; Sukhov, A.M.; Voinov, A.A.; Buklanov, G.V.; Subotic, K.; Zagrebaev, V.I.; Itkis, M.G.; Patin, J.B. [Joint Institute for Nuclear Research, 141980 Dubna (Russian Federation); Lawrence Livermore National Laboratory, University of California, Livermore, California 94551 (United States); Russian Federal Nuclear Center, All-Russian Research Institute of Experimental Physics, 607190 Sarov (Russian Federation)] [and others



Tobacco plants transformed with the bean. alpha. ai gene express an inhibitor of insect. alpha. -amylase in their seeds. [Nicotiana tabacum; Tenebrio molitor  

SciTech Connect

Bean (Phaseolus vulgaris L.) seeds contain a putative plant defense protein that inhibits insect and mammalian but not plant {alpha}-amylases. We recently presented strong circumstantial evidence that this {alpha}-amylase inhibitor ({alpha}Al) is encoded by an already-identified lectin gene whose product is referred to as lectin-like-protein (LLP). We have now made a chimeric gene consisting of the coding sequence of the lectin gene that encodes LLP and the 5{prime} and 3{prime} flanking sequences of the lectin gene that encodes phytohemagglutinin-L. When this chimeric gene was expressed in transgenic tobacco (Nicotiana tabacum), we observed in the seeds a series of polypeptides (M{sub r} 10,000-18,000) that cross-react with antibodies to the bean {alpha}-amylase inhibitor. Most of these polypeptides bind to a pig pancreas {alpha}-amylase affinity column. An extract of the seeds of the transformed tobacco plants inhibits pig pancreas {alpha}-amylase activity as well as the {alpha}-amylase present in the midgut of Tenebrio molitor. We suggest that introduction of this lectin gene (to be called {alpha}ai) into other leguminous plants may be a strategy to protect the seeds from the seed-eating larvae of Coleoptera.

Altabella, T.; Chrispeels, M.J. (Univ. of California, San Diego, La Jolla (USA))



Observing CP Violation in Many-Body Decays  

E-Print Network (OSTI)

It is well known that observing CP violation in many-body decays could provide strong evidence for physics beyond the Standard Model. Many searches have been carried out; however, no 5sigma evidence for CP violation has yet been found in these types of decays. A novel model-independent method for observing CP violation in many-body decays is presented in this paper. It is shown that the sensitivity of this method is significantly larger than those used to-date.

Mike Williams



T violation in radiative $\\beta$ decay and electric dipole moments  

E-Print Network (OSTI)

In radiative $\\beta$ decay, $T$ violation can be studied through a spin-independent $T$-odd correlation. We consider contributions to this correlation by beyond the standard model (BSM) sources of $T$-violation, arising above the electroweak scale. At the same time such sources, parametrized by dimension-6 operators, can induce electric dipole moments (EDMs). As a consequence, the manifestations of the $T$-odd BSM physics in radiative $\\beta$ decay and EDMs are not independent. Here we exploit this connection to show that current EDM bounds already strongly constrain the spin-independent $T$-odd correlation in radiative $\\beta$ decay.

Dekens, W G



Sensitivity Increases for the TITAN Decay Spectroscopy Program  

E-Print Network (OSTI)

The TITAN facility at TRIUMF has recently initiated a program of performing decay spectroscopy measurements in an electron-beam ion-trap (EBIT). The unique environment of the EBIT provides backing-free storage of the radioactive ions, while guiding charged decay particles from the trap centre via the strong magnetic field. This measurement technique is able to provide a significant increase in detection sensitivity for photons which result from radioactive decay. A brief overview of this device is presented, along with methods of improving the signal-to-background ratio for photon detection by reducing Compton scattered events, and eliminating vibrational noise.

Leach, K G; Grossheim, A; Andreoiu, C; Dilling, J; Frekers, D; Good, M; Seeraji, S



Sensitivity Increases for the TITAN Decay Spectroscopy Program  

E-Print Network (OSTI)

The TITAN facility at TRIUMF has recently initiated a program of performing decay spectroscopy measurements in an electron-beam ion-trap (EBIT). The unique environment of the EBIT provides backing-free storage of the radioactive ions, while guiding charged decay particles from the trap centre via the strong magnetic field. This measurement technique is able to provide a significant increase in detection sensitivity for photons which result from radioactive decay. A brief overview of this device is presented, along with methods of improving the signal-to-background ratio for photon detection by reducing Compton scattered events, and eliminating vibrational noise.

