Powered by Deep Web Technologies
Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Office of Legacy Management (LM)

:; / 2. ' :; / 2. ' b-:-"y .",...4 * .-.a 2 IL !< :. 34 --' -, ' ' < I ,-. g Tvo"l r . . .-i- :- " .1-. . . . . NC0 /L ' J,, ' ;.' , -_I( + ? CENTRAL FILES c -&' { ' c;$y ;;j*' E ,J): ' i' Z, 1; p -^ r-raL-r.nuzT".Fn., , ,..-y - -' -ie .". iJ.&:~e!ct.;;' sf ' ;;i_is ,trip ' JG,' go f-Jj;~ey~ 2123 -:s Cc::!<:\.& a k,ea 1:1,:r a;::: zzft:k-~ .sl.x"fe:; an:: , I to a&-isc 2n tiie g Tc;t?z ~,;~~~,;;'


US ENC WI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

120 120 US ENC WI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC WI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC WI Site Consumption kilowatthours $0 $300 $600 $900 $1,200 $1,500 US ENC WI Expenditures dollars ELECTRICITY ONLY average per household * Wisconsin households use 103 million Btu of energy per home, 15% more than the U.S. average. * Lower electricity and natural gas rates compared to states with a similar climate, such as New York, result in households spending 5% less for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers, keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC WI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

120 120 US ENC WI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC WI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC WI Site Consumption kilowatthours $0 $300 $600 $900 $1,200 $1,500 US ENC WI Expenditures dollars ELECTRICITY ONLY average per household * Wisconsin households use 103 million Btu of energy per home, 15% more than the U.S. average. * Lower electricity and natural gas rates compared to states with a similar climate, such as New York, result in households spending 5% less for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers, keeps average site electricity consumption in the state low relative to other parts of the U.S.


WiFi-Nano: Reclaiming WiFi Efficiency Through 800 ns Eugenio Magistretti  

E-Print Network (OSTI)

WiFi-Nano: Reclaiming WiFi Efficiency Through 800 ns Slots Eugenio Magistretti Rice University of WiFi has deteriorated from over 80% at 1 Mbps to under 10% at 1 Gbps. In this paper, we propose WiFi-Nano, thereby reducing ack overhead. We validate the effectiveness of WiFi-Nano through im- plementation

Mellor-Crummey, John


IL Wted States Government  

Office of Legacy Management (LM)

Tis&: p/WI-3 Tis&: p/WI-3 . IL Wted States Government ' 1, -1. \ k. 4 4L La. -iF 1 I ' __, 7, Department of Energy memorandum


WI Windinvest | Open Energy Information  

Open Energy Info (EERE)

WI Windinvest WI Windinvest Jump to: navigation, search Name WI Windinvest Place Westfalen, Germany Zip 48727 Sector Wind energy Product Westfalen based wind project developer Coordinates 43.992484°, -117.711985° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.992484,"lon":-117.711985,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Evansville WI (WWTP) | Open Energy Information  

Open Energy Info (EERE)

Evansville WI (WWTP) Evansville WI (WWTP) Jump to: navigation, search Name Evansville WI (WWTP) Facility Evansville WI (WWTP) Sector Wind energy Facility Type Small Scale Wind Facility Status In Service Owner Evansville WI (WWTP) Energy Purchaser Evansville WI (WWTP) Location Evansville WI Coordinates 42.77765315°, -89.28004146° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.77765315,"lon":-89.28004146,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Scheduling in multihop WiMAX networks  

Science Conference Proceedings (OSTI)

IEEE 802.16, popularly known as WiMAX, is at the forefront of the technology drive because of the growing demand for high-speed wireless broadband networks. Multihop WiMAX networks are particularly useful as they increase the coverage area without the ...

Debalina Ghosh; Ashima Gupta; Prasant Mohapatra



What is MoWiTT  

NLE Websites -- All DOE Office Websites (Extended Search)

the net energy flow through two window samples in side-by-side tests using ambient weather conditions. MoWiTT characterizes the net energy flow as a function of time and...


Category:Green Bay, WI | Open Energy Information  

Open Energy Info (EERE)

WI WI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Green Bay, WI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Green Bay WI Wisconsin Electric Power Co.png SVFullServiceRestauran... 79 KB SVQuickServiceRestaurant Green Bay WI Wisconsin Electric Power Co.png SVQuickServiceRestaura... 79 KB SVHospital Green Bay WI Wisconsin Electric Power Co.png SVHospital Green Bay W... 79 KB SVLargeHotel Green Bay WI Wisconsin Electric Power Co.png SVLargeHotel Green Bay... 78 KB SVLargeOffice Green Bay WI Wisconsin Electric Power Co.png SVLargeOffice Green Ba... 90 KB SVMediumOffice Green Bay WI Wisconsin Electric Power Co.png SVMediumOffice Green B... 78 KB SVMidriseApartment Green Bay WI Wisconsin Electric Power Co.png


Northern Illinois Gas Co IL  

Gasoline and Diesel Fuel Update (EIA)

Northern Northern Illinois Gas Co ............................ IL 254,574,988 4.60 Southern California Gas Co ...................... CA 233,632,354 6.89 Columbia Gas Dist Co............................... OH,KY,PA,MD 196,322,935 6.64 Pacific Gas and Elec Co............................ CA 190,864,262 5.83 Consumers Pwr Co ................................... MI 188,587,672 4.81 Michigan Consol Gas Co........................... MI 160,809,168 5.16 East Ohio Gas Co ..................................... OH 146,802,045 5.44 Pub Svc Elec and Gas Co......................... NJ 140,712,209 6.62 Peoples Gas Lt and Coke Co.................... IL 126,356,925 6.40 Brooklyn Union Gas Co............................. NY 106,349,594 9.43 Atlanta Gas Lt Co ...................................... GA 106,075,815 6.66 Lone Star Gas Co......................................


MoWiTT: The Mobile Window Thermal Test Facility  

NLE Websites -- All DOE Office Websites (Extended Search)

Airflow schematic MoWiTT: The Mobile Window Thermal Test Facility In the MoWiTT facility, efficient window-and-frame systems are measured to understand the flow of energy through...


An efficient security framework for mobile WiMAX  

Science Conference Proceedings (OSTI)

WiMAX is a technology that provides continuous high data throughput with low delays for various user types and modes of operation. The security protocols proposed for WiMAX impose a heavy performance overhead, especially on mobile subscribers running ... Keywords: PKMv2, WiMAX, handover, hierarcical identity based cryptography, security

Mete Rodoper; Arati Baliga; Edward Jung; Wade Trappe




Office of Legacy Management (LM)

ixa6-q ?k.m+~ ixa6-q ?k.m+~ @ lo3 IL.26 -ORNL/TM-11552 OAK RIDGE NATIONAL LABORATORY PRELIMINARY RESULTS OF THE RADIOLOGICAL SURVEY AT THE FORMER DOW CHEMICAL COMPANY SITE, MADISON, ILLINOIS c W . D. Cottrell J. K. W illiams OPERATED BY MARTIN MARIETTA ENERGY SYSTEMS, INC. FOR THE UNITED STATES DEPARTMENT OF ENERGY This report has been reproduced directly from the best available copy. Available to DOE and DOE contractors from the Office of Scientific and Techni- cal Information, P.O. Box 62. Oak Ridge, TN 37831; prices available from (615) 5766401, PTS 626-840 1. Availabie to the public from the National Technical Information Service, U.S. Department of Commerce, 5285 Port Royal Rd., Springfield, VA 22161. I I This report was prepared as an account of work sponsored by an agency of


Utilizing WiMAX mesh mode for efficient IPTV transmission  

Science Conference Proceedings (OSTI)

Providing high bit-rates, WiMAX enables IPTV multicasting for several simultaneous broadcasting channels. WiMAX base stations can offer higher capacity to users with better signal quality values, and more robust but lower capacity modulations to users ... Keywords: iptv, mesh mode, multicasting, wimax

Murat Ozyurt; Seckin Ulug; Tuna Tugcu



Detecting transmission power misbehaviour in wi-fi networks  

Science Conference Proceedings (OSTI)

In Wi-Fi networks, transmission (TX) power levels are constrained by regulatory limits. However, the emergence of flexible MAC drivers allows the easy modification of PHY and MAC layer parameters. This has enabled users to attempt to violate these limits. ... Keywords: EIRP, Wi-Fi, detection, misbehaviour, transmission power

Szymon Szott, Marek Sikora, Marek Natkaniec, Krzysztof Loziak




Gasoline and Diesel Fuel Update (EIA)

0.00-1.99 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1996 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1996 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: In 1996, consumption of natural gas for agricultural use


DOE - Office of Legacy Management -- Besley-Wells - Wisconsin - WI 03  

Office of Legacy Management (LM)

Besley-Wells - Wisconsin - WI 03 Besley-Wells - Wisconsin - WI 03 FUSRAP Considered Sites Site: Besley-Wells - Wisconsin (WI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Besley Products Co. WI.03-3 Location: Beloit , Wisconsin WI.03-1 Evaluation Year: 1994 WI.03-1 Site Operations: 1953 proposal for a trial lot of 500 uranium slugs to be machined by Besley double spindle wet grinder in order to compare production rate with that of current process; no indication proposed activities were carried out. WI.03-2 WI.03-3 Site Disposition: Eliminated - Potential for contamination considered remote based on the indication that proposed activities were not carried out WI.03-1 WI.03-3 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None WI.03-3



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

WI-TRIBE-STOCKBRIDGE-MUNSEE BAND OF MOHICAN INDIANS WI-TRIBE-STOCKBRIDGE-MUNSEE BAND OF MOHICAN INDIANS Location: Tribe WI-TRIBE- STOCKBRIDGE- MUNSEE BAND OF MOHICAN INDIANS WI American Recovery and Reinvestment Act: Proposed Action or Project Description The Stockbridge-Munsee Band of Mohican Indians proposes to conduct energy efficient audits of residential and commerical buildings. Conditions: None Categorical Exclusion(s) Applied: A9, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21 This action would not: threaten a violation of applicable statutory, regulatory, or permit requirements for environment, safety, and health, including DOE and/or Executive Orders; require siting, construction, or major expansion of waste storage, disposal, recovery, or


On the Construction of WiMax Mesh Tree  

E-Print Network (OSTI)

Abstract The IEEE 802.16 protocol, also known as WiMAX, has been designed to support long-range communications with high bitrates, using two operation modes: Point-to-Multi-Point (PMP) and Mesh. In the mesh mode, Subscriber Stations (SSs) can directly communicate with each other, thus forming a tree, and can be used to forward others data packets in a multihop fashion. On the contrary, in the PMP mode only one hop communication toward the Base Station (BS) is allowed. In this paper, we investigate the performance of the mesh mode by proposing an algorithm for constructing the WiMAX mesh tree. Our algorithm increases routes effective throughput by splitting long links into multiple shorter ones. We show through simulations that this approach leads to improving the throughput capacity of WiMAX-based wireless mesh networks. Index Terms WiMAX, wireless mesh networks. I.

Salim Nahle; Luigi Iannone; Benoit Donnet; Naceur Malouch


Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Allis-Chalmers Co - WI 01  

Office of Legacy Management (LM)

Allis-Chalmers Co - WI 01 Allis-Chalmers Co - WI 01 FUSRAP Considered Sites Site: Allis-Chalmers Co (WI.01 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Hawley Plant WI.01-1 Location: Milwaukee , Wisconsin WI.01-1 Evaluation Year: 1987 WI.01-1 Site Operations: Manufactured electrical equipment - pumps, motors, and switchgears for K-25 and Y-12. WI.01-1 Site Disposition: Eliminated - Scope of testing activities were limited - Very small amounts of Uranium metal were used for testing - Potential for residual radioactive material on the site considered remote. WI.01-1 WI.01-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Test Quantities of Uranium Metal WI.01-1 Radiological Survey(s): None Indicated


High School Visits (WI, IL, MN and other states) Arranged in alpha order  

E-Print Network (OSTI)

High School 10/5/12 8:15 a.m. Black River Falls High School 9/21/12 9:00 a.m. Bollingbrook High School High School 10/16/12 12:00 p.m. Crystal Lake Central High School 10/15/12 9:40 a.m. Cuba City High

Saldin, Dilano


State Laboratory Contacts IL  

Science Conference Proceedings (OSTI)

State Laboratory Contact Information IL. Idaho. ... State of Iowa Metrology Laboratory Ellsworth Community College 1100 College Ave. ...



DOE - Office of Legacy Management -- Trane Co - WI 0-02  

Office of Legacy Management (LM)

Trane Co - WI 0-02 Trane Co - WI 0-02 FUSRAP Considered Sites Site: TRANE CO. (WI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: LaCross , Wisconsin WI.0-02-1 Evaluation Year: 1987 WI.0-02-1 Site Operations: Produced Aluminum cans for fuel rod experiments at Argonne Met Lab; Supplied construction materials to Oak Ridge. WI.0-02-1 Site Disposition: Eliminated - No radioactive materials used at this site WI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None WI.0-02-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to TRANE CO. WI.0-02-1 - Memorandum/Checklist; A. Wallo to the File; (Elimination


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


MoWiTT:Mobile Window Thermal Test Facility  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 MoWiTT: Mobile Window Thermal Test Facility The window has come a long way since the days when it was a single pane of glass in a wood frame. Low-emissivity windows were designed to help buildings retain some of the energy that would have leaked out of less efficient windows. Designing efficient window-and-frame systems requires accurate measurement of the flow of energy through windows in realistic conditions, a capability provided by the Mobile Window Thermal Test facility. Consisting of a pair of outdoor, room-sized calorimeters, MoWiTT measures the net energy flow through two window samples in side-by-side tests using ambient weather conditions. MoWiTT characterizes the net energy flow as a function of time and measures the temperatures, solar fluxes, and


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


Fundamentals of WiMAX: Understanding Broadband Wireless Networking  

Science Conference Proceedings (OSTI)

This is the eBook version of the printed book. Praise for Fundamentals of WiMAX "This book is one of the most comprehensive books I have reviewed ... it is a must-read for engineers and students planning to remain current or who plan to pursue a career ...

Jeffrey Andrews; Arunabha Ghosh; Rias Muhamed



A survey of MAC based QoS implementations for WiMAX networks  

Science Conference Proceedings (OSTI)

We present a comprehensive survey of proposed Quality of Service (QoS) mechanisms in the Media Access Control (MAC) sublayer of WiMAX based wireless networks. QoS support in WiMAX is a fundamental design requirement, and is considerably more difficult ... Keywords: MAC, Media Access Control, QoS, Quality of Service, WiMAX, Wireless networks

Y. Ahmet ?ekercio?lu; Milosh Ivanovich; Alper Ye?in



QoS differentiation for IEEE 802.16 WiMAX mesh networking  

Science Conference Proceedings (OSTI)

Recently IEEE 802.16 WiMAX has attracted a lot of attention in wireless networking research and applications. To enable a flexible and cost-effective deployment, mesh networking mode is defined in WiMAX standard. In this paper, we introduce a system ... Keywords: IEEE 802.16, QoS, WiMAX mesh, interference-aware design, scheduling

Yan Zhang; Honglin Hu; Hsiao-Hwa Chen



A joint centralized scheduling and channel assignment scheme in WiMax mesh networks  

Science Conference Proceedings (OSTI)

The IEEE 802.16 standard, also known as Worldwide Interoperability for Microwave Access (WiMax), which provides a mechanism for deploying high-speed wireless mesh networks in metropolitan areas. Thus, Quality of Service (QoS) is very important for WiMax ... Keywords: MDFS algorithm, WiMax mesh networks, centralized scheduling, channel assignment

Yuliang Tang; Yan Yao; Xinrong Lin



DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


Wireless wakeups revisited: energy management for voip over wi-fi smartphones  

Science Conference Proceedings (OSTI)

IP based telephony is rapidly gaining acceptance over traditional means of voice communication. Wireless LANs are also becoming ubiquitous due to their inherent ease of deployment and decreasing costs. In enterpriseWi-Fi environments, VoIP is a compelling ... Keywords: VoIP, Wi-Fi, cellular networks, power management, smartphones

Yuvraj Agarwal; Ranveer Chandra; Alec Wolman; Paramvir Bahl; Kevin Chin; Rajesh Gupta



Applications of WiMAX-based wireless mesh network in monitoring wind farms  

Science Conference Proceedings (OSTI)

This paper has studied the feasibility of applying World Interoperability for Microwave Access (WiMAX) based Wireless Mesh Networks (WMNs) in monitoring wind farms. WMNs provide a dynamic topology which meets the requirements of communications ... Keywords: WMNs, WiMAX, World Interoperability for Microwave Access, communications, renewable energy, simulation, wind energy, wind farm monitoring, wind farms, wind power, wireless mesh networks, wireless networks

Gang Zheng; Hongbing Xu; Xinheng Wang; Jianxiao Zou



Blue-Fi: enhancing Wi-Fi performance using bluetooth signals  

Science Conference Proceedings (OSTI)

Mobile devices are increasingly equipped with multiple network interfaces with complementary characteristics. In particular, the Wi-Fi interface has high throughput and transfer power efficiency, but its idle power consumption is prohibitive. In this ... Keywords: bluetooth, context-awareness, energy-efficiency, location, mobile device, wi-fi

Ganesh Ananthanarayanan; Ion Stoica



Citywide mobile internet access using dense urban WiFi coverage  

Science Conference Proceedings (OSTI)

We investigate if it is feasible to use the WiFi coverage in urban areas for mobile Internet access and which type of applications can benefit from the Internet access provided by the already deployed WiFi Access Points (APs). Nowadays, most smartphones ... Keywords: mobile clients, mobile internet access, wifi, wireless networks

Maria Eugenia Berezin; Franck Rousseau; Andrzej Duda



WiMAX Double Movable Boundary Scheme in the Vehicle to Infrastructure Communication Scenario  

Science Conference Proceedings (OSTI)

WiMAX is an interesting technology that will be applied in vehicular networks due to the provisioning of high mobility, wide coverage, and different classes of service. In this paper, we investigate the problem of vehicular applications mapping in the ... Keywords: Intelligent Transportation System, Quality of service, Scheduling, WiMAX

Rola Naja; Melhem El Helou; Samir Tohm


Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Beyond deployments and testbeds: experiences with public usage on vehicular WiFi hotspots  

Science Conference Proceedings (OSTI)

We describe our experiences with deploying a vehicular Internet access service on public transit buses. Our system, called WiRover, has been running on these buses since April 2010 for about 18 months till date providing a WiFi hotspot to which bus passengers ... Keywords: network diversity, vehicular connectivity, wireless, wirover

Joshua Hare; Lance Hartung; Suman Banerjee



Fast-converging scheduling and routing algorithms for WiMAX mesh networks  

Science Conference Proceedings (OSTI)

In this paper, we present fast converging algorithms that fit well WiMAX mesh networks. First, a centralized scheduling algorithm is presented. It calculates schedules by transforming the multi-hop tree into a single hop, and then repartitioning the ... Keywords: WiMAX, mesh networks, routing, scheduling

Salim Nahle; Naceur Malouch




Office of Legacy Management (LM)

,,.. .r' ,,.. .r' +p,o~ ,!,*' A;>$, :.::> ,' ; ,.;I:- : ~ ", ,r .,,. ' , ' i.,l<, ~ ,1* .iT ,.~~~~~~~I~ _,L :,~.:/: .,,.,,,.,' ,, ;, ,, ,, I .. ,(: _ : ; . , y.,+ lar&f&r!rj&~+ ,id) L"'w#~~~~* I. ,& f ;";.y,m; ,I @ & **t&,y%:iis ;*a k' q&t ,:.: ;,I,' ,,, ,_ *, . ,. ,,&S_ ;, , (, t+ I . 1. -. ' ,' ~' i"'i,!..l + *I .(, h," ,rz ,. ,' :' ,' . :,' . ,.' _-#I_ ,. ,I. :, ,.' , ..I>. Xi,,? ,I. , ,r c/i' ,"" >.:1.. .>,. w/.&q:r*x Il.-'",.' !,.~~,,,~~iyY;~~~aj' ,~,,~~~~~~~~~ri~ *~i..iz~~ri~~~J~illi~;' ~(l~.~~i:)i9:ll~,-' i ?, ".' a? ,,?J,?" ~~~~I~~.~,~~~~~~~~.~~~~~~~~~~~~~-~ +q86?,r$w4t .r:~:@o:, " .", ' 1 j/ +$+. : WJl @+&?+&&w ' . 2 _ ._ b )., .;,a. :,. I .b.i.:.,*. A'


Energy Management for the "WiFi of Things"  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Management for the "WiFi of Things" Energy Management for the "WiFi of Things" Speaker(s): Janet Peterson Date: May 6, 2010 - 12:00pm Location: 90-3122 This seminar will present an overview of the WiFi enabled energy management technologies pioneered by Our Home Spaces. Our Home Spaces provides consumer facing energy management solutions. These energy management solutions are based on using the existing consumer infrastructure and devices - this allows a lower cost of entry for both the utilities and less complexity in the home. Working with low cost low power WiFi chips from GainSpan and Marvell allow WiFi solutions to range from communicating thermostat, to energy monitoring and controlling smart plugs thru irrigation controllers. The system takes advantage of ubiquitous nature


A-GPS Assisted Wi-Fi Access Point Discovery on Mobile Devices for Energy Saving  

E-Print Network (OSTI)

Mobile devices have been shipped with multiple wireless network interfaces in order to meet their diverse communication and networking demands. In this paper, we propose an A-GPS assisted scheme that discovers the nearest Wi-Fi network access points (APs) by using user's location information. This allows the user to switch to the Wi-Fi interface in an intelligent manner when she/he arrives at the nearest Wi-Fi network AP. Therefore, it avoids the long periods in idle state and greatly reduces the number of unnecessary Wi-Fi scans on the mobile device. The experimental results demonstrate that our scheme effectively saves energy for mobile devices integrated with Wi-Fi and cellular interfaces.

Xia, Feng; Ding, Fangwei; Hao, Ruonan




NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)



Gasoline and Diesel Fuel Update (EIA)

176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY...


DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


Il Vopiscus di Lucio Afranio.  

E-Print Network (OSTI)

??In un quadro bibliografico molto ridotto, il presente lavoro si prefigge di ricercare un metodo per proporre un testo, una traduzione e un commento esegetico, (more)




St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


Super Wi-Fi is Super for Energy Too | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Super Wi-Fi is Super for Energy Too Super Wi-Fi is Super for Energy Too Super Wi-Fi is Super for Energy Too September 24, 2010 - 11:45am Addthis Super Wi-Fi is Super for Energy Too Nick Sinai Senior Advisor to the U.S. Chief Technology Officer, White House Office of Science and Technology Policy What does this mean for me? By integrating broadband into the emerging Smart Grid, consumers will have revolutionized communication with their utility -- they will have detailed information on their energy use that will help inform them how they can save on their electric bills. Editor's Note: Cross-posted from the National Broadband Plan blog, which deals with how broadband technology will integrate into the smart grid. We at the FCC are very excited about yesterday's order to free up the unused "white spaces" spectrum between television channels, intended to


Using unlabeled Wi-Fi scan data to discover occupancy patterns of private households  

Science Conference Proceedings (OSTI)

This poster presents the homeset algorithm, a lightweight approach to estimate occupancy schedules of private households. The algorithm relies on the mobile phones of households' occupants to collect Wi-Fi scans. The scans are then used to determine ...

Wilhelm Kleiminger, Christian Beckel, Anind Dey, Silvia Santini



Identified Patent Waiver W(I)2012-003 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3 Identified Patent Waiver W(I)2012-003 This document waives certain patent rights the Department of Energy (DOE) has to inventions conceived or first actually reduced to practice...


Identified Patent Waiver W(I)2012-004 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

4 Identified Patent Waiver W(I)2012-004 This document waives certain patent rights the Department of Energy (DOE) has to inventions conceived or first actually reduced to practice...


Identified Patent Waiver W(I)2012-005 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5 Identified Patent Waiver W(I)2012-005 This document waives certain patent rights the Department of Energy (DOE) has to inventions conceived or first actually reduced to practice...


