Powered by Deep Web Technologies
Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Report Period: EIA ID NUMBER: Instructions: (e.g., Street Address, Bldg, Floor, Suite)  

U.S. Energy Information Administration (EIA) Indexed Site

Report Period: Report Period: EIA ID NUMBER: Instructions: (e.g., Street Address, Bldg, Floor, Suite) Secure File Transfer option available at: (e.g., PO Box, RR) Electronic Transmission: The PC Electronic Data Reporting Option (PEDRO) is available. Zip Code: - If interested in software, call (202) 586-9659. Email form to: Fax form to: (202) 586-9772 - - Mail form to: Oil & Gas Survey - - U.S. Department of Energy Ben Franklin Station PO Box 279 Washington, DC 20044-0279 Questions? Call toll free: 1-800-638-8812 OOG.SURVEYS@eia.doe.gov Contact Name: Version No.: 2013.01 Date of this Report: Mo Day State: Year Phone No.: DOMESTIC CRUDE OIL FIRST PURCHASE REPORT Company Name: A completed form must be filed by the 30th calendar day following the end of the report


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


Street Trees and Intersection Safety  

E-Print Network (OSTI)

streets and the design of street lights on a typical street.Roadway signs: 10 feet Street lights: 10 feet for palmlines: 5 feet Street lights: 15 feet Not specified Not

Macdonald, Elizabeth; Harper, Alethea; Williams, Jeff; Hayter, Jason A.



Street Trees and Intersection Safety  

E-Print Network (OSTI)

streets and the design of street lights on a typical street.Roadway signs: 10 feet Street lights: 10 feet for palmelectrical lines: 5 feet Street lights: 15 feet City of

Macdonald, Elizabeth; Harper, Alethea; Williams, Jeff; Hayter, Jason A.




National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


California Street Biomass Facility | Open Energy Information  

Open Energy Info (EERE)

Street Biomass Facility Street Biomass Facility Jump to: navigation, search Name California Street Biomass Facility Facility California Street Sector Biomass Facility Type Landfill Gas Location San Bernardino County, California Coordinates 34.9592083°, -116.419389° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":34.9592083,"lon":-116.419389,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Electric, Gas, Water, Heating, Refrigeration, and Street Railways Facilities and Service (South Dakota)  

Energy.gov (U.S. Department of Energy (DOE))

This legislation contains provisions for facilities and service related to electricity, natural gas, water, heating, refrigeration, and street railways. The chapter addresses the construction and...


Address List  

NLE Websites -- All DOE Office Websites (Extended Search)

Address List for 2 nd U.S.-China Symposium on CO 2 Emissions Control Science & Technology Participants No. Name Sex Title Organization Address Phone E-Mail 1 Ah-Hyung Alissa Park F...


Making Streets that Work [Streets: Old Paradigm, New Investment  

E-Print Network (OSTI)

components as varied as street lights, trash cans ands / S E D Street l i g h t i n g / S E D , City Light D C L

Sellin, Dennis



Work Address:  

NLE Websites -- All DOE Office Websites (Extended Search)

BO SAULSBURY BO SAULSBURY Work Address: Home Address: Oak Ridge National Laboratory 12952 Buckley Road National Transportation Research Center Knoxville, TN 37934 Building NTRC-2, Room 118 (865) 288-0750 Oak Ridge, TN 37831-6479 (865) 574-4694 saulsburyjw@ornl.gov Technical Specialties: Land use planning Environmental and socioeconomic impact assessment National Environmental Policy Act (NEPA) project management Vehicle fuel economy Education: 1986 B. A., History (minors in English and Business), The University of Tennessee 1989 M. S., Planning, The University of Tennessee (Thesis title: Land Use Compatibility Planning for Airfield Environs: Intergovernmental Cooperation to Protect Land Users From the Effects of Aircraft Operations)


Pecan Street Project Inc | Open Energy Information  

Open Energy Info (EERE)

Project Inc Project Inc Jump to: navigation, search Name Pecan Street Project Inc Place Austin, Texas Zip 78759 Product Austin-based smart grid, energy system developer. The Pecan Street Project is involved in a smart grid project. Coordinates 30.267605°, -97.742984° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":30.267605,"lon":-97.742984,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


The solar LED street light.  

E-Print Network (OSTI)

??The purpose of this essay is to analyze the component of the solar LED street lighting, such as structure, principle, characteristics and precautions for installation (more)

Ma, Hao



Hope Street Academy Wind Project | Open Energy Information  

Open Energy Info (EERE)

Street Academy Wind Project Street Academy Wind Project Jump to: navigation, search Name Hope Street Academy Wind Project Facility Hope Street Academy Sector Wind energy Facility Type Community Wind Location KS Coordinates 39.031624°, -95.733482° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.031624,"lon":-95.733482,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Gas, Heat, Water, Sewerage Collection and Disposal, and Street Railway  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Gas, Heat, Water, Sewerage Collection and Disposal, and Street Gas, Heat, Water, Sewerage Collection and Disposal, and Street Railway Companies (South Carolina) Gas, Heat, Water, Sewerage Collection and Disposal, and Street Railway Companies (South Carolina) < Back Eligibility Agricultural Commercial Construction Industrial Installer/Contractor Investor-Owned Utility Municipal/Public Utility Rural Electric Cooperative Utility Program Info State South Carolina Program Type Generating Facility Rate-Making Siting and Permitting Provider South Carolina Public Service Commission This legislation applies to public utilities and entities furnishing natural gas, heat, water, sewerage, and street railway services to the public. The legislation addresses rates and services, exemptions, investigations, and records. Article 4 (58-5-400 et seq.) of this


200 N. Spring Street  

Office of Legacy Management (LM)

Dipartment of Energy. ,' Dipartment of Energy. ,' Washington,DC20585 ., .\ FEB 1 7 ' 19g5' ,The Honorable Richa,rd. Riordon .', 200 N. Spring Street 'Los Angeles, California ,90012 '~ Dear Mayor Riordon: " Secretary of Energy Hazel O'Leary'has announced a neb approach to openness ins- the Department of Energy (DOE) and its communications with the public. fin support of this initiative, we are pleased~ to forward the enclosed information related to the. former Shannon Luminous Metals site in your jurisdiction that pe.rformed work for DOE's'predecessor agencies.' .This'information is provided foryour information, use! and,retention.~' "I , DOE's Formerly.Utilized Sites Remedial Action Program (FUSRAP) is responsible for identification of, sites used by DOE's predecessor agencies, determining


Energy management in municipal street lighting  

SciTech Connect

This report presents strategies to reduce the energy used in street lighting and, at the same time, reduce or stabilize the cost of street lighting to municipalities.



Sociology, Street-Level Bureaucracy, and the Management of the Public Sector  

E-Print Network (OSTI)

This article extends the concept of street-level bureaucracy to address the problem of the inflexibility and rigidity of governmental rules and regulations, a problem at the heart of the standard economic argument against ...

Piore, Michael J.


Easy Street (Smart Grid Project) | Open Energy Information  

Open Energy Info (EERE)

Easy Street (Smart Grid Project) Easy Street (Smart Grid Project) Jump to: navigation, search Project Name Easy Street Country Netherlands Headquarters Location Breda, Netherlands Coordinates 51.574806°, 4.774816° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.574806,"lon":4.774816,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


FIA-13-0006 - In the Matter of Wall Street Journal | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

6 - In the Matter of Wall Street Journal 6 - In the Matter of Wall Street Journal FIA-13-0006 - In the Matter of Wall Street Journal On May 24, 2013, the Office of Hearings and Appeals (OHA) issued a decision denying an appeal (Appeal) from a Freedom of Information Act (FOIA) determination issued by the Department of Energy's (DOE) Office of Information Resources (OIR). The Wall Street Journal, the Appellant, sought categories of records concerning IP addresses of computers that have accessed web pages administered by the DOE's Energy Information Administration (EIA) or on which data on energy resources are first made public by the EIA. In its partial response to the Appellant's request, the OIR withheld all IP addresses pursuant to Exemption 6. OIR stated that some of the withheld IP addresses would likely reveal the names of


The Recovery Act is "Lighting Up" the streets of Philadelphia...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

The Recovery Act is "Lighting Up" the streets of Philadelphia The Recovery Act is "Lighting Up" the streets of Philadelphia Addthis Description The Philadelphia Streets Department...

Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Incorporating video into Google Mobile Street View  

E-Print Network (OSTI)

Mobile Street View is a compelling application but suffers from significant latency problems, especially in limited bandwidth circumstances. Currently, the application uses static images to display street level information. ...

Wright, Christina (Christina E.)



Physical Modeling of Flow Field inside Urban Street Canyons  

Science Conference Proceedings (OSTI)

The flow characteristics inside urban street canyons were studied in a laboratory water channel. The approaching flow direction was horizontal and perpendicular to the street axis. The street width was adjusted to form street canyons of aspect ...

Xian-Xiang Li; Dennis Y. C. Leung; Chun-Ho Liu; K. M. Lam



Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


Fifth Street, Texas: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Street, Texas: Energy Resources Street, Texas: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 29.5982899°, -95.551333° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":29.5982899,"lon":-95.551333,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Stacey Street, Florida: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Stacey Street, Florida: Energy Resources Stacey Street, Florida: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 26.6983986°, -80.1236545° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":26.6983986,"lon":-80.1236545,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Brighter Lights, Safer Streets | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Brighter Lights, Safer Streets May 15, 2012 - 5:56pm Addthis Workers install the final LED streetlight for DC's EECBG-funded energy efficient lighting upgrade. | Energy...


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Organization Organization Address Place Zip Notes Website Region Organization Organization Address Place Zip Notes Website Region Adirondack North Country Association Adirondack North Country Association Main Street Suite Saranac Lake New York http www adirondack org Northeast NY NJ CT PA Area African Renewable Energy Alliance AREA African Renewable Energy Alliance AREA Online http area network ning com xg source msg mes network Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies



NLE Websites -- All DOE Office Websites (Extended Search)

CHANGE OF ADDRESS and EMERGENCY NOTIFICATION CHANGE OF ADDRESS and EMERGENCY NOTIFICATION TO: HUMAN RESOURCES DATE: Z# Social Security # Print First Name Print Middle Name or Initial Print Last Name (Currently in Payroll System) Complete appropriate changes: NAME CHANGE: Print Name Change to ADDRESS CHANGE: Mailing Address City State Zip


FranklinAvenue SouthDepysterStreet  

E-Print Network (OSTI)

Grille F10 Pita Pit F11 Bu alo Wild Wings F12 College Creamery F13 Euro Gyro F14 College Coneys F15 Taco (one way tra c) foottraconlyfoottraconly SouthWaterStreetNorthWaterStreet Red listings, see map

Palffy-Muhoray, Peter


Property:Address | Open Energy Information  

Open Energy Info (EERE)

Address Address Jump to: navigation, search This is a property of type String. Pages using the property "Address" Showing 25 pages using this property. (previous 25) (next 25) 1 1366 Technologies + 45 Hartwell Avenue + 1st Light Energy, Inc. + 3224 McHennry Ave Suite F + 2 21-Century Silicon, Inc. + 1681 Firman Drive, Suite 103 + 3 3Degrees + 2 Embarcadero Center Suite 2950 + 3M + 3M Center + 3TIER + 2001 Sixth Avenue + 4 4th Day Energy + 38886 River Belle + 5 5 boro biofuel + 100 maiden lane + 8 8minutenergy Renewables, LLC + 111 Woodmere Road, Suite 190 + @ @Ventures (California) + 800 Menlo Avenue, Suite 120 + @Ventures (Massachusetts) + 187 Ballardvale Street, Suite A260 + A A.J. Rose Manufacturing Company + 38000 Chester Road + A1 Sun, Inc. + 1435 4th St. +


Information Resources: Adaptive Street Lighting Controls  

NLE Websites -- All DOE Office Websites (Extended Search)

Adaptive Street Lighting Controls Adaptive Street Lighting Controls This two-part DOE Municipal Solid-State Street Lighting Consortium webinar focused on LED street lighting equipped with adaptive control components. In Part I, presenters Amy Olay of the City of San Jose, CA, and Kelly Cunningham of the California Lighting Technology Center at UC Davis discussed their experiences as early adopters of these smart street lighting systems. In Part II, presenters Laura Stuchinsky of the City of San Jose, CA, and Michael Poplawski of Pacific Northwest National Laboratory explored the MSSLC's recently released Model Specification for Adaptive Control and Remote Monitoring of LED Roadway Luminaires. Part I: Experiences and Benefits June 11, 2013 View the presentation slides Part II: Reviewing the MSSLC's Model Specification


Cleaning up the Streets of Denver  

Science Conference Proceedings (OSTI)

Between 1913 and 1924, several Denver area facilities extracted radium from carnotite ore mined from the Paradox basin region of Colorado. Tailings or abandoned ores from these facilities were apparently incorporated into asphalt used to pave approximately 7.2 kilometers (4.5 miles) of streets in Denver. A majority of the streets are located in residential areas. The radionuclides are bound within the asphalt matrix and pose minimal risk unless they are disturbed. The City and County of Denver (CCoD) is responsible for controlling repairs and maintenance on these impacted streets. Since 2002, the CCoD has embarked on a significant capital improvement project to remove the impacted asphalt for secure disposal followed by street reconstruction. To date, Parsons has removed approximately 55 percent of the impacted asphalt. This paper discusses the history of the Denver Radium Streets and summarizes on-going project efforts. (authors)

Stegen, R.L.; Wood, T.R.; Hackett, J.R. [Parsons, 1700 Broadway, Suite 900, Denver, Colorado 80290 (United States); Sogue, A. [City and County of Denver, 201 West Colfax, Denver, Colorado 80202 (United States)



Boulevard Livability Study [Streets: Old Paradigm, New Investment  

E-Print Network (OSTI)

whereas the medium and light control streets ranged from 70OCEAN PKWY EASTERN PKWY LIGHT STREET boulevards. M o r eeach direction and the light streets just one lane i n each

Bosselmann, Peter; Macdonald, Elizabeth



Gas, Heat, Water, Sewerage Collection and Disposal, and Street...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Gas, Heat, Water, Sewerage Collection and Disposal, and Street Railway Companies (South Carolina) Gas, Heat, Water, Sewerage Collection and Disposal, and Street Railway Companies...


Electric, Gas, Water, Heating, Refrigeration, and Street Railways...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

and Street Railways Facilities and Service (South Dakota) Electric, Gas, Water, Heating, Refrigeration, and Street Railways Facilities and Service (South Dakota) < Back...


Street and Parking Facility Lighting Retrofit Financial Analysis...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Street and Parking Facility Lighting Retrofit Financial Analysis Tool Webinar Street and Parking Facility Lighting Retrofit Financial Analysis Tool Webinar August 22, 2013 1:00PM...

Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The Recovery Act is "Lighting Up" the streets of Philadelphia...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Marketing Administration Other Agencies You are here Home The Recovery Act is "Lighting Up" the streets of Philadelphia The Recovery Act is "Lighting Up" the streets of...


Solid-State Lighting: Webcast: Evaluating LED Street Lighting...  

NLE Websites -- All DOE Office Websites (Extended Search)

Webcast: Evaluating LED Street Lighting Solutions to someone by E-mail Share Solid-State Lighting: Webcast: Evaluating LED Street Lighting Solutions on Facebook Tweet about...


Solid-State Lighting: Adaptive Street Lighting Controls  

NLE Websites -- All DOE Office Websites (Extended Search)

Adaptive Street Lighting Adaptive Street Lighting Controls to someone by E-mail Share Solid-State Lighting: Adaptive Street Lighting Controls on Facebook Tweet about Solid-State Lighting: Adaptive Street Lighting Controls on Twitter Bookmark Solid-State Lighting: Adaptive Street Lighting Controls on Google Bookmark Solid-State Lighting: Adaptive Street Lighting Controls on Delicious Rank Solid-State Lighting: Adaptive Street Lighting Controls on Digg Find More places to share Solid-State Lighting: Adaptive Street Lighting Controls on AddThis.com... Conferences & Meetings Presentations Publications Webcasts Videos Tools Adaptive Street Lighting Controls This two-part DOE Municipal Solid-State Street Lighting Consortium webinar focused on LED street lighting equipped with adaptive control components.


2009 Takin' it to the Streets Campaign  

Energy.gov (U.S. Department of Energy (DOE))

The objective of the Summer Takin It to the Streets awareness campaign is to reinforce awareness and understanding by informing DOE employees and general users about best practices to prevent,...


Main Street Loan Program (North Dakota)  

Energy.gov (U.S. Department of Energy (DOE))

The Main Street Loan Program loans of up to $24,999 through the Certified Development Corporation (CDC) in participation with local lenders or economic development organizations for small...


Manhattan Project: Los Alamos Street Scene  

Office of Scientific and Technical Information (OSTI)

LOS ALAMOS STREET SCENE LOS ALAMOS STREET SCENE Los Alamos (The Town) Resources > Photo Gallery Los Alamos street scene. Fuller Lodge and the "Big House" are visible in the distance (see below). Above is a view of Los Alamos (looking north). In the distance, Fuller Lodge and the "Big House" are visible to the left and right, respectively (see below). The photograph is reproduced from Los Alamos Scientific Laboratory, Los Alamos: Beginning of an Era, 1943-1945 (Los Alamos: Public Relations Office, Los Alamos Scientific Laboratory, ca. 1967-1971), 13. The labels and "close-ups" below were made by the Office of History and Heritage Resources. Los Alamos street scene (labeled) Close-up of Fuller Lodge Close-up of the "Big House" Click on a link below to return to:


Addressing Energy Demand  

NLE Websites -- All DOE Office Websites (Extended Search)

Addressing Energy Demand through Demand Response: International Experiences and Practices Bo Shen, Girish Ghatikar, Chun Chun Ni, and Junqiao Dudley Environmental Energy...


July 18, 2012 Using QECBs for Street Lighting Upgrades  

E-Print Network (OSTI)

lighting technologies (e.g. light-emitting diodes, induction lighting) can reduce street light energy


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


PNNL: Contacts - Richland Building Addresses  

NLE Websites -- All DOE Office Websites (Extended Search)

for the US DOE 790 6th Street Richland WA 99354 Warehouse Phone: (509) 375-2927 PNNL Campus Map Hours of Operations: 8:00am to 3:30pm (closed for lunch) - all freight...


Wall Street vs. Main Street: Firm Strategies for Defending Legitimacy and Their Impact on Different Stakeholders  

Science Conference Proceedings (OSTI)

We assess the effect of firm strategies to defend legitimacy on two different stakeholder groupsthe public (Main Street) and the investment community (Wall Street). We identify four types of firm strategies in response ... Keywords: crisis response, legitimacy, stakeholder theory, stigma management, thought worlds

Anna Lamin; Srilata Zaheer



Addressing Missclassified Positions  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2 2009 2 2009 MEMORANDUM FOR HUMAN RESOURCE DIRECTORS FROM: CAPITAL OFFICER SUBJECT: GULDANCE MEMORANDUM #3: Addressing Misclassified Positions This memorandum provides policy guidance on how to consistently address misclassified positions within the Department and is effective immediately. There are several different circumstances that affect how a misclassified position will be addressed. These are discussed below: If it is determined that a position is classified to the wrong title, then the classification must be corrected immediately. If it is determined that a position is classified to the wrong series, then the classification must be corrected immediately. Note: The series determination involves distinguishing between one-grade interval work and two-grade interval


Brighter Lights, Safer Streets | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Brighter Lights, Safer Streets Brighter Lights, Safer Streets Brighter Lights, Safer Streets May 15, 2012 - 5:56pm Addthis Workers install the final LED streetlight for DC's EECBG-funded energy efficient lighting upgrade. | Energy Department photo, credit Chris Galm. Workers install the final LED streetlight for DC's EECBG-funded energy efficient lighting upgrade. | Energy Department photo, credit Chris Galm. Chris Galm Marketing & Communications Specialist, Office of Energy Efficiency & Renewable Energy What does this project do? DC's streetlight upgrades will save approximately $59,000 in energy costs every year -- in addition to the reduced maintenance and replacement costs. The new lights will also cut greenhouse gas emissions by 719 tons. Thanks to support from an Energy Department Recovery Act grant, Washington,



NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


Retrofitting Urban Arterials Into Complete Streets  

E-Print Network (OSTI)

speeds reduce mobility and increase costs for all vehicles Required to design to Level of Service C with Federal highway standards and guidelines Slower speeds reduce mobility and increase costs for all in Complete Streets Conflicts with National Guidelines #12;ITE New Recommended Practice Designing Walkable

Bertini, Robert L.


Lighting the Night: Technology, Urban Life and the Evolution of Street Lighting [Light in Place  

E-Print Network (OSTI)

May 1912), 783. 8. "New Street Lights Increase Trade 3 5 Perlight, including street light, became part of America'sBeautiful-inspired street lights graced wealthy residen

Holden, Alfred



The National Science Bowl Students are Here! (The Streets of...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

The National Science Bowl Students are Here (The Streets of D.C. Just Got a Little Smarter.) The National Science Bowl Students are Here (The Streets of D.C. Just Got a Little...


Spatial stratification of street vendors in downtown Mexico City  

E-Print Network (OSTI)

The fight for space between city administrators and street vendors working in city centers is one of the major controversies about street commerce. Trying to renew and upgrade their downtowns, city administrators of most ...

Baroni, Bruno Nazim



Alternative Fuels Data Center: Natural Gas Street Sweepers Improve Air  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Natural Gas Street Natural Gas Street Sweepers Improve Air Quality in New York to someone by E-mail Share Alternative Fuels Data Center: Natural Gas Street Sweepers Improve Air Quality in New York on Facebook Tweet about Alternative Fuels Data Center: Natural Gas Street Sweepers Improve Air Quality in New York on Twitter Bookmark Alternative Fuels Data Center: Natural Gas Street Sweepers Improve Air Quality in New York on Google Bookmark Alternative Fuels Data Center: Natural Gas Street Sweepers Improve Air Quality in New York on Delicious Rank Alternative Fuels Data Center: Natural Gas Street Sweepers Improve Air Quality in New York on Digg Find More places to share Alternative Fuels Data Center: Natural Gas Street Sweepers Improve Air Quality in New York on AddThis.com...

Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


A Laboratory Model of Urban Street-Canyon Flows  

Science Conference Proceedings (OSTI)

A circulating water channel is constructed to examine urban street-canyon flow. In the cases of an even-notch street canyon in which model buildings on both sides of the street have equal heights, one vortex is observed in model canyons with ...

Jong-Jin Baik; Rae-Seol Park; Hye-Yeong Chun; Jae-Jin Kim



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


LED Street and Area Lighting Technologies  

Science Conference Proceedings (OSTI)

Light emitting diodes (LEDs) are being used for applications beyond just indicator lights. One of those applications, street and area lighting, is of considerable interest. This interest is generated by potential reductions that can be achieved in operating costs resulting from lower maintenance costs as well as potentially lower electricity costs that result from the higher efficiency of LED lamps in the systems, the capability to dim and control LED systems, and better light quality. This white paper l...



DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


Address EJ Conference  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Congressman Clyburn to Congressman Clyburn to Address EJ Conference Congressman Clyburn has graciously agreed to speak at The State of Environmental Justice in America 2011 Conference. Congressman Clyburn (D - SC) has been a member of the U.S. House of Congress since 1993. He has held the positions of Chairman of the Democratic Black Caucus, House Democratic Caucus Vice Chair, Chair of the Democratic Caucus and from 2006 until January 2011, was the House Majority Whip. Currently, as Assistant Democratic Leader in the 112th Congress and the number three Democrat in the House, James E. Clyburn will be the leadership liaison to the Appropriations Committee and one of the Democratic Caucus' primary liaisons to the White House. Congressman Clyburn has been a life long champion and has worked diligently


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


Southwestern Power Administration One West Third Street  

NLE Websites -- All DOE Office Websites (Extended Search)

Department of Energy Department of Energy Southwestern Power Administration One West Third Street Tulsa, Oklahoma 74103-3502 December 2, 2008 ENVIRONMENTAL POLICY STATEMENT The Environmental Policy is the driver for implementing and improving Southwestern Power Administration's (Southwestern) Environmental Management System so that Southwestern can maintain and improve environmental performance. The policy reflects the commitment of top management to comply with applicable legal and other requirements, to prevent pollution and to continually improve. Southwestern's Environmental Policy forms the basis upon which its Environmental Objectives and Targets are established. Southwestern's senior management has committed in writing the following Environmental Policy:


*Corresponding author. E-mail address: agagroup@olympus.ece.jhu.edu (A.G. Andreou).  

E-Print Network (OSTI)

*Corresponding author. E-mail address: agagroup@olympus.ece.jhu.edu (A.G. Andreou). This research and Computer Engineering, The Johns Hopkins University, 3400 N. Charles Street, Baltimore, MD 21211, USA contains eight photoreceptors which receive light through a facet lens and respond in graded fashion

Maryland at College Park, University of


Information Resources: Webcast: Evaluating LED Street Lighting Solutions  

NLE Websites -- All DOE Office Websites (Extended Search)

Evaluating LED Street Lighting Solutions Evaluating LED Street Lighting Solutions In this July 20, 2010 webcast, Edward Smalley of Seattle City Light provided an update on DOE Municipal Solid-State Street Lighting Consortium activities. The webcast also presented perspectives from members who are involved with implementing LED street lighting evaluations, including Tod Rosinbum of the City of Portland, Oregon, John Walter of National Grid, and Amy Olay of the City of San Jose, California. View presentation slides (Visit the Adobe® Web site to Download Adobe Reader.) Introduction (PDF 984 KB) Edward Smalley, DOE Municipal Solid-State Street Lighting Consortium, Moderator Evaluating LED Street Lighting Solutions (PDF 404 KB) Tod Rosinbum, City of Portland, Oregon LED Pilot Projects: A Utility Perspective (PDF 112 KB)


Electric, Street Railway, and Gas Corporations (South Dakota) | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Electric, Street Railway, and Gas Corporations (South Dakota) Electric, Street Railway, and Gas Corporations (South Dakota) Electric, Street Railway, and Gas Corporations (South Dakota) < Back Eligibility Commercial Developer Savings Category Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making Electricity Water Home Weatherization Solar Wind Program Info State South Dakota Program Type Line Extension Analysis Provider South Dakota Public Utilities Commission This legislation contains provisions pertaining to a corporation formed for the purpose of constructing, maintaining and operating a street railway or railways; generating, transmitting or distributing electricity to be sold to or used by the public for heat, light or power manufacturing; or producing, supplying, or transporting natural or artificial gas. The


Quantity versus Quality in Off-Street Parking Requirements  

E-Print Network (OSTI)

off-street parking requirements does not restrict parking orrequirements if they are con- verted to residential uses. Los Angeles, for example, does

Mukhija, Vinit; Shoup, Donald



Federal Energy Management Program: Outdoor Solid State Street...  

NLE Websites -- All DOE Office Websites (Extended Search)

& Structures Case Studies Resources Working Group Distributed Energy ResourcesCombined Heat & Power Resources Renewable Energy Outdoor Solid State Street and Roadway Lighting...


Information Resources: Member Case Studies: LED Street Lighting...  

NLE Websites -- All DOE Office Websites (Extended Search)

Member Case Studies: LED Street Lighting Programs in Algona (IA), Asheville (NC), and Boston (MA) This May 8, 2013 webcast featured presentations from DOE Municipal Solid-State...


Texas Avenue mixed-use urban street redevelopment, Lubbock, Texas.  

E-Print Network (OSTI)

??This thesis focused primarily on establishing design principles for mixed-use urban street redevelopment. This study began with a literature review exploring the history of modern (more)

[No author


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab


Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


2013 Director's New Year Address  

NLE Websites -- All DOE Office Websites (Extended Search)

Director's New Year Address 2013 Director's New Year Address Print Looking Forward and Celebrating 20 Years in 2013 falocne We recently sat down with ALS Director Roger Falcone to...


One West Third Street Tulsa, Oklahoma  

NLE Websites -- All DOE Office Websites (Extended Search)

gave a welcoming address which emphasized the need for more outspoken advocacy of Corps infrastructure funding. He noted that while regional organizations lobby for specific...


Notices 888 First Street, NE., Washington, DC  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

11 Federal Register 11 Federal Register / Vol. 76, No. 122 / Friday, June 24, 2011 / Notices 888 First Street, NE., Washington, DC 20426. The filings in the above-referenced proceeding are accessible in the Commission's eLibrary system by clicking on the appropriate link in the above list. They are also available for review in the Commission's Public Reference Room in Washington, DC. There is an eSubscription link on the Web site that enables subscribers to receive e-mail notification when a document is added to a subscribed docket(s). For assistance with any FERC Online service, please e-mail FERCOnlineSupport@ferc.gov or call (866) 208-3676 (toll free). For TTY, call (202) 502-8659. Dated: June 20, 2011. Kimberly D. Bose, Secretary. [FR Doc. 2011-15859 Filed 6-23-11; 8:45 am]


Notices 888 First Street NE., Washington, DC  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

53 Federal Register 53 Federal Register / Vol. 78, No. 56 / Friday, March 22, 2013 / Notices 888 First Street NE., Washington, DC 20426. This filing is accessible on-line at http://www.ferc.gov, using the ''eLibrary'' link and is available for review in the Commission's Public Reference Room in Washington, DC. There is an ''eSubscription'' link on the Web site that enables subscribers to receive email notification when a document is added to a subscribed docket(s). For assistance with any FERC Online service, please email FERCOnlineSupport@ferc.gov, or call (866) 208-3676 (toll free). For TTY, call (202) 502-8659. Comment Date: 5:00 p.m. Eastern Time on April 2, 2013. Dated: March 15, 2013. Kimberly D. Bose, Secretary. [FR Doc. 2013-06602 Filed 3-21-13; 8:45 am] BILLING CODE 6717-01-P


Notices Disabled, 1401 S. Clark Street, Suite  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

13 Federal Register 13 Federal Register / Vol. 78, No. 240 / Friday, December 13, 2013 / Notices Disabled, 1401 S. Clark Street, Suite 10800, Arlington, Virginia 22202-4149. FOR FURTHER INFORMATION CONTACT: Barry S. Lineback, Telephone: (703) 603-7740, Fax: (703) 603-0655, or email CMTEFedReg@AbilityOne.gov. SUPPLEMENTARY INFORMATION: Addition On 6/28/2013 (78 FR 38952-38953), the Committee for Purchase From People Who Are Blind or Severely Disabled published notice of proposed addition to the Procurement List. After consideration of the material presented to it concerning capability of qualified nonprofit agency to provide the service and impact of the addition on the current or most recent contractors, the Committee has determined that the service listed below is suitable for procurement by the


Solid-State Lighting: Municipal Consortium LED Street Lighting Workshop  

NLE Websites -- All DOE Office Websites (Extended Search)

Los Angeles, CA to someone Los Angeles, CA to someone by E-mail Share Solid-State Lighting: Municipal Consortium LED Street Lighting Workshop Presentations and Materials-Los Angeles, CA on Facebook Tweet about Solid-State Lighting: Municipal Consortium LED Street Lighting Workshop Presentations and Materials-Los Angeles, CA on Twitter Bookmark Solid-State Lighting: Municipal Consortium LED Street Lighting Workshop Presentations and Materials-Los Angeles, CA on Google Bookmark Solid-State Lighting: Municipal Consortium LED Street Lighting Workshop Presentations and Materials-Los Angeles, CA on Delicious Rank Solid-State Lighting: Municipal Consortium LED Street Lighting Workshop Presentations and Materials-Los Angeles, CA on Digg Find More places to share Solid-State Lighting: Municipal Consortium


FirstEnergy (Potomac Edison) - Municipal and Street Lighting Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FirstEnergy (Potomac Edison) - Municipal and Street Lighting FirstEnergy (Potomac Edison) - Municipal and Street Lighting Program (Maryland) FirstEnergy (Potomac Edison) - Municipal and Street Lighting Program (Maryland) < Back Eligibility Commercial Industrial Institutional Local Government Nonprofit Schools State Government Savings Category Appliances & Electronics Commercial Lighting Lighting Program Info State Maryland Program Type Utility Rebate Program Rebate Amount '''Street Lighting'''br/> High Pressure Sodium Fixtures: $10 - $50/unit LED/Induction Fixtures: $50 '''Traffic/Pedestrian Signals''' Lamp/Signal/Arrows: $35/unit Provider FirstEnergy (Potomac Edison) FirstEnergy offers several incentives for non-residential and municipal customers to upgrade traffic signals, pedestrian signals, street lights to more efficient fixtures. The Municipal Lighting Incentive Program offers


DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institution Name Institution Name Address Place Zip Notes Website Region Institution Name Institution Name Address Place Zip Notes Website Region ARCH Venture Partners Texas ARCH Venture Partners Texas Bridgepoint Parkway Bldg Suite Austin Texas http www archventure com Texas Area ARCH Venture Partners Washington ARCH Venture Partners Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area African Wind Energy Association South Africa African Wind Energy Association South Africa South Africa http www afriwea org en south africa htm Alternative Energy Institute Alternative Energy Institute russell long blvd Canyon Texas http www windenergy org Texas Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Research Addressing Power Plant Water  

NLE Websites -- All DOE Office Websites (Extended Search)

Addressing Power Plant Water Management to Minimize Water Use while Providing Reliable Electricity Generation Water and Energy 2 Water and Energy are inextricably linked. Because...


