Powered by Deep Web Technologies
Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


VT Nuclear Services ltd | Open Energy Information  

Open Energy Info (EERE)

Login | Sign Up Search Page Edit with form History Facebook icon Twitter icon VT Nuclear Services ltd Jump to: navigation, search Name VT Nuclear Services ltd Place...


Category:Burlington, VT | Open Energy Information  

Open Energy Info (EERE)

VT VT Jump to: navigation, search Go Back to PV Economics By Location Media in category "Burlington, VT" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Burlington VT Central Vermont Pub Serv Corp.png SVFullServiceRestauran... 67 KB SVMidriseApartment Burlington VT Central Vermont Pub Serv Corp.png SVMidriseApartment Bur... 68 KB SVQuickServiceRestaurant Burlington VT Central Vermont Pub Serv Corp.png SVQuickServiceRestaura... 68 KB SVStandAloneRetail Burlington VT Central Vermont Pub Serv Corp.png SVStandAloneRetail Bur... 68 KB SVHospital Burlington VT Central Vermont Pub Serv Corp.png SVHospital Burlington ... 64 KB SVLargeHotel Burlington VT Central Vermont Pub Serv Corp.png SVLargeHotel Burlingto... 63 KB SVLargeOffice Burlington VT Central Vermont Pub Serv Corp.png


VT PowerPoint Template  

NLE Websites -- All DOE Office Websites (Extended Search)

EMBEDDED ACTIVE FIBER OPTIC SENSING EMBEDDED ACTIVE FIBER OPTIC SENSING NETWORK FOR STRUCTURAL HEALTH MONITORING IN HARSH ENVIRONMENTS DE-FE0007405 Anbo Wang, Cheng Ma Virginia Tech Center for Photonics Technology Blacksburg, VA 24061 awang@vt.edu, cma1@vt.edu http://photonics.ece.vt.edu/ 1 Advanced Research Sensor and Controls Project Review Meeting DOE NETL Morgantown, WV 03/12/2012 Outline * Motivation, Overview & Objectives * Background and Fundamentals of Proposed Technology * Project Scope and Work Plan 2 MOTIVATION AND OBJECTIVES 3 Motivation * Non-Destructive Evaluation (NDE) of structural health in advanced energy systems. Examples: * Ultra Supercritical (USC) systems: * Steam temperature 760 o C, pressure 5000 psi. * Integrated Gasification Combined Cycle (IGCC):


VT PowerPoint Template  

NLE Websites -- All DOE Office Websites (Extended Search)

DISTRIBUTED FIBER OPTIC SENSOR FOR DISTRIBUTED FIBER OPTIC SENSOR FOR ON-LINE MONITORING OF COAL GASIFIER REFRACTORY HEALTH DE-FE0005703 Anbo Wang, Cheng Ma Virginia Tech Center for Photonics Technology Blacksburg, VA 24061 awang@vt.edu, cma1@vt.edu http://photonics.ece.vt.edu/ 1 Advanced Research Sensor and Controls Project Review Meeting DOE NETL Morgantown, WV 03/12/2012 Outline * Motivation, Overview & Objectives * Background and Fundamentals of Proposed Technology * Project Scope and Work Plan * Project Progress 2 MOTIVATION AND OBJECTIVES 3 Motivation * Refractory health monitoring in slagging coal gasifiers: * Rapid corrosion of refractory materials. * High-temperature reducing environment. * Difficult to predict remaining refractory life. * Localized thinning, spallation, cracking.


VT PowerPoint Template  

NLE Websites -- All DOE Office Websites (Extended Search)

SINGLE-CRYSTAL SAPPHIRE OPTICAL SINGLE-CRYSTAL SAPPHIRE OPTICAL FIBER SENSOR DE-FC26-99FT40685 Anbo Wang, Gary Pickrell, Ke Wang, Cheng Ma, Brian Scott Virginia Tech Center for Photonics Technology Blacksburg, VA 24061 awang@vt.edu http://photonics.ece.vt.edu/ 1 Advanced Research Sensor and Controls Project Review Meeting DOE NETL Morgantown, WV 03/12/2012 Outline * Motivation & Objective * Background and Fundamentals of Proposed Technology * Project Scope and Work Plan * Project Progress 2 MOTIVATION AND OBJECTIVE 3 Motivation 4 * Temperature sensor for harsh-environments: * Coal gasifier (major focus of prior work). * Gas turbine. * Temperature measurement is critical for: * Gasifier start-up. * Process optimization. * Event/failure detection.


Highgate Springs, VT Natural Gas Liquefied Natural Gas Imports...  

U.S. Energy Information Administration (EIA) Indexed Site

Highgate Springs, VT Natural Gas Liquefied Natural Gas Imports from Canada (Million Cubic Feet) Highgate Springs, VT Natural Gas Liquefied Natural Gas Imports from Canada (Million...


,"North Troy, VT Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Troy, VT Natural Gas Pipeline Imports From Canada (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest Data...


,"Highgate Springs, VT Natural Gas Pipeline Imports From Canada...  

U.S. Energy Information Administration (EIA) Indexed Site

Highgate Springs, VT Natural Gas Pipeline Imports From Canada (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","L...


Hinsdale, NH Wal-Mart's impact on small businesses in Brattleboro, VT : a case study.  

E-Print Network (OSTI)

??The debate over the effects of big box retail on smaller communities is one of the most contentious topics of public planning discourse. Many feel… (more)

Sadlowski, Jin, 1970-



North Troy, VT Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Million Cubic Feet) North Troy, VT Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's...


North Troy, VT Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Dollars per Thousand Cubic Feet) North Troy, VT Natural Gas Pipeline Imports From Canada (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6...


Price of Highgate Springs, VT Natural Gas LNG Imports from Canada...  

Annual Energy Outlook 2012 (EIA)

Springs, VT Natural Gas LNG Imports from Canada (Dollars per Thousand Cubic Feet) Price of Highgate Springs, VT Natural Gas LNG Imports from Canada (Dollars per Thousand...


NREL: Wind Research - Ventera's VT 10 Turbine Testing and Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Ventera's VT 10 Turbine Testing and Results Ventera's VT 10 Turbine Testing and Results Ventera's VT10 wind turbine. Text Version As part of the National Renewable Energy Laboratory and U.S. Department of Energy (NREL/DOE) Independent Testing project, NREL is testing Ventera's VT10 small wind turbine at the National Wind Technology Center (NWTC). The VT10 is a horizontal-axis downwind, three-bladed turbine rated at 10 kilowatts (kW). Its diameter is 6.7 meters, and it is mounted on a lattice tower with a hub height of 21.7 meters. The VT10 uses a single-phase, grid-connected, permanent-magnet generator that operates at 240 volts AC. Testing Summary The summary of the tests is listed below, along with the final reports. Cumulative Energy Production 3/22/2010: 0; 3/29/2010: 26; 3/31/2010: 74; 4/1/2010: 75; 4/2/2010: 174;



NLE Websites -- All DOE Office Websites (Extended Search)

VrnVtR^iTY OF CALIFOKKIA VrnVtR^iTY OF CALIFOKKIA L a w r e n c s BadidUon L a b o r a t o r y B e r k e l e y , Calift^raia Contract rto "*'-740n-.e,ig~48 THE EARLY ANJ'IPROTON WORK Owen GharBDeriair. DecetDfter 15, 195.9 L i G A L N O T I C E - This report was prepared as an account ot <: I nor any person acUng on beliflU of the C DISCLAIMER This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency Thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights. Reference herein to any specific commercial product,


Duration Test Report for the Ventera VT10 Wind Turbine  

DOE Green Energy (OSTI)

This project was established to help reduce the barriers of wind energy expansion by providing independent testing results for small wind turbines. Five turbines were tested at the National Wind Technology Center (NWTC) at the National Renewable Energy Laboratory (NREL) as a part of round one of this project. Duration testing is one of up to five tests that may be performed on the turbines, including power performance, safety and function, noise, and power quality. Test results will provide manufacturers with reports that can be used to fulfill part of the requirements for small wind turbine certification. The test equipment included a grid-connected Ventera Energy Corporation VT10 wind turbine mounted on an 18.3-m (60-ft) self-supporting lattice tower manufactured by Rohn.

Smith, J.; Huskey, A.; Jager, D.; Hur, J.



Wind Turbine Generator System Safety and Function Test Report for the Ventera VT10 Wind Turbine  

DOE Green Energy (OSTI)

This report summarizes the results of a safety and function test that NREL conducted on the Ventera VT10 wind turbine. This test was conducted in accordance with the International Electrotechnical Commissions' (IEC) standard, Wind Turbine Generator System Part 2: Design requirements for small wind turbines, IEC 61400-2 Ed.2.0, 2006-03.

Smith, J.; Huskey, A.; Jager, D.; Hur, J.



Category:Concord, NH | Open Energy Information  

Open Energy Info (EERE)

Go Back to PV Economics By Location Go Back to PV Economics By Location Media in category "Concord, NH" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Concord NH Public Service Co of NH.png SVFullServiceRestauran... 74 KB SVHospital Concord NH Public Service Co of NH.png SVHospital Concord NH ... 75 KB SVLargeHotel Concord NH Public Service Co of NH.png SVLargeHotel Concord N... 74 KB SVLargeOffice Concord NH Public Service Co of NH.png SVLargeOffice Concord ... 76 KB SVMediumOffice Concord NH Public Service Co of NH.png SVMediumOffice Concord... 74 KB SVMidriseApartment Concord NH Public Service Co of NH.png SVMidriseApartment Con... 71 KB SVOutPatient Concord NH Public Service Co of NH.png SVOutPatient Concord N... 72 KB SVPrimarySchool Concord NH Public Service Co of NH.png



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

)'vtAHAGEMENT CENTER )'vtAHAGEMENT CENTER NEPA DETERl\ifINATION RECIPIENT:Colorado School of Mines Page 1 of2 STATE: CO PROJECT TITLE: Joint Inversion of Electrical and Seismic data for Fracture Characterization and Imaging of Fluid Flow in Geotllermal Systems Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE·PS36·08G098008 . DE·FG36·08G018195 GFO·G018195·002 0 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply



NLE Websites -- All DOE Office Websites (Extended Search)

- Grand Station Foyer Continental Breakfast - Grand Station iii PoSt-CoMbuStion MeMbrane-baS Moderator - Jos Figueroa, U.S. Department of Energy, National Energy Techno tueSday,...


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...

Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


Updated 6/10 Volunteer NH!  

E-Print Network (OSTI)

Plant a garden 5 Hitchcock Hall Durham, NH 03824 Marianne Fortescue, Coordinator 603-862-2197 marianne.fortescue

Pohl, Karsten


DOE - Office of Legacy Management -- R Brew Co - NH 01  

NLE Websites -- All DOE Office Websites (Extended Search)

R Brew Co - NH 01 R Brew Co - NH 01 FUSRAP Considered Sites Site: R. BREW CO. (NH.01 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Concord , New Hampshire NH.01-1 Evaluation Year: 1994 NH.01-2 Site Operations: Conducted vacuum furnace tests using uranium and copper billets. NH.01-1 NH.01-3 Site Disposition: Eliminated - Potential for contamination remote NH.01-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium NH.01-1 NH.01-3 Radiological Survey(s): Yes - radiological monitoring during operations NH.01-3 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to R. BREW CO. NH.01-1 - Memorandum/Checklist; Landis to File; Subject: R. Brew


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed



NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


NH House Committee_April27 2005  

NLE Websites -- All DOE Office Websites (Extended Search)

Mercury Control Mercury Control Technology R&D Program for Coal-Fired Boilers Working Session of the New Hampshire House Science, Technology, & Energy Committee April 26, 2005 Concord, New Hampshire Thomas J. Feeley, III thomas.feeley@netl.doe.gov National Energy Technology Laboratory NH House Committee_April 2005 Mercury Control Technology Field Testing Program Performance/Cost Objectives * Have technologies ready for commercial demonstration by 2007 for all coals * Reduce "uncontrolled" Hg emissions by 50-70% * Reduce cost by 25-50% compared to baseline cost estimates Baseline Costs: $50,000 - $70,000 / lb Hg Removed 2000 Year Cost NH House Committee_April 2005 Stages of Mercury Control Technology Development DOE RD&D Model Lab/Bench/Pilot-Scale Testing Field Testing



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

S S . DEPART]\.1ENT OF ENERGY EERE PROJECT T'....IANACiE!vtENT CENTER NEPA DETERl\HNATION RECI PI ENT:Amonix, Inc. STATE: CA PROJECT Low Cost High Concentration Photovoltaic Power Systems for Utility Power Generation - Sandia site TITLE: Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-PS36-06G 096034 DE-FC36-07G017042 GFO-G017042-006 G017042 Based on my review of the information concerning the proposed action, as N EPA Compliance Officer (authorized under DOE Order 451.1 A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation , and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab


Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


,"Pittsburg, NH Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Pittsburg, NH Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


NH Clean Power Act (New Hampshire) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NH Clean Power Act (New Hampshire) NH Clean Power Act (New Hampshire) NH Clean Power Act (New Hampshire) < Back Eligibility Agricultural Commercial Industrial Investor-Owned Utility Municipal/Public Utility Utility Savings Category Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making Electricity Water Home Weatherization Solar Wind Program Info State New Hampshire Program Type Environmental Regulations Provider NH Department of Environmental Services The Act calls for annual reductions of multiple pollutants, including SO2, Nox, CO2, and mercury. The Act calls for an 87% reduction in SO2 emissions and a 70% reduction in Nox emissions from 1999 levels. CO2 emissions are to be reduced to 1990 levels by the end of 2006. Act is implemented under NH Rules Env-A 2900. This act applies specifically to three existing fossil


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mäkinen; Jorma Tarhio



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Public Service Co of NH | Open Energy Information  

Open Energy Info (EERE)

NH NH (Redirected from PSNH) Jump to: navigation, search Name Public Service Co of NH Place New Hampshire Service Territory New Hampshire Website www.psnh.com Green Button Landing Page www.psnh.com/SaveEnergyMo Green Button Reference Page www.psnh.com/SaveEnergyMo Green Button Implemented Yes Utility Id 15472 Utility Location Yes Ownership I NERC Location NPCC NERC NPCC Yes ISO NE Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Activity Retail Marketing Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections



Gasoline and Diesel Fuel Update (EIA)



Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...



Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...



Gasoline and Diesel Fuel Update (EIA)




Annual Energy Outlook 2012 (EIA)



U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)



Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


The Institute for Critical Technology and Applied Science at Virginia Tech supports and promotes cutting-edge research at the intersection of engineering, science, and medicine. Please visit www.ictas.vt.edu.  

E-Print Network (OSTI)

.ictas.vt.edu. Fuel Cell Research A Focus Area within the ICTAS Sustainable Energy Thrust Mission The mission cell technology to help meet society's energy needs. Technical Approach At its core, a fuel cell employees, students, or applicants for admission or employment on the basis of race, gender, disability, age

Beex, A. A. "Louis"


Public Service Co of NH | Open Energy Information  

Open Energy Info (EERE)

Name Public Service Co of NH Name Public Service Co of NH Place New Hampshire Service Territory New Hampshire Website www.psnh.com Green Button Landing Page www.psnh.com/SaveEnergyMo Green Button Reference Page www.psnh.com/SaveEnergyMo Green Button Implemented Yes Utility Id 15472 Utility Location Yes Ownership I NERC Location NPCC NERC NPCC Yes ISO NE Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Activity Retail Marketing Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now!

Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


Characterization of the selective reduction of NO by NH/sub 3/  

Science Conference Proceedings (OSTI)

The selective reduction of NO by NH/sub 3/ addition has been studied in a lean-burning oil-fired laboratory combustion tunnel as a function of equivalence ratio, NH/sub 3/ injection temperature, concentration of NH/sub 3/ added, and the source of NO. Ammonia breakthrough was found to depend strongly on the NH/sub 3/ addition temperature. The total concentration of nitrogen containing species other N/sub 2/, NO, and NH/sub 3/ was measured with a variety of techniques and was found to be less than 5 ppM over the range of conditions studied.

Lucas, D.; Brown, N.J.



DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


VT PowerPoint Template  

NLE Websites -- All DOE Office Websites (Extended Search)

DISTRIBUTED FIBER OPTIC SENSOR FOR ON-LINE MONITORING OF COAL GASIFIER REFRACTORY HEALTH DE-FE0005703 Anbo Wang, Cheng Ma Virginia Tech Center for Photonics Technology Blacksburg,...



NLE Websites -- All DOE Office Websites (Extended Search)

DataTechnologySpecificUnitedStatesWindHighResolutionVermontWindHighResolution.zip> Description: Abstract: Annual average wind resource potential for the state of Vermont...


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Page 1 of 7 2013 NH 4-H HORSE QUIZ BOWL  

E-Print Network (OSTI)

at http://extension.unh.edu/4H/NH4-HHorseProject.htm or by sending an Excel document to Rhiannon.Beauregard

New Hampshire, University of


Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Microsoft Word - figure_8.doc  

Gasoline and Diesel Fuel Update (EIA)


Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.




E-Print Network (OSTI)

and Maloney, K.L. , "NOx Reduction with Ammonia: Laboratoryand Hashizawa, K. , "Reduction of NOx in Combustion ExhaustSelective Noncatalytic Reduction of NOx with NH3," EPRI NOx

Brown, N.J.



OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


Thermal Durability of Cu-CHA NH3-SCR Catalysts for Diesel NOx Reduction  

SciTech Connect

Multiple catalytic functions (NOx conversion, NO and NH3 oxidation, NH3 storage) of a commercial Cu-zeolite urea/NH3-SCR catalyst were assessed in a laboratory fixed-bed flow reactor system after differing degrees of hydrothermal aging. Catalysts were characterized by using x-ray diffraction (XRD), 27Al solid state nuclear magnetic resonance (NMR) and transmission electron microscopy (TEM) / energy dispersive X-ray (EDX) spectroscopy to develop an understanding of the degradation mechanisms during catalyst aging. The catalytic reaction measurements of laboratory-aged catalysts were performed, which allows us to obtain a universal curve for predicting the degree of catalyst performance deterioration as a function of time at each aging temperature. Results show that as the aging temperature becomes higher, the zeolite structure collapses in a shorter period of time after an induction period. The decrease in SCR performance was explained by zeolite structure destruction and/or Cu agglomeration, as detected by XRD/27Al NMR and by TEM/EDX, respectively. Destruction of the zeolite structure and agglomeration of the active phase also results in a decrease in the NO/NH3 oxidation activity and the NH3 storage capacity of the catalyst. Selected laboratory aging conditions (16 h at 800oC) compare well with a 135,000 mile vehicle-aged catalyst for both performance and characterization criteria.

Schmieg, Steven J.; Oh, Se H.; Kim, Chang H.; Brown, David B.; Lee, Jong H.; Peden, Charles HF; Kim, Do Heui



Photolysis of solid NH{sub 3} and NH{sub 3}-H{sub 2}O mixtures at 193 nm  

SciTech Connect

We have studied UV photolysis of solid ammonia and ammonia-dihydrate samples at 40 K, using infrared spectroscopy, mass spectrometry, and microgravimetry. We have shown that in the pure NH{sub 3} sample, the main species ejected are NH{sub 3}, H{sub 2}, and N{sub 2}, where the hydrogen and nitrogen increase with laser fluence. This increase in N{sub 2} ejection with laser fluence explains the increase in mass loss rate detected by a microbalance. In contrast, for the ammonia-water mixture, we see very weak signals of H{sub 2} and N{sub 2} in the mass spectrometer, consistent with the very small mass loss during the experiment and with a <5% decrease in the NH{sub 3} infrared absorption bands spectroscopy after a fluence of {approx}3 x 10{sup 19} photons/cm{sup 2}. The results imply that ammonia-ice mixtures in the outer solar system are relatively stable under solar irradiation.

Loeffler, M. J. [Astrochemistry Laboratory, NASA Goddard Space Flight Center, Code 691, Greenbelt, Maryland 20771 (United States); Laboratory for Atomic and Surface Physics, Engineering Physics, University of Virginia, Charlottesville, Virginia 22904 (United States); Baragiola, R. A. [Laboratory for Atomic and Surface Physics, Engineering Physics, University of Virginia, Charlottesville, Virginia 22904 (United States)



Grants to Help N.H. Towns Conserve Energy | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Grants to Help N.H. Towns Conserve Energy Grants to Help N.H. Towns Conserve Energy Grants to Help N.H. Towns Conserve Energy March 19, 2010 - 4:17pm Addthis New Hampshire has a plan to lower expenses and create jobs, all while conserving energy. In all, the state has received $17.3 million in Energy Efficiency and Conservation Block Grant (EECBG) funding. Of that, $9.6 million has been sent to the New Hampshire Office of Energy and Planning (NHOEP) to launch several energy saving projects. NHOEP established a subgrant program to award $6.6 million of the EECBG grant funding to local municipalities and counties. New Hampshire municipalities and counties submitted over 270 applications, totaling over $21 million in grant requests. "Substantial energy efficiency improvements will be made throughout the


Grants to Help N.H. Towns Conserve Energy | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Grants to Help N.H. Towns Conserve Energy Grants to Help N.H. Towns Conserve Energy Grants to Help N.H. Towns Conserve Energy March 19, 2010 - 4:17pm Addthis New Hampshire has a plan to lower expenses and create jobs, all while conserving energy. In all, the state has received $17.3 million in Energy Efficiency and Conservation Block Grant (EECBG) funding. Of that, $9.6 million has been sent to the New Hampshire Office of Energy and Planning (NHOEP) to launch several energy saving projects. NHOEP established a subgrant program to award $6.6 million of the EECBG grant funding to local municipalities and counties. New Hampshire municipalities and counties submitted over 270 applications, totaling over $21 million in grant requests. "Substantial energy efficiency improvements will be made throughout the


Synthesis and Characterization of Th2N2(NH) Isomorphous to Th2N3  

SciTech Connect

Using a new, low-temperature, fluoride-based process, thorium nitride imide of the chemical formula Th{sub 2}N{sub 2}(NH) was synthesized from thorium dioxide via an ammonium thorium fluoride intermediate. The resulting product phase was characterized by powder X-ray diffraction (XRD) analysis and was found to be crystallographically similar to Th{sub 2}N{sub 3}. Its unit cell was hexagonal with a space group of P3m{bar 1} and lattice parameters of a = b = 3.886(1) and c = 6.185(2) {angstrom}. The presence of -NH in the nitride phase was verified by Fourier transform infrared spectroscopy (FTIR). Total energy calculations performed using all-electron scalar relativistic density functional theory (DFT) showed that the hydrogen atom in the Th{sub 2}N{sub 2}(NH) prefers to bond with nitrogen atoms occupying 1a Wyckoff positions of the unit cell. Lattice fringe disruptions observed in nanoparticle areas of the nitride species by high-resolution transmission electron microscopic (HRTEM) images also displayed some evidence for the presence of -NH group. As ThO{sub 2} was identified as an impurity, possible reaction mechanisms involving its formation are discussed.

Silva, G W Chinthaka M [ORNL; Yeamans, Charles B. [University of California, Berkeley; Hunn, John D [ORNL; Sattelberger, Alfred P [Argonne National Laboratory (ANL); Czerwinski, Ken R. [University of Nevada, Las Vegas; Weck, Dr. Phil F [University of Nevada, Las Vegas



Page 1 of 16 2013 NH 4-H Horse Quiz Bowl  

E-Print Network (OSTI)

: 9:00 AM to 5:00 PM Location: Belmont Middle School, 38 School Street, Belmont NH 03220 Deadline Quiz Bowl is an event where youth demonstrate their knowledge of equine science in a contest similar to high school quiz bowls. Teams of four race to hit their buzzers and answer equine-related questions

New Hampshire, University of



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....


Page 1 of 16 2014 NH 4-H Horse Quiz Bowl  

E-Print Network (OSTI)

their knowledge of equine science in a contest similar to high school quiz bowls. Teams of four race to hitPage 1 of 16 2014 NH 4-H Horse Quiz Bowl Date: Saturday January 25, 2014 Time: 9:00 AM to 5:00 PM the day of the contest. The New Hampshire 4-H Quiz Bowl is an event where youth demonstrate

New Hampshire, University of


Highgate Springs, VT LNG Imports from Canada  

U.S. Energy Information Administration (EIA) Indexed Site

Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011 2012 View History Pipeline Volumes 8,021 8,106 9,319 8,895...


VT PowerPoint Template2  

NLE Websites -- All DOE Office Websites (Extended Search)

injection site * Determine optimal sensor array Aneth - Reservoir Information * Aneth oil field, discovered in 1956 * Limestone * Permeability: 3-30 mD * Porosity: 10.2% *...


Theoretical Investigations on the Formation and Dehydrogenation Reaction Pathways of H(NH2BH2)nH (n=1-4) Oligomers: Importance of Dihydrogen Interactions (DHI)  

DOE Green Energy (OSTI)

The H(NH2BH2)nH oligomers are possible products from dehydrogenation of ammonia borane (NH3BH3) and ammonium borohydride (NH4BH4), which belong to a class of boron-nitrogen-hydrogen (BNHx) compounds that are promising materials for chemical hydrogen storage. Understanding the kinetics and reaction pathways of formation of these oligomers and their further dehydrogenation is essential for developing BNHx-based hydrogen storage materials. We have performed computational modeling using density functional theory (DFT), ab initio wavefunction theory, and Car-Parrinello molecular dynamics (CPMD) simulations on the energetics and formation pathways for the H(NH2BH2)nH (n=1-4) oligomers, polyaminoborane (PAB), from NH3BH3 monomers and the subsequent dehydrogenation steps to form polyiminoborane (PIB). Through transition state searches and evaluation of the intrinsic reaction coordinates, we have investigated the B-N bond cleavage, the reactions of NH3BH3 molecule with intermediates, dihydrogen release through intra- and intermolecular hydrogen transfer, dehydrocoupling/cyclization of the oligomers, and the dimerization of NH3BH3 molecules. We discovered the formation mechanism of H(NH2BH2)n+1H oligomers through reactions of the H(NH2BH2)nH oligomers first with BH3 followed by reactions with NH3 and the release of H2, where the BH3 and NH3 intermediates are formed through dissociation of NH3BH3. We also found that the dimerization of the NH3BH3 molecules to form c-(NH2BH2)2 is slightly exothermic, with an unexpected transition state that leads to the simultaneous release of two H2 molecules. The dehydrogenations of the oligomers are also exothermic, typically by less than 10 kcal/(mol of H2), with the largest exothermicity for n=3. The transition state search shows that the one-step direct dehydrocoupling cyclization of the oligomers is not a favored pathway because of high activation barriers. The dihydrogen bonding, in which protic (HN) hydrogens interact with hydridic (HB) hydrogens, plays a vital role in stabilizing different structures of the reactants, transition states, and products. The dihydrogen interaction (DHI) within the -BH2(?2-H2) moiety accounts for both the formation mechanisms of the oligomers and for the dehydrogenation of ammonia borane. Support was provided from the U.S. Department of Energy, Office of Basic Energy Sciences, Chemical Sciences Division and from the U.S. Department of Energy, Energy Efficiency and Renewable Energy, Chemical Hydrogen Storage Center of Excellence. Pacific Northwest National Laboratory is operated by Battelle for the US Department of Energy.

Li, Jun; Kathmann, Shawn M.; Hu, Han-Shi; Schenter, Gregory K.; Autrey, Thomas; Gutowski, Maciej S.




SciTech Connect

We present the results of a Nobeyama 45 m H{sub 2}O maser and NH{sub 3} survey of all 94 northern GLIMPSE extended green objects (EGOs), a sample of massive young stellar objects (MYSOs) identified based on their extended 4.5 {mu}m emission. We observed the NH{sub 3}(1,1), (2,2), and (3,3) inversion lines, and detected emission toward 97%, 63%, and 46% of our sample, respectively (median rms {approx} 50 mK). The H{sub 2}O maser detection rate is 68% (median rms {approx} 0.11 Jy). The derived H{sub 2}O maser and clump-scale gas properties are consistent with the identification of EGOs as young MYSOs. To explore the degree of variation among EGOs, we analyze subsamples defined based on mid-infrared (MIR) properties or maser associations. H{sub 2}O masers and warm dense gas, as indicated by emission in the higher-excitation NH{sub 3} transitions, are most frequently detected toward EGOs also associated with both Class I and II CH{sub 3}OH masers. Ninety-five percent (81%) of such EGOs are detected in H{sub 2}O (NH{sub 3}(3,3)), compared to only 33% (7%) of EGOs without either CH{sub 3}OH maser type. As populations, EGOs associated with Class I and/or II CH{sub 3}OH masers have significantly higher NH{sub 3} line widths, column densities, and kinetic temperatures than EGOs undetected in CH{sub 3}OH maser surveys. However, we find no evidence for statistically significant differences in H{sub 2}O maser properties (such as maser luminosity) among any EGO subsamples. Combining our data with the 1.1 mm continuum Bolocam Galactic Plane Survey, we find no correlation between isotropic H{sub 2}O maser luminosity and clump number density. H{sub 2}O maser luminosity is weakly correlated with clump (gas) temperature and clump mass.