K. G. Leach; A. Lennarz; A. Grossheim; C. Andreoiu; J. Dilling; D. Frekers; M. Good; S. Seeraji



Searches for new physics in top decays at the LHC  

E-Print Network (OSTI)

The search for new physics in top quark decays at the LHC is reviewed in this paper. Results from ATLAS and CMS experiments on top quark decays within the Standard Model are presented together with the measurements of the W boson polarizations and the study of the structure of the Wtb vertex. As a natural step forward, the experimental status on measurements sensitive to top quark couplings to gauge bosons (\\gamma, Z, W and H) is reviewed as well as possible top quark decays Beyond the Standard Model (MSSM and FCNC).

A. Onofre



Empirical Survey of Neutrinoless Double Beta Decay Matrix Elements  

E-Print Network (OSTI)

Neutrinoless double beta decay has been the subject of intensive theoretical work as it represents the only practical approach to discovering whether neutrinos are Majorana particles or not, and whether lepton number is a conserved quantum number. Available calculations of matrix elements and phase-space factors are reviewed from the perspective of a future large-scale experimental search for neutrinoless double beta decay. Somewhat unexpectedly, a uniform inverse correlation between phase space and the square of the nuclear matrix element emerges. As a consequence, no isotope is either favored or disfavored; all have qualitatively the same decay rate per unit mass for any given value of the Majorana mass.

R. G. H. Robertson



A Search for Invisible Decays of the Upsilon(1S)  

SciTech Connect

We search for invisible decays of the {Upsilon}(1S) meson using a sample of 91.4 x 10{sup 6} {Upsilon}(3S) mesons collected at the BABAR/PEP-II B Factory. We select events containing the decay {Upsilon}(3S) {yields} {pi}{sup +}{pi}{sup -} {Upsilon}(1S) and search for evidence of an undetectable {Upsilon}(1S) decay recoiling against the dipion system. We set an upper limit on the branching fraction {Beta}({Upsilon}(1S) {yields} invisible) < 3.0 x 10{sup ?4} at the 90% confidence level.

Aubert, B.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prencipe, E.; Prudent, X.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Martinelli, M.; Palano, A.; Pappagallo, M.; /INFN, Bari /Bari U.; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Battaglia, M.; Brown, D.N.; Hooberman, B.; Kerth, L.T.; Kolomensky, Yu.G.; Lynch, G. /LBL, Berkeley /UC, Berkeley /Birmingham U. /Ruhr U., Bochum /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /Frascati /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa U. /Iowa State U. /Johns Hopkins U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Mainz U., Inst. Kernphys. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT, LNS /McGill U. /INFN, Milan /Milan U. /INFN, Milan /INFN, Milan /Milan U. /Mississippi U. /Montreal U. /Mt. Holyoke Coll. /INFN, Naples /Naples U. /INFN, Naples /INFN, Naples /Naples U. /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /Paris U., VI-VII /Pennsylvania U. /INFN, Perugia /Perugia U. /INFN, Pisa /Pisa U. /INFN, Pisa /Pisa, Scuola Normale Superiore /INFN, Pisa /Pisa U. /INFN, Pisa /Princeton U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /Rostock U. /Rutherford /DAPNIA, Saclay /SLAC /South Carolina U. /Stanford U., Phys. Dept. /SUNY, Albany /Tel Aviv U. /Tennessee U. /Texas U. /Texas U., Dallas /INFN, Turin /Turin U. /INFN, Trieste /Trieste U. /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison



A Search for Invisible Decays of the Upsilon(1S)  

E-Print Network (OSTI)

We search for invisible decays of the Upsilon(1S) meson using a sample of 91.4 x 10^{6} Upsilon(3S) mesons collected at the BaBar/PEP-II B-factory. We select events containing the decay Upsilon(3S) -> pi+ pi- Upsilon(1S) and search for evidence of an undetectable Upsilon(1S) decay recoiling against the dipion system. We set an upper limit on the branching fraction BR(Upsilon(1S) -> invisible) < 3.0 x 10^{-4} at the 90% confidence level.