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



Lighting the Night: Technology, Urban Life and the Evolution of Street Lighting [Light in Place  

E-Print Network (OSTI)

Electrical 16. "Highway Lighting by So dium Vapor Lamps,"Possibilities of Street: Lighting Improve ments," TheLaunches Broad Street Lighting Promotion Campaign," The

Holden, Alfred



One West Third Street Tulsa, Oklahoma  

NLE Websites -- All DOE Office Websites (Extended Search)

Third Street Tulsa, Oklahoma 74103-3502 918-595-6600 Fax 918-595-6656 www.swpa.gov The UPDATE is published by and for customers, retirees, and employees of Southwestern Power Administration like: Katherine (K.C.) Thomas Director, Division of Information Technology (CIO) Tulsa, Oklahoma Special thanks to: Ron Beck Miya Boyken Ashley Butler Scott Carpenter Mike Deihl Ruben Garcia William Hiller David Kannady Jim McDonald Beth Nielsen Fritha Ohlson Tracey Stewart U P D AT E S O U T H W E S T E R N P O W E R A D M I N I S T R A T I O N J A N U A R Y - J U N E 2 0 0 7 Southwestern Responds to Reliability Requirements Southwestern expects to complete its agency-wide assessment regarding compliance with mandatory reliability standards under Standards Order 693 of the Federal Energy Regulatory Commission (FERC) by the June 18, 2007,


Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


Information Resources: Webcast: Municipal Solid-State Street Lighting  

NLE Websites -- All DOE Office Websites (Extended Search)

Municipal Solid-State Street Lighting Consortium Retrofit Financial Analysis Tool Municipal Solid-State Street Lighting Consortium Retrofit Financial Analysis Tool This April 3, 2012 webcast presented information about the Retrofit Financial Analysis Tool developed by DOE"s Municipal Solid-State Street Lighting Consortium. Doug Elliott of Pacific Northwest National Laboratory provided a guided walk-through of what the tool can do and how to use it to evaluate costs and benefits associated with converting to LED street and roadway lighting. The webcast showed how city and other government agencies, utilities, finance and budget offices, and energy efficiency organizations can use the tool to compute annualized energy-cost savings, maintenance savings, greenhouse gas reductions, net present value, and simple payback, which can be helpful when putting together construction and conservation grant applications, as well as for preparing budgets and comparing incumbent costs to new costs.


Information Resources: Municipal Solid-State Street Lighting...  

NLE Websites -- All DOE Office Websites (Extended Search)

6, 2010 webcast served as the first official meeting of the new DOE Municipal Solid-State Street Lighting Consortium. Ed Smalley of Seattle City Light and Bruce Kinzey of Pacific...


Benchmarking the Mean Streets of NYC and Beyond  

NLE Websites -- All DOE Office Websites (Extended Search)

Benchmarking the Mean Streets of NYC and Beyond Speaker(s): Conor Laver Date: September 30, 2013 - 12:00pm - 1:00pm Location: 90-3122 Seminar HostPoint of Contact: Louis-Benoit...

Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Street and Parking Facility Lighting Retrofit Financial Analysis Tool Webinar  

Energy.gov (U.S. Department of Energy (DOE))

DOE will present a live webinar titled "Using the Street and Parking Facility Lighting Retrofit Financial Analysis Tool" on Thursday, August 22, from 1:00 p.m. to 2:00 p.m. Eastern Daylight Time....


Solid-State Lighting: Municipal Consortium LED Street Lighting...  

NLE Websites -- All DOE Office Websites (Extended Search)

Boston, MA to someone by E-mail Share Solid-State Lighting: Municipal Consortium LED Street Lighting Workshop Presentations and Materials-Boston, MA on Facebook Tweet about...


Solid-State Lighting: Municipal Consortium LED Street Lighting...  

NLE Websites -- All DOE Office Websites (Extended Search)

Dallas, TX to someone by E-mail Share Solid-State Lighting: Municipal Consortium LED Street Lighting Workshop Presentations and Materials-Dallas, TX on Facebook Tweet about...


Street media : ambient messages in an urban space  

E-Print Network (OSTI)

Ambient street media are the media of our everyday lives in cities. Manifested in bits and fragments on the surfaces of the streetscape, these media often escape our notice - tuned out as visual clutter or dismissed as ...

Murthy, Rekha (Rekha S.)



Flow Variability in a North American Downtown Street Canyon  

Science Conference Proceedings (OSTI)

Previous field and laboratory studies have indicated that flow and turbulence inside urban areas and, in particular, in street canyons, is very complex and is associated with wakes and vortices developing near buildings. However, a number of open ...

Petra Klein; James V. Clark



Information Resources: Using the Street and Parking Facility Lighting  

NLE Websites -- All DOE Office Websites (Extended Search)

Using the Street and Parking Facility Lighting Retrofit Financial Analysis Tool Using the Street and Parking Facility Lighting Retrofit Financial Analysis Tool This August 22, 2013 webinar provided a guided walk-through of the Street and Parking Facility Lighting Retrofit Financial Analysis Tool. Developed by a partnership of the DOE Municipal Solid-State Street Lighting Consortium, the Clinton Climate Initiative/C40, and the DOE Federal Energy Management Program, the Excel-based tool assists with the financial analysis of retrofitting street and parking facility lighting with more efficient alternatives. During the webinar, Doug Elliott of Pacific Northwest National Laboratory discussed how the tool can be used to evaluate costs and benefits associated with converting to more efficient street and parking facility lighting and how property owners, city and other government agencies, utilities, and energy efficiency organizations can use the tool to compute annualized energy and energy-cost savings, maintenance savings, greenhouse gas reductions, net present value, and simple payback associated with potential lighting upgrades.


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Massachusetts Ballardvale Street Suite Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area Battery Ventures Battery Ventures Winter Street Suite Waltham Massachusetts Venture Capital http www battery com Greater Boston Area Black Coral Capital Black Coral Capital Union Street rd Floor Boston Massachusetts Cleantech private equity http www blackcoralcapital com Greater Boston Area Commons Capital Commons Capital Washington Street th floor Brookline Massachusetts Early stage venture capital fund http www commonscapital


Title: Address: Type of report:  

E-Print Network (OSTI)

To explore options for reducing greenhouse gas emissions from freight transport Environment Recommendation to the Australian Transport Council by July 2009. This report discusses the key issues for addressing growing greenhouse gas emissions from freight transport. The report proposes actions for managing and reducing greenhouse gas emissions from freight transport over the longer term. For public consultation Climate change, greenhouse gas emissions, freight transport.

Key Milestones; Key Words



,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Addressing Energy Demand through Demand Response: International...  

NLE Websites -- All DOE Office Websites (Extended Search)

Addressing Energy Demand through Demand Response: International Experiences and Practices Title Addressing Energy Demand through Demand Response: International Experiences and...


Research Projects Addressing Technical Challenges to Environmentally...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Research Projects Addressing Technical Challenges to Environmentally Acceptable Shale Gas Development Selected by DOE Research Projects Addressing Technical Challenges to...


New Rules Help Pocahontas Brighten Streets | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Rules Help Pocahontas Brighten Streets Rules Help Pocahontas Brighten Streets New Rules Help Pocahontas Brighten Streets October 21, 2010 - 10:00am Addthis The City of Pocahontas, Iowa swill replace sodium streetlights with LED fixtures. | File photo The City of Pocahontas, Iowa swill replace sodium streetlights with LED fixtures. | File photo Maya Payne Smart Former Writer for Energy Empowers, EERE What are the key facts? Pocahontas, Iowa was awarded a Recovery Act grant of more than $81,000. The city will replace 266 high-pressure sodium streetlights with LED fixtures. The LED lights are projected to reduce energy and maintenance costs by more than $17, 000 a year. Officials of the City of Pocahontas, Iowa, thought replacing old streetlights with light-emitting diode (LED) lighting was a no-brainer.


Microsoft PowerPoint - Pecan Street-Scott Hinson-Building America.pptx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Pecan Street Inc. Pecan Street Inc. Scott Hinson shinson@pecanstreet.org Contents Pecan Street Background Pecan Street Research Initiatives Pike Powers Commercialization Laboratory Light Bulbs Pecan Street Background Information What is Pecan Street Who is Pecan Street Research Objectives and Initiatives Residential Home Energy Data Deepest residential energy available Enables research and application development not possible with "normal" data Granularity Comparison August 10, 2011: 60-minute Consumption Data (kW) August 10, 2011: 1-hour Consumption Data (kW) 0 4 8 12 04:00 08:00 12:00 16:00 20:00 Pecan Street Consortium Granularity Comparison August 10, 2011: 15-minute Consumption Data (kW 0 4 8 12 04:00 08:00 12:00 16:00 20:00 Pecan Street Consortium Granularity Comparison


Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


Cursive script postal address recognition  

E-Print Network (OSTI)

Large variations in writing styles and di culty in segmenting cursive words are the main reasons for cursive script postal address recognition being a challenging task. A scheme for locating and recognizing words based on over-segmentation followed by dynamic programming is proposed. This technique is being used for zip code extraction as well as city-state recognition in our system. Results have been reported based on cursive script images from the United States Postal Service(USPS) database. An overview of the cursive script postal address recognition system under development at the IBM Almaden Research Center, is presented. Optical Character Recognition(OCR) systems are usually trained to minimize character level errors, which does not necessarily guarantee the best results for word level recognition. Ascheme for combining character-level optimized classi ers, using a word-level optimization function, to achieve higher word level recognition rates is proposed. The optimum values for the parameters of the combination function are obtained using the gradient descent method. Improvements in word recognition rates on the USPS database by using word-level optimized ensembles of classi ers are reported. To My Family iii

Prasun Sinha; Prasun Sinha



Mr. Tad W. Patzek 13331 Trail Drive Street  

E-Print Network (OSTI)

Mr. Tad W. Patzek 13331 Trail Drive Street Austin, Texas 78737 Dear Mr. Patzek: THE SECRETARY OF THE INTERIOR WASHINGTON MAR 11 2011 It is my pleasure to appoint you as a member of the Ocean Energy Safety of the Bureau of Ocean Energy Management, Regulation and Enforcement on matters and actions relating to offshore

Patzek, Tadeusz W.


A Review of Street Lighting Evaluations: Crime Reduction Effects  

E-Print Network (OSTI)

Abstract: Consideration of the literature concerning street lighting effects on crime yields the following conclusions: (1) Precisely targeted increases in street lighting generally have crime reduction effects. (2) More general increases in street lighting seem to have crime prevention effects, but this outcome is not universal Older and U.S. research yield fewer positive results than more recent U.K. research. (3) Even untargeted increases in crime prevention generally make residents less fearful of crime or more confident of their own safety at night. (4) In the most recent and sophisticated studies, street lighting improvements are associated with crime reductions in the daytime as well as during the hours of darkness. (5) The debate about lighting effects has served to preclude a more refined analysis of the means by and circumstances in which lighting might reduce crime. Our aim should now be to use context-appropriate lighting schemes as part of a full repertoire of crime reduction tactics. Recommendations based upon a strategic view of current crime reduction policy are made about how lighting effects could be clarified and elaborated. The provisions of the British Crime and Disorder Act 1998 constitute a potential vehicle for lighting programmes operating within crime reduction schemes generally.

Ken Pease



Solid-State Lighting: Using the Street and Parking Facility Lighting  

NLE Websites -- All DOE Office Websites (Extended Search)

Using the Street and Parking Using the Street and Parking Facility Lighting Retrofit Financial Analysis Tool to someone by E-mail Share Solid-State Lighting: Using the Street and Parking Facility Lighting Retrofit Financial Analysis Tool on Facebook Tweet about Solid-State Lighting: Using the Street and Parking Facility Lighting Retrofit Financial Analysis Tool on Twitter Bookmark Solid-State Lighting: Using the Street and Parking Facility Lighting Retrofit Financial Analysis Tool on Google Bookmark Solid-State Lighting: Using the Street and Parking Facility Lighting Retrofit Financial Analysis Tool on Delicious Rank Solid-State Lighting: Using the Street and Parking Facility Lighting Retrofit Financial Analysis Tool on Digg Find More places to share Solid-State Lighting: Using the Street and


Solid-State Lighting: Text-Alternative Version: Evaluating LED Street  

NLE Websites -- All DOE Office Websites (Extended Search)

Evaluating LED Street Lighting Solutions to someone by E-mail Evaluating LED Street Lighting Solutions to someone by E-mail Share Solid-State Lighting: Text-Alternative Version: Evaluating LED Street Lighting Solutions on Facebook Tweet about Solid-State Lighting: Text-Alternative Version: Evaluating LED Street Lighting Solutions on Twitter Bookmark Solid-State Lighting: Text-Alternative Version: Evaluating LED Street Lighting Solutions on Google Bookmark Solid-State Lighting: Text-Alternative Version: Evaluating LED Street Lighting Solutions on Delicious Rank Solid-State Lighting: Text-Alternative Version: Evaluating LED Street Lighting Solutions on Digg Find More places to share Solid-State Lighting: Text-Alternative Version: Evaluating LED Street Lighting Solutions on AddThis.com... Conferences & Meetings Presentations

Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Solid-State Lighting: Municipal Solid-State Street Lighting Consortium  

NLE Websites -- All DOE Office Websites (Extended Search)

Municipal Solid-State Street Municipal Solid-State Street Lighting Consortium Kickoff Webcast to someone by E-mail Share Solid-State Lighting: Municipal Solid-State Street Lighting Consortium Kickoff Webcast on Facebook Tweet about Solid-State Lighting: Municipal Solid-State Street Lighting Consortium Kickoff Webcast on Twitter Bookmark Solid-State Lighting: Municipal Solid-State Street Lighting Consortium Kickoff Webcast on Google Bookmark Solid-State Lighting: Municipal Solid-State Street Lighting Consortium Kickoff Webcast on Delicious Rank Solid-State Lighting: Municipal Solid-State Street Lighting Consortium Kickoff Webcast on Digg Find More places to share Solid-State Lighting: Municipal Solid-State Street Lighting Consortium Kickoff Webcast on AddThis.com... Conferences & Meetings


Solid-State Lighting: Considering LEDs for Street and Area Lighting  

NLE Websites -- All DOE Office Websites (Extended Search)

Considering LEDs for Street and Area Lighting to someone by E-mail Share Solid-State Lighting: Considering LEDs for Street and Area Lighting on Facebook Tweet about Solid-State...


A Large-Eddy Simulation Study of Thermal Effects on Turbulent Flow and Dispersion in and above a Street Canyon  

Science Conference Proceedings (OSTI)

Thermal effects on turbulent flow and dispersion in and above an idealized street canyon with a street aspect ratio of 1 are numerically investigated using the parallelized large-eddy simulation model (PALM). Each of upwind building wall, street ...

Seung-Bu Park; Jong-Jin Baik; Siegfried Raasch; Marcus Oliver Letzel



Technical Options to Address Cyber Security, Interoperability...  

NLE Websites -- All DOE Office Websites (Extended Search)

Technical Options to Address Cyber Security, Interoperability and Other Issues with ZigBee SEP Title Technical Options to Address Cyber Security, Interoperability and Other Issues...


Federal Engagement in Standards Activities to Address ...  

Science Conference Proceedings (OSTI)

... panels and coordination initiatives that address key national priorities, including homeland security, nanotechnology, biofuels, nuclear energy ...



The Network Analysis of Urban Streets: A Primal Approach  

E-Print Network (OSTI)

The network metaphor in the analysis of urban and territorial cases has a long tradition especially in transportation/land-use planning and economic geography. More recently, urban design has brought its contribution by means of the "space syntax" methodology. All these approaches, though under different terms like accessibility, proximity, integration,connectivity, cost or effort, focus on the idea that some places (or streets) are more important than others because they are more central. The study of centrality in complex systems,however, originated in other scientific areas, namely in structural sociology, well before its use in urban studies; moreover, as a structural property of the system, centrality has never been extensively investigated metrically in geographic networks as it has been topologically in a wide range of other relational networks like social, biological or technological. After two previous works on some structural properties of the dual and primal graph representations of urban street ne...

Porta, S; Latora, V; Porta, Sergio; Crucitti, Paolo; Latora, Vito



Mr. Mark Finkelstein State Street,Associates'L..P. II  

Office of Legacy Management (LM)

Mr. Mark Finkelstein Mr. Mark Finkelstein State Street,Associates'L..P. II 210 Lake Street Ithaca, New York I4856 Dear Mr. Finkelstein: ', 'The Oak Ridge Institute forScience',and Education (ORISEj,has recently sent me the enclosed'radiological survey,conducted at the former Ithaca Gun Company forging building. : The radiationilevels measured during, the'survey were similar to the background'levels in the Ithaca 'area. A number of samples were taken for analysis, and all exhibited background ,concentrations of radioactive,elements: No radioactive,materials that are 'attributable to the former Ithaca Gun Company or to' the activities of the former Atomic.Energy Commission were identified. ;The Department of Energy will prepare.documentation to formally eliminate the site from the Department's Formerly Utilized Sites


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



Solid-State Lighting: Member Case Studies: LED Street Lighting Programs in  

NLE Websites -- All DOE Office Websites (Extended Search)

Member Case Studies: LED Street Member Case Studies: LED Street Lighting Programs in Algona (IA), Asheville (NC), and Boston (MA) to someone by E-mail Share Solid-State Lighting: Member Case Studies: LED Street Lighting Programs in Algona (IA), Asheville (NC), and Boston (MA) on Facebook Tweet about Solid-State Lighting: Member Case Studies: LED Street Lighting Programs in Algona (IA), Asheville (NC), and Boston (MA) on Twitter Bookmark Solid-State Lighting: Member Case Studies: LED Street Lighting Programs in Algona (IA), Asheville (NC), and Boston (MA) on Google Bookmark Solid-State Lighting: Member Case Studies: LED Street Lighting Programs in Algona (IA), Asheville (NC), and Boston (MA) on Delicious Rank Solid-State Lighting: Member Case Studies: LED Street Lighting Programs in Algona (IA), Asheville (NC), and Boston (MA) on Digg


Street-based Topological Representations and Analyses for Predicting Traffic Flow in GIS  

E-Print Network (OSTI)

It is well received in the space syntax community that traffic flow is significantly correlated to a morphological property of streets, which are represented by axial lines, forming a so called axial map. The correlation co-efficient (R square value) approaches 0.8 and even a higher value according to the space syntax literature. In this paper, we study the same issue using the Hong Kong street network and the Hong Kong Annual Average Daily Traffic (AADT) datasets, and find surprisingly that street-based topological representations (or street-street topologies) tend to be better representations than the axial map. In other words, vehicle flow is correlated to a morphological property of streets better than that of axial lines. Based on the finding, we suggest the street-based topological representations as an alternative GIS representation, and the topological analyses as a new analytical means for geographic knowledge discovery.

Jiang, Bin



Solid-State Lighting: DOE Municipal Solid-State Street Lighting Consortium  

NLE Websites -- All DOE Office Websites (Extended Search)

Market-Based Programs Printable Version Share this resource Send a link to Solid-State Lighting: DOE Municipal Solid-State Street Lighting Consortium to someone by E-mail Share Solid-State Lighting: DOE Municipal Solid-State Street Lighting Consortium on Facebook Tweet about Solid-State Lighting: DOE Municipal Solid-State Street Lighting Consortium on Twitter Bookmark Solid-State Lighting: DOE Municipal Solid-State Street Lighting Consortium on Google Bookmark Solid-State Lighting: DOE Municipal Solid-State Street Lighting Consortium on Delicious Rank Solid-State Lighting: DOE Municipal Solid-State Street Lighting Consortium on Digg Find More places to share Solid-State Lighting: DOE Municipal Solid-State Street Lighting Consortium on AddThis.com... LED Lighting Facts


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


Large-Eddy Simulation of Flow and Pollutant Transport in Street Canyons of Different Building-Height-to-Street-Width Ratios  

Science Conference Proceedings (OSTI)

This study employs a large-eddy simulation technique to investigate the flow, turbulence structure, and pollutant transport in street canyons of building-height-to-street-width (aspect) ratios of 0.5, 1.0, and 2.0 at a Reynolds number of 12 000 ...

Chun-Ho Liu; Mary C. Barth; Dennis Y. C. Leung



Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network (OSTI)

; Transportable Exhauster; and Mobile Arm Retrieval System for Hanford's HLW tank farms. 5413 Architectural services Master Lee Hanford Corporation 1996 1904 Airport Way Richland WA 99354 (509) 943-2949 Fax: (509 services Image Works Media Group 1994 5710 Bedford Street Pasco WA 99301 (509) 545-9100 (509) 545-2509 info


Addressing Energy Demand through Demand Response: International...  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Demand through Demand Response: International Experiences and Practices Title Addressing Energy Demand through Demand Response: International Experiences and Practices...


Reducing code size through address register assignment  

Science Conference Proceedings (OSTI)

In DSP processors, minimizing the amount of address calculations is critical for reducing code size and improving performance, since studies of programs have shown that instructions that manipulate address registers constitute a significant portion of ... Keywords: DSP, Software compilation, address registers, register assignment

G. Chen; M. Kandemir; M. J. Irwin; J. Ramanujam


Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


Solid-State Lighting: Webcast: Municipal Solid-State Street Lighting  

NLE Websites -- All DOE Office Websites (Extended Search)

Webcast: Municipal Solid-State Webcast: Municipal Solid-State Street Lighting Consortium Retrofit Financial Analysis Tool to someone by E-mail Share Solid-State Lighting: Webcast: Municipal Solid-State Street Lighting Consortium Retrofit Financial Analysis Tool on Facebook Tweet about Solid-State Lighting: Webcast: Municipal Solid-State Street Lighting Consortium Retrofit Financial Analysis Tool on Twitter Bookmark Solid-State Lighting: Webcast: Municipal Solid-State Street Lighting Consortium Retrofit Financial Analysis Tool on Google Bookmark Solid-State Lighting: Webcast: Municipal Solid-State Street Lighting Consortium Retrofit Financial Analysis Tool on Delicious Rank Solid-State Lighting: Webcast: Municipal Solid-State Street Lighting Consortium Retrofit Financial Analysis Tool on Digg


Solid-State Lighting: Text-Alternative Version: Using the Street and  

NLE Websites -- All DOE Office Websites (Extended Search)

Using Using the Street and Parking Facility Lighting Retrofit Financial Analysis Tool to someone by E-mail Share Solid-State Lighting: Text-Alternative Version: Using the Street and Parking Facility Lighting Retrofit Financial Analysis Tool on Facebook Tweet about Solid-State Lighting: Text-Alternative Version: Using the Street and Parking Facility Lighting Retrofit Financial Analysis Tool on Twitter Bookmark Solid-State Lighting: Text-Alternative Version: Using the Street and Parking Facility Lighting Retrofit Financial Analysis Tool on Google Bookmark Solid-State Lighting: Text-Alternative Version: Using the Street and Parking Facility Lighting Retrofit Financial Analysis Tool on Delicious Rank Solid-State Lighting: Text-Alternative Version: Using the Street and Parking Facility Lighting Retrofit Financial Analysis Tool on


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Intelligent street lighting application for electric power distribution systems the business case for smartgrid technology.  

E-Print Network (OSTI)

??This research project builds upon previous work related to intelligent and energy efficient lighting in modern street and outdoor lighting systems. The concept of implementing (more)

Davis, Wesley O'Brian Sr.



State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

State Oil and Gas Board Address Place Zip Website State Oil and Gas Board Address Place Zip Website Alabama Oil and Gas Board Alabama Oil and Gas Board Hackberry Lane Tuscaloosa Alabama http www gsa state al us ogb ogb html Alaska Division of Oil and Gas Alaska Division of Oil and Gas W th Ave Suite Anchorage Alaska http dog dnr alaska gov Alaska Oil and Gas Conservation Commission Alaska Oil and Gas Conservation Commission W th Ave Ste Anchorage Alaska http doa alaska gov ogc Arizona Oil and Gas Commission Arizona Oil and Gas Commission W Congress Street Suite Tucson Arizona http www azogcc az gov Arkansas Oil and Gas Commission Arkansas Oil and Gas Commission Natural Resources Dr Ste Little Rock Arkansas http www aogc state ar us JDesignerPro JDPArkansas AR Welcome html California Division of Oil Gas and Geothermal Resources California


Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Company Oil and Gas Company Address Place Zip Website Company Oil and Gas Company Address Place Zip Website Abu Dhabi National Oil Company Abu Dhabi National Oil Company Abu http www adnoc ae default aspx Al Furat Petroleum Company Al Furat Petroleum Company Damascus Syria http www afpc sy com new history htm Dolphin Energy Dolphin Energy Abu Dhabi Trade Center Building Abu Dhabi United Arab Emirates http www dolphinenergy com Public default index htm ExxonMobil ExxonMobil Las Colinas Boulevard Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United Kingdom W1S LG http www gulfsands com s Home asp Kuwait Petroleum Corporation Kuwait Petroleum Corporation Safat Kuwait http www kpc com kw default aspx


Recommendations to Address Power Reliability Concerns Raised...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Reliability Concerns Raised as a Result of Pending Environmental Regulations for Electric Generation Stations Recommendations to Address Power Reliability Concerns Raised as a...


Research Projects Addressing Technical Challenges to Environmentally...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

to improve the safety and minimize the environmental impacts of oil and natural gas exploration and production. The projects will address research needs primarily in four...


NIST Scientists Address 'Wrinkles' in Transparent Film ...  

Science Conference Proceedings (OSTI)

NIST Scientists Address 'Wrinkles' in Transparent Film Development. ... High on the wish list of the solar power industry is a cheap, flexible ...



Research Projects Addressing Technical Challenges to Environmentally...  

NLE Websites -- All DOE Office Websites (Extended Search)

projects aimed at addressing the technical challenges of producing natural gas from shales and tight sands, while simultaneously reducing environmental footprints and risks,...


Capture Effect of Randomly Addressed Polling Protocol  

Science Conference Proceedings (OSTI)

The capture effect, discussed in this paper, is generally considered to enhance the systems performance in a wireless network. This paper also considers the Randomly Addressed Polling (RAP) protocol in the presence of a fading mobile radio ... Keywords: capture effect, noiseless, randomly addressed polling protocol

Jiang-Whai Dai



Home Address City State Zip Code  

E-Print Network (OSTI)

must be full-time University faculty or staff. To be eligible for the program, participants must live Parking Program will be provided within ten (10) business days. Work Address Work # Home # Cell # Email Address MCTA South Shore Line Full-time Faculty Part-time Faculty Full-time Staff Part-time Staff Please

He, Chuan


Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani




NLE Websites -- All DOE Office Websites (Extended Search)

STATE OF WASHINGTON STATE OF WASHINGTON DEPARTMENT OF COMMERCE 1011 Plum Street SE  PO Box 42525  Olympia, Washington 98504-2525  (360) 725-4000 www.commerce.wa.gov July 33, 2013 Roland J. Risser Building Technologies Program Manager Office of Energy Efficiency and Renewable Energy U.S. Department of Energy 1000 Independence Avenue SW, Mail Stop EE-2J Washington, DC 20585-0121 RE: State Certification of Residential and Commercial Building Energy Codes Dear Mr. Risser: In compliance with Title III of the Energy Conservation and Production Act (ECPA) of 1976, as amended, this is to certify that the State of Washington has adopted the 2012 Edition, Washington State Energy Code, which meets or exceeds the 2012 version of the International Energy Conservation Code (IECC) for low-rise residential


Planning Department 168 North Edwards Street Post Office Drawer L  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Department Department 168 North Edwards Street Post Office Drawer L Independence, California 93526 Phone: (619) 872-1168 FAX: (619) 873-5695 E-Mail: bmettam@telis.org January 30, 1998 U. S. Department of Energy Office of General Counsel, GC-52 1000 Independence Avenue, SW Washington, D.C. 20585 NOTICE OF INQUIRY CONCERNING PREPARATION OF REPORT TO CONGRESS ON THE PRICE-ANDERSON ACT Thank you for the opportunity to comment prior to the Department of Energy's report to Congress concerning the continuation or modification of the provisions of the Price-Anderson Act (the "Act"). The thirty-day notice period does not allow sufficient time for the County to conduct a through analysis of the potential impact to local governments of changes to the Act. The following general

Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Pecan Street Project, Inc. Smart Grid Demonstration Project | Open Energy  

Open Energy Info (EERE)

Project, Inc. Smart Grid Demonstration Project Project, Inc. Smart Grid Demonstration Project Jump to: navigation, search Project Lead Pecan Street Project, Inc. Country United States Headquarters Location Austin, Texas Recovery Act Funding $10,403,570.00 Total Project Value $24,656,485.00 Coordinates 30.267153°, -97.7430608° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


A LIMITED LIABILITY PARTNERSHIP 1050 Thomas Jefferson Street, NW  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

A LIMITED LIABILITY PARTNERSHIP A LIMITED LIABILITY PARTNERSHIP 1050 Thomas Jefferson Street, NW Seventh Floor Washington, DC 20007 (202) 298-1800 Phone (202) 338-2416 Fax MEMORANDUM TO: DOE Office of General Counsel FROM: Doug Smith DATE: August 29, 2013 RE: Record of Communication Concerning Ceiling Fan and Ceiling Fan Light Kit Framework Document-Docket No. EERE-2012-BT-STD-0045 This memo provides an overview of communications made to DOE staff on the subject of possible changes to standards and test procedures for ceiling fans and ceiling fan light kits. The communications occurred at a meeting held at 10:30 a.m. on August 20, 2013, following the close of the comment period on the initial framework document for ceiling fans and light kits. The meeting attendees included:


The Honorable Robert E. Williams 44 W. Washington Street  

Office of Legacy Management (LM)

SEC ; : ' SEC ; : ' ,-<- I ;;;s The Honorable Robert E. Williams 44 W. Washington Street Shelbyville, Indiana 46176 Dear Mayor Williams: Secretary of Energy Hazel O'Leary has announced a new approach to openness in the Department of Energy (DOE) and its communications with the public. In support of this initiative, we are pleased to forward the enclosed information related to the former General Electric Co. site in your jurisdiction that performed work for DOE or its predecessor agencies. This information is provided for your information, use, and retention. DOE's Formerly Utilized Sites Remedial Action Program is responsible for identification of sites used by DOE's predecessor agencies, determining their current radiological condition and, where it has authority, performing


Self-organizing traffic lights at multiple-street intersections  

E-Print Network (OSTI)

Summary: Traffic light coordination is a complex problem. In this paper, we extend previous work on an abstract model of city traffic to allow for multiple street intersections. We test a self-organizing method in our model, showing that it is close to theoretical optima and superior to a traditional method of traffic light coordination. Abstract: The elementary cellular automaton following rule 184 can mimic particles flowing in one direction at a constant speed. This automaton can therefore model highway traffic. In a recent paper, we have incorporated intersections regulated by traffic lights to this model using exclusively elementary cellular automata. In such a paper, however, we only explored a rectangular grid. We now extend our model to more complex scenarios employing an hexagonal grid. This extension shows first that our model can readily incorporate multiple-way intersections and hence simulate complex scenarios. In addition, the current extension allows us to study and evaluate the behavior of two...