Cyganowski, C. J. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States)] [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Koda, J.; Towers, S.; Meyer, J. Donovan [Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794 (United States)] [Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794 (United States); Rosolowsky, E. [Department of Physics and Astronomy, University of British Columbia, Okanagan, Kelowna BC V1V 1V7 (Canada)] [Department of Physics and Astronomy, University of British Columbia, Okanagan, Kelowna BC V1V 1V7 (Canada); Egusa, F. [Institute of Space and Astronautical Science, Japan Aerospace Exploration Agency, Chuo-ku, Sagamihara, Kanagawa 252-5210 (Japan)] [Institute of Space and Astronautical Science, Japan Aerospace Exploration Agency, Chuo-ku, Sagamihara, Kanagawa 252-5210 (Japan); Momose, R. [Department of Astronomy, University of Tokyo, Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan)] [Department of Astronomy, University of Tokyo, Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Robitaille, T. P., E-mail: ccyganowski@cfa.harvard.edu [Max Planck Institute for Astronomy, Heidelberg (Germany)



miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li


Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


[(CH3)4N][(C5H5NH)0.8((CH3)3NH)0.2]U2Si9O23F4 (USH-8): An Organically Templated Open-Framework Uranium Silicate  

E-Print Network (OSTI)

-Framework Uranium Silicate Xiqu Wang, Jin Huang, and Allan J. Jacobson* Department of Chemistry, Uni pyramids we obtained also a number of open-framework uranium silicates.18,19 These new compounds were-framework uranium fluorosilicate [(CH3)4N][(C5H5NH)0.8((CH3)3NH)0.2]U2Si9O23F4 (USH- 8) that has been synthesized

Wang, Xiqu


Ammonia as a hydrogen energy-storage medium. [LH/sub 2/, MeOH, and NH/sub 3/  

DOE Green Energy (OSTI)

Liquid Hydrogen (LH/sub 2/), Methanol (MeOH), and Ammonia (NH/sub 3/) are compared as hydrogen energy-storage media on the basis of reforming the MeOH to produce H/sub 2/ and dissociating (cracking) the NH/sub 3/ to release H/sub 2/. The factors important in this storage concept are briefly discussed. Results of the comparison show that, in terms of energy input for media manufacture from natural gas, hydrogen energy content of the medium, and energy cost ($/10/sup 6/ Btu), NH/sub 3/ has a wide advantage and comes the closest to matching gasoline. The tasks required in developing a safe and practicial hydrogen energy-storage system based on the storage and cracking of NH/sub 3/ are listed. Results of the technical and economic evaluation of this concept will provide the basis for continued development.

Strickland, G



Metallicity of InN and GaN surfaces exposed to NH{sub 3}.  

Science Conference Proceedings (OSTI)

A systematic study of energies and structures of InN and GaN (0001) surfaces exposed to NH{sub 3} and its decomposition products was performed with first-principles methods. A phenomenological model including electron counting contributions is developed based on calculated DFT energies and is used to identify low-energy structures. These predictions are checked with additional DFT calculations. The equilibrium phase diagrams are found to contain structures that violate the electron counting rule. Densities of states for these structures indicate n-type conductivity, consistent with available experimental results.

Walkosz, W.; Zapol, P.; Stephenson, G. B. (Materials Science Division)



Quasielastic neutron scattering of -NH3 and -BH3 rotational dynamics in orthorhombic ammonia borane  

Science Conference Proceedings (OSTI)

Neutrons scattering techniques are ideally suited to directly probe H in materials due to the large incoherent scattering cross-section of hydrogen atom, and have been invaluable in providing direct insight into the local fluctuations and large amplitude motions in AB. Dihydrogen bonding may have a significant affect on materials to be used to store hydrogen for fuel-cell powered applications. We have noticed a trend of low temperature release of H2 in materials composed of hydridic and protonic hydrogen. This phenomenon has caught our attention and motivated our interest to gain more insight into dihydrogen bonding interactions in AB. We present results from a thorough Quasielastic Neutron Scattering (QENS) investigation of diffusive hydrogen motion in NH311BH3 and ND311BH3 to obtain (1) a direct measure of the rotational energy barriers the protonated species and (2) a confirmation of the 3-site jump model for rotational motion. The amplitude of the energy barrier of rotation of BH3 and NH3 determined by QENS are compared to those determined for BD3 and ND3 determined by 2H NMR studies.

Hess, Nancy J.; Hartman, Michael R.; Brown, Craig; Mamontov, Eugene; Karkamkar, Abhijeet J.; Heldebrant, David J.; Daemen, Luke L.; Autrey, Thomas



Herschel / HIFI observations of CO, H2O and NH3 in Mon R2  

E-Print Network (OSTI)

Context. Mon R2 is the only ultracompact HII region (UCHII) where the associated photon-dominated region (PDR) can be resolved with Herschel. Due to its brightness and proximity, it is the best source to investigate the chemistry and physics of highly UV-irradiated PDRs. Aims. Our goal is to estimate the abundance of H2O and NH3 in this region and investigate their origin. Methods. We present new observations obtained with HIFI and the IRAM-30m telescope. Using a large velocity gradient approach, we model the line intensities and derive an average abundance of H2O and NH3 across the region. Finally, we model the line profiles with a non-local radiative transfer model and compare these results with the abundance predicted by the Meudon PDR code. Results. The variations of the line profiles and intensities indicate complex geometrical and kinematical patterns. The H2O lines present a strong absorption at the ambient velocity and emission in high velocity wings towards the HII region. The spatial distribution of...

Pilleri, P; Cernicharo, J; Ossenkopf, V; Berné, O; Gerin, M; Pety, J; Goicoechea, J R; Rizzo, J R; Montillaud, J; González-García, M; Joblin, C; Bourlot, J Le; Petit, F Le; Kramer, C



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)



Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Growth kinetics and micromorphology of NH{sub 4}Cl:Mn{sup 2+} crystals formed in the NH{sub 4}Cl-MnCl{sub 2}-H{sub 2}O-CONH{sub 3} system  

Science Conference Proceedings (OSTI)

The growth kinetics and elementary growth processes on the surface of NH{sub 4}Cl:Mn{sup 2+} heterogeneous crystals formed in the NH{sub 4}Cl-MnCl{sub 2}-H{sub 2}O-CONH{sub 3} system are experimentally studied. It is found that a change in the composition of complexes in an NH{sub 4}Cl crystal from Mn(NH{sub 4}){sub 2}Cl{sub 4} {center_dot} 2H{sub 2}O to MnCl{sub 2} {center_dot} 2CONH{sub 3} leads to the occurrence of a local maximum in the kinetic curve and a change in the shape of dislocation growth centers from flat to conical. The growth kinetics of {l_brace}100{r_brace} faces of heterogeneous NH{sub 4}Cl:Mn{sup 2+} crystals is described within the Bliznakov model using the Fowler-Guggenheim adsorption isotherm, which takes into account the lateral interaction of adsorbed particles.

Pyankova, L. A., E-mail: lyuba_pyan@mail.ru; Punin, Yu. O.; Bocharov, S. N.; Shtukenberg, A. G. [Petersburg State University (Russian Federation)




National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Verification of Allowable Stresses In ASME Section III Subsection NH For Grade 91 Steel & Alloy 800H  

Science Conference Proceedings (OSTI)

The database for the creep-rupture of 9Cr-1Mo-V (Grade 91) steel was collected and reviewed to determine if it met the needs for recommending time-dependent strength values, S{sub t}, for coverage in ASME Section III Subsection NH (ASME III-NH) to 650 C (1200 F) and 600,000 hours. The accumulated database included over 300 tests for 1% total strain, nearly 400 tests for tertiary creep, and nearly 1700 tests to rupture. Procedures for analyzing creep and rupture data for ASME III-NH were reviewed and compared to the procedures used to develop the current allowable stress values for Gr 91 for ASME II-D. The criteria in ASME III-NH for estimating S{sub t} included the average strength for 1% total strain for times to 600,000 hours, 80% of the minimum strength for tertiary creep for times to 600,000 hours, and 67% of the minimum rupture strength values for times to 600,000 hours. Time-temperature-stress parametric formulations were selected to correlate the data and make predictions of the long-time strength. It was found that the stress corresponding to 1% total strain and the initiation of tertiary creep were not the controlling criteria over the temperature-time range of concern. It was found that small adjustments to the current values in III-NH could be introduced but that the existing values were conservative and could be retained. The existing database was found to be adequate to extend the coverage to 600,000 hours for temperatures below 650 C (1200 F).

R. W. Swindeman; M. J. Swindeman; B. W. Roberts; B. E. Thurgood; D. L. Marriott



Effect of sulfated CaO on NO reduction by NH{sub 3} in the presence of excess oxygen  

Science Conference Proceedings (OSTI)

The effect of sulfated CaO on NO reduction by NH{sub 3} in the presence of excess oxygen was investigated to evaluate the potential of simultaneous SO{sub 2} and NO removal at the temperature range of 700-850{sup o}C. The physical and chemical properties of the CaO sulfation products were analyzed to investigate the NO reduction mechanism. Experimental results showed that sulfated CaO had a catalytic effect on NO reduction by NH{sub 3} in the presence of excess O{sub 2} after the sulfation reaction entered the transition control stage. With the increase of CaO sulfation extent in this stage, the activity for NO reduction first increased and then decreased, and the selectivity of NH{sub 3} for NO reduction to N{sub 2} increased. The byproduct (NO{sub 2} and N{sub 2}O) formation during NO reduction experiments was negligible. X-ray photoelectron spectroscopy (XPS) analysis showed that neither CaSO{sub 3} nor CaS was detected, indicating that the catalytic activity of NO reduction by NH{sub 3} in the presence of excess O{sub 2} over sulfated CaO was originated from the CaSO{sub 4} product. These results revealed that simultaneous SO{sub 2} and NOx control by injecting NH{sub 3} into the dry flue gas desulfurization process for NO reduction might be achieved. 38 refs., 6 figs., 1 tab.

Tianjin Li; Yuqun Zhuo; Yufeng Zhao; Changhe Chen; Xuchang Xu [Tsinghua University, Beijing (China). Key Laboratory for Thermal Science and Power Engineering of Ministry of Education



Plasma-sprayed semiconductor electrodes: Photoelectrochemical characterization and NH sub 3 photoproduction by substoichiometric tungsten oxides  

Science Conference Proceedings (OSTI)

Two substoichiometric tungsten oxide coatings have been obtained by plasma spray of WO{sub 3} powder on Ti substrates. The films are 40 {plus minus} 20 {mu}m thick and are yellow (WO{sub 2.99}) or dark blue (WO{sub 2.97}). WO{sub 2.99} coatings show a highly textured surface with a specific area 27.9 times the geometrical one. X-ray diffraction pattern reveals that their structure is a mixture of monoclinic and triclinic phases. The yellow films have been characterized photoelectrochemically in regenerative cells by using O{sub 2}/H{sub 2}O redox at pH 2.0. Under anodic polarization of 1.5 V (SCE) their quantum yield is between 10% and 20% in the wavelength range comprised between 270 and 430 nm with an indirect bandgap of 2.55 eV and a flatband potential of {minus}0.1 V. WO{sub 2.99} films have been tested for NH{sub 3} photoproduction.

Ladouceur, M.; Dodelet, J.P. (INRS-Energie, Varennes, Quebec (Canada)); Tourillon, G. (Universite Paris-Sud, Orsay (France)); Parent, L.; Dallaire, S. (IGM, Boucherville, Quebec (Canada))



NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

VT, and MI A Comprehensive Investigation of Unsteady Reciprocating Effects on Near-Wall Heat Transfer in Engines The objective of the proposed project is to use collaborative...


Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



Capacitive deionization of NH{sub 4}CIO{sub 4} solutions with carbon aerogel electrodes. Revision 1  

Science Conference Proceedings (OSTI)

A process for capacitive deionization of water with a stack of carbon aerogel electrodes was developed. Unlike ion exchange, one of the more conventional deionization processes, no chemicals are required for regeneration of the system; electricity is used instead. An aqueous solution of NH{sub 4}ClO{sub 4} is pumped through the electrochemical cell. After polarization, NH{sub 4}{sup +} and ClO{sub 4}{sup -} ions are removed from the water by the imposed electric field and trapped in the extensive cathodic and anodic double layers. Thsi process produces one stream of purified water and a second stream of concentrate. Effects of cell voltage, salt concentration, and cycling on electrosorption capacity were studied and results reported.

Farmer, J.C.; Fix, D.V.; Mack, G.V.; Pekala, R.W.; Poco, J.F.



A reaction mechanism for titanium nitride CVD from TiCl{sub 4} and NH{sub 3}  

Science Conference Proceedings (OSTI)

A gas-phase and surface reaction mechanism for the CVD of TiN from TiCl{sub 4} and NH{sub 3} is proposed. The only gas-phase process is complex formation, which can compete with deposition. The surface mechanism postulates the stepwise elimination of Cl and H atoms from TiCl{sub 4} and NH{sub 3}, respectively, to form solid TiN and gaseous HCl. The mechanism also accounts for the change in oxidation state of Ti by allowing for liberation of N{sub 2}. Provided that the surface composition is at steady state, the stoichiometry of the overall reaction is reproduced exactly. In addition, the global kinetic law predicted by the mechanism is successfully fit to new deposition data from a rotating disk reactor and is shown to be consistent with literature results.

Larson, R.S.; Allendorf, M.D.


Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural



Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration


Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.



Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."



Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of


UNH Cooperative Extension is an equal opportunity educator and employer, UNH, U.S. Dept. of Agriculture and NH counties cooperating.  

E-Print Network (OSTI)

-up of what you did to Rhiannon Beauregard, 4-H State Program Coordinator. Signature of Applicant Date: Rhiannon Beauregard, 4-H State Program Coordinator Moiles House, 180 Main Street, Durham, NH 03824 Rhiannon.beauregard

New Hampshire, University of


Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office



SciTech Connect

We investigate 35 prestellar cores and 36 protostellar cores in the Perseus molecular cloud. We find a very tight correlation between the physical parameters describing the N{sub 2}H{sup +} and NH{sub 3} gas. Both the velocity centroids and the line widths of N{sub 2}H{sup +} and NH{sub 3} correlate much better than either species correlates with CO, as expected if the nitrogen-bearing species are probing primarily the dense core gas where the CO has been depleted. We also find a tight correlation in the inferred abundance ratio between N{sub 2}H{sup +} and para-NH{sub 3} across all cores, with N(p-NH{sub 3})/N(N{sub 2}H{sup +}) = 22 +- 10. We find a mild correlation between NH{sub 3} (and N{sub 2}H{sup +}) column density and the (sub)millimeter dust continuum derived H{sub 2} column density for prestellar cores, N(p-NH{sub 3})/N(H{sub 2}) {approx}10{sup -8}, but do not find a fixed ratio for protostellar cores. The observations suggest that in the Perseus molecular cloud the formation and destruction mechanisms for the two nitrogen-bearing species are similar, regardless of the physical conditions in the dense core gas. While the equivalence of N{sub 2}H{sup +} and NH{sub 3} as powerful tracers of dense gas is validated, the lack of correspondence between these species and the (sub)millimeter dust continuum observations for protostellar cores is disconcerting and presently unexplained.

Johnstone, Doug; Kirk, Helen [National Research Council Canada, Herzberg Institute of Astrophysics, 5071 West Saanich Road, Victoria, BC V9E 2E7 (Canada); Rosolowsky, Erik [University of British Columbia Okanagan, Kelowna, BC V1V 1V7 (Canada); Tafalla, Mario, E-mail: doug.johnstone@nrc-cnrc.gc.c [Observatorio Astronomico Nacional (IGN), Alfonso XII 3, E-28014 Madrid (Spain)


Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Precios de Gasolina  

NLE Websites -- All DOE Office Websites (Extended Search)

Precios de Gasolina para Ciudades en EEUU Pulse en el mapa para ver los precios de la gasolina en diferentes ciudades de su estado. AK VT ME NH NH MA MA RI CT CT DC NJ DE DE NY WV...



Gasoline and Diesel Fuel Update (EIA)

NOIlVUlSININdV NOIlVWdOdNI AOd3N3 NOIlVUlSININdV NOIlVWdOdNI AOd3N3 ACTO3NH 0661 This publication may be purchased from the Superintendent of Documents, U.S. Government Printing Office. Purchasing in formation for this or other Energy Information Administration (EIA) publications may be obtained from the Government Printing Office or ElA's National Energy Information Center. Questions on energy statistics should be directed to the Center by mail, telephone, or telecommunications device for the hearing impaired. Addresses, telephone numbers, and hours are as follows: National Energy Information Center Energy Information Administration Forrestal Building, Room 1F-048 Washington, DC 20585 (202) 586-8800 Telecommunications Device for the Hearing Impaired Only: (202) 586-1181 8 a.m. - 5 p.m., eastern time, M-F


Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



A model of the gas-phase chemistry of boron nitride CVC from BCl{sub 3} and NH{sub 3}  

Science Conference Proceedings (OSTI)

The kinetics of gas-phase reactions occurring during the CVD of boron nitride (BN) from BCl{sub 3} and NH{sub 3} are investigated using an elementary reaction mechanism whose rate constants were obtained from theoretical predictions and literature sources. Plug-flow calculations using this mechanism predict that unimolecular decomposition of BCl{sub 3} is not significant under typical CVD conditions, but that some NH{sub 3} decomposition may occur, especially for deposition occurring at atmospheric pressure. Reaction of BCl{sub 3} with NH{sub 3} is rapid under CVD conditions and yields species containing both boron and nitrogen. One of these compounds, Cl{sub 2}BNH{sub 2}, is predicted to be a key gas-phase precursor to BN.

Allendorf, M.D.; Melius, C.F.; Osterheld, T.H.




SciTech Connect

Ammonia is a major reservoir of nitrogen atoms in cometary materials. However, detections of ammonia in comets are rare, with several achieved at radio wavelengths. A few more detections were obtained through near-infrared observations (around the 3 {mu}m wavelength region), but moderate relative velocity shifts are required to separate emission lines of cometary ammonia from telluric absorption lines in the 3 {mu}m wavelength region. On the other hand, the amidogen radical (NH{sub 2}-a photodissociation product of ammonia in the coma) also shows rovibrational emission lines in the 3 {mu}m wavelength region. Thus, gas production rates for ammonia can be determined from the rovibrational emission lines of ammonia (directly) and amidogen radical (indirectly) simultaneously in the near-infrared. In this article, we present new fluorescence excitation models for cometary ammonia and amidogen radical in the near-infrared, and we apply these models to the near-infrared high-dispersion spectra of comet C/2004 Q2 (Machholz) to determine the mixing ratio of ammonia to water in the comet. Based on direct detection of NH{sub 3} lines, the mixing ratio of NH{sub 3}/H{sub 2}O is 0.46% {+-} 0.03% in C/2004 Q2 (Machholz), in agreement with other results. The mixing ratio of ammonia determined from the NH{sub 2} observations (0.31%-0.79%) is consistent but has relatively larger error, owing to uncertainty in the photodissociation rates of ammonia. At the present level of accuracy, we confirm that NH{sub 3} could be the sole parent of NH{sub 2} in this comet.

Kawakita, Hideyo [Department of Physics, Faculty of Science, Kyoto Sangyo University, Motoyama, Kamigamo, Kita-ku, Kyoto 603-8555 (Japan); Mumma, Michael J., E-mail: kawakthd@cc.kyoto-su.ac.jp [Solar System Exploration Division, Mailstop 690.3, NASA Godard Space Flight Center, Greenbelt, MD 20771 (United States)



Short-term recovery of NH4-15N applied to a temperate forest inceptisol and ultisol in east Tennessee USA  

Science Conference Proceedings (OSTI)

The short-term fate and retention of ammonium (NH4)-{sup 15}nitrogen (N) applied to two types of forest soils in east Tennessee was investigated. Four ridgetop forests, predominantly oak (Quercus spp.), were studied. Five applications of NH{sub 4}-{sup 15}N tracer were made to the forest floor at 2- to 4-week intervals over a 14-week period in 2004. Nitrogen-15 recovery in the forest floor, fine roots (100 weeks) indicated the forest floor is an effective filter for atmospheric N inputs.

Garten Jr, Charles T [ORNL; Brice, Deanne Jane [ORNL; Todd Jr, Donald E [ORNL



PUBLICATION 460-131 www.ext.vt.edu  

E-Print Network (OSTI)

, but it is similar to that of other coal-mining states in the Appalachian coal region. Modern coal, waste rock, and low-grade coals from run-of-mine coal. Up to 50 percent of the raw, mined product may end up as refuse, particularly when the coal originates from longwall mining operations -- thin

Liskiewicz, Maciej


North Troy, VT Natural Gas Imports by Pipeline from Canada  

Gasoline and Diesel Fuel Update (EIA)

Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 1997 1998 1999 2000 2001 2002 View...


PUBLICATION 420-145 www.ext.vt.edu  

E-Print Network (OSTI)

such functions as sales, distribu- tion, pricing, promotion, products, and many others. Here is an example-satisfying products and services and to price, promote, distribute, and effect exchange of these products generally bring a price premium. Examples of these are specialty hardwood boards for the do

Liskiewicz, Maciej


Highgate Springs, VT Natural Gas Pipeline Imports From Canada...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 7,711 8,136 7,680 8,141 2000's 9,980 7,815 8,421 8,272 8,761 8,392 8,404 8,021 8,106 9,319...


Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 – 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: © 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



Better Buildings Neighborhood Program: San Jose  

NLE Websites -- All DOE Office Websites (Extended Search)

San Jose to San Jose to someone by E-mail Share Better Buildings Neighborhood Program: San Jose on Facebook Tweet about Better Buildings Neighborhood Program: San Jose on Twitter Bookmark Better Buildings Neighborhood Program: San Jose on Google Bookmark Better Buildings Neighborhood Program: San Jose on Delicious Rank Better Buildings Neighborhood Program: San Jose on Digg Find More places to share Better Buildings Neighborhood Program: San Jose on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Jose, California San Jose Leverages Partnerships to Improve Low-Income Households' Energy


Wind Program: Stakeholder Engagement and Outreach  

Wind Powering America (EERE)

Outreach Outreach Printable Version Bookmark and Share The Stakeholder Engagement and Outreach initiative of the U.S. Department of Energy's Wind Program is designed to educate, engage, and enable critical stakeholders to make informed decisions about how wind energy contributes to the U.S. electricity supply. Highlights Resources Wind Resource Maps State Activities What activities are happening in my state? AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Installed wind capacity maps. Features A image of a house with a residential-scale small wind turbine. Small Wind for Homeowners, Farmers, and Businesses Stakeholder Engagement & Outreach Projects


Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012


Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central

Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2007 (Million Cubic Feet) Nigeria Algeria 37,483 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports.


Better Buildings Neighborhood Program: Maine - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- SEP to - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Maine - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Maine - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Maine - SEP on Google Bookmark Better Buildings Neighborhood Program: Maine - SEP on Delicious Rank Better Buildings Neighborhood Program: Maine - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Maine - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Maine - SEP Maine Makes Multifamily Units Energy-Efficient and Cost-Effective


Better Buildings Neighborhood Program: Seattle, Washington  

NLE Websites -- All DOE Office Websites (Extended Search)

Seattle, Seattle, Washington to someone by E-mail Share Better Buildings Neighborhood Program: Seattle, Washington on Facebook Tweet about Better Buildings Neighborhood Program: Seattle, Washington on Twitter Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Google Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Delicious Rank Better Buildings Neighborhood Program: Seattle, Washington on Digg Find More places to share Better Buildings Neighborhood Program: Seattle, Washington on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA


Better Buildings Neighborhood Program: San Diego  

NLE Websites -- All DOE Office Websites (Extended Search)

Diego to Diego to someone by E-mail Share Better Buildings Neighborhood Program: San Diego on Facebook Tweet about Better Buildings Neighborhood Program: San Diego on Twitter Bookmark Better Buildings Neighborhood Program: San Diego on Google Bookmark Better Buildings Neighborhood Program: San Diego on Delicious Rank Better Buildings Neighborhood Program: San Diego on Digg Find More places to share Better Buildings Neighborhood Program: San Diego on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Diego County, California Energy Upgrade California Motivates Home Improvements in San Diego County


Better Buildings Neighborhood Program: Alabama - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Alabama - Alabama - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Alabama - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Alabama - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Google Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Delicious Rank Better Buildings Neighborhood Program: Alabama - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Alabama - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Alabama - SEP Alabama Program Takes a Dual Approach to Energy Efficiency Upgrades


Better Buildings Neighborhood Program: Virginia - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Virginia - Virginia - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Virginia - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Virginia - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Google Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Delicious Rank Better Buildings Neighborhood Program: Virginia - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Virginia - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Virginia - SEP Virginia's Regional Energy Alliances Help Forge a State Program for


Better Buildings Neighborhood Program: Austin, Texas  

NLE Websites -- All DOE Office Websites (Extended Search)

Austin, Texas Austin, Texas to someone by E-mail Share Better Buildings Neighborhood Program: Austin, Texas on Facebook Tweet about Better Buildings Neighborhood Program: Austin, Texas on Twitter Bookmark Better Buildings Neighborhood Program: Austin, Texas on Google Bookmark Better Buildings Neighborhood Program: Austin, Texas on Delicious Rank Better Buildings Neighborhood Program: Austin, Texas on Digg Find More places to share Better Buildings Neighborhood Program: Austin, Texas on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Austin, Texas Austin Energy Accelerates Residential and Multifamily Efficiency Upgrades


Better Buildings Neighborhood Program: Michigan - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Michigan - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Michigan - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Google Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Delicious Rank Better Buildings Neighborhood Program: Michigan - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Michigan - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Michigan - SEP Better Buildings Means Better Business for Michigan


Better Buildings Neighborhood Program: Toledo, Ohio  

NLE Websites -- All DOE Office Websites (Extended Search)

Toledo, Ohio Toledo, Ohio to someone by E-mail Share Better Buildings Neighborhood Program: Toledo, Ohio on Facebook Tweet about Better Buildings Neighborhood Program: Toledo, Ohio on Twitter Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Google Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Delicious Rank Better Buildings Neighborhood Program: Toledo, Ohio on Digg Find More places to share Better Buildings Neighborhood Program: Toledo, Ohio on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Toledo, Ohio A Broad Approach to Energy Efficiency in Northwest Ohio


Regulatory Safety Issues in the Structural Design Criteria of ASME Section III Subsection NH and for Very High Temperatures for VHTR & GEN IV  

Science Conference Proceedings (OSTI)

The objective of this task is to identify issues relevant to ASME Section III, Subsection NH [1], and related Code Cases that must be resolved for licensing purposes for VHTGRs (Very High Temperature Gas Reactor concepts such as those of PBMR, Areva, and GA); and to identify the material models, design criteria, and analysis methods that need to be added to the ASME Code to cover the unresolved safety issues. Subsection NH was originally developed to provide structural design criteria and limits for elevated-temperature design of Liquid Metal Fast Breeder Reactor (LMFBR) systems and some gas-cooled systems. The U.S. Nuclear Regulatory Commission (NRC) and its Advisory Committee for Reactor Safeguards (ACRS) reviewed the design limits and procedures in the process of reviewing the Clinch River Breeder Reactor (CRBR) for a construction permit in the late 1970s and early 1980s, and identified issues that needed resolution. In the years since then, the NRC and various contractors have evaluated the applicability of the ASME Code and Code Cases to high-temperature reactor designs such as the VHTGRs, and identified issues that need to be resolved to provide a regulatory basis for licensing. This Report describes: (1) NRC and ACRS safety concerns raised during the licensing process of CRBR , (2) how some of these issues are addressed by the current Subsection NH of the ASME Code; and (3) the material models, design criteria, and analysis methods that need to be added to the ASME Code and Code Cases to cover unresolved regulatory issues for very high temperature service.