DOE - Office of Legacy Management -- Chicago North IL Site - IL 05  

Office of Legacy Management (LM)

North IL Site - IL 05 North IL Site - IL 05 FUSRAP Considered Sites Chicago North, IL Alternate Name(s): National Guard Armory 124th Field Artillery Armory Illinois National Guard Armory Site IL.05-4 IL.05-5 Location: 5200 Cottage Grove Avenue, Chicago, Illinois IL.05-4 Historical Operations: Processed and stored uranium metal, resulting in uranium metal and dry uranium oxide contamination. Metallurgical operations were conducted by the University of Chicago, an MED contractor. IL.05-5 IL.05-7 IL.05-8 Eligibility Determination: Eligible IL.05-1 IL.05-2 IL.05-3 Radiological Survey(s): Assessment Surveys, Verification Surveys IL.05-6 IL.05-7 Site Status: Certified-Certification Basis, Federal Register Notice Included IL.05-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


US ENC IL Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

IL IL Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC IL Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC IL Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC IL Expenditures dollars ELECTRICITY ONLY average per household * Illinois households use 129 million Btu of energy per home, 44% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Illinois households spending 2% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


US ENC IL Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

IL IL Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC IL Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC IL Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC IL Expenditures dollars ELECTRICITY ONLY average per household * Illinois households use 129 million Btu of energy per home, 44% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Illinois households spending 2% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


Category:Chicago, IL | Open Energy Information  

Open Energy Info (EERE)

IL IL Jump to: navigation, search Go Back to PV Economics By Location Media in category "Chicago, IL" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Chicago IL Commonwealth Edison Co.png SVFullServiceRestauran... 74 KB SVHospital Chicago IL Commonwealth Edison Co.png SVHospital Chicago IL ... 68 KB SVLargeHotel Chicago IL Commonwealth Edison Co.png SVLargeHotel Chicago I... 75 KB SVLargeOffice Chicago IL Commonwealth Edison Co.png SVLargeOffice Chicago ... 76 KB SVMediumOffice Chicago IL Commonwealth Edison Co.png SVMediumOffice Chicago... 73 KB SVMidriseApartment Chicago IL Commonwealth Edison Co.png SVMidriseApartment Chi... 77 KB SVOutPatient Chicago IL Commonwealth Edison Co.png SVOutPatient Chicago I... 74 KB SVPrimarySchool Chicago IL Commonwealth Edison Co.png


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


DOE - Office of Legacy Management -- Granite City IL Site - IL 28  

Office of Legacy Management (LM)

Granite City IL Site - IL 28 Granite City IL Site - IL 28 FUSRAP Considered Sites Granite City, IL Alternate Name(s): Granite City Steel General Steel Industries General Steel Casings Corporation New Betatron Building IL.28-3 Location: 1417 State Street, Granite City, Illinois IL.28-3 Historical Operations: Under subcontract with Mallinckrodt and using a government-owned Betatron (magnetic induction electron accelerator), x-rayed natural uranium ingots and dingots to detect metallurgical flaws. Contamination from rubbing off of oxidized uranium during handling. IL.28-3 IL.28-5 Eligibility Determination: Eligible IL.28-1 IL.28-2 Radiological Survey(s): Assessment Surveys, Verification Survey IL.28-6 IL.28-7 IL.28-8 Site Status: Certified - Certification Basis, Federal Register Notice included IL.28-9


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



Category:Springfield, IL | Open Energy Information  

Open Energy Info (EERE)

IL IL Jump to: navigation, search Go Back to PV Economics By Location Media in category "Springfield, IL" The following 16 files are in this category, out of 16 total. SVQuickServiceRestaurant Springfield IL Commonwealth Edison Co.png SVQuickServiceRestaura... 75 KB SVFullServiceRestaurant Springfield IL Commonwealth Edison Co.png SVFullServiceRestauran... 75 KB SVHospital Springfield IL Commonwealth Edison Co.png SVHospital Springfield... 67 KB SVLargeHotel Springfield IL Commonwealth Edison Co.png SVLargeHotel Springfie... 75 KB SVLargeOffice Springfield IL Commonwealth Edison Co.png SVLargeOffice Springfi... 76 KB SVMediumOffice Springfield IL Commonwealth Edison Co.png SVMediumOffice Springf... 74 KB SVMidriseApartment Springfield IL Commonwealth Edison Co.png


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...


FI St Po Crypto IPS 140 tanley ortal Ga ograph 0-2 Sec Wi-Q ...  

Science Conference Proceedings (OSTI)

... Q Portal Gat ey Wi-Q Port a wireless ga Wi-Q Comm ry 802.15.4 on tested: 3. on tested: 12 tion ... he s the nts. Page 11. ... The PG d lf Test ower-Up ...



A study on the security, the performance and the penetration of Wi-Fi networks in a Greek urban area  

Science Conference Proceedings (OSTI)

This paper presents a study on the expansion of urbanWi-Fi networks and the degree of users' awareness about their characteristics. It involves an experiment contacted at the area of Serres, a Greek city of around 70,000 inhabitants. The findings revealed ... Keywords: Wi-Fi networks usage, urban networks, war driving, wireless security

Savvas Mousionis; Alex Vakaloudis; Constantinos Hilas



A Silence Duration Based Uplink Scheduling Algorithm for Multiple VoIP Users in M-WiMAX  

Science Conference Proceedings (OSTI)

This paper proposes an efficient uplink scheduling algorithm that can perfectly support various VoIP CODECs with VAD/DTX/CNG in M-WiMAX considering the variants of silence duration between different voice users, solving the problems of uplink resources ... Keywords: G.729B, VAD/DTX/CNG, VoIP CODECs, WiMAX, ertPS, scheduling algorithm

Farouk Y. M. Alkadhi; Zheng Liu; Min Yang; Qiuhong Wang; Jufeng Dai



Quick GuideWindows 7 Wi-Fi set up POSTECH Wireless Network Connection Setup Guide for Windows 7  

E-Print Network (OSTI)

Quick GuideWindows 7 Wi-Fi set up POSTECH Wireless Network Connection Setup Guide for Windows 7 1 the box is unchecked. #12;Quick GuideWindows 7 Wi-Fi set up 7. Successfully added postech -> Change Connection Setup Guide for Windows 7 Make sure this box is unchecked. #12;

Kim, Yong Jung


A cross-layer framework for video-on-demand service in multi-hop WiMax mesh networks  

Science Conference Proceedings (OSTI)

In this work, we introduce a cross-layer framework to favor the video-on-demand service in multi-hop WiMax mesh networks. We first propose a joint solution of admission control and channel scheduling for video streams. The proposed approach guarantees ... Keywords: Cross-layer design, Simulation, Video-on-demand, WiMax, Wireless mesh network

Fei Xie; Kien A. Hua; Ning Jiang



Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


Quantitative analysis of IL-2 and IL-15 signal transduction in T lymphocytes  

E-Print Network (OSTI)

IL-2 and IL-15 are common y-chain family cytokines critically involved in regulation of T cell differentiation and homeostasis. Both cytokines signal through a heterotrimeric surface receptor complex (IL-2/15R) composed ...

Arneja, Abhinav




E-Print Network (OSTI)

36 SEPTEMBER | 2012 WiNd TURbiNE CAPACiTY FRONTiER FROM SCAdA ThE WORld hAS SEEN A significant contributor to this growth. The wind turbine generated energy depends on the wind potential and the turbine of wind turbines. Supervi- sory control and data acquisition (SCADA) systems record wind turbine

Kusiak, Andrew


Experiences, challenges and lessons from rolling out a rural WiFi mesh network  

Science Conference Proceedings (OSTI)

The computing for development community knows that technology interventions involve consideration of social, technical and environmental factors. Research into WiFi solutions has fallen off as ubiquitous mobile solutions penetrate even the deepest rural ... Keywords: VoIP, baseline study, community co-design, inverse infrastructure, participatory and ethnographic methods, telecommunications

Carlos Rey-Moreno; Zukile Roro; William D. Tucker; Masbulele Jay Siya; Nicola J. Bidwell; Javier Simo-Reigadas


Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Improvement security for RuBee radio-WiMAX mesh networks  

Science Conference Proceedings (OSTI)

Next generation communication standard integrate various access networks technology to become mesh networks. One of air interface standard is metropolitan area wireless broadband service. IEEE 802.16 is the basis for Worldwide Interoperability for Microwave ... Keywords: AAA, RuBee (IEEE 1902.1), WiMAX, gateway access point, group identity key

Tin-Yu Wu; Jhong-Ci Wu; Wei-Fang Weng



Wi-Fi/ZigBee coexistence for fault-tolerant building automation system  

Science Conference Proceedings (OSTI)

The paper presents a case study where a building automation system is investigated using two wireless standards, ZigBee and Wi-Fi 802.11b. Since each standard has specific features and advantages, a network incorporating both manifests itself as an optimal ...

Tarek K. Refaat, Mohamed A. Saleh, Ramz M. Daoud, Hassanein H. Amer, Magdy S. El-Soudani, Magdi S. Moustafa



An experimental performance comparison of 3G and Wi-Fi  

Science Conference Proceedings (OSTI)

Mobile Internet users have two options for connectivity: pay premium fees to utilize 3G or wander around looking for open Wi-Fi access points. We perform an experimental evaluation of the amount of data that can be pushed to and pulled from the Internet ...

Richard Gass; Christophe Diot



Perspectives on quality of experience for video streaming over WiMAX  

Science Conference Proceedings (OSTI)

The advent of broadband wireless networks, such as WiMAX, is paving the way for the widespread deployment of high-bandwidth video streaming services for mobile users. To provide acceptable end-to-end performance in such a network, it is important to ...

Arun Vishwanath; Partha Dutta; Malolan Chetlu; Parul Gupta; Shivkumar Kalyanaraman; Amitabha Ghosh



WiMAX-RBDS-Sim: an OPNET simulation framework for IEEE 802.16 mesh networks  

Science Conference Proceedings (OSTI)

In this paper, a simulation model for IEEE 802.16 (WiMAX) wireless mesh networks with distributed scheduling is developed. It provides a framework for the evaluation of reservation-based distributed scheduling (RBDS) policies at the medium access control ... Keywords: IEEE 802.16, OPNET, distributed scheduling, simulation, wireless mesh networks

Gustavo Vejarano; Janise McNair



RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



DOE - Office of Legacy Management -- Chicago South IL Site - IL 06  

NLE Websites -- All DOE Office Websites (Extended Search)

South IL Site - IL 06 South IL Site - IL 06 FUSRAP Considered Sites Chicago South, IL Alternate Name(s): University of Chicago Charles Herbert Jones Chemical Laboratory Ryerson Physical Laboratory Eckhart Hall Kent Chemical Laboratory Ricketts Laboratory IL.06-3 Location: University of Chicago, Ellis Avenue and East 58th Street, Chicago, Illinois IL.06-3 Historical Operations: Performed activities associated with (1) production and purification of plutonium, which involved the handling and processing of uranium compounds; (2) demonstrating the self-sustaining nature of the fission process and the production of Pu-239 from U-238 (nuclear fission and Chicago Pile-1); and (3) health effects (metal toxicology and radiation effects). IL.06-5 IL.06-6 IL.06-7 Eligibility Determination: Eligible IL.06-1


DOE - Office of Legacy Management -- Chicago South IL Site - IL 06  

Office of Legacy Management (LM)

South IL Site - IL 06 South IL Site - IL 06 FUSRAP Considered Sites Chicago South, IL Alternate Name(s): University of Chicago Charles Herbert Jones Chemical Laboratory Ryerson Physical Laboratory Eckhart Hall Kent Chemical Laboratory Ricketts Laboratory IL.06-3 Location: University of Chicago, Ellis Avenue and East 58th Street, Chicago, Illinois IL.06-3 Historical Operations: Performed activities associated with (1) production and purification of plutonium, which involved the handling and processing of uranium compounds; (2) demonstrating the self-sustaining nature of the fission process and the production of Pu-239 from U-238 (nuclear fission and Chicago Pile-1); and (3) health effects (metal toxicology and radiation effects). IL.06-5 IL.06-6 IL.06-7 Eligibility Determination: Eligible IL.06-1


Weights and Measures State Directors IL  

Science Conference Proceedings (OSTI)

State Directors IL. Idaho. Mailing Address, Contact Information. ISDA Bureau of Weights & Measures PO Box 790 Boise, ID 83701. ...



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links  

E-Print Network (OSTI)

2) and the concentration of 65Cu2+ estimated by the speciation model WHAM (1.0 (28)), we could]e^ equals zero and that [65 Cu2+ ] was constant (i.e., nominal [65 Cu2+ ] ) 5.2-µg L-1). That is, WHAM the speciation model WHAM (28) assuming that the lake water has a pH near 8 (30), a dissolved organic carbon

Allen, Gale


File:USDA-CE-Production-GIFmaps-WI.pdf | Open Energy Information  

Open Energy Info (EERE)

WI.pdf WI.pdf Jump to: navigation, search File File history File usage Wisconsin Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 326 KB, MIME type: application/pdf) Description Wisconsin Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Wisconsin External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:22, 27 December 2010 Thumbnail for version as of 16:22, 27 December 2010 1,650 × 1,275 (326 KB) MapBot (Talk | contribs) Automated bot upload


Multi-channel transmission with efficient delivery of routing information in maritime WiMAX mesh networks  

Science Conference Proceedings (OSTI)

There is a lack of broadband wireless network in sea to meet the increasing needs of modern maritime users and we have envisaged WiMAX mesh networks for high-speed and low-cost ship-to-ship/shore communications. In such a maritime WiMAX mesh network, ... Keywords: IEEE Std 802.16-2004, broadband wireless access, maritime communications, mesh network, multi-channel transmission

Ming-Tuo Zhou; Hiroshi Harada; Peng-Yong Kong; Chee-Wei Ang; Yu Ge; J. S. Pathmasuntharam



,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


DOE - Office of Legacy Management -- Madison - IL 26  

Office of Legacy Management (LM)

Madison - IL 26 Madison - IL 26 FUSRAP Considered Sites Madison, IL Alternate Name(s): Spectrulite Consortium, Inc. Former Dow Chemical Company Site IL.26-3 IL.26-4 Location: Intersection of College and Weaver Streets, Madison, Illinois IL.26-4 Historical Operations: Conducted experimental work in natural uranium metal extrusion. IL.26-4 IL.26-5 Eligibility Determination: Eligible IL.26-1 IL.26-2 Radiological Survey(s): Assessment Survey, Verification Survey IL.26-4 LTSM00011565 LTSM00013029 LTSM00011563 Site Status: Cleanup Complete LTSM00011565 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP Also see Madison, Illinois, Site Documents Related to Madison, IL FACT SHEET The Madison, Illinois, Site is located northeast of and


The University of Texas at Austin July 11, 2012 Data Communications Wi-Fi Access Points 27 21 33-1  

E-Print Network (OSTI)

The University of Texas at Austin July 11, 2012 Data Communications Wi-Fi Access Points 27 21 33 of WAPs Up to 125 1 WAP / 25 people #12;The University of Texas at Austin July 11, 2012 Data of Texas at Austin July 11, 2012 Data Communications Wi-Fi Access Points 27 21 33-3 5. Distance limitation

Texas at Austin, University of

Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Human activity recognition in indoor environments by means of fusing information extracted from intensity of WiFi signal and accelerations  

Science Conference Proceedings (OSTI)

In this work, we propose an activity recognition system based on the use of a topology-based WiFi localization system combined with accelerometers for body posture recognition. The WiFi localization system is developed using a fuzzy rule-based classifier ... Keywords: Fuzzy logic, Human activity recognition, Interpretability-accuracy trade-off

Alberto Alvarez-Alvarez; Jose M. Alonso; Gracian Trivino



St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


DOE - Office of Legacy Management -- Podbeilniac Corp - IL 22  

Office of Legacy Management (LM)

Podbeilniac Corp - IL 22 Podbeilniac Corp - IL 22 FUSRAP Considered Sites Site: PODBEILNIAC CORP. (IL.22) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Chicago , Illinois IL.22-1 Evaluation Year: 1990 IL.22-2 Site Operations: MED used equipment for a uranium extraction experiment in 1957. IL.22-1 Site Disposition: Eliminated - Potential for contamination considered remote due to limited scope of activities performed at the site IL.22-2 IL.22-3 IL.22-4 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium IL.22-1 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to PODBEILNIAC CORP. IL.22-1 - Report, Ross to Quigley; Trip Report to Podbeilniac Corp.,


DOE - Office of Legacy Management -- Fansteel Metallurgical Corp - IL 16  

NLE Websites -- All DOE Office Websites (Extended Search)

Fansteel Metallurgical Corp - IL 16 Fansteel Metallurgical Corp - IL 16 FUSRAP Considered Sites Site: Fansteel Metallurgical Corp. (IL.16 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Chicago , Illinois IL.16-1 Evaluation Year: 1987 IL.16-3 Site Operations: Sole producer and supplier of tantalum and columbium metals to the MED. IL.16-1 IL.16-3 Site Disposition: Eliminated - No radioactive materials handled at this site IL.16-2 IL.16-3 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None IL.16-2 Radiological Survey(s): No Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Fansteel Metallurgical Corp. IL.16-1 - MED Memorandum; Greninger to the File; Subject: Visit to


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



Radiometric and Engineering Performance of the SeaWiFS Quality Monitor (SQM): A Portable Light Source for Field Radiometers  

Science Conference Proceedings (OSTI)

A portable and stable source of radiant flux, the Sea-viewing Wide Field-of-view Sensor (SeaWiFS) Quality Monitor (SQM), was developed as a field instrument for use in experiments away from the calibration laboratory such as those encountered ...

B. Carol Johnson; Ping-Shine Shaw; Stanford B. Hooker; Don Lynch



DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


DOE - Office of Legacy Management -- Precision Extrusion Co - IL 20  

NLE Websites -- All DOE Office Websites (Extended Search)

Precision Extrusion Co - IL 20 Precision Extrusion Co - IL 20 FUSRAP Considered Sites Site: PRECISION EXTRUSION CO. (IL.20) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 720 East Green Avenue , Bensenville , Illinois IL.20-1 Evaluation Year: 1987 IL.20-2 Site Operations: 1956-1959, metal fabrication - extruded uranium billets. IL.20-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantities of materials handled at the site IL.20-2 Radioactive Materials Handled: Yes IL.20-1 Primary Radioactive Materials Handled: Uranium IL.20-1 Radiological Survey(s): Yes IL.20-3 Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to PRECISION EXTRUSION CO.


IL.06-123 057 I I  

Office of Legacy Management (LM)

IL.06-123 057 I I IL.06-123 057 I I 7 Bechtel National. Inc Systems Engmeers - Constructors Jackson Plaza Tower e 800 Oak Ridge Turnpike Oak Ridge. Tennessee 37830 AII.il Addr.u P.O 80.350. 0.' R,dg_. 7N 3713' .0350 7.'-. 3785873 NOV 1 5 . . u.s. Department of Energy Oak Ridge Operations Post Office Box E Oak Ridge, Tennessee 37831 Attention: Peter J. Gross, Director Technical Services Division Subject: Bechtel Job No. 14501, FUSRAP Project DOE Contract No. DE-AC05-810R20722 Revised Letter Characterization Report for the George Herbert Jones Chemical Laboratory at the Unive sity of Chicago Site, Chicago, Illinois Code: 7330/WBS: 131 Dear Mr. Gross: Radiological characterization and remedial action activities were performed by Bechtel National, Inc. (BNI) at George


SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012" Coal Consumers in the Manufacturing and Coke Sectors, 2012" "Company Name","Plant Location" "Top Ten Manufacturers" "American Crystal Sugar Co","MN, ND" "Archer Daniels Midland","IA, IL, MN, ND, NE" "Carmeuse Lime Stone Inc","AL, IL, IN, KY, MI, OH, PA, TN, VA, WI" "Cemex Inc","AL, CA, CO, FL, GA, KY, OH, TN, TX" "Dakota Gasification Company","ND" "Eastman Chemical Company","TN" "Georgia-Pacific LLC","AL, GA, OK, VA, WI" "Holcim (US) Inc","AL, CO, MD, MO, MT, OK, SC, TX, UT" "NewPage Corporation","MD, MI, WI" "U S Steel Corporation","AL, IN, MI, MN"


U.S. Energy Information Administration | Annual Coal Report 2012  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012 Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Table 25. Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Company Name Plant Location Top Ten Manufacturers American Crystal Sugar Co MN, ND Archer Daniels Midland IA, IL, MN, ND, NE Carmeuse Lime Stone Inc AL, IL, IN, KY, MI, OH, PA, TN, VA, WI Cemex Inc AL, CA, CO, FL, GA, KY, OH, TN, TX Dakota Gasification Company ND Eastman Chemical Company TN Georgia-Pacific LLC AL, GA, OK, VA, WI Holcim (US) Inc AL, CO, MD, MO, MT, OK, SC, TX, UT NewPage Corporation MD, MI, WI U S Steel Corporation AL, IN, MI, MN Other Major Manufacturers Ash Grove Cement Co


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


DOE - Office of Legacy Management -- Blockson Chemical Co - IL 07  

Office of Legacy Management (LM)

Blockson Chemical Co - IL 07 Blockson Chemical Co - IL 07 FUSRAP Considered Sites Site: Blockson Chemical Co. (IL.07) Eliminated from consideration under FUSRAP - Referred to US EPA Region V and the State of Illinios Designated Name: Not Designated Alternate Name: Olin Corporation IL.07-1 Location: Patterson Road , Joliet , Illinois IL.07-2 Evaluation Year: 1985 IL.07-1 Site Operations: Process development studies and pilot plant testing of uranium recovery from phosphoric acid during the 1950s. Site Disposition: Eliminated - No Authority IL.07-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Radiological Survey(s): Yes IL.07-2 Site Status: Eliminated from consideration under FUSRAP - Referred to US EPA Region V and the State of Illinios IL.07-1


DOE - Office of Legacy Management -- Kankakee Ordnance Plant - IL 32  

Office of Legacy Management (LM)

Kankakee Ordnance Plant - IL 32 Kankakee Ordnance Plant - IL 32 FUSRAP Considered Sites Site: KANKAKEE ORDNANCE PLANT (IL.32 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Kankakee , Illinois IL.32-1 Evaluation Year: 1991 IL.32-1 Site Operations: Kankakee Ordnance Plant was cited as a possible location for the disposal of radioactive waste material. There is no indication that any radioactive waste was brought to Kankakee. IL.32-1 IL.32-2 Site Disposition: Eliminated - No indication that radioactive materials were handled at this site IL.32-1 Radioactive Materials Handled: None Indicated IL.32-1 Primary Radioactive Materials Handled: None Radiological Survey(s): No Site Status: Eliminated from further consideration under FUSRAP


DOE - Office of Legacy Management -- Rock Island Arsenal - IL 09  

NLE Websites -- All DOE Office Websites (Extended Search)

Rock Island Arsenal - IL 09 Rock Island Arsenal - IL 09 FUSRAP Considered Sites Site: ROCK ISLAND ARSENAL ( IL.09 ) Eliminated from consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: None Location: Rock Island , Illinois IL.09-1 Evaluation Year: 1987 IL.09-2 Site Operations: Site located on a DOD facility and operated under AEC control. Exact nature or time period of operations not clear. No indication that radioactive materials were involved. Contract work with Albuquerque Operations office performed. IL.09-1 IL.09-2 Site Disposition: Eliminated - No Authority - Referred to DOD IL.09-2 Radioactive Materials Handled: None Indicated IL.09-2 Primary Radioactive Materials Handled: None Indicated Radiological Survey(s): None Indicated


DOE - Office of Legacy Management -- Kaiser Aluminum Corp - IL 19  

NLE Websites -- All DOE Office Websites (Extended Search)

Kaiser Aluminum Corp - IL 19 Kaiser Aluminum Corp - IL 19 FUSRAP Considered Sites Site: KAISER ALUMINUM CORP. (IL.19 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Dolton , Illinois IL.19-2 Evaluation Year: 1987 IL.19-2 Site Operations: Performed limited duration work extruding uranium billets into three CP-5 fuel elements, circa 1959. IL.19-2 Site Disposition: Eliminated - Potential for contamination considered remote due to limited scope of activities IL.19-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium IL.19-2 Radiological Survey(s): Yes - health and safety monitoring during operations IL.19-4 Site Status: Eliminated from further consideration under FUSRAP


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units

Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Window nighttime U-values: A comparison between computer calculations and MoWiTT measurements  

SciTech Connect

The proper specification of window U-values has been a controversial area for many years, and current attempts to incorporate more careful treatment of windows into building standards and utility conservation programs and to define window energy labels has heightened the controversy. In a previous paper (Klems 1979) it was argued that current calculation techniques, as embodied in the computer program WINDOW, accurately represented field-measured window U-values, provided frame corrections and surface heat transfer coefficients were correctly estimated, and that in most cases the calculations were also consistent with test laboratory measurements on the same windows. This means that the calculation could serve both as a standard for deriving calculated U-values and as a method of comparing measurements made under different conditions to determine their consistency. This work has now been extended to form a joint US/Canadian collaborative effort to test current computer programs. For six windows the U-values measured with the MoWiTT under field conditions are compared with detailed U-value calculations for the same conditions using the programs WINDOW and ANSYS. There is good agreement between measurements and calculations. 7 refs., 3 figs., 4 tabs.

Klems, J.H.; Reilly, S.



EIA Sh tEIA Short-T d Wi t F l O tl kTerm and Winter Fuels Outlook  

U.S. Energy Information Administration (EIA)

EIA Sh tEIA Short-T d Wi t F l O tl kTerm and Winter Fuels Outlook for Winter Fuels Outlook Conference National Association of State Energy Officials (NASEO)


DOE - Office of Legacy Management -- Crane Co - IL 13  

Office of Legacy Management (LM)

Crane Co - IL 13 Crane Co - IL 13 FUSRAP Considered Sites Site: Crane Co. (IL.13 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Chicago , Illinois IL.13-2 Evaluation Year: 1987 IL.13-2 Site Operations: MED activities during late-1940s to early/mid-1950s included the development of valves and possibly the use of test quantities of normal uranium in the development process. IL.13-4 Site Disposition: Eliminated - Potential for contamination remote due to limited scope of operations IL.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium IL.13-2 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Crane Co.


DOE - Office of Legacy Management -- Swenson Evaporator Co - IL 23  

NLE Websites -- All DOE Office Websites (Extended Search)

Swenson Evaporator Co - IL 23 Swenson Evaporator Co - IL 23 FUSRAP Considered Sites Site: SWENSON EVAPORATOR CO. (IL.23 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Harvey , Illinois IL.23-1 Evaluation Year: 1987 IL.23-1 Site Operations: Scheduled a raffinate spray drying test that was later cancelled. IL.23-1 Site Disposition: Eliminated - No indication that radioactive materials were handled at this site IL.23-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to SWENSON EVAPORATOR CO. IL.23-1 - Memorandum/Checklist; D.Levine to the File; Subject:


Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2012 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT...



Gasoline and Diesel Fuel Update (EIA)




Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...



Gasoline and Diesel Fuel Update (EIA)




Annual Energy Outlook 2012 (EIA)



U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)



Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.


A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



DOE - Office of Legacy Management -- Heavy Minerals Inc - IL...  

Office of Legacy Management (LM)

Subject: FUSRAP Considered Site Recommendation; July 9, 1990. IL.14-2 - Heavy Minerals Co. Letter; Wyatt to Faulkner; Subject: Crude Thorium Hydroxide Proposal; December 1, 1954...


DOE - Office of Legacy Management -- W E Pratt Manufacturing Co - IL 12  

Office of Legacy Management (LM)

E Pratt Manufacturing Co - IL 12 E Pratt Manufacturing Co - IL 12 FUSRAP Considered Sites Site: W.E. PRATT MANUFACTURING CO. (IL.12) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: William E. Pratt Manufacturing Co. Klassing Handbrake Company IL.12-1 IL.12-2 Location: 18 Henderson Street , Joliet , Illinois IL.12-3 Evaluation Year: 1990 IL.12-4 IL.12-5 Site Operations: Performed metal fabrication tasks (machining and grinding). IL.12-1 IL.12-4 Site Disposition: Eliminated - Radiation levels below criteria IL.12-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal IL.12-1 IL.12-3 Radiological Survey(s): Yes IL.12-3 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to W.E. PRATT MANUFACTURING CO.

Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



DOE - Office of Legacy Management -- Quality Hardware and Machine Co - IL  

NLE Websites -- All DOE Office Websites (Extended Search)

Quality Hardware and Machine Co - Quality Hardware and Machine Co - IL 11 FUSRAP Considered Sites Site: QUALITY HARDWARE AND MACHINE CO. (IL.11) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Ravenswood Venture Marden Manufacturing Co. IL.11-1 IL.11-2 Location: 5823/5849 North Ravenswood Avenue , Chicago , Illinois IL.11-3 Evaluation Year: 1990 IL.11-4 IL.11-5 Site Operations: From 1944 to 1945, entered into subcontracts with the University of Chicago to furnish personnel, facilities, and equipment to produce special tools, dies, fixtures, etc., from materials furnished by the University; was involved in the Hanford slug canning process. IL.11-10 IL.11-6 IL.11-7 IL.11-8 IL.11-9 Site Disposition: Eliminated - Radiation levels below criteria IL.11-11


DOE - Office of Legacy Management -- Lindsay Light and Chemical Co - IL 10  

Office of Legacy Management (LM)

Lindsay Light and Chemical Co - IL Lindsay Light and Chemical Co - IL 10 FUSRAP Considered Sites Site: LINDSAY LIGHT AND CHEMICAL CO. ( IL.10 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: West Chicago , Illinois IL.10-3 Evaluation Year: 1995 IL.10-4 Site Operations: Processed thorium ores - chiefly monazite sands - for thorium and rare earth metals. IL.10-1 IL.10-2 Site Disposition: Eliminated - No Authority - NRC licensed operation IL.10-4 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium IL.10-2 Radiological Survey(s): Yes IL.10-2 IL.10-5 Site Status: Eliminated from consideration under FUSRAP IL.10-4 Also see Documents Related to LINDSAY LIGHT AND CHEMICAL CO. IL.10-1 - Lindsay Light & Chemical Letter; J. Murray to E. Lintner;


DOE - Office of Legacy Management -- GSA 39th Street Warehouse - IL 02  

Office of Legacy Management (LM)

GSA 39th Street Warehouse - IL 02 GSA 39th Street Warehouse - IL 02 FUSRAP Considered Sites Site: GSA 39TH STREET WAREHOUSE (IL.02 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 1716 West Pershing Road , Chicago , Illinois IL.02-1 Evaluation Year: 1985 IL.02-2 IL.02-3 Site Operations: Stored radioactive materials. IL.02-1 IL.02-2 Site Disposition: Eliminated - Radiation levels below criteria IL.02-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Unknown IL.02-2 Radiological Survey(s): Yes IL.02-1 IL.02-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to GSA 39TH STREET WAREHOUSE IL.02-1 - Report (DOE/EV-0005/9); Formerly Utilized MED/AEC Sites Remedial Action Program Radiological Survey of the Former GSA 39th Street


OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


Executive Bios: Dr. Yoon Il Chang - Nuclear Engineering Division (Argonne)  

NLE Websites -- All DOE Office Websites (Extended Search)

Yoon Il Chang Yoon Il Chang Director's Welcome Organization Achievements Awards Patents Professional Societies Highlights Fact Sheets, Brochures & Other Documents Multimedia Library About Nuclear Energy Nuclear Reactors Designed by Argonne Argonne's Nuclear Science and Technology Legacy Opportunities within NE Division Visit Argonne Work with Argonne Contact us For Employees Site Map Help Join us on Facebook Follow us on Twitter NE on Flickr Celebrating the 70th Anniversary of Chicago Pile 1 (CP-1) Argonne OutLoud on Nuclear Energy Argonne Energy Showcase 2012 Distinguished Fellows Bookmark and Share Dr. Yoon Il Chang Dr. Yoon Il Chang Senior Technical Advisor Distinguished Fellow PhD, Engineer Nuclear Engineering Division Argonne Experts: Y.I. Chang Dr. Chang joined Argonne National Laboratory in 1974 and has been


DOE - Office of Legacy Management -- Great Lakes Carbon Corp - IL 21  

Office of Legacy Management (LM)

Great Lakes Carbon Corp - IL 21 Great Lakes Carbon Corp - IL 21 FUSRAP Considered Sites Site: GREAT LAKES CARBON CORP. ( IL.21 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 333 North Michigan Avenue , Chicago , Illinois IL.21-1 Evaluation Year: 1987 IL.21-1 Site Operations: Facility performed a limited amount of nuclear fuel fabrication in the 1950s. Facility also developed graphite production under an AEC contract. IL.21-1 IL.21-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited scope of activities performed IL.21-1 Radioactive Materials Handled: Yes IL.21-3 Primary Radioactive Materials Handled: Uranium, Thorium IL.21-3 Radiological Survey(s): Yes IL.21-3


DOE - Office of Legacy Management -- American Machine and Metals Inc - IL  

NLE Websites -- All DOE Office Websites (Extended Search)

Machine and Metals Inc - Machine and Metals Inc - IL 24 FUSRAP Considered Sites Site: American Machine and Metals Inc (IL.24 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: E. Moline , Illinois IL.24-1 Evaluation Year: 1994 IL.24-2 IL.24-3 Site Operations: Tested process for dewatering green salt by centrifugation. IL.24-1 IL.24-2 Site Disposition: Eliminated - Potential for contamination considered remote due to limited amount of radioactive materials handled IL.24-1 IL.24-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide (Green Salt) IL.24-1 Radiological Survey(s): Health and Safety Monitoring IL.24-1 Site Status: Eliminated from consideration under FUSRAP Also see


DOE - Office of Legacy Management -- Wyckoff Drawn Steel Co - IL 0-09  

Office of Legacy Management (LM)

Drawn Steel Co - IL 0-09 Drawn Steel Co - IL 0-09 FUSRAP Considered Sites Site: Wyckoff Drawn Steel Co (IL 0-09) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Chicago , Illinois IL.0-09-1 Evaluation Year: 1987 IL.0-09-3 Site Operations: Experimentation on centerless grinding of uranium rods in 1943. IL.0-09-2 IL.0-09-3 Site Disposition: Eliminated - Potential for contamination considered remote based on the limited scope of activities at the site IL.0-09-1 IL.0-09-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium IL.0-09-2 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Wyckoff Drawn Steel Co IL.0-09-1 - DOE Letter; Wagoner to Daley; Subject: Wycoff Steel Co.


Cross-layer modeling of capacity in wireless networks: Application to UMTS/HSDPA, IEEE802.11 WLAN and IEEE802.16 WiMAX  

Science Conference Proceedings (OSTI)

We investigate in this work the cross-layer modeling of the capacity of wireless systems in the presence of two types of flows: streaming and elastic, under a dynamic configuration wherein users join the system and leave it after a finite duration. For ... Keywords: Capacity, Cross-layer design, Flow level, IEEE802.11 WLAN, IEEE802.16 WiMAX, Integrated services, MAC scheduling, UMTS/HSDPA

Mariana Dirani; Chadi Tarhini; Tijani Chahed



Role of microRNA?155 in dendritic cells and macrophages MiR?155 directly targets PU.1 and IL13R1.  

E-Print Network (OSTI)

??In search of genes differentially expressed between M1 (pro?Th1 or pro?inflammatory) and M2 (pro?Th2 or pro?tolerogenic) macrophages, BIC (microRNA 155 hosting gene) was found up (more)

Martinez?Nunez, Rocio Teresa



DOE - Office of Legacy Management -- Granite City Army Depot - IL 0-02  

Office of Legacy Management (LM)

Granite City Army Depot - IL 0-02 Granite City Army Depot - IL 0-02 FUSRAP Considered Sites Site: GRANITE CITY ARMY DEPOT ( IL.0-02 ) Eliminated from consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: None Location: Granite City , Illinois IL.0-02-1 Evaluation Year: 1987 IL.0-02-1 Site Operations: Site was used for storage of GSA thorium residues until circa 1964. IL.0-02-1 Site Disposition: Eliminated - Referred to DOD IL.0-02-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium IL.0-02-1 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP - Referred to DOD IL.0-02-1 Also see Documents Related to GRANITE CITY ARMY DEPOT IL.0-02-1 - DOE Letter; J.Fiore to C.Schafer; Information regarding


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


Secretary Bodman Highlights Advanced Energy Initiative in Peoria, IL |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Bodman Highlights Advanced Energy Initiative in Peoria, Bodman Highlights Advanced Energy Initiative in Peoria, IL Secretary Bodman Highlights Advanced Energy Initiative in Peoria, IL April 6, 2006 - 10:15am Addthis PEORIA, IL - Secretary of Energy Samuel W. Bodman today highlighted the goals of President Bush's Advanced Energy Initiative after consulting on an energy savings assessment at Caterpillar Inc.'s manufacturing facility in Peoria, Illinois. To answer President Bush's call for Americans to be more energy efficient, the Department of Energy (DOE) is conducting no-cost energy assessments at 200 of the nation's most energy-intensive manufacturing facilities to identify energy- and money-saving opportunities. "President Bush has called on all Americans to be more energy efficient. Private industry is joining the federal government in taking a leading role



Office of Legacy Management (LM)

F3on: A 6 IL F3on: A 6 IL ---A------------ ALTERNATE CITY: l4v+&a ------- _-__------___-___ STATE: -~-~-- if yes, date contacted _____ & Development a Facility Type 0 Prndurtion scale testing 0 Pilot Scale 0 Makfacturing .a Bench Scale 0 0 Process University 0 0 Theoretical Studies Reseaich Organization cl Sample & Analysis 0 Gopernment Sponsored Facility 0 Other -~~-~~~--_-~~-__----- 0 Production I 0 Disposal/Storage TYPE OF CONTRACT ~------__--_____ q Prime q Subcontract& u Purchase Order Cl Other'infcrmation (i.e., cost + fixed fee, unit price; time & material, +r) ------- ' 'Con+act/Purchase Order # nls.vP ---------------------------- --------------------_____________ CONTRACTING P=3IOD- -----------w-=---T- h,Jn<, ------------------------------- _


DOE - Office of Legacy Management -- Eimco Corp - IL 0-01  

Office of Legacy Management (LM)

Eimco Corp - IL 0-01 Eimco Corp - IL 0-01 FUSRAP Considered Sites Site: Eimco Corp. (IL.0-01 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Palatine , Illinois IL.0-01-1 Evaluation Year: 1987 IL.0-01-1 Site Operations: Conducted laboratory leaf filtration tests IL.0-01-1 Site Disposition: Eliminated - Potential for contamination considered remote based on the limited scope of activities at the site IL.0-01-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Test Quantities of Uranium (Yellow Cake Uranium). IL.0-01-1 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Eimco Corp. IL.0-01-1 - Memorandum/Checklist; Levine to the File; Subject:

Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Era Tool and Engineering Co - IL 29  

NLE Websites -- All DOE Office Websites (Extended Search)

Era Tool and Engineering Co - IL 29 Era Tool and Engineering Co - IL 29 FUSRAP Considered Sites Site: Era Tool and Engineering Co. (IL.29 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Audi-Tex Industries, Incorporated IL.29-1 Location: 4555 West Addison Street , Chicago , Illinois IL.29-2 Evaluation Year: 1989 IL.29-3 Site Operations: From February 1944 through June 1944, provided personnel, facilities, and equipment to produce machined parts for special equipment, tools, jigs, fixtures, etc., from materials furnished by the University of Chicago IL.29-4 IL.29-5 Site Disposition: Eliminated - Radiation levels below criteria IL.29-2 Radioactive Materials Handled: None indicated Primary Radioactive Materials Handled: None indicated


WI Radiation Protection  

Energy.gov (U.S. Department of Energy (DOE))

This statute seeks to regulate radioactive materials, to encourage the constructive uses of radiation, and to prohibit and prevent exposure to radiation in amounts which are or may be detrimental...


Wi-Fi security  

Science Conference Proceedings (OSTI)

"ALL [wireless security] mechanisms are completely in-effective" was the conclusion of a study by the Department of Computer Science at the University of Maryland. This discussion will systematically shed light on the inherent insecurities involved with ...

Paul Williams



miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



Metodi per il miglioramento continuo della qualit. Il caso di Cesab Carrelli elavatori S.p.A (gruppo Toyota Material Handling).  

E-Print Network (OSTI)

??La tesi affronta diversi argomenti, legati ai metodi e agli strumenti per il miglioramento continuo della Qualit all'intern del mondo Toyota. Ho approfondito dunque i (more)

Dal Pra', Sarah




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

lincoln lincoln u.s. DEPARTlIlENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERlIlINATION Pagc 1 of3 STATE: NE PROJECT TITLE: EECBG DE- EE 0000664 City of Lincoln Statement of Work Template (S) {Activities 1, 2, 3 , 4, 5 , 6 , 7 , 8, 10 & 14 on SOW; Add'i CX for 9,13,15,16,17] Funding Opportunity Announ<:ement Number PrCKurement Instrument Number NEPA Control Number cm Number DE-FOA-OOOOO13 DE-EEOOOO664 0 Based OD my review of the information con<:erning the proposed a<:tion, as NEPA Complian<:e Offi<:er (authorized under DOE Order 451.IA), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited 10, literature surveys, inventories, audits), data analysis (including


Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)



The IL-9 receptor gene (IL9R): Genomic structure, chromosomal localization in the pseudoautosomal region of the long arm of sex chromosomes, and identification of IL9R pseudogenes at 9qter, 10pter, 16pter, 18pter  

Science Conference Proceedings (OSTI)

Cosmids containing the human IL-9 receptor (R) gene (IL9R) have been isolated from a genomic library using the IL9R cDNA as a probe. We have shown that the human IL9R gene is composed of 11 exons and 10 introns, stretching over {approx} 17 kb, and is located within the pseudoautosomal region of the Xq and Yq chromosome, in the vicinity of the telomere. Analysis of the 5` flanking region revealed multiple transcription initiation sites as well as potential binding motifs for AP1, AP2, AP3, Sp1, and NF-kB, although this region lacks a TATA box. Using the human IL9R cosmid as a probe to perform fluorescence in situ hybridization, additional signals were identified in the subtelomeric regions of chromosomes 9q, 10p, 16p, and 18p. IL9R homologs located on chromosomes 9 and 18 were partially characterized, while those located on chromosomes 16 and 10 were completely sequenced. Although they are similiar to the IL9R gene ({approx} 90% identity), none of these copies encodes a functional receptor: none of them contains sequences homologous to the 5` flanking region or exon 1 of the IL9R gene, and the remaining ORFs have been inactivated by various point mutations and deletions. Taken together, our results indicate that the IL9R gene is located at Xq28 and Yq12, in the long arm pseudoautosomal region, and that four IL9R pseudogenes are located on 9q34, 10p15, 16p13.3 and 18p11.3, probably dispersed as the result of translocations during evolution. 42 refs., 6 figs., 3 tabs.

Kermouni, A.; Godelaine, D.; Lurquin, C.; Szikora, J.P. [Ludwig Institute for Cancer Research, Brussels (Belgium)] [and others



Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


DOE - Office of Legacy Management -- Morse Chemical Co - IL 0-05  

Office of Legacy Management (LM)

Morse Chemical Co - IL 0-05 Morse Chemical Co - IL 0-05 FUSRAP Considered Sites Site: MORSE CHEMICAL CO. (IL.0-05 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 8 South Michigan Avenue , Chicago , Illinois IL.05-1 Evaluation Year: 1987 IL.05-3 Site Operations: Submitted a bid to AEC for thorium work; proposal was not accepted; no indication work done for a DOE predecessor at this site. IL.05-3 Site Disposition: Eliminated - No Authority - No work for a DOE predecessor was done at the site IL.05-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MORSE CHEMICAL CO.


Measurement of single and double glazing thermal performance under realistic conditions using the mobile window thermal test (MoWiTT) facility  

SciTech Connect

The thermal performance of single glazing, clear double glazing, and double glazing with a low-emissivity coating was measured in both south-facing and north-facing orientations under realistic field conditions using the new MoWiTT field test facility. The time-dependent net heat flow through each fenestration was found to be consistent with the predictions of the standard simplified heat transfer model, provided that an angle-dependent shading coefficient is used and diffuse solar gain is included in the calculation. Summer-condition average U-values were derived for each glazing type and were found to agree with the expected values for both types of double glazing. The measured U-value for single glazing was lower than predicted.

Klems, J.; Keller, H.




Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration


Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.



Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of


Blockage of IL-6 secretion in glia by lead and mercury  

E-Print Network (OSTI)

Mercury (Hg) and lead (Pb) are toxic to the development and function of the central nervous system (CNS). Interleukin-6 (IL 6) produced by astroglia protects neurons from damage in many progressive degenerative disorders. IL-6 secretion is chaperoned by a 78 kD glucose-regulated protein (GRP78), which is an ER-chaperone protein involved in protein folding, assembly, and trafficking. We hypothesized that Pb and Hg could target GRP78 and thereby block IL-6 secretion from astroglia. In this report, we constructed an IL-6-EGFP chimera and transiently transfected rat C6 glioma cells and rat primary astroglia. IL-6-EGFP signal in transfected cultures exposed to Pb, Hg, or anti-oligos against GRP78 was detected with a bio-image fluorescence microscope. Data of the bio-image analysis showed that the retention of IL-6-EGFP in both astroglia and C6 cells transfected with IL-6-EGFP was at an undetectable level. However, the IL-6-EGFP signal in these cultures, while exposed to Pb (0-10 ?M) or Hg (0-10 ?M) for 24 hours, apparently increased, suggesting that Pb or Hg could block IL-6 secretion from astroglia. Furthermore, when these transfected cultures were exposed to anti-oligos against GRP78, as expected, the retention of IL-6-EGFP within the cultures increased. In order to quantify the increase of IL-6-EGFP retention, we used ELISA to detect IL-6 levels in the medium of non-transfected astroglia exposed to Pb (0-100 ?M) and Hg (0-10 ?M). Data showed that IL-6 levels in the medium decreased when the primary astrocyte cultures were exposed to Pb or Hg, suggesting that the increased retention results in part from a decrease in IL-6 secretion. We used an immunocytochemistry assay as an additional approach for quantifying IL-6 amounts of cells treated or not treated with metals. The immunocytochemistry data concurred with the ELISA findings. These data, together with our previous studies, suggest that Pb and Hg may target GRP78, thereby reducing the amount of IL-6 secreted from astroglia. The decrease in IL-6 secretion prevents this cytokine from doing its job of protecting and restoring neighboring neural tissue.

Pourrajabi, Nima Matthew




National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)

Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



Il fenomeno dei fan nel mercato della musica. Analisi netnografica dei seguaci italiani di Bruce Springsteen.  

E-Print Network (OSTI)

??Lo studio ha ad oggetto la comunit dei fan italiani di Bruce Springsteen. Dopo aver analizzato la letteratura e descritto il fenomeno dei fan e (more)

Gallo, Sara



Structural comparison and chromosomal localization of the human and mouse IL-13 genes  

SciTech Connect

The genomic structure of the recently described cytokine IL-13 has been determined for both human and mouse genes. The nucleotide sequence of a 4.6-kb DNA segment of the human gene is described. The human IL-13 gene (IL 13) occurs as a single copy in the haploid genome and maps to human chromosome 5. A 4.3-kb DNA fragment of the mouse IL-13 gene (Il 13) has been sequenced and found to occur as a single copy, mapping to mouse chromosome 11. Intrachromosomal mapping studies revealed that both genes contain four exons and three introns and show a high degree of sequence identify throughout their length. Potential recognition sequences for transcription factors that are present in the 5'-flanking region and are conserved between both genes include IFN-responsive elements, binding sites for AP-1, AP-2, and AP-3, an NF-lL 6 site, and a TATA-like sequence. Both genes map to chromosomal locations adjacent to genes encoding other cytokines, including IL-3, GM-CSF, IL-5, and IL-4 suggesting that IL-13 is another member of this cytokine gene family that may have arisen by gene duplication. 26 refs., 5 figs., 3 tabs.

McKenzie, A.N.J.; Sato, A.; Doyle, E.L.; Zurawski, G. (DNAX Research Institute of Cellular and Molecular Biology, Palo Alto, CA (United States)); Li, X.; Milatovich, A.; Francke, U. (Stanford Univ. Medical School, CA (United States)); Largaespada, D.A.; Copeland, N.G.; Jenkins, N.A. (National Cancer Institute, Frederick, MD (United States))



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Classes Are Starting Soon! Prof"..roMI Photography G,aph~ o..,rgn  

E-Print Network (OSTI)

Simone Gori and Val HamburQer, then atthe UnOiersily of FreiburQ in Germany, is a noyel Yariation ofthe .... S~deshows > Mind~Br'" Combiml1iOll of the RO'il1illU_liKed_lilies ""d Enigma Gori and HamburQer


Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



Signaling thresholds govern heterogeneity in IL-7-receptor-mediated responses of nave CD8? T cells  

E-Print Network (OSTI)

Variable sensitivity to T-cell-receptor (TCR)- and IL-7-receptor (IL-7R)-mediated homeostatic signals among nave T cells has thus far been largely attributed to differences in TCR specificity. We show here that even when ...

Palmer, Megan Joan



Office of Legacy Management (LM)

decontmlmtlon proceam takee longer than originally anticipated decontmlmtlon proceam takee longer than originally anticipated 'U&e order .are urgently required to prevent a shutdown. "Z, mo-1 ' 2lda.p - from 4a6-55 to a possible 4-5-55 based on the receipt of vendor's plantby 1-22-55. #iWNCD W ONTAININO Il@MQWm; ;g hours worked; Hours worked will be observed and under the control of . . M%-.'E.Section . (Copy of Vendorts letter of quotation dated l/5/55 is VAWNWWXlINALORDEt :Y $ u(,507.60 upoDRpuiI9APPROPAk &movND* 0 3375.00 (rllaxlmum) Field approval contained in .!lT Savannah.A L, 1 Not required., Gosney to Hutton. (The Operating Departmeni Ato& Bad-~ Cadeaiaa agrees on the urgency and the need for autho -,. ,n - this premiumpayment.) l-13-55 loiD. 365 duPont l topa 4-26-55 pa and the faettbat


Ionizing radiation induces IL-6-production by human fibroblasts involving activation of nuclear factor-. kappa. B  

Science Conference Proceedings (OSTI)

The authors report that human lung fibroblasts respond to X-ray treatment with release of interleukin (IL) -6. Synthesis of IL-6 upon ionizing radiation is preceded by an increase of IL-6 transcript levels resulting from transcriptional activation of the IL-6 gene. Analysis of deleted fragments of the IL-6 promoter revealed that transcriptional induction of the IL-6 promoter is due to enhanced binding activity of the transcription factor NF-kB. Although AP-1 does not participate in the rapid induction of the IL-6 promoter its binding activity is also enhanced upon XRT. In contrast to binding kinetics observed with NF-kB, AP-1 binding upon XRT. In contrast to binding kinetics observed with NF-kB- and the AP-1 recognition sequence, conferred inducibility by XRT to a heterologous promoter, with reporter gene activity being maximal 24 hours or 48 hours upon XRT, respectively. Sequential activation of two distinct transcription factors might thus contribute to synchronize transcriptional activation of different genes participating in the X-ray response.

Brach, M.A.; Gruss, H.J.; Kaisho, Tsuneyasu; Asano, Yoshinobu; Vos, Sven de; Mertelsmann, R.; Hirano, Toshio; Herrmann, F. (Univ. of Freiburg (Germany) Osaka Univ. (Japan))



TCL: Comandi utili versione 2.1. [open stringa mode] restituisce il descrittore di un file aperto (di nome stringa) in modalit "riscrittura" (se mode w) o in  

E-Print Network (OSTI)

TCL: Comandi utili versione 2.1. [open stringa mode] restituisce il descrittore di un file aperto]) restituisce il nome del file .tcl corrente [$ns get-ns-traceall] restituisce il descrittore del file di trace

Bregni, Stefano



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site



Bakken Formation Producing Wells W il sto nBa North Dakota ...  

U.S. Energy Information Administration (EIA)

USA CANADA SD MT ND Saskatchewan Manitoba Dunn Ward Dawson McLean McKenzie Morton W il ams Stark Richland R os ev lt Mountrail Divide Prairie McHenry Burke Sheridan


PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



sqas wi9 final document  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SQAS96-001 SQAS96-001 Quality Report SQAS96-001 Preparation for a Software Quality Audit June 1996 Software Quality Assurance Subcommittee of the Nuclear Weapons Complex Quality Managers United States Department of Energy Albuquerque Operations Office Abstract This document will enable a site to prepare for a software quality audit by providing specific guidance. It will also provide guidance to a site that would enable it to perform a software quality audit. Preparation for a Software Quality Audit SQAS96-001 ACKNOWLEDGMENT This document was prepared for the Department of Energy (DOE) by a Working Group of the Nuclear Weapons Complex (NWC) Quality Managers' Software Quality Assurance Subcommittee (SQAS). The following contributed towards the creation of this document:


INVITED REVIEW On the Role of sIL-2R Measurements in Rheumatoid Arthritis and Cancers  

E-Print Network (OSTI)

A soluble IL-2 receptor (sIL-2R) is a circulating form of a membrane receptor localized on lymphoid and some cancer cells. The biological function of sIL-2R has not been completely understood. Substantially, it seems to reflect T-lymphocyte activation in diseases of different pathology. Moreover, the soluble receptor has been considered, at least in part, responsible for unsuccessful immunotherapy with IL-2 in cancers. Several lines of evidence indicate sIL-2R measurements to be useful in determining disease progress and prognosis. This review summarizes current knowledge on the sIL-2R behavior in RA and solid cancers of varied etiology.