The BABAR Collaboration; B. Aubert



Organization Advisor Type Name Email Address Alpha Delta Pi Chapter Advisor Allison Thompson aburkethompson@hotmail.com  

E-Print Network (OSTI)

Organization Advisor Type Name Email Address Alpha Delta Pi Chapter Advisor Allison Thompson aburkethompson@hotmail.com Alpha Delta Pi On-Campus Advisor Kendra Stewart stewartk@cofc.edu Alpha Epsilon Pi Chapter Advisor Andrew London andrewlondon@london.com Alpha Epsilon Pi On-Campus Advisor Marsha Alterman

Young, Paul Thomas


A two-loop relation between inclusive radiative and semileptonic B-decay spectra  

E-Print Network (OSTI)

A shape-function independent relation is derived between the partial B->X_u+l+nu decay rate with a cut on P_+=E_X-P_XX_s+gamma photon-energy spectrum. The leading-power contribution to the weight function is calculated at next-to-next-to-leading order in renormalization-group improved perturbation theory, including exact two-loop matching corrections at the scale mu_i^2 ~ m_b*Lambda_{QCD}. The overall normalization of the weight function is obtained up to yet unknown corrections of order [alpha_s(m_b)]^2. Power corrections from phase-space factors are included exactly, while the remaining subleading contributions are included at first order in 1/m_b. At this level unavoidable hadronic uncertainties enter, which are estimated in a conservative way. The combined theoretical accuracy in the extraction of |V_{ub}| is at the level of 5% if a value of Delta near the charm threshold can be achieved experimentally.

Bjorn O. Lange; Matthias Neubert; Gil Paz


Note: This page contains sample records for the topic "milliseconds alpha decay" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Two surface plasmon decay of plasma oscillations  

E-Print Network (OSTI)

The interaction of ultra-intense lasers with solid foils can be used to accelerate ions to high energies well exceeding 60 MeV. The non-linear relativistic motion of electrons in the intense laser radiation leads to their acceleration and later to the acceleration of ions. Ions can be accelerated from the front surface, the foil interior region, and the foil rear surface (TNSA, most widely used), or the foil may be accelerated as a whole if sufficiently thin (RPA). Here, we focus on the most widely used mechanism for laser ion-acceleration of TNSA. Starting from perfectly flat foils we show by simulations how electron filamentation at or inside the solid leads to a spatial modulations in the ions. The exact dynamics depend very sensitively on the chosen initial parameters which has a tremendous effect on electron dynamics. In the case of step-like density gradients we find evidence that suggests a two-surface-plasmon decay of plasma oscillations triggering a Raileigh-Taylor-like instability.

Kluge, Thomas; Zeil, Karl; Bussmann, Michael; Schramm, Ulrich; Cowan, Thomas E



Charm semileptonic decays from E791  

SciTech Connect

We report the results of a measurement of the form factor ratios r{sub V}=V(0)/A{sub 1}(0), r{sub 2}=A{sub 2}(0)/A{sub 1}(0) and r{sub 3}=A{sub 3}(0)/A{sub 1}(0) in the decays D{sup +}{r_arrow}{bar K}{sup {asterisk}0}scr(l){sup +}{nu}{sub scr(l)}, with {bar K}{sup {asterisk}0}{r_arrow}K{sup {minus}}{pi}{sup +}, and D{sub s}{sup +}{r_arrow}{phi}scr(l){sup +}{nu}{sub scr(l)}, with {phi}{r_arrow}K{sup {minus}}K{sup +}, using data from charm hadroproduction experiment E791 at Fermilab. We also report the results of an E791 measurement of the branching fraction B(D{sup +}{r_arrow}{rho}{sup 0}scr(l){sup +}{nu}{sub scr(l)})/B(D{sup +}{r_arrow}{bar K}{sup {asterisk}0}scr(l){sup +}{nu}{sub scr(l)}). {copyright} {ital 1999 American Institute of Physics.}

Fermilab E791 Collaboration



Search For Neutrinoless Double Beta Decay  

E-Print Network (OSTI)