William J. O’Donnell; Donald S. Griffin



Effects of gaseous NH{sub 3} and SO{sub 2} on the concentration profiles of PCDD/F in flyash under post-combustion zone conditions  

Science Conference Proceedings (OSTI)

Highlights: Black-Right-Pointing-Pointer Influence of NH{sub 3} and SO{sub 2} on 2378-PCDD/F in flyash and flue gases was investigated. Black-Right-Pointing-Pointer NH{sub 3} decreased the concentration of PCDD and PCDF by 34-75% in the flyash. Black-Right-Pointing-Pointer NH{sub 3} decreased the concentration of PCDD and PCDF by 21-40% from the flue gases. Black-Right-Pointing-Pointer SO{sub 2} led to 99% PCDD and 93% PCDF reductions in the flyash. Black-Right-Pointing-Pointer SO{sub 2} led to 89% PCDD and 76% PCDF reductions in the flue gases. - Abstract: The influence of gaseous ammonia and sulphur dioxide on the formation of 2378-substituted PCDD/F on a reference flyash from a municipal waste incinerator has been investigated using a laboratory scale fixed-bed reactor. The reference flyash samples (BCR-490) was reacted under a simulated flue gas stream at temperatures of 225 and 375 Degree-Sign C for 96 h. The experiments were carried out in two series: first with simulated flue gas alone, and then with injection of NH{sub 3} or SO{sub 2} gas into the flue gas just before the reactor inlet. It was found that the injection of gaseous ammonia into the flue gas could decrease the concentration of both PCDD and PCDF by 34-75% from the solid phase and by 21-40% from the gas phase. Converting the results to I-TEQ values, it could reduce the total I-TEQ values of PCDD and PCDF in the sum of the flyash and exhaust flue gas by 42-75% and 24-57% respectively. The application of SO{sub 2} led to 99% and 93% reductions in the PCDD and PCDF average congener concentrations, respectively in the solid phase. In the gas phase, the total reductions were 89% and 76% for PCDD and PCDF, respectively. Moreover, addition of SO{sub 2} reduced the total I-TEQ value of PCDD and PCDF in the flyash and exhaust flue gas together by 60-86% and 72-82% respectively. Sulphur dioxide was more effective than ammonia in suppressing PCDD/F formation in flyash under the conditions investigated.

Hajizadeh, Yaghoub; Onwudili, Jude A. [Energy Research Institute, University of Leeds, Leeds LS2 9JT (United Kingdom); Williams, Paul T., E-mail: p.t.williams@leeds.ac.uk [Energy Research Institute, University of Leeds, Leeds LS2 9JT (United Kingdom)



Decomposition of NH3BH3 at sub-ambient pressures: A combined thermogravimetry-differential thermal analysis-mass spectrometry study  

DOE Green Energy (OSTI)

We report a systematic study of the isothermal decomposition of ammonia borane, NH3BH3, at 363 K as a function of argon pressure ranging between 50 and 1040 mbar using thermogravimetry and differential thermal analysis coupled with mass analysis of the volatile species. During thermal aging at 363 K, evolution of hydrogen, aminoborane and borazine is monitored, with the relative mass loss strongly depending on the pressure in the reaction chamber. Furthermore, the induction period required for hydrogen release at 363 K decreases with decreasing pressure.

Palumbo, Oriele; Paolone, Annalisa; Rispoli, Pasquale; Cantelli, Rosario; Autrey, Thomas



U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

4 4 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

2 2 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


Quantum wells on 3C-SiC/NH-SiC heterojunctions. Calculation of spontaneous polarization and electric field strength in experiments  

SciTech Connect

The results of experiments with quantum wells on 3C-SiC/4H-SiC and 3C-SiC/6H-SiC heterojunctions obtained by various methods are reconsidered. Spontaneous polarizations, field strengths, and energies of local levels in quantum wells on 3C-SiC/NH-SiC heterojunctions were calculated within a unified model. The values obtained are in agreement with the results of all considered experiments. Heterojunction types are determined. Approximations for valence band offsets on heterojunctions between silicon carbide polytypes and the expression for calculating local levels in quantum wells on the 3C-SiC/NH-SiC heterojunction are presented. The spontaneous polarizations and field strengths induced by spontaneous polarization on 3C-SiC/4H-SiC and 3C-SiC/6H-SiC heterojunctions were calculated as 0.71 and 0.47 C/m{sup 2} and 0.825 and 0.55 MV/cm, respectively.

Sbruev, I. S.; Sbruev, S. B., E-mail: science@yandex.ru [Moscow Aviation Institute (Russian Federation)



HfO2 Gate Dielectric on (NH4)2S Passivated (100) GaAs Grown by Atomic Layer Deposition  

Science Conference Proceedings (OSTI)

The interface between hafnium oxide grown by atomic layer deposition and (100) GaAs treated with HCl cleaning and (NH{sub 4}){sub 2}S passivation has been characterized. Synchrotron radiation photoemission core level spectra indicated successful removal of the native oxides and formation of passivating sulfides on the GaAs surface. Layer-by-layer removal of the hafnia film revealed a small amount of As{sub 2}O{sub 3} formed at the interface during the dielectric deposition. Traces of arsenic and sulfur out-diffusion into the hafnia film were observed after a 450 C post-deposition anneal, and may be the origins for the electrically active defects. Transmission electron microscopy cross section images showed thicker HfO{sub 2} films for a given precursor exposure on S-treated GaAs versus the non-treated sample. In addition, the valence-band and the conduction-band offsets at the HfO{sub 2}/GaAs interface were deduced to be 3.18 eV and a range of 0.87-0.97 eV, respectively. It appears that HCl+(NH{sub 4})2{sub S} treatments provide a superior chemical passivation for GaAs and initial surface for ALD deposition.

Chen, P.T.; /Stanford U., Materials Sci. Dept.; Sun, Y.; /SLAC, SSRL; Kim, E.; McIntyre, P.C.; /Stanford U., Materials Sci. Dept.; Tsai, W.; Garner, M.; /Intel, Santa Clara; Pianetta, P.; /SLAC, SSRL; Nishi, Y.; /Stanford U., Elect. Eng. Dept.; Chui, C.O.; /UCLA




DOE Green Energy (OSTI)

The destabilized complex hydride system composed of LiNH{sub 2}:MgH{sub 2} (1:1 molar ratio) is one of the leading candidates of hydrogen storage with a reversible hydrogen storage capacity of 8.1 wt%. A low sorption enthalpy of {approx}32 kJ/mole H{sub 2} was first predicted by Alapati et al. utilizing first principle density function theory (DFT) calculations and has been subsequently confirmed empirically by Lu et al. through differential thermal analysis (DTA). This enthalpy suggests that favorable sorption kinetics should be obtainable at temperatures in the range of 160 C to 200 C. Preliminary experiments reported in the literature indicate that sorption kinetics are substantially lower than expected in this temperature range despite favorable thermodynamics. Systematic isothermal and isobaric sorption experiments were performed using a Sievert's apparatus to form a baseline data set by which to compare kinetic results over the pressure and temperature range anticipated for use of this material as a hydrogen storage media. Various material preparation methods and compositional modifications were performed in attempts to increase the kinetics while lowering the sorption temperatures. This paper outlines the results of these systematic tests and describes a number of beneficial additions which influence kinetics as well as NH{sub 3} formation.

Erdy, C.; Anton, D.; Gray, J.



A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



High-throughput and in situ EDXRD investigation on the formation of two new metal aminoethylphosphonates - Ca(O{sub 3}PC{sub 2}H{sub 4}NH{sub 2}) and Ca(OH)(O{sub 3}PC{sub 2}H{sub 4}NH{sub 3}){center_dot}2H{sub 2}O  

SciTech Connect

The system Ca{sup 2+}/2-aminoethylphosphonic acid/H{sub 2}O/NaOH was systematically investigated using high-throughput methods. The experiments led to one new compound Ca(O{sub 3}PC{sub 2} H{sub 4}NH{sub 2}) (1) and the crystal structure was determined using in house X-ray powder diffraction data (monoclinic, P2{sub 1}/c, a=9.7753(3), b=6.4931(2), c=8.4473(2) A, {beta}=106.46(2) Degree-Sign , V=514.20(2) A{sup 3}, Z=4). The formation of 1 was investigated by in situ energy dispersive X-ray diffraction measurements (EDXRD) at beamline F3 at HASYLAB (light source DORIS III), DESY, Hamburg. An intermediate, Ca(OH)(O{sub 3}PC{sub 2}H{sub 4}NH{sub 3}){center_dot}2H{sub 2}O (2), was observed and could be isolated from the reaction mixture at ambient temperatures by quenching the reaction. The crystal structure of 2 was determined from XRPD data using synchrotron radiation (monoclinic, P2{sub 1}/m, a=11.2193(7), b=7.1488(3), c=5.0635(2) A, {beta}=100.13(4) Degree-Sign , V=399.78(3) A{sup 3}, Z=2). - Graphical abstarct: The detailed in situ energy dispersive X-ray diffraction (EDXRD) investigation on the formation of the new inorganic-organic hybrid compound Ca(O{sub 3}PC{sub 2}H{sub 4}NH{sub 2}) leads to the discovery of a new crystalline intermediate phase. Both crystal structures were elucidated using X-ray powder diffraction data. Highlights: Black-Right-Pointing-Pointer High-throughput investigation led to new metal aminoethylphosphonate Ca(O{sub 3}PC{sub 2}H{sub 4}NH{sub 2}). Black-Right-Pointing-Pointer The formation of Ca(O{sub 3}PC{sub 2}H{sub 4}NH{sub 2}) was followed by in situ EDXRD measurements. Black-Right-Pointing-Pointer The crystalline intermediate Ca(O{sub 3}PC{sub 2}H{sub 4}NH{sub 3})(OH){center_dot}2H{sub 2}O was discovered. Black-Right-Pointing-Pointer Isolation of Ca(O{sub 3}PC{sub 2}H{sub 4}NH{sub 3})(OH){center_dot}2H{sub 2}O was accomplished by quenching experiments. Black-Right-Pointing-Pointer The structures were determined using X-ray powder diffraction data.

Schmidt, Corinna; Feyand, Mark [Institut fuer Anorganische Chemie, Christian-Albrechts-Universitaet, Max-Eyth Strasse 2, D 24118 Kiel (Germany); Rothkirch, Andre [HASYLAB, DESY Hamburg, Notkestrasse 85, 22607 Hamburg (Germany); Stock, Norbert, E-mail: stock@ac.uni-kiel.de [Institut fuer Anorganische Chemie, Christian-Albrechts-Universitaet, Max-Eyth Strasse 2, D 24118 Kiel (Germany)



APPENDIX A1 Domestic (CONUS) Per Diem Rates -Effective October 1, 2012 State Primary Destination County  

E-Print Network (OSTI)

$ 66 VT Manchester Bennington $ 71 VT Middlebury Addison $ 61 VT Montpelier Washington $ 61 VT Stowe

Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


High external quantum efficiency and fill-factor InGaN/GaN heterojunction solar cells grown by NH{sub 3}-based molecular beam epitaxy  

SciTech Connect

High external quantum efficiency (EQE) p-i-n heterojunction solar cells grown by NH{sub 3}-based molecular beam epitaxy are presented. EQE values including optical losses are greater than 50% with fill-factors over 72% when illuminated with a 1 sun AM0 spectrum. Optical absorption measurements in conjunction with EQE measurements indicate an internal quantum efficiency greater than 90% for the InGaN absorbing layer. By adjusting the thickness of the top p-type GaN window contact layer, it is shown that the short-wavelength (<365 nm) quantum efficiency is limited by the minority carrier diffusion length in highly Mg-doped p-GaN.

Lang, J. R.; Hurni, C. A.; Cruz, S. C.; Matioli, E.; Speck, J. S. [Department of Materials, University of California, Santa Barbara, California 93106 (United States); Neufeld, C. J.; Mishra, U. K. [Department of Electrical and Computer Engineering, University of California, Santa Barbara, California 93106 (United States)



QM/MM Lineshape Simulation of the Hydrogen-bonded Uracil NH Stretching Vibration of the Adenine:Uracil Base Pair in CDCl$_3$  

E-Print Network (OSTI)

A hybrid Car-Parrinello QM/MM molecular dynamics simulation has been carried out for the Watson-Crick base pair of 9-ethyl-8-phenyladenine and 1-cyclohexyluracil in deuterochloroform solution at room temperature. The resulting trajectory is analyzed putting emphasis on the N-H$...$N Hydrogen bond geometry. Using an empirical correlation between the $\\NN$-distance and the fundamental NH-stretching frequency, the time-dependence of this energy gap along the trajectory is obtained. From the gap-correlation function we determine the infrared absorption spectrum using lineshape theory in combination with a multimode oscillator model. The obtained average transition frequency and the width of the spectrum is in reasonable agreement with recent experimental data.

Yan, Yun-an; Kühn, Oliver



Figure 23. Average price of natural gas delivered to U.S. commercial...  

Annual Energy Outlook 2012 (EIA)

Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA FL NJ AL...


Microsoft Word - figure_22.doc  

Gasoline and Diesel Fuel Update (EIA)

Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA FL NJ AL...


Microsoft Word - figure_21.doc  

Annual Energy Outlook 2012 (EIA)

of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA...


Microsoft Word - figure_23.doc  

Annual Energy Outlook 2012 (EIA)

11.00+ Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." IN OH TN WV VA KY MD PA NY VT NH MA...


Microsoft Word - figure_23.doc  

Gasoline and Diesel Fuel Update (EIA)

Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." IN OH TN WV VA KY MD PA NY VT NH MA...


New England Wind Forum: More Search Options  

Wind Powering America (EERE)

Projects in New England Building Wind Energy in New England Newsletter Perspectives Events Quick Links to States CT MA ME NH RI VT More Search Options New England Wind Forum Site...


Selective Catalytic Reduction (SCR) of nitric oxide with ammonia using Cu-ZSM-5 and Va-based honeycomb monolith catalysts: effect of H2 pretreatment, NH3-to-NO ratio, O2, and space velocity  

E-Print Network (OSTI)

In this work, the steady-state performance of zeolite-based (Cu-ZSM-5) and vanadium-based honeycomb monolith catalysts was investigated in the selective catalytic reduction process (SCR) for NO removal using NH3. The aim was to delineate the effect of various parameters including pretreatment of the catalyst sample with H2, NH3-to-NO ratio, inlet oxygen concentration, and space velocity. The concentrations of the species (e.g. NO, NH3, and others) were determined using a Fourier Transform Infrared (FTIR) spectrometer. The temperature was varied from ambient (25 C) to 500 C. The investigation showed that all of the above parameters (except pre-treatment with H2) significantly affected the peak NO reduction, the temperature at which peak NO reduction occurred, and residual ammonia left at higher temperatures (also known as 'NH3 slip'). Depending upon the particular values of the parameters, a peak NO reduction of around 90% was obtained for both the catalysts. However, an accompanied generation of N2O and NO2 species was observed as well, being much higher for the vanadium-based catalyst than for the Cu-ZSM-5 catalyst. For both catalysts, the peak NO reduction decreased with an increase in space velocity, and did not change significantly with an increase in oxygen concentration. The temperatures at which peak NO reduction and complete NH3 removal occurred increased with an increase in space velocity but decreased with an increase in oxygen concentration. The presence of more ammonia at the inlet (i.e. higher NH3-to-NO ratio) improved the peak NO reduction but simultaneously resulted in an increase in residual ammonia. Pretreatment of the catalyst sample with H2 (performed only for the Cu-ZSM-5 catalyst) did not produce any perceivable difference in any of the results for the conditions of these experiments.

Gupta, Saurabh



Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan




E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


LOW-TEMPERATURE ION TRAP STUDIES OF N{sup +}({sup 3} P{sub ja} ) + H{sub 2}(j) {yields} NH{sup +} + H  

SciTech Connect

Using a low-temperature 22-pole ion trap apparatus, detailed measurements for the title reaction have been performed between 10 K and 100 K in order to get some state specific information about this fundamental hydrogen abstraction process. The relative population of the two lowest H{sub 2} rotational states, j = 0 and 1, has been varied systematically. NH{sup +} formation is nearly thermo-neutral; however, to date, the energetics are not known with the accuracy required for low-temperature astrochemistry. Additional complications arise from the fact that, so far, there is no reliable theoretical or experimental information on how the reactivity of the N{sup +} ion depends on its fine-structure (FS) state {sup 3} P{sub ja} . Since in the present trapping experiment, thermalization of the initially hot FS population competes with hydrogen abstraction, the evaluation of the decay of N{sup +} ions over long storage times and at various He and H{sub 2} gas densities provides information on these processes. First assuming strict adiabatic behavior, a set of state specific rate coefficients is derived from the measured thermal rate coefficients. In addition, by recording the disappearance of the N{sup +} ions over several orders of magnitude, information on nonadiabatic transitions is extracted including FS-changing collisions.

Zymak, I.; Hejduk, M.; Mulin, D.; Plasil, R.; Glosik, J.; Gerlich, D. [Faculty of Mathematics and Physics, Charles University, Prague (Czech Republic)



Imaging ion-molecule reactions: Charge transfer and C-N bond formation in the C{sup +}+ NH{sub 3} system  

Science Conference Proceedings (OSTI)

The velocity mapping ion imaging method is applied to the ion-molecule reactions occurring between C{sup +} and NH{sub 3}. The velocity space images are collected over the relative collision energy range from 1.5 to 3.3 eV, allowing both product kinetic energy distributions and angular distributions to be obtained from the data. The charge transfer process appears to be direct, dominated by long-range electron transfer that results in minimal deflection of the products. The product kinetic energy distributions are consistent with a process dominated by energy resonance. The kinetic energy distributions for C-N bond formation appear to scale with the total available energy, providing strong evidence that energy in the [CNH{sub 3}]{sup +} precursor to products is distributed statistically. The angular distributions for C-N bond formation show pronounced forward-backward symmetry, as expected for a complex that resembles a prolate symmetric top decaying along its symmetry axis.

Pei, Linsen; Farrar, James M. [Department of Chemistry, University of Rochester, Rochester, New York 14627 (United States)



Detailed modeling and laser-induced fluorescence imaging of nitric oxide in a NH(i)-seeded non-premixed methane/air flame  

Science Conference Proceedings (OSTI)

In this paper we study the formation of NO in laminar, nitrogen diluted methane diffusion flames that are seeded with ammonia in the fuel stream. We have performed numerical simulations with detailed chemistry as well as laser-induced fluorescence imaging measurements for a range of ammonia injection rates. For comparison with the experimental data, synthetic LIF images are calculated based on the numerical data accounting for temperature and fluorescence quenching effects. We demonstrate good agreement between measurements and computations. The LIF corrections inferred from the simulation are then used to calculate absolute NO mole fractions from the measured signal.The NO formation in both doped and undoped flames occurs in the flame sheet. In the undoped flame, four different mechanisms including thermal and prompt NO appear to contribute to NO formation. As the NH3 seeding level increases, fuel-NO becomes the dominant mechanism and N2 shifts from being a net reactant to being a net product. Nitric oxide in the undoped flame as well as in the core region of the doped flames are underpredicted by the model; we attribute this mainly to inaccuracies in the NO recycling chemistry on the fuel-rich side of the flame sheet.

Bell, John B.; Day, Marcus S.; Grcar, Joseph F.; Bessler, Wolfgang G.; Schulz, Christof; Glarborg, Peter; Jensen, Anker D.



Make Checks Payable to the 4-H Foundation of New Hampshire. For more information contact Rhiannon Beauregard at Rhiannon.Beauergard@unh.edu or (603) 862-2188. All of this information can be found at the NH 4-H State Horse Show Website  

E-Print Network (OSTI)

Beauregard at Rhiannon.Beauergard@unh.edu or (603) 862-2188. All of this information can be found at the NH 4 Foundation of New Hampshire. For more information contact Rhiannon Beauregard at Rhiannon Exposition. Please notify Rhiannon Beauregard, NH 4-H Animal and Agricultural Science Education Coordinator

New Hampshire, University of


Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use



NLE Websites -- All DOE Office Websites (Extended Search)

UnitedStatesWindHighResolutionNewHampshireWindHighResolution.zip> Description: Abstract: Annual average wind resource potential for the state of New...



Gasoline and Diesel Fuel Update (EIA)

LNG Imports LNG Imports Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming



Gasoline and Diesel Fuel Update (EIA)

Specific LNG Terminals Specific LNG Terminals Generic LNG Terminals Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Specific LNG Terminals Generic LNG Terminals Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana


DOE/EIA-0131(96) Distribution Category/UC-960 Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

ID ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Interstate Movements of Natural Gas in the United States, 1996 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL KY (T) MA ME (T) AL LA MA NH (T) AL MO (T) MA NJ (T) AL SC MD DC CT RI RI MA DE MD VA DC MA CT (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 906,407 355,260 243,866 220 384,311 576,420 823,799 842,114 27,271 126,012 133 602,841 266 579,598 16,837 268,138 48,442 182,511 219,242 86,897 643,401 619,703 8,157 937,806 292,711 869,951 12,316 590,493 118,256

Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Australia Australia Trinidad Qatar Malaysia Canada Mexico Interstate Movements of Natural Gas in the United States, 1999 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL TX MA NH CT RI MD DC DE MD RI MA MA CT VA DC (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 837,902 415,636 225,138 232 308,214 805,614 803,034 800,345 685 147 628,589 9,786 790,088 17,369 278,302 40,727 214,076 275,629 51,935 843,280 826,638 9,988 998,603 553,440 896,187 11,817 629,551 98,423


Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


Gas Prices  

NLE Websites -- All DOE Office Websites (Extended Search)

Prices Gasoline Prices for U.S. Cities Click on the map to view gas prices for cities in your state. AK VT ME NH NH MA MA RI CT CT DC NJ DE DE NY WV VA NC SC FL GA AL MS TN KY IN...


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

style, material costs, and labor costs. Initial cost of construction can range from $4.00 per square foot for an open-sided barn to over $6.00 per square foot for a fully enclosed barn. 1 This represents of a 100-foot by 50-foot, open-sided farm storage building. Initial cost of the building is $20

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

·11 /2 Tbsp whole wheat flour · 1 /2 Tbsp whole wheat flour and 1 /2 Tbsp all-purpose flour Flour, 1 flour, result in a rye flour or whole wheat flour and reduced volume 1 /2 cup all-purpose flour and a · 3 /4 cup whole wheat flour or bran heavier product. flour and 1 /4 cup all-purpose flour ·1 cup rye

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

residential lots. RD takes roof runoff that has been collected in gutters and piped directly to streets, storm Management Handbook,"VCE publication 430-350. #12;2 of 6 to 10 inches, and adding 2 to 4 inches of compost

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

recovery on coal surface-mined lands reclaimed in the Appala- chian region using different reclamation that will encourage native forest recovery on reclaimed coal surface mines. Table 2. Common species observed succession in surface coal mine reclamation. Minerals and the Environment 6(1): 10-22. Burger,J.A

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

the 1940s, surface mining for coal in Southwest Virginia has disturbed more than 100,000 acres of land disturbances such as coal mining. #12;3 and occasionally in the rocks around the coal seams. As discussed later. 1994. Improving coal surface mine reclamation in the central Appala- chian region. In: Rehabilitating

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

is essential to comply with the federal Surface Mining Control and Reclamation Act (SMCRA) by coal-mining seeding of vegetation on coal refuse; these practices may be adapted to reclamation of mine sites, but this is not a general practice in coal surface-mine reclamation. Quality should be considered carefully when purchasing

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

region, owners of lands mined for coal are increasingly interested in assuring that productive for- estsForestryReclamationApproach The Forestry Reclamation Approach (FRA) is a method for reclaiming coal-mined land to forest under SMCRA (see by coal-mining firms in past years to establish both hayland/pasture and unmanaged for- est postmining

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

of mined lands in the Appalachian coal region has resulted in the successful establishment and utilization that reduce forage quality and quantity, resulting in reduced cattle performance on reclaimed, coal-mined by coal mining. Incorporating goats Managing Shrub-Infested, Postmined Pasturelands With Goats and Cattle

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

to advances in reclamation science, Virginia coal mining operations can establish high-value, productive Success on Coal Surface Mines, describes grading practices that are recommended for use in reforestation Grading to Enhance Reforestation Success on Coal Surface Mines. Forest Reclamation Advisory No. 4

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

With the decline of coal-mining jobs in Virginia's coal- fields, availability of local employment in high in the coalfield region is a shortage of suitable industrial sites. In some cases, coal surface mines can create, compared to the woodlands and pastures typi- cally established on reclaimed mines in Virginia's coal

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

or have in the past been used for rec- lamation of coal-mined sites. Due to the nature of the land positive influences on botanical composition and invasive plant species control on reclaimed, coal-mined on reclaimed, coal-mined lands. Mixed grazing resulted in greater utilization of pasture resources, mainly due

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

, coal mining became the region's economic mainstay. After the virgin timber cut, the Appalachian forest and good plant- ing stock. The FRA method has been used successfully by many coal-mining firms productivity of land mined for coal. Thus, mining firms that can dem- onstrate the capability to restore

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

on mined lands in Virginia's coalfields. When active coal mines are being preparing for graz- ing use after concern on coal surface mines is pH. Generally, water used to support livestock should have a pH that is no less than 6.0. Highly acidic (low pH) water from coal mines can often be recognized visually from

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

The development of Southwest Virginia's coal mining region is limited by a lack of building sites. Much develop- ment. In recent years, widespread surface coal mining has created land that is favorably located treatment options is often an obstacle to residential development on reclaimed coal mines. In response

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

infrastructure construction, industrial recruitment, and business development. Reclaimed coal mines are widely typically employed by Appalachian coal surface mines; they are intended to minimize settlement- cialized compaction equipment will be cost-prohibitive for most coal-mining operations. An alternative

Liskiewicz, Maciej


Microsoft PowerPoint - AnnualReview1011_Westman_VT.pptx  

NLE Websites -- All DOE Office Websites (Extended Search)

Status - 50% complete * Synthetic data generated * Initial analysis completed Initial analysis completed Combination Receiver Array Plume Event Loc. 56 Spiral 750 Plume...


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

? If so, are there any risks associated with this approach? Biochar is a charcoal-based material of purported benefits of biochar usage in soils is long, but are these claims justified when biochar is used in Canadian soils? Are there any environmental risks associated with biochar usage? This talk will summarize

Liskiewicz, Maciej

Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

replaces them with high- protein foods such as beef, chicken, pork, eggs, and fish and high-fat foods of the Atkins Diet are to remove "carbo- hydrate cravings," "reset" the body's metabolism, and induce fat loss that insulin, not the types or quantity of foods, leads to an imbalanced metabolism and, ultimately, to fat

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

), rendered animal fats, or waste veg- etable oils (WVO). The major components of these feedstocks, and emissions. This pub- lication addresses producing one's own biodiesel fuel from waste oil, fats, and oilseed Fuels Inc. How Biodiesel Is Made Biodiesel is made through a chemical reaction between oils or fats

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

of tricylglycerols 2. Animal Fats The second group of feedstock for biodiesel produc- tion is fats and tallow derived

Liskiewicz, Maciej



E-Print Network (OSTI)

Pakistan Vêt. J., 22(4): 2002 STRESS MANAGEMENT FOLLOWING VACCINATION AGAINST COCCIDIOSISPathology, 'Department ofParasitology University ofVeterinary and Animal sciences, Lahore, Pakistan ABSTRACT The présent

Paris-Sud XI, Université de



NLE Websites -- All DOE Office Websites (Extended Search)

Solar Thermal Test Facility in Albuquerque, New Mexico. The manufacturing of these solar panels is already approved under the original NEPA Control Number GFO-08-005. The...