Anna Maria Witkowska



IL-1 beta and TNF-alpha upregulate angiotensin II type 1 (AT(1)) receptors on cardiac fibroblasts and are associated with increased AT(1) density in the post-MI heart  

E-Print Network (OSTI)

broblasts and the infarcted heart. Am J Physiol 1998;274:matrix remodeling in heart failure: a role for de novoin right and left heart after myocardial infarction. Mol

Gurantz, D; Cowling, R T; Varki, N; Frikovsky, E; Moore, C D; Greenberg, Barry H


Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Appliances in Homes in Midwest Region, Divisions, and States, 2009" 9 Appliances in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Appliances",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Cooking Appliances" "Stoves (Units With Both" "an Oven and a Cooktop)"


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1-07 0 1-07 0 USS Honolulu (SSN 718) and Locals 280 miles from North Pole PROGRAM RECORD * Program founded in 1948 * 5,800 reactor- years of safe operations * 136,000,000 miles safely steamed * 103 operating naval reactors * Welcomed in over 150 ports worldwide and 50 countries BROAD RESPONSIBILITIES * Research, Development, Design * Acquisition, Specification, Construction, Testing * Operation, Training, Maintenance * Overhaul, Refueling, Disposal * Reactor Safety, Radiological Controls, Environmental Safety, Occupational Health * Security, Nuclear Safeguards, Transportation * Administration (Public Information) NAVAL NUCLEAR PROPULSION PROGRAM TEC 1-07 1 WA OR ID MT ND SD WY NE MN WI IA IL MI IN OH KY



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARTlIlENT OF ENERGY DEPARTlIlENT OF ENERGY EERE PROJECT M ANAGE MENT CEN T ER NEPA DETERlIlINATION Page 1 of2 STATE: NC PROJECT TITLE : Charlotte Activity 3 * 1-485 Park & Ride Energy Efficiency Lighting Pilot ARRA-EECBG Strategy-Only Funding Opportunity Announcement Number DE·FOA-OOOOO13 Pr()(urement Instrument Number DE-EEOOO0765.001 NEPA Control Number elO Number o BaRd on my re",iew of the information concerning the proposed action, as NEPA Compliance Officer (authoriud under DOE Order 451.IA), I have made the following ddumination: ex, EA, EIS APPENDIX AN» NUMBER: Description: 82.5 Safety and environmental improvements of a facility , including replacement and upgrade of facility components, that do not result in a significant change in the expected useful life, design capacity, or function of the facility and during which



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

lAl.4Il lAl.4Il ) U.S. DEPARTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERlIlINATION RECIPIENT: NREL PROJECT TITLE: los Indios Meteorological Tower; NREL Tracking No. 11-008 Page 1 of2 STATE : TX funding Opportunity Announcement Number PJ"O(urement Instrument Number NEPA Control Number em Number NREL-11-OO8 G010337 Based on my review nflhe information concerning the proposed adion, as NEPA Compliance Officer (authorized under DOE Order 45I.1A), I have made the following determination: ex, EA, [IS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, aUdits). data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DICHIARAZIONE CONGIUNTA DICHIARAZIONE CONGIUNTA TRA IL GOVERNO DEGLI STAT1 UNIT1 D'AMERICA IL GOVERNO DELLA REPUBBLICA ITALIANA IN TEMA DI COOPERAZIONE INDUSTRIALE E COMMERCIALE NEL SETTORE DELL'ENERGIA NUCLEARE I1 Governo degli Stati Uniti d'America e il Governo della Repubblica Italians, in seguito i "Partecipanti", RICONOSCENDO la necessita di considerare un mix adeguato di fonti di energia sicure e sostenibili dal punto di vista ambientale - compresa l'energia nucleare - per soddisfare le necessita energetiche delle popolazioni dei rispettivi Paesi; RICONOSCENDO la necessita di rispondere alle sfide derivanti dalle crescenti necessita energetiche che interessano i Paesi partecipanti, come pure la comunita internazionale in generale, in maniera da contribuire alla riduzione degli effetti nocivi dei gas serra sul


Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Re: RE: disappointment BlIl.Lehr 0 Rainey, David I  

E-Print Network (OSTI)

History: Re: RE: disappointment t BlIl.Lehr 0 Rainey, David I Cc: Kathryn Moran, mcnutt, Jane. Bill Original Message - - - -- From: "Rainey, David I" Da te: Sunday, May 23, 2010 9 :30 pm Subject: RE > > -- -- -original Message-- -- - > From : Bill.Lehr@noaa.gov ( > Sent: Sunday, May 23, 2010 8:56 PM > To: Rainey, Da


Differential transcriptional regulation of IL-8 expression by human airway epithelial cells exposed to diesel exhaust particles  

Science Conference Proceedings (OSTI)

Exposure to diesel exhaust particles (DEP) induces inflammatory signaling characterized by MAP kinase-mediated activation of NFkB and AP-1 in vitro and in bronchial biopsies obtained from human subjects exposed to DEP. NFkB and AP-1 activation results in the upregulation of genes involved in promoting inflammation in airway epithelial cells, a principal target of inhaled DEP. IL-8 is a proinflammatory chemokine expressed by the airway epithelium in response to environmental pollutants. The mechanism by which DEP exposure induces IL-8 expression is not well understood. In the current study, we sought to determine whether DEP with varying organic content induces IL-8 expression in lung epithelial cells, as well as, to develop a method to rapidly evaluate the upstream mechanism(s) by which DEP induces IL-8 expression. Exposure to DEP with varying organic content differentially induced IL-8 expression and IL-8 promoter activity human airway epithelial cells. Mutational analysis of the IL-8 promoter was also performed using recombinant human cell lines expressing reporters linked to the mutated promoters. Treatment with a low organic-containing DEP stimulated IL-8 expression by a mechanism that is predominantly NFkB-dependent. In contrast, exposure to high organic-containing DEP induced IL-8 expression independently of NFkB through a mechanism that requires AP-1 activity. Our study reveals that exposure to DEP of varying organic content induces proinflammatory gene expression through multiple specific mechanisms in human airway epithelial cells. The approaches used in the present study demonstrate the utility of a promoter-reporter assay ensemble for identifying transcriptional pathways activated by pollutant exposure.

Tal, Tamara L. [Curriculum in Toxicology, University of North Carolina, Chapel Hill (United States); Simmons, Steven O. [Integrated Systems Toxicology, National Health and Environmental Effects Research Laboratory, U.S. EPA (United States); Silbajoris, Robert; Dailey, Lisa [Environmental and Public Health, National Health and Environmental Effects Research Laboratory, U.S. EPA (United States); Cho, Seung-Hyun [Air Pollution Prevention Control Division, National Risk Management Research Laboratory, U.S. EPA (United States); Research Participation Program, Oak Ridge Institute for Science and Education, Oak Ridge (United States); Ramabhadran, Ram [Curriculum in Toxicology, University of North Carolina, Chapel Hill (United States); Integrated Systems Toxicology, National Health and Environmental Effects Research Laboratory, U.S. EPA (United States); Linak, William [Air Pollution Prevention Control Division, National Risk Management Research Laboratory, U.S. EPA (United States); Reed, William; Bromberg, Philip A. [Center for Environmental Medicine, Asthma, and Lung Biology, University of North Carolina, Chapel Hill (United States); Samet, James M., E-mail: samet.james@epa.go [Curriculum in Toxicology, University of North Carolina, Chapel Hill (United States); Environmental and Public Health, National Health and Environmental Effects Research Laboratory, U.S. EPA (United States)



Secretary Chu Announces Agreement on FutureGen Project in Mattoon, IL |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Agreement on FutureGen Project in Mattoon, Agreement on FutureGen Project in Mattoon, IL Secretary Chu Announces Agreement on FutureGen Project in Mattoon, IL June 12, 2009 - 12:00am Addthis Washington, D.C. - U.S. Secretary of Energy Steven Chu today announced an agreement with the FutureGen Alliance that advances the construction of the first commercial scale, fully integrated, carbon capture and sequestration project in the country in Mattoon, Illinois. "This important step forward for FutureGen reflects this Administration's commitment to rapidly developing carbon capture and sequestration technology as part of a comprehensive plan to create jobs, develop clean energy and reduce climate change pollution." said Energy Secretary Steven Chu. "The FutureGen project holds great promise as a flagship facility to


File:USDA-CE-Production-GIFmaps-IL.pdf | Open Energy Information  

Open Energy Info (EERE)

IL.pdf IL.pdf Jump to: navigation, search File File history File usage Illinois Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 387 KB, MIME type: application/pdf) Description Illinois Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Illinois External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:14, 27 December 2010 Thumbnail for version as of 16:14, 27 December 2010 1,275 × 1,650 (387 KB) MapBot (Talk | contribs) Automated bot upload



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DETERlIlINATION DETERlIlINATION RECIPIENT:Westmoreland County Page 101"2 STATE: PA PROJECf TITLE: Westmoreland County (PA)· Geothermal at New Juvenile Detention Center· ARRA-EECBG Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOAOOOOO13 DE-EE00CI0940 0 Based on my review or the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45I.1A), I have made the following determination: ex, EA, EIS APPEND IX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARThIl!NT OF ENERGY DEPARThIl!NT OF ENERGY EERE PROJECT MANAG EMENT CENTER NEPA DETERMINATION RECIPIENT: Northwest Energy Innovations Page 1 of3 STATE: OR PROJECT TITLE: WAVE ENERGY TECHNOLOGY-NEW ZEALAND MULTI-MODE WAVE ENERGY CONVERTER ADVANCEMENT PROJECT Funding Opportunity Announcement Number Procurement Instr ument Number NEPA Control Number elD Number DE-FOA -OOOO293 DE-EEOOO3642 GFO-OO03642-OO2 G03642 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4S1.1A), I have made the rollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: Rational for determination: EA Category: DOE/EA 1917 and DOE Mitigated FONSI signed 8-15-2012 This determination is being made for tasks 2.12 -



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARTlIlENT OF ENERGY DEPARTlIlENT OF ENERGY EERE PROJECT MANAGEM ENT CENT ER NEPA DFTFRlIllNATION Page 1 of2 RECIPIENT:City of Cleveland· Division of Engineering & Construction STATE: OH PROJECT TITLE: Cleveland City ARRA·EECBG Act 9 (Lake-to--Lake Bikeway) Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number cm Number OE·EEOOOO705 0 Based on my review oflhe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), [have made the following determination: CX, EA, E[S APPENDIX AND NUMBER: Description: A11 Technical advice and planning assistance to internaUonal, national, stale, and local organizations, A9 Information gathering (including, but not limited to, literature surveys, inventories, audits), data analysis (including


Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available




Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure

Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure


Demonstration Assessment of Light-Emitting Diode (LED) Accent Lighting at the Field Museum in Chicago, IL  

SciTech Connect

This report reviews a demonstration of light-emitting diode (LED) accent lighting compared to halogen (typical) accent lighting in a gallery of the Field Museum in Chicago, IL.

Myer, Michael; Kinzey, Bruce R.



U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office


Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



2nd Annual DOE-ERSP PI Meeting: Abstracts  

E-Print Network (OSTI)

Northwest National Laboratory, Richland, WA Argonne NationalLaboratory, Argonne, IL Despite the promise of bioreductionWisconsin, Madison, WI Argonne National Laboratory, Argonne,

Hazen, Terry C.



DOE Challenge Home Case Study, Weiss Building & Development, LLC., System Home, River Forest, IL  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

LLC LLC System Home River Forest, IL BUILDING TECHNOLOGIES OFFICE DOE Challenge Home builders are in the top 1% of builders in the country meeting the extraordinary levels of excellence and quality specifi ed by the U.S. Department of Energy. Every DOE Challenge Home starts with ENERGY STAR for Homes Version 3 for an energy-effi cient home built on a solid foundation of building science research. Then, even more advanced technologies are designed in for a home that goes above and beyond current code to give you the superior quality construction, HVAC, appliances, indoor air quality, safety, durability, comfort, and solar-ready components along with ultra-low or no utility bills. This provides homeowners with a quality home that will last for generations to come.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

p-, ** p-, ** ~ , u.s DEPARTMENT OFENFRGY EERE PROJECT MAN AGEM ENT CENT ER NEPA DETEIU.IlNATION RECIPIENT:Simpson College; a SEP ARRA sub-recipient of the Iowa Economic Development Authority PROJECf TITLE: Simpson College Boiler Plant De-Centralization Page 1 of3 STATE: lA Funding Opportunity Announcement Number DE-FOA-OOOOO52 Procurement Instrument Number DE-EEOOOO162 NEPA Control Number em Number GF0-0000162-020 EE162 Based on my review of the information concerning the proposed aelion, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 (a) Actions to conserve energy or water, demonstrate potential energy or water conservation, and promote energy



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

21 21 Recipient: County of McHenry, IL ENERGY EFFICIENCY AND CONSERVATION BLOCK GRANTS NEPA COMPLIANCE FORM Activities Determination/ Categorical Exclusion Reviewer's Specific Instructions and Rationale (Restrictions and Allowable Activity) Project #1: Daylighting B5.1 None Project #2: Occupancy Sensors B5.1 None Project #3: Administration Building - LED Parking Lot Lighting B5.1 Waste Stream Clause Project #4: Annex A - Replace Hot Water Boiler B5.1 Waste Stream Clause *boiler replacements cannot result in a net increase in air emissions. Project #5: Annex A - Window Film B5.1 None Project #6: Department of Transportation Building - Skylights B5.1 Historic Preservation Clause Waste Stream Clause Project #7: Department of Transportation Building - HID to T8 Fluorescent with Occupancy Sensors



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FINDING FINDING OF NO SIGNIFICANT IMPACT FOR LINAC COHERENT LIGHT SOURCE-Il PROJECT SLAC NATIONAL ACCELERATOR LABORATORY AGENCY: U. S. Department of Energy (DOE) ACTION: Finding of No Significant Impact (FONSI) SUMMARY: The U. S. Department of Energy (DOE) has completed an Environmental Assessment (DOE/EA-1904) on a project to expand the existing Linac Coherent Light Source (LCLS) facility at the SLAC National Accelerator Laboratory (SLAC). One of SLAC's major scientific facilities is the LCLS, the world's first hard X-ray free electron laser. The LCLS X-ray laser beams enable the simultaneous investigation of a material's electronic and structural properties on the size (sub-nanometer) and time (femto-second) scales that determine their function. Research programs at SLAC include materials science, catalytic sciences, structural molecular biology, and molecular environmental


DOE Challenge Home Case Study, StreetScape Development, LLC, Libertyville, IL, Custom  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

StreetScape StreetScape Development, LLC Libertyville, IL BUILDING TECHNOLOGIES OFFICE DOE Challenge Home builders are in the top 1% of builders in the country meeting the extraordinary levels of excellence and quality specifi ed by the U.S. Department of Energy. Every DOE Challenge Home starts with ENERGY STAR for Homes Version 3 for an energy-effi cient home built on a solid foundation of building science research. Then, even more advanced technologies are designed in for a home that goes above and beyond current code to give you the superior quality construction, HVAC, appliances, indoor air quality, safety, durability, comfort, and solar-ready components along with ultra-low or no utility bills. This provides homeowners with a quality home that will last for generations to come.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

!AUll !AUll u.s. DEP.-lliThIl!NT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION RECIP1ENT: Texas Engineering Experiment Station PROJECf TITLE: Novel Mechanical Pretreatment for Ugnocellulosic Feedstocks Page I of I STATE: TX t'unding Opportunity Announctment Number Procurement Instrument Number NEPA Control Numbu CID Numbtr Oe-FOA-0000337 EEOOO500S GFO-OOO5005-001 0 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (a ulhori7.ed under DOE Order 451.1A).1 haH' made the followinll: detumination: ex, EA, [IS APPENDIX AND NUMBER: Descriptio n: 8 3.6 Siting. construction (or modification), operation, and decommissioning of facinlies for Indoor bench-scale research projects and conventional laboratory operations (for example. preparation of chemical sta


DOE Challenge Home Case Study, Weiss Building & Development, LLC., Custom Home, Downer Grove, IL  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

LLC LLC Custom Home Downers Grove, IL BUILDING TECHNOLOGIES OFFICE DOE Challenge Home builders are in the top 1% of builders in the country meeting the extraordinary levels of excellence and quality specifi ed by the U.S. Department of Energy. Every DOE Challenge Home starts with ENERGY STAR for Homes Version 3 for an energy-effi cient home built on a solid foundation of building science research. Then, even more advanced technologies are designed in for a home that goes above and beyond current code to give you the superior quality construction, HVAC, appliances, indoor air quality, safety, durability, comfort, and solar-ready components along with ultra-low or no utility bills. This provides homeowners with a quality home that will last for generations to come.


Snapshots of the IL-4 Receptor Ternary Complexes: An Opportunity to  

NLE Websites -- All DOE Office Websites (Extended Search)

Snapshots of the IL-4 Receptor Ternary Snapshots of the IL-4 Receptor Ternary Complexes: An Opportunity to Visualize the Basis of Cytokine Receptor Pleiotropy in the Immune System Cytokines are a group of proteins and peptides that are employed in complex multi-cellular organisms as signaling compounds produced by individual cells to transmit information from one cell to another. The distances across which these cytokine signals may travel varies from within the neighborhood of a tissue or organ to remote tissues far away from the cytokine source via the blood. They are variously named as interleukins, lymphokines, and chemokines as well as other "factors" and with the names based upon the presumed function at the time of discovery. These cytokines act by binding to a cell surface receptor in either of two ways. In the first case a cytokine binds the extracellular domain of a receptor and recruits additional receptors where a receptor is composed of three domains: extracellular ligand binding domain, a single trans-membrane helix domain and an intracellular domain; in this case, cytokine binding and subsequent extracellular domain rearrangements change the spacing and orientation of the intracellular domains resulting in signal transduction across the cell membrane in a deliberate manner. In the second case a cytokine binds to a multi-spanning transmembrane protein causing movements within the transmembrane region, which conveys the signal more directly across the membrane, where this latter mechanism is beyond the scope of our research results. Due to their central role in the immune system, cytokines are involved in a variety of immunological, inflammatory, and infectious diseases. When the body is fighting pathogens, cytokines activate and recruit immune cells to travel to the site of infection, for example. These cytokine-mediated processes are known to go awry in some diseases.


A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



An Epigenetic Switch Involving NF-kB, Lin28, Let-7 MicroRNA, and IL6 Links  

E-Print Network (OSTI)

An Epigenetic Switch Involving NF-kB, Lin28, Let-7 MicroRNA, and IL6 Links Inflammation to Cell to cancer, and NF-kB appears to play a causa- tive role, but the mechanisms are poorly understood. We show activation triggers an inflammatory response mediated by NF-kB that directly activates Lin28 transcription


WiH1950s poster  

Science Conference Proceedings (OSTI)

... definitive work on the thermochemical properties of ions: Gas-Phase Ion ... Despite working under a very tight deadline, she successfully designed a ...


Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


a beneficial manner. The three projects wi  

NLE Websites -- All DOE Office Websites (Extended Search)

beneficial manner. The three projects will demonstrate technologies beneficial manner. The three projects will demonstrate technologies that: (1) make progress toward DOE's target CO 2 capture efficiency of 90 percent; (2) make progress toward DOE's capture and sequestration goal of less than 10 percent increase in the cost of electricity for gasification systems and less than 35 percent for combustion and oxy-combustion systems; and (3) capture and sequester, or put to


Microsoft Word - topic_B_WI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Western Interconnection on Electric Resource Western Interconnection on Electric Resource Planning and Priorities The awardee must complete the following at a minimum: 1. Continued development of the Western Renewable Energy Zone (WREZ) analysis, currently performed by the Western Governors' Association (WGA) under DOE Cooperative Agreement (DE-FC26-08NT01788) in order to identify those areas in the West with vast renewable resources to expedite the development and delivery of renewable energy to where it is needed. Specifically, the awardee must complete the following tasks. a. Coordinating Energy Purchasing from the WREZs Aggregating demand for renewable energy can stimulate the development of commercial renewable generation and supporting transmission projects. Many public power, cooperative, state, federal and provincial electric systems have


Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan




Science Conference Proceedings (OSTI)

In both cases of packages for either low-level and intermediate-level short-lived (LL-IL/SL) or high-level and intermediate-level long-lived (HL-IL/LL) radioactive waste, Andra has defined a quality reference system, manages it, follows up its appropriate implementation in production plants and verifies its effectiveness in production. The purpose of such a reference system is to ensure, in the first case, that waste packages comply with the Centre de l'Aube's acceptance criteria and, in the second case, that the characteristics submitted by the waste generators to Andra as input data for the deep geological repository project reflect the actual production conditions. In that context, the three management steps of the quality reference system include differences due to the fact that HL-IL/SL packages have not been submitted yet to any technical acceptance criterion. Compliance with any such criterion should be the subject of a characterization report during the qualification phase and of a examination during the verification phase. The management of the quality reference system also involves similarities that facilitate the joint work carried out by Andra with the waste generators, especially in the facilities where both package types are produced.

Trentesaux, C.; Cairon, P.; Dumont, J.-N.; Felix, B.; Losada, F.




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARThIl!NT OF ENERGY DEPARThIl!NT OF ENERGY EERE PROJECT MANAGEMENT CENTER NllPA DEl'ER}.fiNATION RECIPIENT:Cortiand County Business Development Corporation PROJE(.T TITLE : Energy Independent Agri-Business Outreach Page I of2 STATE: NY Funding Opportunity Announcement Number DE-EOOO3110 Procurement Instrument Number EEOOO3110 NEPA Control Number em Number GFO-10-573 0 Based on my review orlbe information concerning the proposed action, as N[PA Compliance Officer (autborized under DOE Order 4SI.IA),1 have made tbe follol'iing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, bul nollimiled 10, literature surveys. inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

illThIl!NT OF ENERGY illThIl!NT OF ENERGY EERE PROJECT MA"IAGEMENT CENTER NEPA DE:rJ!IU...lINATION RECIPIENT:TX STATE ENERGY CONSERVATION OFFICE PROJECT TITLE: SHARYLAND ISD Page 1 of2 STATE: TX Funding Opportunity Announcement Number Procurement Instmment Number NEPA Control Number CIO Number DE-EEOOO116 DE-EEOOO116 GFO-OOO0116-032 GOO Based OD my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination : ex, EA, EIS APPENDIX AND NUMBER: Description: 85.16 Solar photovoltaic systems The installation, modification. operation, and removal of commercially avaUable solar photovoltaic systems located on a building or other structure (such as rooftop, par1o:.ing lot or facility, and mounted to signage, lighting, gates, or fences), or if



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

'""c-.-n. '""c-.-n. j!." OJ . U.S. DEP.-\RTUENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERl\ilNATION RECIPIENT:James Hardie Building Products PROJECT TITLE: XLD Reject Reclamation STATE: IL Page 1 of2 / ~ ~,' .' unding Opportunity AnnounCEment Number Procurement Instrument Numbu NEPA Control Number CID Number DE-FOA-OOOOOS2 EEOOOO119 GFO-1Q.-322 EE119 Baud on my rnitw oftht information concerning the proposed action, 85 NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Office of Legacy Management (LM)

IlONITORING REPORT FOR THE NEVADA TEST SITE IlONITORING REPORT FOR THE NEVADA TEST SITE AND OTHER TEST AREAS USED FOR UNDERGROUND NUCLEAR DETONATIONS January through December 1975 Nonitoring Operations Division Environmental Monitoring and Support Laboratory U.S. ENVIRONMENTAL PROTECTION AGENCY Las Vegas, Nevada 89114 APRIL 1976 This work performed under a Memorandum of Understanding No. AT(26-1)-539 for the U . S . ENERGY RESEARCH & DEVELOPMENT ADMINISTRATION EMSL-LV-5 39-4 May 1976 ENVIRONMENTAL 14ONITORING REPORT FOR THE NEVADA TEST SITE AND OTHER TEST AREAS USED FOR UNDERGROUND NUCLEAR DETONATIONS January through December I975 Monitoring Operations Division Environmental Monitoring and Support Laboratory U.S. ENVIRONMENTAL PROTECTION AGENCY Las Vegas, Nevada 89114 APRIL 1976 This work performed under a Memorandum of



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CENTER CENTER NEPA DETER!vIlNATION RECIPIENT:l1linois Department of Commerce and Economic Opportunity PROJECf TITLE: Fluorecycle. Inc Page 1 of2 / ® STATE: IL Funding Opportunity Announcement Number DE-FOA-OOOOO52 Procurement Instrument Number EEOOOO119 NEPA Control Number em Numbcr EEll9 Based on my rc"iew ortbe information cODeeming the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45I.1A), I have made the following detennination: ex, EA, EIS APPENDIX AND NUMBER: Description: B5.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy--efficiency that do nol increase the indoor concentrations of potentially hannful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Characterization of the Transient Response of the ILS with One Module Installed to Heatup Changes in Power Level and Cooldown  

DOE Green Energy (OSTI)

This report provides documentation of the initial startup and testing of the first electrolysis module in the Idaho National Laboratory (INL) High Temperature Steam Electrolysis Integrated Laboratory Scale (ILS) facility. Initial shakedown testing of the INL ILS experimental facility commenced on August 22, 2007. This fulfilled a DOE Level 2 milestone. Heatup of the first ILS module started at approximately 4:10 PM on September 24, 2007. Initial module testing continued for 420 hours. The test average H2 production rate was approximately 1.3 Nm3/hr (0.116 kg H2/hr), with a peak measured value of over 2 Nm3/hr (0.179 kg H2/hr). Significant module performance degradation was observed over the first 250 hours, after which no further degradation was noted for the remainder of the test. Once all test objectives had been successfully met, the test was terminated in a controlled fashion. Discussion is included concerning several modifications that will be incorporated into the facility components to improve reliability and ease of operation for future long term testing.