The HEIDELBERG-MOSCOW experiment, which is the most sensitive double beta decay experiment since ten years has been regularly continued until end of November 2003. An analysis of the data has been performed already until May 20, 2003. The experiment yields now, on a 4? level, evidence for lepton number violation and proves that the neutrino is a Majorana particle. It further shows that neutrino masses are degenerate. In addition it puts several stringent constraints on other physics beyond the Standard Model. Among others it opens the door to test various supersymmetric theory scenarios, for example it gives the sharpest in the R-parity violating part of the superpotential, and limit on the parameter ? ? 111 gives information on the splitting of the sneutrino-antisneutrino system. The result from the HEIDELBERG-MOSCOW experiment is consistent with recent results from CMB investigations, with high energy cosmic rays, with the result from the g-2 experiment and with recent theoretical work. It is indirectly supported by the analysis of other Ge double beta experiments. Recent criticism of various kind has been shown to be wrong, among others by measurements performed in 2003 with a 214Bi source ( 226Ra), by simulation of the background in the range of Q?? by GEANT4, and by deeper investigation of statistical features such as sensitivity of peak search, and relevance of width of window of analysis. 1

H. V. Klapdor-kleingrothaus *a; I. V. Krivosheina A; A. Dietz A



Channeling of positrons from. mu. /sup +/ decay  

SciTech Connect

The first attempt to observe the steering or channeling effect of a host crystal lattice on the trajectories of decay positrons from interstitial positive muons is described. An enhanced (flux peaking) or diminished (blocking) positron counting rate for emission along a low index crystalline axis would be evidence of such an effect and would help to determine the lattice location of the emitting muon. The expected angular widths of these features is approximately 0.2/sup 0/. A 29.8 MeV/c surface ..mu../sup +/ beam was stopped in a high quality silicon crystal wafer which was elastically bent to a good approximation to a spherical cap. This brought the (100) axes, which were initially normal to the wafer surface, to a focus at the radius of curvature R = 110 cm. The normalized e/sup +/ rate was measured as a function of position with a small two-counter scintillation telescope which was moved through the focus. We found no evidence for channeling at the 17% level, suggesting that the ..mu../sup +/ in Si either (1) makes large vibratory excursions, (2) occupies a site of low symmetry, or (3) occupies one of several possible inequivalent stopping sites.

Patterson, B.D. (Simon Fraser Univ., Burnaby, British Columbia); Arrott, A.S.; Wichert, T.



Expression of POEM, a positive regulator of osteoblast differentiation, is suppressed by TNF-{alpha}  

SciTech Connect

Highlights: {yields} TNF-{alpha} inhibits POEM gene expression. {yields} Inhibition of POEM gene expression is caused by NF-{kappa}B activation by TNF-{alpha}. {yields} Over-expression of POEM recovers inhibition of osteoblast differentiation by TNF-{alpha}. -- Abstract: POEM, also known as nephronectin, is an extracellular matrix protein considered to be a positive regulator of osteoblast differentiation. In the present study, we found that tumor necrosis factor-{alpha} (TNF-{alpha}), a key regulator of bone matrix properties and composition that also inhibits terminal osteoblast differentiation, strongly inhibited POEM expression in the mouse osteoblastic cell line MC3T3-E1. TNF-{alpha}-induced down-regulation of POEM gene expression occurred in both time- and dose-dependent manners through the nuclear factor kappa B (NF-{kappa}B) pathway. In addition, expressions of marker genes in differentiated osteoblasts were down-regulated by TNF-{alpha} in a manner consistent with our findings for POEM, while over-expression of POEM recovered TNF-{alpha}-induced inhibition of osteoblast differentiation. These results suggest that TNF-{alpha} inhibits POEM expression through the NF-{kappa}B signaling pathway and down-regulation of POEM influences the inhibition of osteoblast differentiation by TNF-{alpha}.

Tsukasaki, Masayuki [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)] [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Yamada, Atsushi, E-mail: yamadaa@dent.showa-u.ac.jp [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)] [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Suzuki, Dai [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)] [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Aizawa, Ryo [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan) [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan); Miyazono, Agasa [Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan)] [Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan); Miyamoto, Yoichi; Suzawa, Tetsuo; Takami, Masamichi; Yoshimura, Kentaro [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)] [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Morimura, Naoko [Laboratory for Comparative Neurogenesis, RIKEN Brain Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198 (Japan)] [Laboratory for Comparative Neurogenesis, RIKEN Brain Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198 (Japan); Yamamoto, Matsuo [Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan)] [Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan); Kamijo, Ryutaro [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)] [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)



Prompt Neutron Decay for Delayed Critical Bare and Natural-Uranium-Reflected Metal Spheres of Plutonium and Highly Enriched Uranium  