Gershenson, Carlos



UC Davis Medical Education Building | 4610 X Street | Room 1222 & 2222 ONLINE REGISTRATION  

E-Print Network (OSTI)

UC Davis Medical Education Building | 4610 X Street | Room 1222 & 2222 ONLINE REGISTRATION/ TECHNOLOGIST SYMPOSIUM Advances In Cardiovascular Medical and Surgical Care SAVE THE DATE Saturday, May 5, 2012-734-5512, janine.neely@ucdmc.ucdavis.edu. LOCATION UC Davis Medical Education Building 4610 X Street, Room 1222

Hammock, Bruce D.


Assistance in local government energy conservation in Massachusetts. Energy management in municipal street lighting  

SciTech Connect

This report presents strategies to reduce the energy used in street lighting and, at the same time, reduce or stabilize the cost of street lighting to municipalities. The strategies described are based upon the existing rate structure and institutional arrangements whereby municipalities purchase a total lighting service under long-term contract from a utility.



Integrated Google Maps and Smooth Street View Videos for Route Planning National Taiwan University  

E-Print Network (OSTI)

Integrated Google Maps and Smooth Street View Videos for Route Planning Chi Peng National Taiwan that takes start and end points as the input, and will automatically connect to the Google Maps with Street a smooth scenic video from the starting point to the destination, which combines the Google Maps to provide

Ouhyoung, Ming


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Arch Venture Partners Owens Street San Francisco Arch Venture Partners Owens Street San Francisco California Venture capital firm investing in alternative energy production http www archventure com Bay Area Atrium Capital Atrium Capital Sand Hill Road Building Suite Menlo Park California Corporate strategic venture investing http www atriumcapital com Bay Area CMEA Capital CMEA Capital Embarcadero Center San Francisco California http www cmea com Bay Area CalCEF Clean Energy Angel Fund CalCEF Clean Energy Angel Fund Third Street Suite San Francisco California Seed Stage Venture Capital Firm http www calcefangelfund com Bay Area Clean Pacific Ventures Clean Pacific Ventures California Street Suite San Francisco California Venture capital firm investing in early stage clean technology companies http www cleanpacific com Bay Area


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance Apollo Alliance Townsend Street Suite San Francisco Alliance Apollo Alliance Townsend Street Suite San Francisco California Coalition of labor business environmental and community leaders working towards a clean energy revolution http apolloalliance org Bay Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www bootsontheroof com Bay Area CalCEF Angel Network CalCEF Angel Network Third Street Suite San Francisco California http www calcefangelnetwork org Bay Area Cleantech Open Cleantech Open Broadway Street Redwood City California http www cleantechopen com Bay Area Go Solar California Go Solar California San Francisco California Joint effort of CA energy commission and CPUC http www gosolarcalifornia ca gov Bay Area Green Depot Green Depot P O Box Santa Monica California Non profit


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Ventures Massachusetts Ballardvale Street Suite Ventures Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Access Venture Partners Access Venture Partners Turnpike Drive Suite Westminster Colorado Venture Capital http www accessvp com Rockies Area Advanced Materials Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en


Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



DOE - Office of Legacy Management -- GSA 39th Street Warehouse - IL 02  

Office of Legacy Management (LM)

GSA 39th Street Warehouse - IL 02 GSA 39th Street Warehouse - IL 02 FUSRAP Considered Sites Site: GSA 39TH STREET WAREHOUSE (IL.02 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 1716 West Pershing Road , Chicago , Illinois IL.02-1 Evaluation Year: 1985 IL.02-2 IL.02-3 Site Operations: Stored radioactive materials. IL.02-1 IL.02-2 Site Disposition: Eliminated - Radiation levels below criteria IL.02-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Unknown IL.02-2 Radiological Survey(s): Yes IL.02-1 IL.02-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to GSA 39TH STREET WAREHOUSE IL.02-1 - Report (DOE/EV-0005/9); Formerly Utilized MED/AEC Sites Remedial Action Program Radiological Survey of the Former GSA 39th Street


A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Demonstration of LED Street Lighting in Kansas City, MO  

SciTech Connect

Nine different streetlighting products were installed on various streets in Kansas City, Missouri during February, 2011, to evaluate their performance relative to the incumbent high-pressure sodium (HPS) lighting. The applications investigated included 100 W, 150 W, 250 W, and 400 W HPS installations. Initial measurements and comparisons included power, illuminance, and luminance; sample illuminance readings have continued at each of the nine locations at roughly 1,000-hour operating intervals since then. All of the LED products consumed less power than their HPS counterpartswith a mean difference of 39% and a range of 31% to 51%but they also emitted 31% fewer lumens, on average. The net result is just a 15% increase in mean efficacy. Applying the citys stringent light loss factors to the initial measured data meant that five of the LED products (and two of the HPS luminaires) were predicted to eventually fail to meet the specified mean illuminance over their lifetimes; however, the specified light loss levels are not expected to be reached by the LED products until some distant future date (between 12 and 30 years after installation according to manufacturer specification sheet estimates). The practical value of designing streetlighting systems to meet illumination requirements more than 15 years in the future is questioned. Numerous sources of variation in field measurements are noted throughout the report, particularly seasonal influences such as ambient temperature and foliage that are evident in the time-series illuminance data.

Kinzey, Bruce R.; Royer, Michael P.; Hadjian, M.; Kauffman, Rick




National Nuclear Security Administration (NNSA)




NLE Websites -- All DOE Office Websites (Extended Search)




NLE Websites -- All DOE Office Websites (Extended Search)



Early Science Instruction Addressing Fundamental Issues  

E-Print Network (OSTI)

Commentary Early Science Instruction Addressing Fundamental Issues David Klahr Carnegie Mellon (Vol. Eds.), Handbook of child psychology: Vol. 4. Child psychology in practice (6th ed.). New York acquisition in foundational domains. In W. Damon (Series Ed.) & D. Kuhn & R.S. Siegler (Vol. Eds.), Handbook

Klahr, David


Addressing & invocation of IMS-attached services  

Science Conference Proceedings (OSTI)

Services provided by non-IMS enabled platforms (e.g. home electronics, entertainment systems, and various home appliances) are typically not accessible to remote users such as IMS subscribers in spite of the ubiquity of modern mobile communications. ... Keywords: IMS, SIP, presence, service addressing, service discovery, service mapping, service registration

Roman Levenshteyn; Ioannis Fikouras; Salvatore Loreto; Gonzalo Camarillo



Model replication: transformations to address model scalability  

Science Conference Proceedings (OSTI)

In model-driven engineering, it is often desirable to evaluate different design alternatives as they relate to scalability issues of the modeled system. A typical approach to address scalability is model replication, which starts by creating base models ... Keywords: domain-specific modeling, model transformation, model-driven engineering, scalability

Yuehua Lin; Jeff Gray; Jing Zhang; Steve Nordstrom; Aniruddha Gokhale; Sandeep Neema; Swapna Gokhale


Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Biotech Nano Name School Email Address Module  

E-Print Network (OSTI)

Biotech Nano Name School Email Address Module Ajlouni, Leen Y American Community School Amman leen_ajlouni@hotmail.com Biotech Nano Jordan ajlouniyas@gmail.com Anupindi, Arusha Academy for Science & Design aaofnda@gmail.com Biotech Nano greet_hello@yahoo.com hellosmartboy@gmail.com Bourque, Mary Bangor High School maryebourque


DOE - Office of Legacy Management -- Utica Street Warehouse - NY 0-23  

Office of Legacy Management (LM)

Street Warehouse - NY 0-23 Street Warehouse - NY 0-23 FUSRAP Considered Sites Site: UTICA STREET WAREHOUSE (NY.0-23) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 240 West Utica Street , Buffalo , New York NY.0-23-2 Evaluation Year: 1987 NY.0-23-1 Site Operations: Stored and rebarrelled uranium process residues from operations at Linde. NY.0-23-3 Site Disposition: Eliminated - Original building demolished. Current land use - Parking facility. Potential for residual radioactive contamination considered remote. NY.0-23-1 Radioactive Materials Handled: Yes NY.0-23-1 Primary Radioactive Materials Handled: Natural Uranium Process Residues NY.0-23-1 Radiological Survey(s): None Indicated NY.0-23-1 Site Status: Eliminated from consideration under FUSRAP NY.0-23-1


How Energy Efficiency is "Lighting Up" the Streets of Philadelphia |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

How Energy Efficiency is "Lighting Up" the Streets of Philadelphia How Energy Efficiency is "Lighting Up" the Streets of Philadelphia How Energy Efficiency is "Lighting Up" the Streets of Philadelphia April 6, 2011 - 11:01am Addthis Andy Oare Andy Oare Former New Media Strategist, Office of Public Affairs What does this project do? Philadelphia Streets Department converting 58,000 yellow and green traffic signals to LED's. President Obama has made building a secure, prosperous energy future a top priority. Last week, he outlined a plan to strengthen energy security in a speech at Georgetown University. Then on Friday, he traveled to a UPS shipping facility in Landover, Maryland to announce a major milestone for the "National Clean Fleet Partnership": Five of the largest domestic shipping companies have made commitments to reduce gasoline use in their


The Recovery Act is "Lighting Up" the streets of Philadelphia | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

The Recovery Act is "Lighting Up" the streets of Philadelphia The Recovery Act is "Lighting Up" the streets of Philadelphia The Recovery Act is "Lighting Up" the streets of Philadelphia Addthis Description The Philadelphia Streets Department is converting 58,000 yellow and green traffic signals and will replace approximately 27,000 red LED lights that have come to the end of their useful life. The project will use approximately $3 million in EECBG funds, matched with $3 million in PECO funding, and will save the city approximately $1 million in electric costs each year. Speakers Micheal Nutter, Toby Russel, Katherine Gajewski, DeLain Best, Duration 2:23 Topic Commercial Lighting Energy Sector Jobs Grants Credit Energy Department Video MAYOR MICHAEL NUTTER (D-PA): We're here to announce a partnership among


Recovery Act is "Lighting Up" the Streets of Philadelphia | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

is "Lighting Up" the Streets of Philadelphia is "Lighting Up" the Streets of Philadelphia Recovery Act is "Lighting Up" the Streets of Philadelphia September 27, 2010 - 5:27pm Addthis Andy Oare Andy Oare Former New Media Strategist, Office of Public Affairs The Philadelphia Streets Department is converting 58,000 yellow and green traffic signals and will replace approximately 27,000 red LED lights that have come to the end of their useful life. The project will use approximately $3 million in Energy Efficiency Conservation Block Grant funds, matched with $3 million in PECO funding, and will save the city approximately $1 million in electric costs each year. The program is part of the larger Greenworks Philadelphia project which commits the city to pursue 15 targets by the year 2015, including:


How Energy Efficiency is "Lighting Up" the Streets of Philadelphia |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Efficiency is "Lighting Up" the Streets of Philadelphia Energy Efficiency is "Lighting Up" the Streets of Philadelphia How Energy Efficiency is "Lighting Up" the Streets of Philadelphia April 6, 2011 - 11:01am Addthis Andy Oare Andy Oare Former New Media Strategist, Office of Public Affairs What does this project do? Philadelphia Streets Department converting 58,000 yellow and green traffic signals to LED's. President Obama has made building a secure, prosperous energy future a top priority. Last week, he outlined a plan to strengthen energy security in a speech at Georgetown University. Then on Friday, he traveled to a UPS shipping facility in Landover, Maryland to announce a major milestone for the "National Clean Fleet Partnership": Five of the largest domestic shipping companies have made commitments to reduce gasoline use in their


Midtropospheric Anticyclonic Vortex Street Associated with a Cloud Band near a Cold Front  

Science Conference Proceedings (OSTI)

The characteristics and formation mechanism of an anticyclonic vortex street of meso-? scale, which appeared near a cold front around the Ryukyu Islands, Japan, on 11 April 1995, were examined by an analysis of observational data, a numerical ...

Eizi Toyoda; Hiroshi Niino; Kazuhisa Tsuboki; Ryuji Kimura; Masanori Yoshizaki



A Numerical Study of the Development of Claud-Street Spacing  

Science Conference Proceedings (OSTI)

Two-dimensional numerical computations of the developing boundary layer with a positive surface heat flux are presented. The model incorporates moisture phase-change effects; we are particularly interested in the cloud-street formation. The ...

R. I. Sykes; W. S. Lewellen; D. S. Henn



A Numerical Study of Flow and Pollutant Dispersion Characteristics in Urban Street Canyons  

Science Conference Proceedings (OSTI)

The flow and pollutant dispersion in urban street canyons are investigated using a two-dimensional numerical model with the k? turbulent closure scheme. It is shown that the flow field is characterized mainly by the number and intensity of ...

Jong-Jin Baik; Jae-Jin Kim



Woodward Avenue, Detroit : a pedestrian zone for a changing downtown retail street  

E-Print Network (OSTI)

The thesis studies the changing direction of Detroit's central downtown shopping street, Woodward Avenue. During the last two decades, Woodward Avenue has lost most of its retail market to suburban shopping centers. The ...

Lewis, Philip Strickland



A Numerical Study of Thermal Effects on Flow and Pollutant Dispersion in Urban Street Canyons  

Science Conference Proceedings (OSTI)

This study investigates thermal effects on the flow and pollutant dispersion in urban street canyons. A two-dimensional numerical model with a k? turbulent closure scheme is developed, and the heat transfer between the air and the building wall ...

Jae-Jin Kim; Jong-Jin Baik



IntenCity - 2 Solid State Outdoor Luminaire SL-3200 High Output LED Street Light  

Science Conference Proceedings (OSTI)

The product under assessment is an advanced lighting technology8212a solid state outdoor luminarie light emitting diode (LED) street lighting system designed to provide various levels of direct white light.



A right to vend : new policy framework for fostering street based entrepreneurs in New York City  

E-Print Network (OSTI)

Street vending remains one of the most highly regulated and least understood activities in New York City. The current regulatory framework is overly confusing and complex, leaving policy decisions about who gets to vend ...

Liu, Ya-Ting, M.C.P. Massachusetts Institute of Technology



FROM COUNTERPUBLICS TO COUNTERSPACES: Livable city advocates' efforts to reshape cities through carfree-streets events  

E-Print Network (OSTI)

left turns to enter the gas station located at the corner ofspill in April 2010, the gas station on Fell Street, which11, 2010 in front of the gas station and they continued for

Morhayim, Lusi



Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute Breakthrough Institute th Street Suite Oakland Institute Breakthrough Institute th Street Suite Oakland California http www thebreakthrough org Bay Area California Fuel Cell Partnership California Fuel Cell Partnership Industrial Blvd West Sacramento California Collaboration of organizations that work together to promote the commercialization of hydrogen fuel cell vehicles http www fuelcellpartnership net Bay Area ClimateWorks ClimateWorks Montgomery Street Suite San Francisco California http www climateworks org Bay Area Rahus Institute Rahus Institute Center Ave Martinez California Research and educational organization with a focus on resource efficiency http www californiasolarcenter org index html Bay Area San Francisco Biofuels Cooperative San Francisco Biofuels Cooperative Post St San Francisco California Mission is to facilitate access to


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Laboratory Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Austin Clean Energy Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area E Co E Co Franklin Street Bloomfield New Jersey http www eandco net EcoElectron Ventures Inc EcoElectron Ventures Inc Second Street PMB Encinitas California http www ecoelectron com Southern CA Area


Comparing Light-Emitting Diode (LED) Street and Area Lighting to Traditional Lighting Technologies  

Science Conference Proceedings (OSTI)

Manufacturing advances have now made the use of light-emitting diode (LED) technology practical for street and area lighting. To better understand the application, the Electric Power Research Institute (EPRI) teamed with Southern Company and Alabama Power to install LED street lights at a demonstration site and measure the performance. The data showed several disadvantages such as a lower efficacy compared to traditional technology and lower immunity to electrical disturbances, but advantages in energy s...



Comparing Light-Emitting Diode (LED) Street and Area Lighting to Traditional Lighting Technologies  

Science Conference Proceedings (OSTI)

Manufacturing advances have now made the use of light-emitting diode (LED) technology practical for street and area lighting. To better understand the application, the Electric Power Research Institute (EPRI) teamed with Southern Company and Gulf Power to install LED street lights at a demonstration site and measure their performance. The data showed several disadvantages for the LED lights, such as a lower efficacy compared to traditional technology and lower immunity to electrical disturbances, but an ...



Secretary Chu Op-Ed on Small Modular Reactors in the Wall Street Journal |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Op-Ed on Small Modular Reactors in the Wall Street Op-Ed on Small Modular Reactors in the Wall Street Journal Secretary Chu Op-Ed on Small Modular Reactors in the Wall Street Journal March 23, 2010 - 12:00am Addthis Washington, D.C. - Today, the Wall Street Journal published an op-ed by U.S. Secretary of Energy Steven Chu on small modular reactors. The op-ed can be viewed on the Wall Street Journal. The text of the op-ed is below: America's New Nuclear Option Small modular reactors will expand the ways we use atomic power. By Steven Chu Wall Street Journal, March 23, 2010 America is on the cusp of reviving its nuclear power industry. Last month President Obama pledged more than $8 billion in conditional loan guarantees for what will be the first U.S. nuclear power plant to break ground in nearly three decades. And with the new authority granted by the president's


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Solar Energy Society American Solar Energy Society Central Ave Boulder Colorado Nonprofit organization dedicated to increasing the use of solar energy energy efficiency and other sustainable technologies in the U S http www ases org Rockies Area Boulder Innovation Center Boulder Innovation Center th Street Boulder Colorado http www boulderinnovationcenter com Rockies Area Clean Economy Network Rockies Clean Economy Network Rockies Denver Colorado http rockies cleaneconomynetwork org Rockies Area

Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

Category Sector Telephone number Website Category Sector Telephone number Website Coordinates Testing Facilities Overseen References Alden Research Laboratory Inc Alden Research Laboratory Inc Shrewsbury Street Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro Hydro http www aldenlab com http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large Flume Bucknell University Bucknell University Civil Mechanical Engineering Departments Hydraulic Flume Moore Avenue Dana Engineering Building Lewisburg Pennsylvania Category Testing Facility Operators Hydro http www bucknell edu x16287 xml Bucknell Hydraulic Flume Colorado State University Hydrodynamics Colorado State University Hydrodynamics Daryl B Simons Building Engineering Research Center Campus Delivery


Address (Smart Grid Project) | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Project Name Address Country Spain Coordinates 40.388397°, -4.526367° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.388397,"lon":-4.526367,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Addressing mixed waste in plutonium processing  

SciTech Connect

The overall goal is the minimization of all waste generated in actinide processing facilities. Current emphasis is directed toward reducing and managing mixed waste in plutonium processing facilities. More specifically, the focus is on prioritizing plutonium processing technologies for development that will address major problems in mixed waste management. A five step methodological approach to identify, analyze, solve, and initiate corrective action for mixed waste problems in plutonium processing facilities has been developed.

Christensen, D.C.; Sohn, C.L. (Los Alamos National Lab., NM (United States)); Reid, R.A. (New Mexico Univ., Albuquerque, NM (United States). Anderson Schools of Management)



Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



Quantum key distribution network with wavelength addressing  

E-Print Network (OSTI)

Most traditional applications of quantum cryptography are point-to-point communications, in which only two users can exchange keys. In this letter, we present a network scheme that enable quantum key distribution between multi-user with wavelength addressing. Considering the current state of wavelength division multiplexing technique, dozens or hundreds of users can be connected to such a network and directly exchange keys with each other. With the scheme, a 4-user demonstration network was built up and key exchanges were performed.

Mo, X F; Han, Z F; Xu, F X; Zhang, T; Guo, Guang-Can; Han, Zheng-Fu; Mo, Xiao-Fan; Xu, Fang-Xing; Zhang, Tao



Addressing the Crisis in Fundamental Physics  

E-Print Network (OSTI)

I present the case for fundamental physics experiments in space playing an important role in addressing the current "dark energy'' crisis. If cosmological observations continue to favor a value of the dark energy equation of state parameter w=-1, with no change over cosmic time, then we will have difficulty understanding this new fundamental physics. We will then face a very real risk of stagnation unless we detect some other experimental anomaly. The advantages of space-based experiments could prove invaluable in the search for the a more complete understanding of dark energy. This talk was delivered at the start of the Fundamental Physics Research in Space Workshop in May 2006.

Christopher W. Stubbs



Secretary Chu's Op-Ed on Small Modular Reactors in the Wall Street Journal  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretary Chu's Op-Ed on Small Modular Reactors in the Wall Street Secretary Chu's Op-Ed on Small Modular Reactors in the Wall Street Journal Secretary Chu's Op-Ed on Small Modular Reactors in the Wall Street Journal March 23, 2010 - 12:24pm Addthis Washington, D.C. - Today, the Wall Street Journal published an op-ed by U.S. Secretary of Energy Steven Chu on small modular reactors. The op-ed can be found here. The text of the op-ed is below: Small modular reactors will expand the ways we use atomic power. By Steven Chu, Secretary of Energy Wall Street Journal America is on the cusp of reviving its nuclear power industry. Last month President Obama pledged more than $8 billion in conditional loan guarantees for what will be the first U.S. nuclear power plant to break ground in nearly three decades. And with the new authority granted by the president's


Secretary Chu's Op-Ed on Small Modular Reactors in the Wall Street Journal  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretary Chu's Op-Ed on Small Modular Reactors in the Wall Street Secretary Chu's Op-Ed on Small Modular Reactors in the Wall Street Journal Secretary Chu's Op-Ed on Small Modular Reactors in the Wall Street Journal March 23, 2010 - 12:24pm Addthis Washington, D.C. - Today, the Wall Street Journal published an op-ed by U.S. Secretary of Energy Steven Chu on small modular reactors. The op-ed can be found here. The text of the op-ed is below: Small modular reactors will expand the ways we use atomic power. By Steven Chu, Secretary of Energy Wall Street Journal America is on the cusp of reviving its nuclear power industry. Last month President Obama pledged more than $8 billion in conditional loan guarantees for what will be the first U.S. nuclear power plant to break ground in nearly three decades. And with the new authority granted by the president's


Laboratory or Facility Representative Email Addresses Phone #  

NLE Websites -- All DOE Office Websites (Extended Search)

Laboratory or Facility Representative Email Addresses Phone # Ames Laboratory Stacy Joiner joiner@ameslab.gov 515-294-5932 Argonne National Laboratory Connie Cleary ccleary@anl.gov 630-252-8111 Brookhaven National Laboratory Walter Copan wcopan@bnl.gov 631-344-3035 Fermi National Acclerator Laboratory Bruce Chrisman chrisman@fnal.gov 630-840-6657 Idaho National Laboratory Steven McMaster steven.mcmaster@inl.gov 208-526-1340 Kansas City Plant Caron O'Dower codower@kcp.com 816-997-2645 Lawrence Berkeley National Laboratory Viviana Wolinsky viwolinsky@lbl.gov 510-486-6463 Lawrence Livermore National Laboratory Roger Werne werne1@llnl.gov 925-423-9353 Los Alamos National Laboratory John Mott jmott@lanl.gov 505-665-0883 National Energy Technology Laboratory Jessica Sosenko jessica.sosenko@netl.doe.gov 412-386-7417


Verification Checklist Home Address: City: State: Zip:  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Indoor airPLUS Version 1 (Rev. 01) Verification Checklist Home Address: City: State: Zip: Section Requirements (Refer to full Indoor airPLUS Construction Specifications for details) Must Correct Builder Verified Rater Verified N/A Note: The Rev. 01 checklist has been modified to reflect only the additional Indoor airPLUS requirements and their corresponding section numbers that must be met after completing the ENERGY STAR checklists. ENERGY STAR remains a prerequisite for Indoor airPLUS certification. ENERGY STAR V3 Checklists Thermal Enclosure System Rater Checklist completed. o o Water Management System Builder Checklist completed. o o HVAC System Quality Installation Contractor Checklist completed. o o HVAC System Quality Installation Rater Checklist completed. o o


"If we own the story, we own the place": Cultural Heritage, Historic Preservation, and Gentrification on U Street.  

E-Print Network (OSTI)

??This thesis investigates the roles of cultural heritage and historic preservation in the gentrification of the Greater U Street neighborhood in Washington, D.C. Its larger (more)

Frank, Stephanie



OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


Students Earn Street Cred With the EcoCAR Challenge | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Students Earn Street Cred With the EcoCAR Challenge Students Earn Street Cred With the EcoCAR Challenge Students Earn Street Cred With the EcoCAR Challenge Addthis EcoCAR Challenge Finish Line Event 1 of 8 1 of 8 EcoCAR Challenge Finish Line Event 1 of 8 US Department of Energy Secretary Steven Chu talks shop with members of the West Virginia EcoCAR team. Image: Energy Department Image | Photo by Charles Watkins, Contractor EcoCAR Challenge Finish Line Event2 of 8 2 of 8 EcoCAR Challenge Finish Line Event2 of 8 Secretary Steven Chu discusses the EcoCAR Challenge during the 'Finish Line' event held at the US Department of Energy headquarters in Washington, DC. Image: Energy Department Image | Photo by Charles Watkins, Contractor EcoCAR Challenge Finish Line Event 3 of 8 3 of 8 EcoCAR Challenge Finish Line Event 3 of 8


EA-1741: Seattle Steam Company Combined Heat and Power at Post Street in  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

741: Seattle Steam Company Combined Heat and Power at Post 741: Seattle Steam Company Combined Heat and Power at Post Street in Downtown Seattle, Washington EA-1741: Seattle Steam Company Combined Heat and Power at Post Street in Downtown Seattle, Washington Summary This EA evaluates the environmental impacts of a proposal to provide an American Recovery Act and Reinvestment Act of 2009 financial assistance grant to Seattle Steam Company to facilitate the installation of a combined heat and power plant in downtown Seattle, Washington. NOTE: This project has been cancelled. Public Comment Opportunities No public comment opportunities available at this time. Documents Available for Download June 16, 2010 EA-1741: Draft Environmental Assessment Seattle Steam Company Combined Heat and Power at Post Street in Downtown Seattle, Washington (June 2010)


DOE Seeks Input On Addressing Contractor Pension and Medical...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Seeks Input On Addressing Contractor Pension and Medical Benefits Liabilities DOE Seeks Input On Addressing Contractor Pension and Medical Benefits Liabilities March 27, 2007 -...


U.S. Energy Secretary Addresses International Atomic Energy Agency...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretary Addresses International Atomic Energy Agency General Conference U.S. Energy Secretary Addresses International Atomic Energy Agency General Conference September 19, 2011 -...


Can Cloud Computing Address the Scientific Computing Requirements...  

NLE Websites -- All DOE Office Websites (Extended Search)

Can Cloud Computing Address the Scientific Computing Requirements for DOE Researchers? Well, Yes, No and Maybe Can Cloud Computing Address the Scientific Computing Requirements for...


Bush Administration Plays Leading Role in Studying and Addressing...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Plays Leading Role in Studying and Addressing Global Climate Change Bush Administration Plays Leading Role in Studying and Addressing Global Climate Change February 27, 2007 -...

Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Native Village of Teller Addresses Heating Fuel Shortage, Improves...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Native Village of Teller Addresses Heating Fuel Shortage, Improves Energy Security Native Village of Teller Addresses Heating Fuel Shortage, Improves Energy Security June 22, 2012...


Keynote Address by David Sandalow, Assistant Secretary of Energy...  

NLE Websites -- All DOE Office Websites (Extended Search)

Keynote Address by David Sandalow, Assistant Secretary of Energy for Policy and International Affiars, at the Technology and Rare Earth Metals Conference 2010 Keynote Address by...


Addressing Policy and Logistical Challenges to Smart Grid Implementati...  

NLE Websites -- All DOE Office Websites (Extended Search)

Addressing Policy and Logistical Challenges to Smart Grid Implementation: Federal Register Notice Volume 75, No. 180 - Sep. 17, 2010 Addressing Policy and Logistical Challenges to...


Africa - Technical Potential of Solar Energy to Address Energy...  

Open Energy Info (EERE)

- Technical Potential of Solar Energy to Address Energy Poverty and Avoid GHG Emissions Jump to: navigation, search Logo: Technical Potential of Solar Energy to Address Energy...


DOE Awards Over a Billion Supercomputing Hours to Address Scientific...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Over a Billion Supercomputing Hours to Address Scientific Challenges DOE Awards Over a Billion Supercomputing Hours to Address Scientific Challenges January 26, 2010 - 12:00am...


Dairyland Power Cooperative Comments on Smart Grid RFI: Addressing...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Comments on Smart Grid RFI: Addressing Policy and Logistical Challenges Dairyland Power Cooperative Comments on Smart Grid RFI: Addressing Policy and Logistical Challenges...


Okaloosa Gas District Smart Grid RFI: Addressing Policy and Logistical...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Okaloosa Gas District Smart Grid RFI: Addressing Policy and Logistical Challenges to Smart Grid Implementation Okaloosa Gas District Smart Grid RFI: Addressing Policy and...


Southern Company: DOE Smart Grid RFI Addressing Policy and Logistical...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Southern Company: DOE Smart Grid RFI Addressing Policy and Logistical Challenges Southern Company: DOE Smart Grid RFI Addressing Policy and Logistical Challenges Southern Company:...


Steffes Corporation Smart Grid RFI: Addressing Policy and Logistical...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Steffes Corporation Smart Grid RFI: Addressing Policy and Logistical Challenges Steffes Corporation Smart Grid RFI: Addressing Policy and Logistical Challenges Steffes Corporation...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency 3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area ATS Lighting Inc ATS Lighting Inc PO Box Concord Massachusetts Efficiency Effienct lighting and portable lighting systems http www atslighting com Greater Boston Area AXI LLC AXI LLC Quincy Massachusetts Biofuels Aims to make commercially feasible strains of algae for fuel production Greater Boston Area Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation load management and competitive bidding http www acelaenergy com Greater Boston Area Aclara Software Aclara Software Laurel Avenue Wellesley Massachusetts Efficiency Software solutions for efficiency and demand management


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute for the Built Environment CSU Institute for the Built Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org Rockies Area Colorado School of Mines Colorado Energy Research Institute Colorado School of Mines Colorado Energy Research Institute Illinois Street Golden Colorado http www ceri mines org Rockies Area Denver University International Institute for Environment and Enterprise Denver University International Institute for Environment and Enterprise S University Blvd Denver Colorado http www du edu enviro Research htm Rockies Area EverSealed Windows Inc EverSealed Windows Inc Interlocken Drive Evergreen


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Partners Inc Advanced Materials Partners Inc Pine Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Akeida Capital Management Akeida Capital Management New York New York Financing Environmental Projects http www akeidacapital com Northeast NY NJ CT PA Area Ardour Capital Ardour Capital th ave New York New York http www ardourcapital com Northeast NY NJ CT PA Area Asia West LLC Asia West LLC One East Weaver Street Greenwich Connecticut Strategic investor in environmental technologies http www asiawestfunds com Northeast NY NJ CT PA Area BEV Capital BEV Capital Tresser Blvd th Floor Stamford Connecticut Venture capital firm http www bevcapital com Northeast NY NJ CT PA Area Battelle Ventures Battelle Ventures Carnegie Center Suite Princeton


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Colorado Renewable Energy Society Colorado Renewable Energy Society PO Box Golden Colorado Works for the sensible adoption of cost effective energy efficiency and renewable energy technologies by Colorado businesses and consumers http www cres energy org Rockies Area Environmental Entrepreneurs E2 Environmental Entrepreneurs E2 Pearl Street Suite Boulder Colorado http www e2 org jsp controller docName roxchapterwebpage Rockies Area Hogan Hartson Hogan Hartson Walnut Street Boulder Colorado Climate Change Clean Energy http www hhlaw com Rockies Area Northern Colorado Clean Energy Cluster Northern Colorado Clean Energy Cluster Denver Colorado Business led project oriented group of regional partners seeking to have a global impact http www nccleanenergy com Rockies Area Sustainability Center of the Rockies Sustainability Center of the Rockies


Address Allocation ModelsAddress Allocation Models Clean Slate Research "Agenda"  

E-Print Network (OSTI)

----------------------------------------- Clean Slate Research "Agenda" R G iR. Guerin University of Pennsylvania 1 Some Level Setting · What does "clean slate research" have to do with allocation of IP addresses? ­ Learn from past mistakes and try ­ As a matter of fact the IPv6 vs. IPv4 story holds many lessons that clean slate proposals can benefit from

Guerin, Roch


Final Report on Internet Addressable Lightswitch  

Science Conference Proceedings (OSTI)

This report describes the work performed to develop and test a new switching system and communications network that is useful for economically switching lighting circuits in existing commercial buildings. The first section of the report provides the general background of the IBECS (Integrated Building Environmental Communications System) research and development work as well as the context for the development of the new switching system. The research and development effort that went into producing the first proof-of-concept (the IBECS Addressable Power Switch or APS) and the physical prototype of that concept is detailed in the second section. In the third section of the report, we detail the refined Powerline Carrier Based IBECS Title 24 Wall Switch system that evolved from the APS prototype. The refined system provided a path for installing IBECS switching technology in existing buildings that may not be already wired for light level switching control. The final section of the report describes the performance of the IBECS Title 24 Switch system as applied to a small demonstration in two offices at LBNL's Building 90. We learned that the new Powerline Carrier control systems (A-10 technology) that have evolved from the early X-10 systems have solved most of the noise problems that dogged the successful application of X-10 technologies in commercial buildings. We found that the new A-10 powerline carrier control technology can be reliable and effective for switching lighting circuits even in electrically noisy office environments like LBNL. Thus we successfully completed the task objectives by designing, building and demonstrating a new switching system that can provide multiple levels of light which can be triggered either from specially designed wall switches or from a digital communications network. By applying commercially available powerline carrier based technologies that communicate over the in-place lighting wiring system, this type of control can be economi cally installed even in existing buildings that were not wired for dual-level lighting.