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

primarily based on your LDL number. Persons with a history of heart disease may be put on a very restricted-modifiable Risk Factors Age: Male 45 years or older; Female 55 years or older Family history of premature CHD. · Choose foods low in total fat. · Select soft or liquid margarines or spreads that list liquid oil

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

production to maximize marketability and by making modest increases in the selling price. Add fuel surcharges that adding a fuel surcharge to everything they sold during the spring would reverse their losses and restore afford that? Strongly consider adding delivery charges, or at least fuel surcharges, to delivery services

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

inter- mixed with open weedy areas. They also use riparian and wetland areas as sources of food, or sardine oil, · bear hounds or guard dogs to ward off depredating bears, · habitat manipulation (epp. Black Bear Conservation Committee. 1992. Black bear management handbook for Louisiana

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

-producing state, accounting for about half of the nation's supply. Minne- sota, Kansas, Louisiana, Mississippi for food in the United States are pro- duced in the southern states, primarily Louisiana, Mis- sissippi water gardens, and for stocking natural wetlands to attract waterfowl. Figure 38. Water Lily Figure 39

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

Hands ­ On Science with NOAA TITLE: Tying Science to History... Making Rope by Hand OVERVIEW, or wool yarn. INSTRUCTIONS: 1. Each participant should receive 2 lengths of single strand fiber about 15 is fascinating! Research and discuss the development of rope-making technology through human history. · Research

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

't suggest that later software versions have fewer errors. Avishai Wool Tel Aviv University Trends a poorer security history than others. Also, having all 65,536 TCP ports open is probably more risky than. A. Wool, "A Quantitative Study of Firewall Configura- tion Errors," Computer, vol. 37, no. 6, 2004

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

oxygen to the gasoline. Engine warranty Automobiles: Currently, all major automakers (Gen- eral Motors, with fuel ethanol play- ing an important role in this transition. Fuel ethanol can be blended with gasoline (from 10 percent to 85 percent), and thus reduce the amount of gasoline used. In the United States, corn

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

never develop cancer despite years of exposure to tobacco, poor diet, alco- hol, sunlight, etc., while as carcinogens. For unlucky others, a combination of modi- fied genes and a suitable internal environment results, excessive ultraviolet light and radiation provides a strong defense against many common cancers. Food

Liskiewicz, Maciej


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

explains the significant price increase of not just petroleum but most raw materials since 2000. During and assesses their impact on the Southwest region's transportation sector. Biofuel transportation requirements, biofuels constitute the focus of this research given the current level of development and potential

Liskiewicz, Maciej


Total power optimization combining placement, sizing and multi-Vt through slack distribution management  

Science Conference Proceedings (OSTI)

Power dissipation is quickly becoming one of the most important limiters in nanometer IC design for leakage increases exponentially as the technology scaling down. However, power and timing are often conflicting objectives during optimization. In this ...

Tao Luo; David Newmark; David Z. Pan



www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

is to minimize pesticide use and to define where such use is appropriate, while controlling pests effectively.S. Environmental Protection Agency of certain pesticides and biopesticides. Mostly, these are pest controls for use on a minor crop--that is, a crop grown on less than 300,000 acres nationwide. But IR-4 projects also address

Liskiewicz, Maciej


Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:


APPENDIX A1 Domestic (CONUS) Per Diem Rates -Effective October 1, 2010 State Primary Destination County  

E-Print Network (OSTI)

Manchester Bennington $71 VT Middlebury Addison $61 VT Montpelier Washington $61 VT Stowe Lamoille October 1


A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



Hydrogen storage in a combined M.sub.xAlH.sub.6/M'.sub.y(NH.sub.2).sub.z system and methods of making and using the same  

SciTech Connect

As a promising clean fuel for vehicles, hydrogen can be used for propulsion, either directly or in fuel cells. Hydrogen storage compositions having high storage capacity, good dehydrogenation kinetics, and hydrogen release and uptake reactions which are reversible are disclosed and described. Generally a hydrogen storage composition of a metal aluminum hexahydride and a metal amide can be used. A combined system (Li.sub.3AIH.sub.6/3LiNH.sub.2) with a very high inherent hydrogen capacity (7.3 wt %) can be carried out at moderate temperatures, and with approximately 95% of that inherent hydrogen storage capacity (7.0%) is reversible over repeated cycling of release and uptake.

Lu, Jun (Salt Lake City, UT); Fang, Zhigang Zak (Salt Lake City, UT); Sohn, Hong Yong (Salt Lake City, UT)


Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Hydrogen storage in a combined M.sub.xAlH.sub.6/M'.sub.y(NH.sub.2).sub.z system and methods of making and using the same  

DOE Patents (OSTI)

As a promising clean fuel for vehicles, hydrogen can be used for propulsion, either directly or in fuel cells. Hydrogen storage compositions having high storage capacity, good dehydrogenation kinetics, and hydrogen release and uptake reactions which are reversible are disclosed and described. Generally a hydrogen storage composition of a metal aluminum hexahydride and a metal amide can be used. A combined system (Li.sub.3AIH.sub.6/3LiNH.sub.2) with a very high inherent hydrogen capacity (7.3 wt %) can be carried out at moderate temperatures, and with approximately 95% of that inherent hydrogen storage capacity (7.0%) is reversible over repeated cycling of release and uptake.

Lu, Jun (Salt Lake City, UT); Fang, Zhigang Zak (Salt Lake City, UT); Sohn, Hong Yong (Salt Lake City, UT)



Mechanochemical transformation of mixtures of Ca(OH){sub 2} and (NH{sub 4}){sub 2}HPO{sub 4} or P{sub 2}O{sub 5}  

Science Conference Proceedings (OSTI)

A detailed comparative study of the mechanochemical transformation of two mixtures: Ca(OH){sub 2}-(NH{sub 4}){sub 2}HPO{sub 4} and Ca(OH){sub 2}-P{sub 2}O{sub 5}, milled in a mortar dry grinder for different periods of time was carried out. The phase transformations obtained at each milling stage were studied by X-ray diffraction, infrared spectroscopy, transmission electron microscopy, differential scanning calorimetry and thermogravimetric analysis. The transformations taking place during the first periods of milling are very different for both mixtures. However, prolonged milling, over nearly the same period, causes amorphization of both mixtures. DSC analysis of the milled powders showed the temperature of crystallization of hydroxyapatite and tricalcium phosphate ({beta}-TCP). Calcinations of all the different milled powders at 800 deg. C for 2 h, results in the formation of hydroxyapatite and {beta}-TCP.

Gonzalez, G. [Laboratorio de Materiales, Centro Tecnologico, Instituto Venezolano de Investigaciones Cientificas. Aptdo. 21827 Caracas 1020-A (Venezuela)]. E-mail: gemagonz@ivic.ve; Sagarzazu, A. [Laboratorio de Materiales, Centro Tecnologico, Instituto Venezolano de Investigaciones Cientificas. Aptdo. 21827 Caracas 1020-A (Venezuela); Villalba, R. [Laboratorio de Materiales, Centro Tecnologico, Instituto Venezolano de Investigaciones Cientificas. Aptdo. 21827 Caracas 1020-A (Venezuela)



SiO{sub 2} nanospheres with tailorable interiors by directly controlling Zn{sup 2+} and NH{sub 3}.H{sub 2}O species in an emulsion process  

Science Conference Proceedings (OSTI)

SiO{sub 2} nanospheres with tailorable interiors were synthesized by a facile one-spot microemulsion process using TEOS as silica source, wherein cyclohexane including triton X-100 and n-octanol as oil phase and Zn{sup 2+} or NH{sub 3}.H{sub 2}O aqueous solution as dispersive phase, respectively. The products were characterized by Scanning Electron Microscopy, Transmission Electron Microscopy and X-ray Powder Diffraction. It was suggested that the as-synthesized silica nanospheres possessed grape-stone-like porous or single hollow interior, and also found that the ammonia dosage and aging time played key roles in controlling the size and structure of silica nanospheres. Furthermore, the comparative results confirmed that in-situ zinc species [ZnO/Zn(OH){sub 2}] acted as the temporary templates to construct grape-stone-like interior, and a simultaneously competing etching process occurred owing to the soluble Zn(NH{sub 3}){sub 4}{sup 2+} complex formation while the additional excessive ammonia was introduced. With the aging time being extended, the in-situ nanocrystals tended to grow into bigger ones by Ostwald Ripening, producing single hollow interior. - Graphical Abstract: Formation process of SiO{sub 2} nanospheres with porous and single hollow interior. Highlights: > ZnO/Zn(OH){sub 2} nanocrystals as the temporary templates shape the interior structures of SiO{sub 2} nanospheres. > Fabrication of porous and single hollow interiors needs no additional processes such as roasting or dissolving. > Tailorable interiors can be easily obtained through adjusting the aging time of temporary templates.

Liao Yuchao [State Key Laboratory of Multiphase Complex Systems, Institute of Process Engineering, Chinese Academy of Sciences, Beijing 100190 (China); Graduate University of Chinese Academy of Sciences, Beijing 100049 (China); Wu Xiaofeng [State Key Laboratory of Multiphase Complex Systems, Institute of Process Engineering, Chinese Academy of Sciences, Beijing 100190 (China); Wang Zhen [State Key Laboratory of Multiphase Complex Systems, Institute of Process Engineering, Chinese Academy of Sciences, Beijing 100190 (China); Graduate University of Chinese Academy of Sciences, Beijing 100049 (China); Chen Yunfa, E-mail: yfchen@home.ipe.ac.cn [State Key Laboratory of Multiphase Complex Systems, Institute of Process Engineering, Chinese Academy of Sciences, Beijing 100190 (China)



Buildings Energy Data Book: 3.9 Educational Facilities  

Buildings Energy Data Book (EERE)

6 6 2010 Regional New Construction and Renovations Expenditures for Public K-12 Schools ($Million) Region New Schools Additions Renovation Total Region 1 (CT, MA, ME, NH, RI, VT) Region 2 (NJ, NY, PA) Region 3 (DE, MD, VA, WV) Region 4 (KY, NC, SC, TN) Region 5 (AL, FL, GA, MS) Region 6 (IN, MI, OH) Region 7 (IL, MN, WI) Region 8 (IA, KS, MO, NE) Region 9 (AR, LA, OK, TX) Region 10 (CO, MT, ND, NM, SD, UT, WY) Region 11 (AZ, CA, HI, NV) Region 12 (AK, ID, OR, WA) Total Source(s): School Planning & Management, 16th Annual School Construction Report, Feb. 2011 p. CR3 8,669.5 3,074.1 2,796.8 14,540.4 1,605.4 407.3 275.2 2,287.9 258.2 181.8 158.1 598.1 1,653.9 479.6 387.8 2,521.2 548.2 130.9 93.3 772.4 309.3 206.1 135.3 650.7 217.6 231.4 187.8 636.8 1,338.0 327.6 175.9 1,841.4 359.6 286.3 278.9 924.8


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Mexico Trinidad Canada Canada Nigeria Oman Qatar Trinidad Gulf of Mexico Gulf of Mexico Gulf of Mexico Canada Trinidad Trinidad Gulf of Mexico Malaysia 13,623 Figure 8. Interstate Movements of Natural Gas in the United States, 2003 (Million Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Energy Information Administration / Natural Gas Annual 2003 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 366,224 655,731 666,614 633,960 144,284 43,869 536,776 63,133 36,848



Gasoline and Diesel Fuel Update (EIA)

6 6 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 27. Average City Gate Price of Natural Gas in the United States, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Energy Information Administration (EIA), Form EIA-857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Constant dollars: Prices were converted to 2001 dollars using the chain-type


Residential Demand Module  

Gasoline and Diesel Fuel Update (EIA)

and clothes drying. In addition to the major equipment-driven and clothes drying. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric Energy Information Administration/Assumptions to the Annual Energy Outlook 2006 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Figure 5. United States Census Divisions Source:Energy Information Administration,Office of Integrated Analysis and Forecasting. Report #:DOE/EIA-0554(2006) Release date: March 2006


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2008 (Million Cubic Feet) Norway Trinidad/ Tobago Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 45,772 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates.


Green Power Network: Can I Buy Green Power in My State?  

NLE Websites -- All DOE Office Websites (Extended Search)

Can I Buy Green Power in my State? Community Renewable Energy Development Consumer Protection Large Purchasers of Green Power Can I Buy Green Power in My State? Click on your state below to find out which organizations offer green power in your state. The results will include utility green pricing programs, retail green power products offered in competitive electricity markets, and renewable energy certificate (REC) products sold separate from electricity. For additional information about these distinct products, see our Overview of Green Power Markets. Map of the United States. AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Alabama Alaska Arizona Arkansas California Colorado Connecticut Connecticut Delaware Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Maryland Massachusetts Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Hampshire New Jersey New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Vermont Virginia Washington West Virginia Wisconsin Wyoming Washington, DC



Gasoline and Diesel Fuel Update (EIA)

Supply Supply 17 Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 (Million Cubic Feet) 24,891 2,895 Nigeria WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico Algeria C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada N i g e r i a O m a n Qatar Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Malaysia 2,986 Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2005 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 335,380 634,982 664,318 612,297 125,202 33,223 531,868 103,624


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

,833 ,833 35 Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2009 (Million Cubic Feet) Norway Trinidad/ Tobago Trinidad/ Tobago Egypt Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 111,144 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates


AEOSup ltr to Dear Customer  

Gasoline and Diesel Fuel Update (EIA)

WA WA OR CA ID NV UT AZ NM CO WY MT ND SD NE KS OK TX MN IA MO AR LA WI IL KY IN OH WV TN MS AL GA SC NC VA PA NY VT ME NH MA RI CT NJ DE MD D.C. FL MI Electricity Supply Regions 1 ECAR 2 ERCOT 3 MAAC 4 MAIN 5 MAPP 6 NY 7 NE 8 FL 9 STV 10 SPP 11 NWP 12 RA 13 CNV 13 11 12 2 10 5 9 8 1 6 7 3 AK 15 14 H I 14 AK 15 H I Figure 2. Electricity Market Module (EMM) Regions 1. ECAR = East Central Area Reliability Coordination Agreement 2. ERCOT = Electric Reliability Council of Texas 3. MACC = Mid-Atlantic Area Council 4. MAIN = Mid-America Interconnected Network 5. MAPP = Mid-Continent Area Power Pool 6. NY = Northeast Power Coordinating Council/ New York 7. NE = Northeast Power Coordinating Council/ New England 8. FL = Southeastern Electric Reliability Council/ Florida 9. STV = Southeastern Electric Reliability Council /excluding Florida 10. SPP


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

6 6 (Million Cubic Feet) Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 42,411 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2006 253,214 690,780 634,185 658,523 134,764 63,063 526,726 121,049 34,531 492,655 101,101 23,154 40,113 1,496,283 68,601


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2013 Annual Energy Outlook 2013 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2013



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value


Microsoft Word - figure_14.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 14. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2010 (Million Cubic Feet) Norway India Trinidad/ Tobago Egypt Yemen Japan Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 53,122 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada Gulf of Mexico Canada Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates based on historical data. Energy Information


Microsoft Word - Figure_14_15.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 360 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Figure 14. Average Price of Natural Gas Delivered to Residential Consumers, 1980-2004 Figure 15. Average City Gate Price of Natural Gas in the United States, 2004 (Dollars per Thousand Cubic Feet) Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." Constant dollars: Prices were converted to 2004 dollars using the chain-type price indexes for Gross Domestic Product


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act 2 Metric Tons Heavy Metal (MTHM) 3 Based on actual data through 2002 , as provided in the RW-859, and projected discharges for 2003-2010 which are rounded to two significant digits. Reflects trans-shipments as of end-2002. End of Year 2010 SNF & HLW Inventories 1 Approximately 64,000 MTHM 2 of Spent Nuclear Fuel (SNF) 3 & 275 High-Level Radioactive Waste (HLW) Canisters CT 1,900 TX 2,000 MD 1,200 VT 610 RI MT WY NE 790 SD ND OK KS 600 TX 2,000 LA 1,200 AR 1,200 IA 480 MN 1,100 WI 1,300 KY TN 1,500 MS 780 AL 3,000 GA 2,400 FL 2,900 NC 3,400 VA 2,400 WV OH 1,100 PA 5,800 ME 540 NJ 2,400 DE MI 2,500 MA 650 NH 480 IN SC 3,900 CO MO 670 IL 8,400 NY 3,300 CA 2,800 AZ 1,900 NM OR 360 NV UT WA 600 ID < 1 Commercial HLW 275 Canisters (~640 MTHM)


Table 25  

Gasoline and Diesel Fuel Update (EIA)

89 89 Table 25 Created on: 1/3/2014 3:10:33 PM Table 25. Natural gas home customer-weighted heating degree days, New England Middle Atlantic East North Central West North Central South Atlantic Month/Year/Type of data CT, ME, MA, NH, RI, VT NJ, NY, PA IL, IN, MI, OH, WI IA, KS, MN, MO, ND, NE, SD DE, FL, GA, MD, DC, NC, SC, VA, WV November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0 November to November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0

Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

0.00-1.99 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1996 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1996 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: In 1996, consumption of natural gas for agricultural use



Gasoline and Diesel Fuel Update (EIA)

18 18 Energy Information Administration / Natural Gas Annual 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 0 1 2 3 4 5 6 7 T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o A l a b a m a K a n s a s A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 1997 1998 1999 2000 2001 2001 16. Marketed Production of Natural Gas in Selected States, 1997-2001 Figure Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI


NH Acid Rain Control Act (New Hampshire)  

Energy.gov (U.S. Department of Energy (DOE))

The Act is implemented under New Hampshire's acid deposition control program established under the Rules to Control Air Pollution in Chapter Env-A 400. The goal of the Act is to reduce emissions...


Export.gov - NH Our Services  

NLE Websites -- All DOE Office Websites (Extended Search)

Identify potential partners. Market your firm directly to local companies. Partner Search Identify potential partners and get detailed company reports. Determine the...


Pittsburg, NH Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

56,879 39,438 26,767 18,297 19,826 47,451 1998-2012 Pipeline Prices 7.52 9.72 5.04 5.48 5.45 4.08 1998...


Pittsburg, NH Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 0 64 0 0 336 199 2007-2012 Pipeline Prices -- 7.61 -- -- 7.54 2.62 2007-2012...



U.S. Energy Information Administration (EIA)

MO MT NE NV NH NJ NM NY NC ND OH OK OR PA RI SC SD TN TX UT VT VA WA WV WI WY U.S. Number of states in which marketer is licensed ... Service Tech & Research Corp


A 65 nm Sub- V_{t} Microcontroller With Integrated SRAM and Switched Capacitor DC-DC Converter  

E-Print Network (OSTI)

Aggressive supply voltage scaling to below the device threshold voltage provides significant energy and leakage power reduction in logic and SRAM circuits. Consequently, it is a compelling strategy for energy-constrained ...

Verma, Naveen



E-Print Network (OSTI)

Pakistan Vêt. ./., 22(4): 2002 A STUDY ON THE PATHOGENESIS OF YOLK RETENTION IN BROILER CHICKS Laboratories Complex. Lahore, Pakistan ABSTRACT The présent project was designed to identify thé factors commonest cause of early chick mortality in Pakistan (Anjum, 1997). Whcn thé chick émerges from it's shell

Paris-Sud XI, Université de


Graphic Comm Central http://teched.vt.edu:16080/gcc/[6/29/09 8:58:26 AM  

E-Print Network (OSTI)

Strips For Chelsea Handler, Jennifer Aniston Jealous! Marie Osmond Battles Brother Donny Osmond: Writes With Chelsea Handler Did Hulk Hogan Leak His Own Sex Tape? Brooklyn Decker Goes Brunette -- Better Blonde

Beex, A. A. "Louis"


APPENDIX A1 Domestic (CONUS) Per Diem Rates -Effective October 1, 2011 State Primary Destination County  

E-Print Network (OSTI)

Date M&IE Rate VT Middlebury Addison $61 VT Montpelier Washington $61 VT Stowe Lamoille October 1 March


Conserving the Connections: A Nationwide Inventory of State-Based Habitat Connectivity Analysis  

E-Print Network (OSTI)

of Transportation. Montpelier, VT. Personal Communicationin Vermont. Montpelier, VT. http://repositories.cdlib.org/Transportation, Montpelier, VT. http://www.aot.state.vt.us/

Feinberg, Jesse



Bulk gold catalyzed oxidation reactions of amines and isocyanides and iron porphyrin catalyzed N-H and O-H bond insertion/cyclization reactions of diamines and aminoalcohols  

Science Conference Proceedings (OSTI)

This work involves two projects. The first project entails the study of bulk gold as a catalyst in oxidation reactions of isocyanides and amines. The main goal of this project was to study the activation and reactions of molecules at metal surfaces in order to assess how organometallic principles for homogeneous processes apply to heterogeneous catalysis. Since previous work had used oxygen as an oxidant in bulk gold catalyzed reactions, the generality of gold catalysis with other oxidants was examined. Amine N-oxides were chosen for study, due to their properties and use in the oxidation of carbonyl ligands in organometallic complexes. When amine N-oxides were used as an oxidant in the reaction of isocyanides with amines, the system was able to produce ureas from a variety of isocyanides, amines, and amine N-oxides. In addition, the rate was found to generally increase as the amine N-oxide concentration increased, and decrease with increased concentrations of the amine. Mechanistic studies revealed that the reaction likely involves transfer of an oxygen atom from the amine N-oxide to the adsorbed isocyanide to generate an isocyanate intermediate. Subsequent nucleophilic attack by the amine yields the urea. This is in contrast to the bulk gold-catalyzed reaction mechanism of isocyanides with amines and oxygen. Formation of urea in this case was proposed to proceed through a diaminocarbene intermediate. Moreover, formation of the proposed isocyanate intermediate is consistent with the reactions of metal carbonyl ligands, which are isoelectronic to isocyanides. Nucleophilic attack at coordinated CO by amine N-oxides produces CO{sub 2} and is analogous to the production of an isocyanate in this gold system. When the bulk gold-catalyzed oxidative dehydrogenation of amines was examined with amine N-oxides, the same products were afforded as when O{sub 2} was used as the oxidant. When the two types of oxidants were directly compared using the same reaction system and conditions, it was found that the oxidative dehydrogenation of dibenzylamine to Nbenzylidenebenzylamine, with N-methylmorpholine N-oxide (NMMO), was nearly quantitative (96%) within 24 h. However, the reaction with oxygen was much slower, with only a 52% yield of imine product over the same time period. Moreover, the rate of reaction was found to be influenced by the nature of the amine N-oxide. For example, the use of the weakly basic pyridine N-oxide (PyNO) led to an imine yield of only 6% after 24 h. A comparison of amine N-oxide and O2 was also examined in the oxidation of PhCH{sub 2}OH to PhCHO catalyzed by bulk gold. In this reaction, a 52% yield of the aldehyde was achieved when NMMO was used, while only a 7% product yield was afforded when O{sub 2} was the oxidant after 48 h. The bulk gold-catalyzed oxidative dehydrogenation of cyclic amines generates amidines, which upon treatment with Aerosil and water were found to undergo hydrolysis to produce lactams. Moreover, 5-, 6-, and 7-membered lactams could be prepared through a one-pot reaction of cyclic amines by treatment with oxygen, water, bulk gold, and Aerosil. This method is much more atom economical than industrial processes, does not require corrosive acids, and does not generate undesired byproducts. Additionally, the gold and Aerosil catalysts can be readily separated from the reaction mixture. The second project involved studying iron(III) tetraphenylporphyrin chloride, Fe(TPP)Cl, as a homogeneous catalyst for the generation of carbenes from diazo reagents and their reaction with heteroatom compounds. Fe(TPP)Cl, efficiently catalyzed the insertion of carbenes derived from methyl 2-phenyldiazoacetates into O-H bonds of aliphatic and aromatic alcohols. Fe(TPP)Cl was also found to be an effective catalyst for tandem N-H and O-H insertion/cyclization reactions when 1,2-diamines and 1,2-alcoholamines were treated with diazo reagents. This approach provides a one-pot process for synthesizing piperazinones and morpholinones and related analogues such as quinoxalinones and benzoxazin-2-ones.

Klobukowski, Erik



Microsoft Word - Figure_3_4.doc  

Gasoline and Diesel Fuel Update (EIA)

7 7 None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s A l a b a m a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2002 2003 2002 Figure 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2002-2003 Figure 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2003 (Million Cubic Feet) GOM = Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly and Annual Quantity and Value of Natural Gas Report," and the United States Mineral Management



Gasoline and Diesel Fuel Update (EIA)

6 6 Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:



Gasoline and Diesel Fuel Update (EIA)

0 0 Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 2000 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1996-2000 Figure T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a O t h e r S t a t e s 0 1 2 3 4 5 6 7 0 30 60 90 120 150 180 Trillion Cubic Feet Billion Cubic Meters 1996 1997 1998 1999 2000 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly


Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The�¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2

Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...


Selling the Alpine Frontier: The Development of Winter Resorts, Sports, and Tourism in Europe and America, 1865-1941  

E-Print Network (OSTI)

Cross Country Skiing (Montpelier, VT: privately printed,Cross Country Skiing. Montpelier, VT: privately printed,

Esson, Dylan Jim



The Cost of Enforcing Building Energy Codes: Phase 1  

E-Print Network (OSTI)

90% Compliance by 2017. Montpelier, VT: Vermont Department90% Compliance by 2017. Montpelier, VT : Vermont Department

Williams, Alison



Synthesis and crystal structure of a new open-framework iron phosphate (NH{sub 4}){sub 4}Fe{sub 3}(OH){sub 2}F{sub 2}[H{sub 3}(PO{sub 4}){sub 4}]: Novel linear trimer of corner-sharing Fe(III) octahedra  

SciTech Connect

A new iron phosphate (NH{sub 4}){sub 4}Fe{sub 3}(OH){sub 2}F{sub 2}[H{sub 3}(PO{sub 4}){sub 4}] has been synthesized hydrothermally at HF concentrations from 0.5 to 1.2 mL. Single-crystal X-ray diffraction analysis reveals its three-dimensional open-framework structure (monoclinic, space group P2{sub 1}/n (No. 14), a=6.2614(13) A, b=9.844(2) A, c=14.271(3) A, {beta}=92.11(1){sup o}, V=879.0(3) A{sup 3}). This structure is built from isolated linear trimers of corner-sharing Fe(III) octahedra, which are linked by (PO{sub 4}) groups to form ten-membered-ring channels along [1 0 0]. This isolated, linear trimer of corner-sharing Fe(III) octahedra, [(FeO{sub 4}){sub 3}(OH){sub 2}F{sub 2}], is new and adds to the diverse linkages of Fe polyhedra as secondary building units in iron phosphates. The trivalent iron at octahedral sites for the title compound has been confirmed by synchrotron Fe K-edge XANES spectra and magnetic measurements. Magnetic measurements also show that this compound exhibit a strong antiferromagnetic exchange below T{sub N}=17 K, consistent with superexchange interactions expected for the linear trimer of ferric octahedra with the Fe-F-Fe angle of 132.5{sup o}. -- Graphical abstract: The three-dimensional open-framework structure of (NH{sub 4}){sub 4}Fe{sub 3}(OH){sub 2}F{sub 2}[H{sub 3}(PO{sub 4}){sub 4}] is built from a novel isolated, linear (FeO{sub 4}){sub 3}(OH){sub 2}F{sub 2} trimer of corner-sharing Fe(III) octahedra linked by PO{sub 4} tetrahedra. Display Omitted

Mi, Jin-Xiao, E-mail: jxmi@xmu.edu.c [Department of Materials Science and Engineering, College of Materials, Xiamen University, Xiamen 361005 (China); Wang, Cheng-Xin [Department of Materials Science and Engineering, College of Materials, Xiamen University, Xiamen 361005 (China); Chen, Ning [Canadian Light Source, University of Saskatchewan, Saskatoon, SK, Canada S7N 0X4 (Canada); Department of Geological Sciences, University of Saskatchewan, Saskatoon, SK, Canada S7N 5E2 (Canada); Li, Rong [Department of Materials Science and Engineering, College of Materials, Xiamen University, Xiamen 361005 (China); Department of Geological Sciences, University of Saskatchewan, Saskatoon, SK, Canada S7N 5E2 (Canada); Pan, Yuanming [Department of Geological Sciences, University of Saskatchewan, Saskatoon, SK, Canada S7N 5E2 (Canada)



Impacts of anisotropic lattice relaxation on crystal mosaicity and luminescence spectra of m-plane Al{sub x}Ga{sub 1-x}N films grown on m-plane freestanding GaN substrates by NH{sub 3} source molecular beam epitaxy  

SciTech Connect

In-plane anisotropic lattice relaxation was correlated with the crystal mosaicity and luminescence spectra for m-plane Al{sub x}Ga{sub 1-x}N films grown on a freestanding GaN substrate by NH{sub 3}-source molecular beam epitaxy. The homoepitaxial GaN film exhibited A- and B-excitonic emissions at 8 K, which obeyed the polarization selection rules. For Al{sub x}Ga{sub 1-x}N overlayers, the m-plane tilt mosaic along c-axis was the same as the substrate as far as coherent growth was maintained (x{<=}0.25). However, it became more severe than along the a-axis for lattice-relaxed films (x{>=}0.52). The results are explained in terms of anisotropic lattice and thermal mismatches between the film and the substrate. Nonetheless, all the Al{sub x}Ga{sub 1-x}N films exhibited a near-band-edge emission peak and considerably weak deep emission at room temperature.