K. G. Condie; C. M. Stoots; J. E. O'Brien; J. S. Herring



C E N T R A L F IL E S  

Office of Legacy Management (LM)

;zJy, y ;zJy, y J l . T;? : Tflj~j : - ..- ":'cyi$:T,;L . . :z*:, 0 , _ _ : 7 r;-2 :: '7 .' . A 1 :- :-; '3 s:s:a *;iy,:;.~ ~ r.3 , :,& . fJ . A . -y& ~ :.-, ;,!*3 , J. -. v :+ tn g C E N T R A L F IL E S ~ > m cTpnz '3 F T E iP T h e o b ;ectl'.'e o f th e ? = r i ~ ';lila to d 9 c u s s th e h e a l th a n d s a fe ty a s p e c ts o f a - p r O p O S e d O f? -31'te te s t involving electro n b e a m m e l tin g o f s o l & 2 a m n l u m n e tal a t th e S ta u ffer-Temescal C o m p a n y , R i c h m o n d , C a lifornia. T h e technical a s p e c ts o f th e te a t w e r e d iscussed a t - 3 n e s a m e rr?eeti!? g by A . D . C a v e tt, M e tallurgical IIe p a r tze n t, w h o is submitting a sepsi-ate trip r e p o r t. S o m e w h a t sim ilar work xlth uraniiun h a s b e e n d o n e by th e S tsu ffer- T e m e s c a l C o m p a n y iJ th e s a m e fu r 2 3 a c e o n tw o previous occasions - for Y o rth A m e rilcan A viatio



E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Studio di fattibilit per un impianto a biogas nel settore vitivinicolo: il caso della "Cantina Valpantena Verona S.c.a.".  

E-Print Network (OSTI)

??Analisi del settore biogas dal punto di vista energetico,tecnico e normativo, con riferimento al DM 6 luglio 2012 (Decreto rinnovabili).Il caso di studio specifico riguarda (more)

Bonfante, Nicola



Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


Better Buildings Neighborhood Program: San Jose  

NLE Websites -- All DOE Office Websites (Extended Search)

San Jose to San Jose to someone by E-mail Share Better Buildings Neighborhood Program: San Jose on Facebook Tweet about Better Buildings Neighborhood Program: San Jose on Twitter Bookmark Better Buildings Neighborhood Program: San Jose on Google Bookmark Better Buildings Neighborhood Program: San Jose on Delicious Rank Better Buildings Neighborhood Program: San Jose on Digg Find More places to share Better Buildings Neighborhood Program: San Jose on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Jose, California San Jose Leverages Partnerships to Improve Low-Income Households' Energy


Wind Program: Stakeholder Engagement and Outreach  

Wind Powering America (EERE)

Outreach Outreach Printable Version Bookmark and Share The Stakeholder Engagement and Outreach initiative of the U.S. Department of Energy's Wind Program is designed to educate, engage, and enable critical stakeholders to make informed decisions about how wind energy contributes to the U.S. electricity supply. Highlights Resources Wind Resource Maps State Activities What activities are happening in my state? AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Installed wind capacity maps. Features A image of a house with a residential-scale small wind turbine. Small Wind for Homeowners, Farmers, and Businesses Stakeholder Engagement & Outreach Projects


Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Structural and Geographic Characteristics of Homes in Midwest Region, Divisions, and States, 2009" 9 Structural and Geographic Characteristics of Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" "Structural and Geographic Characteristics",,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" ,,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Urban and Rural2" "Urban",88.1,19.9,14.6,4.1,2.9,1.8,5.8,5.3,1.6,2.4,1.4


Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central


Better Buildings Neighborhood Program: Maine - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- SEP to - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Maine - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Maine - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Maine - SEP on Google Bookmark Better Buildings Neighborhood Program: Maine - SEP on Delicious Rank Better Buildings Neighborhood Program: Maine - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Maine - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Maine - SEP Maine Makes Multifamily Units Energy-Efficient and Cost-Effective

Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Better Buildings Neighborhood Program: San Diego  

NLE Websites -- All DOE Office Websites (Extended Search)

Diego to Diego to someone by E-mail Share Better Buildings Neighborhood Program: San Diego on Facebook Tweet about Better Buildings Neighborhood Program: San Diego on Twitter Bookmark Better Buildings Neighborhood Program: San Diego on Google Bookmark Better Buildings Neighborhood Program: San Diego on Delicious Rank Better Buildings Neighborhood Program: San Diego on Digg Find More places to share Better Buildings Neighborhood Program: San Diego on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Diego County, California Energy Upgrade California Motivates Home Improvements in San Diego County


Better Buildings Neighborhood Program: Alabama - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Alabama - Alabama - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Alabama - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Alabama - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Google Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Delicious Rank Better Buildings Neighborhood Program: Alabama - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Alabama - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Alabama - SEP Alabama Program Takes a Dual Approach to Energy Efficiency Upgrades


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Computers and Other Electronics in Homes in Midwest Region, Divisions, and States, 2009" 9 Computers and Other Electronics in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Computers and Other Electronics",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Computers" "Number of Computers" 0,27.4,6.7,4.7,1.1,1.1,0.6,2,2,0.6,1,0.5


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Fuels Used and End Uses in Homes in Midwest Region, Divisions, and States, 2009" 9 Fuels Used and End Uses in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Fuels Used and End Uses",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Fuels Used for Any Use" "Electricity",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

HC4.9 Televisions in Homes in Midwest Region, Divisions, and States, 2009" HC4.9 Televisions in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Televisions",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Televisions" "Number of Televisions" 0,1.5,0.3,0.2,"Q","Q","Q","Q",0.1,"Q","Q","Q"


Better Buildings Neighborhood Program: Virginia - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Virginia - Virginia - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Virginia - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Virginia - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Google Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Delicious Rank Better Buildings Neighborhood Program: Virginia - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Virginia - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Virginia - SEP Virginia's Regional Energy Alliances Help Forge a State Program for


Better Buildings Neighborhood Program: Austin, Texas  

NLE Websites -- All DOE Office Websites (Extended Search)

Austin, Texas Austin, Texas to someone by E-mail Share Better Buildings Neighborhood Program: Austin, Texas on Facebook Tweet about Better Buildings Neighborhood Program: Austin, Texas on Twitter Bookmark Better Buildings Neighborhood Program: Austin, Texas on Google Bookmark Better Buildings Neighborhood Program: Austin, Texas on Delicious Rank Better Buildings Neighborhood Program: Austin, Texas on Digg Find More places to share Better Buildings Neighborhood Program: Austin, Texas on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Austin, Texas Austin Energy Accelerates Residential and Multifamily Efficiency Upgrades


Better Buildings Neighborhood Program: Michigan - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Michigan - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Michigan - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Google Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Delicious Rank Better Buildings Neighborhood Program: Michigan - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Michigan - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Michigan - SEP Better Buildings Means Better Business for Michigan


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Water Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" 9 Water Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,,,,,"IA, MN, ND, SD" "Water Heating",,,,"IL","MI","WI","IN, OH",,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Number of Storage Tank Water Heaters" 0,2.9,0.4,0.3,"Q","Q","Q","Q",0.1,"Q","Q","Q"


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Air Conditioning in Homes in Midwest Region, Divisions, and States, 2009" 9 Air Conditioning in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Air Conditioning",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Air Conditioning Equipment" "Use Air Conditioning Equipment",94,22.4,15,4.3,3.1,1.8,5.9,7.4,2.3,3.4,1.7


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Space Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" 9 Space Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" " ",,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Space Heating",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Space Heating Equipment" "Use Space Heating Equipment",110.1,25.8,17.8,4.7,3.8,2.3,7,8.1,2.3,3.9,1.8


Better Buildings Neighborhood Program: Toledo, Ohio  

NLE Websites -- All DOE Office Websites (Extended Search)

Toledo, Ohio Toledo, Ohio to someone by E-mail Share Better Buildings Neighborhood Program: Toledo, Ohio on Facebook Tweet about Better Buildings Neighborhood Program: Toledo, Ohio on Twitter Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Google Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Delicious Rank Better Buildings Neighborhood Program: Toledo, Ohio on Digg Find More places to share Better Buildings Neighborhood Program: Toledo, Ohio on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Toledo, Ohio A Broad Approach to Energy Efficiency in Northwest Ohio


Related Links | Building Energy Codes Program  

NLE Websites -- All DOE Office Websites (Extended Search)

Related Links Related Links Regional Energy Efficiency Organizations MEEA NEEP NEEA SEEA SWEEP SPEER Midwest Energy Efficiency Alliance (MEEA) IL, IN, IA, KS, KY, ND, NE, MI, MN, MO, OH, SD, WI The Midwest Energy Efficiency Alliance (MEEA) is a collaborative network advancing energy efficiency in the Midwest to support sustainable economic development and environmental preservation. MEEA raises awareness, facilitates energy efficiency programs and strengthens policy across the nine-state region. MEEA brings together a respected network of members, partners, board and staff, and inspires others to create new technologies, new products and new ways of thinking when it comes to energy efficiency. Codes Contact Isaac Elnecave Senior Policy Manager ielnecave@mwalliance.org phone: (312)784-7253


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Household Demographics of Homes in Midwest Region, Divisions, and States, 2009" 9 Household Demographics of Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Household Demographics",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Number of Household Members" "1 Person",31.3,7.4,5.1,1.4,1,0.6,2.1,2.3,0.6,1.1,0.6


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

2 2 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

4 4 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

·O'.G: , ·O'.G: , u.s. DEPARTlIlENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERlIIINATION RECIPIENT:Polk County PROJECT TITLE: Polk County, FL EECBG - SOW Building Control Systems EE Retrofits (S) Page 1 of2 STATE: FL Funding Opportunity Announcement Number DE-FOAOOOO013 Procurement Instrument Number DE-EE0000796 NEPA Control Number CID Number o Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45I.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency thai do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARTlIIENT OF ENERGY DEPARTlIIENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERJl.ilNATION Page 1 01'2 RECIPIENT:County of Baltimore STATE: MD PROJECT TITLE: County of Baltimore ARRA-EEC8G (5) funding Opportunity Announcement Number DE-FOA-OOOOO13 Procurement Instrument Number DE-EEOOOO740 NEPA Control Number em Numbn o Baud on my nview oftht information concerning the proposed action, as NEPA Compliance Offien (authoril:ed under DOE Order 45I.1A), I han made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 InfOm1ation gathering (including. but not limited to, literature surveys, inventories, audits), data analysis (induding computer modeling), document preparation (such as conceptual design or feasibi lity studies, analytical energy supply



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

City of Noriolk City of Noriolk u.s. DEPARTMENT OF ENERGY EERE PROJECT MANAG EMEN T CENTER NEPA DETERl\ilNATION Page 1 of2 STATE: VA PROJECT TITLE: Green Vision Community Energy Program and Evergreen Municipal Energy Efficiency Program- SOW (5) Funding Opportunity Announcement Number Proc:urt:mtnt Instrument Number NEPA Control Number CID Number DE-FOA-OOOOO13 OE-EEOOOO880/000 0 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical

Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

tvIENT OF ENERG tvIENT OF ENERG Y EERE PROJ ECT MANAGEMENT CEN T ER NEPA DETERlIlINAIION RECIPIENT;County of Montgomery Page 1 of2 STATE: PA ~ R liO i ~ PROJELi TITLE: Montgomery County (PA): Financial Incentive Program and Energy Efficiency Retrofits -- ARRA-EECBG (S) Funding Opportunity Announcement Number DE-FOA-0000013 Procurement Instrument Number DE-EE0000938 NEPA Control Number em Number o Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1 A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A11 Technical advice and planning assistance to international, national, state, and local organizations. A9 Information gathering (including, but not limited to, literature surveys, inventories, audits), data analysis (including



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EE EE RE PROJECT MANAGEMENT CENTER NEPA DETERlIlIN.-\IION Page 1 of2 RECIPIENT:Delaware State Energy Office - DNREC . STATE: DE PROJECf TITLE: EECBG Rehoboth Beach Convention Center VVhile Roof and Insulation Project Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-OOOOO13 DE-EEOOOO775 GFO.()()()()775-003 0 Based on my review of the information (on("eruing the proposed actioD, as NEPA Compliance Omen (authorized under DOE Order 451.11\), I have made tbe following determination: ex, EA, [IS APPENDIX AND NUMBER: Descriptiun: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase Ihe indoor concentrations of potentially harmful substances. These actions may involve financial and technical


Maria Cadeddu, James C. Liljegren, and Andrew Pazmany Decision and Information Sciences Division, Argonne National Laboratory, Argonne, IL  

NLE Websites -- All DOE Office Websites (Extended Search)

and Retrievals from a New 183-GHz Water Vapor Radiometer in the Arctic and Retrievals from a New 183-GHz Water Vapor Radiometer in the Arctic Maria Cadeddu, James C. Liljegren, and Andrew Pazmany Decision and Information Sciences Division, Argonne National Laboratory, Argonne, IL Prosensing, Inc., Amherst, MA This work was supported by the Climate Change Research Division, U.S. Department of Energy, Office of Science, Office of Biological and Environmental Research, under contract W-31-109-Eng-38, as part of the DOE Atmospheric Radiation Measurement (ARM) Program. Argonne National Laboratory is managed by The University of Chicago for the U.S. Department of Energy. The two-channels microwave water vapor radiometer (MWR) shown in Fig. 1 measures brightness temperatures at the microwave frequencies of 23.8 and 31.4 GHz. Brightness



Gasoline and Diesel Fuel Update (EIA)

6 6 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 27. Average City Gate Price of Natural Gas in the United States, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Energy Information Administration (EIA), Form EIA-857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Constant dollars: Prices were converted to 2001 dollars using the chain-type


Microsoft Word - Figure_14_15.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 360 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Figure 14. Average Price of Natural Gas Delivered to Residential Consumers, 1980-2004 Figure 15. Average City Gate Price of Natural Gas in the United States, 2004 (Dollars per Thousand Cubic Feet) Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." Constant dollars: Prices were converted to 2004 dollars using the chain-type price indexes for Gross Domestic Product



Gasoline and Diesel Fuel Update (EIA)

18 18 Energy Information Administration / Natural Gas Annual 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 0 1 2 3 4 5 6 7 T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o A l a b a m a K a n s a s A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 1997 1998 1999 2000 2001 2001 16. Marketed Production of Natural Gas in Selected States, 1997-2001 Figure Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI


Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:


XL-A A.&lx A!i' X!Ii?Z IL';;i'  

Office of Legacy Management (LM)

-- :I 9 .a # ** ,. . . m . . pJ;-,L' ,' i:-t.T .)r' yjs JzZ~ J~~;L,;.~;r 1:). 2 . m I;S~X:T ?I?. ::.:-25-::%-I.:.Glu~ XL-A A.&lx A!i' X!Ii?Z IL';;i' , X2,-d c i.XZEA?, th At3Ac Z:r.zr.~ f4z22s343n >q3 pquask$ tL,..- psg zd of &,-cc b&ldjmms: >UAeT; :,:,. &&;j L' *r: ! 3 ..m 3CCU"pxy &jJdbc ' Au ..3* 6u, I;..:; ' 2. CL&51, 1;; *-- l - l &j-2+; z5 a?, ft . IALP !13. f&%-i;& 2$&J 3;. ft.1 sq, ft.; &ii+ m* i.3. $+, hZE2X, it >a tmn dds=ir.ti mailzblc for t.ha us rcq:~sted. eat 3' tid tulla.Eg axi 2zd3 are . - \ .'iizx, E ri~h~ysl.-eT;try m3 frrnt-cd to tB3 Atod~ Crmycp Caziszlon ta use xxi occ-2;~7 tahze3 'fi--- 34 acma of la& "d&&e+ &-J-.*3 lisp, G;i &;>?ma'$Q


NMR Study of the Dynamics of ILs with -CH2Si(CH3)3 vs CH2C(CH3)3  

NLE Websites -- All DOE Office Websites (Extended Search)

Magnetic Resonance Study of the Dynamics of Imidazolium Ionic Magnetic Resonance Study of the Dynamics of Imidazolium Ionic Liquids with -CH2Si(CH3)3 vs CH2C(CH3)3 Substituents S. H. Chung, R. Lopato, S. G. Greenbaum, H. Shirota, E. W. Castner, Jr. and J. F. Wishart J. Phys. Chem. B 111, 4885-4893 (2007). [Find paper at ACS Publications] or use ACS Articles on Request Abstract: Trimethylsilylmethyl (TMSiM)-substituted imidazolium bis(trifluoromethylsulfonyl)imide (NTf2-), and tetrafluoroborate (BF4-) ionic liquids (ILs) have lower room-temperature viscosities by factors of 1.6 and 7.4, respectively, than isostructural neopentylimidazolium ILs. In an attempt to account for the effects of silicon substitution in imidazolium RTILs and to investigate the ion dynamics, we report nuclear magnetic resonance (NMR) measurements of 1H (I = 1/2) and 19F (I = 1/2)


A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada




Office of Legacy Management (LM)

design. The ingot size will be 5 inch diameter and 46 inches long approximately before crop- ping. It i estimated-that the total cycle for a run containing zinc will be 12 hours,...



NLE Websites -- All DOE Office Websites (Extended Search)

address Address: 15013 Denver West Parkway City: Golden StateorProvince: CO PostalCode: 80401 Country: USA ContactVoiceTelephone: 303-384-7098 ContactFacsimileTelephone:...


fcmlbig - Energy Information Administration  

U.S. Energy Information Administration (EIA)

256821 TX Freeman-Martin 256852 MI Freeman-Redding 256914 WV Freemansburg 256945 IL Freemanspur 256976 KS Freemeyer 257007 CA Fremont Landing 257038 OK Freeny



Gasoline and Diesel Fuel Update (EIA)

LNG Imports LNG Imports Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming



Gasoline and Diesel Fuel Update (EIA)

Specific LNG Terminals Specific LNG Terminals Generic LNG Terminals Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Specific LNG Terminals Generic LNG Terminals Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana


Carbon Dioxide, Hydrographic, and Chemical Data Obtained During the Nine R/V Korr Cruises Comprising the Indian Ocean CO2Survey (WOCE Sections I8SI9S, I9N, I8NI5E, I3, I5WI4, I7N, I1, I10, and I2; December 1, 1994-January 19, 1996)  

SciTech Connect

This document describes the procedures and methods used to measure total carbon dioxide (TCO{sub 2}) and total alkalinity (TALK) at hydrographic stations taken during the R/V Knorr Indian Ocean cruises (Sections I8SI9S, I9N, I8NI5E, I3, I5WI4, I7N, I1, I10, and I2) in 1994-1996. The measurements were conducted as part of the World Ocean Circulation Experiment (WOCE). The expedition began in Fremantle, Australia, on December 1, 1994, and ended in Mombasa, Kenya, on January 22, 1996. During the nine cruises, 12 WOCE sections were occupied. Total carbon dioxide was extracted from water samples and measured using single-operator multiparameter metabolic analyzers (SOMMAs) coupled to coulometers. The overall precision and accuracy of the analyses was {+-} 1.20 {micro}mol/kg. The second carbonate system parameter, TALK, was determined by potentiometric titration. The precision of the measurements determined from 962 analyses of certified reference material was {+-} 4.2 {micro}mol/kg (REFERENCE). This work was supported by grants from the National Science Foundation, the U. S. Department of Energy, and the National Oceanographic and Atmospheric Administration. The R/V Knorr Indian Ocean data set is available as a numeric data package (NDP) from the Carbon Dioxide Information Analysis Center (CDIAC). The NDP consists of 18 oceanographic data files, two FORTRAN 77 data retrieval routine files, a readme file, and this printed documentation, which describes the contents and format of all files as well as the procedures and methods used to obtain the data. Instructions for accessing the data are provided.

Kozyr, A.V.



Carbon Dioxide, Hydrographic, and Chemical Data Obtained During the Nine R/V Korr Cruises Comprising the Indian Ocean CO2Survey (WOCE Sections I8SI9S, I9N, I8NI5E, I3, I5WI4, I7N, I1, I10, and I2; December 1, 1994-January 19, 1996)  

Science Conference Proceedings (OSTI)

This document describes the procedures and methods used to measure total carbon dioxide (TCO{sub 2}) and total alkalinity (TALK) at hydrographic stations taken during the R/V Knorr Indian Ocean cruises (Sections I8SI9S, I9N, I8NI5E, I3, I5WI4, I7N, I1, I10, and I2) in 1994-1996. The measurements were conducted as part of the World Ocean Circulation Experiment (WOCE). The expedition began in Fremantle, Australia, on December 1, 1994, and ended in Mombasa, Kenya, on January 22, 1996. During the nine cruises, 12 WOCE sections were occupied. Total carbon dioxide was extracted from water samples and measured using single-operator multiparameter metabolic analyzers (SOMMAs) coupled to coulometers. The overall precision and accuracy of the analyses was {+-} 1.20 {micro}mol/kg. The second carbonate system parameter, TALK, was determined by potentiometric titration. The precision of the measurements determined from 962 analyses of certified reference material was {+-} 4.2 {micro}mol/kg (REFERENCE). This work was supported by grants from the National Science Foundation, the U. S. Department of Energy, and the National Oceanographic and Atmospheric Administration. The R/V Knorr Indian Ocean data set is available as a numeric data package (NDP) from the Carbon Dioxide Information Analysis Center (CDIAC). The NDP consists of 18 oceanographic data files, two FORTRAN 77 data retrieval routine files, a readme file, and this printed documentation, which describes the contents and format of all files as well as the procedures and methods used to obtain the data. Instructions for accessing the data are provided.

Kozyr, A.V.




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

INCINERATION AT THE INCINERATION AT THE IDAHO NATIONAL ENGINEERING AND ENVIRONMENTAL LABORATORY U.S. DEPARTMENT OF ENERGY OFFICE OF INSPECTOR GENERAL OFFICE OF AUDIT SERVICES DECEMBER 1999 DOE/IG-0454 AUDIT REPORT December 15, 1999 MEMORANDUM FOR THE SECRETARY FROM: Gregory H. Friedman (Signed) Inspector General SUBJECT: INFORMATION : Audit Report on "Waste Incineration at the Idaho National Engineering and Environmental Laboratory" BACKGROUND The Waste Experimental Reduction Facility (WERF) Incinerator is located at the Idaho National Engineering and Environmental Laboratory (INEEL) in Idaho Falls, Idaho. The primary mission of the incinerator is to provide mixed waste treatment until a demonstrated, more cost-effective commercial facility is available.


Harnessing frequency diversity in wi-fi networks  

Science Conference Proceedings (OSTI)

Wireless multicarrier communication systems transmit data by spreading it over multiple subcarriers and are widely used today owing to their robustness to multipath fading, high spectrum efficiency, and ease of implementation. In this paper, we use real ... Keywords: IEEE 802.11, cross layer design, forward error correction (FEC), orthorgonal frequency division multiplexing (OFDM), rate adaptation

Apurv Bhartia; Yi-Chao Chen; Swati Rallapalli; Lili Qiu



Identified Patent Waiver W(I)2008-011  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by ELTRON RESEARCH, INC. for a DOE waiver of domestic and foreign patent rights under agreement DE-FC26-05NT42469

Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Patent Waiver W(I)2011-013  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by ALSTOM POWER, INC. for a DOE waiver of domestic and foreign patent rights under agreement DE-FC26-01NT41223.


Identified Patent Waiver W(I)2011-011  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by ALSTOM POWER, INC. for a DOE waiver of domestic and foreign patent rights under agreement DE-FC26-01NT41223.


Identified Patent Waiver W(I)2011-012  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by ALSTOM POWER, INC. for a DOE waiver of domestic and foreign patent rights under agreement DE-FC26-01NT41223.


Identified Patent Waiver W(I)2012-002  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by BATTELLE MEMORIAL INSTITUTE for a DOE Identified patent waiver of domestic and foreign patent rights under agreement DE-AC07-05ID14517.


Identified Patent Waiver W(I)2012-009  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by UNITED TECHNOLOGIES RESEARCH for a DOE Identified patent waiver of domestic and foreign patent rights under agreement DE-AC02-05CH11231.



E-Print Network (OSTI)

December 3-5, 1979 THE MOBILE WINDOW THERMAL TEST FACILITY (Orlando, Florida. The Mobile Window Thermal Test Facility (Press, 197 . THE NOBILE WINDOW THERMAL TEST FACILITY (

Klems, J. H.



Why Wi-Fi wants to be free  

Science Conference Proceedings (OSTI)

As the telecommunications industry wavers, a global grassroots movement is building the next-generation wireless network.

Terry Schmidt; Anthony Townsend



Nation Weekly June 6, 2004, Volume 1, Number 7  

E-Print Network (OSTI)

ec ted c o- or din ate s yo u wi ll f ind u nli mi ted p os sib ilit y f or yo ur lim ite d bu dg et. Sp re ad y ou r n et at th e Te x-W or ld an d sp en d so me qu ite h ou rs fi sh ing th ro ug h ou r c oll ec tio n yo u wi ll...

Upadhyay, Akhilesh


Le Cercle Benveniste est un club informel de linguistique. Il se veut un forum de discussion o toute personne s'intressant la linguistique peut venir changer et dbattre, informellement et en franais, des  

E-Print Network (OSTI)

LE CERCLE Le Cercle Benveniste est un club informel de linguistique. Il se veut un forum de discussion où toute personne s'intéressant à la linguistique peut venir échanger et débattre, informellement impasses ; bref, explorer différents aspects du langage, à la recherche de Problèmes de linguistique

Maurer, Frank


International Conference on Mathematics, Computational Methods & Reactor Physics (M&C 2009) Saratoga Springs, New York, May 3-7, 2009, on CD-ROM, American Nuclear Society, LaGrange Park, IL (2009)  

E-Print Network (OSTI)

International Conference on Mathematics, Computational Methods & Reactor Physics (M&C 2009) Saratoga Springs, New York, May 3-7, 2009, on CD-ROM, American Nuclear Society, LaGrange Park, IL (2009 International Conference on Mathematics, Computational Methods & Reactor Physics (M&C 2009), Saratoga Springs

Benzi, Michele


Microsoft Word - Figure_3_4.doc  

Gasoline and Diesel Fuel Update (EIA)

7 7 None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s A l a b a m a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2002 2003 2002 Figure 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2002-2003 Figure 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2003 (Million Cubic Feet) GOM = Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly and Annual Quantity and Value of Natural Gas Report," and the United States Mineral Management



Gasoline and Diesel Fuel Update (EIA)

6 6 Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:



E-Print Network (OSTI)

NY NY NJ OH PA NY IN NJ Rate Score Cancer of the Rectum :-Bergen New York Lake NJ IL NJ NY OH Rate Score Cancer of theNew York Middlesex Rate Score IL NJ MI OH NY PA NY IL NY MA

Selvin, S.