Rubinstein, Francis; Pettler, Peter



Flow Patterns at the Ends of a Street Canyon: Measurements from the Joint Urban 2003 Field Experiment  

Science Conference Proceedings (OSTI)

During the Joint Urban 2003 experiment held in Oklahoma City, Oklahoma, an eastwest-running street canyon was heavily instrumented with wind sensors. In this paper, the flow patterns at the street canyon ends are investigated by looking at sonic ...

Suhas U. Pol; Michael J. Brown



UCSC Student Health Services Student Health Insurance Office 1156 High Street Phone: (831) 459-2389  

E-Print Network (OSTI)

UCSC Student Health Services Student Health Insurance Office 1156 High Street Phone: (831) 459 your health plan's customer service number for assistance.** 5. Does your health insurance plan cover conditions? Yes / No Emergency room services? Yes / No Diagnostic services including laboratory tests? Yes


Demonstration Assessment of Light-Emitting Diode (LED) Street Lighting Host Site: Lija Loop, Portland, Oregon  

SciTech Connect

This report describes the process and results of a demonstration of solid-state lighting (SSL) technology in a residential street lighting application, under the U.S. Department of Energy GATEWAY Solid-State Lighting Technology Demonstration Program. In this project, eight 100W (nominal) high-pressure sodium cobra head fixtures were replaced with a like number of LED street light luminaires manufactured by Leotek, Inc. The Leotek product achieved an estimated payback in the Lija Loop installation of about 20 years for replacement scenarios and a much shorter 7.6 years for new installations. Much of the associated energy savings (55%) supporting these payback periods, however, were achieved by reducing average horizontal photopic illuminance a similar amount (53%). Examined from a different perspective, the measured performance suggests that the Leotek product is at approximate parity with the HPS cobra head in terms of average delivered photopic illumination for a given power consumption. HPS comprises the second most efficacious street lighting technology available, exceeded only by low pressure sodium (LPS). LPS technology is not considered suitable for most street lighting applications due to its monochromatic spectral output and poor color rendering ability; therefore, this LED product is performing at an efficiency level comparable to its primary competition in this application.

Kinzey, Bruce R.; Myer, Michael



Automated extraction of street-scene objects from mobile lidar point clouds  

Science Conference Proceedings (OSTI)

Mobile laser scanning or lidar is a new and rapid system to capture high-density three-dimensional 3-D point clouds. Automatic data segmentation and feature extraction are the key steps for accurate identification and 3-D reconstruction of street-scene ...

Bisheng Yang; Zheng Wei; Qingquan Li; Jonathan Li



Lawn chairs in Times Square : an analysis of the Pilot Streets Program and the provisional project approach for New York City's Green Light in Midtown project  

E-Print Network (OSTI)

In 2009 the New York City Department of Transportation (NYC DOT) initiated a Pilot Streets Program that called for the temporary closure of Broadway between 47th and 42nd Streets to all vehicular traffic. With Times Square ...

Taylor, Alexis (Alexis Abreu)


Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Dairyland Power Cooperative Comments on Smart Grid RFI: Addressing Policy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Comments on Smart Grid RFI: Addressing Comments on Smart Grid RFI: Addressing Policy and Logistical Challenges Dairyland Power Cooperative Comments on Smart Grid RFI: Addressing Policy and Logistical Challenges Dairyland Power Cooperative is a generation and transmission cooperative (G&T) that provides the wholesale electrical requirements and other services for 25 electric distribution cooperatives and 16 municipal utilities in the Upper Midwest. Smart Grid RFI: Addressing Policy and Logistical Challenges More Documents & Publications AARP, National Consumer Law Center, and Public Citizen Comments to:DEPARTMENT OF ENERGY Smart Grid RFI: Addressing Policy and Logistical Challenges Florida Power and Light Comments on Smart Grid Request For Information (RFI): Addressing Policy & Logistical Challenges.


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


DOE Action Plan Addressing the Electricity Distribution System  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ACTION PLAN ACTION PLAN ADDRESSING THE ELECTRICITY DISTRIBUTION SYSTEM ~DRAFT~ DOE Action Plan Addressing the Electricity Distribution System 1 Table of Contents INTRODUCTION ................................................................................................................... 2 The Grid Tech Team ................................................................................................ 2 Focus on Distribution .............................................................................................. 3 Roadmap Goals ....................................................................................................... 3 PROCESS OVERVIEW ........................................................................................................... 4


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Big Sky Carbon Sequestration Partnership Big Sky Carbon Sequestration Partnership University Way rd Floor Bozeman Montana One of the US DOE s seven regional carbon sequestration partnerships http www bigskyco2 org Pacific Northwest Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Northwest National Marine Renewable Energy Center Northwest National Marine Renewable Energy Center th Ave Seattle Washington http depts washington edu nnmrec Pacific Northwest Area


Distributed Generation Study/10 West 66th Street Corp | Open Energy  

Open Energy Info (EERE)

10 West 66th Street Corp 10 West 66th Street Corp < Distributed Generation Study Jump to: navigation, search Study Location New York, New York Site Description Residential-Multifamily-Single Building Study Type Long-term Monitoring Technology Microturbine Prime Mover Ingersoll Rand I-R PowerWorks 70 Heat Recovery Systems Built-in Fuel Natural Gas System Installer DSM Engineering System Enclosure Indoor System Application Combined Heat and Power Number of Prime Movers 1 Stand-alone Capability None Power Rating 70 kW0.07 MW 70,000 W 70,000,000 mW 7.0e-5 GW 7.0e-8 TW Nominal Voltage (V) 480 Heat Recovery Rating (BTU/hr) 300000 Cooling Capacity (Refrig/Tons) Origin of Controller 3rd Party Off-the-Shelf Component Integration Customer Assembled Start Date 2005/11/17 Monitoring Termination Date 1969/12/31


DOE Challenge Home Case Study, StreetScape Development, LLC, Libertyville, IL, Custom  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

StreetScape StreetScape Development, LLC Libertyville, IL BUILDING TECHNOLOGIES OFFICE DOE Challenge Home builders are in the top 1% of builders in the country meeting the extraordinary levels of excellence and quality specifi ed by the U.S. Department of Energy. Every DOE Challenge Home starts with ENERGY STAR for Homes Version 3 for an energy-effi cient home built on a solid foundation of building science research. Then, even more advanced technologies are designed in for a home that goes above and beyond current code to give you the superior quality construction, HVAC, appliances, indoor air quality, safety, durability, comfort, and solar-ready components along with ultra-low or no utility bills. This provides homeowners with a quality home that will last for generations to come.


Chromatin Regulation and Low Dose Irradiation: A Two-Way Street?  

NLE Websites -- All DOE Office Websites (Extended Search)

Chromatin Regulation and Low Dose Irradiation: A Two-Way Street? Chromatin Regulation and Low Dose Irradiation: A Two-Way Street? Irene Chiolo Lawrence Berkeley National Lab Abstract Goal: We are trying to understand the impact of exposure to low-dose ionizing radiation on epigenetic mechanisms, chromatin organization and functional responses, and how these processes affect the response to low-dose radiation. Background/Significance: Genomic instability (GI) is one of the hallmarks of cancer that contributes to genetic diversity and has been associated with exposure to ionizing radiation (IR) (1,2). Radiobiology dogma has focused on DNA as the likely target for GI effects of radiation, but until fairly recently, without incorporating roles for chromatin. Eukaryotic genomes contain two major chromatin domains: heterochromatin and


Chromatin Regulation and Low Dose Irradiation: A Two-Way Street ?  

NLE Websites -- All DOE Office Websites (Extended Search)

Chromatin Regulation and Low Dose Irradiation: A Two-Way Street ? Chromatin Regulation and Low Dose Irradiation: A Two-Way Street ? Irene Chiolo, Sylvain Costes and Gary H. Karpen. Lawrence Berkeley National Lab and UC Berkeley, Berkeley, CA Goal: We are trying to understand the impact of exposure to low-dose ionizing radiation on epigenetic mechanisms, chromatin organization and functional responses, and how these processes affect the response to low-dose radiation. Background/Significance: Genomic instability (GI) is one of the hallmarks of cancer that contributes to genetic diversity and has been associated with exposure to ionizing radiation (IR) (1,2). Radiobiology dogma has focused on DNA as the likely target for GI effects of radiation, but until fairly recently, without incorporating roles for chromatin.


Comparing Light Emitting Diode (LED) Street and Area Lighting to Traditional Lighting Technologies  

Science Conference Proceedings (OSTI)

High-power light-emitting diode (LED) technology holds great promise for outdoor illumination. This case study discusses the results of the LED Street and Area Lighting Demonstration performed by Tennessee Valley Authority (TVA), Knoxville Utilities Board (KUB), and EPRI. Data was collected on Wall Avenue, a busy thoroughfare in downtown Knoxville, using a specially developed computer-controlled mobile light measurement vehicle with a global positioning system.Early reports from the ...



Comparing Light-Emitting Diode (LED) Street and Area Lighting to Traditional Lighting Technologies  

Science Conference Proceedings (OSTI)

In 2008, the Tennessee Valley Authority (TVA) and Benton County Electric System partnered with the Electric Power Research Institute (EPRI) to launch an investigation into the use of LED technology for area lighting. The goal of the projectcalled the LED Street and Area Lighting Demonstrationwas to discover a better light bulb, one that not only meets the outdoor lighting requirements of consumers, but also uses less electricity in doing so. This case study discusses the results of ...



Alternative Fuels Data Center: State Agency Coordination to Address Climate  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

State Agency State Agency Coordination to Address Climate Change to someone by E-mail Share Alternative Fuels Data Center: State Agency Coordination to Address Climate Change on Facebook Tweet about Alternative Fuels Data Center: State Agency Coordination to Address Climate Change on Twitter Bookmark Alternative Fuels Data Center: State Agency Coordination to Address Climate Change on Google Bookmark Alternative Fuels Data Center: State Agency Coordination to Address Climate Change on Delicious Rank Alternative Fuels Data Center: State Agency Coordination to Address Climate Change on Digg Find More places to share Alternative Fuels Data Center: State Agency Coordination to Address Climate Change on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type


Pepco Holdings, Inc. Smart Grid RFI: Addressing Policy and Logistical  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Holdings, Inc. Smart Grid RFI: Addressing Policy and Holdings, Inc. Smart Grid RFI: Addressing Policy and Logistical Challenges Pepco Holdings, Inc. Smart Grid RFI: Addressing Policy and Logistical Challenges Pepco Holdings, Inc. Smart Grid RFI: Addressing Policy and Logistical Challenges. Pepco Holdings, Inc. (PHI) is pleased to respond to the US Department of Energy (DOE) request for information regarding addressing policy and logistical challenges to smart grid implementation. This follows on the heels of PHI's responses to two other DOE RFls on data access and communications requirements. Pepco Holdings, Inc. Smart Grid RFI: Addressing Policy and Logistical Challenges More Documents & Publications DC OPC Comments. September 17, 2010 Addressing Policy and Logistical Challenges to smart grid Implementation:


The National Science Bowl Students are Here! (The Streets of D.C. Just Got  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

The National Science Bowl Students are Here! (The Streets of D.C. The National Science Bowl Students are Here! (The Streets of D.C. Just Got a Little Smarter.) The National Science Bowl Students are Here! (The Streets of D.C. Just Got a Little Smarter.) April 28, 2011 - 3:45pm Addthis Ginny Simmons Ginny Simmons Former Managing Editor for Energy.gov, Office of Public Affairs Hundreds of America's best science high school and middle school students are arriving in D.C. today to gear up for the National Science Bowl. For the last few months, more than 14,000 students from 1,800 schools competed in 110 regional matches -- all to determine the best science teams in the nation. After a series of run-off competitions this weekend, the best-of-the-best, last-standing teams will compete in the Science Bowl finals on Monday, May 2, to determine the 2011 national middle and high


The National Science Bowl Students are Here! (The Streets of D.C. Just Got  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

The National Science Bowl Students are Here! (The Streets of D.C. The National Science Bowl Students are Here! (The Streets of D.C. Just Got a Little Smarter.) The National Science Bowl Students are Here! (The Streets of D.C. Just Got a Little Smarter.) April 28, 2011 - 3:45pm Addthis Ginny Simmons Ginny Simmons Former Managing Editor for Energy.gov, Office of Public Affairs Hundreds of America's best science high school and middle school students are arriving in D.C. today to gear up for the National Science Bowl. For the last few months, more than 14,000 students from 1,800 schools competed in 110 regional matches -- all to determine the best science teams in the nation. After a series of run-off competitions this weekend, the best-of-the-best, last-standing teams will compete in the Science Bowl finals on Monday, May 2, to determine the 2011 national middle and high


Properties of the Wind Field within the Oklahoma City Park Avenue Street Canyon. Part I: Mean Flow and Turbulence Statistics  

Science Conference Proceedings (OSTI)

Velocity data were obtained from sonic anemometer measurements within an eastwest-running street canyon located in the urban core of Oklahoma City, Oklahoma, during the Joint Urban 2003 field campaign. These data were used to explore the ...

M. A. Nelson; E. R. Pardyjak; J. C. Klewicki; S. U. Pol; M. J. Brown



Rolls, Streets, Waves, and More: A Review of Quasi-Two-Dimensional Structures in the Atmospheric Boundary Layer  

Science Conference Proceedings (OSTI)

The atmospheric boundary layer is home to a number of horizontally elongated quasi-two-dimensionalphenomena including cloud streets, roll vortices, thermal waves, and surface layer streaks. These phenomena, their dynamics, and their interactions ...

George S. Young; David A. R. Kristovich; Mark R. Hjelmfelt; Ralph C. Foster



Structured, unstructured, and semistructured search in semistructured databases  

E-Print Network (OSTI)

= {{ Address }} Address [id = 6] T ( All ) = {{ Zip ,Street }, { Zip , POBox } } T ( Zip ) = {{ Zip }} T ( Choice ) = {{ Street }, {

Balmin, Andrey



Southern Company: DOE Smart Grid RFI Addressing Policy and Logistical  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Southern Company: DOE Smart Grid RFI Addressing Policy and Southern Company: DOE Smart Grid RFI Addressing Policy and Logistical Challenges Southern Company: DOE Smart Grid RFI Addressing Policy and Logistical Challenges Southern Company: DOE Smart Grid RFI Addressing Policy and Logistical Challenges. Southern recognizes that many policy and logistical concerns must be addressed for the promises of smart grid technologies and applications to be fully realized in ways that are beneficial, secure, and cost-effective lor utility customers. Southern Company: DOE Smart Grid RFI Addressing Policy and Logistical Challenges More Documents & Publications Re: DOE Request for Information - Implementing the National Broadband Plan by Studying the Communications Requirements of Electric Utilities to Inform Federal Smart Grid Policy

Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



NNSA Administrator Addresses Next Generation of Computational Scientists |  

NLE Websites -- All DOE Office Websites (Extended Search)

Addresses Next Generation of Computational Scientists | Addresses Next Generation of Computational Scientists | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > Media Room > Speeches > NNSA Administrator Addresses Next Generation of Computational ... Speech NNSA Administrator Addresses Next Generation of Computational Scientists Jun 22, 2010


Secretary Moniz Addresses Conference on the Caribbean's Energy...  

NLE Websites -- All DOE Office Websites (Extended Search)

6, 2013 - 2:42pm Addthis Secretary Moniz Addresses Conference on the Caribbeans Energy Future Secretary Moniz joined Inter-American Development Bank President Luis...


A New Addressing and Forwarding Architecture for the Internet.  

E-Print Network (OSTI)

??The current Internet routing and addressing architecture is facing a serious scalability problem. The default free zone (DFZ) routing table size grows at an increasing (more)

Guo, Cong



MCS researchers give keynote addresses at HPCS 2013 | Argonne...  

NLE Websites -- All DOE Office Websites (Extended Search)

Franck Cappello gave keynote addresses at the international conference on High Performance Computing and Simulation (HPCS 2103) in Helsinki, Finland, July 1-5, 2013. Foster, an...


Electrically Addressable Carbon Nanofibers on (Non)Insulating ...  

Addressable Carbon Nanofibers on (Non)Insulating Substrates ... Field emission from a large area of VACNF with nanoscale tips - MIT. 6 Managed by UT-Battelle


Secretary Chu Addresses the International Atomic Energy Agency...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1929, the strongest and most comprehensive set of sanctions to date to address Iranian non-compliance. While we continue to acknowledge Iran's right to pursue peaceful civilian...


Response to Request for Information titled "Addressing Policy...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

energy and climate policy reduces the likelihood of a significant reduction in greenhouse gas emissions or energy imports. Response to Request for Information titled "Addressing...


Smart Grid RFI: Addressing Policy and Logistical Challenges....  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Challenges. Comments of the Alliance to Save Energy. Smart Grid RFI: Addressing Policy and Logistical Challenges. Comments of the Alliance to Save Energy. The Alliance to Save...


Smart Grid RFI: Addressing Policy and Logistical Challenges,...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Challenges, Comments from the Edison Electric Institute Smart Grid RFI: Addressing Policy and Logistical Challenges, Comments from the Edison Electric Institute The Edison Electric...


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Aviation Fuels Development Center Baylor Aviation Fuels Development Center Baylor University Renewable Aviation Fuels Development Center One Bear Place Waco Texas http www baylor edu bias index php id Texas Area CSU Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Caltech Center for Sustainable Energy Research Caltech Center for Sustainable Energy Research East California Boulvard Pasadena California http www ccser caltech edu Southern CA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

McClellan Technology Incubator Clean Start McClellan Technology McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area Energy BioSciences Institute Energy BioSciences Institute Berkeley California http www energybiosciencesinstitute org Bay Area Environmental Business Cluster Environmental Business Cluster North First Street Third Floor San Jose California http www environmentalcluster org Bay Area Global Climate and Energy Project Global Climate and Energy Project Via Ortega Suite Stanford California http gcep stanford edu Bay Area Google org Google org Amphitheatre Parkway Mountain View California http www google org Bay Area Lawrence Berkeley National Laboratory LBNL Lawrence Berkeley National


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brookhaven National Laboratory William Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Consultative Group on International Agricultural Research Consultative Group on International Agricultural Research H Street NW Washington District of Columbia http www cgiar org Northeast NY NJ CT PA Area Knowledge Strategies Knowledge Strategies Atwell Ct Potomac Maryland Northeast NY NJ CT PA Area Passport to Knowledge Passport to Knowledge Morristown New Jersey http passporttoknowledge com Northeast NY NJ CT PA Area Rutgers EcoComplex Rutgers EcoComplex Florence Columbus Rd Bordentown


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean energy energy efficiency a healthy environment and a strong economy for the Empire State http www aceny org Northeast NY NJ CT PA Area Center for Clean Air Policy CCAP Center for Clean Air Policy CCAP First Street NE Suite Washington District of Columbia http www ccap org Northeast NY NJ CT PA Area Coalition for Rainforest Nations CfRN Coalition for Rainforest Nations CfRN Lexington Avenue th Floor New York New York http www rainforestcoalition org eng Northeast NY NJ CT PA Area Conservation International Conservation International Crystal Drive Suite Arlington Virginia http www conservation org Pages default aspx Northeast NY NJ CT PA Area Energy Sector Management Assistance Program of the World Bank ESMAP


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Environmental Foundation Bonneville Environmental Foundation Environmental Foundation Bonneville Environmental Foundation SW st Avenue Portland Oregon https www b e f org Pacific Northwest Area Earth Share Oregon Earth Share Oregon SW Washington Street Portland Oregon Federation of leading local and national non profit conservation groups that provides a convenient way to support conservation and healthy communities http www earthshare oregon org Pacific Northwest Area Renewable Northwest Project Renewable Northwest Project SW Oak St Ste Portland Oregon Nonprofit Advocacy Organization http www RNP org Pacific Northwest Area Solar Oregon Solar Oregon SE Grand Ave Portland Oregon Non profit membership organization providing public education and community outreach to encourage Oregonians to choose solar energy http www solaroregon org Pacific


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Texas Bridgepoint Texas Bridgepoint Parkway Austin Texas Venture capital firm investing in alternative energy production http www archventure com Texas Area Energy Capital Solutions Energy Capital Solutions North Harwood Street Suite Dallas Texas Investment banking firm focused on rainsing private capital and providing advisory services to public and private energy companies http www energycapitalsolutions com Texas Area Genesis Park Genesis Park San Felipe Houston Texas Private equity firm http www genesis park com Texas Area Haddington Ventures LLC Haddington Ventures LLC Augusta Suite Houston Texas Midstream energy private equity fund http www hvllc com Texas Area Sevin Rosen Funds Texas Austin Sevin Rosen Funds Texas Austin Bridgepoint Parkway Building Suite Austin Texas Venture capital fund http www srfunds


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB Geothermal energy Gateway Solar Designs and installs soil investigation systems geothermal systems producer of heat pumps heat pump boilers solar collectors and solar boilers ALDACOR ALDACOR E th St Suite Idaho Falls Idaho Buildings Efficiency Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Advanced Solar LLC Advanced Solar LLC E Lincoln Street Westerville Ohio Geothermal energy Renewable Energy Gateway Solar Wind energy Agriculture Consulting Engineering architectural design Installation Maintenance


Point Of Contact Contractor Name and Address Code  

NLE Websites -- All DOE Office Websites (Extended Search)

15/2011 15/2011 Run Date: DE-SOL-0002014 Vendor List for Solicitation: Page 1 of 6 018572938 NETGAIN CORPORATION ERIN JONES Phone: 8656905811 Fax: 8656905814 ejones@netgain-corp.com 2095 LAKESIDE CENTRE WAY, SUITE 115 KNOXVILLE TN 379226592 040773264 PROTECTION STRATEGIES INCORPORATED KEITH P. HEDMAN Phone: 7035530561 Fax: 7035530562 khedman@protectionsi.com 2300 9TH STREET SOUTH SUITE 400 ARLINGTON VA 222042387 045509338 SECURIGUARD, INC. CHARLIE BORING Phone: 7038216777 Fax: 7037901696 charlie.boring@securiguardinc.com 6858 OLD DOMINION DR # 307 MC LEAN VA 221011383 073891921 WACKENHUT SERVICES, INCORPORATED MICHAEL GOLDEN Phone: 5614723645 Fax: 5614723679 mgolden@wsihq.com 7121 FAIRWAY DRIVE, SUITE 301 PALM BEACH GARDENS FL 334183766 085925480 BRANDAN ENTERPRISES INC GEORGES H. BRANDAN

Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AC Solar Inc AC Solar Inc P O Box Florence Colorado Gateway Solar Solar and wind sales for residential http www acsolar com Rockies Area ALD Nanosolutions ALD Nanosolutions E Burbank Street Unit Broomfield Colorado http www aldnanosolutions com contact php Rockies Area Abengoa Solar Abengoa Solar W th Ave Lakewood Colorado Gateway Solar Solar developer http www abengoasolar com Rockies Area Abound Solar Abound Solar Rocky Mountain Avenue Suite Loveland Colorado Gateway Solar Thin film cadmium telluride solar modules http www abound


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Incubator Austin Clean Energy Incubator West Braker Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Bank of Italy Bank of Italy Via nazionale Rome Italy http www bancaditalia Brookhaven National Laboratory Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Centro de Energ as Renovables CER Centro de Energ as Renovables CER Agustinas piso Santiago Chile http www cer gov cl Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Clean Skies Foundation American Clean Skies Foundation st Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies org Northeast NY NJ CT PA Area Connecticut Clean Energy Fund Connecticut Clean Energy Fund Corporate Place Rocky Hill Connecticut Promotes develops and invests in clean energy sources for the benefit of Connecticut ratepayers http www ctcleanenergy com Northeast NY NJ CT PA Area Global Renewable Energy Network Global Renewable Energy Network P O Box Massapequa New York http www greenjuncture com Northeast NY NJ CT PA Area New Jersey s Clean Energy Program New Jersey s Clean Energy Program South Clinton Avenue Trenton New Jersey Promotes increased energy efficiency and the use of clean renewable sources of energy including solar wind


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AWEA American Wind Energy Association AWEA American Wind Energy Association AWEA M Street NW Suite Washington District of Columbia http www awea org Asociacion Argentina de Energia Eolica Asociacion Argentina de Energia Eolica Buenos Aires Argentina http www argentinaeolica org ar Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Clean Technology Sustainable Industries Organization Clean Technology Sustainable Industries Organization Coolidge Hwy Royal Oak Michigan http www ct si org Green Integrated Design Green Integrated Design Tempe Arizona http www GreenIntegratedDesign com Massachusetts Hydrogen Coalition Massachusetts Hydrogen Coalition Cummings


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Angeleno Group Century Park East Suite Los Angeles California Angeleno Group Century Park East Suite Los Angeles California Private equity firm focused on high growth investments in energy and environmental technology companies http www angelenogroup com Southern CA Area Applied Ventures LLC Applied Ventures LLC Bowers Avenue Santa Clara California Venture capital http www appliedventures com Southern CA Area EcoElectron Ventures EcoElectron Ventures nd Street Encinitas California Seed stage capital investment fund http www ecoelectron com Southern CA Area GreenCore Capital GreenCore Capital Vista Sorrento Parkway San Diego California Invests in developing promising renewable energy companies http www greencorecapital com Southern CA Area Hydrogen Ventures Hydrogen Ventures N Studabaker Road Long Beach California


DOE Action Plan Addressing the Electricity Transmission System  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

U.S. DEPARTMENT OF ENERGY U.S. DEPARTMENT OF ENERGY ACTION PLAN ADDRESSING THE ELECTRICITY TRANSMISSION SYSTEM ~DRAFT~ DOE Action Plan Addressing the Electricity Transmission System 1 Table of Contents * INTRODUCTION ................................................................................................................... 2 The Grid Tech Team ...................................................................................................... 2 Focus on Transmission .................................................................................................. 3 Roadmap Goals ............................................................................................................. 4 * PROCESS OVERVIEW ........................................................................................................... 5


Tuning collective communication for Partitioned Global Address Space programming models  

Science Conference Proceedings (OSTI)

Partitioned Global Address Space (PGAS) languages offer programmers the convenience of a shared memory programming style combined with locality control necessary to run on large-scale distributed memory systems. Even within a PGAS language programmers ... Keywords: Collective communication, One-sided communication, Partitioned Global Address Space languages

Rajesh Nishtala; Yili Zheng; Paul H. Hargrove; Katherine A. Yelick



Understanding the efficacy of deployed internet source address validation filtering  

Science Conference Proceedings (OSTI)

IP source address forgery, or "spoofing," is a long-recognized consequence of the Internet's lack of packet-level authenticity. Despite historical precedent and filtering and tracing efforts, attackers continue to utilize spoofing for anonymity, indirection, ... Keywords: filtering, ip spoofing, source address validation

Robert Beverly; Arthur Berger; Young Hyun; k claffy



Research on IPv6 address configuration for wireless sensor networks  

Science Conference Proceedings (OSTI)

The paper proposes an IPv6 address configuration scheme for wireless sensor networks. In the scheme, one wireless sensor network is divided into multiple clusters and the scheme creates the IPv6 address formats for the cluster heads and the cluster members ...

Xiaonan Wang; Demin Gao



Executive Order 12898: Federal Actions to Address Environmental Justice in  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2898: Federal Actions to Address Environmental 2898: Federal Actions to Address Environmental Justice in Minority Populations and Low-Income Populations (1994) Executive Order 12898: Federal Actions to Address Environmental Justice in Minority Populations and Low-Income Populations (1994) Executive Order 12898: Federal Actions to Address Environmental Justice in Minority Populations and Low-Income Populations (1994). Directs each federal agency to make environmental justice part of its mission, and sets responsibilities for agencies including developing a strategy to identify and address "disproportionately high and adverse human health or environmental effects of its programs, policies, and activities on minority populations and low-income populations." This applies equally to Native American programs. This EO also directs "after consultation with tribal


Okaloosa Gas District Smart Grid RFI: Addressing Policy and Logistical  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Okaloosa Gas District Smart Grid RFI: Addressing Policy and Okaloosa Gas District Smart Grid RFI: Addressing Policy and Logistical Challenges to Smart Grid Implementation Okaloosa Gas District Smart Grid RFI: Addressing Policy and Logistical Challenges to Smart Grid Implementation Okaloosa Gas District (The District) an Independent Special District of the State of Florida is appreciative of the opportunity to submit for your consideration the following comments in response to the U.S. Department of Energy, Office of Electricity Delivery and Energy Reliability's Request for Information Addressing Policy and Logistical Challenges to Smart Grid Implementation, 75 Fed. Reg. 57,006 (Sep. 17, 2010). Okaloosa Gas District Smart Grid RFI: Addressing Policy and Logistical Challenges to Smart Grid Implementation More Documents & Publications


Secretary Chu Announces Latest Efforts to Address Cybersecurity |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Latest Efforts to Address Cybersecurity Latest Efforts to Address Cybersecurity Secretary Chu Announces Latest Efforts to Address Cybersecurity September 23, 2010 - 12:00am Addthis Washington, D.C. - Speaking at the inaugural GridWise Global Forum, U.S. Energy Secretary Steven Chu today announced the investment of more than $30 million for ten projects that will address cybersecurity issues facing the nation's electric grid. Together, these projects represent a significant investment in addressing cybersecurity issues in the nation's electric infrastructure. Today's announcement supports the Administration's goal of building a 21st Century clean energy economy supported by a secure, reliable, electricity system delivering power to American homes and businesses. "These awards help us make a significant leap forward to strengthen the


Smart Grid RFI: Addressing Policy and Logistical Challenges, Comments from  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

RFI: Addressing Policy and Logistical Challenges, RFI: Addressing Policy and Logistical Challenges, Comments from the Edison Electric Institute Smart Grid RFI: Addressing Policy and Logistical Challenges, Comments from the Edison Electric Institute The Edison Electric Institute ("EEI"), on behalf of its member companies, hereby submits the following comments in response to the request by the Department of Energy ("DOE" or "Department") for information on a wide range of issues dealing with Smart Grid technology, applications, consumer interaction, policy initiatives and economic impacts, including the definition of Smart Grid; interactions with and implications for residential, commercial and industrial customers; Smart Grid costs and benefits; collaboration between utilities, device manufacturers and energy


Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)



Energy Secretary Steven Chu to Address Montana Economic Development Summit  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Address Montana Economic Development Address Montana Economic Development Summit Energy Secretary Steven Chu to Address Montana Economic Development Summit September 13, 2010 - 12:00am Addthis Washington D.C. -Tuesday, September 14, 2010, U.S. Energy Secretary Steven Chu will speak at the 2010 Montana Economic Development Summit. This year's summit will discuss the mechanics of a healthy recovery and how to get workers back into good-paying jobs. At the invitation of Senator Max Baucus, Secretary Chu will discuss how Montana can seize the clean energy opportunity and highlight the investments the administration has made in the state's clean energy sector. The summit will be webcast live. What: U.S. Secretary of Energy Steven Chu to give keynote address at Montana Economic Development Summit


Abraham Calls on Global Community to Aggressively Address Nuclear  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Abraham Calls on Global Community to Aggressively Address Nuclear Abraham Calls on Global Community to Aggressively Address Nuclear Nonproliferation Abraham Calls on Global Community to Aggressively Address Nuclear Nonproliferation January 13, 2005 - 9:49am Addthis WASHINGTON, DC - In a lunchtime speech to the Council on Foreign Relations in Washington, DC, Energy Secretary Spencer Abraham called on the global community to join in implementing a comprehensive nuclear nonproliferation strategy to address 21st century challenges. Outlining his vision for dealing with constantly evolving proliferation threats in an age of terrorism, Secretary Abraham said the international community must play a greater role in future efforts. "Terrorists have struck not just Washington, New York, Moscow, and Beslan," he said. "The challenge of confronting terrorism falls to every nation. .