Hoshi, T.; Hazu, K.; Ohshita, K.; Kagaya, M.; Onuma, T.; Chichibu, S. F. [CANTech, Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, 2-1-1 Katahira, Aoba, Sendai 980-8577 (Japan); Fujito, K. [Optoelectronics Laboratory, Mitsubishi Chemical Corporation, 1000 Higashi-Mamiana, Ushiku 300-1295 (Japan); Namita, H. [Mitsubishi Chemical Group Science and Technology Research Center, Inc., 8-3-1 Chuo, Ami, Inashiki 300-0332 (Japan)



NH4-smectite: Characterization, hydration properties and hydro mechanical behaviour  

E-Print Network (OSTI)

et al., 1993], [Shackelford, 1994], [Studds et al., 1996], [Coméaga, 1997], [Lin, 1998], [Alawaji, 1999], [Mohan et al., 1999], [Shackelford et al., 2000], #12;[Egloffstein, 2001] and [Jullien et al

Paris-Sud XI, Université de


Hydrothermally Stable, Low-Temperature NOx Reduction NH3 ...  

aging. In contrast, the conventional, commercially available chabazite SCR catalyst, Cu-SSZ-13, exhibits high activity only in 200-550 °C range.


Poultry Curriculum Committee Meeting Minutes February 2, 2013 Boscawen, NH  

E-Print Network (OSTI)

Beauregard c. Clubs with Poultry Project Areas: i. Kim Steele (Hillsborough County): Hooves, Hens, Heifers

New Hampshire, University of


Page 1 of 4 2013 NH HORSE AD BOOKLET  

E-Print Network (OSTI)

or Rhiannon Beauregard, New Hampshire 4-H Animal and Agricultural Science Education Coordinator at (603) 862-2188 or Rhiannon.Beauregard@unh.edu. 1. Promote the ad campaign within your county - Work with your Extension. Send all materials to Rhiannon Beauregard (see below) by May 17, 2013. You will need to include a copy

New Hampshire, University of


Beef Curriculum Committee Meeting Minutes February 2, 2013 Boscawen, NH  

E-Print Network (OSTI)

) (Carroll); Jean Rudolph (Cheshire); and Rhiannon Beauregard (Rockingham) c. Names of Some Folks that should

New Hampshire, University of


Pittsburg, NH Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 2000's 0 64 0 2010's 0 336 199 - No Data Reported; -- Not Applicable; NA Not Available; W ...


Pittsburg, NH Natural Gas Pipeline Exports to Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 2000's -- 7.61 -- 2010's -- 7.54 2.62 - No Data Reported; -- Not Applicable; NA Not Available; W...


Pittsburg, NH Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's NA 22,820 2000's 38,289 45,808 29,014 34,983 17,257 28,041 31,853 56,879 39,438 26,767 2010's...


Pittsburg, NH Natural Gas Pipeline Exports to Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 7.54 2012 2.20 2.65 2.46 3.48 2013 14.87 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to...


Pittsburg, NH Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 5,804 3,798 865 295 2,790 248 792 242 144 126 655 4,066 2012 6,044 5,109 1,927 2,629 2,692 3,438 3,976 3,786 4,614 3,630...


Pittsburg, NH Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 336 2012 0 138 55 5 2013 21 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid...


Pittsburg, NH Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's NA 2.61 2000's 4.07 4.01 3.37 6.08 6.44 10.88 7.26 7.52 9.72 5.04 2010's 5.48 5.45 4.08...

Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Pittsburg, NH Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 6.06 5.95 6.14 5.56 4.91 5.14 5.66 4.76 4.54 4.33 4.49 4.58 2012 4.22 3.79 3.14 2.55 2.72 3.49 3.75 3.52 3.30 3.80 5.65...


HIPAA 2013 - The National Health ISAC (NH-ISAC)  

Science Conference Proceedings (OSTI)

... Department of Homeland Security (DHS) Office of Infrastructure ... Dams Critical Manufacturing /Emergency Services Nuclear Reactors, Materials and ...



Tetrahedral-Network Organo-Zincophosphates: Syntheses and Structures of (N(2)C(6)H(14)).Zn(HPO(4))(2).H(2)O, H(3)N(CH(2))(3)NH(3).Zn(2)(HPO(4))(3) and (N(2)C(6)H(14)).Zn(3)(HPO(4))(4)  

SciTech Connect

The solution-mediated syntheses and single crystal structures of (N2C6H14)·Zn(HPO4)2·H2O (I), H3N(CH2)3NH3·Zn2(HPO4)3 (II), and (N2C6H14)·Zn3(HPO4)4 (III) are described. These phases contain vertex-sharing Zn04 and HP04 tetrahedra, accompanied by doubly- protonated organic cations. Despite their formal chemical relationship, as members of the series of t·Znn(HP04)n+1 (t= template, n = 1-3), these phases adopt fimdamentally different crystal structures, as one-dimensional, two-dimensional, and three-dimensional Zn04/HP04 networks, for I, II, and III respectively. Similarities and differences to some other zinc phosphates are briefly discussed. Crystal data: (N2C6H14)·Zn(HP04)2·H20, Mr = 389.54, monoclinic, space group P21/n (No. 14), a = 9.864 (4) Å, b = 8.679 (4) Å, c = 15.780 (3) Å, ? = 106.86 (2)°, V= 1294.2 (8) Å3, Z = 4, R(F) = 4.58%, RW(F) = 5.28% [1055 reflections with I >3?(I)]. H3N(CH2)3NH3·Zn2(HP04)3, Mr = 494.84, monoclinic, space group P21/c (No. 14), a= 8.593 (2)Å, b= 9.602 (2)Å, c= 17.001 (3)Å, ?= 93.571 (8)°, V = 1400.0 (5) Å3, Z = 4, R(F) = 4.09%, RW(F) = 4.81% [2794 reflections with I > 3? (I)]. (N2C6H14)·Zn3(HP04)4, Mr= 694.25, monoclinic, space group P21/n (No. 14), a = 9.535 (2) Å, b = 23.246 (4)Å, c= 9.587 (2)Å, ?= 117.74 (2)°, V= 1880.8 (8) Å3, Z = 4, R(F) = 3.23%, RW(F) = 3.89% [4255 reflections with 1> 3?(I)].

Chavez, Alejandra V.; Hannooman, Lakshitha; Harrison, William T.A.; Nenoff, Tina M.



Ab initio simulation of ammonia monohydrate ,,NH3"H2O... and ammonium hydroxide ,,NH4OH...  

E-Print Network (OSTI)

the whole ammonia-water system. As part of a broader ongoing study into solids in the ammonia-water system,9 pseudopotential plane-wave simulations of the static properties of ammonia monohydrate phase I AMH I and ammonium of the hydrogen bonds in AMH may exhibit properties which are transferable to much more complex molecular solids

Vocadlo, Lidunka


Multi-fluid shocks in clusters of galaxies: entropy, sigma_ v-T, M-T and L_x-T scalings  

E-Print Network (OSTI)

The nonthermal phenomena in clusters of galaxies are considered in the context of the hierarchical model of cosmic structure formation by accretion and merging of the dark matter (DM) substructures.Accretion and merging processes produce large-scale gas shocks. The plasma shocks are expected to be collisionless. In the course of cluster's aggregation, the shocks, being the main gas-heating agent, generate turbulent magnetic fields and accelerate energetic particles via collisionless multi-fluid plasma relaxation processes. The intracluster gas heating and entropy production rate by a collisionless shock may differ significantly from that in a single-fluid collisional shock. Simple scaling relations for postshock ion temperature and entropy as functions of shock velocity in strong collisionless multi-fluid shocks are presented. We show that the multi-fluid nature of the collisionless shocks results in high gas compression, reduced entropy production and modified sigma_v-T, M-T and L_x-T scalings. The scaling i...

Bykov, A M



Multi-fluid shocks in clusters of galaxies: entropy, sigma_ v-T, M-T and L_x-T scalings  

E-Print Network (OSTI)

The nonthermal phenomena in clusters of galaxies are considered in the context of the hierarchical model of cosmic structure formation by accretion and merging of the dark matter (DM) substructures.Accretion and merging processes produce large-scale gas shocks. The plasma shocks are expected to be collisionless. In the course of cluster's aggregation, the shocks, being the main gas-heating agent, generate turbulent magnetic fields and accelerate energetic particles via collisionless multi-fluid plasma relaxation processes. The intracluster gas heating and entropy production rate by a collisionless shock may differ significantly from that in a single-fluid collisional shock. Simple scaling relations for postshock ion temperature and entropy as functions of shock velocity in strong collisionless multi-fluid shocks are presented. We show that the multi-fluid nature of the collisionless shocks results in high gas compression, reduced entropy production and modified sigma_v-T, M-T and L_x-T scalings. The scaling indexes estimated for a simple model of a strong accretion multi-fluid shock are generally consistent with observations. Soft X-ray and extreme ultraviolet photons dominate the emission of strong accretion shock precursors that appear as large-scale filaments. Magnetic fields, turbulence and energetic particles constitute the nonthermal components contributing into the pressure balance, energy transport and emission of clusters. Nonthermal emission of energetic particles could be a test to constrain the cluster properties.

A. M. Bykov



US Relations with Mexico and Central America, 1977-1999  

E-Print Network (OSTI)

United States Relations. Montpelier, VT: The Academy ofUnited States Relations. Montpelier, VT: The Academy ofUnited States Relations. Montpelier, VT: The Academy of

Rosenblum, Marc



New ambient pressure organic superconductors:. alpha. -(BEDT-TTF) sub 2 (NH sub 4 )Hg(SCN) sub 4 ,. beta. m-(BEDO-TTF) sub 3 Cu sub 2 (NCS) sub 3 , and. kappa. -(BEDT-TTF) sub 2 Cu(N(CN) sub 2 )Br  

Science Conference Proceedings (OSTI)

More than one hundred and twenty conducting salts based on the organic donor-molecule BEDT-TTF are known, where BEDT-TTF is bis(ethylenedithio)tetrathiafulvalene (abbreviated herein as ET). Several of the early salts possessed tetrahedral and octahedral anions, such as (ET){sub 2}ClO{sub 4}(TCE), (ET){sub 2}PF{sub 6}, (ET){sub 2}ReO{sub 4}, and (ET){sub 2}BrO{sub 4}. The perchlorate salt is metallic to 1.4 K,{sup 1} and the perrenate derivative was the first ET based organic superconductor ({Tc} 2 K, 4.5 kbar). Since the discovery of ambient pressure superconductivity in {beta}-(ET){sub 2}I{sub 3} ({Tc} 1.4 K),{sup 5} other isostructural {beta}-(ET){sub 2}X salts have been prepared with higher {Tc}'s. A structure-property correlation for the {beta}-type salts has been reviewed in this volume; it predicts that {Tc}'s higher than 8K are possible if {beta}-salts with linear anions longer than I{sub 3}{sup {minus}} can be synthesized. During the search for new linear anions, a variety of compounds with discovered with polymeric anions. The report of superconductivity in {kappa}-(ET){sub 4}Hg{sub 3}X{sub 8} (X = Cl, {Tc} 5.4 K 29 kbar and X = Br, {Tc} 4.3 K ambient pressure and 6.7 K 3.5 kbar) and {kappa}-(ET){sub 2}Cu(NCS){sub 2} ({Tc} 10.4 K) further stimulated the search for novel polymeric anions. A general synthetic strategy for preparing new salts containing polymeric anions is to couple a coordinatively unsaturated neutral transition metal halide/pseudohalide with a simple halide or pseudohalide during an electrocrystallization synthesis. In this article, the authors discuss three new ambient pressure organic superconductors with novel polymeric anions, {alpha}-(ET){sub 2}(NH{sub 4})Hg(SCN){sub 4}, {beta}m-(BO){sub 3}Cu{sub 2}(NCS){sub 3} and {kappa}-(ET){sub 2}Cu(N(CN){sub 2})Br. 48 refs., 8 figs., 2 tabs.

Wang, H.H.; Beno, M.A.; Carlson, K.D.; Geiser, U.; Kini, A.M.; Montgomery, L.K.; Thompson, J.E.; Williams, J.M.



Performance Measures for Complete, Green Streets: A Proposal for Urban Arterials in California  

E-Print Network (OSTI)

and Bicycle Policy Plan. Montpelier, VT: Vermont Agency ofand Bicycle Policy Plan. Montpelier, VT: Vermont Agency of

Macdonald, Elizabeth; Sanders, Rebecca; Anderson, Alia



Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...


Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...



owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy’s National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION



Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as



Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake


Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and… (more)

Yun, Michael




E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.



E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...

Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...


St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...


ENERGY SURETY MI ROGRID™ - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment– assists in planning and analysis of potential risks


miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha


Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.


,"Vermont Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

80SVT3","N3050VT3","N3010VT3","N3020VT3","N3035VT3","N3045VT3" "Date","Vermont Natural Gas Imports Price (Dollars per Thousand Cubic Feet)","Vermont Natural Gas Pipeline and...


The Institute for Critical Technology and Applied Science at Virginia Tech supports and promotes cutting-edge research at the intersection of engineering, science, and medicine. Please visit www.ictas.vt.edu.  

E-Print Network (OSTI)

on the basis of race, gender, disability, age, veteran status, national origin, religion, sexual orientation and Deterioration Science Construction and Renewal Engineering Public Health and Wealth Water-Energy-Climate Nexus

Beex, A. A. "Louis"


General Considerations in the Corrosion of Structures  

Science Conference Proceedings (OSTI)

Table 1   Corrosion rates of carbon steel calibrating specimens at various locations...Vancouver Island BC, Canada Rural marine 13 0.5 Detroit, MI Industrial 14.5 0.57 Fort Amidor Pier, Panama, CZ Marine 14.5 0.57 Morenci, MI Urban 19.5 0.77 Potter County, PA Rural 20 0.8 Waterbury, CT Industrial 22.8 0.89 State College, PA Rural 23 0.9 Montreal, Que. Canada Urban 23 0.9 Durham, NH Rural...


Carbon Steels  

Science Conference Proceedings (OSTI)

Table 1   Corrosion rates of carbon steel at various locations...Vancouver Island, BC, Canada Rural marine 13 0.5 Detroit, MI Industrial 14.5 0.57 Fort Amidor Pier, CZ Marine 14.5 0.57 Morenci, MI Urban 19.5 0.77 Potter County, PA Rural 20 0.8 Waterbury, CT Industrial 22.8 0.89 State College, PA Rural 23 0.9 Montreal, QC, Canada Urban 23 0.9 Durham, NH Rural 28 1.1...



U.S. Energy Information Administration (EIA) Indexed Site

VT)","VT",2013,1,1372,8449,16525,2476,15128,3706,777,5247,12,0,0,0,4625,28824,20243 7601,"Green Mountain Power Corp","VT",2013,1,28620,159754,218382,18657,134557,38190,10074,105040...


Virtualization (Panel Discussion)  

Science Conference Proceedings (OSTI)

... Perf improvements for interrupt intensive env, faster VM boot Interrupt isolation & remapping PCI-SIG ATS support Intel VT-x Intel VT-d Intel VT-c ...



Year Month U.S. Average PAD District I Average CT ME MA NH RI  

Gasoline and Diesel Fuel Update (EIA)

1995 January ........................... 86.9 87.6 86.7 77.8 84.8 78.4 87.3 85.7 88.4 102.4 February ......................... 87.4 88.2 87.8 77.4 84.9 78.5 87.3 85.9 88.5 103.4 March .............................. 86.6 87.3 87.0 76.3 82.5 77.7 87.0 85.6 87.6 103.3 April ................................ 85.4 85.8 85.2 76.7 81.9 76.6 86.5 84.8 87.0 100.0 May ................................. 86.4 86.9 86.5 78.7 84.7 75.8 86.1 84.5 85.2 93.2 June ................................ 84.6 85.2 84.2 78.1 82.5 74.5 83.2 83.9 83.0 NA July ................................. 82.0 82.4 79.4 76.9 80.6 72.9 81.7 81.7 80.0 85.1 August ............................ 80.7 81.1 77.4 76.7 80.9 73.0 85.3 81.7 82.1 W September ...................... 82.3 82.7 79.2 76.2 81.7 73.8 84.9 82.5 82.4 86.1 October ...........................


Year Month U.S. Average PAD District I Average CT ME MA NH RI  

Gasoline and Diesel Fuel Update (EIA)

1997 January ........................... 107.9 109.0 108.6 105.2 106.5 102.1 107.0 104.4 106.5 130.4 February ......................... 105.1 106.0 105.2 102.2 103.4 101.0 104.5 103.5 104.2 127.0 March .............................. 101.6 102.5 99.3 94.3 97.7 98.6 100.4 103.1 100.7 121.4 April ................................ 99.2 100.3 97.6 90.9 95.9 95.2 99.4 100.4 100.1 116.3 May ................................. 96.4 97.1 93.4 90.6 93.0 91.9 97.3 97.7 96.4 108.6 June ................................ 92.3 92.9 89.9 88.1 89.1 89.1 93.3 92.9 90.8 99.9 July ................................. 88.3 88.7 83.7 86.7 87.5 85.6 91.6 91.1 88.8 W August ............................ 86.9 86.8 84.2 85.8 84.7 85.3 91.0 92.7 89.2 W September ...................... 88.7 89.0 85.5 87.0 87.0 86.3 91.2 91.7 88.5 NA October ...........................


Year Month U.S. Average PAD District I Average CT ME MA NH RI  

Gasoline and Diesel Fuel Update (EIA)

1996 January ........................... 94.6 96.1 94.5 93.0 92.0 89.1 94.9 92.6 94.7 111.7 February ......................... 95.9 97.5 96.2 93.2 93.8 90.8 95.6 93.7 94.4 112.9 March .............................. 99.1 100.6 99.6 96.7 99.3 93.8 99.7 97.3 96.1 117.7 April ................................ 101.5 102.7 102.1 98.7 101.5 96.5 98.8 100.3 100.7 115.9 May ................................. 97.8 98.1 96.8 95.4 95.9 93.6 94.9 98.8 98.0 109.7 June ................................ 91.0 91.3 88.8 90.1 87.9 87.2 88.7 92.2 91.9 102.5 July ................................. 87.9 88.0 84.9 87.5 87.5 83.6 87.7 88.5 91.0 97.3 August ............................ 88.1 88.2 84.0 89.5 89.0 85.1 88.3 89.0 91.0 99.2 September ...................... 94.5 94.4 92.5 96.4 93.1 91.9 96.6 94.4 95.3 106.2 October ...........................



E-Print Network (OSTI)

No. KVB-15500-717B, 1978. Wendt, J.O. , Morcomb, J.T. andsulfur combustion chemistry. Wendt et al 9 and De Soete 10in agreement with the results of Wendt et al 9 Wendt et al

Lucas, Donald



Year Month U.S. Average PAD District I Average CT ME MA NH RI  

Gasoline and Diesel Fuel Update (EIA)

1994 January ........................... 89.6 91.0 90.2 83.8 88.4 80.4 87.3 88.8 92.1 102.5 February ......................... 92.9 94.6 93.8 90.4 91.3 86.6 91.4 92.3 91.5 105.5 March .............................. 91.4 92.5 92.1 85.9 88.3 83.6 89.4 91.0 91.2 102.0 April ................................ 88.2 89.0 89.4 80.8 86.0 78.2 85.1 88.3 89.2 93.7 May ................................. 86.1 86.6 85.4 76.8 85.1 75.4 83.3 86.7 84.4 83.1 June ................................ 85.2 85.6 86.1 75.6 83.7 73.1 82.3 84.6 82.0 W July ................................. 82.7 83.1 84.2 75.6 82.1 71.8 81.6 83.0 80.5 W August ............................ 82.1 82.4 79.7 78.0 78.7 72.8 84.0 83.8 82.3 81.9 September ...................... 83.2 83.7 80.5 78.5 81.1 72.9 84.7 83.3 83.1 86.2 October ........................... 84.7


Up-Hill ET in (NH3)5Ru(III)-Modified Ferrocytochrome c  

NLE Websites -- All DOE Office Websites (Extended Search)

Up-Hill Electron Transfer in Pentaammineruthenium(III)-Modified Up-Hill Electron Transfer in Pentaammineruthenium(III)-Modified Ferrocytochrome c: Rates, Thermodynamics, and the Mediating Role of the Ruthenium Moiety Ji Sun, James F. Wishart, and Stephan S. Isied Inorg. Chem. 34, 3998-4000 (1995) Abstract: At moderate to high ionic strengths (>0.1 M), Co(oxalate)33- oxidizes native cytochrome c very slowly, however it undergoes a rapid reaction with pendant ruthenium complexes covalently attached to the surface of the protein. Under these conditions, the rate of the thermodynamically unfavorable (up-hill) FeII-to-RuIII electron transfer process in pentaammineruthenium-modified horse-heart cytochrome c can be revealed using sufficiently high Co(oxalate) 33- concentrations. Rate measurements performed over a wide range of CoIII concentrations confirm the proposed


Year Month U.S. Average PAD District I Average CT ME MA NH RI  

Gasoline and Diesel Fuel Update (EIA)

1993 January ........................... 94.3 95.7 94.9 85.2 94.0 87.1 91.7 93.4 91.2 105.2 February ......................... 94.6 95.9 96.2 85.4 94.4 86.9 91.8 93.3 90.8 106.8 March .............................. 95.4 96.5 96.7 86.4 94.8 86.6 92.4 93.7 92.4 108.5 April ................................ 92.6 93.4 93.6 83.0 91.5 84.5 90.4 91.2 91.6 106.7 May ................................. 91.1 91.7 91.6 81.7 91.1 83.9 90.7 91.3 89.4 104.3 June ................................ 88.9 89.4 88.6 81.1 88.6 82.4 87.6 89.7 90.6 100.4 July ................................. 85.6 85.9 86.5 78.5 83.9 78.3 85.2 85.5 86.4 100.2 August ............................ 84.1 84.6 84.0 77.4 83.4 76.0 82.7 85.6 83.5 96.1 September ...................... 85.5 85.8 84.2 78.3 83.8 74.9 84.8 86.6 84.6 95.5 October ...........................


Structure of the Electron-Transfer Probe Analogue trans-(NH3...  

NLE Websites -- All DOE Office Websites (Extended Search)

electron transfer in cytochrome c, azurin, and myoglobin have exploited the modification of these metalloprotein surfaces with ruthenium ammine probes attached to surface...


Details in Semiconductors Gordon Conference, New London, NH, August 3-8, 2008  

SciTech Connect

Continuing its tradition of excellence, this Gordon Conference will focus on research at the forefront of the field of defects in homogeneous and structured semiconductors. The conference will have a strong emphasis on the control of defects during growth and processing, with an increases emphasis on nanostructures as compared to previous conferences. Electronic, magnetic, and optical properties of bulk, thin film, and nanoscale semiconductors will be discussed in detail. In contrast to many conferences, which tend to focus on specific semiconductors, this conference deals with defects in a broad range of bulk and nanoscale electronic materials. This approach has proved to be extremely fruitful for advancing fundamental understanding in emerging materials such as wide-band-gap semiconductors, doped nanoparticles, and organic semiconductors. Presentations of state-of-the-art theoretical methods will contribute to a fundamental understanding of atomic-scale phenomena. The program consists of about twenty invited talks, with plenty of discussion time, and a number of contributed poster sessions. Because of the large amount of discussion time, the conference provides an ideal forum for dealing with topics that are new and/or controversial.

Shengbai Zhang and Nancy Ryan Gray



Hydramotor (R) Actuator Application and Maintenance Guide: ASCO NH90 Series Hydramotors (R) for Nuclear Applications  

Science Conference Proceedings (OSTI)

Hydramotors(R), electro-hydraulic actuators manufactured by ASCO General Controls (formerly ITT Barton and ITT General Controls), are widely used in nuclear power plant systems. Many provide critical safety functions such as valve and damper operation. While Hydramotors(R) are generally very reliable, regular maintenance and overhaul is important. Improving the reliability of Hydramotor(R) actuators has become an industry focus because of the implementation of the Nuclear Regulatory Commission's Maintena...



Multi-Objective Evolutionary Fuzzy Cognitive Maps for Decision N.H. Mateou  

E-Print Network (OSTI)

motorcade as it traveled to a meeting with an opposition figure in Damascus and then trying to break

Coello, Carlos A. Coello


Trapped Lee Waves Observed during PYREX by Constant Volume Balloons: Comparison with Meso-NH Simulations  

Science Conference Proceedings (OSTI)

The main objective of the present paper is the use of a constant volume balloon (CVB) as a tool to (i) study trapped lee waves and (ii) assess the forecasting capability of a nonhydrostatic numerical model. Then, CVB data obtained during the ...

Ernest N’Dri Koffi; Marc Georgelin; Bruno Benech; Evelyne Richard


Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Update and Improve Subsection NH - Simplified Elastic and Inelastic Design Analysis Methods  

SciTech Connect

The objective of this subtask is to develop a template for the 'Ideal' high temperature design Code, in which individual topics can be identified and worked on separately in order to provide the detail necessary to comprise a comprehensive Code. Like all ideals, this one may not be attainable as a practical matter. The purpose is to set a goal for what is believed the 'Ideal' design Code should address, recognizing that some elements are not mutually exclusive and that the same objectives can be achieved in different way. Most, if not all existing Codes may therefore be found to be lacking in some respects, but this does not mean necessarily that they are not comprehensive. While this subtask does attempt to list the elements which individually or in combination are considered essential in such a Code, the authors do not presume to recommend how these elements should be implemented or even, that they should all be implemented at all. The scope of this subtask is limited to compiling the list of elements thought to be necessary or at minimum, useful in such an 'Ideal' Code; suggestions are provided as to their relationship to one another. Except for brief descriptions, where these are needed for clarification, neither this repot, nor Task 9 as a whole, attempts to address details of the contents of all these elements. Some, namely primary load limits (elastic, limit load, reference stress), and ratcheting (elastic, e-p, reference stress) are dealt with specifically in other subtasks of Task 9. All others are merely listed; the expectation is that they will either be the focus of attention of other active DOE-ASME GenIV Materials Tasks, e.g. creep-fatigue, or to be considered in future DOE-ASME GenIV Materials Tasks. Since the focus of this Task is specifically approximate methods, the authors have deemed it necessary to include some discussion on what is meant by 'approximate'. However, the topic will be addressed in one or more later subtasks. This report describes work conducted toward developing a template for what might be the 'Ideal' high temperature design Code. While attempting to be as comprehensive as possible as to subject matter, it does not presume to recommend what individual components of a Code should be implemented, some of which is the focus of other Tasks in the DOE-ASME Gen IV/NGNP Materials Projects. This report does serve as a basis for construction of an attribute chart which is being prepared as part of Task 9.2; the intention for which is to provide a uniform format and concise means for summarizing and comparing other high temperature Codes currently in use around the world.

Jeries J. Abou-Hanna; Douglas L. Marriott; Timothy E. McGreevy



Reconstructing the NH Mean Temperature: Can Underestimation of Trends and Variability Be Avoided?  

Science Conference Proceedings (OSTI)

There are indications that hemispheric-mean climate reconstructions seriously underestimate the amplitude of low-frequency variability and trends. Some of the theory of linear regression and error-in-variables models is reviewed to identify the ...

Bo Christiansen



Multipodal coordination of a tetracarboxylic crown ether with NH 4 + : A vibrational spectroscopy and computational study  

Science Conference Proceedings (OSTI)

The elucidation of the structural requirements for molecular recognition by the crown ether (18–crown–6)-2

Paola Hurtado; Francisco Gámez; Said Hamad; Bruno Martínez–Haya; Jeffrey D. Steill; Jos Oomens



Electron Transfer in (NH3)5Ru-Cobaltocytochrome c  

NLE Websites -- All DOE Office Websites (Extended Search)

Pentaammineruthenium(III)-Modified Cobaltocytochrome c Ji Sun, Chang Su, and James F. Wishart Inorg. Chem., 35, 5893-5901 (1996) Find paper at ACS Publications or use ACS...


NH3- H2O absorption systems used for research and student activities  

Science Conference Proceedings (OSTI)

In the context of the sustainable development and of the future environment and energy concerns, a new laboratory was developed based on absorption systems (a chiller-heater and a heat pump). The installation together with the proposed experimental activity ... Keywords: absorption systems, education and research activity, environment, heat pump

Ioan Boian; Alexandru Serban; Stan Fota; Florea Chiriac




E-Print Network (OSTI)

post combustion gases of propane/air in a laboratory scalepost combustion gases of propane/air in a laboratory scaleThe combustion products of propane and air are diluted by

Brown, N.J.



Continued investigations of the catalytic reduction of N? to NH? by molybdenum triamidoamine complexes  

E-Print Network (OSTI)

A study of the effects of employing different solvents and the introduction of dihydrogen during the catalytic reduction of dinitrogen to ammonia with [HIPTN 3N]Mo complexes was completed. During a catalytic reaction, the ...

Hanna, Brian S. (Brian Stewart)



Conversion for Avicel and AFEX pretreated corn stover by Clostridium thermocellum and simultaneous saccharification and fermentation: Insights into microbial conversion of pretreated cellulosic biomass  

NLE Websites -- All DOE Office Websites (Extended Search)

for for Avicel and AFEX pretreated corn stover by Clostridium thermocellum and simultaneous saccharification and fermentation: Insights into microbial conversion of pretreated cellulosic biomass Xiongjun Shao a , Mingjie Jin b,c , Anna Guseva a , Chaogang Liu d , Venkatesh Balan b,c , David Hogsett d , Bruce E. Dale b,c , Lee Lynd a,d,⇑ a Thayer School of Engineering at Dartmouth College, 8000 Cummings Hall, Hanover, NH 03755, USA b Biomass Conversion Research Laboratory (BCRL), Department of Chemical Engineering and Materials Science, Michigan State University, MBI Building, 3900 Collins Road, Lansing, MI 48910, USA c Great Lakes Bioenergy Research Center (GLBRC), Michigan State University, East Lansing, MI 48824, USA d Mascoma Corporation, 67 Etna Road, Suite 300, Lebanon, NH 03766, USA a r t i c l e i n f o Article history: Received 8 March 2011 Received in revised form 6 May 2011 Accepted


A Review of the Representation of Induced Highway Travel in Current Travel and Land Use Models  

E-Print Network (OSTI)

and User Reference Report. SACOG. Sacramento, CA.number of case studies (Sacramento, CA, Chittenden, VT, andhighway capacity in Sacramento (CA), Chittenden (VT), and

Rodier, Caroline J



Category:Utility Rate Impacts on PV Economics By Location | Open Energy  

Open Energy Info (EERE)

Utility Rate Impacts on PV Economics By Location Utility Rate Impacts on PV Economics By Location Jump to: navigation, search Impact of Utility Rates on PV Economics Montgomery, AL Little Rock, AR Flagstaff, AZ Phoenix, AZ Tucson, AZ Arcata, CA LA, CA San Francisco, CA Boulder, CO Eagle County, CO Pueblo, CO Bridgeport, CT Wilmington, DE Miami, FL Tampa, FL Atlanta, GA Savannah, GA Des Moines, IA Mason, IA Boise, ID Chicago, IL Springfield, IL Indianapolis, IN Goodland, KS Wichita, KS Lexington, KY New Orleans, LA Shreveport, LA Boston, MA Baltimore, MD Caribou, ME Portland, ME Detroit, MI Houghton-Lake, MI Traverse City, MI International Falls, MN Minneapolis, MN Kansas City, MO Jackson, MS Billings, MT Greensboro, NC Wilmington, NC Bismarck, ND Minot, ND Omaha, NE Concord, NH Atlantic City, NJ Albuquerque, NM Las Vegas, NV Reno, NV New York, NY


U.S. LNG Imports from Canada  

Gasoline and Diesel Fuel Update (EIA)

Noyes, MN Warroad, MN Babb, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Galvan Ranch, TX LNG Imports from Algeria LNG Imports from Australia LNG Imports from Brunei LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Elba Island, GA Freeport, TX Gulf LNG, MS LNG Imports from Equatorial Guinea LNG Imports from Indonesia LNG Imports from Malaysia LNG Imports from Nigeria Cove Point, MD LNG Imports from Norway Cove Point, MD Freeport, TX Sabine Pass, LA LNG Imports from Oman LNG Imports from Peru Cameron, LA Freeport, TX LNG Imports from Qatar Elba Island, GA Golden Pass, TX Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Sabine Pass, LA LNG Imports from United Arab Emirates LNG Imports from Yemen Everett, MA Freeport, TX Sabine Pass, LA LNG Imports from Other Countries Period: Monthly Annual


U.S. LNG Imports from Norway  

Gasoline and Diesel Fuel Update (EIA)

Noyes, MN Warroad, MN Babb, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Galvan Ranch, TX LNG Imports from Algeria LNG Imports from Australia LNG Imports from Brunei LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Elba Island, GA Freeport, TX Gulf LNG, MS LNG Imports from Equatorial Guinea LNG Imports from Indonesia LNG Imports from Malaysia LNG Imports from Nigeria Cove Point, MD LNG Imports from Norway Cove Point, MD Freeport, TX Sabine Pass, LA LNG Imports from Oman LNG Imports from Peru Cameron, LA Freeport, TX LNG Imports from Qatar Elba Island, GA Golden Pass, TX Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Sabine Pass, LA LNG Imports from United Arab Emirates LNG Imports from Yemen Everett, MA Freeport, TX Sabine Pass, LA LNG Imports from Other Countries Period: Monthly Annual


U.S. LNG Imports from Equatorial Guinea  

Gasoline and Diesel Fuel Update (EIA)

Noyes, MN Warroad, MN Babb, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Galvan Ranch, TX LNG Imports from Algeria LNG Imports from Australia LNG Imports from Brunei LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Elba Island, GA Freeport, TX Gulf LNG, MS LNG Imports from Equatorial Guinea LNG Imports from Indonesia LNG Imports from Malaysia LNG Imports from Nigeria Cove Point, MD LNG Imports from Norway Cove Point, MD Freeport, TX Sabine Pass, LA LNG Imports from Oman LNG Imports from Peru Cameron, LA Freeport, TX LNG Imports from Qatar Elba Island, GA Golden Pass, TX Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Sabine Pass, LA LNG Imports from United Arab Emirates LNG Imports from Yemen Everett, MA Freeport, TX Sabine Pass, LA LNG Imports from Other Countries Period: Monthly Annual


U.S. LNG Imports from Australia  

Gasoline and Diesel Fuel Update (EIA)

Noyes, MN Warroad, MN Babb, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Galvan Ranch, TX LNG Imports from Algeria LNG Imports from Australia LNG Imports from Brunei LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Elba Island, GA Freeport, TX Gulf LNG, MS LNG Imports from Equatorial Guinea LNG Imports from Indonesia LNG Imports from Malaysia LNG Imports from Nigeria Cove Point, MD LNG Imports from Norway Cove Point, MD Freeport, TX Sabine Pass, LA LNG Imports from Oman LNG Imports from Peru Cameron, LA Freeport, TX LNG Imports from Qatar Elba Island, GA Golden Pass, TX Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Sabine Pass, LA LNG Imports from United Arab Emirates LNG Imports from Yemen Everett, MA Freeport, TX Sabine Pass, LA LNG Imports from Other Countries Period: Monthly Annual


U.S. LNG Imports from United Arab Emirates  

Gasoline and Diesel Fuel Update (EIA)

Noyes, MN Warroad, MN Babb, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Galvan Ranch, TX LNG Imports from Algeria LNG Imports from Australia LNG Imports from Brunei LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Elba Island, GA Freeport, TX Gulf LNG, MS LNG Imports from Equatorial Guinea LNG Imports from Indonesia LNG Imports from Malaysia LNG Imports from Nigeria Cove Point, MD LNG Imports from Norway Cove Point, MD Freeport, TX Sabine Pass, LA LNG Imports from Oman LNG Imports from Peru Cameron, LA Freeport, TX LNG Imports from Qatar Elba Island, GA Golden Pass, TX Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Sabine Pass, LA LNG Imports from United Arab Emirates LNG Imports from Yemen Everett, MA Freeport, TX Sabine Pass, LA LNG Imports from Other Countries Period: Monthly Annual


U.S. LNG Imports from Other Countries  

Gasoline and Diesel Fuel Update (EIA)

Noyes, MN Warroad, MN Babb, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Galvan Ranch, TX LNG Imports from Algeria LNG Imports from Australia LNG Imports from Brunei LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Elba Island, GA Freeport, TX Gulf LNG, MS LNG Imports from Equatorial Guinea LNG Imports from Indonesia LNG Imports from Malaysia LNG Imports from Nigeria Cove Point, MD LNG Imports from Norway Cove Point, MD Freeport, TX Sabine Pass, LA LNG Imports from Oman LNG Imports from Peru Cameron, LA Freeport, TX LNG Imports from Qatar Elba Island, GA Golden Pass, TX Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Sabine Pass, LA LNG Imports from United Arab Emirates LNG Imports from Yemen Everett, MA Freeport, TX Sabine Pass, LA LNG Imports from Other Countries Period: Monthly Annual


U.S. LNG Imports from Egypt  

Gasoline and Diesel Fuel Update (EIA)

Noyes, MN Warroad, MN Babb, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Galvan Ranch, TX LNG Imports from Algeria LNG Imports from Australia LNG Imports from Brunei LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Elba Island, GA Freeport, TX Gulf LNG, MS LNG Imports from Equatorial Guinea LNG Imports from Indonesia LNG Imports from Malaysia LNG Imports from Nigeria Cove Point, MD LNG Imports from Norway Cove Point, MD Freeport, TX Sabine Pass, LA LNG Imports from Oman LNG Imports from Peru Cameron, LA Freeport, TX LNG Imports from Qatar Elba Island, GA Golden Pass, TX Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Sabine Pass, LA LNG Imports from United Arab Emirates LNG Imports from Yemen Everett, MA Freeport, TX Sabine Pass, LA LNG Imports from Other Countries Period: Monthly Annual


U.S. LNG Imports from Malaysia  

Gasoline and Diesel Fuel Update (EIA)

Noyes, MN Warroad, MN Babb, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Galvan Ranch, TX LNG Imports from Algeria LNG Imports from Australia LNG Imports from Brunei LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Elba Island, GA Freeport, TX Gulf LNG, MS LNG Imports from Equatorial Guinea LNG Imports from Indonesia LNG Imports from Malaysia LNG Imports from Nigeria Cove Point, MD LNG Imports from Norway Cove Point, MD Freeport, TX Sabine Pass, LA LNG Imports from Oman LNG Imports from Peru Cameron, LA Freeport, TX LNG Imports from Qatar Elba Island, GA Golden Pass, TX Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Sabine Pass, LA LNG Imports from United Arab Emirates LNG Imports from Yemen Everett, MA Freeport, TX Sabine Pass, LA LNG Imports from Other Countries Period: Monthly Annual


U.S. LNG Imports from Peru  

Gasoline and Diesel Fuel Update (EIA)

Noyes, MN Warroad, MN Babb, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Galvan Ranch, TX LNG Imports from Algeria LNG Imports from Australia LNG Imports from Brunei LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Elba Island, GA Freeport, TX Gulf LNG, MS LNG Imports from Equatorial Guinea LNG Imports from Indonesia LNG Imports from Malaysia LNG Imports from Nigeria Cove Point, MD LNG Imports from Norway Cove Point, MD Freeport, TX Sabine Pass, LA LNG Imports from Oman LNG Imports from Peru Cameron, LA Freeport, TX LNG Imports from Qatar Elba Island, GA Golden Pass, TX Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Sabine Pass, LA LNG Imports from United Arab Emirates LNG Imports from Yemen Everett, MA Freeport, TX Sabine Pass, LA LNG Imports from Other Countries Period: Monthly Annual


U.S. LNG Imports from Trinidad/Tobago  

Gasoline and Diesel Fuel Update (EIA)

Noyes, MN Warroad, MN Babb, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Galvan Ranch, TX LNG Imports from Algeria LNG Imports from Australia LNG Imports from Brunei LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Elba Island, GA Freeport, TX Gulf LNG, MS LNG Imports from Equatorial Guinea LNG Imports from Indonesia LNG Imports from Malaysia LNG Imports from Nigeria Cove Point, MD LNG Imports from Norway Cove Point, MD Freeport, TX Sabine Pass, LA LNG Imports from Oman LNG Imports from Peru Cameron, LA Freeport, TX LNG Imports from Qatar Elba Island, GA Golden Pass, TX Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Sabine Pass, LA LNG Imports from United Arab Emirates LNG Imports from Yemen Everett, MA Freeport, TX Sabine Pass, LA LNG Imports from Other Countries Period: Monthly Annual

Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


U.S. LNG Imports from Algeria  

Gasoline and Diesel Fuel Update (EIA)

Noyes, MN Warroad, MN Babb, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Galvan Ranch, TX LNG Imports from Algeria LNG Imports from Australia LNG Imports from Brunei LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Elba Island, GA Freeport, TX Gulf LNG, MS LNG Imports from Equatorial Guinea LNG Imports from Indonesia LNG Imports from Malaysia LNG Imports from Nigeria Cove Point, MD LNG Imports from Norway Cove Point, MD Freeport, TX Sabine Pass, LA LNG Imports from Oman LNG Imports from Peru Cameron, LA Freeport, TX LNG Imports from Qatar Elba Island, GA Golden Pass, TX Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Sabine Pass, LA LNG Imports from United Arab Emirates LNG Imports from Yemen Everett, MA Freeport, TX Sabine Pass, LA LNG Imports from Other Countries Period: Monthly Annual


U.S. LNG Imports from Nigeria  

Gasoline and Diesel Fuel Update (EIA)

Noyes, MN Warroad, MN Babb, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Galvan Ranch, TX LNG Imports from Algeria LNG Imports from Australia LNG Imports from Brunei LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Elba Island, GA Freeport, TX Gulf LNG, MS LNG Imports from Equatorial Guinea LNG Imports from Indonesia LNG Imports from Malaysia LNG Imports from Nigeria Cove Point, MD LNG Imports from Norway Cove Point, MD Freeport, TX Sabine Pass, LA LNG Imports from Oman LNG Imports from Peru Cameron, LA Freeport, TX LNG Imports from Qatar Elba Island, GA Golden Pass, TX Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Sabine Pass, LA LNG Imports from United Arab Emirates LNG Imports from Yemen Everett, MA Freeport, TX Sabine Pass, LA LNG Imports from Other Countries Period: Monthly Annual


U.S. LNG Imports from Qatar  

Gasoline and Diesel Fuel Update (EIA)

Noyes, MN Warroad, MN Babb, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Galvan Ranch, TX LNG Imports from Algeria LNG Imports from Australia LNG Imports from Brunei LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Elba Island, GA Freeport, TX Gulf LNG, MS LNG Imports from Equatorial Guinea LNG Imports from Indonesia LNG Imports from Malaysia LNG Imports from Nigeria Cove Point, MD LNG Imports from Norway Cove Point, MD Freeport, TX Sabine Pass, LA LNG Imports from Oman LNG Imports from Peru Cameron, LA Freeport, TX LNG Imports from Qatar Elba Island, GA Golden Pass, TX Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Sabine Pass, LA LNG Imports from United Arab Emirates LNG Imports from Yemen Everett, MA Freeport, TX Sabine Pass, LA LNG Imports from Other Countries Period: Monthly Annual


U.S. LNG Imports from Yemen  

Gasoline and Diesel Fuel Update (EIA)

Noyes, MN Warroad, MN Babb, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Galvan Ranch, TX LNG Imports from Algeria LNG Imports from Australia LNG Imports from Brunei LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Elba Island, GA Freeport, TX Gulf LNG, MS LNG Imports from Equatorial Guinea LNG Imports from Indonesia LNG Imports from Malaysia LNG Imports from Nigeria Cove Point, MD LNG Imports from Norway Cove Point, MD Freeport, TX Sabine Pass, LA LNG Imports from Oman LNG Imports from Peru Cameron, LA Freeport, TX LNG Imports from Qatar Elba Island, GA Golden Pass, TX Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Sabine Pass, LA LNG Imports from United Arab Emirates LNG Imports from Yemen Everett, MA Freeport, TX Sabine Pass, LA LNG Imports from Other Countries Period: Monthly Annual


U.S. Total Exports  

Gasoline and Diesel Fuel Update (EIA)

Noyes, MN Warroad, MN Babb, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Galvan Ranch, TX LNG Imports from Algeria LNG Imports from Australia LNG Imports from Brunei LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Elba Island, GA Freeport, TX Gulf LNG, MS LNG Imports from Equatorial Guinea LNG Imports from Indonesia LNG Imports from Malaysia LNG Imports from Nigeria Cove Point, MD LNG Imports from Norway Cove Point, MD Freeport, TX Sabine Pass, LA LNG Imports from Oman LNG Imports from Peru Cameron, LA Freeport, TX LNG Imports from Qatar Elba Island, GA Golden Pass, TX Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Sabine Pass, LA LNG Imports from United Arab Emirates LNG Imports from Yemen Everett, MA Freeport, TX Sabine Pass, LA LNG Imports from Other Countries Period: Monthly Annual


U.S. LNG Imports from Indonesia  

Gasoline and Diesel Fuel Update (EIA)

Noyes, MN Warroad, MN Babb, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Galvan Ranch, TX LNG Imports from Algeria LNG Imports from Australia LNG Imports from Brunei LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Elba Island, GA Freeport, TX Gulf LNG, MS LNG Imports from Equatorial Guinea LNG Imports from Indonesia LNG Imports from Malaysia LNG Imports from Nigeria Cove Point, MD LNG Imports from Norway Cove Point, MD Freeport, TX Sabine Pass, LA LNG Imports from Oman LNG Imports from Peru Cameron, LA Freeport, TX LNG Imports from Qatar Elba Island, GA Golden Pass, TX Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Sabine Pass, LA LNG Imports from United Arab Emirates LNG Imports from Yemen Everett, MA Freeport, TX Sabine Pass, LA LNG Imports from Other Countries Period: Monthly Annual


New England Wind Forum: Interviews with Wind Industry Stakeholders and  

Wind Powering America (EERE)

Small Wind Small Wind Large Wind Newsletter Perspectives Events Quick Links to States CT MA ME NH RI VT Bookmark and Share Interviews With Wind Industry Stakeholders and Pioneers in New England The New England Wind Forum will interview different stakeholders actively shaping the wind power landscape in New England and wind pioneers to examine how they have laid the groundwork for today's New England wind energy market. Stephan Wollenburg, Green Energy Program Director of Energy Consumers Alliance of New England January 2013 A Panel of Seven Offer Insight into the Evolving Drivers and Challenges Facing Wind Development in New England June 2011 John Norden, Manager of Renewable Resource Integration, Independent System Operator-New England September 2010 Angus King, Former Governor of Maine and Co-Founder of Independence Wind


New England Wind Forum: New England Wind Forum Newsletter  

Wind Powering America (EERE)

Projects in New England Building Wind Energy in New England Wind Resource Wind Power Technology Economics Markets Siting Policy Technical Challenges Issues Small Wind Large Wind Newsletter Perspectives Events Quick Links to States CT MA ME NH RI VT Bookmark and Share New England Wind Forum Newsletter Follow news from the New England Wind Forum by subscribing to its newsletter. Newsletter The New England Wind Forum Newsletter informs stakeholders of New England Wind Energy Education Project announcements, plus, events, project, siting, and policy updates. Enter your email address below to begin the registration process. After you subscribe to the New England Wind Forum Newsletter, you can choose to subscribe to other energy efficiency and renewable energy news. Archived copies of this e-newsletter are not available, but all of the news items can be found on this website under news, events, and publications. If you have ideas or news items to contribute for future issues, please contact Sustainable Energy Advantage.


New England Wind Forum: New England Regional and State Activities  

Wind Powering America (EERE)

Connecticut Connecticut Maine Massachusetts New Hampshire Rhode Island Vermont Projects in New England Building Wind Energy in New England Newsletter Perspectives Events Quick Links to States CT MA ME NH RI VT Bookmark and Share New England Activities Although much of the wind-power-related activity in the New England region occurs at the state level, regional activities and organizations are also prevalent. For state-specific wind power activities and information, follow the links to specific states on the left-hand menu. Operating and Planned Wind Projects A clickable regional map provides information on operating and planned wind projects in New England. Regional Resource Agencies Northeast States for Coordinated Air Use Management New England Governors Conference


New England Wind Forum: Building Wind Energy in New England  

Wind Powering America (EERE)

Projects in New England Building Wind Energy in New England Wind Resource Wind Power Technology Economics Markets Siting Policy Technical Challenges Issues Small Wind Large Wind Newsletter Perspectives Events Quick Links to States CT MA ME NH RI VT Bookmark and Share Building Wind Energy in New England Many factors influence the ability to develop wind power in the New England region. A viable project requires the right site and the right technology for the application. It must provide suitable revenue or economic value to justify investment in this capital-intensive but zero-fuel technology. Policy initiatives are in place throughout the region to support the expansion of wind power's role in the regional supply mix. However, issues affecting public acceptance of wind projects in host communities must be addressed. Information on topics affecting wind power development in New England can be found by using the navigation to the left.


New England Wind Forum: New England Wind Resources  

Wind Powering America (EERE)

New England Wind Forum About the New England Wind Forum New England Wind Energy Education Project Historic Wind Development in New England State Activities Projects in New England Building Wind Energy in New England Wind Resources Wind Power Technology Economics Markets Siting Policy Technical Challenges Issues Small Wind Large Wind Newsletter Perspectives Events Quick Links to States CT MA ME NH RI VT Bookmark and Share New England Wind Resources Go to the Vermont wind resource map. Go to the New Hampshire wind resource map. Go to the Maine wind resource map. Go to the Massachusetts wind resource map. Go to the Connecticut wind resource map. Go to the Rhode Island wind resource map. New England Wind Resource Maps Wind resources maps of Connecticut, Massachusetts, Maine, New Hampshire, Rhode Island, and Vermont.


Wind Powering America: New England Wind Forum  

Wind Powering America (EERE)

About the New England Wind Forum About the New England Wind Forum New England Wind Energy Education Project Historic Wind Development in New England State Activities Projects in New England Building Wind Energy in New England Wind Resource Wind Power Technology Economics Markets Siting Policy Technical Challenges Issues Small Wind Large Wind Newsletter Perspectives Events Quick Links to States CT MA ME NH RI VT Bookmark and Share The New England Wind Forum was conceived in 2005 as a platform to provide a single, comprehensive and objective source of up-to-date, Web-based information on a broad array of wind-energy-related issues pertaining to New England. The New England Wind Forum provides information to wind energy stakeholders through Web site features, periodic newsletters, and outreach activities. The New England Wind Forum covers the most frequently discussed wind energy topics.


New England Wind Forum: News  

Wind Powering America (EERE)

Connecticut Connecticut Maine Massachusetts New Hampshire Rhode Island Vermont Projects in New England Building Wind Energy in New England Newsletter Perspectives Events Quick Links to States CT MA ME NH RI VT Bookmark and Share News This page lists news for New England. Some of the following documents are available as Adobe Acrobat PDFs. Download Adobe Reader. Total of 251 records found. Page 1 of 26, Sorted by descending date Filtered by: News and Potential New England Wind Forum Information 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 Next Page >> Date sort by ascending date sort by descending date State sort by ascending state sort by descending state Type of Information Program Area Title sort by ascending title sort by descending title More Details


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

8 Air Conditioning in Homes in Northeast Region, Divisions, and States, 2009" 8 Air Conditioning in Homes in Northeast Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Northeast Census Region" ,,,"New England Census Division",,,"Middle Atlantic Census Division" ,"Total U.S.1 (millions)",,"Total New England",,,"Total Middle Atlantic" ,,"Total Northeast",,,"CT, ME, NH, RI, VT" "Air Conditioning",,,,"MA",,,"NY","PA","NJ" "Total Homes",113.6,20.8,5.5,2.5,3,15.3,7.2,4.9,3.2 "Air Conditioning Equipment" "Use Air Conditioning Equipment",94,16.5,3.9,1.9,2,12.6,5.3,4.4,2.9 "Have Air Conditioning Equipment But"


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

8 Home Appliances in Homes in Northeast Region, Divisions, and States, 2009" 8 Home Appliances in Homes in Northeast Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Northeast Census Region" ,,,"New England Census Division",,,"Middle Atlantic Census Division" ,"Total U.S.1 (millions)",,"Total New England",,,"Total Middle Atlantic" ,,"Total Northeast",,,"CT, ME, NH, RI, VT" "Home Appliances",,,,"MA",,,"NY","PA","NJ" "Total Homes",113.6,20.8,5.5,2.5,3,15.3,7.2,4.9,3.2 "Cooking Appliances" "Stoves (Units With Both" "an Oven and a Cooktop)" "Use a Stove",102.3,19.2,5.2,2.3,2.8,14.1,6.8,4.6,2.7


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

8 Fuels Used and End Uses in Homes in Northeast Region, Divisions, and States, 2009" 8 Fuels Used and End Uses in Homes in Northeast Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Northeast Census Region" ,,,"New England Census Division",,,"Middle Atlantic Census Division" ,"Total U.S.1 (millions)",,"Total New England",,,"Total Middle Atlantic" ,,"Total Northeast",,,"CT, ME, NH, RI, VT" "Fuels Used and End Uses",,,,"MA",,,"NY","PA","NJ" "Total Homes",113.6,20.8,5.5,2.5,3,15.3,7.2,4.9,3.2 "Fuels Used for Any Use" "Electricity",113.6,20.8,5.5,2.5,3,15.3,7.2,4.9,3.2 "Natural Gas",69.2,13.8,2.9,1.7,1.1,10.9,5.7,2.3,2.8


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

8 Computers and Other Electronics in Homes in Northeast Region, Divisions, and States, 2009" 8 Computers and Other Electronics in Homes in Northeast Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Northeast Census Region" ,,,"New England Census Division",,,"Middle Atlantic Census Division" ,"Total U.S.1 (millions)",,"Total New England",,,"Total Middle Atlantic" ,,"Total Northeast",,,"CT, ME, NH, RI, VT" "Computers and Other Electronics",,,,"MA",,,"NY","PA","NJ" "Total Homes",113.6,20.8,5.5,2.5,3,15.3,7.2,4.9,3.2 "Computers" "Number of Computers" 0,27.4,4.7,1,0.5,0.5,3.7,1.7,1.4,0.5 1,46.9,8.7,2.3,1,1.3,6.4,3.2,2,1.2 2,24.3,4.3,1.2,0.5,0.7,3.1,1.4,0.9,0.8


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

8 Televisions in Homes in Northeast Region, Divisions, and States, 2009" 8 Televisions in Homes in Northeast Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Northeast Census Region" ,,,"New England Census Division",,,"Middle Atlantic Census Division" ,"Total U.S.1 (millions)",,"Total New England",,,"Total Middle Atlantic" ,,"Total Northeast",,,"CT, ME, NH, RI, VT" "Televisions",,,,"MA",,,"NY","PA","NJ" "Total Homes",113.6,20.8,5.5,2.5,3,15.3,7.2,4.9,3.2 "Televisions" "Number of Televisions" 0,1.5,0.4,0.1,0.1,"Q",0.2,"Q","Q","Q" 1,24.2,4.6,1.2,0.6,0.6,3.5,2,1,0.4


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

8 Space Heating in U.S. Homes in Northeast Region, Divisions, and States, 2009" 8 Space Heating in U.S. Homes in Northeast Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Northeast Census Region" ,,,"New England Census Division",,,"Middle Atlantic Census Division" ,"Total U.S.1 (millions)",,"Total New England",,,"Total Middle Atlantic" ,,"Total Northeast",,,"CT, ME, NH, RI, VT" "Space Heating",,,,"MA",,,"NY","PA","NJ" "Total Homes",113.6,20.8,5.5,2.5,3,15.3,7.2,4.9,3.2 "Space Heating Equipment" "Use Space Heating Equipment",110.1,20.8,5.5,2.5,3,15.3,7.2,4.9,3.2 "Have Space Heating Equipment But Do "


,"Housing Units1","Average Square Footage Per Housing Unit",,,"Average Square Footage Per Household Member"  

U.S. Energy Information Administration (EIA) Indexed Site

0 Average Square Footage of Northeast Homes, by Housing Characteristics, 2009" 0 Average Square Footage of Northeast Homes, by Housing Characteristics, 2009" " Final" ,"Housing Units1","Average Square Footage Per Housing Unit",,,"Average Square Footage Per Household Member" "Housing Characteristics","Millions","Total2","Heated","Cooled","Total2","Heated","Cooled" "Total Northeast",20.8,2121,1663,921,836,656,363 "Northeast Divisions and States" "New England",5.5,2232,1680,625,903,680,253 "Massachusetts",2.5,2076,1556,676,850,637,277 "CT, ME, NH, RI, VT",3,2360,1781,583,946,714,234 "Mid-Atlantic",15.3,2080,1657,1028,813,647,402

Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Preliminary Release: April 19, 2012  

U.S. Energy Information Administration (EIA) Indexed Site

2 Total Square Footage of Northeast Homes, by Housing Characteristics, 2009" 2 Total Square Footage of Northeast Homes, by Housing Characteristics, 2009" " Final" ,,"Total Square Footage" ,"Housing Units1","Total2","Heated","Cooled" "Housing Characteristics","Millions","Billions","Billions","Billions" "Total Northeast",20.8,44.1,34.5,19.1 "Northeast Divisions and States" "New England",5.5,12.3,9.3,3.4 "Massachusetts",2.5,5.1,3.9,1.7 "CT, ME, NH, RI, VT",3,7.2,5.4,1.8 "Mid-Atlantic",15.3,31.7,25.3,15.7 "New York",7.2,13.2,10.6,4.9 "Pennsylvania",4.9,11,8.4,5.9 "New Jersey",3.2,7.6,6.2,4.9 "Urban and Rural3"


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

8 Household Demographics of Homes in Northeast Region, Divisions, and States, 2009" 8 Household Demographics of Homes in Northeast Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Northeast Census Region" ,,,"New England Census Division",,,"Middle Atlantic Census Division" ,"Total U.S.1 (millions)",,"Total New England",,,"Total Middle Atlantic" ,,"Total Northeast",,,"CT, ME, NH, RI, VT" "Household Demographics",,,,"MA",,,"NY","PA","NJ" "Total Homes",113.6,20.8,5.5,2.5,3,15.3,7.2,4.9,3.2 "Number of Household Members" "1 Person",31.3,6,1.5,0.7,0.8,4.5,2.1,1.6,0.8 "2 Persons",35.8,6.3,1.8,0.8,1,4.5,2,1.5,0.9


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

8 Structural and Geographic Characteristics of Homes in Northeast Region, Divisions, and States, 2009" 8 Structural and Geographic Characteristics of Homes in Northeast Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Northeast Census Region" ,,,"New England Census Division",,,"Middle Atlantic Census Division" ,"Total U.S.1 (millions)",,"Total New England",,,"Total Middle Atlantic" "Structural and Geographic Characteristics",,"Total Northeast",,,"CT, ME, NH, RI, VT" ,,,,"MA",,,"NY","PA","NJ" "Total Homes",113.6,20.8,5.5,2.5,3,15.3,7.2,4.9,3.2 "Urban and Rural2" "Urban",88.1,18,4.4,2.2,2.2,13.6,6.6,3.9,3.1 "Rural",25.5,2.8,1.1,0.3,0.8,1.7,0.6,1,"Q"


New England Wind Forum: Publications  

Wind Powering America (EERE)

Connecticut Connecticut Maine Massachusetts New Hampshire Rhode Island Vermont Projects in New England Building Wind Energy in New England Newsletter Perspectives Events Quick Links to States CT MA ME NH RI VT Bookmark and Share Publications This page lists publications for New England. Some of the following documents are available as Adobe Acrobat PDFs. Download Adobe Reader. Total of 298 records found. Page 1 of 30, Sorted by descending date Filtered by: Publication and Potential New England Wind Forum Information 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Next Page >> Date sort by ascending date sort by descending date State sort by ascending state sort by descending state Type of Information Program Area Title sort by ascending title sort by descending title More Details


New England Wind Forum: Wind Power Economics  

Wind Powering America (EERE)

State Activities Projects in New England Building Wind Energy in New England Wind Resource Wind Power Technology Economics Cost Components Determining Factors Influencing Wind Economics in New England How does wind compare to the cost of other electricity options? Markets Siting Policy Technical Challenges Issues Small Wind Large Wind Newsletter Perspectives Events Quick Links to States CT MA ME NH RI VT Bookmark and Share Wind Power Economics Long-Term Cost Trends Since the first major installations of commercial-scale wind turbines in the 1980s, the cost of energy from wind power projects has decreased substantially due to larger turbine generators, towers, and rotor lengths; scale economies associated with larger projects; improvements in manufacturing efficiency, and technological advances in turbine generator and blade design. These technological advances have allowed for higher generating capacities per turbine and more efficient capture of wind, especially at lower wind speeds.


New England Wind Forum: Large Wind  

Wind Powering America (EERE)

Small Wind Small Wind Large Wind Newsletter Perspectives Events Quick Links to States CT MA ME NH RI VT Bookmark and Share Large Wind When establishing wind farms, wind energy developers generally approach landowners where they want to build. Interest in wind farms is frequently spurred by external pressures such as tax and other financial incentives and legislative mandates. Since each situation is influenced by local policies and permitting, we can only provide general guidance to help you learn about the process of installing wind turbines. Publications Wind Project Development Process Permitting of Wind Energy Facilities: A Handbook. (August 2002). National Wind Coordinating Collaborative. Landowner Frequently Asked Questions and Answers. (August 2003). "State Wind Working Group Handbook." pp. 130-133.


New England Wind Forum: New England Wind Projects  

Wind Powering America (EERE)

Projects in New England Building Wind Energy in New England Wind Resource Wind Power Technology Economics Markets Siting Policy Technical Challenges Issues Small Wind Large Wind Newsletter Perspectives Events Quick Links to States CT MA ME NH RI VT Bookmark and Share New England Wind Projects This page shows the location of installed and planned New England wind projects. Find windfarms, community-scale wind projects, customer-sited wind projects, small wind projects, and offshore wind projects. Read more information about how to use the Google Map and how to add your wind project to the map. Text version New England Wind Energy Projects Connecticut, East Canaan Wind Connecticut, Klug Farm Connecticut, Phoenix Press Connecticut, Wind Colebrook (South and North)


New England Wind Forum: Past Webinars  

Wind Powering America (EERE)

Connecticut Connecticut Maine Massachusetts New Hampshire Rhode Island Vermont Projects in New England Building Wind Energy in New England Newsletter Perspectives Events Past Webinars Quick Links to States CT MA ME NH RI VT Bookmark and Share Past Webinars Here you will find audio visual files and transcripts of webinars hosted by the New England Wind Energy Project (NEWEEP). You can also learn about upcoming NEWEEP webinars. Title: Wind Power as a Neighbor: Experience with Techniques for Mitigating Public Impacts: A NEWEEP Webinar Speaker(s): Charles Newcomb, National Renewable Energy Laboratory; John Knab, Sheldon, NY; Nils Bolgen, Massachusetts Clean Energy Center Date: 12/7/2011 Running time: 2 hour, 20 minutes Title: Understanding the Current Science, Regulation, and Mitigation of Shadow Flicker: A NEWEEP Webinar


New England Wind Forum: New England Wind Energy Education Project  

Wind Powering America (EERE)

Webinars Webinars Conference Historic Wind Development in New England State Activities Projects in New England Building Wind Energy in New England Newsletter Perspectives Events Quick Links to States CT MA ME NH RI VT Bookmark and Share New England Wind Energy Education Project The New England Wind Energy Education Project (NEWEEP) is designed to complement the New England Wind Forum website and newsletter as a comprehensive source of objective information on wind energy issues in the New England region. The project, funded by the U.S. Department of Energy's (DOE's) former Wind Powering America Initiative under a 2-year grant, began as an eight-part webinar series and a conference. The NEWEEP webinar series provides the public with objective information to allow informed decisions about proposed wind energy projects throughout the New England region.



co-fabricated filtration system for enhancement of ... increases functionality and integration of micro ... for the U.S. Department of Energy’s National Nuclear ...


May All Good Things Gather Here: Life, Religion and Marriage in a Mi nyag Tibetan Village  

E-Print Network (OSTI)

;#15; #29;#31;#3;#14;#12; 3 #11;#5;#12;#6;#3;#20; #8;#20; #31;#6;#7; #29;#7;#5;8#16;#11;#3; #14; #15;#7;#5;#14;#3;#19;#5;#17;.#7;#5; #5;#14; #14;#5;#7;#8; #5;#7;#8;#11;#12; #6;#5;#20;#5;9 : ?@AB@A : >C?DEFGH@AB@A : CIH@AB@A : EKDLMAB@A : N...

Bkra shis bzang po



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

DOE Green Energy (OSTI)

gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



ANRV286-MI60-17 ARI 25 May 2006 23:56 The Bacterial  

E-Print Network (OSTI)

Molecular Genetics and Microbiology, University of Texas, Austin, Texas 78712-0231; email: philipl energy-transducing membranes (133). It is widespread within the microbial world and in plants. Homologs

Georgiou, George


UCRL-MI-224010 ARM-06-012 ARM's Support for GCM Improvement:...  

NLE Websites -- All DOE Office Websites (Extended Search)

updrafts. Because the total mass of water condensed into clouds is controlled by thermodynamics, a greater number of droplets for the same mass of cloud water means that the...


Technical Section: CHuMI viewer: Compressive huge mesh interactive viewer  

Science Conference Proceedings (OSTI)

The preprocessing of large meshes to provide and optimize interactive visualization implies a complete reorganization that often introduces significant data growth. This is detrimental to storage and network transmission, but in the near future could ... Keywords: Interactive visualization, Large meshes, Lossless compression, Out-of-core

Clément Jamin; Pierre-Marie Gandoin; Samir Akkouche



LAT HING MI RO OPTI AL SWIT H - Home - Energy Innovation ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy’s National Nuclear Security Administration. SAND # 2013-10084P


Classes Are Starting Soon! Prof"..roMI Photography G,aph~ o..,rgn  

E-Print Network (OSTI)

Simone Gori and Val HamburQer, then atthe UnOiersily of FreiburQ in Germany, is a noyel Yariation ofthe .... S~deshows > Mind~Br'" Combiml1iOll of the RO'il1illU_liKed_lilies ""d Enigma Gori and HamburQer


Superfund Record of Decision (EPA Region 5): Wash King Laundry, Baldwin, MI, March 1993  

SciTech Connect

This decision document presents the selected remedial action for the Wash King Laundry Superfund site in Baldwin, Pleasant Plains Township, Michigan. The groundwater remedial action consists of the following: groundwater monitoring; deed restrictions; and groundwater extraction with physical/chemical treatment. The lagoon remedial action consists of the following: excavation of contaminated sediments and soils and off-site disposal.



Characterization of UNUSUAL LATERAL ORGANS : a miRNA regulated F-Box protein  

E-Print Network (OSTI)

between ULO and the HD-ZIP proteins in planta. Anotherof homodomain-leucine zipper (HD-Zip) proteins. Plant SignalKANADI and class III HD-Zip gene families regulate embryo

Smith, Peter Thomas



Integrated modeling within a Hydrologic Information System: An OpenMI based approach  

Science Conference Proceedings (OSTI)

This paper presents a prototype software system for integrated environmental modeling that provides interoperability between the Consortium of Universities for the Advancement of Hydrologic Science, Inc. (CUAHSI) Hydrologic Information System (HIS) and ... Keywords: Data management, Environmental management, Integrated modeling, Systems analysis

Anthony M. Castronova; Jonathan L. Goodall; Mehmet B. Ercan


Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


"Orgulloso de mi Caserío y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetón  

E-Print Network (OSTI)

Puertorriqueña. Humacao, Puerto Rico: Editorial Furidi,and Colonization of Puerto Rico, 1493-1599. San Juan: Centroand U.S. Imperialism in Puerto Rico. Berkeley: University of

Rivera, Petra Raquel



"Orgulloso de mi Caserío y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetón.  

E-Print Network (OSTI)

??My dissertation examines entanglements of race, place, gender, and class in Puerto Rican reggaetón. Based on ethnographic and archival research in San Juan, Puerto Rico,… (more)

Rivera, Petra Raquel



Ruofan Wu, Hieu Pham Trung Nguyen and Zetian Mi INTRODUCTION TO LEDs  

E-Print Network (OSTI)

-in-a-Wire Light Emitting Diodes and Prevention Method Nano-electronic Devices and Materials, Electrical Computer., Efficiency droop in nitride-based light-emitting diodes. Physica Status Solidi a-Applications and Materials history. Nature Photonics 2007, 1 (4), 189-192. [4] Holonyak, N., Is the light emitting diode (LED

Barthelat, Francois


"Orgulloso de mi Caserío y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetón  

E-Print Network (OSTI)

May ________. “A vistas la pornografía. ” Primera Hora, 22la medida contra la pornografía. ” El Nuevo Día, 13 Junecomunicación contra la pornografía. ” El Nuevo Día, 16 May

Rivera, Petra Raquel



Informa(on and Resources Water Quality and Mi/ga/on: Bifenthrin and Fipronil  

E-Print Network (OSTI)

strategy, Pesticides fluxes, Surface water, Vineyard Introduction The intensive use of pesticides for crop on the mobilisation of pesticides and total fluxes in surface water. Moreover, the effect of the sampling strategy ranged from 1.0 to 60 g. Effect of sampling strategy on the estimation of pesticides fluxes in the river

Hammock, Bruce D.


Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in  

E-Print Network (OSTI)

Universidad Católica de Chile, Santiago 8331010, Chile; b Department of Plant and Soil Sciences, Delaware activated cell sorter (FACS) and extracted total RNA as described previously (9). KNO3 treat- ment induced

Green, Pamela


Partitioning of solutes between liquid water and steam in the system {l_brace}Na-NH{sub 4}-NH{sub 3}-H-Cl{r_brace} to 350{degree}C  

DOE Green Energy (OSTI)

Measurements have been made of the partitioning of solutes between liquid and vapor phases for hydrochloric acid and chloride salts found in both power plant steam cycles and in natural geothermal systems. Static sampling of equilibrium liquid and vapor phases extended from 350 C to the lowest temperatures for which reliable analytical determinations of vapor-phase solute concentrations could be made. Equilibrium constants for the partitioning of the various solutes were calculated from the measured equilibrium compositions, and represented as functions of temperature and solvent density over the full temperature range investigated. These equilibrium constants can be used to calculate equilibrium compositions of coexisting liquid and vapor phases under conditions ranging from steam production from saline geothermal brines to early-condensate formation in all-volatile treatment steam cycles.

Simonson, J.M.; Palmer, D.A. [Oak Ridge National Lab., TN (United States). Chemical and Analytical Sciences Div.



Reconstruction of the Extratropical NH Mean Temperature over the Last Millennium with a Method that Preserves Low-Frequency Variability  

Science Conference Proceedings (OSTI)

A new multiproxy reconstruction of the Northern Hemisphere extratropical mean temperature over the last millennium is presented. The reconstruction is performed with a novel method designed to avoid the underestimation of low-frequency variability ...

Bo Christiansen; Fredrik Charpentier Ljungqvist



2011 Laser Diagnostics in Combustion Gordon Research Conference, (August 14-19, 2011, Waterville Valley Resort, Waterville Valley, NH)  

SciTech Connect

The vast majority of the world's energy needs are met by combustion of fossil fuels. Optimum utilization of limited resources and control of emissions of pollutants and greenhouse gases demand sustained improvement of combustion technology. This task can be satisfied only by detailed knowledge of the underlying physical and chemical processes. Non-intrusive laser diagnostics continuously contribute to our growing understanding of these complex and coupled multi-scale processes. The GRC on Laser Diagnostics in Combustion focuses on the most recent scientific advances and brings together scientists and engineers working at the leading edge of combustion research. Major tasks of the community are developing and applying methods for precise and accurate measurements of fluid motion and temperatures; chemical compositions; multi-phase phenomena appearing near walls, in spray and sooting combustion; improving sensitivities, precision, spatial resolution and tracking transients in their spatio-temporal development. The properties and behaviour of novel laser sources, detectors, optical systems that lead to new diagnostic capabilities are also part of the conference program.

Thomas Settersten



A numerical and experimental study of in-situ NO formation in laminar NH3-seeded syngas diffusion flames.  

E-Print Network (OSTI)

?? Oxides of nitrogen formed during combustion are significant threats to our environment. They result in the formation of “acid rain”, smog, and depletion of… (more)

Li, Miao



A numerical and experimental study of in-situ NO formation in laminar NH3-seeded syngas diffusion flames.  

E-Print Network (OSTI)

??Oxides of nitrogen formed during combustion are significant threats to our environment. They result in the formation of "acid rain", smog, and depletion of the… (more)

Li, Miao



U.S. Natural Gas Pipeline Exports by Point of Exit  

U.S. Energy Information Administration (EIA) Indexed Site

25,575 142,032 133,749 128,589 130,297 122,391 1997-2013 25,575 142,032 133,749 128,589 130,297 122,391 1997-2013 To Canada 70,735 81,695 75,846 66,473 68,325 69,733 1973-2013 Eastport, ID 6 2011-2013 Calais, ME 2,021 1,528 433 652 122 185 2011-2013 Detroit, MI 3,571 4,430 3,769 3,933 4,131 3,885 2011-2013 Marysville, MI 2,983 1,470 995 1,856 1,521 1,400 2011-2013 Sault Ste. Marie, MI 1,531 1,171 935 1,231 849 911 2011-2013 St. Clair, MI 43,917 56,075 54,114 42,609 45,524 47,795 2011-2013 Noyes, MN 76 171 316 1,331 447 445 2011-2013 Babb, MT 2011-2011 Havre, MT 184 188 174 177 183 166 2011-2013 Pittsburg, NH 2011-2013 Grand Island, NY 47 20 10 10 11 2011-2013 Massena, NY 2012-2012 Niagara Falls, NY 13,738 13,789 13,174 13,904 13,939 13,022 2011-2013 Waddington, NY


Carbon Sequestration  

NLE Websites -- All DOE Office Websites (Extended Search)

David a. Lang David a. Lang Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-4881 david.lang@netl.doe.gov andrew chizmeshya Arizona State University Center for Solid State Science Tempe, AZ 85287-1704 480-965-6072 chizmesh@asu.edu A Novel ApproAch to MiNerAl cArboNAtioN: eNhANciNg cArboNAtioN While AvoidiNg MiNerAl pretreAtMeNt process cost Background Carbonation of the widely occurring minerals of the olivine group, such as forsterite (Mg 2 SiO 4 ), is a potential large-scale sequestration process that converts CO 2 into the environmentally benign mineral magnesite (MgCO 3 ). Because the process is exothermic, it inherently offers low-cost potential. Enhancing carbonation reactivity is the key to economic viability. Previous


Better Buildings Neighborhood Program: Indianapolis, Indiana  

NLE Websites -- All DOE Office Websites (Extended Search)

Indianapolis, Indianapolis, Indiana to someone by E-mail Share Better Buildings Neighborhood Program: Indianapolis, Indiana on Facebook Tweet about Better Buildings Neighborhood Program: Indianapolis, Indiana on Twitter Bookmark Better Buildings Neighborhood Program: Indianapolis, Indiana on Google Bookmark Better Buildings Neighborhood Program: Indianapolis, Indiana on Delicious Rank Better Buildings Neighborhood Program: Indianapolis, Indiana on Digg Find More places to share Better Buildings Neighborhood Program: Indianapolis, Indiana on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC


Better Buildings Neighborhood Program: Better Buildings Partners  

NLE Websites -- All DOE Office Websites (Extended Search)

Better Better Buildings Partners to someone by E-mail Share Better Buildings Neighborhood Program: Better Buildings Partners on Facebook Tweet about Better Buildings Neighborhood Program: Better Buildings Partners on Twitter Bookmark Better Buildings Neighborhood Program: Better Buildings Partners on Google Bookmark Better Buildings Neighborhood Program: Better Buildings Partners on Delicious Rank Better Buildings Neighborhood Program: Better Buildings Partners on Digg Find More places to share Better Buildings Neighborhood Program: Better Buildings Partners on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY


Better Buildings Neighborhood Program: Jacksonville, Florida  

NLE Websites -- All DOE Office Websites (Extended Search)

Jacksonville, Jacksonville, Florida to someone by E-mail Share Better Buildings Neighborhood Program: Jacksonville, Florida on Facebook Tweet about Better Buildings Neighborhood Program: Jacksonville, Florida on Twitter Bookmark Better Buildings Neighborhood Program: Jacksonville, Florida on Google Bookmark Better Buildings Neighborhood Program: Jacksonville, Florida on Delicious Rank Better Buildings Neighborhood Program: Jacksonville, Florida on Digg Find More places to share Better Buildings Neighborhood Program: Jacksonville, Florida on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC


U.S. LNG Imports from Indonesia  

Annual Energy Outlook 2012 (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Australia  

Annual Energy Outlook 2012 (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Equatorial Guinea  

Gasoline and Diesel Fuel Update (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Other Countries  

Annual Energy Outlook 2012 (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...

Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


U.S. LNG Imports from Trinidad/Tobago  

Gasoline and Diesel Fuel Update (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Yemen  

Gasoline and Diesel Fuel Update (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Peru  

Gasoline and Diesel Fuel Update (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. Natural Gas Exports to Mexico  

Gasoline and Diesel Fuel Update (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. Total Exports  

U.S. Energy Information Administration (EIA) Indexed Site

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Nigeria  

Gasoline and Diesel Fuel Update (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Malaysia  

Gasoline and Diesel Fuel Update (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Oman  

Annual Energy Outlook 2012 (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Egypt  

Annual Energy Outlook 2012 (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Norway  

Annual Energy Outlook 2012 (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Algeria  

Gasoline and Diesel Fuel Update (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


U.S. LNG Imports from Brunei  

Annual Energy Outlook 2012 (EIA)

NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island,...


Vector-thread architecture and implementation  

E-Print Network (OSTI)

This thesis proposes vector-thread architectures as a performance-efficient solution for all-purpose computing. The VT architectural paradigm unifies the vector and multithreaded compute models. VT provides the programmer ...

Krashinsky, Ronny (Ronny Meir), 1978-




E-Print Network (OSTI)

) Maplebrook Farm Feta (Bennington, VT) Featuring Misty Knoll Farms Chicken (New Haven, VT) Peace Valley Farm, Applesauce, and Cider (Williamstown) Sidehill Farm Plain and Maple-Flavored Low-Fat Yogurt (Ashfield, MA

Aalberts, Daniel P.


Exploring the Tradeoffs between Programmability and Efficiency in Data-Parallel Accelerators  

Science Conference Proceedings (OSTI)

We present a taxonomy and modular implementation approach for data-parallel accelerators, including the MIMD, vector-SIMD, subword-SIMD, SIMT, and vector-thread (VT) architectural design patterns. We introduce Maven, a new VT microarchitecture based ...

Yunsup Lee, Rimas Avizienis, Alex Bishara, Richard Xia, Derek Lockhart, Christopher Batten, Krste Asanovi?



Marriage, Registration and Dissolution by Same-Sex Couples in the US  

E-Print Network (OSTI)

P.L.2006, c.103 C.2A.34-8; Vermont: Vt. Stat. Ann. tit. 15,reciprocal beneficiary); Vermont: Vt. Stat. Ann. tit. 15, §sex couples traveled to Vermont for civil unions (the only

Gates, Gary J; Badgett, M.V. Lee; Ho, Deborah



National Idling Reduction Network News - August 2012  

NLE Websites -- All DOE Office Websites (Extended Search)

found at http:www.idleair.com. August 2012 5 EDUCATION, OUTREACH, AND CAMPAIGNS Idle-Free VT Launching "Idle Free from the Start" Idle-Free VT is taking a new approach to the...


Integration of Molecular Networks in the Shoot Apical Meristem that Controls Floral Specification in Arabidopsis thaliana  

E-Print Network (OSTI)

lycopersicum_miR156b Solanum_lycopersicum_miR156c Sorghum_bicolor_miR156a Sorghum_bicolor_miR156b Sorghum_bicolor_miR156c Sorghum_

Lal, Shruti



Company Level Imports  

U.S. Energy Information Administration (EIA)

all states asphalt inc 0209 derby line, vt ... united kingdom kinder morgan liq termls llc ... st louis, mo missouri

Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Effects of Weather Variables on Pedestrian Volumes in Alameda County, California  

E-Print Network (OSTI)

volume was undertaken in Montpelier, Vermont (7). That studyregion. The study done in Montpelier, VT found that during a

Attaset, Vanvisa; Schneider, Robert J.; Arnold, Lindsay S.; Ragland, David R



NCWM 93 Annual Meeting  

Science Conference Proceedings (OSTI)

... Jennifer Nuckolls Siemens Energy & Automation, Inc. ... July 13 - 17, 2008 Sheraton Burlington Hotel • Burlington, VT Attendee List ...



ECE 3050 Analog Electronics Quiz 3 January 28, 2009  

E-Print Network (OSTI)

with the simplified T model. For each circuit, it is given that Rtb = 1 k, RE = 2 k, r0 = 20 k, = 99, = 0.99, IC = 1 mA, and VT = 0.025 V. Relevant equations are i0 c = gmv = ib = i0 e r0 e = Rtb 1 + + re gm = IC VT r = VT IB re = VT IE IC = IB = IE = gmr (a) Solve for vo/vtb using the hybrid- model. (b) Solve

Leach Jr.,W. Marshall


U.S. LNG Imports from Oman  

Gasoline and Diesel Fuel Update (EIA)

International Falls, MN Noyes, MN Warroad, MN Babb, MT Havre, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island, GA LNG Imports into Everett, MA LNG Imports into Freeport, TX LNG Imports into Golden Pass, TX LNG Imports into Gulf Gateway, LA LNG Imports into Gulf LNG, MS LNG Imports into Lake Charles, LA LNG Imports into Neptune Deepwater Port LNG Imports into Northeast Gateway LNG Imports into Sabine Pass, LA U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Alamo, TX El Paso, TX Galvan Ranch, TX Hidalgo, TX McAllen, TX Penitas, TX LNG Imports from Algeria Cove Point, MD Everett, MA Lake Charles, LA LNG Imports from Australia Everett, MA Lake Charles, LA LNG Imports from Brunei Lake Charles, LA LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Equatorial Guinea Elba Island, GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba Island, GA Freeport, TX Gulf Gateway, LA Lake Charles, LA Sabine Pass, LA LNG Imports from Norway Cove Point, MD Sabine Pass, LA LNG Imports from Oman Lake Charles, LA LNG Imports from Peru Cameron, LA Freeport, TX Sabine Pass, LA LNG Imports from Qatar Cameron, LA Elba Island, GA Golden Pass, TX Gulf Gateway, LA Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf Gateway, LA Gulf LNG, MS Lake Charles, LA Neptune Deepwater Port Northeast Gateway Sabine Pass, LA LNG Imports from United Arab Emirates Lake Charles, LA LNG Imports from Yemen Everett, MA Freeport, TX Neptune Deepwater Port Sabine Pass, LA LNG Imports from Other Countries Lake Charles, LA Period: Monthly Annual


U.S. LNG Imports from Australia  

Gasoline and Diesel Fuel Update (EIA)

International Falls, MN Noyes, MN Warroad, MN Babb, MT Havre, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island, GA LNG Imports into Everett, MA LNG Imports into Freeport, TX LNG Imports into Golden Pass, TX LNG Imports into Gulf Gateway, LA LNG Imports into Gulf LNG, MS LNG Imports into Lake Charles, LA LNG Imports into Neptune Deepwater Port LNG Imports into Northeast Gateway LNG Imports into Sabine Pass, LA U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Alamo, TX El Paso, TX Galvan Ranch, TX Hidalgo, TX McAllen, TX Penitas, TX LNG Imports from Algeria Cove Point, MD Everett, MA Lake Charles, LA LNG Imports from Australia Everett, MA Lake Charles, LA LNG Imports from Brunei Lake Charles, LA LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Equatorial Guinea Elba Island, GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba Island, GA Freeport, TX Gulf Gateway, LA Lake Charles, LA Sabine Pass, LA LNG Imports from Norway Cove Point, MD Sabine Pass, LA LNG Imports from Oman Lake Charles, LA LNG Imports from Peru Cameron, LA Freeport, TX Sabine Pass, LA LNG Imports from Qatar Cameron, LA Elba Island, GA Golden Pass, TX Gulf Gateway, LA Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf Gateway, LA Gulf LNG, MS Lake Charles, LA Neptune Deepwater Port Northeast Gateway Sabine Pass, LA LNG Imports from United Arab Emirates Lake Charles, LA LNG Imports from Yemen Everett, MA Freeport, TX Neptune Deepwater Port Sabine Pass, LA LNG Imports from Other Countries Lake Charles, LA Period: Monthly Annual


U.S. LNG Imports from Nigeria  

Gasoline and Diesel Fuel Update (EIA)

International Falls, MN Noyes, MN Warroad, MN Babb, MT Havre, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island, GA LNG Imports into Everett, MA LNG Imports into Freeport, TX LNG Imports into Golden Pass, TX LNG Imports into Gulf Gateway, LA LNG Imports into Gulf LNG, MS LNG Imports into Lake Charles, LA LNG Imports into Neptune Deepwater Port LNG Imports into Northeast Gateway LNG Imports into Sabine Pass, LA U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Alamo, TX El Paso, TX Galvan Ranch, TX Hidalgo, TX McAllen, TX Penitas, TX LNG Imports from Algeria Cove Point, MD Everett, MA Lake Charles, LA LNG Imports from Australia Everett, MA Lake Charles, LA LNG Imports from Brunei Lake Charles, LA LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Equatorial Guinea Elba Island, GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba Island, GA Freeport, TX Gulf Gateway, LA Lake Charles, LA Sabine Pass, LA LNG Imports from Norway Cove Point, MD Sabine Pass, LA LNG Imports from Oman Lake Charles, LA LNG Imports from Peru Cameron, LA Freeport, TX Sabine Pass, LA LNG Imports from Qatar Cameron, LA Elba Island, GA Golden Pass, TX Gulf Gateway, LA Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf Gateway, LA Gulf LNG, MS Lake Charles, LA Neptune Deepwater Port Northeast Gateway Sabine Pass, LA LNG Imports from United Arab Emirates Lake Charles, LA LNG Imports from Yemen Everett, MA Freeport, TX Neptune Deepwater Port Sabine Pass, LA LNG Imports from Other Countries Lake Charles, LA Period: Monthly Annual