Buildings Energy Data Book: 3.9 Educational Facilities  

Buildings Energy Data Book (EERE)

6 6 2010 Regional New Construction and Renovations Expenditures for Public K-12 Schools ($Million) Region New Schools Additions Renovation Total Region 1 (CT, MA, ME, NH, RI, VT) Region 2 (NJ, NY, PA) Region 3 (DE, MD, VA, WV) Region 4 (KY, NC, SC, TN) Region 5 (AL, FL, GA, MS) Region 6 (IN, MI, OH) Region 7 (IL, MN, WI) Region 8 (IA, KS, MO, NE) Region 9 (AR, LA, OK, TX) Region 10 (CO, MT, ND, NM, SD, UT, WY) Region 11 (AZ, CA, HI, NV) Region 12 (AK, ID, OR, WA) Total Source(s): School Planning & Management, 16th Annual School Construction Report, Feb. 2011 p. CR3 8,669.5 3,074.1 2,796.8 14,540.4 1,605.4 407.3 275.2 2,287.9 258.2 181.8 158.1 598.1 1,653.9 479.6 387.8 2,521.2 548.2 130.9 93.3 772.4 309.3 206.1 135.3 650.7 217.6 231.4 187.8 636.8 1,338.0 327.6 175.9 1,841.4 359.6 286.3 278.9 924.8



Gasoline and Diesel Fuel Update (EIA)

1 1 55 0 2 4 6 8 10 Residential Onsystem Commercial Onsystem Industrial Onsystem Vehicle Fuel Electric Utilities Dollars per Thousand Cubic Feet 0 30 60 90 120 150 180 210 240 270 300 330 Dollars per Thousand Cubic Meters 1997 1998 1999 2000 2001 25. Average Price of Natural Gas Delivered to Consumers in the United States, 1997-2001 Figure Note: Prices are calculated from onsystem sales. Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition" and Federal Energy Regulatory Commission (FERC), Form FERC- 423, "Monthly Report of Cost and Quality of Fuels for Electric Plants." Energy Information Administration / Natural Gas Annual 2001 56 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Mexico Trinidad Canada Canada Nigeria Oman Qatar Trinidad Gulf of Mexico Gulf of Mexico Gulf of Mexico Canada Trinidad Trinidad Gulf of Mexico Malaysia 13,623 Figure 8. Interstate Movements of Natural Gas in the United States, 2003 (Million Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Energy Information Administration / Natural Gas Annual 2003 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 366,224 655,731 666,614 633,960 144,284 43,869 536,776 63,133 36,848


Residential Demand Module  

Gasoline and Diesel Fuel Update (EIA)

and clothes drying. In addition to the major equipment-driven and clothes drying. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric Energy Information Administration/Assumptions to the Annual Energy Outlook 2006 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Figure 5. United States Census Divisions Source:Energy Information Administration,Office of Integrated Analysis and Forecasting. Report #:DOE/EIA-0554(2006) Release date: March 2006


AEOSup ltr to Dear Customer  

Gasoline and Diesel Fuel Update (EIA)

WA WA OR CA ID NV UT AZ NM CO WY MT ND SD NE KS OK TX MN IA MO AR LA WI IL KY IN OH WV TN MS AL GA SC NC VA PA NY VT ME NH MA RI CT NJ DE MD D.C. FL MI Electricity Supply Regions 1 ECAR 2 ERCOT 3 MAAC 4 MAIN 5 MAPP 6 NY 7 NE 8 FL 9 STV 10 SPP 11 NWP 12 RA 13 CNV 13 11 12 2 10 5 9 8 1 6 7 3 AK 15 14 H I 14 AK 15 H I Figure 2. Electricity Market Module (EMM) Regions 1. ECAR = East Central Area Reliability Coordination Agreement 2. ERCOT = Electric Reliability Council of Texas 3. MACC = Mid-Atlantic Area Council 4. MAIN = Mid-America Interconnected Network 5. MAPP = Mid-Continent Area Power Pool 6. NY = Northeast Power Coordinating Council/ New York 7. NE = Northeast Power Coordinating Council/ New England 8. FL = Southeastern Electric Reliability Council/ Florida 9. STV = Southeastern Electric Reliability Council /excluding Florida 10. SPP


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2013 Annual Energy Outlook 2013 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2013

Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value


DOE/EIA-0131(96) Distribution Category/UC-960 Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

ID ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Interstate Movements of Natural Gas in the United States, 1996 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL KY (T) MA ME (T) AL LA MA NH (T) AL MO (T) MA NJ (T) AL SC MD DC CT RI RI MA DE MD VA DC MA CT (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 906,407 355,260 243,866 220 384,311 576,420 823,799 842,114 27,271 126,012 133 602,841 266 579,598 16,837 268,138 48,442 182,511 219,242 86,897 643,401 619,703 8,157 937,806 292,711 869,951 12,316 590,493 118,256


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act 2 Metric Tons Heavy Metal (MTHM) 3 Based on actual data through 2002 , as provided in the RW-859, and projected discharges for 2003-2010 which are rounded to two significant digits. Reflects trans-shipments as of end-2002. End of Year 2010 SNF & HLW Inventories 1 Approximately 64,000 MTHM 2 of Spent Nuclear Fuel (SNF) 3 & 275 High-Level Radioactive Waste (HLW) Canisters CT 1,900 TX 2,000 MD 1,200 VT 610 RI MT WY NE 790 SD ND OK KS 600 TX 2,000 LA 1,200 AR 1,200 IA 480 MN 1,100 WI 1,300 KY TN 1,500 MS 780 AL 3,000 GA 2,400 FL 2,900 NC 3,400 VA 2,400 WV OH 1,100 PA 5,800 ME 540 NJ 2,400 DE MI 2,500 MA 650 NH 480 IN SC 3,900 CO MO 670 IL 8,400 NY 3,300 CA 2,800 AZ 1,900 NM OR 360 NV UT WA 600 ID < 1 Commercial HLW 275 Canisters (~640 MTHM)


Table 25  

Gasoline and Diesel Fuel Update (EIA)

89 89 Table 25 Created on: 1/3/2014 3:10:33 PM Table 25. Natural gas home customer-weighted heating degree days, New England Middle Atlantic East North Central West North Central South Atlantic Month/Year/Type of data CT, ME, MA, NH, RI, VT NJ, NY, PA IL, IN, MI, OH, WI IA, KS, MN, MO, ND, NE, SD DE, FL, GA, MD, DC, NC, SC, VA, WV November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0 November to November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0



Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Australia Australia Trinidad Qatar Malaysia Canada Mexico Interstate Movements of Natural Gas in the United States, 1999 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL TX MA NH CT RI MD DC DE MD RI MA MA CT VA DC (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 837,902 415,636 225,138 232 308,214 805,614 803,034 800,345 685 147 628,589 9,786 790,088 17,369 278,302 40,727 214,076 275,629 51,935 843,280 826,638 9,988 998,603 553,440 896,187 11,817 629,551 98,423


Green Power Network: Can I Buy Green Power in My State?  

NLE Websites -- All DOE Office Websites (Extended Search)

Can I Buy Green Power in my State? Community Renewable Energy Development Consumer Protection Large Purchasers of Green Power Can I Buy Green Power in My State? Click on your state below to find out which organizations offer green power in your state. The results will include utility green pricing programs, retail green power products offered in competitive electricity markets, and renewable energy certificate (REC) products sold separate from electricity. For additional information about these distinct products, see our Overview of Green Power Markets. Map of the United States. AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Alabama Alaska Arizona Arkansas California Colorado Connecticut Connecticut Delaware Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Maryland Massachusetts Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Hampshire New Jersey New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Vermont Virginia Washington West Virginia Wisconsin Wyoming Washington, DC



Gasoline and Diesel Fuel Update (EIA)

Supply Supply 17 Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity


San Juan Montana Thrust Belt WY Thrust Belt Black Warrior  

U.S. Energy Information Administration (EIA) Indexed Site

San San Juan Montana Thrust Belt WY Thrust Belt Black Warrior Paradox - San Juan NW (2) Uinta- Piceance Paradox - San Juan SE (2) Florida Peninsula Appalachian- NY (1) Appalachian OH-PA (2) Appalachian Eastern PA (3) Appalachian Southern OH (4) Appalachian Eastern WV (5) Appalachian WV-VA (6) Appalachian TN-KY (7) Piceance Greater Green River Eastern OR-WA Ventura Williston Williston NE (2) Williston NW (1) Williston South (3) Eastern Great Basin Ventura West, Central, East Eastern OR-WA Eastern Great Basin Appalachian Denver Florida Peninsula Black Warrior W Y T h ru st B e lt Powder River Paradox- Uinta- Grtr Green River MT Thrust Belt Powder River North (1) Powder River South (2) Denver North (1) Denver South (3) Denver Middle (2) TX CA MT AZ ID NV NM CO IL OR UT KS WY IA NE SD MN ND OK FL WI MO AL WA GA AR LA MI IN PA NY NC MS TN KY VA OH SC


Phase Locked Loop Control of Inverters in a Microgrid  

E-Print Network (OSTI)

Phase Locked Loop Control of Inverters in a Microgrid Matthew Surprenant Dept of ECE University Venkataramanan Dept of ECE University of Wisconsin Madison, WI, USA Abstract--Microgrids are small for inverter-based microsources within a mi- crogrid. The general control philosophy within a microgrid

Hiskens, Ian A.


Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...



U.S. Energy Information Administration (EIA) Indexed Site

BUTANENGL",3901,"CHICAGO, IL","ILLINOIS",2,260,"CANADA",1,0,0,,,,, 32904,"ALPENA OIL CO INC",1,411,"DISTILLATE FUEL, TOTAL",3843,"ALPENA, MI","MICHIGAN",2,260,"CANADA",40,0...


II castelletto sui Carso - Springer  

Science Conference Proceedings (OSTI)

rona con attenzione il progetto che avevo in mente e mi dissero che non c'erano problemi. Potevo utilizzare la struttura e Ie attrez- zature dell'lstituto, awalermi...


Sixth American Nuclear Society International Topical Meeting on Nuclear Plant Instrumentation, Control, and Human-Machine Interface Technologies NPIC&HMIT 2009, Knoxville, Tennessee, April 5-9, 2009, on CD-ROM, American Nuclear Society, LaGrange Park, IL  

E-Print Network (OSTI)

Sixth American Nuclear Society International Topical Meeting on Nuclear Plant Instrumentation, on CD-ROM, American Nuclear Society, LaGrange Park, IL (2009) FUELASSEMBLY SELF SHIELDING Polytechnic Institute Department of Mechanical, Aerospace and Nuclear Engineering Romanc2@rpi.edu; Danony

Danon, Yaron


SCOTT T. SANDERS 1500 Engineering Dr., Madison, WI, 53706 | 608 262 3540 | stsanders@wisc.edu  

E-Print Network (OSTI)

, S.T., and Okura, Y., "Design of System for Rugged, Low-noise Fiber-optic Access to High Study: Two-Step Water Splitting Cycle Using the Fe3O4/FeO Redox System," Solar Energy 65, 43-53, 1999} Walewski, J.W., Filipa, J.A., and Sanders, S.T., "Optical beating of polychromatic light and its impact

Van Veen, Barry D.

Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Identified Patent Waiver W(I)2012-012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

has to inventions conceived or first actually reduced to practice by DR. F. JEFFREY MARTIN under agreement DE-AC52-06NA25396, as the DOE has determined that granting such a...


Centr um voor Wi skunde en I nf or mati ca Modelling, AnalysisandSimulation  

E-Print Network (OSTI)

. . . . . . . . . . . . . . . . . . . . . . . . . . 31 iii #12;Contents CAFE Final Report Volume II III Protocols 33 6 Notation and De nitions 35 6.1 and Simulation CAFE project _ Final report volume II Secure protocols and architecture Edited by A. Bosselaers, R;CAFE Project - Final Report Volume II Secure Protocols and Architecture Edited by A. Bosselaers, R

Schoenmakers, Berry


The Xirrus Wi-Fi Array XS4, XS8 Security Policy Xirrus, Inc.  

Science Conference Proceedings (OSTI)

... Production-grade components and production-grade opaque ... dirt, or oil. ... The security strap should be pulled tight to disallow turning of the mounting ...



The Xirrus Wi-Fi Array XN4, XN8, XN12, XN16 Security Policy ...  

Science Conference Proceedings (OSTI)

... Production?grade components and production?grade opaque ... the surface area of any grease, dirt, or oil. ... strap should be pulled tight to disallow ...



WiFi Meet FuFi: Research Topics in SCM and DSS  

E-Print Network (OSTI)

Disruptive innovation catalysed by energy (carbon footprint) may reshape supply chain and logistics. The continents of Europe, Asia and Africa may evolve as a connected value network through railroad logistics.

Datta, Shoumen



Evaluating next-cell predictors with extensive Wi-Fi mobility data  

E-Print Network (OSTI)

cycles or more. If an external fault happens, breaker B1 will shut down the fuel cell immediately and separate it from the system. The breaker B2 will then operate to isolate the fault. As a result, the user factor 1HK (7) where


WiGriMMA: A Wireless Grid Monitoring Model Using Agents  

Science Conference Proceedings (OSTI)

The complexity, heterogeneity, device mobility and the unpredictable user behavior demands proper automation of monitoring activity in the wireless Grid to enable the user needs. Since the wireless devices can dynamically join/leave the Grid, and its ... Keywords: Agent, Credit management, Device state control, Grid monitoring, Wireless Grid

Mahantesh N. Birje; Sunilkumar S. Manvi



North Brazil Current Ring Generation and Evolution Observed with SeaWiFS  

Science Conference Proceedings (OSTI)

The earth's largest oceanic rings are formed by the retroflecting North Brazil Current (NBC) near 8N in the western tropical Atlantic. The NBC flows northward across the equator and past the mouth of the Amazon River entraining river-influenced ...

David M. Fratantoni; Deborah A. Glickson



ARIEL: automatic wi-fi based room fingerprinting for indoor localization  

Science Conference Proceedings (OSTI)

People spend the majority of their time indoors, and human indoor activities are strongly correlated with the rooms they are in. Room localization, which identifies the room a person or mobile phone is in, provides a powerful tool for characterizing ...

Yifei Jiang; Xin Pan; Kun Li; Qin Lv; Robert P. Dick; Michael Hannigan; Li Shang



Achieving True Video-on-Demand Service in Multi-Hop WiMax Mesh Networks  

E-Print Network (OSTI)

Mesh Network Configuration (MSH-NCFG) messages. Each MSH-NCFG message contains a Network Descriptor by listening to MSH-NCFG messages. From all the possible neighboring nodes that advertise MSH-NCFG messages

Hua, Kien A.



Gasoline and Diesel Fuel Update (EIA)

0 0 Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 2000 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1996-2000 Figure T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a O t h e r S t a t e s 0 1 2 3 4 5 6 7 0 30 60 90 120 150 180 Trillion Cubic Feet Billion Cubic Meters 1996 1997 1998 1999 2000 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly


Microsoft Word - figure_8.doc  

Gasoline and Diesel Fuel Update (EIA)




NLE Websites -- All DOE Office Websites (Extended Search)

two figures show measurements performed during the IMPACT campaign 2008 in Cabauw (NL). The data were sampled in a field of shallow cumulus two figures show measurements performed during the IMPACT campaign 2008 in Cabauw (NL). The data were sampled in a field of shallow cumulus clouds with cloud top in about 2000 m. During this flight leg, ACTOS was at a nearly constant height in 1930 m above ground level and 50 m below cloud top. The left plot shows the time series of reflectance at a wavelength of 1645 nm (red curve) measured onboard the helicopter and effective radius (blue triangles) measured with the PVM onboard ACTOS. The right plot shows the corresponding time series of vertical velocity w, measurement height z, liquid water content LWC, and temperature T. Reference Siebert, H., H. Franke, K. Lehmann, R. Maser, E. W. Saw, D. Schell, R. A. Shaw, and M. Wendisch (2006) Probing Fine-Scale Dynamics and Microphysics of Clouds with Helicopter-Borne


Fermilab Cultural Events in Batavia, IL  

NLE Websites -- All DOE Office Websites (Extended Search)

Click here to order for all of our upcoming events - no fees! Fermilab Arts & Lecture Series Presents: Dirty Dozen Brass Band Saturday, January 25, 2014 @ 8 pm Pre-Performance Prix-Fixe Dinner at Chez Leon is available, with seating at 6 pm Menu is Corn Chowder, Pork Tenderloin, Bourbon-Walnut Sweet Potato Mash, Sautéed Brussels Sprouts, and Pecan Rum Cake Phone Chez Leon directly at 630/840.3524 for reservations. Follow us on Facebook, and be sure to share our exciting events with your friends & neighbors! The Rise of Supersmart Super Computers Dr. Pete Beckman, Argonne National Laboratory Fri., Jan. 17 @ 8 pm - $7 Pre-Lecture Dinner at 6 pm at Chez Leon Menu: Zucchini Fritters w/Yogurt Dill Sauce, Filet Mignon w/Cabernet Sauce, Peppery Baked Onions, w/Sage & Gruyere Smashed Potatoes, & Espresso Crème Brule


Tetraalkylphosphonium polyoxometalate ILs: Organic-Inorganic...  

NLE Websites -- All DOE Office Websites (Extended Search)

F. Wishart and Mark L. Dietz J. Phys. Chem. B 111, 4685-4692 (2007). Find paper at ACS Publications or use ACS Articles on Request Abstract: Pairing of a Keggin or Lindqvist...


Yoon Il Chang | Argonne National Laboratory  

NLE Websites -- All DOE Office Websites (Extended Search)

analysis Energy storage Batteries Lithium-ion batteries Lithium-air batteries Smart Grid Energy economy Energy policy Environment Biology Environmental biology Molecular...


,"Wisconsin Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050WI3","N3010WI3","N3020WI3","N3035WI3","N3045WI3" "Date","Natural Gas Citygate Price in Wisconsin (Dollars per Thousand Cubic Feet)","Wisconsin...


IlIl RecuperoRecupero EnergeticoEnergetico deldel RifuitiRifuiti  

E-Print Network (OSTI)

.J. Themelis and P. Ulloa, "Capture and Utilization of Landfill Gas", in Renewable Energy 2005) THE GLOBAL 7.0 Singapore 4.0 China 3.0 Switzerland and Norway 3.8 South Korea 1.0 All other 9 Total 143 · Comparison with WTE: #12;WTE can be a major source of Renewable Energy (U.S. DOE 2002) Energy source Billion

Columbia University


Revue dEtudes Tibtaines  

E-Print Network (OSTI)

rinuncia (shanli ??), A te che in sei anni di difficolt praticasti completamente le pramit, A te, che hai ottenuto il dhyna vittorioso, io mi prostro. * Rifugio nel Dharma. A te che al fine di condurre gli esseri senzienti (youqing ??)13 ad abbandonare... ogni sofferenza, Hai sottomesso tutte le terrificanti torme di Mra, E che nel corso di quarantanove anni hai predicato lindicibile, A te, che (hai realizzato) il nirva supremo, io mi prostro.14 * Rifugio nel Sagha. A voi, fluente corpo di...

Achard, Jean-Luc




E-Print Network (OSTI)

.henl into ~tsmall tmmber ol+functions, wiLh t.he pa.ram(:i(:rs weighted oil basis of how usehd they ;u, which is what inl;erests us here. Douglas I~il)et: has sl,udied l;exl, variat.ion along scv eral l)liea-- tion. ()m: aim is 1,o t;~ke ~ set of texts that. has b(:ei, select,ed I)y sotne sort of crude semantic

Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


bersicht ber die Durchfhrung der Fachpraktika Master Gym Bachelor BEU / Master GH / R  

E-Print Network (OSTI)

) WiSe od. SoSe 2) WiSe 1) 4) WiSe od. SoSe 2) Chemie SoSe SoSe 5) ______ SoSe 5) _____ _____ _____ _____ Deutsch WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. So

Kallenrode, May-Britt


Revue dEtudes Tibtaines  

E-Print Network (OSTI)

nouvelles classifications : gshin rje, ma mo, srin po, gnod sbyin, mi' am ci, sa bdag, btsan, bdud ; et lha, btsan, bdud, gza', dmu, srin po, rgyal po, ma mo4. Questionn sur les recoupements, mais aussi les diver- gences que prsentent ces trois listes, il... citant les an- ciens voquent la possibilit pour les klu dapparatre sous la forme dtres surnaturels mi-humains mi-serpents. Les anciens disent que dans la mer vivent des klu et des klu mo ou klu femelles tte et torse d'homme ou de femme et ...

Achard, Jean-Luc



Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...


Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...



owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION



Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as



Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake


Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael




E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.



E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...

Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...


St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...


ENERGY SURETY MI ROGRID - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment assists in planning and analysis of potential risks


miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha



A Model Of Pedestal Structure J.D. Callen, University of Wisconsin, Madison, WI 53706-1609  

E-Print Network (OSTI)

paleoclassical ones, i.e., for Dan > Dpc eff fDD where fD ( 0.1 in 988892 ) is degree of diffusion reduction

Princeton Plasma Physics Laboratory



E-Print Network (OSTI)

??The Medicaid Home and Community Based Services Waiver (HCBS) funds services for people with developmental disabilities in community based group homes. The purpose of the (more)

Cook, Craig



a h|^w[!"????????x?x?Wi8]4!xb0??*ܼ |uY ...  

Science Conference Proceedings (OSTI)

... sG?? w?A?????9???*vv*?_*?g*'??^? 8DXit7=5???*r?*L??*ATS????\\?2??*`*m ...



Calibration Evaluation and Radiometric Testing of Field Radiometers with the SeaWiFS Quality Monitor (SQM)  

Science Conference Proceedings (OSTI)

One of the goals of calibration and validation programs supporting ocean color satellites is to produce water-leaving radiances with an uncertainty of 5% in clear-water regions. This objective requires field instruments with a calibration and ...

Stanford B. Hooker; James Aiken



WiMsh: a simple and efficient tool for simulating IEEE 802.16 wireless mesh networks in ns-2  

Science Conference Proceedings (OSTI)

Wireless mesh networks (WMNs) are two-tier wireless multihop networks. The top tier is made of wireless routers, which provide access to the wireless clients in the bottom tier. One technology for enabling multi-hop communication in the top tier is IEEE ... Keywords: IEEE 802.16, network simulator 2, simulation, wireless mesh networks

Claudio Cicconetti; Ian F. Akyildiz; Luciano Lenzini



Vehicle Technologies Office: Fact #672: April 25, 2011 Freight...  

NLE Websites -- All DOE Office Websites (Extended Search)

82.4 167.9 Long Beach, CA Water 4 32.8 119.2 152 Houston, TX Water 5 68.5 78.2 146.7 Detroit, MI Land 6 66.5 53.7 120.2 Laredo, TX Land 7 53.9 61.8 115.8 Chicago, IL Air 8 35.9...


Category:Utility Rate Impacts on PV Economics By Location | Open Energy  

Open Energy Info (EERE)

Utility Rate Impacts on PV Economics By Location Utility Rate Impacts on PV Economics By Location Jump to: navigation, search Impact of Utility Rates on PV Economics Montgomery, AL Little Rock, AR Flagstaff, AZ Phoenix, AZ Tucson, AZ Arcata, CA LA, CA San Francisco, CA Boulder, CO Eagle County, CO Pueblo, CO Bridgeport, CT Wilmington, DE Miami, FL Tampa, FL Atlanta, GA Savannah, GA Des Moines, IA Mason, IA Boise, ID Chicago, IL Springfield, IL Indianapolis, IN Goodland, KS Wichita, KS Lexington, KY New Orleans, LA Shreveport, LA Boston, MA Baltimore, MD Caribou, ME Portland, ME Detroit, MI Houghton-Lake, MI Traverse City, MI International Falls, MN Minneapolis, MN Kansas City, MO Jackson, MS Billings, MT Greensboro, NC Wilmington, NC Bismarck, ND Minot, ND Omaha, NE Concord, NH Atlantic City, NJ Albuquerque, NM Las Vegas, NV Reno, NV New York, NY

Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Topic Group Meeting Participants were: Ira Baldwin, NCSTS Daren Gilbert, State Rail Sfty. Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

July 13, 1998 3:30-6:00 p.m. Milwaukee Hilton Hotel, Milwaukee, WI July 13, 1998 3:30-6:00 p.m. Milwaukee Hilton Hotel, Milwaukee, WI Topic Group Meeting Participants were: Ira Baldwin, NCSTS Daren Gilbert, State Rail Sfty. Program Jim Baranski, NY SEMO Steve Hamp, DOE-NTP Kevin Blackwell, FRA Rick Hand, IL Commerce Commission Mike Butler, UETC Swenam Lee, DOE-FETC Mike Calhoun, FRA Norm Lindgren, UDOT Sandra Covi, UPRR Bruce Mibeck, FRA J.C. De La Garza, DOE-YMSCO William Naughton, ComEd Ray English, DOE-NR Markus Popa, DOE-OCRWM Allan Fisher, Conrail Bill Sherman, NE HLRW Task Force Bob Fronczak, AAR Carlisle Smith, Pub. Utilities Comm. of OH Phil Gehner, TRW-YMP Thor Strong, Michigan DEQ/MOCSG Michael Giblin, DOE-NV Jim Williams, Planning Information Corp. The meeting convened at approximately 3:35 p.m. CDT. Mike Butler (UETC) welcomed


Studio e progettazione di attrezzature per il sollevamento dei reattori.  

E-Print Network (OSTI)

??Lattivita di tirocinio stata svolta presso lUfficio Tecnico dellazienda Nuovo Pignone GE Oil and Gas, stabilimento di Massa, che si occupa principalmente della produzione (more)




Recombination of Photogenerated Lophyl Radicals in Imidazolium-Based ILs  

NLE Websites -- All DOE Office Websites (Extended Search)

Recombination of Photogenerated Lophyl Radicals in Imidazolium-Based Ionic Recombination of Photogenerated Lophyl Radicals in Imidazolium-Based Ionic Liquids V. Strehmel, J. F. Wishart, D. E. Polyansky and B. Strehmel ChemPhysChem 10, 3112-3118 (2009). [Find paper at Wiley] Abstract: Laser flash photolysis is applied to study the recombination reaction of lophyl radicals in ionic liquids in comparison with dimethylsulfoxide as an example of a traditional organic solvent. The latter exhibits a similar micropolarity as the ionic liquids. The ionic liquids investigated are 1-butyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide (1), 1-hexyl-3-methylimidazolium hexafluorophosphate (2), and 1-butyl-3-methylimidazolium tetafluoroborate (3). The recombination of the photolytic generated lophyl radicals occur significantly faster in the ionic liquids than expected from their


GSLIS, UIUC; 501 East Daniel Street; Champaign; IL; 61820 ...  