Ambient Corporation's Reply comments to DOE RFI: Addressing Policy and  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Ambient Corporation's Reply comments to DOE RFI: Addressing Policy Ambient Corporation's Reply comments to DOE RFI: Addressing Policy and Logistical Challenges to Smart Grid Implementation Ambient Corporation's Reply comments to DOE RFI: Addressing Policy and Logistical Challenges to Smart Grid Implementation Ambient Corporation submits the following comments to the US Department of Energy (DOE) in hopes that their contribution can highlight and further the understanding of the DOE on the key role that integrated communications will play ineneabling utilities to deploy cost-effective long-term smart grid benefits. Ambient Corporation's Reply comments to DOE RFI: Addressing Policy and Logistical Challenges to Smart Grid Implementation More Documents & Publications Comments of Tendril Networks Inc Technical Standards Newsletter - September 2001


EPA -- Addressing Children's Health through Reviews Conducted Pursuant to  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EPA -- Addressing Children's Health through Reviews Conducted EPA -- Addressing Children's Health through Reviews Conducted Pursuant to the National Environmental Policy Act and Section 309 of the Clean Air Act EPA -- Addressing Children's Health through Reviews Conducted Pursuant to the National Environmental Policy Act and Section 309 of the Clean Air Act Addressing Children's Health through Reviews Conducted Pursuant to the National Environmental Policy Act and Section 309 of the Clean Air Act Executive Order 13045, "Protection of Children from Environmental Health Risks and Safety Risks " (April 21, 1997), directs Federal agencies, to the extent permitted by law and appropriate, to make it a high priority to identify and assess environmental health and safety risks that may disproportionately affect children and to ensure that policies, programs,

Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE Seeks Input On Addressing Contractor Pension and Medical Benefits  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Input On Addressing Contractor Pension and Medical Input On Addressing Contractor Pension and Medical Benefits Liabilities DOE Seeks Input On Addressing Contractor Pension and Medical Benefits Liabilities March 27, 2007 - 12:10pm Addthis WASHINGTON, DC - The U.S. Department of Energy (DOE) today announced in the Federal Register that it is seeking public comment on how to address the increasing costs and liabilities of contractor employee pension and medical benefits. Under the Department of Energy's unique Management and Operating and other site management contracts, DOE reimburses its contractors for allowable costs incurred in providing contractor employee pension and medical benefits to current employees and retirees. In FY2006, these costs reached approximately $1.1 billion - a more than 226 percent increase since FY2000 - and are expected to grow in future years.


Secretary Chu Addresses the International Atomic Energy Agency General  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretary Chu Addresses the International Atomic Energy Agency Secretary Chu Addresses the International Atomic Energy Agency General Conference Secretary Chu Addresses the International Atomic Energy Agency General Conference September 20, 2010 - 12:00am Addthis Washington, DC - U.S. Energy Secretary Steven Chu addressed the International Atomic Energy Agency's 54th General Conference today in Vienna. His prepared remarks are below: Thank you, Ambassador Enkhsaikhan. Congratulations on your election as President of this Conference. I extend my thanks and appreciation to Director General Mr. Yukiya Amano for his exemplary leadership in his first year. I especially welcome the Director General's initiative to help fight cancer in developing countries. I am honored to represent the United States today, and I want to share a


EPA -- Addressing Children's Health through Reviews Conducted Pursuant to  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EPA -- Addressing Children's Health through Reviews Conducted EPA -- Addressing Children's Health through Reviews Conducted Pursuant to the National Environmental Policy Act and Section 309 of the Clean Air Act EPA -- Addressing Children's Health through Reviews Conducted Pursuant to the National Environmental Policy Act and Section 309 of the Clean Air Act Addressing Children's Health through Reviews Conducted Pursuant to the National Environmental Policy Act and Section 309 of the Clean Air Act Executive Order 13045, "Protection of Children from Environmental Health Risks and Safety Risks " (April 21, 1997), directs Federal agencies, to the extent permitted by law and appropriate, to make it a high priority to identify and assess environmental health and safety risks that may disproportionately affect children and to ensure that policies, programs,


Secretary Chu Addresses the International Atomic Energy Agency General  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Addresses the International Atomic Energy Agency Addresses the International Atomic Energy Agency General Conference Secretary Chu Addresses the International Atomic Energy Agency General Conference September 20, 2010 - 12:00am Addthis Washington, DC - U.S. Energy Secretary Steven Chu addressed the International Atomic Energy Agency's 54th General Conference today in Vienna. His prepared remarks are below: Thank you, Ambassador Enkhsaikhan. Congratulations on your election as President of this Conference. I extend my thanks and appreciation to Director General Mr. Yukiya Amano for his exemplary leadership in his first year. I especially welcome the Director General's initiative to help fight cancer in developing countries. I am honored to represent the United States today, and I want to share a message from President Barack Obama:


Department of Energy Releases Strategic Plan to Address Energy Challenges |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Department of Energy Releases Strategic Plan to Address Energy Department of Energy Releases Strategic Plan to Address Energy Challenges Department of Energy Releases Strategic Plan to Address Energy Challenges October 2, 2006 - 9:01am Addthis WASHINGTON, DC - Secretary of Energy Samuel W. Bodman today released the Department's five-year strategic plan that focuses on the Department's role in powering and securing America's future. The plan addresses overall Department goals for developing and deploying new clean energy technologies, reducing our dependence on foreign energy sources, protecting our nuclear weapons stockpile, and ensuring that America remains competitive in the global marketplace. The Department's plan builds on President Bush's Advanced Energy and American Competitiveness Initiatives, which are increasing America's energy security, spurring scientific


NAP Coalition Response to DOE RFI: Addressing Policy and Logistical  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NAP Coalition Response to DOE RFI: Addressing Policy and Logistical NAP Coalition Response to DOE RFI: Addressing Policy and Logistical Challenges to Smart Grid Implementation NAP Coalition Response to DOE RFI: Addressing Policy and Logistical Challenges to Smart Grid Implementation The NAP Coalition is a "Coalition of Coalitions" that has been formed for the purpose of implementing the National Action Plan released by FERC in cooperation with DOE in June of 2010. Organizations working together on NAP implementation in include EEI, APPA, NRECA, ASE, ACEEE, NASUCA, NARUC, NASEO, DRSG, DRCC and EDF. The NAP Coalition submits a response in this RFI only to question #14 in Section II of the RFI. NAP Coalition Response to DOE RFI: Addressing Policy and Logistical Challenges to Smart Grid Implementation More Documents & Publications


Native Village of Teller Addresses Heating Fuel Shortage, Improves Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Native Village of Teller Addresses Heating Fuel Shortage, Improves Native Village of Teller Addresses Heating Fuel Shortage, Improves Energy Security Native Village of Teller Addresses Heating Fuel Shortage, Improves Energy Security June 22, 2012 - 4:54pm Addthis The combination of the Native Village of Teller’s limited fuel storage capacity and a harsh winter led to a supply shortage. Photo by Alexander Dane, NREL The combination of the Native Village of Teller's limited fuel storage capacity and a harsh winter led to a supply shortage. Photo by Alexander Dane, NREL Native Village of Teller Addresses Heating Fuel Shortage, Improves Energy Security Native Village of Teller fuel storage. Photo by Alexander Dane, NREL Native Village of Teller fuel storage. Photo by Alexander Dane, NREL The combination of the Native Village of Teller's limited fuel storage capacity and a harsh winter led to a supply shortage. Photo by Alexander Dane, NREL


Energy Department Assistant Secretary Patricia Hoffman Addresses 2011 FERC  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Assistant Secretary Patricia Hoffman Addresses Assistant Secretary Patricia Hoffman Addresses 2011 FERC Reliability Technical Conference Energy Department Assistant Secretary Patricia Hoffman Addresses 2011 FERC Reliability Technical Conference November 30, 2011 - 1:50pm Addthis WASHINGTON, D.C. - Department of Energy Assistant Secretary for Electricity Delivery and Energy Reliability Patricia Hoffman today addressed the 2011 Federal Energy Regulatory Commission technical conference in Washington, D.C. In remarks prepared for delivery, Assistant Secretary Hoffman discussed recent evaluations of proposed Environmental Protection Agency (EPA) rules and the impact those rules could be expected to have on our nation's electrical grid. Hoffman noted an emerging consensus that the new rules are not expected to create


NAP Coalition Response to DOE RFI: Addressing Policy and Logistical  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NAP Coalition Response to DOE RFI: Addressing Policy and Logistical NAP Coalition Response to DOE RFI: Addressing Policy and Logistical Challenges to Smart Grid Implementation NAP Coalition Response to DOE RFI: Addressing Policy and Logistical Challenges to Smart Grid Implementation The NAP Coalition is a "Coalition of Coalitions" that has been formed for the purpose of implementing the National Action Plan released by FERC in cooperation with DOE in June of 2010. Organizations working together on NAP implementation in include EEI, APPA, NRECA, ASE, ACEEE, NASUCA, NARUC, NASEO, DRSG, DRCC and EDF. The NAP Coalition submits a response in this RFI only to question #14 in Section II of the RFI. NAP Coalition Response to DOE RFI: Addressing Policy and Logistical Challenges to Smart Grid Implementation More Documents & Publications


Smart Grid RFI: Addressing Policy and Logistical Challenges. Comments of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Smart Grid RFI: Addressing Policy and Logistical Challenges. Smart Grid RFI: Addressing Policy and Logistical Challenges. Comments of the Alliance to Save Energy. Smart Grid RFI: Addressing Policy and Logistical Challenges. Comments of the Alliance to Save Energy. The Alliance to Save Energy is a coalition of prominent business, government, environmental, and consumer leaders who promote the efficient use of energy worldwide to benefit consumers, the environment, economy, and national security. The Alliance to Save Energy (the Alliance) thanks the Department of Energy for the opportunity to comment on broad issues of policy and logistical challenges faced in smart grid implementation. Smart Grid RFI: Addressing Policy and Logistical Challenges. Comments of the Alliance to Save Energy. More Documents & Publications


Addressing the Sputniks of our Generation | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Addressing the Sputniks of our Generation Addressing the Sputniks of our Generation Addressing the Sputniks of our Generation September 30, 2010 - 5:55pm Addthis Dr. Arun Majumdar Dr. Arun Majumdar Former Director, Advanced Research Projects Agency - Energy Earlier this week, I traveled to Boston to take part in Boston University's Presidential Lecture on Clean Energy and Environmental Sustainability. The purpose of my discussion was to address technology innovations with fierce urgency. To understand what I mean, we must take a quick look back to 1958. In response to the Soviet Union's launch of its first satellite - Sputnik 1, the Department of Defense created DARPA to regain the country's technological lead. Today, we are faced with three similar "Sputnik-like" challenges in the energy sector:


Energy Department Assistant Secretary Patricia Hoffman Addresses 2011 FERC  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Department Assistant Secretary Patricia Hoffman Addresses Energy Department Assistant Secretary Patricia Hoffman Addresses 2011 FERC Reliability Technical Conference Energy Department Assistant Secretary Patricia Hoffman Addresses 2011 FERC Reliability Technical Conference November 30, 2011 - 1:50pm Addthis WASHINGTON, D.C. - Department of Energy Assistant Secretary for Electricity Delivery and Energy Reliability Patricia Hoffman today addressed the 2011 Federal Energy Regulatory Commission technical conference in Washington, D.C. In remarks prepared for delivery, Assistant Secretary Hoffman discussed recent evaluations of proposed Environmental Protection Agency (EPA) rules and the impact those rules could be expected to have on our nation's electrical grid. Hoffman noted an emerging consensus that the new rules are not expected to create


Deputy Secretary Poneman Addresses Nuclear Deterrence Summit | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Addresses Nuclear Deterrence Summit Addresses Nuclear Deterrence Summit Deputy Secretary Poneman Addresses Nuclear Deterrence Summit February 17, 2010 - 12:00am Addthis Alexandria, VA - U.S. Deputy Secretary of Energy Daniel Poneman today addressed the opening session of the second annual Nuclear Deterrence Summit and discussed the Department of Energy's commitment to helping achieve the President's goals of reducing nuclear dangers and expanding the use of nuclear energy in a manner that minimizes the risks of proliferation. The Deputy Secretary also spoke about the Department's commitment to management excellence. Read the Deputy Secretary's full remarks. Excerpts from his remarks as prepared for delivery are below. On the Department of Energy's Role in our Nuclear Energy Future: "As we consider our nuclear energy future, all three program areas of the


Neile Miller addresses DOE/NNSA intergovernmental meeting | National  

National Nuclear Security Administration (NNSA)

Neile Miller addresses DOE/NNSA intergovernmental meeting | National Neile Miller addresses DOE/NNSA intergovernmental meeting | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > NNSA Blog > Neile Miller addresses DOE/NNSA intergovernmental meeting Neile Miller addresses DOE/NNSA intergovernmental meeting Posted By Office of Public Affairs NNSA Blog


Secretary Moniz Addresses Conference on the Caribbean's Energy Future |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretary Moniz Addresses Conference on the Caribbean's Energy Secretary Moniz Addresses Conference on the Caribbean's Energy Future Secretary Moniz Addresses Conference on the Caribbean's Energy Future December 6, 2013 - 2:42pm Addthis Secretary Moniz Addresses Conference on the Caribbean’s Energy Future Secretary Moniz joined Inter-American Development Bank President Luis Alberto Moreno in welcoming a group of Caribbean ministers who convened to discuss the region's energy future, climate change, and the roles of energy efficiency, renewable energy and natural gas. Addthis Related Articles Secretary Chu's Remarks at the 2012 IAEA General Conference -- As Prepared for Delivery Energy Department Invests Over $7 Million to Deploy Tribal Clean Energy Projects Deputy Secretary Daniel Poneman's Remarks to the Washington Institute for


Native Village of Teller Addresses Heating Fuel Shortage, Improves Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Native Village of Teller Addresses Heating Fuel Shortage, Improves Native Village of Teller Addresses Heating Fuel Shortage, Improves Energy Security Native Village of Teller Addresses Heating Fuel Shortage, Improves Energy Security June 22, 2012 - 4:54pm Addthis The combination of the Native Village of Teller’s limited fuel storage capacity and a harsh winter led to a supply shortage. Photo by Alexander Dane, NREL The combination of the Native Village of Teller's limited fuel storage capacity and a harsh winter led to a supply shortage. Photo by Alexander Dane, NREL Native Village of Teller Addresses Heating Fuel Shortage, Improves Energy Security Native Village of Teller fuel storage. Photo by Alexander Dane, NREL Native Village of Teller fuel storage. Photo by Alexander Dane, NREL The combination of the Native Village of Teller's limited fuel storage capacity and a harsh winter led to a supply shortage. Photo by Alexander Dane, NREL


Bush Administration Plays Leading Role in Studying and Addressing Global  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Plays Leading Role in Studying and Addressing Plays Leading Role in Studying and Addressing Global Climate Change Bush Administration Plays Leading Role in Studying and Addressing Global Climate Change February 27, 2007 - 3:49pm Addthis Washington, DC - Continuing to take the lead in addressing global climate change, Energy Secretary Samuel Bodman, Environmental Protection Agency (EPA) Administrator Stephen Johnson, and National Oceanic and Atmospheric Administration (NOAA) Administrator Vice Admiral Conrad Lautenbacher discussed Working Group I's contribution to the Fourth Assessment Report released today by the Intergovernmental Panel on Climate Change (IPCC). The report confirms what President Bush has said about the nature of climate change and it reaffirms the need for continued U.S. leadership in


Regional Effort to Deploy Clean Coal Technologies -- Addressing...  

NLE Websites -- All DOE Office Websites (Extended Search)

Water Resources Regional effoRt to Deploy Clean Coal teChnologies Addressing the Water-Energy Interface Background Recent water shortages in various parts of the United States have...


PROGRAM OPPORTUNITY NOTICE Solicitation to Address High Purchase Costs  

E-Print Network (OSTI)

PROGRAM OPPORTUNITY NOTICE Solicitation to Address High Purchase Costs and Disposal Impacts of PEV Battery Packs PON-12-501 http://www.energy.ca.gov/contracts/index.html State of California California.......................................................................................... 19 COST OF DEVELOPING APPLICATION



Office of Legacy Management (LM)


Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The Legacy of the Gettysburg Address, 1863-1965  

E-Print Network (OSTI)

My project examines the legacy of the Gettysburg Address from 1863 to 1965. After an introduction and a chapter setting the stage, each succeeding chapter surveys the meaning of the Gettysburg Address at key moments: the initial reception of the speech in 1863; its status during the semi-centennial in 1913 and during the construction of the Lincoln Memorial; the place it held during the world wars; and the transformation of the Address in the late 1950s and early 1960s marked by the confluence of the Cold War, Civil Rights Movement, Lincoln Birth Sesquicentennial, and Civil War Centennial. My final chapter considers how interpretations of the Address changed in textbooks from 1900 to 1965, and provides the entire trajectory of the evolving meanings of the speech in one medium and in one chapter. For each time period I have analyzed what the Address meant to people living in four cities: Gettysburg, Richmond, New York, and London. My argument is twofold. First, rather than operating as a national document the Gettysburg Address has always held different meanings in the North and South. Given that the speech addressed questions central to the United States (equality and democracy), this lack of a common interpretation illustrates that there was no singular collective memory or national identity regarding core values. Second, as the nation and world shifted, so did the meaning of the Gettysburg Address. Well into the twentieth-century the essence of the speech was proclaimed to be its support of the democratic form of government as opposed to monarchies or other institutions. But in the middle twentieth-century that interpretation began to shift, with many both abroad and at home beginning to see the speechs assertion of human equality as its focal point and most important contribution.

Peatman, Jared Elliott




DOE Green Energy (OSTI)

The Los Angeles Department of Water and Power (LADWP) has developed one of the most recognized fuel cell demonstration programs in the United States. In addition to their high efficiencies and superior environmental performance, fuel cells and other generating technologies that can be located at or near the load, offers several electric utility benefits. Fuel cells can help further reduce costs by reducing peak electricity demand, thereby deferring or avoiding expenses for additional electric utility infrastructure. By locating generators near the load, higher reliability of service is possible and the losses that occur during delivery of electricity from remote generators are avoided. The potential to use renewable and locally available fuels, such as landfill or sewage treatment waste gases, provides another attractive outlook. In Los Angeles, there are also many oil producing areas where the gas by-product can be utilized. In June 2000, the LADWP contracted with FCE to install and commission the precommercial 250kW MCFC power plant. The plant was delivered, installed, and began power production at the JFB in August 2001. The plant underwent manufacturer's field trials up for 18 months and was replace with a commercial plant in January 2003. In January 2001, the LADWP contracted with FCE to provide two additional 250kW MCFC power plants. These commercial plants began operations during mid-2003. The locations of these plants are at the Terminal Island Sewage Treatment Plant at the Los Angeles Harbor (for eventual operation on digester gas) and at the LADWP Main Street Service Center east of downtown Los Angeles. All three carbonate fuel cell plants received partial funding through the Department of Defense's Climate Change Fuel Cell Buydown Program. This report covers the technical evaluation and benefit-cost evaluation of the Main Street 250kW MCFC power plant during its first year of operation from September 2003 to August 2004. The data for the month of September 2004 was not available at the time this report was prepared. An addendum to this report will be prepared and transmitted to the Department of Energy once this data becomes available. This fuel cell power plant was originally intended to be installed at an American Airlines facility located at Los Angeles International Airport, however, due to difficulties in obtaining a site, the plant was ultimately installed at the LADWP's Distributed Generation Test Facility at it's Main Street Service Center.

William W. Glauz




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FOLEY FOLEY FOLEY & LARDNER LLP ATTORNEYS AT LAW WASHINGTON HARBOUR 3000 K STREET, N.W. SUITE 600 WASHINGTON, D.C. 20007-5109 202.672.5300 TEL 202.672.5399 FAX foley.com WRITER'S DIRECT LINE 202.672.5442 jsnewman©foley.corn EMAIL December 13, 2010 VIA E-Mail (Celia.Sher@hq.doe.gov) Ms. Celia Sher U.S. Department of Energy Office of General Counsel Forrestal Building, GC-71 1000 Independence Avenue, S.W. Washington, D.C. 585-0121 Re: Requested Summary of Telephone Conference Regarding Certification and Compliance Requirements Dear Ms. Sher: On behalf of Johnson Controls, Inc. (JCI), I am providing at your request a summary of the concerns raised during our telephone call on Wednesday, December 8, 2010 concerning the certification and compliance requirements for commercial air conditioning and heat pump


The Honorable Richard M. Daley,. Jr. 121 N.. LaSalle Street  

Office of Legacy Management (LM)

Pepartment of Energy Pepartment of Energy Washington, DC 20585 FEB 24 1995 The Honorable Richard M. Daley,. Jr. 121 N.. LaSalle Street Chicago, Illinoi~s 60602 Dear Mayor Daley:. Secretary of Energy Hazel O'Leary has announced a new approach.to openness in the Department.of Energy (DOE) and its communicationswith the public. In . support of this initiative, we are,pleased to.forward the enclosed information related to,the former Wyckoff Steel Co. site in your jurisdiction that performed work for DDE or its predecessor agencies. 'This information is provided for your information, use, and retention. DOE's Formerly Utilized Sites Remedial ActionProgram is responsible for identification of sites used by DOE's predecessor agencies, determining their current radiplogical condition'and, where it has authority, performing


The Honorable Richard M., Daley, ~Jr: 121 N. LaSalle Street  

Office of Legacy Management (LM)

Richard M., Daley, ~Jr: Richard M., Daley, ~Jr: \ 121 N. LaSalle Street Chicago, Illinois 60602 ', Dear Mayor Daley.:' / Secretary-of Energy Hazel O'Leary has announced a new approach to openness in the Department of Energy (DOE) and its communications with the public. In support'of this .initiative, we are pleased to forward the.enclosed in7ormatio'n related to the former Crane Co. si,te in your jurisdiction 'that'performed work for DOE or.its predecessor agencies. information, use, and retention. , This in,formation- is provided for your. -\ DOE's Formerly Utilized Sites Remedial Act~ion Program is responsible for ,' identification of sites used by DOE's predecessor. agencies, determining their current .radiological condition and, where it- has authority;. performing


Street N.W., Washington, DC 20036 Letter Electrostatic Force Assisted Exfoliation of  

NLE Websites -- All DOE Office Websites (Extended Search)

LAWRENCE BERKELEY NATL LAB LAWRENCE BERKELEY NATL LAB Nano Letters is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Letter Electrostatic Force Assisted Exfoliation of Prepatterned Few-Layer Graphenes into Device Sites Xiaogan Liang, Allan S. P. Chang, Yuegang Zhang, Bruce D. Harteneck, Hyuck Choo, Deirdre L. Olynick, and Stefano Cabrini Nano Lett., Article ASAP Downloaded from http://pubs.acs.org on December 15, 2008 More About This Article Additional resources and features associated with this article are available within the HTML version: * Supporting Information * Access to high resolution figures * Links to articles and content related to this article * Copyright permission to reproduce figures and/or text from this article Electrostatic


Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Article  

NLE Websites -- All DOE Office Websites (Extended Search)

Chemical Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Article Proton Dynamics in N,N,N#,N#-Tetramethylguanidinium Bis(perfluoroethylsulfonyl)imide Protic Ionic Liquid Probed by Quasielastic Neutron Scattering Eugene Mamontov, Huimin Luo, and Sheng Dai J. Phys. Chem. B, 2009, 113 (1), 159-169 * DOI: 10.1021/jp808102k * Publication Date (Web): 11 December 2008 Downloaded from http://pubs.acs.org on January 2, 2009 More About This Article Additional resources and features associated with this article are available within the HTML version: * Supporting Information * Access to high resolution figures * Links to articles and content related to this article * Copyright permission to reproduce figures and/or text from this article Proton Dynamics in N,N,N',N'-Tetramethylguanidinium


Hr. Michael Esposito Audio-Tex Industries, Incorporated 4555 West Addison Street  

Office of Legacy Management (LM)

-- -- Hr. Michael Esposito Audio-Tex Industries, Incorporated 4555 West Addison Street Chicago, Illinois 60641 Dear Mr. Esposito: Enclosed is a copy of the final survey report for your facility in Chicago,. Illinois , which is the site of the former ERA Tool & Engineering Company. The survey report documents the fact that the radiological condition of your facility is in compliance with applicable Department of Energy Guidelines and that no remedial action or further investigaticns are necessary. If you have any questions regarding the survey results or our dssociated actions, contact Mr. James Wagoner of my staff at 301-353-2802. Sincerely, James 3. Fiore, Director Division of Facility and Site Decommissioning Projects Office of Kuclear Energy


Main Street Net-Zero Energy Buildings: The Zero Energy Method in Concept and Practice  

NLE Websites -- All DOE Office Websites (Extended Search)

870 870 July 2010 Main Street Net-Zero Energy Buildings: The Zero Energy Method in Concept and Practice Preprint Paul Torcellini, Shanti Pless, and Chad Lobato National Renewable Energy Laboratory Tom Hootman RNL Design Presented at the ASME 2010 4 th International Conference on Energy Sustainability Phoenix, Arizona May 17-22, 2010 NOTICE The submitted manuscript has been offered by an employee of the Alliance for Sustainable Energy, LLC (ASE), a contractor of the US Government under Contract No. DE-AC36-08-GO28308. Accordingly, the US Government and ASE retain a nonexclusive royalty-free license to publish or reproduce the published form of this contribution, or allow others to do so, for US Government purposes. This report was prepared as an account of work sponsored by an agency of the United States government.


Fiber-optic, anti-cycling, high pressure sodium street light control. Final technical progress report  

Science Conference Proceedings (OSTI)

This is the Final Technical Progress Report on a project to develop and market a Fiber-Optic Anti-Cycling High Pressure Sodium Street Light Control. The field test units are now being made with a single vertical PC board design and contains a computer-on-a-chip or PROM IC to take the place of the majority of the components previously contained on the upper logic board. This will reduce the final costs of the unit when it is in production and increase the control`s flexibility. The authors have finished the soft tooling and have made the 400 plastic cases for the field test units. The new configuration of the cases entails a simplified design of the control shell which will have the lenses cast in place. The shell and base plastics are now finished and in final assembly awaiting the completion of the PC boards.




Headquarters Program & Staff Office Mailing Addresses | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Headquarters Program & Staff Office Mailing Headquarters Program & Staff Office Mailing Addresses Headquarters Program & Staff Office Mailing Addresses The following addresses are for delivery of regular mail and small packages: Delivery to the Headquarters buildings in Washington, DC: Name of Individual Title Routing Symbol/Forrestal Building U.S. Department of Energy 1000 Independence Ave., S.W. Washington, DC 20585 Name of Individual Title Routing Symbol/L'Enfant Plaza Building U.S. Department of Energy 1000 Independence Ave., S.W. Washington, DC 20585-1615 Delivery to the Headquarters buildings in Germantown, MD: Name of Individual Title Routing Symbol/Germantown Building U.S. Department of Energy 1000 Independence Ave., S.W. Washington, DC 20585-1290 Name of Individual Title Routing Symbol/Cloverleaf Building


Address (Smart Grid Project) (Switzerland) | Open Energy Information  

Open Energy Info (EERE)

Project Name Address Project Name Address Country Switzerland Coordinates 46.818188°, 8.227512° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.818188,"lon":8.227512,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Snir gives keynote address at distributed computing conference | Argonne  

NLE Websites -- All DOE Office Websites (Extended Search)

Snir gives keynote address at distributed computing conference Snir gives keynote address at distributed computing conference August 14, 2013 Tweet EmailPrint Marc Snir, director of Argonne's Mathematics and Computer Science Division and Argonne Distinguished Fellow, delivered a keynote address at the joint PODC/SPAA symposium held in Montreal, Canada, July 22-24, 2013. The PODC (Principles of Distributed Computing) symposium was collocated this year with SPAA (Symposium on Parallelism in Algorithms and Architectures). Both annual conferences are sponsored by the Association for Computer Machinery. Snir's presentation, titled "Supercomputing: Technical Evolution and Programming Models," began with a description of punctuated equilibrium and three technological (r)evolutionary developments in high-performance


Secretary Bodman Addresses IAEA General Conference in Vienna | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretary Bodman Addresses IAEA General Conference in Vienna Secretary Bodman Addresses IAEA General Conference in Vienna Secretary Bodman Addresses IAEA General Conference in Vienna September 18, 2006 - 8:53am Addthis Highlights President Bush's global initiatives to expand international access to nuclear energy and promote nonproliferation VIENNA, AUSTRIA - U.S. Secretary of Energy Samuel W. Bodman today discussed the need to further expand international cooperative work in safely expanding the use of nuclear energy as a clean and affordable energy source while strengthening nuclear nonproliferation in remarks he delivered to the 50th Annual International Atomic Energy Agency (IAEA) General Conference in Vienna, Austria. "As an international community, we must work together to globally expand clean, reliable, and affordable nuclear energy in ways that reduce


Interagency Collaboration to Address Environmental Impacts of Shale Gas  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Interagency Collaboration to Address Environmental Impacts of Shale Interagency Collaboration to Address Environmental Impacts of Shale Gas Drilling Interagency Collaboration to Address Environmental Impacts of Shale Gas Drilling April 23, 2013 - 12:06pm Addthis Dr. John Howard (right), Director of NIOSH and Dr. Anthony Cugini (left), Director of NETL announced the establishment of a research partnership to evaluate the environmental impacts of shale gas drilling. Dr. John Howard (right), Director of NIOSH and Dr. Anthony Cugini (left), Director of NETL announced the establishment of a research partnership to evaluate the environmental impacts of shale gas drilling. Washington, DC - A memorandum of understanding to perform collaborative research related to airborne emissions and air quality at natural gas drilling sites has been signed by the Office of Fossil Energy's National


DOE Awards Over a Billion Supercomputing Hours to Address Scientific  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Over a Billion Supercomputing Hours to Address Over a Billion Supercomputing Hours to Address Scientific Challenges DOE Awards Over a Billion Supercomputing Hours to Address Scientific Challenges January 26, 2010 - 12:00am Addthis Washington, DC. - The U.S. Department of Energy announced today that approximately 1.6 billion supercomputing processor hours have been awarded to 69 cutting-edge research projects through the Innovative and Novel Computational Impact on Theory and Experiment (INCITE) program. The INCITE program provides powerful resources to enable scientists and engineers to conduct cutting-edge research in just weeks or months rather than the years or decades needed previously. This facilitates scientific breakthroughs in areas such as climate change, alternative energy, life sciences, and materials science.