SciTech Connect

Prompt neutron decay at delayed criticality was measured by Oak Ridge National Laboratory for uranium-reflected highly enriched uranium (HEU) and Pu metal spheres (FLATTOP), for an unreflected Pu metal (4.5% {sup 240}Pu) sphere (JEZEBEL) at Los Alamos National Laboratory (LANL) and for an unreflected HEU metal sphere at Oak Ridge Critical Experiments Facility. The average prompt neutron decay constants from hundreds of Rossi-{alpha} and randomly pulsed neutron measurements with {sup 252}Cf at delayed criticality are as follows: 3.8458 {+-} 0.0016 x 10{sup 5} s{sup -1}, 2.2139 {+-} 0.0022 x 10{sup 5} s{sup -1}, 6.3126 {+-} 0.0100 x 10{sup 5} s{sup -1}, and 1.1061 {+-} 0.0009 x 10{sup 6} s{sup -1}, respectively. These values agree with previous measurements by LANL for FLATTOP, JEZEBEL, and GODIVA I as follows: 3.82 {+-} 0.02 x 10{sup 5} s{sup -1} for a uranium core; 2.14 {+-} 0.05 x 10{sup 5} s{sup -1} and 2.29 x 10{sup 5} s{sup -1} (uncertainty not reported) for a plutonium core; 6.4 {+-} 0.1 x 10{sup 5} s{sup -1}, and 1.1 {+-} 0.1 x 10{sup 6} s{sup -1}, respectively, but have smaller uncertainties because of the larger number of measurements. For the FLATTOP and JEZEBEL assemblies, the measurements agree with calculations. Traditionally, the calculated decay constants for the bare uranium metal sphere GODIVA I and the Oak Ridge Uranium Metal Sphere were higher than experimental by {approx}10%. Other energy-dependent quantities for the bare uranium sphere agree within 1%.

Mihalczo, John T [ORNL



Activation of bean (Phaseolus vulgaris) [alpha]-amylase inhibitor requires proteolytic processing of the proprotein  

SciTech Connect

Seeds of the common bean (Phaseolus vulgaris) contain a plant defense protein that inhibits the [alpha]-amylases of mammals and insects. This [alpha]-amylase inhibitor ([alpha]Al) is synthesized as a proprotein on the endoplasmic reticulum and is proteolytically processed after arrival in the protein storage vacuoles to polypeptides of relative molecular weight (M[sub r]) 15,000 to 18,000. The authors report two types of evidence that proteolytic processing is linked to activation of the inhibitory activity. First, by surveying seed extracts of wild accessions of P. vulgaris and other species in the genus Phaseolus, they found that antibodies to [alpha]Al recognize large (M[sub r] 30,000-35,000) polypeptides as well as typical [alpha]Al processing products (M[sub r] 15,000-18,000). [alpha]Al activity was found in all extracts that had the typical [alpha]Al processed polypeptides, but was absent from seed extracts that lacked such polypeptides. Second, they made a mutant [alpha]Al in which asparagine-77 is changed to aspartic acid-77. This mutation slows down the proteolytic processing of pro-[alpha]Al when the gene is expressed in tobacco. When pro-[alpha]Al was separated from mature [alpha]Al by gel filtration, pro-[alpha]Al was found not to have [alpha]-amylase inhibitory activity. The authors interpret these results to mean that formation of the active inhibitor is causally related to proteolytic processing of the proprotein. They suggest that the polypeptide cleavage removes a conformation constraint on the precursor to produce the biochemically active molecule. 43 refs., 5 figs., 1 tab.

Pueyo, J.J.; Hunt, D.C.; Chrispeels, M.J. (Univ. of California, San Diego, La Jolla (United States))



Role of Hepatocyte Nuclear Factor 4 alpha in Hepatocyte Proliferation  

E-Print Network (OSTI)

-binding domain and the ligand-binding domain for proper binding of HNF4? to its response elements. A lack of the ligand-binding domain can reduce the affinity of HNF4? for its response elements by 75-fold (Chandra, Huang et al. 2013). HNF4?’s ligand..., 2013, with permission from American Physiological Society. Hepatology, 57(3): 2480-2490, Hepatocyte Nuclear Factor 4 alpha Deletion Promotes Diethylnitrosamine-induced Hepatocellular Carcinoma in Rodents, 2013, with permission from John Wiley & Sons...

Walesky, Chad Michael



Subthreshold K+ production in deuteron and alpha induced nuclear reactions  

E-Print Network (OSTI)

Double differential cross sections have been measured for pi+ and K+ emitted around midraidity in d+A and He+A collisions at a beam kinetic energy of 1.15 GeV/nucleon. The total pi+ yield increases by a factor of about 2 when using an alpha projectile instead of a deuteron whereas the K+ yield increases by a factor of about 4. According to transport calculations, the K+ enhancement depends both on the number of hadron-hadron collisions and on the energy available in those collisions: their center-of-mass energy increases with increasing number of projectile nucleons.

M. Debowski; P. Senger; M. Boivin; Y. LeBornec; P. Courtat; R. Gacougnolle; E. Grosse; S. Kabana; T. Kirchner; P. Koczon; M. Mang; E. Schwab; B. Tatischeff; A. Wagner; W. Walus; N. Willis; G. Wolf; R. Wurzinger; J. Yonnet



A Toy Model Study of Decay Trapping | Superconducting Magnet Division  

NLE Websites -- All DOE Office Websites (Extended Search)

A Toy Model Study of Decay Trapping, reported by Brett Parker A Toy Model Study of Decay Trapping, reported by Brett Parker Introduction A group from the BNL Superconducting Magnet Division is looking at various options for dipole magnets which would be suitable for use in a muon storage ring that is used as a neutrino factory. Since the useful neutrino beams from a neutrino factory come from straight sections it is desirable to minimize the rings arc circumference, in relation to straight section length, in order to ensure that the fraction of muons which decay in the straight section is as large as possible. Therefore superconducting magnets, with higher B-fields and smaller bend radii, are reasonable to consider for this application. Unfortunately the decay electrons generated along with the neutrinos carry on average about a third of the original


Fate of the false monopoles: Induced vacuum decay  

SciTech Connect

We study a gauge theory model where there is an intermediate symmetry breaking to a metastable vacuum that breaks a simple gauge group to a U(1) factor. Such a model admits the existence of metastable magnetic monopoles, which we dub false monopoles. We prove the existence of these monopoles in the thin-wall approximation. We determine the instantons for the collective coordinate that corresponds to the radius of the monopole wall and we calculate the semiclassical tunneling rate for the decay of these monopoles. The monopole decay consequently triggers the decay of the false vacuum. As the monopole mass is increased, we find an enhanced rate of decay of the false vacuum relative to the celebrated homogeneous tunneling rate due to S. R. Coleman [Subnuclear series 13, 297 (1977).].

Kumar, Brijesh [Physics Department, Indian Institute of Technology Bombay, Mumbai, 400076 (India); Groupe de physique des particules, Departement de physique, Universite de Montreal, Case Postale 6128, succursale Centre-ville, Montreal, Quebec, H3C 3J7 (Canada); Paranjape, M. B. [Groupe de physique des particules, Departement de physique, Universite de Montreal, Case Postale 6128, succursale Centre-ville, Montreal, Quebec, H3C 3J7 (Canada); Yajnik, U. A. [Physics Department, Indian Institute of Technology Bombay, Mumbai, 400076 (India); Groupe de physique des particules, Departement de physique, Universite de Montreal, Case Postale 6128, succursale Centre-ville, Montreal, Quebec, H3C 3J7 (Canada); Department of Physics, Ernest Rutherford Physics Building, McGill University, 3600 rue University, Montreal, Quebec, H3A 2T5 (Canada)



Covariant Wave Function Reduction and Coherent Decays of Kaon Pair  

E-Print Network (OSTI)

The recently developed relativistically covariant formulation of wave function reduction is illustrated for Lipkin's proposal to study CP violation in the coherent decay of kaon pairs. Covariant results are obtained in agreement with an amplitude approach proposed in the literature.

Bernd A. Berg



Recent Results in Semileptonic B Decays With BaBar  

E-Print Network (OSTI)

In this note, recent results of studies of semileptonic B meson decays from \\babar\\ are discussed and preliminary results given. In particular, a recent measurement of $\\mathcal{B}(B \\to D^{(*)}\\tau \

B. K. Hamilton



Solvable models of resonances and decays Pavel Exner  

E-Print Network (OSTI)

6. More about the decay laws 20 7. Quantum graphs 26 8. High-energy behavior of quantum many aspects that a review like this one cannot cover all of them; our ambition is to give just


Evidence of the Higgs Boson Decaying into Two Photons.  

E-Print Network (OSTI)

??A search for the standard model Higgs boson decaying to two photons will be presented. The analysis will cover 5.1 fb-1 and 19.6 fb-1 of… (more)

Berry, Douglas R



Chaotic Quantum Decay in Driven Biased Optical Lattices  

E-Print Network (OSTI)

Quantum decay in an ac driven biased periodic potential modeling cold atoms in optical lattices is studied for a symmetry broken driving. For the case of fully chaotic classical dynamics the classical exponential decay is quantum mechanically suppressed for a driving frequency \\omega in resonance with the Bloch frequency \\omega_B, q\\omega=r\\omega_B with integers q and r. Asymptotically an algebraic decay ~t^{-\\gamma} is observed. For r=1 the exponent \\gamma agrees with $q$ as predicted by non-Hermitian random matrix theory for q decay channels. The time dependence of the survival probability can be well described by random matrix theory. The frequency dependence of the survival probability shows pronounced resonance peaks with sub-Fourier character.

S. Mossmann; C. Schumann; H. J. Korsch



Renewal convergence rates and correlation decay for homogeneous pinning models  

E-Print Network (OSTI)

A class of discrete renewal processes with super-exponentially decaying inter-arrival distributions coincides with the infinite volume limit of general homogeneous pinning models in their localized phase. Pinning models are statistical mechanics systems to which a lot of attention has been devoted both for their relevance for applications and because they are solvable models exhibiting a non-trivial phase transition. The spatial decay of correlations in these systems is directly mapped to the speed of convergence to equilibrium for the associated renewal processes. We show that close to criticality, under general assumptions, the correlation decay rate, or the renewal convergence rate, coincides with the inter-arrival decay rate. We also show that, in general, this is false away from criticality. Under a stronger assumption on the inter-arrival distribution we establish a local limit theorem, capturing thus the sharp asymptotic behavior of correlations.

Giambattista Giacomin



The Decays of Luminescent KBr and LiF  

Science Journals Connector (OSTI)

A photo-multiplier, together with electronic pulse techniques, has been used to investigate the luminescent decay of KBr and LiF after irradiation with x-rays, at various temperatures. Decay curves plotted on a log-log scale are linear for KBr at 21°C and for LiF at 21°C and 0°C, with an average slope of 1.2. The curves for KBr at 0°C and the temperature of dry ice and acetone have linear upper and lower parts, connected by an intermediate curved part. It is suggested that the upper linear part is due to the decay of F? centers, and the lower part to the decay of F centers. The emission spectrum of KBr consists of 2 bands, a strong one centered at 4550A and a weaker one at 5300A, while that of LiF extends into the ultraviolet below 3000A.

A. H. Morrish and A. J. Dekker



Strong decays of excited baryons in Large Nc QCD  

SciTech Connect

We present the analysis of the strong decays widths of excited baryons in the framework of the 1/Nc expansion of QCD. These studies are performed up to order 1/Nc and include both positive and negative parity excited baryons.

Goity, J. L. [Physics Dept., Hampton University, Hampton, VA 23668 (United States); TJNAF, Newport News, VA 23606 (United States); Scoccola, N. N. [Lab. TANDAR, CNEA, Av.Libertador 8250, 1429 Buenos Aires (Argentina); CONICET, Rivadavia 1917, 1033 Buenos Aires (Argentina); Universidad Favaloro, Solis 453, 1078 Buenos Aires (Argentina)



Radiative decays of the ?(3684) into high-mass states  

Science Journals Connector (OSTI)

Results of studies of radiative decays of the ?(3684) using the SLAC-LBL magnetic detector at the electron storage ring SPEAR are presented. There are three high-mass states produced in ?(3684) radiative decays, with masses of 3414±3, 3503±4, and 3551±4 MeV where the errors given do not include an overall mass-scale uncertainty of ±4 MeV. There is some evidence for a fourth such state at either 3455 or 3340 MeV. The branching ratio for ?(3684) radiative decay into the state at 3414 MeV is found to be (7.5 ± 2.6)%. The decay modes of these states into hadrons and into ??(3095) are studied, yielding information about the branching ratios, spins, and parities of the states. The results are interpreted in the charmonium picture of the high-mass states.

W. Tanenbaum et al.