Science Conference Proceedings (OSTI)

... N - 1 eigenvalues (for a real symmetric matrix ... complexity of the principal components analysis, coupled ... are suitable for visualization and navigation ...



Temperature-Dependent Dynamics and Friction in IL Local Environments  

NLE Websites -- All DOE Office Websites (Extended Search)

Wishart, and E. W. Castner, Jr. J. Phys. Chem. B 111, 4963-4977 (2007). Find paper at ACS Publications or use ACS Articles on Request Abstract: The solvation dynamics and local...


DOE - Office of Legacy Management -- Sciaky Brothers Inc - IL...  

Office of Legacy Management (LM)

1987 Historical documents may contain links which are no longer valid or to outside sources. LM can not attest to the accuracy of information provided by these links. Please see...


batyam@savion.huji.ac.il Prof. Gerald M. Friedman  

E-Print Network (OSTI)

:00 Harold Vinegar, Chief Scientist, Israel Energy Initiatives Ltd Synergies between natural gas and oil shale in Israel 12:30 Lunch break 13:00 Yaakov Mimran, Petroleum Commissioner, Ministry of National

Daniel, Rosenfeld


A Brief History i-l Research Reactors  

E-Print Network (OSTI)

stainless steel sam- ples in the High Flux Isotope Reactor (HFIR) at tem- peratures of 380 to 680" with up/cm' to balance the gas pressure were used m their calculation. A comparison of the results with HFIR and the HFIR ex- perimental data is presented in section 5. Applications of the model to various fusion designs



Energy.gov (U.S. Department of Energy (DOE))

The Department of Energy (DOE) and Department of Homeland Security (DHS), in coordination with the Federal Bureau of Investigation, the Federal Energy Regulatory Commission's Office of Energy Infrastructure Security, the Electricity Sector Information Sharing and Analysis Center (ES-ISAC), North American Electricity Reliability Corporation (NERC), and industry experts, will conduct a series of briefings across the country with electricity sector owners and operators, and local law enforcement on the physical security of electricity substations.



SciTech Connect

This is the second progress and final technical report of the remediation of abandoned wells in Clay and Wayne Counties in Illinois. The wells will be identified as the Routt No.3 and No.4 and the Bates Hosselton 1 and 2. Both sites have met all legal, financial and environmental requirements to drill and/or pump oil on both leases. We have also obtained all available information about both leases. All steps were taken to improve access roads, dig the necessary pits, and build the necessary firewalls. This progress and final technical report will address the remediation efforts as well as our results and conclusions.

Peter L. Dakuras; Larry Stieber; Dick Young



Designation of Sites for Remedial Action - Metal Hydrides, Beverly,  

Office of Legacy Management (LM)

T: T: Designation of Sites for Remedial Action - Metal Hydrides, Beverly, MA; Bridgeport Brass, Adrian, MI and Seymour, Chicago, IL CT; National Guard Armory, 0: Joe LaGrone, Manager Oak Ridge Operations Office Based on the attached radiological survey data (Attachments 1 through 3) and an appropriate authority review, the following properties are being authorized for remedial action. It should be noted that the attached survey data are for designation purposes only and that Bechtel National, Inc. (BNI) should conduct appropriate comprehensive characterization studies to determine the extent'and magnitude of contamination on properties. Site Location Priority Former Bridgeport Brass Co. (General Motors) Adrian, MI Low Former Bridgeport Brass Co.


Tagore au Tibet  

E-Print Network (OSTI)

modernit loccidentale.50 Quoi quil en soit, 47 Tagore 2002b : 99.48 Gru gzings 2001 : 152 (Brtsams chos nang gi mi sna gtso bo Rgya gar chos lugs pa Kar la ni rgyalgces kyi snying stobs shugs drag... cing / rang gshis brtan zhing brling bai na gzhon zhig yin / Slobchen mthar phyin ma thag Rgya gar rgyal gces pai mthun tshogs kyi dbu bzhugs su bsdad pas / mirigs bcings grol gyi ched du dbyin jii mi ser spel mkhan mthar skrod gtong ba khur du...

Robin, Francoise



Contribution aux nombrables de la tradition Bon po : l'Appendive de bsTan 'dzin Rin chen rgyal mtshan a la Sphere de Cristal des Dieux et des Demons de Shar rdza rin po che  

E-Print Network (OSTI)

lettre Ha) ; 2. lessence fminine manifeste sous la forme du a shad etlocalise lextrmit infrieure du canal central ; et 3. le thig le indestructi-ble (mi shig pai thig le) localise dans le cur et exprime en fonction duneEssence vide (ngo bo... familiarisation avec les principes de lapratique, lors de la fusion des essences conscutive au Brasier et lEcoulement (bar dzag)44, il entre alors dans des expriences contemplativesde Dlice (bde ba), de Clart (gsal ba) et de Non-discursivit (mi rtog pa...

Achard, Jean-Luc



A propos d'un premier inventaire des monasteres bon po du Tibet et de l'Himalaya. Notes de lecture  

E-Print Network (OSTI)

bon po au Gansu (p. 504 et 506) et 10 au Qinghai (p.497-500, de faon plus dtaille). Revue dEtudes Tibtaines44 Bon po, la grande statue de Buddha du Bingling si (Gansu) est celle degShen rab mi bo. Il cite galement des relevs chinois des annes... 'dition de 1982 (Lanzhou,Kan su'u mi rigs dpe skrun khang), le numro de ligne est celui o apparat lenom du monastre ; sa dfinition ou localisation sommaire telle qu'elle peut tredduite des brves mentions du texte ou du contexte ; ventuellement...

Chayet, Anne



David Robertson Argonne National Laboratory Chemical Sciences and Engineering Division  

NLE Websites -- All DOE Office Websites (Extended Search)

Robertson Robertson Argonne National Laboratory Chemical Sciences and Engineering Division 9700 South Cass Avenue, Building 205 Argonne, IL 60439-4837 Phone: 630/252-7906; fax: 630/972-4468 e-mail: robertsond@anl.gov Professional Experience * May 2010-present: Argonne National Laboratory, Argonne, IL: Engineering Specialist, Electrochemical Analysis and Diagnostics Laboratory, Testing of advanced battery technologies, DOE contract deliverables, benchmarking of foreign battery technologies * July 2007-May 2010: LGCPI, Troy, MI: Electrical Engineering Manager, Lead the development, validation and integration of Battery Management and Control systems, electrical interfaces, wiring systems and sensing interfaces of large format lithium ion batteries for automotive and other applications.



Gasoline and Diesel Fuel Update (EIA)

2000 2000 Southern California Gas Co ..................... CA 251,452,001 8.32 Nicor Gas ................................................. IL 221,009,522 6.68 Pacific Gas and Elec Co........................... CA 211,181,852 7.98 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 184,692,129 7.53 Consumers Energy Co ............................. MI 176,663,600 4.76 Michigan Consol Gas Co.......................... MI 136,124,328 5.41 Keyspan Energy Del Co ........................... NY 134,055,940 10.75 Pub Svc Elec and Gas Co........................ NJ 132,611,115 6.32 East Ohio Gas Co .................................... OH 131,187,521 7.49 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 130,622,887 8.82 Peoples Gas Lt and Coke Co................... IL 103,856,141 8.60 Pub Svc Co of Colorado...........................



Gasoline and Diesel Fuel Update (EIA)

Energy Information Administration / Natural Gas Annual 1999 Southern California Gas Co ..................... CA 275,767,714 6.50 Pacific Gas and Elec Co........................... CA 234,195,449 6.61 Nicor Gas ................................................. IL 211,147,988 4.71 Consumers Energy Co ............................. MI 167,318,229 4.89 Michigan Consol Gas Co.......................... MI 134,432,032 5.42 Pub Svc Elec and Gas Co........................ NJ 133,426,119 6.86 East Ohio Gas Co .................................... OH 127,141,913 5.81 Keyspan Energy Del Co ........................... NY 125,709,092 9.79 Columbia Gas Dist Co.............................. KY,PA,MD,OH 121,011,064 7.32 Peoples Gas Lt and Coke Co................... IL 98,758,164 6.77 Pub Svc Co of Colorado........................... CO 84,115,032 5.28



Gasoline and Diesel Fuel Update (EIA)

3 3 Northern Illinois Gas Co ........................... IL 241,353,299 5.25 Southern California Gas Co ..................... CA 237,581,205 7.28 Pacific Gas and Elec Co........................... CA 191,919,171 6.12 Consumers Pwr Co .................................. MI 178,690,154 4.80 Columbia Gas Dist Co.............................. OH,KY,PA,MD 178,512,589 7.64 Michigan Consol Gas Co.......................... MI 152,111,213 5.59 East Ohio Gas Co .................................... OH 147,197,186 6.36 Pub Svc Elec and Gas Co........................ NJ 138,404,765 7.58 Peoples Gas Lt and Coke Co................... IL 113,561,765 6.96 Lone Star Gas Co..................................... TX 100,079,759 6.13 Atlanta Gas Lt Co ..................................... GA 96,381,162 7.41 Brooklyn Union Gas Co............................



Gasoline and Diesel Fuel Update (EIA)

8 8 Southern California Gas Co ..................... CA 269,739,909 7.31 Pacific Gas and Elec Co........................... CA 224,402,286 6.32 Northern Illinois Gas Co ........................... IL 196,608,329 4.63 Consumers Pwr Co .................................. MI 153,128,350 4.92 Columbia Gas Dist Co.............................. OH,KY,PA,MD 138,064,908 7.21 Pub Svc Elec and Gas Co........................ NJ 126,142,540 6.61 Michigan Consol Gas Co.......................... MI 125,456,377 5.35 East Ohio Gas Co .................................... OH 117,574,196 6.21 Peoples Gas Lt and Coke Co................... IL 89,685,006 6.81 Atlanta Gas Lt Co ..................................... GA 89,103,601 6.69 Lone Star Gas Co..................................... TX 84,559,915 5.95 Brooklyn Union Gas Co............................ NY


Mr. Jack W. Anderson Chief Operating Officer Fermilab  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Jack W. Anderson Jack W. Anderson Chief Operating Officer Fermilab P.O. Box 500 Batavia, IL 60510 Dear Mr. Anderson: SUBJECT: NATIONAL ENVIRONMENTAL POLICY ACT (NEPA) DETERMINATION AT i FERMI NATIONAL ACCELERATOR LABORATORY (FERMILAB) - HYDROSTATIC RELIEF ACTION AT THE NEUTRINOS AT THE MAIN INJECTOR (NUMI) Reference: Letter, from J. Anderson to M. Weis, dated January 16, 2013, Subject: NEPA Environmental Evaluation Notification Form (EENF) for the Hydrostatic Relief Action at NuMI have reviewed the Fermilab EENF for the Hydrostatic Relief Action at NuMI. Based on the information provided in the EENF, I have approved the following categorical exclusion (CX): Project Name Approved CX Hydrostatic Relief Action at NuMI 1/76/2013 B2.5 am returning a signed copy of the EENF for your records. No further NEPA review is required.

Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Aggregationn of Space-Time Processes  

E-Print Network (OSTI)

irfxvrq LhihiUi? |_tU ttL? t@? _@TT*U@|L? tLu| i5T@UiA4i -i|@*i_hiuihi? Uit@? _@_tU ttL? Lui} |4@|h tTiU U@|L? U@?i? |% | uhL4| i5T@UiA4i tTL? |i_L |M)`i@? _ -@hiM@ti_L? |

Giacomini, Raffaella; Granger, Clive W.J.



John Freeland  

NLE Websites -- All DOE Office Websites (Extended Search)

Welcome Welcome Getting Beamtime 4-ID-C Soft 4-ID-D Hard Publications Contact Us Ring Status Current Schedule John Freeland Argonne National Laboratory 9700 S. Cass Ave 431/E004 Argonne, Il 60439 Phone: 252-9614 Fax: 252-7392 E-Mail: freeland@aps.anl.gov Education/Experience: 1998 - present: Staff Scientist, Advanced Photon Source, Argonne National Laboratory, Argonne, IL 2001 - present: Adjunct Faculty, Department of Physics, Northern Illinois University 1996 - 1998: National Research Council (NRC) Fellow Naval Research Laboratory The Johns Hopkins University; Ph. D in Physics, 1996 Beloit College, Beloit, WI; B.S. in Physics, 1990 Research Interests: Understanding the magnetic and electronic properties of complex oxides both in the bulk and at surfaces and interfaces.


Presented at the 16th ANS Topical Meeting on the Technology of Fusion Energy, Madison WI, Sept. 14-16, 2004.  

E-Print Network (OSTI)

Stanford University . . . . . . . . #12;13 Solar Energy Ordered Bulk Heterojunction Photovoltaic Cells Inorganic Nanocomposite Solar Cells by Atomic Layer Deposition Nanostructured Metal-Organic Composite Solar Cells Nanostructured Silicon-Based Tandem Solar Cells Photosynthetic Bioelectricity Biomass Energy

Ghoniem, Nasr M.


Thermal performance measurements of sealed insulating glass units with low-E coatings using the MoWiTT (Mobile Window Thermal Test) field-test facility  

SciTech Connect

Using data obtained in a mobile field-test facility, measured performance of clear and low-emissivity double-glazing units is presented for south-facing and north-facing orientations. The changes in U-value and shading coefficient resulting from addition of the low-E coating are found to agree with theoretical expectations for the cold spring test conditions. Accurate nighttime U-values were derived from the data and found to agree with calculations. Expected correlation between U-value and wind speed was not observed in the data; a plausible experimental reason for this is advanced.

Klems, J.; Keller, H.



Mercury Measurements Characterizing the Impact of SCR on Mercury: Consol Test Site 5 - Eastern Bituminous Coal-Fired Power Plant wi th an SCR, ESP, and Wet FGD  

Science Conference Proceedings (OSTI)

CONSOL Energy Inc., Research & Development (CONSOL), with support from the U.S. Department of Energy, National Energy Technology Laboratory (DOE) and the Electric Power Research Institute (EPRI), is evaluating the effects of selective catalytic reduction (SCR) on mercury (Hg) capture in coal-fired plants equipped with an electrostatic precipitator (ESP) - wet flue gas desulfurization (FGD) combination or a spray dyer absorber 8212 fabric filter (SDA-FF) combination. In this program CONSOL is determining ...



Dept. of Sol Science, UW-Madison/UW-Extension, 1525 Observatory Dr., Madison, WI 53706/608-262-0485 November 2010 Issue #2 2010  

E-Print Network (OSTI)

plants burn low S coal and some have installed flue gas scrubbers to reduce sulfur emissions. Use is generated from burning coal. As a consequence of the 1990 Clean Air Act Amendment many coal-burning power power plants in the south- eastern part of the state producing FGD gypsum, with a third to come on

Balser, Teri C.


Installation Restoration Program. Remedial investigation report. Site 1. Fire Training Area. Volk Field Air National Guard Base, Camp Douglas, Wi. Volume 2. Final remedial investigation report  

SciTech Connect

Volume II of this report contains data tables and field notes of information gathered from the sampling of soils and ground water. Hydrocarbons and aromatic volatile organics are among the contaminants listed.

Not Available



Installation Restoration Program. Remedial investigation report. Site 1. Fire Training Area. Volk Field Air National Guard Base, Camp Douglas, Wi. Volume 1. Final remedial investigation report  

SciTech Connect

Volume 1 of this report covers the Remedial Investigation conducted on Site 1, Fire Training Area at Volk Field Air National Guard Base. The remedial work is described and the testing conducted after remediation to insure all contamination has been removed. The study as conducted under the Air National Guard's Installation Restoration Program. Partial contents include: Meteorology; Hydrology; Soils; Water wells; Groundwater; Borings; Samplings; Chemical contamination; Migration; Decontamination.

Not Available



Optimum Cycle Length and Discharge Burnup for Nuclear Fuel - A Comprehensive Study for BWRs and PWRs: Phase I: Results Achievable Wi thin the 5 Percent Enrichment Limit  

Science Conference Proceedings (OSTI)

Core reload design and economic analyses show that both pressurized water reactors (PWRs) and boiling water reactors (BWRs) can derive significant benefits by increasing the discharge burnup of their fuel above the currently licensed values. Optimum discharge burnup levels, however, may not be achievable without exceeding the current 5 wt percent limit on enrichment.



Matching renewal energy sources to rural development needs : a prototype design for a rural community development center for Jamaica, W.I.  

E-Print Network (OSTI)

The opportunities for utilizing Jamaica/s rich supply of renewable energy resources as a base for stead, environmentally sound rural development is tremendous. This thesis explores as way of tapping this potential. Jamaica's ...

Jackson, Michael Onaje



Anthropogenic impact on spring bloom dynamics in the Yangtze River Estuary based on SeaWiFS mission 19982010 and MODIS 20032010 observations  

Science Conference Proceedings (OSTI)

Nutrient output from the Yangtze River to the sea has increased dramatically since the 1960s, and over the past 50 years more than 50,000 reservoirs on the Yangtze River basin have had little impact on water discharge, but have drastically reduced the ...

Cheng Chen, Hong Jiang, Yu Zhang



~o,nnarrrs C/WI. Vol. 19.No. 2. no. 85-90. 1995I. Copyright f. 1995Els&er ScienceLrd  

E-Print Network (OSTI)

`A' to interpret it as a chemical element and searches its memory for the element that corresponds of the program can be secured by sending a disk to the author. Acknou,lrrlg~nle,lrs-The author would like

Campanario, Juan Miguel


wyang98@stanford.edu; phone 1 650 723-6213; fax 1 650 725-9755; http://eil.stanford.edu/WiMMS/  

E-Print Network (OSTI)

In this study, a new wireless sensing unit for operation within an automated Structural Health Monitoring (SHM) system is proposed, designed and validated. The design of the wireless sensing unit emphasizes minimization of its power consumption characteristics to ensure it is suited for long-term field deployment in civil structures. The wireless modem integrated with the unit has a long communication range that permits wireless sensors to be spaced over 100m apart. A multi-channel high-resolution analog-to-digital converter is included within each sensing unit to provide flexibility for high-fidelity data collection. A key feature of the wireless sensing unit design is the inclusion of a sophisticated computing core that is capable of locally executing engineering algorithms in real-time. As part of the embedded software, a novel communication protocol is written that can accomplish low-latency communications for accurate time synchronization between spatially distributed wireless sensors. To illustrate the capabilities of the wireless monitoring platform, including the execution of extensive computational tasks, a prototype system is fabricated and tested in the laboratory and field. As part of validating the system performance in the field, the vertical acceleration response of the Geumdang Bridge under traffic loading is measured by 14 wireless sensing unit prototypes.

Design Of Low-Power; Wang Yang; Jerome P. Lynch; B Kincho H. Law




co-fabricated filtration system for enhancement of ... increases functionality and integration of micro ... for the U.S. Department of Energys National Nuclear ...


May All Good Things Gather Here: Life, Religion and Marriage in a Mi nyag Tibetan Village  

E-Print Network (OSTI)

;#15; #29;#31;#3;#14;#12; 3 #11;#5;#12;#6;#3;#20; #8;#20; #31;#6;#7; #29;#7;#5;8#16;#11;#3; #14; #15;#7;#5;#14;#3;#19;#5;#17;.#7;#5; #5;#14; #14;#5;#7;#8; #5;#7;#8;#11;#12; #6;#5;#20;#5;9 : ?@AB@A : >C?DEFGH@AB@A : CIH@AB@A : EKDLMAB@A : N...

Bkra shis bzang po



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

DOE Green Energy (OSTI)

gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



ANRV286-MI60-17 ARI 25 May 2006 23:56 The Bacterial  

E-Print Network (OSTI)

Molecular Genetics and Microbiology, University of Texas, Austin, Texas 78712-0231; email: philipl energy-transducing membranes (133). It is widespread within the microbial world and in plants. Homologs

Georgiou, George


UCRL-MI-224010 ARM-06-012 ARM's Support for GCM Improvement:...  

NLE Websites -- All DOE Office Websites (Extended Search)

updrafts. Because the total mass of water condensed into clouds is controlled by thermodynamics, a greater number of droplets for the same mass of cloud water means that the...


Technical Section: CHuMI viewer: Compressive huge mesh interactive viewer  

Science Conference Proceedings (OSTI)

The preprocessing of large meshes to provide and optimize interactive visualization implies a complete reorganization that often introduces significant data growth. This is detrimental to storage and network transmission, but in the near future could ... Keywords: Interactive visualization, Large meshes, Lossless compression, Out-of-core

Clment Jamin; Pierre-Marie Gandoin; Samir Akkouche



LAT HING MI RO OPTI AL SWIT H - Home - Energy Innovation ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2013-10084P

Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Superfund Record of Decision (EPA Region 5): Wash King Laundry, Baldwin, MI, March 1993  

SciTech Connect

This decision document presents the selected remedial action for the Wash King Laundry Superfund site in Baldwin, Pleasant Plains Township, Michigan. The groundwater remedial action consists of the following: groundwater monitoring; deed restrictions; and groundwater extraction with physical/chemical treatment. The lagoon remedial action consists of the following: excavation of contaminated sediments and soils and off-site disposal.



Characterization of UNUSUAL LATERAL ORGANS : a miRNA regulated F-Box protein  

E-Print Network (OSTI)

between ULO and the HD-ZIP proteins in planta. Anotherof homodomain-leucine zipper (HD-Zip) proteins. Plant SignalKANADI and class III HD-Zip gene families regulate embryo

Smith, Peter Thomas



Integrated modeling within a Hydrologic Information System: An OpenMI based approach  

Science Conference Proceedings (OSTI)

This paper presents a prototype software system for integrated environmental modeling that provides interoperability between the Consortium of Universities for the Advancement of Hydrologic Science, Inc. (CUAHSI) Hydrologic Information System (HIS) and ... Keywords: Data management, Environmental management, Integrated modeling, Systems analysis

Anthony M. Castronova; Jonathan L. Goodall; Mehmet B. Ercan



"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

Puertorriquea. Humacao, Puerto Rico: Editorial Furidi,and Colonization of Puerto Rico, 1493-1599. San Juan: Centroand U.S. Imperialism in Puerto Rico. Berkeley: University of

Rivera, Petra Raquel



"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn.  

E-Print Network (OSTI)

??My dissertation examines entanglements of race, place, gender, and class in Puerto Rican reggaetn. Based on ethnographic and archival research in San Juan, Puerto Rico, (more)

Rivera, Petra Raquel



Ruofan Wu, Hieu Pham Trung Nguyen and Zetian Mi INTRODUCTION TO LEDs  

E-Print Network (OSTI)

-in-a-Wire Light Emitting Diodes and Prevention Method Nano-electronic Devices and Materials, Electrical Computer., Efficiency droop in nitride-based light-emitting diodes. Physica Status Solidi a-Applications and Materials history. Nature Photonics 2007, 1 (4), 189-192. [4] Holonyak, N., Is the light emitting diode (LED

Barthelat, Francois


"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

May ________. A vistas la pornografa. Primera Hora, 22la medida contra la pornografa. El Nuevo Da, 13 Junecomunicacin contra la pornografa. El Nuevo Da, 16 May

Rivera, Petra Raquel



Informa(on and Resources Water Quality and Mi/ga/on: Bifenthrin and Fipronil  

E-Print Network (OSTI)

strategy, Pesticides fluxes, Surface water, Vineyard Introduction The intensive use of pesticides for crop on the mobilisation of pesticides and total fluxes in surface water. Moreover, the effect of the sampling strategy ranged from 1.0 to 60 g. Effect of sampling strategy on the estimation of pesticides fluxes in the river

Hammock, Bruce D.


Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in  

E-Print Network (OSTI)

Universidad Católica de Chile, Santiago 8331010, Chile; b Department of Plant and Soil Sciences, Delaware activated cell sorter (FACS) and extracted total RNA as described previously (9). KNO3 treat- ment induced

Green, Pamela


Project Award Spreadsheets 2010 12 21 1232.xlsx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

City HQ State City HQ State Congressional District(s) Population Recovery Act Funding* Asheville ** NC NC-011 500,000 $209,940 Aspen CO CO-003 5,902 $59,193 Aurora CO CO-007 319,057 $151,800 Baltimore MD MD-002 636,919 $200,000 Baton Rouge LA LA-6 223,689 $200,000 Boston MA MA-009 609,023 $300,000 Casper WY WY-001 54,047 $130,000 Chicago IL IL-005 2,853,114 $300,000 Chula Vista CA CA-051 219,318 $200,000 City and County of Denver CO CO-001 598,707 $210,040 Columbia MO MO-009 100,733 $200,000 Davenport IA IA-001 100,827 $200,000 Delray Beach FL FL-022 64,092 $130,000 Durango CO CO-003 16,416 $58,500 Flint MI MI-005 112,900 $199,814 Fort Wayne IN IN-003 251,591 $195,700 Hailey ID ID-002 7,883 $83,202 Hamilton OH OH-008 62,477 $130,000 Heber** UT UT-002 13,988 $100,000 Hoffman Estates IL IL-008 53,641 $98,556 Lake Worth FL FL-022 35,513


The Tension in Solidarity: Race, Gender, and National Identity in Katherine Dunhams Southland  

E-Print Network (OSTI)

WI: The University of Wisconsin Press, 2005. 345-363.WI: The University of Wisconsin Press, 2005. 364-381. ---. WI: The University of Wisconsin Press, 2005. Cole, Johnnetta

Timmons, Michele



100000241,1,1,1,1,20050516,"AL",10610,"Albertville Municipal...  

U.S. Energy Information Administration (EIA) Indexed Site

,1,229279,"WI",8026,"Sheboygan Falls City of",99 5500018312,1,1,1,1,18004899,"WI",10610,"Sun Prairie Water & Light Comm",99 5500018312,1,2,1,1,1961803,"WI",10620,"Sun Prairie Water...