NETL's Supercomputer Addresses Energy Issues on Two Fronts | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NETL's Supercomputer Addresses Energy Issues on Two Fronts NETL's Supercomputer Addresses Energy Issues on Two Fronts NETL's Supercomputer Addresses Energy Issues on Two Fronts September 26, 2013 - 10:42am Addthis The visualization center for the SBEUC (Simulation Based Engineering User Center). Located at the Department’s National Energy Technology Laboratory in Morgantown, W. Va., the SBEUC will be powered by a high performance computer that will allow researchers to simulate phenomena that are difficult or impossible to probe experimentally. The results from simulations will become accessible through user centers that provide advanced visualization capabilities and foster collaboration among researchers. The SBEUC will be used for developing and deploying simulation tools required for overcoming energy technology barriers quickly and reliably.


DOE Awards Over a Billion Supercomputing Hours to Address Scientific  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE Awards Over a Billion Supercomputing Hours to Address DOE Awards Over a Billion Supercomputing Hours to Address Scientific Challenges DOE Awards Over a Billion Supercomputing Hours to Address Scientific Challenges January 26, 2010 - 12:00am Addthis Washington, DC. - The U.S. Department of Energy announced today that approximately 1.6 billion supercomputing processor hours have been awarded to 69 cutting-edge research projects through the Innovative and Novel Computational Impact on Theory and Experiment (INCITE) program. The INCITE program provides powerful resources to enable scientists and engineers to conduct cutting-edge research in just weeks or months rather than the years or decades needed previously. This facilitates scientific breakthroughs in areas such as climate change, alternative energy, life


Helping Local Officials Address Fuel Shortages | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Helping Local Officials Address Fuel Shortages Helping Local Officials Address Fuel Shortages Helping Local Officials Address Fuel Shortages November 3, 2012 - 6:30pm Addthis The Energy Department continues to work with its federal and state partners to restore critical energy infrastructure throughout the region affected by Hurricane Sandy. The Energy Department continues to work with its federal and state partners to restore critical energy infrastructure throughout the region affected by Hurricane Sandy. Lindsey Geisler Lindsey Geisler Public Affairs Specialist, Office of Public Affairs What are the key facts? Local utilities have restored power to over 6 million customers, but we still have 2.5 million to go. More than 70,000 linemen, technicians and other workers from around the country are working around the clock to turn power back on.


Students Innovate to Address Gas Shortages Following Hurricane Sandy |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Students Innovate to Address Gas Shortages Following Hurricane Students Innovate to Address Gas Shortages Following Hurricane Sandy Students Innovate to Address Gas Shortages Following Hurricane Sandy November 9, 2012 - 3:43pm Addthis Franklin High School students working on their online map of gas and charging stations. | Photo courtesy Dayana Bustamante Franklin High School students working on their online map of gas and charging stations. | Photo courtesy Dayana Bustamante Bob Brese Bob Brese Chief Information Officer Ian Kalin Director of the Energy Data Initiative What are the key facts? Students in New Jersey are using open data and online maps to support their community in the aftermath of Hurricane Sandy. As part of our efforts in helping with Hurricane Sandy restoration efforts, the Energy Department is working closely with other federal partners, state

Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Mailing Addresses and Information Numbers for Operations, Field, and Site  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

About Energy.gov » Mailing Addresses and Information Numbers for About Energy.gov » Mailing Addresses and Information Numbers for Operations, Field, and Site Offices Mailing Addresses and Information Numbers for Operations, Field, and Site Offices Name Telephone Number U.S. Department of Energy Ames Site Office 111 TASF, Iowa State University Ames, Iowa 50011 515-294-9557 U.S. Department of Energy Argonne Site Office 9800 S. Cass Avenue Argonne, IL 60439 630-252-2000 U.S. Department of Energy Berkeley Site Office Berkeley National Laboratory 1 Cyclotron Road Berkeley, CA 94720 510-486-5784 U.S. Department of Energy Bonneville Power Administration P.O. Box 3621 905 NE 11th Avenue Portland, OR 97232 Bonneville Power Administration General and Regional Offices 503-230-3000 U.S. Department of Energy Brookhaven Site Office Upton, NY 11973 631-344-5050


Helping Local Officials Address Fuel Shortages | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Helping Local Officials Address Fuel Shortages Helping Local Officials Address Fuel Shortages Helping Local Officials Address Fuel Shortages November 3, 2012 - 6:30pm Addthis The Energy Department continues to work with its federal and state partners to restore critical energy infrastructure throughout the region affected by Hurricane Sandy. The Energy Department continues to work with its federal and state partners to restore critical energy infrastructure throughout the region affected by Hurricane Sandy. Lindsey Geisler Lindsey Geisler Public Affairs Specialist, Office of Public Affairs What are the key facts? Local utilities have restored power to over 6 million customers, but we still have 2.5 million to go. More than 70,000 linemen, technicians and other workers from around the country are working around the clock to turn power back on.


Mailing Addresses for National Laboratories and Technology Centers |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mailing Addresses for National Laboratories and Mailing Addresses for National Laboratories and Technology Centers Mailing Addresses for National Laboratories and Technology Centers Name Telephone Number U.S. Department of Energy Albany Research Center 1450 Queen Ave. SW Albany, OR 97321-2198 541-967-5892 U.S. Department of Energy Ames Laboratory #311 TASF, Iowa State University Ames, Iowa 50011 515-294-2680 U.S. Department of Energy Argonne National Laboratory (East) 9700 S. Cass Avenue Argonne, IL 60439 630-252-2000 U.S. Department of Energy Argonne National Laboratory (West) P.O. Box 2528 Idaho Fall, ID 83403-2528 208-533-7341 U.S. Department of Energy Bettis Atomic Power Laboratory, Bechtel Bettis, Inc. 814 Pittsburgh McKeesport Boulevard West Mifflin, PA 15122-0079 412-476-5000 U.S. Department of Energy


Secretary Bodman Addresses IAEA General Conference in Vienna | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretary Bodman Addresses IAEA General Conference in Vienna Secretary Bodman Addresses IAEA General Conference in Vienna Secretary Bodman Addresses IAEA General Conference in Vienna September 18, 2006 - 8:53am Addthis Highlights President Bush's global initiatives to expand international access to nuclear energy and promote nonproliferation VIENNA, AUSTRIA - U.S. Secretary of Energy Samuel W. Bodman today discussed the need to further expand international cooperative work in safely expanding the use of nuclear energy as a clean and affordable energy source while strengthening nuclear nonproliferation in remarks he delivered to the 50th Annual International Atomic Energy Agency (IAEA) General Conference in Vienna, Austria. "As an international community, we must work together to globally expand clean, reliable, and affordable nuclear energy in ways that reduce


Using DISE to Protect Return Addresses from Attack  

E-Print Network (OSTI)

Stack-smashing by buffer overflow is a common tactic used by viruses and worms to crash or hijack systems. Exploiting a bounds-unchecked copy into a stack buffer, an attacker can---by supplying a specially-crafted and unexpectedly long input--- overwrite a stored return address and trigger the execution of code of her choosing. In this paper, we propose to protect code from this common form of attack using dynamic instruction stream editing (DISE), a previously proposed hardware mechanism that implements binary rewriting in a transparent, efficient, and convenient way by rewriting the dynamic instruction stream rather than the static executable. Simply, we define productions (rewriting rules) that instrument program calls and returns to maintain and verify a "shadow" stack of return addresses in a protected region of memory. When invalid return addresses are detected, the application is terminated.

Marc Corliss Christopher; E Christopher; Lewis Amir Roth



Wind versus Biofuels for Addressing Climate, Health, and Energy  

DOE Green Energy (OSTI)

The favored approach today for addressing global warming is to promote a variety of options: biofuels, wind, solar thermal, solar photovoltaic, geothermal, hydroelectric, and nuclear energy and to improve efficiency. However, by far, most emphasis has been on biofuels. It is shown here, though, that current-technology biofuels cannot address global warming and may slightly increase death and illness due to ozone-related air pollution. Future biofuels may theoretically slow global warming, but only temporarily and with the cost of increased air pollution mortality. In both cases, the land required renders biofuels an impractical solution. Recent measurements and statistical analyses of U.S. and world wind power carried out at Stanford University suggest that wind combined with other options can substantially address global warming, air pollution mortality, and energy needs simultaneously.

Jacobson, Mark Z.



Secretary Bodman Addresses Turkmenistan Industrial Oil and Gas Exhibition |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretary Bodman Addresses Turkmenistan Industrial Oil and Gas Secretary Bodman Addresses Turkmenistan Industrial Oil and Gas Exhibition Secretary Bodman Addresses Turkmenistan Industrial Oil and Gas Exhibition November 16, 2007 - 4:31pm Addthis Holds Bilateral Discussion with President of Turkmenistan on Opening of Markets, Increased Investment, and Multiple Trade Routes ASHGABAT, TURKMENISTAN - U.S. Secretary of Energy Samuel W. Bodman today held bilateral energy discussions with the President of Turkmenistan and other senior Turkmenistan officials and delivered remarks to the Turkmenistan Industrial Oil and Gas Exhibition. Secretary Bodman highlighted the role of international investment in developing Turkmenistan's vast resources and expanding infrastructure. He also discussed the importance of establishing a stable and transparent


Students Innovate to Address Gas Shortages Following Hurricane Sandy |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Innovate to Address Gas Shortages Following Hurricane Innovate to Address Gas Shortages Following Hurricane Sandy Students Innovate to Address Gas Shortages Following Hurricane Sandy November 9, 2012 - 3:43pm Addthis Franklin High School students working on their online map of gas and charging stations. | Photo courtesy Dayana Bustamante Franklin High School students working on their online map of gas and charging stations. | Photo courtesy Dayana Bustamante Bob Brese Bob Brese Chief Information Officer Ian Kalin Director of the Energy Data Initiative What are the key facts? Students in New Jersey are using open data and online maps to support their community in the aftermath of Hurricane Sandy. As part of our efforts in helping with Hurricane Sandy restoration efforts, the Energy Department is working closely with other federal partners, state


Policy Agenda for Addressing Climate Change in Bangladesh: Copenhagen and  

Open Energy Info (EERE)

for Addressing Climate Change in Bangladesh: Copenhagen and for Addressing Climate Change in Bangladesh: Copenhagen and Beyond Jump to: navigation, search Name Policy Agenda for Addressing Climate Change in Bangladesh: Copenhagen and Beyond Agency/Company /Organization United Nations Environment Programme, Centre for Policy Dialogue Sector Energy, Land Topics Implementation, GHG inventory, Policies/deployment programs, Pathways analysis, Background analysis Resource Type Presentation Website http://www.indiaenvironmentpor Program Start 2009 Country Bangladesh UN Region South-Eastern Asia References Policy Agenda: Bangladesh[1] Overview "Dialogue and carbon dioxide from the atmosphere The Fourth Assessment Report (AR4) of the Intergovernmental Panel on Climate Change(IPCC) gives detailed projections for the 21st century These


Interagency Collaboration to Address Environmental Impacts of Shale Gas  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Interagency Collaboration to Address Environmental Impacts of Shale Interagency Collaboration to Address Environmental Impacts of Shale Gas Drilling Interagency Collaboration to Address Environmental Impacts of Shale Gas Drilling April 23, 2013 - 12:06pm Addthis Dr. John Howard (right), Director of NIOSH and Dr. Anthony Cugini (left), Director of NETL announced the establishment of a research partnership to evaluate the environmental impacts of shale gas drilling. Dr. John Howard (right), Director of NIOSH and Dr. Anthony Cugini (left), Director of NETL announced the establishment of a research partnership to evaluate the environmental impacts of shale gas drilling. Washington, DC - A memorandum of understanding to perform collaborative research related to airborne emissions and air quality at natural gas drilling sites has been signed by the Office of Fossil Energy's National


The Jamming point street-lamp in the world of granular media  

E-Print Network (OSTI)

The Jamming of soft spheres at zero temperature, the J-point, has been extensively studied both numerically and theoretically and can now be considered as a safe location in the space of models, where a street lamp has been lit up. However, a recent work by Ikeda et al, 2013 reveals that, in the Temperature/Packing fraction parameter space, experiments on colloids are actually rather far away from the scaling regime illuminated by this lamp. Is it that the J-point has little to say about real system? What about granular media? Such a-thermal, frictional, systems are a-priori even further away from the idealized case of thermal soft spheres. In the past ten years, we have systematically investigated horizontally shaken grains in the vicinity of the Jamming transition. We discuss the above issue in the light of very recent experimental results. First, we demonstrate that the contact network exhibits a remarkable dynamics, with strong heterogeneities, which are maximum at a packing fraction phi star, distinct and smaller than the packing fraction phi dagger, where the average number of contact per particle starts to increase. The two cross-overs converge at point J in the zero mechanical excitation limit. Second, a careful analysis of the dynamics on time scales ranging from a minute fraction of the vibration cycle to several thousands of cycles allows us to map the behaviors of this shaken granular system onto those observed for thermal soft spheres and demonstrate that some light of the J-point street-lamp indeed reaches the granular universe.

Corentin Coulais; Robert P. Behringer; Olivier Dauchot



Addressing Policy and Logistical Challenges to Smart Grid Implementation:  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Smart Grid Smart Grid Implementation: Comments by the Office of the Ohio Consumers' Counsel Addressing Policy and Logistical Challenges to Smart Grid Implementation: Comments by the Office of the Ohio Consumers' Counsel The Office of the Ohio Consumers' Counsel ("OCC") hereby submits the following comments in response to the United States Department of Energy ("DOE") Request for Information ("RFI") entitled "Addressing Policy and Logistical Challenges to Smart Grid Implementation" See 75 Fed. Reg. 57006 (September 17, 201 0). The RFI requests comments and information from interested parties to assist DOE in understanding "policy and logistical challenges that confront smart grid implementation, as well as recommendations on how to best overcome those challenges."


STATE OF CALIFORNIA --THE RESOURCES PROVIDER Edmund G. Brown Jr., Governor CALIFORNIA ENERGY COMMISSION 1516 Ninth Street Sacramento, California 95814  

E-Print Network (OSTI)

electronically, on paper, and orally at Energy Commission hearings. A. A Brief History of the Energy Commission1 STATE OF CALIFORNIA -- THE RESOURCES PROVIDER Edmund G. Brown Jr., Governor CALIFORNIA ENERGY COMMISSION 1516 Ninth Street Sacramento, California 95814 Main website: www.energy.ca.gov INITIAL STATEMENT


Numerical model to characterize the thermal comfort in new ecodistricts: methodology and validation through the canyon street case  

Science Conference Proceedings (OSTI)

In built-up areas, the urban structures affect the radiative and thermal environment. The numerical simulation models provide informations about urban thermal performance for many ranges of urban configurations. This paper presents a validation of a ... Keywords: CFD model, building heat transfers, coupling model, street canyon, thermo-radiative model

Khaled Athamena; Jean Francois Sini; Julien Guilhot; Jerome Vinet; Maeva Sabre; Jean-Michel Rosant



Numerical model to characterize the thermal comfort in new eco-districts: methodology and validation through the canyon street case  

Science Conference Proceedings (OSTI)

In built-up areas, the urban structures affect the radiative and thermal environment. The numerical simulation models provide informations about urban thermal performance for many ranges of urban configurations. This paper presents a validation of a ... Keywords: CFD model, building heat transfers, coupling model, street canyon, thermo-radiative model

Khaled Athamena; Jean Francois Sini; Julien Guilhot; Jerome Vinet; Maeva Sabre; Jean-Michel Rosant



Indonesia National Action Plan Addressing Climate Change | Open Energy  

Open Energy Info (EERE)

Indonesia National Action Plan Addressing Climate Change Indonesia National Action Plan Addressing Climate Change Jump to: navigation, search Tool Summary Name: Indonesia National Action Plan Addressing Climate Change Agency/Company /Organization: Indonesia State Ministry of Environment Sector: Energy, Land Topics: Background analysis, Low emission development planning Resource Type: Case studies/examples, Publications Website: climatechange.menlh.go.id/index.php?option=com_docman&task=down&bid=17 Country: Indonesia South-Eastern Asia Coordinates: -0.789275°, 113.921327° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-0.789275,"lon":113.921327,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Workshop: Analysis and Concepts to Address Electric Infrastructure Needs  

E-Print Network (OSTI)

Organization Email Address 1. Marshall Reed DOE marshall.reed@ee.doe.gov 2. Jim Daley DOE james ORNL feenstrar@ornl.gov 12. Bob Hawsey ORNL hawseyra@ornl.gov 13. Paul Carrier DOE/Policy paul.carrier@hq.doe.gov 14. Cathy Tripodi DOE/Secretary Office cathy.tripodi@hq.doe.gov 15. Brian Newnam LANL bnewnam


Better I/O through byte-addressable, persistent memory  

Science Conference Proceedings (OSTI)

Modern computer systems have been built around the assumption that persistent storage is accessed via a slow, block-based interface. However, new byte-addressable, persistent memory technologies such as phase change memory (PCM) offer fast, fine-grained ... Keywords: file systems, performance, phase change memory

Jeremy Condit; Edmund B. Nightingale; Christopher Frost; Engin Ipek; Benjamin Lee; Doug Burger; Derrick Coetzee



Distribution of goals addressed to a group of agents  

Science Conference Proceedings (OSTI)

The problem investigated in this paper is the distribution of goals addressed to a group of rational agents. Those agents are characterized by their ability (i.e. what they can do), their knowledge about the world and their commitments.The goals of the ... Keywords: goal selection, modal logic, multiagent systems, qualitative decision theory, theories of rational agency

Laurence Cholvy; Christophe Garion



HVAC System Design Strategies to Address Indoor Air Quality Standards  

Science Conference Proceedings (OSTI)

This report describes strategies that can be employed in the design and operation of heating, ventilating, and air conditioning (HVAC) systems to address the ASHRAE Standard 62 "Ventilation for Acceptable Indoor Air Quality" requirements. The report examines a wide variety of approaches to meeting the standard and their impact on energy consumption, occupant comfort, and other factors.


Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Evolution of internet address space deaggregation: myths and reality  

Science Conference Proceedings (OSTI)

Internet routing table size growth and BGP update churn are two prominent Internet scaling issues. There is widespread belief in a high and fast growing number of ASs that deaggregate prefixes, e.g., due to multi-homing and for the purpose of traffic ... Keywords: address deaggregation, routing table growth, traffic engineering, update churn

Luca Cittadini; Wolfgang Muhlbauer; Steve Uhlig; Randy Bush; Pierre Francois; Olaf Maennel



File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



Measurement of genotoxic air pollutant exposures in street vendors and school children in and near Bangkok  

SciTech Connect

The effects of air pollution on human health are a great concern, particularly in big cities with severe traffic problems such as Bangkok, Thailand. In this study, exposure to genotoxic compounds in ambient air was studied by analysis of particle-associated polycyclic aromatic hydrocarbons (PAHs) and benzene through direct measurement of concentrations in air as well as through the use of different biomarkers of exposure: urinary 1-hydroxypyrene (1-OHP) for PAHs and urinary t,t-muconic acid (t,t-MA) for benzene. The study was conducted in various susceptible groups of the population with different occupations in 5 traffic-congested areas of Bangkok, as well as in primary school children. The level of total PAHs on the main roads at various sites ranged from 7.10 to 83.04 ng/m{sup 3}, while benzene levels ranged from 16.35 to 49.25 ppb. In contrast, ambient levels in nearby temples, the control sites, ranged from 1.67 to 3.04 ng/m{sup 3} total PAHs and 10.16 to 16.25 ppb benzene. Street vendors selling clothes were exposed to 16.07 {+-} 1.64 ng/m{sup 3} total PAHs and 21.97 {+-} 1.50 ppb benzene, levels higher than in monks and nuns residing in nearby temples (5.34 {+-} 0.65 ng/m{sup 3} total PAHs and 13.69 {+-} 0.77 ppb benzene). Grilled-meat vendors in the same area were exposed to both total PAHs and benzene at even higher levels, possibly due to additional formation of PAHs during the grilling of meat (34.27 {+-} 7.02 ng/m{sup 3} total PAHs; 27.49 {+-} 2.72 ppb benzene). At the end of the workday, urinary 1-OHP levels in street vendors (0.12 and 0.15 {mu}mol/mol creatinine in clothes and grilled-meat vendors, respectively) were significantly higher than in controls (0.04 {mu}mol/mol creatinine; P < 0.01). Afternoon urinary t,t-MA levels in both groups of street vendors (0.12 mg/g creatinine) were also significantly higher than in controls (0.08 mg/g creatinine; P < 0.05). School children from two schools in Bangkok were exposed to total PAHs and benzene at levels of 6.70 {+-} 0.47 ng/m{sup 3} and 4.71 {+-} 0.25 ppb, respectively, higher than those to which children living outside the city were exposed (1.25 {+-} 0.24 ng/m{sup 3} total PAHs; 2.10 {+-} 0.16 ppb benzene). At the end of the school day, levels of urinary 1-OHP and t,t-MA were significantly higher (P < 0.001 and P < 0.01, respectively) in Bangkok school children (0.23 {mu}mol/mol creatinine and 0.27 mg/g creatinine, respectively) than in school children from outside Bangkok (0.10 {mu}mol/mol creatinine and 0.08 mg/g creatinine, respectively)

Ruchirawat, Mathuros [Laboratory of Environmental Toxicology, Chulabhorn Research Institute, Bangkok 10210 (Thailand) and Department of Pharmacology, Faculty of Science, Mahidol University, Bangkok 10400 (Thailand)]. E-mail: mathuros@tubtim.cri.or.th; Navasumrit, Panida [Laboratory of Environmental Toxicology, Chulabhorn Research Institute, Bangkok 10210 (Thailand); Settachan, Daam [Laboratory of Environmental Toxicology, Chulabhorn Research Institute, Bangkok 10210 (Thailand); Tuntaviroon, Jantamas [Laboratory of Environmental Toxicology, Chulabhorn Research Institute, Bangkok 10210 (Thailand); Buthbumrung, Nantaporn [Laboratory of Environmental Toxicology, Chulabhorn Research Institute, Bangkok 10210 (Thailand); Sharma, Suman [Laboratory of Environmental Toxicology, Chulabhorn Research Institute, Bangkok 10210 (Thailand)



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Addressing Policy and Logistical Challenges to smart grid Implementation:  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

smart grid smart grid Implementation: eMeter Response to Department of Energy RFI Addressing Policy and Logistical Challenges to smart grid Implementation: eMeter Response to Department of Energy RFI eMeter is a smart grid software company that provides smart network application platform (SNAP) software to integrate smart meters and smart grid communications networks and devices with utility IT systems. eMeter also provides smart grid application software such as meter data management (MDM) and consumer engagement software. Being vendor-neutral toward all meter, hardware, and legacy utility software systems (e.g. CIS and Billing), eMeter has a unique, unbiased and global perspective on smart grid IT issues. Addressing Policy and Logistical Challenges to smart grid Implementation:


Addressing Complexity In Laboratory Experiments- The Scaling Of Dilute  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » Addressing Complexity In Laboratory Experiments- The Scaling Of Dilute Multiphase Flows In Magmatic Systems Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: Addressing Complexity In Laboratory Experiments- The Scaling Of Dilute Multiphase Flows In Magmatic Systems Details Activities (0) Areas (0) Regions (0) Abstract: The kinematic and dynamic scaling of dilute multiphase mixtures in magmatic systems is the only guarantee for the geological verisimilitude of laboratory experiments. We present scaling relations that can provide a more complete framework to scale dilute magmatic systems because they


Address (Smart Grid Project) (France) | Open Energy Information  

Open Energy Info (EERE)

France) France) Jump to: navigation, search Project Name Address Country France Coordinates 46.073231°, 2.427979° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.073231,"lon":2.427979,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Addressing Policy and Logistical Challenges to Smart Grid Implementation  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Before the Before the Department of Energy Washington, D.C. 20585 In the Matter of Addressing Policy and Logistical Challenges to Smart Grid Implementation Smart Grid RFI: Addressing Policy and Logistical Challenges COMMENTS OF BALTIMORE GAS & ELECTRIC COMPANY I. Introduction BGE is the nation's oldest utility company. It has met the energy needs of Central Maryland for nearly 200 years. Today, it serves more than 1.2 million business and residential electric customers and approximately 650,000 gas customers in an economically diverse, 2,300- square-mile area encompassing Baltimore City and all or part of 10 central Maryland counties. BGE already has many systems that it considers to be "smart." For example:


Address (Smart Grid Project) (Italy) | Open Energy Information  

Open Energy Info (EERE)

Italy) Italy) Jump to: navigation, search Project Name Address Country Italy Coordinates 41.746727°, 12.052002° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.746727,"lon":12.052002,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Secretary Chu's Nobel Prize Winning Research Unexpectedly Addressing  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretary Chu's Nobel Prize Winning Research Unexpectedly Secretary Chu's Nobel Prize Winning Research Unexpectedly Addressing Global Water Challenge Secretary Chu's Nobel Prize Winning Research Unexpectedly Addressing Global Water Challenge September 22, 2011 - 2:41pm Addthis Secretary Chu participating at the recent International Atomic Energy Agency (IAEA) Scientific Forum in Vienna, Austria | Photo courtesy of Dean Calma/IAEA Secretary Chu participating at the recent International Atomic Energy Agency (IAEA) Scientific Forum in Vienna, Austria | Photo courtesy of Dean Calma/IAEA Keri Fulton Public Affairs Specialist, Office of Public Affairs Decades ago, Steven Chu, a young researcher at Bell Labs working on atomic physics, developed a method to use lasers to trap individual atoms. In 1997, he was awarded the Nobel Prize in Physics for this research.


Secretary Chu's Nobel Prize Winning Research Unexpectedly Addressing  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretary Chu's Nobel Prize Winning Research Unexpectedly Secretary Chu's Nobel Prize Winning Research Unexpectedly Addressing Global Water Challenge Secretary Chu's Nobel Prize Winning Research Unexpectedly Addressing Global Water Challenge September 22, 2011 - 2:41pm Addthis Secretary Chu participating at the recent International Atomic Energy Agency (IAEA) Scientific Forum in Vienna, Austria | Photo courtesy of Dean Calma/IAEA Secretary Chu participating at the recent International Atomic Energy Agency (IAEA) Scientific Forum in Vienna, Austria | Photo courtesy of Dean Calma/IAEA Keri Fulton Public Affairs Specialist, Office of Public Affairs Decades ago, Steven Chu, a young researcher at Bell Labs working on atomic physics, developed a method to use lasers to trap individual atoms. In 1997, he was awarded the Nobel Prize in Physics for this research.


Smart Grid RFI: Addressing Policy and Logistical Challenges. Comments of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Challenges. Challenges. Comments of the Alliance to Save Energy. Smart Grid RFI: Addressing Policy and Logistical Challenges. Comments of the Alliance to Save Energy. The Alliance to Save Energy is a coalition of prominent business, government, environmental, and consumer leaders who promote the efficient use of energy worldwide to benefit consumers, the environment, economy, and national security. The Alliance to Save Energy (the Alliance) thanks the Department of Energy for the opportunity to comment on broad issues of policy and logistical challenges faced in smart grid implementation. Smart Grid RFI: Addressing Policy and Logistical Challenges. Comments of the Alliance to Save Energy. More Documents & Publications DC OPC Comments. September 17, 2010 Comments of the National Rural Electric Cooperative Association, Request


Plan for addressing issues relating to oil shale plant siting  

SciTech Connect

The Western Research Institute plan for addressing oil shale plant siting methodology calls for identifying the available resources such as oil shale, water, topography and transportation, and human resources. Restrictions on development are addressed: land ownership, land use, water rights, environment, socioeconomics, culture, health and safety, and other institutional restrictions. Descriptions of the technologies for development of oil shale resources are included. The impacts of oil shale development on the environment, socioeconomic structure, water availability, and other conditions are discussed. Finally, the Western Research Institute plan proposes to integrate these topics to develop a flow chart for oil shale plant siting. Western Research Institute has (1) identified relative topics for shale oil plant siting, (2) surveyed both published and unpublished information, and (3) identified data gaps and research needs. 910 refs., 3 figs., 30 tabs.

Noridin, J.S.; Donovan, R.; Trudell, L.; Dean, J.; Blevins, A.; Harrington, L.W.; James, R.; Berdan, G.



Address (Smart Grid Project) (SVEZIA) | Open Energy Information  

Open Energy Info (EERE)

SVEZIA) SVEZIA) Jump to: navigation, search Project Name Address Country SVEZIA Coordinates 60.128162°, 18.643501° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":60.128162,"lon":18.643501,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Street science : the fusing of local and professional knowledge in environmental policy  

E-Print Network (OSTI)

his dissertation analyzes how local knowledge improves environmental decisions. The premise is that controlling pollution and addressing public health disparities are not problems that professionals alone can solve. Concerned ...

Coburn, Jason



Reservoir technology research at LBL addressing geysers issues  

DOE Green Energy (OSTI)

The Geothermal Technology Division of the Department of Energy is redirecting a significant part of its Reservoir Technology funding to study problems now being experienced at The Geysers. These include excessive pressure drawdown and associated decline in well flow rates, corrosion due to high chloride concentration in the produced steam and high concentration of noncondensible gases in some parts of the field. Lawrence Berkeley Laboratory (LBL) is addressing some of these problems through field, laboratory and theoretical studies. 11 refs., 6 figs.

Lippmann, M.J.; Bodvarsson, G.S.



Guidelines for Addressing Environmental Effects in Fatigue Usage Calculations  

Science Conference Proceedings (OSTI)

Requirements by the U.S. Nuclear Regulatory Commission (NRC) to address reactor water environmental effects on fatigue of class 1 reactor pressure boundary components in license renewal evaluations and for new plants have led to the development of American Society of Mechanical Engineers (ASME) Code Cases designed to provide rules for such evaluations. This report describes the results of efforts by industry participants to complete two sample fatigue evaluations according to the rules of ASME Code ...



Writing on the Streets: Popular Literature and the Bad Black Hero  

E-Print Network (OSTI)

This dissertation examines the various ways in which pop-cultural illustrations of the bad nigger figure beginning in the late 1960s helped to shape the kinds of defiant and oppositional practices that define the lives of black male youths today. I offer a brief history of the cultural and literary trope of the so-called bad nigger. I not only chart the cultural and political expressions of the bad nigger trope from the antebellum South to the industrial North, I also offer a critique of these accounts of defiant black male behavior that have dominated much of the intellectual discourse. Writing on the Streets: Urban Literatures Black Male Hero does not pretend that the struggles of poor black inner-city life are somehow romantic or dramatic. What this dissertation does do, however, is offer popular black male cultural productions as a new critical site for engaging the cultural politics of economic power and racial oppression. Much of the scholarship on black male youth culture fails to engage popular texts that respond to black peoples negotiation of global issues. The works that do engage popular expressions and cultural productions often underestimate the importance violence, defiance, and opposition plays in the construction of a black male identity, not just for poor urban black male youths, but for men of color in general. Thus, this dissertation intends to magnify the need for more critical inquiry into popular cultural productions such as street literature and rap music, both of which contain poetic as well as practical elements of community uplift and self-empowerment and engage issues of cultural nihilism and self-destruction. This projects focus on non-canonical texts follows bell hooks methodology and whose intellectual philosophy argues for learning in relation to living regular life, of using everything we already know to know more. Merging critical thinking in everyday life with knowledge learned in books and through study has been the union of theory and practice that has informed my intellectual cultural work (hooks 2). My hope, therefore, is that the readings I offer here will open the possibility for scholars and students of literature to consider more earnestly the importance of popular cultural productions in black communities. Furthermore, I write this dissertation in an effort to convince cultural and literary critics to concern themselves with the unique history and plight of poor urban black males confronting oppression and struggling in this criminal society.

Winston, Dennis 1979-



Superfund Record of Decision (EPA Region 2): Grand Street Mercury Site, Hoboken, NJ, September 30, 1997  

SciTech Connect

This Record of Decision presents the selected remedial action for the Grand Street Mercury Site. The major components of the selected remedy include: permanent relocation of the former residents of the Site; continuation of temporary relocation of the former residents until permanent relocation has been implemented; historic preservation mitigation measures for the buildings at the Site, as appropriate; gross mercury decontamination of the buildings at the Site including recovery of available mercury, whenever possible; identification and abatement of asbestos in the buildings at the Site; removal and recovery of reusable fixtures, appliances, and recyclable scrap metal and other building components; demolition of the two buildings at the Site using measures to minimize releases of mercury into the environment; removal and off-site disposal of all demolition debris at EPA-approved facilities; sampling of soils at the Site; excavation and off-site disposal of contaminated soils at EPA-approved facilities; sampling of soils at off-site adjacent locations; sampling of groundwater at the Site; and assessment of off-site soil and groundwater data to evaluate the need for future remedial action.


Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Results of the radiological and beryllium verification survey at the Peek Street Site, Schenectady, New York (SY001V)  

Science Conference Proceedings (OSTI)

At the request of the U.S. Department of Energy (DOE), a team from Oak Ridge National Laboratory conducted an independent verification radiological and non-radioactive beryllium survey at the Peek Street site, located at 425 Peek Street, Schenectady, New York. The purpose of the survey, conducted during 1993 and continuing through January 1994, was to confirm the success of the remedial actions performed to remove any beryllium concentrations or radioactive materials in excess of the identified guidelines. The verification survey included surface gamma scans and gamma readings at one meter indoors and outdoors, alpha and beta scans inside the structure, and the collection of soil, dust and debris samples and smears for radionuclide and beryllium analyses. Results of the survey demonstrated that all radiological and beryllium measurements on the property were within applicable DOE guidelines. Based on all data collected, the industrial property at 425 Peek Street and the adjacent state-owned bike path in Schenectady, New York, conforms to all applicable radiological and non-radioactive beryllium guidelines established for this site by DOE and approved by the State of New York.

Foley, R.D.; Johnson, C.A.; Carrier, R.F.; Allred, J.F.



Addressing questions about including environmental effects in the DMSO HLA  

SciTech Connect

The Defense Modeling and Simulation Office (DMSO) is developing a High Level Architecture (HLA) to support the DOD Modeling and Simulation (M and S) community. Many, if not all, of the simulations involve the environment in some fashion. In some applications, the simulation takes place in an acknowledged environment without any environmental functionality being taken into account. The Joint Training Federation Prototype (JTFp) is one of several prototype efforts that have been created to provide a test of the DMSO HLA. In addition to addressing the applicability of the HLA to a training community, the JTFp is also one of two prototype efforts that is explicitly including environmental effects in their simulation effort. These two prototyping efforts are examining the issues associated with the inclusion of the environment in an HLA federation. In deciding whether or not to include an environmental federation in the JTFp effort, a number of questions have been raised about the environment and the HLA. These questions have raised the issue of incompatibility between the environment and the HLA and also shown that there is something unique about including the environment in simulations. The purpose of this White Paper, which was developed with inputs from the National Air and Space [Warfare] Model Program among others, is to address the various questions that have been posed about including environmental effects in an HLA simulation.

Hummel, J.R.



Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



Accommodate street vendors during the urban development process : with two empirical cases of Zhu Lian (ZL), and Guan Dong (GD) public markets in Hsinchu City, Taiwan  

E-Print Network (OSTI)

Every day, the recurring scene of conflict between street vendors and municipal authorities can be found in virtually every major city around the world. Through licensing, zoning, or relocating, municipal governments devise ...

Weng, Chia Yang



Comparing Light-Emitting Diode (LED) Street and Area Lighting to Traditional Lighting Technologies: Assessing LED Performance at Gul f Power in Pensacola, Florida  

Science Conference Proceedings (OSTI)

Manufacturing advances have now made the use of light-emitting diode (LED) technology practical for street and area lighting. To better understand the application, the Electric Power research Institute (EPRI teamed with Southern Company and Gulf Power to install LED street lights at a demonstration site and measure the performance. The data showed several disadvantages such as a lower efficacy compared to traditional technology and lower immunity to electrical disturbances, but advantages in energy savin...



NETL: News Release - Fuel Cell Projects Address Barriers to  

NLE Websites -- All DOE Office Websites (Extended Search)

June 1, 2006 June 1, 2006 Fuel Cell Projects Address Barriers to Commercialization Six Projects Focus on Improvements to Materials, Key Components WASHINGTON, DC - The Department of Energy today announced the selection of six research and development (R&D) projects expected to further enhance solid-oxide fuel cell (SOFC) technology, moving it one step closer to commercialization. These projects, part of DOE's Solid State Energy Conversion Alliance (SECA), build upon earlier Phase I research to support the development of efficient, low-cost and near-zero emissions SOFC power systems. "The projects selected reflect yet another step forward in the President's Hydrogen and Climate Initiatives, which envision a key role for fuel cells," said Jeffrey Jarrett, Assistant Secretary for Fossil Energy. "These projects are expected to further push fuel cell technology toward the ultimate application of fuel cells in FutureGen, the zero-emissions coal-fired plant of the future."


Smart Grid RFI: Addressing Policy and Logistical Challenges  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Electricity Delivery and Energy Reliability Electricity Delivery and Energy Reliability 1000 Independence Avenue, SW Room 8H033 Washington, DC 20585 Submitted electronically via smartgridpolicy@hq.doe.gov Smart Grid Request for Information: Addressing Policy and Logistical Challenges Comments of the Alliance to Save Energy The Alliance to Save Energy (the Alliance) thanks the Department of Energy for the opportunity to comment on broad issues of policy and logistical challenges faced in smart grid implementation. The Alliance to Save Energy is a coalition of prominent business, government, environmental, and consumer leaders who promote the efficient use of energy worldwide to benefit consumers, the environment, economy, and national security. The Alliance is a nonprofit 501 (c) (3) organization.


Western Wind Strategy: Addressing Critical Issues for Wind Deployment  

DOE Green Energy (OSTI)

The goal of the Western Wind Strategy project was to help remove critical barriers to wind development in the Western Interconnection. The four stated objectives of this project were to: (1) identify the barriers, particularly barriers to the operational integration of renewables and barriers identified by load-serving entities (LSEs) that will be buying wind generation, (2) communicate the barriers to state officials, (3) create a collaborative process to address those barriers with the Western states, utilities and the renewable industry, and (4) provide a role model for other regions. The project has been on the forefront of identifying and informing state policy makers and utility regulators of critical issues related to wind energy and the integration of variable generation. The project has been a critical component in the efforts of states to push forward important reforms and innovations that will enable states to meet their renewable energy goals and lower the cost to consumers of integrating variable generation.

Douglas Larson; Thomas Carr



U-115: Novell GroupWise Client Address Book Processing Buffer...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Other Agencies You are here Home U-115: Novell GroupWise Client Address Book Processing Buffer Overflow Vulnerability U-115: Novell GroupWise Client Address Book...


Addressing the Need for Independence in the CSE Model  

SciTech Connect

Abstract Information system security risk, defined as the product of the monetary losses associated with security incidents and the probability that they occur, is a suitable decision criterion when considering different information system architectures. Risk assessment is the widely accepted process used to understand, quantify, and document the effects of undesirable events on organizational objectives so that risk management, continuity of operations planning, and contingency planning can be performed. One technique, the Cyberspace Security Econometrics System (CSES), is a methodology for estimating security costs to stakeholders as a function of possible risk postures. In earlier works, we presented a computational infrastructure that allows an analyst to estimate the security of a system in terms of the loss that each stakeholder stands to sustain, as a result of security breakdowns. Additional work has applied CSES to specific business cases. The current state-of-the-art of CSES addresses independent events. In typical usage, analysts create matrices that capture their expert opinion, and then use those matrices to quantify costs to stakeholders. This expansion generalizes CSES to the common real-world case where events may be dependent.

Abercrombie, Robert K [ORNL; Ferragut, Erik M [ORNL; Sheldon, Frederick T [ORNL; Grimaila, Michael R [ORNL



Software programs that address site-specific inventory characteristics issues.  

Science Conference Proceedings (OSTI)

The proper characterization of Hazardous, Mixed Low-Level, and Mixed Transuranic waste enhances productivity and safety. Hazardous material criteria that need to be considered include physical and health hazards inherent to the waste stream. Other factors that may influence characterization include: particulate diameter, complexing or chelating agent properties, lead, and mercury content, pressurized containers, and P-listed wastes. To meet these requirements are only a simple matter of generating a database with the proper fields. Manufactures and institutional databases bank huge sources of information, such as, work control documents, substance identification, container types, components of mixtures, physical property data, and regulatory data. In this report, utilization of commercially available software programs to take advantage of these resources in addressing waste characterization issues are presented. The application of user-friendly programs eliminates part of the tediousness associated with the complex requirements of certifying to general waste acceptance criteria with minimal impact on programmatic work. In other words, tapping into manufacturer and institutional database provides a way to take advantage of the combined expertise of these resources in managing a cost effective waste certification program as well as adding a quality assurance element to the program.

Dare, J. H. (Jeffrey H.); Cournoyer, M. E. (Cournoyer, Michael E.)



Strategies to address transition costs in the electricity industry  

SciTech Connect

Transition costs are the potential monetary losses that electric- utility shareholders, ratepayers, or other parties might experience because of structural changes in the electricity industry. Regulators, policy analysts, utilities, and consumer groups have proposed a number of strategies to address transition costs, such as immediately opening retail electricity markets or delaying retail competition. This report has 3 objectives: identify a wide range of strategies available to regulators and utilities; systematically examine effects of strategies; and identify potentially promising strategies that may provide benefits to more than one set of stakeholders. The many individual strategies are grouped into 6 major categories: market actions, depreciation options, rate-making actions, utility cost reductions, tax measures, and other options. Of the 34 individual strategies, retail ratepayers have primary or secondary responsibility for paying transition costs in 19 of the strategies, shareholders in 12, wheeling customers in 11, taxpayers in 8, and nonutility suppliers in 4. Most of the strategies shift costs among different segments of the economy, although utility cost reductions can be used to offset transition costs. Most of the strategies require cooperation of other parties, including regulators, to be implemented successfully; financial stakeholders must be engages in negotiations that hold the promise of shared benefits. Only by rejecting ``winner-take-all`` strategies will the transition-cost issue be expeditiously resolved.

Baxter, L.; Hadley, S.; Hirst, E.



U.S. Army Corps of Engineers Buffalo District Office 1776 Niagara Street, Buffalo, New York, 14207  

Office of Legacy Management (LM)

Army Corps of Engineers Army Corps of Engineers Buffalo District Office 1776 Niagara Street, Buffalo, New York, 14207 Explanation of Significant Differences for the Rattlesnake Creek Portion of the Ashland Sites Tonawanda, New York September 20, 2004 Formerly Utilized Sites Remedial Action Program Explanation of Significant Differences for the Rattlesnake Creek Portion of the Ashland Sites Table of Contents I. INTRODUCTION 1 II. SITE mSTORY, CONTAMINATION AND SELECTED REMEDy 2 A. Site History 2 B. Original Remedy 3 III. BASIS FOR TmS DOCUMENT.................................*...................*..........*................*.**** 3 A. Summary of Additional Information 3 B. References 4 IV. DESCRIPTION OF SIGNIFICANT DIFFERENCES 4 V. SUPPORT AGENCY COMMENTS 5 VI. STATUTORY DETERMINATIONS 5


IPv6 stateless address autoconfiguration: balancing between security, privacy and usability  

Science Conference Proceedings (OSTI)

Included in the IPv6 suite is a method for devices to automatically configure their own addresses in a secure manner. This technique is called Cryptographically Generated Addresses (CGAs). CGA provides the ownership proof necessary for an IPv6 address ... Keywords: IPv6 address autoconfiguration, IPv6 security, users' privacy

Ahmad AlSa'deh, Hosnieh Rafiee, Christoph Meinel



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


n a jam-packed Assembly Hall on January 21, New York State Attorney General Eliot Spitzer addressed 1,270 graduates and  

E-Print Network (OSTI)

;FORWARD Four Decades of Takin' it to the Streets In 1976, I was in 9th grade and working as a dishwasher

Qiu, Weigang


3610 N. 44th Street, Suite 250, Phoenix, AZ 85018 ● Phone 602-808-2004 ●  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

10 N. 44th Street, Suite 250, Phoenix, AZ 85018 ● Phone 602-808-2004 ● Fax 602-808-2099 ● www.sunzia.net 10 N. 44th Street, Suite 250, Phoenix, AZ 85018 ● Phone 602-808-2004 ● Fax 602-808-2099 ● www.sunzia.net October 17, 2013 Transmitted via electronic mail to juliea.smith@hq.doe.gov and christopher.lawrence@hq.doe.gov Subject: SunZia Southwest Transmission Project comments on Department of Energy's August 29, 2013 Federal Register Notice regarding Improving Performance of Federal Permitting and Review of Infrastructure Projects. The following comments are provided to the Department of Energy (DOE) in response to the agency's request for information on (RFI) the draft Integrated Interagency Pre-Application (IIP) Process. These comments reflect the views and suggestions of the SunZia Southwest Transmission Project (SunZia). The Bureau of Land Management is the lead agency for processing our right-of-

Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


GridWise Alliance: Smart Grid RFI: Addressing Policy and Logistical...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

GridWise Alliance: Smart Grid RFI: Addressing Policy and Logistical Challenges GridWise Alliance: Smart Grid RFI: Addressing Policy and Logistical Challenges The GridWise Alliance...


1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society.  

NLE Websites -- All DOE Office Websites (Extended Search)

Chemical Society. Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties. Article Radical Coupling Reactions in Lignin Synthesis: A DFT study Amandeep Kaur Sangha, Jerry Matthew Parks, Robert F. Standaert, Angela Ziebell, Mark F Davis, and Jeremy C. Smith J. Phys. Chem. B, Just Accepted Manuscript * DOI: 10.1021/jp2122449 * Publication Date (Web): 04 Apr 2012 Downloaded from http://pubs.acs.org on April 10, 2012 Just Accepted "Just Accepted" manuscripts have been peer-reviewed and accepted for publication. They are posted


SNR Denton US LLP 1301 K Street, NW Suite 600, East Tower Washington, DC 20005-3364 USA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SNR Denton US LLP SNR Denton US LLP 1301 K Street, NW Suite 600, East Tower Washington, DC 20005-3364 USA Thomas C. Jensen Partner thomas.jensen@snrdenton.com D +1 202 408 3956 M 703 304 5211 T +1 202 408 6400 F +1 202 408 6399 snrdenton.com March 28, 2012 BY E-MAIL Lamont Jackson Office of Electricity Delivery and Energy Reliability Mail Code: OE-20 U.S. Department of Energy 1000 Independence Avenue SW Washington, DC 20585 Re: OE Docket No. RRTT-IR-001 Dear Mr. Jackson:: This letter is submitted on behalf of PPL Electric and Public Service Electric and Gas Company ("PSE&G") 1 ,(referred to herein as "the Companies") with respect to the Susquehanna-Roseland


Results of the radiological survey at Essex Street and State Route 17 (MJ036), Maywood, New Jersey  

SciTech Connect

As a result of the Energy and Water Appropriations Act of Fiscal Year 1984, the property discussed in this report and properties in its vicinity contaminated with residues from the former Maywood Chemical Works (MCW) were included as a decontamination research and development project under the DOE Formerly Utilized Sites Remedial Action Program. As part of this project, DOE is conducting radiological surveys in the vicinity of the site to identify properties contaminated with residues derived from the MCW. The principal radionuclide of concern is thorium-232. The radiological survey discussed in this report is part of that effort and was conducted, at the request of DOE, by members of the Measurement Applications and Development Group of the Oak Ridge National Laboratory. A radiological survey of the commercial property at Essex Street and State Route 17, Maywood, New Jersey, was conducted during 1987. 4 refs., 2 figs., 3 tabs.

Foley, R.D.; Crutcher, J.W.; Carrier, R.F.; Floyd, L.M.



Recommendations to Address Power Reliability Concerns Raised as a Result of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

to Address Power Reliability Concerns Raised as a to Address Power Reliability Concerns Raised as a Result of Pending Environmental Regulations for Electric Generation Stations Recommendations to Address Power Reliability Concerns Raised as a Result of Pending Environmental Regulations for Electric Generation Stations Memorandum from the Electricity Advisory Committee to Secretary Chu and Assistant Secretary Patricia Hoffman on recommendations to address power reliability concerns raised as a result of pending environmental regulations for electric generation stations. Recommendations to Address Power Reliability Concerns Raised as a Result of Pending Environmental Regulations for Electric Generation Stations More Documents & Publications DOE Response to EAC Recommendations - March 2012 Interdependence of Electricity System Infrastructure and Natural Gas


Medical, Dental & Vision Add/Drop Form Please return to: Postdoc Benefits Office, 320 Panama Street, Bambi Modular, Stanford, CA 94305-  

E-Print Network (OSTI)

Medical, Dental & Vision Add/Drop Form Please return to: Postdoc Benefits Office, 320 Panama Street Same Add Drop Medical EPO Medical PPO Dental PPO VSP Vision Postdoctoral Scholar Add Drop Medical EPO Medical PPO Dental PPO VSP Vision Spouse Domestic Partner Son Daughter Add Drop Medical EPO Medical PPO

Kay, Mark A.



E-Print Network (OSTI)

4240 Carson Street, Suite 102 Denver, CO 80239 www.sre3.com SOLAR ELECTRIC SOLAR WATER HEATING for homeowners, businesses, and government entities that assist them in lowering utility bills, reducing a unique solutions approach based on the RE3 concept, which includes: · Review ­ current energy usage

Colorado at Boulder, University of


46th Street Pilot Street Lighting Project  

E-Print Network (OSTI)

calculations (Electricity & Maintenance) n LED ­ 10 to 13 years n Induction ­ 3 to 4 years n Energy use-free operation (4 light failures ­ 1 to car wreck) #12;Findings ­ So Far n Light quality varies greatly

Minnesota, University of


Defeating Internet attacks and Spam using "disposable" Mobile IPv6 home addresses  

E-Print Network (OSTI)

We propose a model of operation for next generation wireless Internet, in which a mobile host has hundreds of "disposable" Mobile IPv6 home addresses. Each correspondent is distributed a different disposable home address. If attacked on a given home address, the mobile user can block packets to that address and become unreachable to the attacker. Blocking one address does not affect other addresses. Other correspondents can still reach the mobile host. A new home address can also be requested via e-mail, instant messaging, or directly from the target host using a protocol that we develop. This model is especially useful against battery exhausting Denial-of-Service (DoS) attacks and CPU exhausting distributed DoS attacks, since it seems to be the only viable solution, currently. We show however that this model can also be used to defeat other attacks and also to stop spam.

Mutaf, Pars



U-051: Skype Discloses IP Addresses to Remote Users | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

51: Skype Discloses IP Addresses to Remote Users 51: Skype Discloses IP Addresses to Remote Users U-051: Skype Discloses IP Addresses to Remote Users December 5, 2011 - 7:00am Addthis PROBLEM: A remote user can determine the IP address of a Skype user. PLATFORM: Skype application ABSTRACT: Skype Discloses IP Addresses to Remote Users reference LINKS: SecurityTracker Alert ID: 1026370 Forbes: Skype Flaw IMPACT ASSESSMENT: High Discussion: A remote user can initiate a Skype call to a target user to determine the target user's IP address and then terminate the call before the target user's Skype application has indicated an incoming call. The remote user does not need to be on the target user's contact list. Armed with an IP address, hackers can uncover specific information about victims, including who they chat with, what they download while online, and


Keynote Address  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Update on Environmental Management Update on Environmental Management Alice Williams Associate Principal Deputy Assistant Secretary Office of Environmental Management National Transportation Stakeholders Forum MAY 16, 2012 KNOXVILLE, TN www.em.doe.gov 2 "Complete the safe cleanup of the environmental legacy brought about from five decades of nuclear weapons development, production, and Government-sponsored nuclear energy research"  From a legacy of weapons production to the world's largest environmental cleanup program  Operating in the world's most complex regulatory environment  EM cleanup enables DOE to


Addressing Failures  

NLE Websites -- All DOE Office Websites (Extended Search)

expected to be low (see Table 3). Note that our estimates assume that 4-bit or larger bursts increase from 1% of all SEUs to 10% or higher between 45 nm and 11 nm technology and...


Foremost Address  

NLE Websites -- All DOE Office Websites (Extended Search)

Directorate Environment, Safety, & Health RecordsDocuments Management Rev. 6 42413 Topic Series Title Record Description BNL Site Specific File Plan DOE Retention Responsible...


Addresses (AI)  

Science Conference Proceedings (OSTI)

... (1425) Capital Federal. ARGENTINA. Benecke, Mark. +49-173-287-3136. ... Junin 956.1113-Buenos Aires. ARGENTINA. Cordonnier, Jan. 32-50-310252 ...



President's Address  

Science Conference Proceedings (OSTI)

... dealing with continually declining resources and endless streams of threats ... of the Premium Diesel Work Group and the Automotive Lubricants Work ...



Keynote Address  

Energy.gov (U.S. Department of Energy (DOE))

An overview and update on Environmental Management given by Alice Williams, Associate Principal Deputy Assistant Secretary of the Office of Environmental Management.


Addresses (JR)  

Science Conference Proceedings (OSTI)

... Jalan Sultan. 46661 Petaling Jaya. Selangor. MALAYSIA. Jian, Liu. 86-10-63264488-570. ... Salangor. MALAYSIA. Oz, Carla, Office: 972-2-5429470. ...



Addresses (AI)  

Science Conference Proceedings (OSTI)

... Forensic DNA Laboratory Department of Chemistry. Malaysia , Jalan Sultan. 46661 Petailing Jaya, Selangor. MALAYSIA. Clayton, TM. ...



Addresses (SZ)  

Science Conference Proceedings (OSTI)

... Chulalongkorn University. 1837 Rama 4 Road Pathumwan Bangkok, Thailand. Vossbrink, Russell. (602) 223-2350. Fax: (602) 223-2924. ...



Addresses (JR)  

Science Conference Proceedings (OSTI)

... Head of Research, Development and Defence Projects. Centre of Forensic Sciences. ... (212) 323-1300. Fax: (212) 323-1590. mprinz@ocme.nyc.gov. ...


Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


U-115: Novell GroupWise Client Address Book Processing Buffer Overflow  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5: Novell GroupWise Client Address Book Processing Buffer 5: Novell GroupWise Client Address Book Processing Buffer Overflow Vulnerability U-115: Novell GroupWise Client Address Book Processing Buffer Overflow Vulnerability March 2, 2012 - 7:00am Addthis PROBLEM: A vulnerability has been reported in in Novell GroupWise Client. PLATFORM: versions 8.0 through 8.02 HP3. ABSTRACT: The vulnerability is caused due to an error when processing Novell Address Book (".nab") files and can be exploited to cause a heap-based buffer overflow via an overly long email address. reference LINKS: Vendor Advisory Secunia Advisory 48199 CVE-2011-4189 IMPACT ASSESSMENT: High Discussion: The GroupWise 8 Client for Windows is vulnerable to an exploit where a malformed address book could cause heap memory corruption, which could lead to remote code execution under the privilege of the user that opened the


RedSeal Comments on "Smart Grid RFI: Addressing Policy and Logistical  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

RedSeal Comments on "Smart Grid RFI: Addressing Policy and RedSeal Comments on "Smart Grid RFI: Addressing Policy and Logistical Challenges. RedSeal Comments on "Smart Grid RFI: Addressing Policy and Logistical Challenges. RedSeal Comments on "Smart Grid RFI: Addressing Policy and Logistical Challenges. RedSeal's core technology is the ability to understand the access control of the network as a whole - not simply the behavior of a single device. RedSeal analyzes the interactions of firewalls, routers and load balancers network wide to determine the traffic allowed between every two points. RedSeal Comments on "Smart Grid RFI: Addressing Policy and Logistical Challenges. More Documents & Publications Southern Company: DOE Smart Grid RFI Addressing Policy and Logistical Challenges Association of Home Appliance Manufacturers Comments on Smart Grid RFI


Collaborative process and the transformation of the urban environment : wall, street, and scaffolding on Massachusetts Avenue in Boston  

E-Print Network (OSTI)

This thesis addresses two questions: how to develop a process of collaborative building in cities, and what kind of public places to make in cities. More generally: how can urban dwellers re-engage with urban architecture ...

Carr, James D. (James David)



An introduction to Digital Addressable Lighting Interface (DALI) systems & study of a DALI day lighting application.  

E-Print Network (OSTI)

??The DALI (Digital Addressable Lighting Interface) protocol has set forth the requirements for a digital fluorescent ballast that out performs its predecessors with respect to (more)

Meyer, Lisa



The Role of Teacher Education Experiences in Addressing the Concerns of Apprentice Teachers.  

E-Print Network (OSTI)

??This study investigated the role of a teacher education program in helping apprentice teachers to address their teaching concerns. Quantitative and qualitative analyses of program (more)

McVey, Mary



Galvin Electricity Initiative DOE RFI DOE RFI 2010-23251: Addressing...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Galvin Electricity Initiative DOE RFI DOE RFI 2010-23251: Addressing Policy and Logistical Challenges to Smart Grid Implementation Galvin Electricity Initiative DOE RFI DOE RFI...



E-Print Network (OSTI)

??The thesis is a rhetorical and narrative criticism of Atal Bihari Vajpayee's 1998 pro-nuclear Lok Sabha address. Through Walter Fisher's narrative paradigm, I argue that (more)

DeLong, Brian LaMonte



Addressing the Need for Alternative Transportation Fuels: The Joint BioEnergy Institute  

E-Print Network (OSTI)

transporation fuels. Currently, biofuels such as ethanol areefficiency of starch-based biofuels is however not optimal,address these roadblocks in biofuels production. JBEI draws

Blanch, Harvey



A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



Better Technologies Key to Addressing Climate Change Energy Department official explains U.S. initiatives  

E-Print Network (OSTI)

Better Technologies Key to Addressing Climate Change Energy Department official explains U.S emissions and addressing climate change, according to a U.S. Department of Energy (DOE) official speaking of the DOE statement follows: [U.S. Department of Energy] Intervention by the United States Panel


When the Internet Runs Out of Addresses, It'll be IPv6 to the...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

the Internet Runs Out of Addresses, It'll be IPv6 to the Rescue When the Internet Runs Out of Addresses, It'll be IPv6 to the Rescue June 8, 2011 - 5:25pm Addthis Wendy Wolfson...


Address-Bit Differential Power Analysis of Cryptographic Schemes OK-ECDH and OK-ECDSA  

Science Conference Proceedings (OSTI)

The differential power analysis (DPA) is a powerful attack against the implementation of cryptographic schemes on mobile devices. This paper proposes an alternative DPA using the addresses of registers of elliptic curve based cryptosystems (ECC) implemented ... Keywords: OK-ECDH, OK-ECDSA, address-bit DPA, differential power analysis (DPA), elliptic curve cryptosystems (ECC), scalar exponentiation

Kouichi Itoh; Tetsuya Izu; Masahiko Takenaka



Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



U-237: Mozilla Firefox CVE-2012-1950 Address Bar URI Spoofing Vulnerability  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

7: Mozilla Firefox CVE-2012-1950 Address Bar URI Spoofing 7: Mozilla Firefox CVE-2012-1950 Address Bar URI Spoofing Vulnerability U-237: Mozilla Firefox CVE-2012-1950 Address Bar URI Spoofing Vulnerability August 16, 2012 - 7:00am Addthis PROBLEM: Mozilla Firefox CVE-2012-1950 Address Bar URI Spoofing Vulnerability PLATFORM: Version(s): Mozilla Firefox 6 - 12 ABSTRACT: To exploit this issue, an attacker must entice an unsuspecting user to follow a crafted URI. REFERENCE LINKS: http://www.securityfocus.com/bid/54585 CVE-2012-1950 IMPACT ASSESSMENT: Medium Discussion: The drag-and-drop implementation in Mozilla Firefox 4.x through 13.0 and Firefox ESR 10.x before 10.0.6 allows remote attackers to spoof the address bar by canceling a page load. mozilla Firefox is prone to a URI-spoofing spoofing vulnerability. Attackers may exploit this issue to display


U-237: Mozilla Firefox CVE-2012-1950 Address Bar URI Spoofing Vulnerability  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

37: Mozilla Firefox CVE-2012-1950 Address Bar URI Spoofing 37: Mozilla Firefox CVE-2012-1950 Address Bar URI Spoofing Vulnerability U-237: Mozilla Firefox CVE-2012-1950 Address Bar URI Spoofing Vulnerability August 16, 2012 - 7:00am Addthis PROBLEM: Mozilla Firefox CVE-2012-1950 Address Bar URI Spoofing Vulnerability PLATFORM: Version(s): Mozilla Firefox 6 - 12 ABSTRACT: To exploit this issue, an attacker must entice an unsuspecting user to follow a crafted URI. REFERENCE LINKS: http://www.securityfocus.com/bid/54585 CVE-2012-1950 IMPACT ASSESSMENT: Medium Discussion: The drag-and-drop implementation in Mozilla Firefox 4.x through 13.0 and Firefox ESR 10.x before 10.0.6 allows remote attackers to spoof the address bar by canceling a page load. mozilla Firefox is prone to a URI-spoofing spoofing vulnerability. Attackers may exploit this issue to display


Response to Request for Information titled "Addressing Policy and  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

to Request for Information titled "Addressing Policy and to Request for Information titled "Addressing Policy and Logistical Challenges to Smart Grid Implementation" Response to Request for Information titled "Addressing Policy and Logistical Challenges to Smart Grid Implementation" Response to Request for Information titled "Addressing Policy and Logistical Challenges to Smart Grid Implementation." urrent smart grid initiatives are occurring in a largely uncoordinated fashion and tend to increase near-term energy costs. Meanwhile, Renewable Portfolio Standards are also expected to increase near- term costs. The lack of a comprehensive energy and climate policy reduces the likelihood of a significant reduction in greenhouse gas emissions or energy imports. Response to Request for Information titled "Addressing Policy and


Comments of DRSG to DOE Smart Grid RFI: Addressing Policy and Logistical  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

of DRSG to DOE Smart Grid RFI: Addressing Policy and of DRSG to DOE Smart Grid RFI: Addressing Policy and Logistical Challenges Comments of DRSG to DOE Smart Grid RFI: Addressing Policy and Logistical Challenges In light of the fact that smart grid deployments are moving forward with pace and at scale, DRSG advises the DOE against seeking to redefine the term "smart grid" as a semantic exercise, as such an effort would introduce delay, generate uncertainty, and likely prove counterproductive. DOE Smart Grid RFI: Addressing Policy and Logistical Challenges to Smart Grid Implementation More Documents & Publications Addressing Policy and Logistical Challenges to smart grid Implementation: eMeter Response to Department of Energy RFI Association of Home Appliance Manufacturers Comments on Smart Grid RFI


NBP RFI-Addressing Policy and Logistical Challenges to Smart Grid  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NBP RFI-Addressing Policy and Logistical Challenges to Smart Grid NBP RFI-Addressing Policy and Logistical Challenges to Smart Grid Implementation. September 10, 2009 NBP RFI-Addressing Policy and Logistical Challenges to Smart Grid Implementation. September 10, 2009 The Telecommunications Industry Association (TIA) is pleased to provide comments on how to address the numerous challenges facing the development and deployment of smart grid technologies. Smart grid is a more robust application of information and communication technologies (ICT) to transform the generation, transmission, distribution and consumption of electricity to provide greater automation, increase reliability, improve efficiency and reduce energy consumption. NBP RFI-Addressing Policy and Logistical Challenges to Smart Grid Implementation. September 10, 2009


New York Independent System Operator, Smart Grid RFI: Addressing Policy and  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

York Independent System Operator, Smart Grid RFI: Addressing York Independent System Operator, Smart Grid RFI: Addressing Policy and Logistical Challenges. New York Independent System Operator, Smart Grid RFI: Addressing Policy and Logistical Challenges. In response to the Department of Energy's (DOE) Request for Information regarding smart grid implementation listed in the September 17, 2010 Federal Register, the New York Independent System Operator, Inc. (NYISO) offers the attached white paper entitled Envisioning a Smarter Grid for New York Consumers. New York Independent System Operator, Smart Grid RFI: Addressing Policy and Logistical Challenges. More Documents & Publications Smart Grid Consortium, Response of New York State Smart Grid Addressing Policy and Logistical Challenges 2009 Smart Grid System Report (July 2009)


C/O HELP PLLC, 750 SEVENTEETH STREET N.W. SUITE 900 Washington, D.C. 20006 Tel. Tel. Tel. Tel. 202-378-2300  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

C/O HELP PLLC, 750 SEVENTEETH STREET N.W. SUITE 900 Washington, D.C. 20006 Tel. Tel. Tel. Tel. 202-378-2300 C/O HELP PLLC, 750 SEVENTEETH STREET N.W. SUITE 900 Washington, D.C. 20006 Tel. Tel. Tel. Tel. 202-378-2300 February 27, 2012 Submitted via email to: Brian.Mills@hq.doe.gov Mr. Brian Mills Office of Electricity Delivery and Energy Reliability (OE-20) U.S. Department of Energy 1000 Independence Avenue, SW Washington, DC 20585 Re: Coordination of Federal Authorizations for Electric Transmission Facilities, RIN 1901-AB18 Dear Mr. Mills: On behalf of WIRES (www.wiresgroup.com) I am pleased to submit the attached Comments in response to the Notice of Proposed Rulemaking on Coordination of Federal Authorizations for Electric Transmission Facilities. WIRES regards the work of Assistant Secretary Hoffman and OEDER in the area of electric transmission planning

Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Enhanced solid waste management by understanding the effects of gender, income, marital status, and religious convictions on attitudes and practices related to street littering in Nablus - Palestinian territory  

SciTech Connect

Litter is recognized as a form of street pollution and a key issue for solid waste managers. Nablus district (West Bank, Palestinian Territory), which has an established network of urban and rural roads, suffers from a wide-spread litter problem that is associated with these roads and is growing steadily with a well-felt negative impact on public health and the environment. The purpose of this research was to study the effects of four socio-economic characteristics (gender, income, marital status, and religious convictions) of district residents on their attitudes, practices, and behavior regarding street litter generation and to suggest possible remedial actions. All four characteristics were found to have strong correlations, not only with littering behavior and practices, but also with potential litter prevention strategies. In particular, the impact of religious convictions of the respondents on their littering habits and attitudes was very clear and interesting to observe.

Al-Khatib, Issam A. [Institute of Environmental and Water Studies (IEWS), Birzeit University, Ramallah (Palestinian Territory, Occupied); Arafat, Hassan A. [Chemical Engineering Department, An-Najah National University, Nablus (Palestinian Territory, Occupied)], E-mail: harafat@najah.edu; Daoud, Raeda; Shwahneh, Hadeel [College of Graduate Studies, An-Najah National University, Nablus (Palestinian Territory, Occupied)




SciTech Connect

Oak Ridge Institute for Science and Education (ORISE) personnel visited the United Nuclear Corporation (UNC) Naval Products site on three separate occasions during the months of October and November 2011. The purpose of these visits was to conduct confirmatory surveys of soils associated with the Argyle Street sewer line that was being removed. Soil samples were collected from six different, judgmentally determined locations in the Argyle Street sewer trench. In addition to the six soil samples collected by ORISE, four replicate soil samples were collected by Cabrera Services, Inc. (CSI) for analysis by the ORISE laboratory. Replicate samples S0010 and S0011 were final status survey (FSS) bias samples; S0012 was an FSS systematic sample; and S0015 was a waste characterization sample. Six soil samples were also collected for background determination. Uranium-235 and uranium-238 concentrations were determined via gamma spectroscopy; the spectra were also reviewed for other identifiable photopeaks. Radionuclide concentrations for these soil samples are provided. In addition to the replicate samples and the samples collected by ORISE, CSI submitted three soil samples for inter-laboratory comparison analyses. One sample was from the background reference area, one was from waste characterization efforts (material inside the sewer line), and one was a FSS sample. The inter-laboratory comparison analyses results between ORISE and CSI were in agreement, except for one sample collected in the reference area. Smear results For Argyle Street sewer pipes are tabulated.

Adams, Wade C.



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Is the US Main Street model likely to be an effective approach to revitalizing Japanes city centers?  

E-Print Network (OSTI)

As in the United States in the 1970s, a decline of city centers is a social issue in Japan today. Although the Japanese government has attempted to address the issue since the late 1990s, little accomplishment can be seen ...

Yamamoto, Ai, M.C.P. Massachusetts Institute of Technology



DOE to Address Small Businesses Barriers in Government Contracting at Waste  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

to Address Small Businesses Barriers in Government Contracting to Address Small Businesses Barriers in Government Contracting at Waste Management Conference DOE to Address Small Businesses Barriers in Government Contracting at Waste Management Conference January 31, 2013 - 12:00pm Addthis David Sheeley David Sheeley Editor/Writer PHOENIX - EM and the DOE Office of Small and Disadvantaged Business Utilization (OSDBU) are working to address barriers that hinder small businesses from competing for prime contracts for work in the Cold War cleanup program. To that end, OSDBU and EM are co-hosting a discussion led by a panel of diverse experts from DOE headquarters and leaders from small business companies. The panel dialogue will focus on input received from small businesses. The panel will meet at 3:15 p.m. on Feb. 26 during the Waste Management


U.S. Energy Secretary Addresses International Atomic Energy Agency General  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretary Addresses International Atomic Energy Agency Secretary Addresses International Atomic Energy Agency General Conference U.S. Energy Secretary Addresses International Atomic Energy Agency General Conference September 19, 2011 - 4:48pm Addthis VIENNA, AUSTRIA - U.S. Energy Secretary Steven Chu addressed the International Atomic Energy Agency's General Conference today in Vienna. Opening with a message from President Barack Obama, Secretary Chu highlighted the importance of safety and security in the nuclear industry in light of the tragic events at Fukushima this year, and outlined the four priorities of President Obama's nuclear agenda: promoting the peaceful use of nuclear energy, strengthening the nuclear proliferation regime, pursuing nuclear disarmament and enhancing nuclear security The following are excerpts of Secretary Chu's remarks as prepared for


DRSG Comments to DOE Smart Grid RFI: Addressing Policy and Logistical Challenges  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Comments to DOE Smart Grid RFI: Addressing Policy and Logistical Challenges Comments to DOE Smart Grid RFI: Addressing Policy and Logistical Challenges DRSG- 1 DOE Smart Grid RFI Titled "Addressing Policy and Logistical Challenges to Smart Grid Implementation" Submitted by the Demand Response and Smart Grid Coalition (DRSG) November 1, 2010 DRSG Comments to DOE Smart Grid RFI: Addressing Policy and Logistical Challenges DRSG- 2 I. Definition and Scope 1. What significant policy challenges are likely to remain unaddressed if we employ Title XIII's definition? In light of the fact that smart grid deployments are moving forward with pace and at scale, DRSG advises the DOE against seeking to redefine the term "smart grid" as a semantic exercise, as such an effort would introduce delay, generate uncertainty, and likely prove


Assistant Secretary Patricia Hoffman to Deliver Keynote Address at IEEE PES  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Assistant Secretary Patricia Hoffman to Deliver Keynote Address at Assistant Secretary Patricia Hoffman to Deliver Keynote Address at IEEE PES Conference on Innovative Smart Grid Technologies Assistant Secretary Patricia Hoffman to Deliver Keynote Address at IEEE PES Conference on Innovative Smart Grid Technologies January 25, 2013 - 3:10pm Addthis Assistant Secretary Patricia Hoffman will give the keynote address at the 4th annual IEEE PES Conference on Innovative Smart Grid Technologies (ISGT 2013) on Monday, February 25. The conference, which will be held from February 24 through February 27 in Washington, DC, is a forum to discuss state-of-the-art innovations in smart grid technologies. The event will feature tutorials, panel sessions and paper presentations by international experts. Other keynote speakers will include Mark Wyatt, Vice President


Smart Grid Consortium, Response of New York State Smart Grid Addressing  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Consortium, Response of New York State Smart Grid Consortium, Response of New York State Smart Grid Addressing Policy and Logistical Challenges Smart Grid Consortium, Response of New York State Smart Grid Addressing Policy and Logistical Challenges It represents a unique public-private partnership of largely New York State utilities, authorities, universities, industrial companies, and institutions and research organizations which came together in a collaborative manner to facilitate the development of a Smart Grid in the state and nation. Smart Grid Consortium, Response of New York State Smart Grid Addressing Policy and Logistical Challenges More Documents & Publications SmartGrid Consortium: Smart Grid Roadmap for the State of New York New York Independent System Operator, Smart Grid RFI: Addressing Policy and


Secretary Chu to Address the Winter Meeting of the U.S. Conference of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretary Chu to Address the Winter Meeting of the U.S. Conference Secretary Chu to Address the Winter Meeting of the U.S. Conference of Mayors Secretary Chu to Address the Winter Meeting of the U.S. Conference of Mayors January 19, 2011 - 12:00am Addthis WASHINGTON, D.C. - US Energy Secretary Steven Chu will address the 79th winter meeting of the U.S. Conference of Mayors. Secretary Chu will attend the Energy Standing Committee session of the conference where he will discuss the importance of clean energy to our economic competitiveness. WHAT: Energy Secretary Steven Chu to attend US Conference of Mayors Winter Meeting WHEN: Wednesday, January 19, 2010 4:30 PM EDT WHERE: Capital Hilton 1001 16th St. NW Washington, DC Media contact(s): (202) 586-4940 Addthis Related Articles Secretary Chu to Attend Event in Colorado on the Need to Compete Globally


Assistant Secretary Patricia Hoffman to Deliver Keynote Address at IEEE PES  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Patricia Hoffman to Deliver Keynote Address at Patricia Hoffman to Deliver Keynote Address at IEEE PES Conference on Innovative Smart Grid Technologies Assistant Secretary Patricia Hoffman to Deliver Keynote Address at IEEE PES Conference on Innovative Smart Grid Technologies January 25, 2013 - 3:10pm Addthis Assistant Secretary Patricia Hoffman will give the keynote address at the 4th annual IEEE PES Conference on Innovative Smart Grid Technologies (ISGT 2013) on Monday, February 25. The conference, which will be held from February 24 through February 27 in Washington, DC, is a forum to discuss state-of-the-art innovations in smart grid technologies. The event will feature tutorials, panel sessions and paper presentations by international experts. Other keynote speakers will include Mark Wyatt, Vice President


Natural Gas Industry Comments on Smart Grid RFI: Addressing Policy and  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Natural Gas Industry Comments on Smart Grid RFI: Addressing Policy Natural Gas Industry Comments on Smart Grid RFI: Addressing Policy and Logistical Challenges to Smart Grid Natural Gas Industry Comments on Smart Grid RFI: Addressing Policy and Logistical Challenges to Smart Grid The undersigned members of the natural gas industry are pleased to submit for your consideration the following comments in response to the U.S. Department of Energy, Office of Electricity Delivery and Energy Reliability's Request for Information Addressing Policy and Logistical Challenges to Smart Grid Implementation, 75 Fed. Reg. 57,006 (Sep. 17, 2010). The Request seeks comment on challenges that confront smart grid implementation and recommendations on how best to overcome those challenges. We believe abundant, domestic, low-carbon natural gas resources along with


Secretary Chu to Give Keynote Address at World Forum on Enterprise and the  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretary Chu to Give Keynote Address at World Forum on Enterprise Secretary Chu to Give Keynote Address at World Forum on Enterprise and the Environment Secretary Chu to Give Keynote Address at World Forum on Enterprise and the Environment June 25, 2010 - 12:00am Addthis Washington, DC - On Sunday, June 27th, U.S. Energy Secretary Steven Chu will travel to the United Kingdom to deliver the keynote address at the World Forum on Enterprise and the Environment, hosted by the Oxford University Smith School of Enterprise and the Environment. This year's forum will focus on "Low Carbon Mobility: Land; Sea and Air." On Monday, Secretary Chu will be attending diplomatic meetings focused on solving our shared energy and climate challenges. Following the morning meetings, Secretary Chu will travel to Houston as part of his ongoing work


GridWise Alliance: Smart Grid RFI: Addressing Policy and Logistical  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

GridWise Alliance: Smart Grid RFI: Addressing Policy and Logistical GridWise Alliance: Smart Grid RFI: Addressing Policy and Logistical Challenges GridWise Alliance: Smart Grid RFI: Addressing Policy and Logistical Challenges The GridWise Alliance is a coalition of over 150 companies, organizations, and academic institutions advocating for a smart grid for a more sustainable future. We are consensus-driven and technology neutral and do not advocate for specific platforms or technologies, but, rather, for policies that will move the entire market forward to create jobs, provide clean energy solutions, and increase the reliability, flexibility, and efficiency of our electric grid. GridWise Alliance: Smart Grid RFI: Addressing Policy and Logistical Challenges More Documents & Publications WHAT A SMART GRID MEANS TO OUR NATION'S FUTURE.


The Lessons of Practice: Domestic Policy Reform as a Way to Address Climate  

Open Energy Info (EERE)

The Lessons of Practice: Domestic Policy Reform as a Way to Address Climate The Lessons of Practice: Domestic Policy Reform as a Way to Address Climate Change Jump to: navigation, search Tool Summary LAUNCH TOOL Name: The Lessons of Practice: Domestic Policy Reform as a Way to Address Climate Change Agency/Company /Organization: International Institute for Sustainable Development (IISD) Topics: Policies/deployment programs Resource Type: Lessons learned/best practices Website: www.iisd.org/pdf/2009/bali_2_copenhagen_dom_policy_lessons.pdf The Lessons of Practice: Domestic Policy Reform as a Way to Address Climate Change Screenshot References: The Lessons of Practice[1] Summary "The objectives of this paper are threefold: to review experience to date with policy reforms that can help mitigate climate change, to review work


DOE to Address Small Businesses Barriers in Government Contracting at Waste  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE to Address Small Businesses Barriers in Government Contracting DOE to Address Small Businesses Barriers in Government Contracting at Waste Management Conference DOE to Address Small Businesses Barriers in Government Contracting at Waste Management Conference January 31, 2013 - 12:00pm Addthis David Sheeley David Sheeley Editor/Writer PHOENIX - EM and the DOE Office of Small and Disadvantaged Business Utilization (OSDBU) are working to address barriers that hinder small businesses from competing for prime contracts for work in the Cold War cleanup program. To that end, OSDBU and EM are co-hosting a discussion led by a panel of diverse experts from DOE headquarters and leaders from small business companies. The panel dialogue will focus on input received from small businesses. The panel will meet at 3:15 p.m. on Feb. 26 during the Waste Management


U.S. Energy Secretary Addresses International Atomic Energy Agency General  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

U.S. Energy Secretary Addresses International Atomic Energy Agency U.S. Energy Secretary Addresses International Atomic Energy Agency General Conference U.S. Energy Secretary Addresses International Atomic Energy Agency General Conference September 19, 2011 - 2:24pm Addthis VIENNA, AUSTRIA - U.S. Energy Secretary Steven Chu addressed the International Atomic Energy Agency's General Conference today in Vienna. Opening with a message from President Barack Obama, Secretary Chu highlighted the importance of safety and security in the nuclear industry in light of the tragic events at Fukushima this year, and outlined the four priorities of President Obama's nuclear agenda: promoting the peaceful use of nuclear energy, strengthening the nuclear proliferation regime, pursuing nuclear disarmament and enhancing nuclear security The following are excerpts of Secretary Chu's remarks as prepared for


Smart Grid Consortium, Response of New York State Smart Grid Addressing  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Smart Grid Consortium, Response of New York State Smart Grid Smart Grid Consortium, Response of New York State Smart Grid Addressing Policy and Logistical Challenges Smart Grid Consortium, Response of New York State Smart Grid Addressing Policy and Logistical Challenges It represents a unique public-private partnership of largely New York State utilities, authorities, universities, industrial companies, and institutions and research organizations which came together in a collaborative manner to facilitate the development of a Smart Grid in the state and nation. Smart Grid Consortium, Response of New York State Smart Grid Addressing Policy and Logistical Challenges More Documents & Publications SmartGrid Consortium: Smart Grid Roadmap for the State of New York Comments of DRSG to DOE Smart Grid RFI: Addressing Policy and Logistical


State Oil and Gas Board State Oil and Gas Board Address Place...  

Open Energy Info (EERE)

Board State Oil and Gas Board Address Place Zip Website Alabama Oil and Gas Board Alabama Oil and Gas Board Hackberry Lane Tuscaloosa Alabama http www gsa state al us ogb ogb html...


License integration patterns: Addressing license mismatches in component-based development  

Science Conference Proceedings (OSTI)

In this paper we address the problem of combining software components with different and possibly incompatible legal licenses to create a software application that does not violate any of these licenses while potentially having its own. We call this ...

Daniel M. German; Ahmed E. Hassan


Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Flexibility in building design : a real options approach and valuation methodology to address risk  

E-Print Network (OSTI)

This research develops an approach to designing and valuing flexible systems subject to identified future uncertainties. The approach addresses two shortcomings of current design and decision-making practices that are ...

Greden, Lara V. (Lara Virginia), 1977-



The Lessons of Practice: Domestic Policy Reform as a Way to Address...  

Open Energy Info (EERE)

The Lessons of Practice: Domestic Policy Reform as a Way to Address Climate Change Jump to: navigation, search Tool Summary Name: The Lessons of Practice: Domestic Policy Reform as...


An Attempt to Address the Question, Are Weather patterns Changing? for a Nonspecialist Audience  

Science Conference Proceedings (OSTI)

This paper is derived from an address at an Illinois agricultural conference an the specified topic, Are weather patterns changing? It examines three contrasting perspectives on the weather and climate of the recent past and immediate future ...

Peter J. Lamb



Secretary Chu to Give Keynote Address at World Forum on Enterprise and the  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

to Give Keynote Address at World Forum on Enterprise to Give Keynote Address at World Forum on Enterprise and the Environment Secretary Chu to Give Keynote Address at World Forum on Enterprise and the Environment June 25, 2010 - 12:00am Addthis Washington, DC - On Sunday, June 27th, U.S. Energy Secretary Steven Chu will travel to the United Kingdom to deliver the keynote address at the World Forum on Enterprise and the Environment, hosted by the Oxford University Smith School of Enterprise and the Environment. This year's forum will focus on "Low Carbon Mobility: Land; Sea and Air." On Monday, Secretary Chu will be attending diplomatic meetings focused on solving our shared energy and climate challenges. Following the morning meetings, Secretary Chu will travel to Houston as part of his ongoing work


April 30, 2008; HSS/Union Working Group Meeting to address training - Executive Summary  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

HSS/UNION MEETING TO ADDRESS TRAINING HSS/UNION MEETING TO ADDRESS TRAINING INTEGRATED EXECUTIVE SUMMARY AND FINAL ACTION LIST HSS and the labor unions who participated in the initial 2007 HSS Focus Group meetings agreed to a path forward in which various unions combined to form core working groups to address union identified issues by topical area. The following is a synthesis of actions/activities identified in the April 30 HSS/Union meeting to address training issues with focus in the areas of the development of DOE-wide HAMMER modeled training, standardization of training requirements and implementation, as well as, broader based worker safety training DOE-wide. 1. Define minimum training standards/requirements (851 as a guiding basis) [HSS] - Baseline training requirements [NIEHS/HS-10, NTC, HS-20]


Oklahoma State University -106 Whitehurst, Stillwater, Oklahoma 74078 (405) 744-5449 NAME AND ADDRESS CHANGE  

E-Print Network (OSTI)

- 6365. TIAA-CREF Retirement: To change your address with TIAA-CREF, use the TIAA-CREF Change of Address form found at http://hr.okstate.edu. Send the forms to TIAA-CREF, 730 3rd Avenue, New York, NY 10017-3206. To change your name, contact TIAA-CREF at (800) 842-2776. They will need your social security number, your

Veiga, Pedro Manuel Barbosa



E-Print Network (OSTI)

renovation 3: Hospital Drive reconstruction and realignment 4: Wind Turbine project 5: Animal Resource Center Campus MU Power Plant A 34 kW solar photovoltaic (PV) system has been installed on the new fuel unloading kitchen. 10 Printed on 100 percent recycled paper that contains 60 percent post-consumer waste

Taylor, Jerry


Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



On the Dynamics of IP Address Allocation and Availability of End-Hosts  

E-Print Network (OSTI)

The availability of end-hosts and their assigned routable IP addresses has impact on the ability to fight spammers and attackers, and on peer-to-peer application performance. Previous works study the availability of hosts mostly by using either active pinging or by studying access to a mail service, both approaches suffer from inherent inaccuracies. We take a different approach by measuring the IP addresses periodically reported by a uniquely identified group of the hosts running the DIMES agent. This fresh approach provides a chance to measure the true availability of end-hosts and the dynamics of their assigned routable IP addresses. Using a two month study of 1804 hosts, we find that over 60% of the hosts have a fixed IP address and 90% median availability, while some of the remaining hosts have more than 30 different IPs. For those that have periodically changing IP addresses, we find that the median average period per AS is roughly 24 hours, with a strong relation between the offline time and the probabi...

Argon, Oded; Mokryn, Osnat; Schirman, Dvir; Shavitt, Yuval; Weinsberg, Udi



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Secretary Chu's Address to the IAEA General Conference in Vienna, Austria |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Chu's Address to the IAEA General Conference in Vienna, Chu's Address to the IAEA General Conference in Vienna, Austria Secretary Chu's Address to the IAEA General Conference in Vienna, Austria September 14, 2009 - 12:00am Addthis 53rd IAEA General Conference - As Prepared for Delivery Secretary Steven Chu Monday, September 14, 2009 Thank you, Madame President. Congratulations on your election as President of this Conference. I would also like to congratulate Ambassador Amano on his appointment as Director General. I pledge my government's full support as Ambassador Amano assumes this critical role. I would also like to thank Dr. Mohamed ElBaradei for his quarter century of distinguished service to the IAEA and 12 years as Director General. Dr. ElBaradei's leadership earned him and the IAEA a Nobel Peace Prize and our enduring gratitude.


President Bush Highlights Energy in the State of the Union Address |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

President Bush Highlights Energy in the State of the Union Address President Bush Highlights Energy in the State of the Union Address President Bush Highlights Energy in the State of the Union Address February 3, 2005 - 10:01am Addthis "To keep our economy growing, we also need reliable supplies of affordable, environmentally responsible energy. Nearly four years ago, I submitted a comprehensive energy strategy that encourages conservation, alternative sources, a modernized electricity grid, and more production here at home -- including safe, clean nuclear energy. My Clear Skies legislation will cut power plant pollution and improve the health of our citizens. And my budget provides strong funding for leading-edge technology -- from hydrogen-fueled cars, to clean coal, to renewable sources such as ethanol. Four years of


Event:GGKP-Green Growth: Addressing the Knowledge Gaps Day 1 | Open Energy  

Open Energy Info (EERE)

GGKP-Green Growth: Addressing the Knowledge Gaps: on 2012/01/12 GGKP-Green Growth: Addressing the Knowledge Gaps: on 2012/01/12 The Green Growth Knowledge Platform (GGKP) will hold its inaugural conference, "Green Growth: Addressing the Knowledge Gaps," January 12-13, 2012, in Mexico City Mexico. The conference aims to take stock of the current understanding of the economics of green growth; engage researchers and practitioners in an ongoing dialogue to increase understanding of how green growth approaches can be applied in the field; identify knowledge gaps and establish priorities for knowledge-building work and implementation; and launch follow-on efforts. The conference location will allow attendees to benefit from Mexico's experiences from taking a leading role internationally in advocating pathways to green development.


President Bush Highlights Energy in the State of the Union Address |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

President Bush Highlights Energy in the State of the Union Address President Bush Highlights Energy in the State of the Union Address President Bush Highlights Energy in the State of the Union Address February 3, 2005 - 10:01am Addthis "To keep our economy growing, we also need reliable supplies of affordable, environmentally responsible energy. Nearly four years ago, I submitted a comprehensive energy strategy that encourages conservation, alternative sources, a modernized electricity grid, and more production here at home -- including safe, clean nuclear energy. My Clear Skies legislation will cut power plant pollution and improve the health of our citizens. And my budget provides strong funding for leading-edge technology -- from hydrogen-fueled cars, to clean coal, to renewable sources such as ethanol. Four years of


Ames Laboratory to Lead New Research Effort to Address Shortages in Rare  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Laboratory to Lead New Research Effort to Address Shortages in Laboratory to Lead New Research Effort to Address Shortages in Rare Earth and Other Critical Materials Ames Laboratory to Lead New Research Effort to Address Shortages in Rare Earth and Other Critical Materials January 9, 2013 - 12:13pm Addthis NEWS MEDIA CONTACT (202) 586-4940 WASHINGTON - The U.S. Department of Energy announced today that a team led by Ames Laboratory in Ames, Iowa, has been selected for an award of up to $120 million over five years to establish an Energy Innovation Hub that will develop solutions to the domestic shortages of rare earth metals and other materials critical for U.S. energy security. The new research center, which will be named the Critical Materials Institute (CMI), will bring together leading researchers from academia, four Department of Energy


Galvin Electricity Initiative DOE RFI DOE RFI 2010-23251: Addressing Policy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Galvin Electricity Initiative DOE RFI DOE RFI 2010-23251: Galvin Electricity Initiative DOE RFI DOE RFI 2010-23251: Addressing Policy and Logistical Challenges to Smart Grid Implementation Galvin Electricity Initiative DOE RFI DOE RFI 2010-23251: Addressing Policy and Logistical Challenges to Smart Grid Implementation The Galvin Electricity Initiative, a non-profit organization, has dedicated its resources to researching and developing both prototypes and policy reforms that demonstrate the art of the possible in terms of grid performance. Galvin Electricity Initiative DOE RFI DOE RFI 2010-23251: Addressing Policy and Logistical Challenges to Smart Grid Implementation More Documents & Publications ABB Response to Smart Grid RFI. November 1, 2010 Comments of Santiago Grijalva: High-Level Response to DOE RFI on Smart Grid


Weekly Address: Time to Create the Energy Security Trust | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Weekly Address: Time to Create the Energy Security Trust Weekly Address: Time to Create the Energy Security Trust Weekly Address: Time to Create the Energy Security Trust March 18, 2013 - 3:23pm Addthis Matt Compton Deputy Director of Online Content for the Office of Digital Strategy at the White House. Editor's Note: This blog is cross-posted from WhiteHouse.gov. President Obama discusses the need to harness American energy in order to reduce our dependence on oil and make the United States a magnet for new jobs. He highlights his all-of-the-above approach to American energy -- including a proposal to establish an Energy Security Trust, which invests in research that will help shift our cars and trucks off of oil. Addthis Related Articles National Energy Action Month Photo courtesy of the Pacific Northwest National Laboratory.


Waste Receiving and Processing (WRAP) Facility Public Address System Review Findings  

SciTech Connect

Public address system operation at the Waste Receiving and Processing (WRAP) facility was reviewed. The review was based on an Operational Readiness Review finding that public address performance was not adequate in parts of the WRAP facility. Several improvements were made to the WRAP Public Address (PA) system to correct the deficiencies noted. Speaker gain and position was optimized. A speech processor was installed to boost intelligibility in high noise areas. Additional speakers were added to improve coverage in the work areas. The results of this evaluation indicate that further PA system enhancements are not warranted. Additional speakers cannot compensate for the high background sound and high reverberation levels found in the work areas. Recommendations to improve PA system intelligibility include minor speaker adjustments, enhanced PA announcement techniques, and the use of sound reduction and abatement techniques where economically feasible.



Note: This page contains sample records for the topic "mi street address" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Paving the road to peace: John F. Kennedy's American University address  

E-Print Network (OSTI)

From shortly after World War 11 until the fall of the Berlin Wall in 1989, the United States and the Soviet Union were enmeshed in what came to be known historically as the Cold War. This battle characterized both the political relations and the political rhetoric between the two nations. It was during the height of the Cold War that John F. Kennedy pursued a nuclear test ban treaty with the Soviet Union. Towards this end, he delivered a commencement address at American University on June 10, 1963. This thesis analyzes the strategies used by Kennedy to achieve this goal, and approaches the address from the context of Cold War rhetoric. By responding to the constraints provided to him by the Cold War, Kennedy maximized the potential persuasiveness of his address and offered a new insight to his audiences concerning the possibility of peace between the United States and the Soviet Union.

Joyce, Kelly J



DIEGO FAZI Mailing address: Solar Energy Conversion Group Chemical Sciences & Engineering Division  

NLE Websites -- All DOE Office Websites (Extended Search)

DIEGO FAZI DIEGO FAZI Mailing address: Solar Energy Conversion Group Chemical Sciences & Engineering Division Bldg 200, Room E105 Argonne National Laboratory 9700 South Cass Ave. Argonne IL 60439-4831 E-mail addresses: dfazi@anl.gov Office Number: 630-252-5796 Fax: 630-252-9289 Personal Pages: http://faculty.wcas.northwestern.edu/diego-fazi/ http://www.fazid.org Research Interests Diego Fazi comes from a theoretical Physics background and he performed research in gravitational-wave astronomy within the project LIGO from 2005 to 2012. In October 2012 Dr. Fazi joined the CSE division at Argonne as a postdoctoral appointee in the Solar Conversion


T-552: Cisco Nexus 1000V VEM updates address denial of service in VMware  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

52: Cisco Nexus 1000V VEM updates address denial of service in 52: Cisco Nexus 1000V VEM updates address denial of service in VMware ESX/ESXi T-552: Cisco Nexus 1000V VEM updates address denial of service in VMware ESX/ESXi February 8, 2011 - 7:49am Addthis PROBLEM: Cisco Nexus 1000V VEM updates address denial of service in VMware ESX/ESXi. PLATFORM: ESXi 4.1, ESXi 4.0, ESX 4.1, ESX 4.0 The following Cisco products have the vulnerability: - Cisco Nexus 1000V Virtual Ethernet Module Release 4.0(4) SV1(3b) - Cisco Nexus 1000V Virtual Ethernet Module Release 4.0(4) SV1(3a) - Cisco Nexus 1000V Virtual Ethernet Module Release 4.0(4) SV1(3) - Cisco Nexus 1000V Virtual Ethernet Module Release 4.0(4) SV1(2) - Cisco Nexus 1000V Virtual Ethernet Module Release 4.0(4) SV1(1) ABSTRACT: The Cisco Nexus 1000V Virtual Ethernet Module (VEM) is a virtual switch for


Our winters of discontent: Addressing the problem of rising home-heating costs1  

E-Print Network (OSTI)

on fossil fuels by using solar energy, reducing residential energy demand, and promoting district heating. 1ERG/200602 Our winters of discontent: Addressing the problem of rising home-heating costs1 Larry Residential space heating is a necessity in northern countries such as Canada. With over 70 percent

Hughes, Larry


General and Partial Equilibrium Modeling of Sectoral Policies to Address Climate Change in the United States  

SciTech Connect

This document provides technical documentation for work using detailed sectoral models to calibrate a general equilibrium analysis of market and non-market sectoral policies to address climate change. Results of this work can be found in the companion paper, ?Modeling Costs of Economy-wide versus Sectoral Climate Policies Using Combined Aggregate-Sectoral Models?.

Pizer, William; Burtraw, Dallas; Harrington, Winston; Newell, Richard; Sanchirico, James; Toman, Michael



GA-GPU: extending a library-based global address spaceprogramming model for scalable heterogeneouscomputing systems  

Science Conference Proceedings (OSTI)

Scalable heterogeneous computing (SHC) architectures are emerging as a response to new requirements for low cost, power efficiency, and high performance. For example, numerous contemporary HPC systems are using commodity Graphical Processing Units (GPU) ... Keywords: armci, ga, gas, global address space, global arrays, gpu, nwchem, pgas

Vinod Tipparaju; Jeffrey S. Vetter



Implementing automatic spot addressing and contour based segmentation in microarray image analysis  

Science Conference Proceedings (OSTI)

DNA microarrays have become a widely used technique by geneticists to diagnose or treat diseases through gene expression. The process of analysis gene expression with DNA microarrays is based on the hybridization of a tissue's DNA sequence into a substrate ... Keywords: DNA microarrays, contour segmentation, edge detection, image processing, segmentation, spot addressing

Alexandra Oliveros; Miguel Sotaquir