U.S. LNG Imports from Yemen  

Gasoline and Diesel Fuel Update (EIA)

International Falls, MN Noyes, MN Warroad, MN Babb, MT Havre, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island, GA LNG Imports into Everett, MA LNG Imports into Freeport, TX LNG Imports into Golden Pass, TX LNG Imports into Gulf Gateway, LA LNG Imports into Gulf LNG, MS LNG Imports into Lake Charles, LA LNG Imports into Neptune Deepwater Port LNG Imports into Northeast Gateway LNG Imports into Sabine Pass, LA U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Alamo, TX El Paso, TX Galvan Ranch, TX Hidalgo, TX McAllen, TX Penitas, TX LNG Imports from Algeria Cove Point, MD Everett, MA Lake Charles, LA LNG Imports from Australia Everett, MA Lake Charles, LA LNG Imports from Brunei Lake Charles, LA LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Equatorial Guinea Elba Island, GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba Island, GA Freeport, TX Gulf Gateway, LA Lake Charles, LA Sabine Pass, LA LNG Imports from Norway Cove Point, MD Sabine Pass, LA LNG Imports from Oman Lake Charles, LA LNG Imports from Peru Cameron, LA Freeport, TX Sabine Pass, LA LNG Imports from Qatar Cameron, LA Elba Island, GA Golden Pass, TX Gulf Gateway, LA Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf Gateway, LA Gulf LNG, MS Lake Charles, LA Neptune Deepwater Port Northeast Gateway Sabine Pass, LA LNG Imports from United Arab Emirates Lake Charles, LA LNG Imports from Yemen Everett, MA Freeport, TX Neptune Deepwater Port Sabine Pass, LA LNG Imports from Other Countries Lake Charles, LA Period: Monthly Annual


U.S. LNG Imports from United Arab Emirates  

Gasoline and Diesel Fuel Update (EIA)

International Falls, MN Noyes, MN Warroad, MN Babb, MT Havre, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island, GA LNG Imports into Everett, MA LNG Imports into Freeport, TX LNG Imports into Golden Pass, TX LNG Imports into Gulf Gateway, LA LNG Imports into Gulf LNG, MS LNG Imports into Lake Charles, LA LNG Imports into Neptune Deepwater Port LNG Imports into Northeast Gateway LNG Imports into Sabine Pass, LA U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Alamo, TX El Paso, TX Galvan Ranch, TX Hidalgo, TX McAllen, TX Penitas, TX LNG Imports from Algeria Cove Point, MD Everett, MA Lake Charles, LA LNG Imports from Australia Everett, MA Lake Charles, LA LNG Imports from Brunei Lake Charles, LA LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Equatorial Guinea Elba Island, GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba Island, GA Freeport, TX Gulf Gateway, LA Lake Charles, LA Sabine Pass, LA LNG Imports from Norway Cove Point, MD Sabine Pass, LA LNG Imports from Oman Lake Charles, LA LNG Imports from Peru Cameron, LA Freeport, TX Sabine Pass, LA LNG Imports from Qatar Cameron, LA Elba Island, GA Golden Pass, TX Gulf Gateway, LA Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf Gateway, LA Gulf LNG, MS Lake Charles, LA Neptune Deepwater Port Northeast Gateway Sabine Pass, LA LNG Imports from United Arab Emirates Lake Charles, LA LNG Imports from Yemen Everett, MA Freeport, TX Neptune Deepwater Port Sabine Pass, LA LNG Imports from Other Countries Lake Charles, LA Period: Monthly Annual


U.S. LNG Imports from Algeria  

Gasoline and Diesel Fuel Update (EIA)

International Falls, MN Noyes, MN Warroad, MN Babb, MT Havre, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island, GA LNG Imports into Everett, MA LNG Imports into Freeport, TX LNG Imports into Golden Pass, TX LNG Imports into Gulf Gateway, LA LNG Imports into Gulf LNG, MS LNG Imports into Lake Charles, LA LNG Imports into Neptune Deepwater Port LNG Imports into Northeast Gateway LNG Imports into Sabine Pass, LA U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Alamo, TX El Paso, TX Galvan Ranch, TX Hidalgo, TX McAllen, TX Penitas, TX LNG Imports from Algeria Cove Point, MD Everett, MA Lake Charles, LA LNG Imports from Australia Everett, MA Lake Charles, LA LNG Imports from Brunei Lake Charles, LA LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Equatorial Guinea Elba Island, GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba Island, GA Freeport, TX Gulf Gateway, LA Lake Charles, LA Sabine Pass, LA LNG Imports from Norway Cove Point, MD Sabine Pass, LA LNG Imports from Oman Lake Charles, LA LNG Imports from Peru Cameron, LA Freeport, TX Sabine Pass, LA LNG Imports from Qatar Cameron, LA Elba Island, GA Golden Pass, TX Gulf Gateway, LA Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf Gateway, LA Gulf LNG, MS Lake Charles, LA Neptune Deepwater Port Northeast Gateway Sabine Pass, LA LNG Imports from United Arab Emirates Lake Charles, LA LNG Imports from Yemen Everett, MA Freeport, TX Neptune Deepwater Port Sabine Pass, LA LNG Imports from Other Countries Lake Charles, LA Period: Monthly Annual


U.S. Natural Gas Imports by Pipeline from Mexico  

U.S. Energy Information Administration (EIA) Indexed Site

International Falls, MN Noyes, MN Warroad, MN Babb, MT Havre, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island, GA LNG Imports into Everett, MA LNG Imports into Freeport, TX LNG Imports into Golden Pass, TX LNG Imports into Gulf Gateway, LA LNG Imports into Gulf LNG, MS LNG Imports into Lake Charles, LA LNG Imports into Neptune Deepwater Port LNG Imports into Northeast Gateway LNG Imports into Sabine Pass, LA U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Alamo, TX El Paso, TX Galvan Ranch, TX Hidalgo, TX McAllen, TX Penitas, TX LNG Imports from Algeria Cove Point, MD Everett, MA Lake Charles, LA LNG Imports from Australia Everett, MA Lake Charles, LA LNG Imports from Brunei Lake Charles, LA LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Equatorial Guinea Elba Island, GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba Island, GA Freeport, TX Gulf Gateway, LA Lake Charles, LA Sabine Pass, LA LNG Imports from Norway Cove Point, MD Sabine Pass, LA LNG Imports from Oman Lake Charles, LA LNG Imports from Peru Cameron, LA Freeport, TX Sabine Pass, LA LNG Imports from Qatar Cameron, LA Elba Island, GA Golden Pass, TX Gulf Gateway, LA Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf Gateway, LA Gulf LNG, MS Lake Charles, LA Neptune Deepwater Port Northeast Gateway Sabine Pass, LA LNG Imports from United Arab Emirates Lake Charles, LA LNG Imports from Yemen Everett, MA Freeport, TX Neptune Deepwater Port Sabine Pass, LA LNG Imports from Other Countries Lake Charles, LA Period: Monthly Annual


U.S. Total Exports  

U.S. Energy Information Administration (EIA) Indexed Site

International Falls, MN Noyes, MN Warroad, MN Babb, MT Havre, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island, GA LNG Imports into Everett, MA LNG Imports into Freeport, TX LNG Imports into Golden Pass, TX LNG Imports into Gulf Gateway, LA LNG Imports into Gulf LNG, MS LNG Imports into Lake Charles, LA LNG Imports into Neptune Deepwater Port LNG Imports into Northeast Gateway LNG Imports into Sabine Pass, LA U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Alamo, TX El Paso, TX Galvan Ranch, TX Hidalgo, TX McAllen, TX Penitas, TX LNG Imports from Algeria Cove Point, MD Everett, MA Lake Charles, LA LNG Imports from Australia Everett, MA Lake Charles, LA LNG Imports from Brunei Lake Charles, LA LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Equatorial Guinea Elba Island, GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba Island, GA Freeport, TX Gulf Gateway, LA Lake Charles, LA Sabine Pass, LA LNG Imports from Norway Cove Point, MD Sabine Pass, LA LNG Imports from Oman Lake Charles, LA LNG Imports from Peru Cameron, LA Freeport, TX Sabine Pass, LA LNG Imports from Qatar Cameron, LA Elba Island, GA Golden Pass, TX Gulf Gateway, LA Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf Gateway, LA Gulf LNG, MS Lake Charles, LA Neptune Deepwater Port Northeast Gateway Sabine Pass, LA LNG Imports from United Arab Emirates Lake Charles, LA LNG Imports from Yemen Everett, MA Freeport, TX Neptune Deepwater Port Sabine Pass, LA LNG Imports from Other Countries Lake Charles, LA Period: Monthly Annual


U.S. LNG Imports from Indonesia  

Gasoline and Diesel Fuel Update (EIA)

International Falls, MN Noyes, MN Warroad, MN Babb, MT Havre, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island, GA LNG Imports into Everett, MA LNG Imports into Freeport, TX LNG Imports into Golden Pass, TX LNG Imports into Gulf Gateway, LA LNG Imports into Gulf LNG, MS LNG Imports into Lake Charles, LA LNG Imports into Neptune Deepwater Port LNG Imports into Northeast Gateway LNG Imports into Sabine Pass, LA U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Alamo, TX El Paso, TX Galvan Ranch, TX Hidalgo, TX McAllen, TX Penitas, TX LNG Imports from Algeria Cove Point, MD Everett, MA Lake Charles, LA LNG Imports from Australia Everett, MA Lake Charles, LA LNG Imports from Brunei Lake Charles, LA LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Equatorial Guinea Elba Island, GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba Island, GA Freeport, TX Gulf Gateway, LA Lake Charles, LA Sabine Pass, LA LNG Imports from Norway Cove Point, MD Sabine Pass, LA LNG Imports from Oman Lake Charles, LA LNG Imports from Peru Cameron, LA Freeport, TX Sabine Pass, LA LNG Imports from Qatar Cameron, LA Elba Island, GA Golden Pass, TX Gulf Gateway, LA Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf Gateway, LA Gulf LNG, MS Lake Charles, LA Neptune Deepwater Port Northeast Gateway Sabine Pass, LA LNG Imports from United Arab Emirates Lake Charles, LA LNG Imports from Yemen Everett, MA Freeport, TX Neptune Deepwater Port Sabine Pass, LA LNG Imports from Other Countries Lake Charles, LA Period: Monthly Annual


U.S. LNG Imports from Brunei  

Gasoline and Diesel Fuel Update (EIA)

International Falls, MN Noyes, MN Warroad, MN Babb, MT Havre, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island, GA LNG Imports into Everett, MA LNG Imports into Freeport, TX LNG Imports into Golden Pass, TX LNG Imports into Gulf Gateway, LA LNG Imports into Gulf LNG, MS LNG Imports into Lake Charles, LA LNG Imports into Neptune Deepwater Port LNG Imports into Northeast Gateway LNG Imports into Sabine Pass, LA U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Alamo, TX El Paso, TX Galvan Ranch, TX Hidalgo, TX McAllen, TX Penitas, TX LNG Imports from Algeria Cove Point, MD Everett, MA Lake Charles, LA LNG Imports from Australia Everett, MA Lake Charles, LA LNG Imports from Brunei Lake Charles, LA LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Equatorial Guinea Elba Island, GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba Island, GA Freeport, TX Gulf Gateway, LA Lake Charles, LA Sabine Pass, LA LNG Imports from Norway Cove Point, MD Sabine Pass, LA LNG Imports from Oman Lake Charles, LA LNG Imports from Peru Cameron, LA Freeport, TX Sabine Pass, LA LNG Imports from Qatar Cameron, LA Elba Island, GA Golden Pass, TX Gulf Gateway, LA Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf Gateway, LA Gulf LNG, MS Lake Charles, LA Neptune Deepwater Port Northeast Gateway Sabine Pass, LA LNG Imports from United Arab Emirates Lake Charles, LA LNG Imports from Yemen Everett, MA Freeport, TX Neptune Deepwater Port Sabine Pass, LA LNG Imports from Other Countries Lake Charles, LA Period: Monthly Annual


U.S. LNG Imports from Egypt  

Gasoline and Diesel Fuel Update (EIA)

International Falls, MN Noyes, MN Warroad, MN Babb, MT Havre, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island, GA LNG Imports into Everett, MA LNG Imports into Freeport, TX LNG Imports into Golden Pass, TX LNG Imports into Gulf Gateway, LA LNG Imports into Gulf LNG, MS LNG Imports into Lake Charles, LA LNG Imports into Neptune Deepwater Port LNG Imports into Northeast Gateway LNG Imports into Sabine Pass, LA U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Alamo, TX El Paso, TX Galvan Ranch, TX Hidalgo, TX McAllen, TX Penitas, TX LNG Imports from Algeria Cove Point, MD Everett, MA Lake Charles, LA LNG Imports from Australia Everett, MA Lake Charles, LA LNG Imports from Brunei Lake Charles, LA LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Equatorial Guinea Elba Island, GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba Island, GA Freeport, TX Gulf Gateway, LA Lake Charles, LA Sabine Pass, LA LNG Imports from Norway Cove Point, MD Sabine Pass, LA LNG Imports from Oman Lake Charles, LA LNG Imports from Peru Cameron, LA Freeport, TX Sabine Pass, LA LNG Imports from Qatar Cameron, LA Elba Island, GA Golden Pass, TX Gulf Gateway, LA Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf Gateway, LA Gulf LNG, MS Lake Charles, LA Neptune Deepwater Port Northeast Gateway Sabine Pass, LA LNG Imports from United Arab Emirates Lake Charles, LA LNG Imports from Yemen Everett, MA Freeport, TX Neptune Deepwater Port Sabine Pass, LA LNG Imports from Other Countries Lake Charles, LA Period: Monthly Annual


U.S. LNG Imports from Canada  

U.S. Energy Information Administration (EIA) Indexed Site

International Falls, MN Noyes, MN Warroad, MN Babb, MT Havre, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island, GA LNG Imports into Everett, MA LNG Imports into Freeport, TX LNG Imports into Golden Pass, TX LNG Imports into Gulf Gateway, LA LNG Imports into Gulf LNG, MS LNG Imports into Lake Charles, LA LNG Imports into Neptune Deepwater Port LNG Imports into Northeast Gateway LNG Imports into Sabine Pass, LA U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Alamo, TX El Paso, TX Galvan Ranch, TX Hidalgo, TX McAllen, TX Penitas, TX LNG Imports from Algeria Cove Point, MD Everett, MA Lake Charles, LA LNG Imports from Australia Everett, MA Lake Charles, LA LNG Imports from Brunei Lake Charles, LA LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Equatorial Guinea Elba Island, GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba Island, GA Freeport, TX Gulf Gateway, LA Lake Charles, LA Sabine Pass, LA LNG Imports from Norway Cove Point, MD Sabine Pass, LA LNG Imports from Oman Lake Charles, LA LNG Imports from Peru Cameron, LA Freeport, TX Sabine Pass, LA LNG Imports from Qatar Cameron, LA Elba Island, GA Golden Pass, TX Gulf Gateway, LA Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf Gateway, LA Gulf LNG, MS Lake Charles, LA Neptune Deepwater Port Northeast Gateway Sabine Pass, LA LNG Imports from United Arab Emirates Lake Charles, LA LNG Imports from Yemen Everett, MA Freeport, TX Neptune Deepwater Port Sabine Pass, LA LNG Imports from Other Countries Lake Charles, LA Period: Monthly Annual


U.S. LNG Imports from Trinidad/Tobago  

Gasoline and Diesel Fuel Update (EIA)

International Falls, MN Noyes, MN Warroad, MN Babb, MT Havre, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island, GA LNG Imports into Everett, MA LNG Imports into Freeport, TX LNG Imports into Golden Pass, TX LNG Imports into Gulf Gateway, LA LNG Imports into Gulf LNG, MS LNG Imports into Lake Charles, LA LNG Imports into Neptune Deepwater Port LNG Imports into Northeast Gateway LNG Imports into Sabine Pass, LA U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Alamo, TX El Paso, TX Galvan Ranch, TX Hidalgo, TX McAllen, TX Penitas, TX LNG Imports from Algeria Cove Point, MD Everett, MA Lake Charles, LA LNG Imports from Australia Everett, MA Lake Charles, LA LNG Imports from Brunei Lake Charles, LA LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Equatorial Guinea Elba Island, GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba Island, GA Freeport, TX Gulf Gateway, LA Lake Charles, LA Sabine Pass, LA LNG Imports from Norway Cove Point, MD Sabine Pass, LA LNG Imports from Oman Lake Charles, LA LNG Imports from Peru Cameron, LA Freeport, TX Sabine Pass, LA LNG Imports from Qatar Cameron, LA Elba Island, GA Golden Pass, TX Gulf Gateway, LA Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf Gateway, LA Gulf LNG, MS Lake Charles, LA Neptune Deepwater Port Northeast Gateway Sabine Pass, LA LNG Imports from United Arab Emirates Lake Charles, LA LNG Imports from Yemen Everett, MA Freeport, TX Neptune Deepwater Port Sabine Pass, LA LNG Imports from Other Countries Lake Charles, LA Period: Monthly Annual


U.S. LNG Imports from Peru  

Gasoline and Diesel Fuel Update (EIA)

International Falls, MN Noyes, MN Warroad, MN Babb, MT Havre, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island, GA LNG Imports into Everett, MA LNG Imports into Freeport, TX LNG Imports into Golden Pass, TX LNG Imports into Gulf Gateway, LA LNG Imports into Gulf LNG, MS LNG Imports into Lake Charles, LA LNG Imports into Neptune Deepwater Port LNG Imports into Northeast Gateway LNG Imports into Sabine Pass, LA U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Alamo, TX El Paso, TX Galvan Ranch, TX Hidalgo, TX McAllen, TX Penitas, TX LNG Imports from Algeria Cove Point, MD Everett, MA Lake Charles, LA LNG Imports from Australia Everett, MA Lake Charles, LA LNG Imports from Brunei Lake Charles, LA LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Equatorial Guinea Elba Island, GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba Island, GA Freeport, TX Gulf Gateway, LA Lake Charles, LA Sabine Pass, LA LNG Imports from Norway Cove Point, MD Sabine Pass, LA LNG Imports from Oman Lake Charles, LA LNG Imports from Peru Cameron, LA Freeport, TX Sabine Pass, LA LNG Imports from Qatar Cameron, LA Elba Island, GA Golden Pass, TX Gulf Gateway, LA Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf Gateway, LA Gulf LNG, MS Lake Charles, LA Neptune Deepwater Port Northeast Gateway Sabine Pass, LA LNG Imports from United Arab Emirates Lake Charles, LA LNG Imports from Yemen Everett, MA Freeport, TX Neptune Deepwater Port Sabine Pass, LA LNG Imports from Other Countries Lake Charles, LA Period: Monthly Annual


U.S. LNG Imports from Malaysia  

Gasoline and Diesel Fuel Update (EIA)

International Falls, MN Noyes, MN Warroad, MN Babb, MT Havre, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT North Troy, VT LNG Imports into Cameron, LA LNG Imports into Cove Point, MD LNG Imports into Elba Island, GA LNG Imports into Everett, MA LNG Imports into Freeport, TX LNG Imports into Golden Pass, TX LNG Imports into Gulf Gateway, LA LNG Imports into Gulf LNG, MS LNG Imports into Lake Charles, LA LNG Imports into Neptune Deepwater Port LNG Imports into Northeast Gateway LNG Imports into Sabine Pass, LA U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Alamo, TX El Paso, TX Galvan Ranch, TX Hidalgo, TX McAllen, TX Penitas, TX LNG Imports from Algeria Cove Point, MD Everett, MA Lake Charles, LA LNG Imports from Australia Everett, MA Lake Charles, LA LNG Imports from Brunei Lake Charles, LA LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Equatorial Guinea Elba Island, GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba Island, GA Freeport, TX Gulf Gateway, LA Lake Charles, LA Sabine Pass, LA LNG Imports from Norway Cove Point, MD Sabine Pass, LA LNG Imports from Oman Lake Charles, LA LNG Imports from Peru Cameron, LA Freeport, TX Sabine Pass, LA LNG Imports from Qatar Cameron, LA Elba Island, GA Golden Pass, TX Gulf Gateway, LA Lake Charles, LA Northeast Gateway Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf Gateway, LA Gulf LNG, MS Lake Charles, LA Neptune Deepwater Port Northeast Gateway Sabine Pass, LA LNG Imports from United Arab Emirates Lake Charles, LA LNG Imports from Yemen Everett, MA Freeport, TX Neptune Deepwater Port Sabine Pass, LA LNG Imports from Other Countries Lake Charles, LA Period: Monthly Annual


Projected Regional Impacts of Appliance Efficiency Standards for the U.S. Residential Sector  

E-Print Network (OSTI)

TX UT VA VT WA WI WV WY US Primary Energy Savings PetajoulesTX UT VA VT WA WI WV WY US Primary Energy Savings PetajoulcsTX UT VA VT WA WI wv WY US Primary Energy Savings Petaioules

Koomey, J.G.



Advanced composites III: expanding the technology; Proceedings of the Third Annual Conference, Detroit, MI, Sept. 15-17, 1987  

Science Conference Proceedings (OSTI)

The present conference discusses topics in the design features and methods, manufacturing processes, secondary fabrication techniques, and materials science aspects of advanced composites. Attention is given to composite structural armor for ground combat vehicles, composite structures for automotive energy management, CAD/CAM of braided preforms for advanced composites, composite automobile bumper beams, preforming for structural applications, the three-dimensional braiding of thermoplastic composite preforms, and recent advancements in tooling technology. Also discussed are instrument-grade MMCs for imaging IR guidance systems, automated tape layup of a vertical stabilizer fin, the mechanical properties of thermoplastic matrix composites, surface chemistry and adhesion of SMCs, fiber-matrix bonding, and hybrid yarns for high performance thermoplastic composites.

Not Available


Note: This page contains sample records for the topic "mi vt nh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1996 Department of Energy pre-freshman enrichment program at GMI Engineering and Management Institute, Flint, MI  

SciTech Connect

This document reports on a summer program to encourage students to pursue scientific or engineering professions. The topics of the report include a description of the recruitment program, selection criteria for participants, workshops, nine follow up activities, research projects and student`s presentation, and field trips. Course descriptions and schedule are included as appendices.



Creative Reconstruction in the City: An Analysis of Art, Shrinking, and the Story of the American Dream in Detroit, MI.  

E-Print Network (OSTI)

??A right to the city is a human right that is overlooked in American cities. Cities reflect humanity in collective form, but are manipulated by… (more)

Marotta, Stephen J.



Atliekinio fosfogipso panaudojimas sunki?j? metal? immobilizacijai nuotek? dumble ir dumblo-dirvožemio mišiniuose.  

E-Print Network (OSTI)

??Nuotek? dumble esan?i? sunki?j? metal? neigiam? poveik? aplinkai bei žmogaus sveikatai galima sumažinti apribojant metal? judrum? aplinkoje. Magistro darbe tiriamas sunki?j? metal? judrumas ir j?… (more)

Puodži?nas,; Marius



I Volume 5, Number 2 Spring 1992 A Ne\\izsletter for the RLE Community at MI'T  

E-Print Network (OSTI)

:l XI:~ri:l Ticchi. Inq~tiriesmay he ;~ddrcsscdto: RLE undercurrents Rescarcli Lahor:ltory of Electrc


Volume 2, Number 2 June 1989 A Nelr-sletter for the KL,t.: Communitv at MI'1'  

E-Print Network (OSTI)

Lahoratory of Electrc~nicsfor the RLE community at MIT. The following individuals contributed their time ancl


LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 2002 Place Time Name Group Group  

E-Print Network (OSTI)

37 192 19:28.7 John Wool 40-49 men 48 193 19:32.4 Jaimin Wan page 7 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS 1st


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 1996 Dummy first body page  

E-Print Network (OSTI)

-59 59 668 34:20.7 Seung-yu Rah 30-39 157 669 34:21.4 John Wool 40-49 120 670 34:25.6 Manny Gonzalez 30:42.8 Pete Valerio HISTORY OF LBL RUNAROUND WINNERS


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 14, 1990 Place Time Name Group Group  

E-Print Network (OSTI)

:56.4 John Wool 30­39 105 483 30:00.0 David O'Neill ) Group Time Name Overall Place Place 1 24:24.3 John Magee 373 2 25:41.9 Edward Lofgren 400 HISTORY OF LBL


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 22, 1995 Dummy first body page  

E-Print Network (OSTI)

198 16:04.7 Alan Meier 40-49 30 199 16:05.7 John Wool 40-49 31 200 16:07.5 Ginny Lackner 50-59F 1 201 Don Krieger Frances Mann Peter Morley Bob Shilling HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 10, 1997 Place Time Name Group  

E-Print Network (OSTI)

Larnon, Frank 50-59 13 156 15:17.4 157 15:18.0 Bartholomew, J 50-59 14 158 15:18.4 Wool, John 40-49 18 159 15 Time Name Group Group Place HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 15, 1989 Envel. Time Name Group Group  

E-Print Network (OSTI)

40-49 8 67 12:51.4 Desiderio Kovar Wool 30-39 20 69 12:56.7 Antoine Mensch Envelope Place Number 1 21:59.8 John L. Magee 354 2 26:14.8 Ed Lofgren 427 HISTORY OF LBL RUNAROUND WINNERS


LBL RUNAROUND RESULTS 2.95 km (1.84 mi) September 16, 1988 Envelope Time Name Group Group  

E-Print Network (OSTI)

120 14:08.2 Z. Mei 30-39 26 121 14:09.5 John Wool 30-39 27 122 14:10.3 Timothy Edberg 30-39 28 123 14 Time Name Envelope Place Number 1 30:14.0 Peter Endt 447 HISTORY OF LBL RUNAROUND WINNERS Year Distance


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 11, 1992 Place Time Name Group Group  

E-Print Network (OSTI)

14:26.2 Barry Freifeld Wool 30-39 39 122 14:28.2 Ken Woolfe 40-49 18 123 14 Williams HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS


I Volume 7, Number 2 Spring 1994 A Newsleccer for the RLE Communitv at MI'I'  

E-Print Network (OSTI)

Robert J. Birgeneau, Dean of the School of Science and a principal investigator in RLE's Surfaces has his blue belt in karate. Seventh grader Amanda's bowl~ngteam competed in the state finals


Corrosion mechanisms of low level vitrified radioactive waste in a loamy soil M.I. Ojovan1  

E-Print Network (OSTI)

Topic: Briefings by environmental groups, industry groups, pub- lic policy groups, and state, is the central authority responsi- ble for evaluating and supervising the nuclear industry's research and 1.95 meters in diameter. It is fabricated from forged steel with a stainless steel coating. The cask

Sheffield, University of


Informa(on and Resources Prac&ces for Mi&ga&ng Urban Pes&cide Runoff  

E-Print Network (OSTI)

. Producers can then use these records to analyze the effectiveness of past pesticide applications a documentation system for determining crop replant, rotation and #12;Pesticide Recordkeeping 2 prePI-20 Pesticide Recordkeeping 1 Michael Aerts, O. Norman Nesheim, and Frederick M. Fishel2 1

Hammock, Bruce D.


Former Worker Program - Defunct Beryllium Vendor Screening Program  

NLE Websites -- All DOE Office Websites (Extended Search)

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Wolverine Tube Division (Detroit, MI); National Beryllia (Haskell, NJ);...


Beryllium Vender Screening Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Speedring Systems, Inc. (Detroit, MI); Wolverine Tube Division...


Microsoft Word - Sample Abstract and Format Instructions.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Dearborn, MI 48128, Wayne State University 2 , Department of Physics and Astronomy, Detroit, MI 48202, Kettering University 3 , Flint, MI 48504, University of Paris-Sud 4 ,...


Language Assimilation Today: Bilingualism Persists More Than in the Past, But English Still Dominates  

E-Print Network (OSTI)

Somerset- Hunterdon, NJ Detroit, MI Table 2 Children’s homeSomerset- Hunterdon, NJ Detroit, MI Bergen-Passaic, NJSomerset- Hunterdon, NJ Detroit, MI Appendix Table 2

Alba, Richard