Business Engineering (M.Sc.) Summer Term 2013  

E-Print Network (OSTI)

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 68 Automated Manufacturing Systems- WI4INGMBWBK1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79 Material Flow in Logistic Systems- WI4INGMB25 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81 Material Flow in networked Logistics Systems- WI4INGMB26

Stein, Oliver


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

As A As A Power Resource Steven Nadel, Executive Director American Council for an Energy-Efficient Economy October 2010 2 The American Council for an Energy- Efficient Economy (ACEEE) 30 year old, non-profit 501(c)(3) dedicated to advancing energy efficiency through research and education. 35+ staff in Washington DC, + field offices in DE, MI, WA and WI. Focus on End-Use Efficiency in Industry, Buildings, Utilities, and Transportation; Economic Analysis & Human Behavior; and State & National Policy Worked on utility-sector energy-efficiency programs and policies since 1980s Savings Potential from Jan. 2009 Electricity Advisory Committee Report Average Statewide Utility Cost of Saved Energy for Efficiency Programs 3.3 3.3 3.1 3.0 2.9 2.8 2.7 2.6 2.1 1.9 1.9 1.7


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2007 (Million Cubic Feet) Nigeria Algeria 37,483 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports.



Office of Legacy Management (LM)

~ *-,-' .r_~, ~ *-,-' .r_~, VERIFICATION SURVEY OF THE BAKER AND WILLIAMS WAREHOUSES BUILDING 513-519 NEW YORK, NEW YORK Prepared by W. C. Adams Environmental Survey and Site Assessment Program Energy/Environment Systems Division Oak Ridge Institute for Science and Education Oak Ridge, Tennessee 37831-0117 Prepared for the Office of Environmental Restoration U.S. Department of Energy FINAL REPORT JUNE 1994 This report is based on work performed under contract number DE-AC05-760R00033 with the U.S. Department of Energy. Baker arId Wi,,iMI Wsrchouwl-Vcrification June 28, ,994 - ,I I_ ..I .- VERIFICATION SURVEY OF THE BAKER AND W ILLIAMS WAREHOUSES BUILDING 513-519 NEW YORK, NEW YORK Prepared by: ' J .,,,~ ' . W . C. Adams, Project Leader Date: Environmental Survey and Site Assessment Program


EA-16-C TransAlta Energy Marketing (U.S) Inc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1 Federal Register 1 Federal Register / Vol. 76, No. 14 / Friday, January 21, 2011 / Notices Houghton, MI. NPA: Goodwill Industries of Northern Wisconsin & Upper Michigan, Inc., Marinette, WI Contracting Activity: Dept of the Interior, National Park Service, Midwest Region, Omaha, NE. Deletions On 10/22/2010 (FR 65305) and 11/19/ 2010 (75 FR 70909-70910), the Committee for Purchase From People Who Are Blind or Severely Disabled published notices of proposed deletions from the Procurement List. After consideration of the relevant matter presented, the Committee has determined that the products listed below are no longer suitable for procurement by the Federal Government under 41 U.S.C. 46-48c and 41 CFR 51- 2.4. Regulatory Flexibility Act Certification I certify that the following action will


NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5500 5500 Johnson Controls, Inc. EE Multiple PMC/PVT 2011/ 10/1/2011 to 1/31/2015 Chris Johnson Multiple sites, CA, MI, WI, OR Significant Cost Improvement of Li-Ion Cells (SUMMARY CX) Reduce manufactured cost of large format Li-ion cells by 50% through use of coated separators, dry coated electrodes, and fast formation technologies. Christopher Johnson Digitally signed by Christopher Johnson DN: cn=Christopher Johnson, o=PMC, ou=PVT, email=cjohnson@netl.doe.gov, c=US Date: 2011.12.19 13:35:19 -05'00' 12 19 2011 john ganz Digitally signed by john ganz DN: cn=john ganz, o=netl, ou=environmental compliance division, email=john.ganz@netl.doe.gov, c=US Date: 2011.12.20 11:06:33 -05'00' 12 20 2011 Comprehensive list of subcontractors and five locations covered under this Summary CX has been


Categorical Exclusion Determination Form It Submit by E-_  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

It Submit by E-_ It Submit by E-_ I'llail - ] Proposed Action Title: (0672- 1610) Eaton Corporation - Highly Efficient, Nea r-Isothermal Liquid-Piston Compressor fo r Low Cost At-Home Natural Gas Refueli ng Program or Field Office: Advanced Research Projects Agency - Energy LocationCs) CCity/County/State): Southfield, MI ; Eden Prairie, MN; Minneapolis, MN; and Milwaukee, WI Proposed Action Description: Funding will support efforts to develop a highly efficient, near isothermal liquid piston compressor for low cost, at-home natu ral gas refueling Proposed work will consist of: (1) develop and optimize a concept compressor design to achieve established performance and cost targets; (2) characterize and verify the expected performance for the compressor design; and (3) develop a compressor system prototype to test proof of


A Numerical Model for Combustion of Bubbling Thermoplastic ...  

Science Conference Proceedings (OSTI)

... where Wi = dri/dt and Wi+1 = dri+1/dt are velocities of inner and outer nodes respectively, the mass conservation equation can be rewritten as ...


Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network (OSTI)

of noble gases in molten salts, which also provide a modeln Hexane B2 275C. Hydrogen-Molten Salt WI (dynes/em) WI PI

Joyce, Peter James



Il ruolo dei processi ossidativi nei livelli piu' superficiali delle coperture delle discariche di rifiuti RSU: il caso della discarica di Legoli (Peccioli, Pisa).  

E-Print Network (OSTI)

??Studio e stima della distribuzione spaziale del flusso di biogas emesso dal suolo, composizione chimica ed isotopica del biogas. Campagna di misure di flusso di (more)




Vertical relationships between manufacturers and retailers: inference with limited data  

E-Print Network (OSTI)

OR Electricity (industrial) OH Expon (price-estimatedprice IL Retail rental IL Gasoline IL Gasoline OH Electricity (industrial) IL Electricity (price IL Retail rental IL Gasoline IL Gasoline OH Electricity (industrial) IL Electricity (

Villas-Boas, Sofia B.



Vertical relationships between manufacturers and retailers: inference with limited data  

E-Print Network (OSTI)

Electricity (industrial) OH Dependent Variable = Expon (Price -price IL Retail rental IL Gasoline IL Gasoline OH Electricity (industrial) IL Electricity (price IL Retail rental IL Gasoline IL Gasoline OH Electricity (industrial) IL Electricity (

Villas-Boas, Sofia B.



Integration of Molecular Networks in the Shoot Apical Meristem that Controls Floral Specification in Arabidopsis thaliana  

E-Print Network (OSTI)

lycopersicum_miR156b Solanum_lycopersicum_miR156c Sorghum_bicolor_miR156a Sorghum_bicolor_miR156b Sorghum_bicolor_miR156c Sorghum_

Lal, Shruti



Pub Svc Elec  

Gasoline and Diesel Fuel Update (EIA)

Pub Pub Svc Elec and Gas Co......................... NJ 81,712,678 5.82 Columbia Gas Dist Co............................... OH,KY,PA,MD 76,048,915 5.95 Con Edison Co. of New York Inc............... NY 69,809,658 5.99 Consumers Pwr Co ................................... MI 58,661,306 4.46 Pacific Gas and Elec Co............................ CA 57,793,522 5.67 Minnegasco ............................................... MN 57,154,912 4.57 Southern California Gas Co ...................... CA 54,772,058 6.16 Michigan Consol Gas Co........................... MI 53,635,433 5.16 Entex Div of Noram Energy Corp.............. LA,TX,MS 49,485,836 4.80 Northern Illinois Gas Co ............................ IL 48,165,624 4.62 Pub Svc Co. of Colorado........................... CO 47,339,959 3.51 Atlanta Gas Lt Co ......................................



Gasoline and Diesel Fuel Update (EIA)

4 4 Con Edison Co. of New York Inc.............. NY 88,830,005 5.25 Pub Svc Elec and Gas Co........................ NJ 70,705,783 5.28 Columbia Gas Dist Co.............................. OH,KY,PA,MD 63,746,659 7.11 Southern California Gas Co ..................... CA 57,000,043 6.63 Minnegasco .............................................. MN 55,213,151 4.69 Pacific Gas and Elec Co........................... CA 54,854,821 6.15 Entex Div of Noram Energy Corp ............. LA,MS,TX 51,551,370 5.31 Consumers Pwr Co .................................. MI 50,657,354 4.44 Michigan Consol Gas Co.......................... MI 50,589,626 5.55 Northern Illinois Gas Co ........................... IL 47,159,304 5.26 Pub Svc Co. of Colorado.......................... CO 46,479,502 3.88 East Ohio Gas Co .................................... OH 41,561,614 5.92



E-Print Network (OSTI)

NJ, 07036. **Present address: ***Present address: Chemistry Department, Beloit College, Beloit, WI Solar Energy

Robbins, J.L.




E-Print Network (OSTI)

, University of Wisconsin, Madison, WI 53706 (3) Department of Theoretical Physics and Plasma Research

Redi, Martha H.


NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EE0002550 EE0002550 Texas State Technical College EE CleanFUEL Holdings, Inc. PMC/PVTD 2012/ August 2010 - August 2013 Neil Kirschner Multiple sites, IL and WI "Clean Start" - Development of a National Liquid Propane (Autogas) Refueling Network (SUMMARY CX) This Summary CX is for 36 sites in project selected under Clean Cities FOA DE-PS26-09NT01236, AOI#4. Project is to provide liquid propane at refueling stations as a transportation fuel. Digitally signed by Neil Kirschner DN: cn=Neil Kirschner, o, ou, email=Neil.Kirschner@netl.doe.gov, c=US Date: 2012.08.31 14:36:00 -04'00' 08 31 2012 john ganz Digitally signed by john ganz DN: cn=john ganz, o=environmental compliance division, ou=office of general counsel, email=john.ganz@netl.doe.gov, c=US Date: 2012.09.07 10:55:54


Frequently Asked Questions on the Department of Energy's National Environmental Policy Act Regulations  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Lh[)E Lh[)E F 1W:i il%: ww,:f m ANN IOF SIIJIWEC:V "1-cl ; A'll[gl;lst :?!1.j II '9 w ... . .. . .. ,!! 'Cmk (20 f ,N]b, 1+ A ,J" (:) ![ 1[ c, y and, ,!4,:! ~; ~,',? " ., ,,. I . ) >'ii L.ll,u.r . hWl[Ik: : 6-'! 1'{!11 :?!41 :k:l?i,:$d ""~][(:(:llL]f::~)lt~[:}r ihkd '[)tl:l(:$ti![]l[ ]l$ (Ml 'thE: ]~(fl~)~l]~lt~~l(:~lit ([]~f ~][]k:][[?jf $ (lDcws:)


Lamp Divisions  

Office of Legacy Management (LM)

--- --- /A;; i :' r%i;in~house ilEc;' i:Z3:~cra:ion Lamp Divisions , _.. (I +i. 0 :,,,rg. . I . . -= i?e p/q! qe)-' &se pw E.rcale?l iev, Je!sey 07m March 20, 1 gs? ::r . J. A. Jones I ti. 5. Muclear Regulatory Commission .> = ..- haterials Licensing Branch -s - ,.I, - - Division of Fuel Cycle and hateri al Safety LY. , $2 - _ . ' -' . 3 _- - Yeshington, C. C. 2@555 - :_ :--, =-- -- .-?J -.: y...., : :- 7 Dear Mr. Jones : y-- --, ? . *I 2=15 2 r; X -P The following is our final report of the decontamination efZor?s takz in our Bui Iding 7 basement and wi 11 also serve to update our report i& November 12, 1980. As stated in NRC' s report of December 22, 1983, two closeout inspect ions were conducted by your King of Prussia off i ce on November 21 and December 2,


EIA - Natural Gas Pipeline Network - Largest Natural Gas Pipeline Systems  

U.S. Energy Information Administration (EIA) Indexed Site

Interstate Pipelines Table Interstate Pipelines Table About U.S. Natural Gas Pipelines - Transporting Natural Gas based on data through 2007/2008 with selected updates Thirty Largest U.S. Interstate Natural Gas Pipeline Systems, 2008 (Ranked by system capacity) Pipeline Name Market Regions Served Primary Supply Regions States in Which Pipeline Operates Transported in 2007 (million dekatherm)1 System Capacity (MMcf/d) 2 System Mileage Columbia Gas Transmission Co. Northeast Southwest, Appalachia DE, PA, MD, KY, NC, NJ, NY, OH, VA, WV 1,849 9,350 10,365 Transcontinental Gas Pipeline Co. Northeast, Southeast Southwest AL, GA, LA, MD, MS, NC, NY, SC, TX, VA, GM 2,670 8,466 10,450 Northern Natural Gas Co. Central, Midwest Southwest IA, IL, KS, NE, NM, OK, SD, TX, WI, GM 1,055 7,442 15,874 Texas Eastern Transmission Corp.


Cover image: Postcard illustration of Wacker Drive, Chicago, IL. Published by the Gerson Bros.  

E-Print Network (OSTI)

NUCLEAR POWER in CALIFORNIA: 2007 STATUS REPORT CALIFORNIA ENERGY COMMISSION October 2007 CEC-100, California Contract No. 700-05-002 Prepared For: California Energy Commission Barbara Byron, Senior Nuclear public workshops on nuclear power. The Integrated Energy Policy Report Committee, led by Commissioners


e-mail: elperin@menix.bgu.ac.il Department of Mechanical Engineering,  

E-Print Network (OSTI)

developed a theoretical model of a novel thermal laser shock method for separation of glass and glass-ceramic.1115/1.1649245 Introduction High quality separation of nonmetallic e.g., glass, glass- ceramic wafers into chips is of great significance in electronic industry. Since chips often operate at large thermal loadings, high quality

Elperin, Tov


Impaired Cytokine Signaling in Mice Lacking the IL-1 Receptor-Associated Kinase1  

E-Print Network (OSTI)

first generation college students, have a verified disability, or receive a Pell Grant as part of the Jerry Yang Resource and Support Center for Undocumented Students was to provide a supportive environment. It was the intention of the Jerry Yang Resource and Support Center for Undocumented Students to provide academic


Status of initial testing of the H2SO4 section of the ILS experiment.  

DOE Green Energy (OSTI)

A sulfuric acid catalytic decomposer section was assembled and tested for the Integrated Laboratory Scale experiments of the Sulfur-Iodine Thermochemical Cycle. This cycle is being studied as part of the U. S. Department of Energy Nuclear Hydrogen Initiative. Tests confirmed that the 54-inch long silicon carbide bayonet could produce in excess of the design objective of 100 liters/hr of SO{sub 2} at 2 bar. Furthermore, at 3 bar the system produced 135 liters/hr of SO{sub 2} with only 31 mol% acid. The gas production rate was close to the theoretical maximum determined by equilibrium, which indicates that the design provides adequate catalyst contact and heat transfer. Several design improvements were also implemented to greatly minimize leakage of SO{sub 2} out of the apparatus. The primary modifications were a separate additional enclosure within the skid enclosure, and replacement of Teflon tubing with glass-lined steel pipes.

Moore, Robert Charles; Parma, Edward J., Jr.; Gelbard, Fred




NLE Websites -- All DOE Office Websites (Extended Search)

Center - Parking Lot Lighting Controls B5.1 None Project 11: Government Center - Wall Wash LED Lighting B5.1 Waste Stream Clause Project 12: Government Center - Domestic Hot...



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

project management activities for both proposed project initiatives. DOE has determined thai impacts related to these tasks will have negligible or no affects on the human and...


Costo del capitale e valutazione del rischio in investimenti in energie rinnovabili: il caso del biogas.  

E-Print Network (OSTI)

??La tesi dopo aver discusso i modelli pi importanti per la stima del costo del capitale, propone l'analisi industriale degli impianti a biogas. La terza (more)

Simonetto, Stefano


Note: This page contains sample records for the topic "mi wi il" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Extraction of tetra-oxo anions into a hydrophobic IL without...  

NLE Websites -- All DOE Office Websites (Extended Search)

T. D. Qadah, and S. L. Garvey Ind. Eng. Chem. Res. 49, 5863-5868 (2010). Find paper at ACS Publications Selected for the ACS Special Virtual Issue on Ionic Liquids (March 2011)....



Office of Legacy Management (LM)

for Resihol Rndioncri.e Mnretil 01 Fonncrv Erili-cd Sites Rcmedinl Acfion Propm and Remote Sqhs Fociliries fnnogc:mwr Progwn Sires, Rev. 2. U.S. Department of Energy,...


'5 ,-62994:'03-6958575:1533-6910950 e-mail: assa-gr@actcom.net.il  

E-Print Network (OSTI)

;-82- -" . . . 40 , , , .ASTM110 . . . .NFPA-12A 34.02.5.: . 5" " " 5. " 1). , 2:1; 12): 110%-60; 125%-10; 13)150%-60; 1,000%-1; 14): 100%. -2 A . . . . " " . . 10, , 25. . -NFPA' ,1220. #12;-71- -" . "9002. . -. 34

Maoz, Shahar


Politics on parade : immigration, ethnicity and national identity in Chicago, IL  

E-Print Network (OSTI)

Parades are many things. They are treasured annual traditions, community gatherings, expressions of identity and pride. Parades interrupt the daily flow of city life, rerouting traffic, crowding sidewalks and public ...

Sengupta, Annis Whitlow



Apr il 11, 1 988 Feasibility Study into the Use of Mechanical Choppers  

E-Print Network (OSTI)

·· Plenum Press (1980). 2. D. Moncton, in "New Rings Ivorkshop," SSRL Report 83-02 (1983). 3. G. K. Shenoy;REFERENCE 1. Go1ovchenko, J. A., in SSRL Report 83/102, ed. K. Cantwell and C. Mitchell, (1983), p. 147. 30

Kemner, Ken


Luciano Floridi Research Fellow del Wolson College e Lecturer in Logic and Epistemology presso il St.  

E-Print Network (OSTI)

a nostra insaputa, mentre i crimini variano dalla pornografia elettronica ai virus, dalla riproduzione

Floridi, Luciano


987 Orrington Road (847) 555-3700 Evanston, IL 60208 b-cats@baxter.org  

E-Print Network (OSTI)

from 82% to 99.7% through enhanced queue design, work flow analysis, phone skills training, and call Results-oriented leader with extensive experience in general management, multi-channel marketing Creation New Market and Product Development General Management, Finance, Operations B-to-B and B

Shull, Kenneth R.


A High-throughput Screening Approach Identifies Selective Regulators of Il12b Transcription  

E-Print Network (OSTI)

TLR4, in contrast to NF-kB and AP-1, whose activities aresignaling pathways, such as NF-kB and MAP kinase pathways,

Doty, Kevin Richard



TREC-Il Routing Experiments with the TRW/Paracel Fast Data ...  

Science Conference Proceedings (OSTI)

... 0 19 12 B~nk Failures 87 151 75 42 2 42 36 S&L Prosecutions 88 32 29 21 0 11 26 Crude Oil Price Trends 89 17 8 2 0 3 7 OPEC Investments 90 ...



Epitaxial Ge/Il-V Heterostructures : MOCVD growth, characterization, and applications  

E-Print Network (OSTI)

Epitaxial Ge thin films are being investigated for many important roles in next generation microelectronics. Metal-oxide-semiconductor field effect transistors (MOSFETs) utilizing Ge channels have demonstrated dramatic ...

Bai, Yu, Ph.D. Massachusetts Institute of Technology



Topological visual navigation in large environments IlPyung Park and John R. Kender  

E-Print Network (OSTI)

a new model for robot navigation in large unstructured environments. Our model consists of two parts. Traversing on a trajectory enables the navigator to move reliably towards a target, based on shapes formed direction follower (navigator). Previous qualitative approaches to robot navigation include: the TOUR model


-i&k'il (uI//X -8^O^O --o ~u^ 1MASTER  

E-Print Network (OSTI)

conducted a variety of R&D projects involving absorption systems, gas-engine-driven systems, Rankine-cycle systems, desiccant systems, ejector systems, etc. Of these, three residential absorption systems made, for a somewhat different application -- gas-fired heat pumps for space heating and cooling. Although

Oak Ridge National Laboratory


Optimization of X-ray Radiographic Imaging Birsen Yazici, Il-Young Son, An Jin  

E-Print Network (OSTI)

- Energy Storage and Organic Photovoltaic Devices - Next-Generation Organic Materials and Device after July 14, 2010. Accommodations Hotels Many comfortable hotels with easy access to the conference venue are located along with the subway lines in Kyoto City. Blocks of rooms at the following hotels

Yazici, Birsen


Proc. of the sixteenth symposium on energy engineering sciences, May 13-15, 1998, Argonne, IL.  

Science Conference Proceedings (OSTI)

This Proceedings Volume includes the technical papers that were presented during the Sixteenth Symposium on Energy Engineering Sciences on May 13--15, 1998, at Argonne National Laboratory, Argonne, Illinois. The Symposium was structured into eight technical sessions, which included 30 individual presentations followed by discussion and interaction with the audience. A list of participants is appended to this volume. The DOE Office of Basic Energy Sciences (BES), of which Engineering Research is a component program, is responsible for the long-term, mission-oriented research in the Department. The Office has prime responsibility for establishing the basic scientific foundation upon which the Nation's future energy options will be identified, developed, and built. BES is committed to the generation of new knowledge necessary to solve present and future problems regarding energy exploration, production, conversion, and utilization, while maintaining respect for the environment. Consistent with the DOE/BES mission, the Engineering Research Program is charged with the identification, initiation, and management of fundamental research on broad, generic topics addressing energy-related engineering problems. Its stated goals are to improve and extend the body of knowledge underlying current engineering practice so as to create new options for enhancing energy savings and production, prolonging the useful life of energy-related structures and equipment, and developing advanced manufacturing technologies and materials processing. The program emphasis is on reducing costs through improved industrial production and performance and expanding the nation's store of fundamental knowledge for solving anticipated and unforeseen engineering problems in energy technologies. To achieve these goals, the Engineering Research Program supports approximately 130 research projects covering a broad spectrum of topics that cut across traditional engineering disciplines. The program focuses on three areas: (1) mechanical sciences, (2) control systems and instrumentation, and (3) engineering data and analysis. The Sixteenth Symposium involved approximately one-fourth of the research projects currently sponsored by the DOE/BES Engineering Research Program.




Better Buildings Neighborhood Program: Communities Throughout Oregon  

NLE Websites -- All DOE Office Websites (Extended Search)

Communities Communities Throughout Oregon to someone by E-mail Share Better Buildings Neighborhood Program: Communities Throughout Oregon on Facebook Tweet about Better Buildings Neighborhood Program: Communities Throughout Oregon on Twitter Bookmark Better Buildings Neighborhood Program: Communities Throughout Oregon on Google Bookmark Better Buildings Neighborhood Program: Communities Throughout Oregon on Delicious Rank Better Buildings Neighborhood Program: Communities Throughout Oregon on Digg Find More places to share Better Buildings Neighborhood Program: Communities Throughout Oregon on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO


Better Buildings Neighborhood Program: Indianapolis, Indiana  

NLE Websites -- All DOE Office Websites (Extended Search)

Indianapolis, Indianapolis, Indiana to someone by E-mail Share Better Buildings Neighborhood Program: Indianapolis, Indiana on Facebook Tweet about Better Buildings Neighborhood Program: Indianapolis, Indiana on Twitter Bookmark Better Buildings Neighborhood Program: Indianapolis, Indiana on Google Bookmark Better Buildings Neighborhood Program: Indianapolis, Indiana on Delicious Rank Better Buildings Neighborhood Program: Indianapolis, Indiana on Digg Find More places to share Better Buildings Neighborhood Program: Indianapolis, Indiana on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC


Better Buildings Neighborhood Program: Fayette County, Pennsylvania  

NLE Websites -- All DOE Office Websites (Extended Search)

Fayette Fayette County, Pennsylvania to someone by E-mail Share Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Facebook Tweet about Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Twitter Bookmark Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Google Bookmark Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Delicious Rank Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Digg Find More places to share Better Buildings Neighborhood Program: Fayette County, Pennsylvania on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO


Better Buildings Neighborhood Program: Better Buildings Partners  

NLE Websites -- All DOE Office Websites (Extended Search)

Better Better Buildings Partners to someone by E-mail Share Better Buildings Neighborhood Program: Better Buildings Partners on Facebook Tweet about Better Buildings Neighborhood Program: Better Buildings Partners on Twitter Bookmark Better Buildings Neighborhood Program: Better Buildings Partners on Google Bookmark Better Buildings Neighborhood Program: Better Buildings Partners on Delicious Rank Better Buildings Neighborhood Program: Better Buildings Partners on Digg Find More places to share Better Buildings Neighborhood Program: Better Buildings Partners on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY


Better Buildings Neighborhood Program: Bainbridge Island, Washington  

NLE Websites -- All DOE Office Websites (Extended Search)

Bainbridge Bainbridge Island, Washington to someone by E-mail Share Better Buildings Neighborhood Program: Bainbridge Island, Washington on Facebook Tweet about Better Buildings Neighborhood Program: Bainbridge Island, Washington on Twitter Bookmark Better Buildings Neighborhood Program: Bainbridge Island, Washington on Google Bookmark Better Buildings Neighborhood Program: Bainbridge Island, Washington on Delicious Rank Better Buildings Neighborhood Program: Bainbridge Island, Washington on Digg Find More places to share Better Buildings Neighborhood Program: Bainbridge Island, Washington on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO


Better Buildings Neighborhood Program: Jacksonville, Florida  

NLE Websites -- All DOE Office Websites (Extended Search)

Jacksonville, Jacksonville, Florida to someone by E-mail Share Better Buildings Neighborhood Program: Jacksonville, Florida on Facebook Tweet about Better Buildings Neighborhood Program: Jacksonville, Florida on Twitter Bookmark Better Buildings Neighborhood Program: Jacksonville, Florida on Google Bookmark Better Buildings Neighborhood Program: Jacksonville, Florida on Delicious Rank Better Buildings Neighborhood Program: Jacksonville, Florida on Digg Find More places to share Better Buildings Neighborhood Program: Jacksonville, Florida on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC