Powered by Deep Web Technologies
Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


On Forward-in-Time Differencing for Fluids: Stopping Criteria for Iterative Solutions of Anelastic Pressure Equations  

Science Conference Proceedings (OSTI)

In this note, the authors address the practical issue of selecting appropriate stopping criteria for iterative solutions to the elliptic pressure equation arising in nonoscillatory, forward-in-time Eulerian and semi-Lagrangian anelastic fluid ...

Piotr K. Smolarkiewicz; Vanda Grubis?i?; Len G. Margolin



Stopping Ailantuhs  

NLE Websites -- All DOE Office Websites (Extended Search)

Stopping Ailantuhs Stopping Ailantuhs Name: Maria Location: N/A Country: N/A Date: N/A Question: How is it possible to stop the spreading of ailantuhs, that is infesting the original mediterranean vegetation on the coasts and in the countries of Italy? One of the peculiarity of italian landscape, the strong diversity of the environment, is treatened by that tree, growing everywhere. Replies: As with many environmental questions we get through this system, this is one that must be answered locally; we can't really help much from here without the needed knowledge of local systems . You might check out these addresses though to see if they offer any help: Society for Ecological Restoration: http://nabalu.flas.ufl.edu/ser/SERhome.html Restoration and Management Notes: http://www.wisc.edu/arboretum/rmn/homepage.html


LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


Stop/Start: Overview  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Stop/Start button highlighted banner graphic: blue bar Stop/Start button highlighted banner graphic: blue bar subbanner graphic: gray bar Overview button highlighted Driving button Braking button subbanner graphic: gray bar OVERVIEW Stop/Start hybrids are not true hybrids since electricity from the battery is not used to propel the vehicle. However, the Stop/Start feature is an important, energy-saving building block used in hybrid vehicles. Stop/Start technology conserves energy by shutting off the gasoline engine when the vehicle is at rest, such as at a traffic light, and automatically re-starting it when the driver pushes the gas pedal to go forward. stage graphic: vertical blue rule Main stage: See through car with battery, engine, and electric starter/generator visible. Car is stopped at an intersection.


Stop/Start: Overview  

NLE Websites -- All DOE Office Websites (Extended Search)

visible. Car is stopped at an intersection. Battery: The battery is used to store energy generated from the gasoline engine or, during regenerative braking, from the...


The light stop window  

E-Print Network (OSTI)

We show that a right-handed stop in the 200-400 GeV mass range, together with a nearly degenerate neutralino and, possibly, a gluino below 1.5 TeV, follows from reasonable assumptions, is consistent with present data, and offers interesting discovery prospects at the LHC. Triggering on an extra jet produced in association with stops allows the experimental search for stops even when their mass difference with neutralinos is very small and the decay products are too soft for direct observation. Using a razor analysis, we are able to set stop bounds that are stronger than those published by ATLAS and CMS.

Antonio Delgado; Gian F. Giudice; Gino Isidori; Maurizio Pierini; Alessandro Strumia



Search for long-lived stopped R-hadrons decaying out-of-time with pp collisions using the ATLAS detector  

E-Print Network (OSTI)

An updated search is performed for gluino, top squark, or bottom squark R-hadrons that have come to rest within the ATLAS calorimeter, and decay at some later time to hadronic jets and a neutralino, using 5.0 and 22.9 fb-1 of pp collisions at 7 and 8 TeV, respectively. Candidate decay events are triggered in selected empty bunch crossings of the LHC in order to remove pp collision backgrounds. Selections based on jet shape and muon-system activity are applied to discriminate signal events from cosmic ray and beam-halo muon backgrounds. In the absence of an excess of events, improved limits are set on gluino, stop, and sbottom masses for different decays, lifetimes, and neutralino masses. With a neutralino of mass 100 GeV, the analysis excludes gluinos with mass below 832 GeV (with an expected lower limit of 731 GeV), for a gluino lifetime between 10 microseconds and 1000 s in the generic R-hadron model with equal branching ratios for decays to qqbar+neutralino and gluon+neutralino. Under the same assumptions for the neutralino mass and squark lifetime, top squarks and bottom squarks in the Regge R-hadron model are excluded with masses below 379 and 344 GeV, respectively.

ATLAS Collaboration



Full Hybrid: Stopped  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Braking button Stopped button Braking button Stopped button STOPPED When the vehicle is stopped, such as at a red light, the gasoline engine and electric motor shut off automatically so that energy is not wasted in idling. All other systems, including the electric air conditioning, continue to run. stage graphic: vertical blue rule Main stage: See through car with battery, engine, generator, power split device, and electric motor visible. the car is stopped at an intersection. Main stage: See through car with battery, engine, generator, power split device, and electric motor visible. the car is stopped at an intersection. Battery (highlighted): The battery stores energy generated from the gasoline engine or, during regenerative braking, from the electric motor. Since the battery powers the vehicle at low speeds, it is larger and holds much more energy than batteries used to start conventional vehicles. Main stage: See through car with battery, engine, generator, power split device, and electric motor visible. the car is stopped at an intersection. Main stage: See through car with battery, engine, generator, power split device, and electric motor visible. the car is stopped at an intersection.


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 14, 1990 Place Time Name Group Group  

E-Print Network (OSTI)

:56.4 John Wool 30­39 105 483 30:00.0 David O'Neill ) Group Time Name Overall Place Place 1 24:24.3 John Magee 373 2 25:41.9 Edward Lofgren 400 HISTORY OF LBL


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 10, 1997 Place Time Name Group  

E-Print Network (OSTI)

Larnon, Frank 50-59 13 156 15:17.4 157 15:18.0 Bartholomew, J 50-59 14 158 15:18.4 Wool, John 40-49 18 159 15 Time Name Group Group Place HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN


LBL RUNAROUND RESULTS 2.95 km (1.84 mi) September 16, 1988 Envelope Time Name Group Group  

E-Print Network (OSTI)

120 14:08.2 Z. Mei 30-39 26 121 14:09.5 John Wool 30-39 27 122 14:10.3 Timothy Edberg 30-39 28 123 14 Time Name Envelope Place Number 1 30:14.0 Peter Endt 447 HISTORY OF LBL RUNAROUND WINNERS Year Distance


Optimal Stopping with Information Constraint  

SciTech Connect

We study the optimal stopping problem proposed by Dupuis and Wang (Adv. Appl. Probab. 34:141-157, 2002). In this maximization problem of the expected present value of the exercise payoff, the underlying dynamics follow a linear diffusion. The decision maker is not allowed to stop at any time she chooses but rather on the jump times of an independent Poisson process. Dupuis and Wang (Adv. Appl. Probab. 34:141-157, 2002), solve this problem in the case where the underlying is a geometric Brownian motion and the payoff function is of American call option type. In the current study, we propose a mild set of conditions (covering the setup of Dupuis and Wang in Adv. Appl. Probab. 34:141-157, 2002) on both the underlying and the payoff and build and use a Markovian apparatus based on the Bellman principle of optimality to solve the problem under these conditions. We also discuss the interpretation of this model as optimal timing of an irreversible investment decision under an exogenous information constraint.

Lempa, Jukka, E-mail: jlempa@cma.uio.no [University of Oslo, Centre of Mathematics for Applications (Norway)



A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



Bus Stop - Environment Connection: Do Characteristics of the Built Environment Correlate with Bus Stop Crime?  

E-Print Network (OSTI)

Correlate with Bus Stop Crime? Robin Liggett Anastasiawith Bus Stop Crime? Robin Liggett Anastasia Loukaitou-Correlate with Bus Stop Crime? Robin Liggett, Anestasia

Liggett, Robin S; Loukaitou-Sideris, Anastasia; Iseki, Hiroyuki



MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



Measured values of coal mine stopping resistance  

Science Conference Proceedings (OSTI)

As coal mines become larger, the number of stoppings in the ventilation system increases. Each stopping represents a potential leakage path which must be adequately represented in the ventilation model. Stopping resistance can be calculated using two methods, the USBM method, used to determine a resistance for a single stopping, and the MVS technique, in which an average resistance is calculated for multiple stoppings. Through MVS data collected from ventilation surveys of different subsurface coal mines, average resistances for stoppings were determined for stopping in poor, average, good, and excellent conditions. The calculated average stoppings resistance were determined for concrete block and Kennedy stopping. Using the average stopping resistance, measured and calculated using the MVS method, provides a ventilation modeling tool which can be used to construct more accurate and useful ventilation models. 3 refs., 3 figs.

Oswald, N.; Prosser, B.; Ruckman, R. [Mine Ventilation Services, Fresno, CA (United States)



On Bus-Stop Crime  

E-Print Network (OSTI)

and Martin Wachs, Crime in Public Transit Systems: AnOn Bus-Stop Crime B Y A N A S TA S I A L O U K A I T O U - Sas common settings for crime, pro v i d i n g cover for

Loukaitou-Sideris, Anastasia; Liggett, Robin



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Using laser-driven neutrons to stop nuclear smugglers  

NLE Websites -- All DOE Office Websites (Extended Search)

Using laser-driven neutrons to stop nuclear smugglers Using laser-driven neutrons to stop nuclear smugglers Using laser-driven neutrons to stop nuclear smugglers Researchers have successfully demonstrated for the first time that laser-generated neutrons can be enlisted as a useful tool in the War on Terror. June 4, 2013 A burst of laser energy 50 times greater than the worldwide output of electrical power slams into an extremely thin foil target to produce neutrons at Los Alamos National Laboratory's TRIDENT laser facility during a recent experiment, which proved that laser-driven neutrons can be used to detect and interdict smuggled nuclear materials. A burst of laser energy 50 times greater than the worldwide output of electrical power slams into an extremely thin foil target to produce neutrons at Los Alamos National Laboratory's TRIDENT laser facility during

Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Environment/Health/Safety/Security (EHSS): Stop Work Policy  

NLE Websites -- All DOE Office Websites (Extended Search)

Stop Work Policy stop All Berkeley Lab employees, contractors, and participating guests are responsible for stopping work activities that are considered to be an imminent danger....


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


Stopping Light All-Optically  

E-Print Network (OSTI)

We show that light pulses can be stopped and stored all-optically, with a process that involves an adiabatic and reversible pulse bandwidth compression occurring entirely in the optical domain. Such a process overcomes the fundamental bandwidth-delay constraint in optics, and can generate arbitrarily small group velocities for light pulses with a given bandwidth, without the use of any coherent or resonant light-matter interactions. We exhibit this process in optical resonator systems, where the pulse bandwidth compression is accomplished only by small refractive index modulations performed at moderate speeds. (Accepted for publication in Phys. Rev. Lett. Submitted on Sept. 10th 2003)

Mehmet Fatih Yanik; Shanhui Fan



RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


One Stop Information Shop: Personalized Content Recommendations  

4 Managed by UT-Battelle One Stop Information Shop: Personalized Content Recommendations for the U.S. Department of Energy Technology Leadership


One Stop Information Shop: Personalized Content Recommendations  

Onefor the U.S. Department of Energy Stop Information Shop Problem . 3 Managed by UT-Battelle ... Concept works in prototype, market acceptance unknown


Pathwise Optimization for Optimal Stopping Problems  

Science Conference Proceedings (OSTI)

We introduce the pathwise optimization (PO) method, a new convex optimization procedure to produce upper and lower bounds on the optimal value (the price) of a high-dimensional optimal stopping problem. The PO method builds on a dual characterization ... Keywords: American options, Bermudian options, dynamic programming, optimal control, optimal stopping

Vijay V. Desai; Vivek F. Farias; Ciamac C. Moallemi



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



Mobile Truck Stop Electrification Site Locator  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Truck Stop Electrification Site Locator Location Enter a city, postal code, or address Search Caution: The AFDC recommends that users verify that sites are open prior to making a...


Advanced Vehicle Testing Activity - Stop-Start Vehicles  

NLE Websites -- All DOE Office Websites (Extended Search)

Stop-Start Vehicles Stop-start Vehicles allow the internal combustion engine to shut-down when the vehicle stops in traffic, and re-start quickly to launch the vehicle. Fuel is...


Hanford Railcars Make Final Stop at B Reactor: Move Enhances...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Make Final Stop at B Reactor: Move Enhances Visitor Experience at Historic Reactor Hanford Railcars Make Final Stop at B Reactor: Move Enhances Visitor Experience at Historic...


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


Energy Savers: The One-Stop Shop for Energy Efficiency  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Savers: The One-Stop Savers: The One-Stop Shop for Energy Efficiency Building America Stakeholder Meeting Austin, TX Jayne Choi, Energy Analyst, CNT Energy March 1, 2012 CNT Center for Neighborhood Technology 33 year-old not-for-profit: 100 employees 2009 MacArthur Award Recipient Four issue areas: - Water - Transportation & community development - Climate - Energy Two affiliates: - CNT Energy - I-GO Car Sharing CNT Energy A division of the Center for Neighborhood Technology dedicated to helping communities and consumers save energy and money with: Dynamic Pricing and Smart Grid - Ameren Power Smart Pricing - ComEd Residential Real-Time Pricing Energy Efficient Buildings - Residential - Commercial and municipal buildings Regional Energy Planning - Sustainability plans for municipalities


Epoxy bond and stop etch fabrication method  

DOE Patents (OSTI)

A class of epoxy bond and stop etch (EBASE) microelectronic fabrication techniques is disclosed. The essence of such techniques is to grow circuit components on top of a stop etch layer grown on a first substrate. The first substrate and a host substrate are then bonded together so that the circuit components are attached to the host substrate by the bonding agent. The first substrate is then removed, e.g., by a chemical or physical etching process to which the stop etch layer is resistant. EBASE fabrication methods allow access to regions of a device structure which are usually blocked by the presence of a substrate, and are of particular utility in the fabrication of ultrafast electronic and optoelectronic devices and circuits.

Simmons, Jerry A. (Sandia Park, NM); Weckwerth, Mark V. (Pleasanton, CA); Baca, Wes E. (Albuquerque, NM)




Science Conference Proceedings (OSTI)

The design of accelerator components such as magnets, accelerator cavities and beam instruments tends to be a fairly standardized and collective effort within the particle accelerator community with well established performance, reliability and, in some cases, even budgetary criteria. Beam stop design, by contrast, has been comparatively subjective historically with much more general goals. This lack of rigor has lead to a variety of facility implementations with limited standardization and minimal consensus on approach to development within the particle accelerator community. At the Spallation Neutron Source (SNS), for example, there are four high power beam stops in use, three of which have significantly different design solutions. This paper describes the design of a new off-momentum beam stop for the SNS. The technical description of the system will be complemented by a discussion of design methodology. This paper presented an overview of the new SNS HEBT off-momentum beam stop and outlined a methodology for beam stop system design. The new beam stop consists of aluminium and steel blocks cooled by a closed-loop forced-air system and is expected to be commissioned this summer. The design methodology outlined in the paper represents a basic description of the process, data, analyses and critical decisions involved in the development of a beam stop system.

Polsky, Yarom [ORNL; Plum, Michael A [ORNL; Geoghegan, Patrick J [ORNL; Jacobs, Lorelei L [ORNL; Lu, Wei [ORNL; McTeer, Stephen Mark [ORNL




NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


Stopping power of weakly unstable plasmas  

SciTech Connect

An expression for the additional contribution to the stopping power of a weakly unstable plasma due to the modification of the beam--plasma collision operator by the presence of the unstable modes is derived and evaluated for a plasma with a flowing hot-electron tail, i.e., a bump-on-tail instability. It is found that the unstable plasma oscillations do not substantially alter the screening of the beam--plasma interaction.

Perez, J.D.; Payne, G.L.


Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Ion Stopping Powers and CT Numbers  

SciTech Connect

One of the advantages of ion beam therapy is the steep dose gradient produced near the ion's range. Use of this advantage makes knowledge of the stopping powers for all materials through which the beam passes critical. Most treatment planning systems calculate dose distributions using depth dose data measured in water and an algorithm that converts the kilovoltage X-ray computed tomography (CT) number of a given material to its linear stopping power relative to water. Some materials present in kilovoltage scans of patients and simulation phantoms do not lie on the standard tissue conversion curve. The relative linear stopping powers (RLSPs) of 21 different tissue substitutes and positioning, registration, immobilization, and beamline materials were measured in beams of protons accelerated to energies of 155, 200, and 250 MeV; carbon ions accelerated to 290 MeV/n; and iron ions accelerated to 970 MeV/n. These same materials were scanned with both kilovoltage and megavoltage CT scanners to obtain their CT numbers. Measured RLSPs and CT numbers were compared with calculated and/or literature values. Relationships of RLSPs to physical densities, electronic densities, kilovoltage CT numbers, megavoltage CT numbers, and water equivalence values converted by a treatment planning system are given. Usage of CT numbers and substitution of measured values into treatment plans to provide accurate patient and phantom simulations are discussed.

Moyers, Michael F., E-mail: MFMoyers@roadrunner.co [Department of Proton Therapy, Inc., Colton, CA (United States); Sardesai, Milind [Department of Long Beach Memorial Medical Center, Long Beach, CA (United States); Sun, Sean [Department of City of Hope National Medical Center, Duarte, CA (United States); Miller, Daniel W. [Department of Loma Linda University Medical Center, Loma Linda, CA (United States)



DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


Vehicle Technologies Office: Fact #787: July 8, 2013 Truck Stop...  

NLE Websites -- All DOE Office Websites (Extended Search)

7: July 8, 2013 Truck Stop Electrification Reduces Idle Fuel Consumption to someone by E-mail Share Vehicle Technologies Office: Fact 787: July 8, 2013 Truck Stop Electrification...


Vehicle Technologies Office: Fact #628: June 21, 2010 Truck Stop  

NLE Websites -- All DOE Office Websites (Extended Search)

8: June 21, 2010 8: June 21, 2010 Truck Stop Electrification Sites to someone by E-mail Share Vehicle Technologies Office: Fact #628: June 21, 2010 Truck Stop Electrification Sites on Facebook Tweet about Vehicle Technologies Office: Fact #628: June 21, 2010 Truck Stop Electrification Sites on Twitter Bookmark Vehicle Technologies Office: Fact #628: June 21, 2010 Truck Stop Electrification Sites on Google Bookmark Vehicle Technologies Office: Fact #628: June 21, 2010 Truck Stop Electrification Sites on Delicious Rank Vehicle Technologies Office: Fact #628: June 21, 2010 Truck Stop Electrification Sites on Digg Find More places to share Vehicle Technologies Office: Fact #628: June 21, 2010 Truck Stop Electrification Sites on AddThis.com... Fact #628: June 21, 2010 Truck Stop Electrification Sites


StopBadware comments on DHS and DOC Botnets RFI ...  

Science Conference Proceedings (OSTI)

... file downloads. StopBadware collaborates with Google and Mozilla to ensure that users encountering Page 2. malware ...



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


Synthetic gene design with a large number of hidden stops  

Science Conference Proceedings (OSTI)

Hidden stops are nucleotide triples TAA, TAG and TGA that appear on the second and third reading frames of a protein coding gene. Recent studies suggested the important role of hidden stops in preventing misread of mRNA. We study the problem of designing ... Keywords: back translation, bioinformatics, codons, gene design, hidden stops, mRNA, protein coding genes, synthetic biology

Vinhthuy Phan; Sudip Saha; Ashutosh Pandey; Tit-Yee Wong



Existence of stopping times for almost all integers. - CECM  

E-Print Network (OSTI)

... and Matthews and Watts [51], [52] have extended it to a larger class of functions. It is a measure of the difficulty of problems in this area that even the following...


Time to stop experimenting with UK renewable energy policy  

E-Print Network (OSTI)

this was appropriate when such plant was primarily thermal generation that would have been expected to run at close emerging non-renewable sources of low carbon power, for example carbon capture and storage. The paper draws learning effects is offered by the wind power sector. In the late 1980s commercial wind machines were crude


Sensitivity of nuclear stopping towards density dependent symmetry energy  

E-Print Network (OSTI)

The effect of density dependent symmetry energy on nuclear-stopping is studied using isospin-dependent quantum molecular dynamics model(IQMD). We have used the reduced isospin-dependent cross-section with soft(S) equation of state for the systems having different isostopic content, to explore the various aspects of nuclear stopping. The aim is to pin down the nature of the nuclear stopping with density dependent symmetry energy. Nuclear stopping is found to be sensitive towards the various forms of the density dependent symmetry energy. The nuclear stopping tends to decrease for the stiffer equation of state (EOS), i.e. larger values of gamma.

Karan Singh Vinayak; Suneel Kumar



Sensitivity of nuclear stopping towards density dependent symmetry energy  

E-Print Network (OSTI)

The effect of density dependent symmetry energy on nuclear-stopping is studied using isospin-dependent quantum molecular dynamics model(IQMD). We have used the reduced isospin-dependent cross-section with soft(S) equation of state for the systems having different isostopic content, to explore the various aspects of nuclear stopping. The aim is to pin down the nature of the nuclear stopping with density dependent symmetry energy. Nuclear stopping is found to be sensitive towards the various forms of the density dependent symmetry energy. The nuclear stopping tends to decrease for the stiffer equation of state (EOS), i.e. larger values of gamma.

Vinayak, Karan Singh



miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


Alternative Fuels Data Center: Truck Stop Electrification Site Data  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Fuels & Vehicles » Tools Fuels & Vehicles » Tools Printable Version Share this resource Send a link to Alternative Fuels Data Center: Truck Stop Electrification Site Data Collection Methods to someone by E-mail Share Alternative Fuels Data Center: Truck Stop Electrification Site Data Collection Methods on Facebook Tweet about Alternative Fuels Data Center: Truck Stop Electrification Site Data Collection Methods on Twitter Bookmark Alternative Fuels Data Center: Truck Stop Electrification Site Data Collection Methods on Google Bookmark Alternative Fuels Data Center: Truck Stop Electrification Site Data Collection Methods on Delicious Rank Alternative Fuels Data Center: Truck Stop Electrification Site Data Collection Methods on Digg Find More places to share Alternative Fuels Data Center: Truck Stop


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


Boondocks Truck Stop Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Boondocks Truck Stop Wind Farm Boondocks Truck Stop Wind Farm Jump to: navigation, search Name Boondocks Truck Stop Wind Farm Facility Boondocks Truck Stop Sector Wind energy Facility Type Small Scale Wind Facility Status In Service Owner Boondocks Truck Stop Energy Purchaser Boondocks Truck Stop Location IA Coordinates 42.4703°, -93.5624° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.4703,"lon":-93.5624,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Measuring Lifetimes of Long-Lived Charged Massive Particles Stopped in LHC Detectors  

Science Conference Proceedings (OSTI)

Long-lived charged massive particles (CHAMPs) appear in various particle physics models beyond the standard model. In this Letter, we discuss the prospects for studying the stopping and decaying events of such long-lived CHAMPs at the LHC detectors, and show that the lifetime measurement (and the study of decay products) is possible with the LHC detectors for a wide range of the lifetime O(0.1)-O(10{sup 10}) sec, by using periods of no pp collision. Even a short lifetime of order 1 sec can be measured by (i) identifying the stopping event with the on-line event filter, (ii) immediately making a beam-dump signal which stops the pp collision of the LHC, and at the same time (iii) changing the trigger menu to optimize it for the detection of a CHAMP decay in the calorimeter. Other possibilities are also discussed.

Asai, Shoji; Shirai, Satoshi [Department of Physics, University of Tokyo, Tokyo 113-0033 (Japan); Hamaguchi, Koichi [Department of Physics, University of Tokyo, Tokyo 113-0033 (Japan); Institute for the Physics and Mathematics of the Universe, University of Tokyo, Chiba 277-8568 (Japan)


Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Pulling Out All the Stops: Searching for RPV SUSY with Stop-Jets  

E-Print Network (OSTI)

If the lighter stop eigenstate decays directly to two jets via baryonic R-parity violation, it could have escaped existing LHC and Tevatron searches in four-jet events, even for masses as small as 100 GeV. In order to recover sensitivity in the face of increasingly harsh trigger requirements at the LHC, we propose a search for stop pairs in the highly-boosted regime, using the approaches of jet substructure. We demonstrate that the four-jet triggers can be completely bypassed by using inclusive jet-H_T triggers, and that the resulting QCD continuum background can be processed by substructure methods into a featureless spectrum suitable for a data-driven bump-hunt down to 100 GeV. We estimate that the LHC 8 TeV run is sensitive to 100 GeV stops with decays of any flavor at better than 5-sigma level, and could place exclusions up to 300 GeV or higher. Assuming Minimal Flavor Violation and running a b-tagged analysis, exclusion reach may extend up to nearly 400 GeV. Longer-term, the 14 TeV LHC at 300/fb could extend these mass limits by a factor of two, while continuing to improve sensitivity in the 100 GeV region.

Yang Bai; Andrey Katz; Brock Tweedie



The Borneo Project : Indonesia Fails to Stop Illegal Logging, Report Says Indonesia Fails to Stop Illegal Logging, Report Says  

E-Print Network (OSTI)

The Borneo Project : Indonesia Fails to Stop Illegal Logging, Report Says Indonesia Fails to Stop Illegal Logging, Report Says by Irwan Firdaus, The Associated Press January 15th, 2003 JAKARTA, Indonesia -- Corruption in Indonesia's police and military has contributed to a surge in illegal logging that has


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



Search for strange tribaryon states in the inclusive ^4He(K^{-}_{stopped}, p) reaction  

E-Print Network (OSTI)

A search for tribaryon states was performed at KEK-PS. We adopted the $^4$He($K^-_{stopped}, p)$ reaction to populate the states with strangeness -1, charge 0 and isospin 1. No significant narrow structure was observed in the mass region from 3000 to 3200 MeV/c^2 in an inclusive missing mass spectrum. The upper limit of the formation branching ratio was determined to be ($1\\sim3)\\times 10^{-4}$, ($0.7\\sim2)\\times 10^{-3}$ and ($2\\sim8) \\times 10^{-3}$/($stopped K^{-}$) with 95 % confidence level for narrow states with an assumed width of 0, 20 and 40 MeV/c^2, respectively.

M. Sato; H. Bhang; J. Chiba; Seonho Choi; Y. Fukuda; T. Hanaki; R. S. Hayano; M. Iio; T. Ishikawa; S. Ishimoto; T. Ishiwatari; K. Itahashi; M. Iwai; M. Iwasaki; P. Kienle; J. H. Kim; Y. Matsuda; H. Ohnishi; S. Okada; H. Outa; S. Suzuki; T. Suzuki; D. Tomono; E. Widmann; T. Yamazaki; H. Yim



Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)



Obama Administration's Rural Tour Stops in Western Alaska | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Administration's Rural Tour Stops in Western Alaska Administration's Rural Tour Stops in Western Alaska Obama Administration's Rural Tour Stops in Western Alaska August 13, 2009 - 12:00am Addthis WASHINGTON D.C. - Four Cabinet Secretaries brought the Obama Administration's Rural Tour to rural Alaska today, with stops in Bethel and Hooper Bay, representing the largest Cabinet-level delegation to visit the state. Energy Secretary Steven Chu, Housing and Urban Development Secretary Shaun Donovan, Education Secretary Arne Duncan, and Agriculture Secretary Tom Vilsack held a public forum and indivdual stakeholder meetings in Bethel. The Secretaries toured a school, a housing development and wind turbines in Hooper Bay, a coastal fishing village. President Obama announced the launch of his Administration's Rural Tour in


Design and evaluation of BRT and limited-stop services  

E-Print Network (OSTI)

Many transit agencies operate limited-stop or Bus Rapid Transit (BRT) services overlapped with local services in corridors with high demand. These service strategies have the potential to improve bus performance as well ...

Scorcia, Harvey (Harvey Manuel Scorcia Tenjo)



Capitol Christmas tree stops in Amarillo | National Nuclear Security  

National Nuclear Security Administration (NNSA)

Capitol Christmas tree stops in Amarillo | National Nuclear Security Capitol Christmas tree stops in Amarillo | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > NNSA Blog > Capitol Christmas tree stops in Amarillo Capitol Christmas tree stops in Amarillo Posted By Office of Public Affairs Pantex employees on Saturday got a chance to check out the 2013 Capitol


Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls



E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Licensing stop place before laterals : a study of acoustic cues relevant to the perception of stop-lateral sequences  

E-Print Network (OSTI)

In phonological analyses of both adult and child language, a *dl constraint has frequently been used as a shorthand to indicate that coronal stops are dispreferred before laterals (Dinnsen et al. 2001). This dispreference ...

Michaels, Jennifer M. (Jennifer Marie)



Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Top Polarization in Stop Production at the LHC  

E-Print Network (OSTI)

We survey the expected polarization of the top produced in the decay of a scalar top quark, $\\tilde t \\rightarrow {\\tilde t}\\chi_i^0, i =1-2$. The phenomenology is quite interesting, since the expected polarization depends both on the mixing in the stop and neutralino sectors and on the mass differences between the stop and the neutralino. We find that a mixed stop behaves almost like a right-handed stop due to the larger hypercharge that enters the stop/top/gaugino coupling and that these polarisation effects disappear, when $m_{\\tilde t_1} \\approx m_t+m_{\\tilde\\chi^0_i}$. After a discussion on the expected top polarization from the decay of a scalar top quark, we focus on the interplay of polarization and kinematics at the LHC. We discuss different probes of the top polarization in terms of lab-frame observables. We find that these observables faithfully reflect the polarization of the parent top-quark, but also have a non-trivial dependence on the kinematics of the stop production and decay process. In addition, we illustrate the effect of top polarization on the energy and transverse momentum of the decay lepton in the laboratory frame. Our results show that both spectra are softened substantially in case of a negatively polarized top, particularly for a large mass difference between the stop and the neutralino. Thus, the search strategies, and the conclusions that can be drawn from them, depends not just on the mass difference $m_{\\tilde t} - m_{\\tilde\\chi_{i}^{0}}$ due to the usual kinematic effects but also on the effects of top polarization on the decay kinematics the extent of which depends in turn on the said mass difference.

G. Belanger; R. M. Godbole; L. Hartgring; I. Niessen



Stealth Stops and Spin Correlation: A Snowmass White Paper  

E-Print Network (OSTI)

Stops with the mass nearly degenerate with the top mass, decaying into tops and soft neutralinos, are usually dubbed "stealth stops". Their kinematics looks very similar to that of the standard tops events, which leads to events with little or no excess of missing transverse energy. This complicates the probing of this region of the stop parameter space by hadron colliders, rendering the application of standard searching techniques challenging. In this Snowmass white paper we reanalyze the spin correlation approach to the search of stealth stops, focusing on the feasibility of this search at the 14 TeV LHC. We find, while the statistical limitations significantly shrink compared to the low-luminosity 8 TeV run, the systematic PDF uncertainties pose the main obstacle. We show that the current understanding of PDFs probably does not allow us to talk about top and stop discrimination via spin correlation in the inclusive sample. On the other hand the systematic uncertainties significantly shrink if only events with low center of mass energy are considered, rendering the search in this region feasible.

Zhenyu Han; Andrey Katz



NREL: Fleet Test and Evaluation - Truck Stop Electrification  

NLE Websites -- All DOE Office Websites (Extended Search)

Stop Electrification Stop Electrification NREL's Fleet Test and Evaluation Team is evaluating and documenting the use of 50 truck stop electrification (TSE) sites along the busiest transportation corridors in the United States. Truck drivers typically idle their vehicles during mandated rest periods to maintain access to air conditioning, heat, and electricity. TSE sites allow truckers to enjoy these auxiliary systems by plugging into the electric grid instead of running their engines. The American Recovery and Reinvestment Act (ARRA) provided funding for these TSE sites-which feature electric power pedestals at 1,250 truck parking spaces-and for rebates to upgrade 5,000 long-haul trucks for drivers who agreed to use the facilities. Site usage will be monitored for three years to study patterns across the


Role of density dependent symmetry energy in nuclear stopping  

E-Print Network (OSTI)

Information about the nuclear matter under the extreme conditions of temperature and density and the role of symmetry energy under these conditions is still a topic of crucial importance in the present day nuclear physics research. The multifragmentation, collective flow and the nuclear stopping is among the various rare phenomenon which can be observed in heavy-ion collisions at intermediate energies. The nuclear stopping, which is sensitive towards the symmetry energy has gained a lot of interest because it provides the possibility to examine the degree of thermalization or equilibration in the matter. Aim of the present study is to pin down the nuclear stopping for the different forms of density dependent symmetry energy

Vinayak, Karan Singh


Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Role of density dependent symmetry energy in nuclear stopping  

E-Print Network (OSTI)

Information about the nuclear matter under the extreme conditions of temperature and density and the role of symmetry energy under these conditions is still a topic of crucial importance in the present day nuclear physics research. The multifragmentation, collective flow and the nuclear stopping is among the various rare phenomenon which can be observed in heavy-ion collisions at intermediate energies. The nuclear stopping, which is sensitive towards the symmetry energy has gained a lot of interest because it provides the possibility to examine the degree of thermalization or equilibration in the matter. Aim of the present study is to pin down the nuclear stopping for the different forms of density dependent symmetry energy

Karan Singh Vinayak; Suneel Kumar



,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Electroweak baryogenesis and the Higgs and stop masses  

E-Print Network (OSTI)

In this talk we review the actual situation concerning electroweak phase transition and baryogenesis in the minimal supersymmetric extension of the Standard Model. A strong enough phase transition requires light Higgs and stop eigenstates. For a Higgs mass in the range 110--115 GeV, there is a stop window in the range 105--165 GeV. If the Higgs is heavier than 115 GeV, stronger constrains are imposed on the space of supersymmetric parameters. A baryon-to-entropy ratio is generated by the chargino sector provided that the $\\mu$ parameter has a CP-violating phase larger than $\\sim$ 0.04.

Mariano Quiros



Bottom-Fill Method for Stopping Leaking Oil Wells  

E-Print Network (OSTI)

Hardware failure at the top of a deep underwater oil well can result in a catastrophic oil leak. The enormous pressure lifting the column of oil in that well makes it nearly impossible to stop from the top with seals or pressurization. We propose to fill the bottom of the well with dense and possibly streamlined objects that can descend through the rising oil. As they accumulate, those objects couple to the oil via viscous and drag forces and increase the oil's effective density. When its effective density exceeds that of the earth's crust, the oil will have essentially stopped flowing.

Bloomfield, Louis A



Reach in All Hadronic Stop Decays: A Snowmass White Paper  

E-Print Network (OSTI)

We study the discovery prospects for stops which decay to a top and a light neutralino. We consider fully hadronic decays of the tops and present an estimate for the reach at various future collider runs. Our results are summarized in Table 1.

Stolarski, Daniel



Reach in All Hadronic Stop Decays: A Snowmass White Paper  

E-Print Network (OSTI)

We study the discovery prospects for stops which decay to a top and a light neutralino. We consider fully hadronic decays of the tops and present an estimate for the reach at various future collider runs. Our results are summarized in Table 1.

Daniel Stolarski



File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


Why alite stops hydrating below 80% relative humidity  

Science Conference Proceedings (OSTI)

It has been observed that the hydration of cement paste stops when the relative humidity drops below about 80%. A thermodynamic analysis shows that the capillary pressure exerted at that RH shifts the solubility of tricalcium silicate, so that it is in equilibrium with water. This is a reflection of the chemical shrinkage in this system: according to Le Chatelier's principle, since the volume of the products is less than that of the reactants, a negative (capillary) pressure opposes the reaction.

Flatt, Robert J. [Sika Technology AG, Zuerich (Switzerland); Scherer, George W., E-mail: scherer@princeton.edu [Princeton University, Eng. Quad. E-319, Princeton NJ 08544 (United States); Bullard, Jeffrey W. [National Institute of Standards and Technology, Gaithersburg MD (United States)



Alternative Fuels Data Center: Truck Stop Electrification for Heavy-Duty  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Truck Stop Truck Stop Electrification for Heavy-Duty Trucks to someone by E-mail Share Alternative Fuels Data Center: Truck Stop Electrification for Heavy-Duty Trucks on Facebook Tweet about Alternative Fuels Data Center: Truck Stop Electrification for Heavy-Duty Trucks on Twitter Bookmark Alternative Fuels Data Center: Truck Stop Electrification for Heavy-Duty Trucks on Google Bookmark Alternative Fuels Data Center: Truck Stop Electrification for Heavy-Duty Trucks on Delicious Rank Alternative Fuels Data Center: Truck Stop Electrification for Heavy-Duty Trucks on Digg Find More places to share Alternative Fuels Data Center: Truck Stop Electrification for Heavy-Duty Trucks on AddThis.com... More in this section... Idle Reduction Benefits & Considerations Heavy-Duty Vehicles


California Is the Primary U.S. Stop for LHC's ALICE Data - NERSC...  

NLE Websites -- All DOE Office Websites (Extended Search)

Is the Primary U.S. Stop for LHC's ALICE Data California Is the Primary U.S. Stop for LHC's ALICE Data July 30, 2010 | Tags: Fusion Energy Contact: Linda Vu, lvu@lbl.gov, +1 510...


Alternative Fuels Data Center: U.S. Truck Stop Electrification Locations  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Conserve Fuel Conserve Fuel Printable Version Share this resource Send a link to Alternative Fuels Data Center: U.S. Truck Stop Electrification Locations to someone by E-mail Share Alternative Fuels Data Center: U.S. Truck Stop Electrification Locations on Facebook Tweet about Alternative Fuels Data Center: U.S. Truck Stop Electrification Locations on Twitter Bookmark Alternative Fuels Data Center: U.S. Truck Stop Electrification Locations on Google Bookmark Alternative Fuels Data Center: U.S. Truck Stop Electrification Locations on Delicious Rank Alternative Fuels Data Center: U.S. Truck Stop Electrification Locations on Digg Find More places to share Alternative Fuels Data Center: U.S. Truck Stop Electrification Locations on AddThis.com... U.S. Truck Stop Electrification Locations


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


Your First Stop for Clean Energy Policy Support (Fact Sheet)  

SciTech Connect

The Clean Energy Solutions Center, an initiative of the Clean Energy Ministerial and UN-Energy, helps governments design and adopt policies and programs that support the deployment of transformational low-carbon technologies. The Solutions Center serves as a first-stop clearinghouse of clean energy policy reports, data, and tools and provides expert assistance and peer-to-peer learning forums. This factsheet highlights key Solutions Center offerings, including 'ask an expert' assistance on clean energy policy matters, training and peer learning, and technical resources for policy makers worldwide.

Not Available


Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Your First Stop for Clean Energy Policy Support (Fact Sheet)  

SciTech Connect

The Clean Energy Solutions Center, an initiative of the Clean Energy Ministerial and UN-Energy, helps governments design and adopt policies and programs that support the deployment of transformational low-carbon technologies. The Solutions Center serves as a first-stop clearinghouse of clean energy policy reports, data, and tools and provides expert assistance and peer-to-peer learning forums. This factsheet highlights key Solutions Center offerings, including 'ask an expert' assistance on clean energy policy matters, training and peer learning, and technical resources for policy makers worldwide.



U-158: HP NonStop Server Java Multiple Vulnerabilities | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

8: HP NonStop Server Java Multiple Vulnerabilities 8: HP NonStop Server Java Multiple Vulnerabilities U-158: HP NonStop Server Java Multiple Vulnerabilities April 30, 2012 - 7:00am Addthis PROBLEM: HP NonStop Server Java Multiple Vulnerabilities PLATFORM: HP NonStop Server 6.x ABSTRACT: Multiple vulnerabilities have been reported in HP NonStop Server Reference links: Secunia Advisory SA48977 CVE-2011-3547 CVE-2011-3551 CVE-2011-3553 IMPACT ASSESSMENT: High Discussion: HP has acknowledged multiple vulnerabilities in HP NonStop Server, which can be exploited by malicious users to disclose sensitive information and by malicious people to disclose sensitive information, manipulate certain data, cause a DoS (Denial of Service), and compromise a vulnerable system. Impact: Successful exploitation of this vulnerability may allow remote manipulation


A thermal analysis model for high power density beam stops  

SciTech Connect

The Lawrence Berkeley National Laboratory (LBNL) is presently designing and building the 2.5 MeV injector for the Spallation Neutron Source (SNS). The design includes various beam intercepting devices such as beam stops and slits. The target power densities can be as high as 500 kW/cm{sup 2} with a beam stopping range of 25 to 30 microns, producing stresses well above yield in most materials. In order to analyze the induced temperatures and stresses, a finite element model has been developed. The model has been written parametrically to allow the beam characteristics, target material, dimensions, angle of incidence and mesh densities to be easily adjusted. The heat load is applied to the model through the use of a 3-dimensional table containing the calculated volumetric heat rates. The load is based on a bi-gaussian beam shape which is absorbed by the target according to a Bragg peak distribution. The results of several analyses using the SNS Front End beam are presented.

Virostek, S.; Oshatz, D.; Staples, J.



Creation of a homogeneous plasma column by means of hohlraum radiation for ion-stopping measurements  

E-Print Network (OSTI)

In this work, we present the results of two-dimensional radiation-hydrodynamics simulations of a hohlraum target whose outgoing radiation is used to produce a homogeneously ionized carbon plasma for ion-beam stopping measurements. The cylindrical hohlraum with gold walls is heated by a frequency-doubled (\\lambda_l = 526.5 \\mu m) 1.4 ns long laser pulse with the total energy of E_l = 180 J. At the laser spot, the peak matter and radiation temperatures of, respectively, T ~ 380 eV and T_r ~ 120 eV are observed. X-rays from the hohlraum heat the attached carbon foam with a mean density of \\rho_C = 2 mg/cm^3 to a temperature of T ~ 25 eV. The simulation shows that the carbon ionization degree (Z ~ 3.75) and its column density stay relatively stable (within variations of about +-7%) long enough to conduct the ion-stopping measurements. Also, it is found that a special attention should be paid to the shock wave, emerging from the x-ray heated copper support plate, which at later times may significantly distort the ...

Faik, Steffen; Basko, Mikhail M; Maruhn, Joachim A; Rosmej, Olga; Rienecker, Tim; Novikov, Vladimir G; Grushin, Alexander S



DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Stopping executions, saving computers with new malware detection tool  

NLE Websites -- All DOE Office Websites (Extended Search)

Saving computers with new malware detection tool Saving computers with new malware detection tool Stopping executions, saving computers with new malware detection tool A computer tool that allows the machine to identify malicious executable files without being exposed to their harmful actions. October 21, 2009 Los Alamos National Laboratory sits on top of a once-remote mesa in northern New Mexico with the Jemez mountains as a backdrop to research and innovation covering multi-disciplines from bioscience, sustainable energy sources, to plasma physics and new materials. Los Alamos National Laboratory sits on top of a once-remote mesa in northern New Mexico with the Jemez mountains as a backdrop to research and innovation covering multi-disciplines from bioscience, sustainable energy sources, to plasma physics and new materials.


Truck Stop Electrification: A Cost-Effective Solution to Reducing Truck Idling  

Science Conference Proceedings (OSTI)

Truck stop electrification (TSE) allows truckers to "plug in" their vehicles while stopped, in order to operate air conditioning, heating, and appliances without any engine idling. Truck stop electrification technologies fall into two major categories: "off-board" and "on-board" systems. Off-board systems are fixed, stand-alone units installed at the truck parking space. These systems provide heating, ventilating, and air conditioning (HVAC), and may also include AC electrical power and entertainment, co...



Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



ANL/APS/TB-20 Bremsstrahlung Scattering Calculations for the Beam Stops  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Bremsstrahlung Scattering Calculations for the Beam Stops and Collimators in the APS Insertion-Device Beamlines P. K. Job, D. R. Haeffner, and D. Shu Contents 1. Introduction........................................................................................................1 2. Calculation Method............................................................................................2 3. Results and Discussion ......................................................................................3 a. Thick Lead and Tungsten Targets................................................................3 b. Monochromatic Aperture and Bremsstrahlung Stop ...................................4 c. Collimators for the White-Beam Transport .................................................5


Plasmonic Nanolasers Without Cavity, Threshold and Diffraction Limit using Stopped Light  

E-Print Network (OSTI)

We present a plasmonic waveguide where light pulses are stopped at well-accessed complex-frequency zero-group-velocity points. Introducing gain at such points results in cavity-free, "thresholdless" nanolasers beating the diffraction limit via a novel, stopped-light mode-locking mechanism.

Tsakmakidis, Kosmas L; Pickering, Tim W; Hess, Ortwin



Subfreezing Start/Stop Protocol for an Advanced Metallic Open-Flowfield Fuel Cell Stack  

NLE Websites -- All DOE Office Websites (Extended Search)

Subfreezing Start/Stop Protocol for an Advanced Subfreezing Start/Stop Protocol for an Advanced Subfreezing Start/Stop Protocol for an Advanced Subfreezing Start/Stop Protocol for an Advanced Subfreezing Start/Stop Protocol for an Advanced Metallic Open Metallic Open Metallic Open Metallic Open- - - -Flowfield Flowfield Flowfield Flowfield Fuel Cell Stack Fuel Cell Stack Fuel Cell Stack Fuel Cell Stack Presented at: US DOE New Projects Kickoff Meeting Washington, DC 13-14 February 2007 Alternative Energy Efficient Simple Clean Today Alternative Energy Efficient Simple Clean Today Objective Objective Objective Objective This project will demonstrate a PEM fuel cell stack that is able to perform and start up in subfreezing conditions, respecting allowed energy budget, and showing limited impact at extreme temperatures over multiple


Ion Distribution And Electronic Stopping Power For Au ions In Silicon Carbide  

SciTech Connect

Accurate knowledge of ion distribution and electronic stopping power for heavy ions in light targets is highly desired due to the large errors in prediction by the widely used Stopping and Range of Ions in Matter (SRIM) code. In this study, Rutherford backscattering spectrometry (RBS)and secondary ion mass spectrometry (SIMS) are used as complementary techniques to determine the distribution of Au ions in SiC with energie sfrom 700 keV to 15 MeV. In addition, asingle ion technique with an improved data analysis procedure is applied to measure the electronic stopping power for Au ions in SiC with energies up to ~70 keV/nucleon. Large overestimation of the electronic stopping power is found by SRIM prediction in the low energy regime up to ~50 keV/nucleon. The stopping power data and the ion ranges are crosschecked with each other and a good agreement is achieved.

Jin, Ke; Zhang, Yanwen; Xue, Haizhou; Zhu, Zihua; Weber, William J.



Stop for a moment and think about the number of times you use computers, printers, power  

E-Print Network (OSTI)

can be found in OSHA 29 CFR 1910.305, NFPA 70E Art. 110.9(B)(3) and NFPA 70E Art. 420 it until repairs and tests necessary to render the equipment safe have been made. In the NFPA code, OSHA



Science Conference Proceedings (OSTI)

... Measurements. Lewis Publishers: Chelsea, MI, p. 193 Page 8. ... hands. I've trusted system manufacturers to handle this. Should I have? ...



Automatic generation of stop word lists for information retrieval and analysis  

DOE Patents (OSTI)

Methods and systems for automatically generating lists of stop words for information retrieval and analysis. Generation of the stop words can include providing a corpus of documents and a plurality of keywords. From the corpus of documents, a term list of all terms is constructed and both a keyword adjacency frequency and a keyword frequency are determined. If a ratio of the keyword adjacency frequency to the keyword frequency for a particular term on the term list is less than a predetermined value, then that term is excluded from the term list. The resulting term list is truncated based on predetermined criteria to form a stop word list.

Rose, Stuart J


Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Hanford Railcars Make Final Stop at B Reactor: Move Enhances Visitor  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Hanford Railcars Make Final Stop at B Reactor: Move Enhances Hanford Railcars Make Final Stop at B Reactor: Move Enhances Visitor Experience at Historic Reactor Hanford Railcars Make Final Stop at B Reactor: Move Enhances Visitor Experience at Historic Reactor May 10, 2011 - 12:00pm Addthis Media Contacts Cameron Hardy, DOE (509) 376-5365 Cameron.Hardy@rl.doe.gov Andre Armstrong, CH2M HILL (509) 376-6773 Andre_l_Armstrong@rl.gov RICHLAND, WASH. - Two locomotives that hauled irradiated fuel around the Hanford Site for a half-century will reach their final stop this week when they are delivered to the Historic B Reactor for preservation and public display. The two locomotives are among 16 railcars from Hanford's 200 North Area being removed by Department of Energy (DOE) contractor CH2M HILL Plateau Remediation Company (CH2M HILL).


DOE Takes Action to Stop the Sales of Air-Con Air Conditioner Models Shown  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Takes Action to Stop the Sales of Air-Con Air Conditioner Takes Action to Stop the Sales of Air-Con Air Conditioner Models Shown to Violate Federal Energy Efficiency Appliance Standards DOE Takes Action to Stop the Sales of Air-Con Air Conditioner Models Shown to Violate Federal Energy Efficiency Appliance Standards September 23, 2010 - 12:00am Addthis Washington, DC - The Department of Energy announced today that it has taken action against Air-Con, International, requiring the company to stop selling certain air conditioning systems in the U.S. that have been shown to violate minimum energy efficiency appliance standards. DOE is proposing a civil penalty of more than $230,000 for importing and distributing these inefficient cooling products. This action and the proposed penalties are part of the Department's continued commitment to act aggressively to remove


DOE Takes Action to Stop the Sales of Air-Con Air Conditioner...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

action against Air-Con, International, requiring the company to stop selling certain air conditioning systems in the U.S. that have been shown to violate minimum energy...


Quantifying the Effects of Idle-Stop Systems on Fuel Economy...  

NLE Websites -- All DOE Office Websites (Extended Search)

INLEXT-12-27320 Quantifying the Effects of Idle-Stop Systems on Fuel Economy in Light- Duty Passenger Vehicles Jeffrey Wishart Matthew Shirk Contract No. DE-FC26-05NT42486...


Pneumatic brake control for precision stopping of heavy-duty vehicles  

E-Print Network (OSTI)

stopping of a 40 foot CNG bus for the Bus Precision Dockingfor two different 40 foot CNG buses (c1 and c2). Althoughpressure of two different CNG buses (c1 and c2) speeds since

Bu, Fanping; Tan, Han-Shue



WorldWideScience provides a one-stop search engine to mine global...  

NLE Websites -- All DOE Office Websites (Extended Search)

WorldWideScience provides a one-stop search engine to mine global scientific databases in the deep web News Featured Articles Science Headlines 2013 2012 2011 2010 2009 2008 2007...


Digestion time  

NLE Websites -- All DOE Office Websites (Extended Search)

Digestion time Digestion time Name: Don Mancosh Location: N/A Country: N/A Date: N/A Question: I have always given the rule of thumb in class that material we eat is with us for about 24 hours before exiting the body. The question arises about the time value of liquids. Getting a big coke prior to a 3 hour drive generally means that there will be a stop along the way. Is there a generalization made about liquids in the body similar to the one for solid food? Replies: A physician would give a better answer, but I hazard this: the only liquids which people consume (deliberately) in significant quantities are water, ethyl alcohol and various oils. Water and alcohol are absorbed on a time scale of seconds to minutes through the mouth, stomach and digestive tract. The oils are huge molecules, so I'd guess like any other greasy food they get absorbed in the upper digestive tract. Some of them, perhaps the longest and most nonpolar, are not absorbed at all --- cf. the old-time remedy of mineral oil for constipation --- so there should be some average time-before-what's-left-is-excreted such as you're looking for, and my (wild) guess is that it would not differ substantially from that for food. You can define an average lifetime in the body for alcohol, since the natural level is zero. Rough guidelines are widespread in the context of drunk driving laws. But this is not really possible for water. One's body is normally full up to the brim with water, and there's no way for the body to distinguish between water molecules recently absorbed and molecules that've been moping around since the Beatles split up. Thus the water entering the toilet bowl after the pit stop is not in general the same water as was in the big coke. If you were to consider for water just the average time between drinking and peeing, it would seem to depend strongly on how well hydrated the body was before the drink, and how much was drunk. During sustained heavy exertion in the sun and dry air one can easily drink a pint of water an hour without peeing at all. On the other hand, if one is willing to drink enough water fast enough, so as to establish a high excess of body water one can pee 8 ounces 15 minutes or less after drinking 8 ounces.


An evaluation of supplemental signing at two-way stop-controlled intersections  

E-Print Network (OSTI)

Drivers entering a two-way stop-controlled (TWSC) intersection with similar approach geometries and volumes may make the incorrect assumption that all approach legs are required to stop at the intersection. To respond to this safety concern, traffic engineers developed supplemental signs to remind drivers on the stop-controlled roadway that vehicles on the major roadway are not required to stop. The signs are generally placed directly underneath the STOP sign with a typical legend "CROSS TRAFFIC DOES NOT STOP." The objective of this thesis was to investigate the effectiveness of these signs in reducing conflicts and accidents at TWSC intersections. Traffic conflict and accident data were obtained for six TWSC intersections in Texas; three locations where supplemental signs had been installed and three locations with only a standard STOP sign. Only cross traffic conflicts/accidents were analyzed. A cross traffic accident/conflict was defined as an incident involving a vehicle on the stopped approach and a vehicle on the through approach. Conflict data were collected with a video camera mounted on 9.1 meter telescoping mast, Accident and conflicts were not significantly different where supplemental signs have been installed. Probability distributions were developed to establish 90 percentile levels for both accidents and conflicts at TWSC intersections with 5,000 to I 0,000 total entering vehicles per day. These values were found to be 18 conflicts per day and a mean accident frequency of five per year. The relationship between conflict and accident frequency was determined to be a positive linear relationship. The recommendations provide guidelines for future evaluations of safety at TWSC intersections.

Schuckel, Clint Edwin



Stop the Waste: Making Measurements Measure Up to ...  

Science Conference Proceedings (OSTI)

... On the other hand, bring your US cell phone overseas and you may spend lots of time and money in frustration before you can finally call your ...



Nonlinear normal modes of a two degree of freedom oscillator with a bilateral elastic stop  

E-Print Network (OSTI)

A study of the non linear modes of a two degree of freedom mechanical system with bilateral elastic stop is considered. The issue related to the non-smoothness of the impact force is handled through a regularization technique. In order to obtain the Nonlinear Normal Mode (NNM), the harmonic balance method with a large number of harmonics, combined with the asymptotic numerical method, is used to solve the regularized problem. These methods are present in the software "package" MANLAB. The results are validated from periodic orbits obtained analytically in the time domain by direct integration of the non regular problem. The two NNMs starting respectively from the two linear normal modes of the associated underlying linear system are discussed. The energy-frequency plot is used to present a global vision of the behavior of the modes. The dynamics of the modes are also analyzed comparing each periodic orbits and modal lines. The first NNM shows an elaborate dynamics with the occurrence of multiple impacts per period. On the other hand, the second NNM presents a more simple dynamics with a localization of the displacement on the first mass.

El Hadi Moussi; Sergio Bellizzi; Bruno Cochelin; I. Nistor



Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


How I Learned to Stop Worrying and Love Professional Energy Assessments |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

How I Learned to Stop Worrying and Love Professional Energy How I Learned to Stop Worrying and Love Professional Energy Assessments How I Learned to Stop Worrying and Love Professional Energy Assessments April 19, 2011 - 10:59am Addthis Josiah Narog Staff with the Washington State University Extension Energy Program Several years ago my family moved into a beautiful townhouse. The neighborhood was lovely, there was a gigantic park directly across the sleepy residential street, and it was close enough to my work to bike every day (though I must admit I didn't take advantage of this option every day...). In short, it was perfect for our young and growing family. My oldest daughter, Emily, was eight when we moved in, and my wife and I were blessed with a new baby girl soon after. When I moved in to the home I was pretty


Stop Paying for Energy You Aren't Using | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Stop Paying for Energy You Aren't Using Stop Paying for Energy You Aren't Using Stop Paying for Energy You Aren't Using January 6, 2009 - 4:00am Addthis Allison Casey Senior Communicator, NREL Back in October, we heard a lot about "energy vampires." A very convenient holiday metaphor, to be sure, but you're probably not in the Halloween spirit in January. Nonetheless, you may be in the mood to reduce your energy costs, and standby power is something worth considering all year round. Standby power is the minimum power used when a product is plugged in. That doesn't necessarily mean the product is "on" or "attached to your cell phone"-yup, just plugged in. Obviously, a lot of products need to stay plugged in even when you're not using them; you wouldn't, for instance, unplug your digital clock when you leave the room and plug it


Energy Efficiency Tricks to Stop Your Energy Bill from Haunting You |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Tricks to Stop Your Energy Bill from Haunting You Tricks to Stop Your Energy Bill from Haunting You Energy Efficiency Tricks to Stop Your Energy Bill from Haunting You October 21, 2013 - 2:07pm Addthis This Halloween, keep ghosts and goblins at bay -- while saving energy and money -- with these home energy efficiency tricks. | Infographic by Sarah Gerrity, Energy Department. This Halloween, keep ghosts and goblins at bay -- while saving energy and money -- with these home energy efficiency tricks. | Infographic by Sarah Gerrity, Energy Department. Rebecca Matulka Rebecca Matulka Digital Communications Specialist, Office of Public Affairs What are the key facts? The typical American family spends at least $2,000 a year on their home energy bills. Families can save up to 20-30 percent on their energy bills by


DOE and FERC Joint Public Statement on Back Stop Siting | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FERC Joint Public Statement on Back Stop Siting FERC Joint Public Statement on Back Stop Siting DOE and FERC Joint Public Statement on Back Stop Siting October 11, 2011 - 1:32pm Addthis Washington, D.C. - U.S. Energy Secretary Steven Chu announced today his decision that the Department of Energy will work more closely with the Federal Energy Regulatory Commission (FERC) in reviewing proposed electric transmission projects under section 216 of the Federal Power Act (FPA), as an alternative to delegating additional authority to FERC. Chu said, "This nation promptly needs to build the electric grid of the 21st century to compete in the global economy. Enhanced cooperation between DOE and FERC is the best way to help achieve this goal. I look forward to working with Chairman Wellinghoff as we take steps to ease


U.S. Works With Kazakhstan to Stop Nuclear and Radioactive Material  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Works With Kazakhstan to Stop Nuclear and Radioactive Material Works With Kazakhstan to Stop Nuclear and Radioactive Material Smuggling U.S. Works With Kazakhstan to Stop Nuclear and Radioactive Material Smuggling May 6, 2006 - 10:34am Addthis WASHINGTON, DC - As part of the overall U.S. strategy to prevent nuclear and dangerous radiological materials from falling into the hands of terrorists, the Department of Energy's National Nuclear Security Administration (NNSA) announced today that an agreement with the government of Kazakhstan had been signed to create a partnership under the Second Line of Defense program. U.S. Ambassador Ordway joined Kazakhstan Customs Control Committee Chairman Askar Shakirov in signing the accord. The agreement will pave the way for NNSA to work collaboratively with the Kazakhstan Customs Control Committee


Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester


Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A reconsideration of acoustic invariance for place of articulation in stop consonants: Evidence from cross?language studies  

Science Conference Proceedings (OSTI)

It has been claimed that the gross shape of the onset spectrum provides invariant properties for place of articulation in stop consonants [Blumstein and Stevens

Aditi Lahiri; Shiela E> Blumstein



Stopping duct quacks: Longevity of residential duct sealants  

Science Conference Proceedings (OSTI)

Duct leakage has been identified as a major source of energy loss in residential buildings. Most duct leakage occurs at the connections to registers, plenums or branches in the duct system. At each of these connections a method of sealing the duct system is required. Typical sealing methods include tapes or mastics applied around the joints in the system. Field examinations of duct systems have shown that these seals tend to fail over time periods ranging from days to years. We have used several test methods over the last few years to evaluate the longevity of duct sealants when subjected to temperatures and pressures representative of those found in the field. Traditional cloth duct tapes have been found to significantly under-perform other sealants and have been banned from receiving duct tightness credits in California's energy code (California Energy Commission 1998). Our accelerated testing apparatus has been redesigned since its first usage for improved performance. The methodology is currently under consideration by the American Society for Testing and Materials (ASTM) as a potential new test method. This report will summarize the set of measurements to date, review the status of the test apparatus and test method, and summarize the applications of these results to codes and standards.

Sherman, Max H.; Walker, Iain S.; Dickerhoff, Darryl J.



Elements of Energy Upgrade California Program One-stop clearinghouse for alternative financing; pooled demand, competitive  

E-Print Network (OSTI)

programs offered by the utilities as well as, other energy retrofit incentive programs and tax credits 1 #12;2 · Workforce development ­ Collaborate with Clean Energy Training Program to support localElements of Energy Upgrade California Program · One-stop clearinghouse for alternative financing


Study on Energy-Saving Control Strategy of Idling Stop System for City Bus  

Science Conference Proceedings (OSTI)

Fuel economy of city bus is poor, because the urban traffic is congested, the city bus is constantly in the idle condition resulting in fuel consumption is increasing. In order to improve the vehicle fuel economy and protect environment, the energy consumption ... Keywords: idling stop, energy-saving, control strategy, regenerative braking

Daxing Huang; Ren He



Effects of oil charge on illite dates and stopping quartz cement: calibration of basin models  

E-Print Network (OSTI)

Abstract Effects of oil charge on illite dates and stopping quartz cement: calibration of basin Oil can fill pores in reservoir sandstones at any burial depth by long or short distance migration. There has been a debate since 1920 concerning the effect of oil charge. We have made detailed local

Haszeldine, Stuart


Where to stop reading a ranked list?: threshold optimization using truncated score distributions  

Science Conference Proceedings (OSTI)

Ranked retrieval has a particular disadvantage in comparison with traditional Boolean retrieval: there is no clear cut-off point where to stop consulting results. This is a serious problem in some setups. We investigate and further develop methods to ... Keywords: distributed retrieval, effectiveness measure optimization, expectation maximization, filtering, fusion, meta-search, probability of relevance, score distribution, score normalization, threshold optimization, truncated distribution

Avi Arampatzis; Jaap Kamps; Stephen Robertson



A study of the scalability of stop-the-world garbage collectors on multicores  

Science Conference Proceedings (OSTI)

Large-scale multicore architectures create new challenges for garbage collectors (GCs). In particular, throughput-oriented stop-the-world algorithms demonstrate good performance with a small number of cores, but have been shown to degrade badly beyond ... Keywords: garbage collection, multicore, numa

Lokesh Gidra; Gal Thomas; Julien Sopena; Marc Shapiro



Light Stops, Light Staus and the 125 GeV Higgs  

E-Print Network (OSTI)

The ATLAS and CMS experiments have recently announced the discovery of a Higgs-like resonance with mass close to 125 GeV. Overall, the data is consistent with a Standard Model (SM)-like Higgs boson. Such a particle may arise in the minimal supersymmetric extension of the SM with average stop masses of the order of the TeV scale and a sizable stop mixing parameter. In this article we discuss properties of the SM-like Higgs production and decay rates induced by the possible presence of light staus and light stops. Light staus can affect the decay rate of the Higgs into di-photons and, in the case of sizable left-right mixing, induce an enhancement in this production channel up to $\\sim$ 50% of the Standard Model rate. Light stops may induce sizable modifications of the Higgs gluon fusion production rate and correlated modifications to the Higgs diphoton decay. Departures from SM values of the bottom-quark and tau-lepton couplings to the Higgs can be obtained due to Higgs mixing effects triggered by light third ...

Carena, Marcela; Shah, Nausheen R; Wagner, Carlos E M; Wang, Lian-Tao



CP Asymmetry in the Higgs Decay into the Top Pair Due to the Stop Mixing  

SciTech Connect

We investigate a potentially large CP violating asymmetry in the decay of a neutral scalar or pseudoscalar Higgs boson into the top-anti-top pair. The source of the CP nonconservation is the complex mixing in the (left-right) stop sector. One of the interesting consequence is the different rates of the Higgs boson decays into CP conjugate polarized states.

Chang, Darwin



Heart stopping moments with zebrafish: imaging inside the living, beating heart  

E-Print Network (OSTI)

Heart stopping moments with zebrafish: imaging inside the living, beating heart Seamless this application, enabling researchers to carry out precision "healing" studies on the moving heart by targeting of development Jonathan M. Taylor, Glasgow University d "Realtime Optical Gating for 3D Heart Imaging", Journal

Greenaway, Alan


Method and apparatus for measuring response time  

DOE Patents (OSTI)

A method of measuring the response time of an electrical instrument which generates an output signal in response to the application of a specified input, wherein the output signal varies as a function of time and when subjected to a step input approaches a steady-state value, comprises the steps of: (a) applying a step input of predetermined value to the electrical instrument to generate an output signal; (b) simultaneously starting a timer; (c) comparing the output signal to a reference signal to generate a stop signal when the output signal is substantially equal to the reference signal, the reference signal being a specified percentage of the steady-state value of the output signal corresponding to the predetermined value of the step input; and (d) applying the stop signal when generated to stop the timer.

Johanson, E.W.; August, C.



Method and apparatus for measuring response time  

DOE Patents (OSTI)

A method of measuring the response time of an electrical instrument which generates an output signal in response to the application of a specified input, wherein the output signal varies as a function of time and when subjected to a step input approaches a steady-state value, comprises the steps of: (a) applying a step input of predetermined value to the electrical instrument to generate an output signal; (b) simultaneously starting a timer; (c) comparing the output signal to a reference signal to generate a stop signal when the output signal is substantially equal to the reference signal, the reference signal being a specified percentage of the steady-state value of the output signal corresponding to the predetermined value of the step input; and (d) applying the stop signal when generated to stop the timer.

Johanson, Edward W. (New Lenox, IL); August, Charles (Darien, IL)



miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


Secretary Bodman Makes "Energizing America for Energy Security" Tour Stops  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Makes "Energizing America for Energy Security" Makes "Energizing America for Energy Security" Tour Stops to Launch New Solar Facility Secretary Bodman Makes "Energizing America for Energy Security" Tour Stops to Launch New Solar Facility July 14, 2005 - 2:10pm Addthis AUBURN HILLS, MICH - Secretary of Energy Samuel W. Bodman toured the world's largest amorphous silicon thin-fill solar manufacturing plant in Auburn Hills, Mich., today, and joined United Solar Ovonic leaders in breaking ground on a new facility that will increase production and create 200 new jobs. "I congratulate Uni-Solar on this groundbreaking that will bring 200 new jobs to the Auburn Hills area," Secretary Bodman said. "This new facility will help provide consumers and contractors with another option to reduce


Measuring Active-Sterile Neutrino Oscillations with a Stopped Pion Neutrino Source  

E-Print Network (OSTI)

The question of the existence of light sterile neutrinos is of great interest in many areas of particle physics, astrophysics, and cosmology. Furthermore, should the MiniBooNE experiment at Fermilab confirm the LSND oscillation signal, then new measurements are required to identify the mechanism responsible for these oscillations. Possibilities include sterile neutrinos, CP or CPT violation, variable mass neutrinos, Lorentz violation, and extra dimensions. In this paper, we consider an experiment at a stopped pion neutrino source to determine if active-sterile neutrino oscillations with delta-m greater than 0.1 eV2 can account for the signal. By exploiting stopped pi+ decay to produce a monoenergetic nu_mu source, and measuring the rate of the neutral current reaction nu_x + 12C -> nu_x +12C* as a function of distance from the source, we show that a convincing test for active-sterile neutrino oscillations can be performed.

G. T. Garvey; A. Green; C. Green; W. C. Louis; G. B. Mills; G. McGregor; H. Ray; R. Schirato; R. G. Van de Water; D. H. White



Analysis of a Cellular Automaton Model for Car Traffic with a Slow-to-Stop Rule  

E-Print Network (OSTI)

We propose a modification of the widely known Benjamin-Johnson-Hui (BJH) cellular automaton model for single-lane traffic simulation. In particular, our model includes a slow-to-stop rule that exhibits more realistic microscopic driver behaviour than the BJH model. We present some statistics related to fuel economy and pollution generation and show that our model differs greatly in these measures. We give concise results based on extensive simulations using our system.

Adam Clarridge; Kai Salomaa



High resolution time interval meter  

DOE Patents (OSTI)

Method and apparatus are provided for measuring the time interval between two events to a higher resolution than reliability available from conventional circuits and component. An internal clock pulse is provided at a frequency compatible with conventional component operating frequencies for reliable operation. Lumped constant delay circuits are provided for generating outputs at delay intervals corresponding to the desired high resolution. An initiation START pulse is input to generate first high resolution data. A termination STOP pulse is input to generate second high resolution data. Internal counters count at the low frequency internal clock pulse rate between the START and STOP pulses. The first and second high resolution data are logically combined to directly provide high resolution data to one counter and correct the count in the low resolution counter to obtain a high resolution time interval measurement.

Martin, A.D.



An investigation of the relationship between total and stopped delay at signalized intersections  

E-Print Network (OSTI)

This thesis investigated the relationship between total delay and stopped delay at signalized intersections. As the 1.3 value used in the 1985 HCM was obtained empirically, an analytical model was developed to account for the relevant variables such as approach speeds and associated deceleration and acceleration rates. By studying the effects of the relevant parameters, the relationship between delay components was analyzed with respect to the different operating conditions at signalized intersections. The TRAF-NETSIM computer simulation program was used to provide reference values for the results from the analytical model under the same operating conditions. Actual traffic delay data were collected in the field to validate the model's results. Statistical analysis was used as an important tool to achieve this goal. The results from this study indicated that the ratio of total delay to stopped delay was not a constant as the operating conditions changed. Specifically, as approach speed increased, this delay ratio increased when other parameters were assigned reasonable values. A similar trend was observed from the field measurements. The reason for this phenomenon is that higher deceleration or acceleration rates are generally used by most drivers to decelerate from or accelerate to higher speeds,thus changing the composition of total delay. In conclusion, the ratio of total delay to stopped delay should not be treated as a constant and should be calculated using an appropriate model.

Ouyang, Yang


Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Dose calculations using MARS for Bremsstrahlung beam stops and collimators in APS beamline stations.  

Science Conference Proceedings (OSTI)

The Monte Carlo radiation transport code MARS is used to model the generation of gas bremsstrahlung (GB) radiation from 7-GeV electrons which scatter from residual gas atoms in undulator straight sections within the Advanced Photon Source (APS) storage ring. Additionally, MARS is employed to model the interactions of the GB radiation with components along the x-ray beamlines and then determine the expected radiation dose-rates that result. In this manner, MARS can be used to assess the adequacy of existing shielding or the specifications for new shielding when required. The GB radiation generated in the 'thin-target' of an ID straight section will consist only of photons in a 1/E-distribution up to the full energy of the stored electron beam. Using this analytical model, the predicted GB power for a typical APS 15.38-m insertion device (ID) straight section is 4.59 x 10{sup -7} W/nTorr/mA, assuming a background gas composed of air (Z{sub eff} = 7.31) at room temperature (293K). The total GB power provides a useful benchmark for comparisons between analytical and numerical approaches. We find good agreement between MARS and analytical estimates for total GB power. The extended straight section 'target' creates a radial profile of GB, which is highly peaked centered on the electron beam. The GB distribution reflects the size of the electron beam that creates the radiation. Optimizing the performance of MARS in terms of CPU time per incident trajectory requires the use of a relatively short, high-density gas target (air); in this report, the target density is {rho}L = 2.89 x 10{sup -2} g/cm{sup 2} over a length of 24 cm. MARS results are compared with the contact dose levels reported in TB-20, which used EGS4 for radiation transport simulations. Maximum dose-rates in 1 cc of tissue phantom form the initial basis for comparison. MARS and EGS4 results are approximately the same for maximum 1-cc dose-rates and attenuation in the photon-dominated regions; for thicker targets, however, the dose-rate no longer depends only on photon attenuation, as photoneutrons (PNs) begin to dominate. The GB radiation-induced photoneutron measurements from four different metals (Fe, Cu, W, and Pb) are compared with MARS predictions. The simulated dose-rates for beamline 6-ID are approximately 3-5 times larger than the measured values, whereas those for beamline 11-ID are much closer. Given the uncertainty in local values of pressure and Z, the degree of agreement between MARS and the PN measurements is good. MARS simulations of GB-induced radiation in and around the FOE show the importance of using actual pressure and gas composition (Z{sub eff}) to obtain accurate PN dose. For a beam current of 300 mA, extrapolating pressure data measured in previously published studies predicts an average background gas pressure of 27 nTorr. An average atomic number of Z{sub eff} = 4.0 is obtained from the same studies. In addition, models of copper masks presently in use at the APS are included. Simulations show that inclusion of exit masks make significant differences in both the radiation spatial distribution within the FOE, as well as the peak intensity. Two studies have been conducted with MARS to assess shielding requirements. First, dose levels in contact with the outside wall of the FOE are examined when GB radiation strikes Pb or W beam stops of varying transverse size within the FOE. Four separate phantom regions are utilized to measure the dose, two at beam elevation and two at the horizontal beam position. The first two phantoms are used for scoring FOE dose along the outside and back walls, horizontally; the second two collect dose on the roof and vertically on the back wall. In all cases, the beam stop depth is maintained at 30 cm. Inclusion of front end (FE) exit masks typically cause a 1-2 order-of-magnitude increase in the dose-rates relative to the case with no masks. Masks place secondary bremsstrahlung sources inside the FOE, and therefore they must be shielded appropriately. The MARS model does not fully account for all shielding present

Dooling, J.; Accelerator Systems Division (APS)



Deep-Time Climates  

Science Conference Proceedings (OSTI)

... power supplies, and stopping the pumps needed to cool nuclear ... at household, organizational, community, and regional levels ...



Innovating with institutions : how strategic orientations among one-stop career centers influence labor matching, adaptation, and performance  

E-Print Network (OSTI)

Set in the context of labor market restructuring, public policy reform, and blurring government/nonprofit boundaries, this study examines the functions, adaptation, and performance of Boston's three One-Stop Career Centers ...

Herranz, Joaquin



miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



Quantifying the Effects of Idle-Stop Systems on Fuel Economy in Light-Duty Passenger Vehicles  

SciTech Connect

Vehicles equipped with idle-stop (IS) systems are capable of engine shut down when the vehicle is stopped and rapid engine re-start for the vehicle launch. This capability reduces fuel consumption and emissions during periods when the engine is not being utilized to provide propulsion or to power accessories. IS systems are a low-cost and fast-growing technology in the industry-wide pursuit of increased vehicle efficiency, possibly becoming standard features in European vehicles in the near future. In contrast, currently there are only three non-hybrid vehicle models for sale in North America with IS systems and these models are distinctly low-volume models. As part of the United States Department of Energys Advanced Vehicle Testing Activity, ECOtality North America has tested the real-world effect of IS systems on fuel consumption in three vehicle models imported from Europe. These vehicles were chosen to represent three types of systems: (1) spark ignition with 12-V belt alternator starter; (2) compression ignition with 12-V belt alternator starter; and (3) direct-injection spark ignition, with 12-V belt alternator starter/combustion restart. The vehicles have undergone both dynamometer and on-road testing; the test results show somewhat conflicting data. The laboratory data and the portion of the on-road data in which driving is conducted on a prescribed route with trained drivers produced significant fuel economy improvement. However, the fleet data do not corroborate improvement, even though the data show significant engine-off time. It is possible that the effects of the varying driving styles and routes in the fleet testing overshadowed the fuel economy improvements. More testing with the same driver over routes that are similar with the IS system-enabled and disabled is recommended. There is anecdotal evidence that current Environmental Protection Agency fuel economy test procedures do not capture the fuel economy gains that IS systems produce in real-world driving. The program test results provide information on the veracity of these claims.

Jeff Wishart; Matthew Shirk



Surface structure determination by a one-stop search method for the deepest minimum  

SciTech Connect

We report results of a one-stop automated search method for the deepest minimum in surface structure determination. Starting from known chemical bond lengths, the deepest minimization frozen low-energy electron diffraction (LEED) method locates the deepest minimum in a single run without any human intervention. This is achieved by using an approximation method, the frozen LEED, which has a radius of convergence of over 0.8 A, together with a simulated annealing algorithm that hops out of local minima until a deepest minimum is found. Demonstrations are presented using simulated and experimental results.

Yu, Z.X. [Department of Physics, Zhongshan University, Guangzhou 510275 (China); Tong, S.Y. [Department of Physics and Materials, City University of Hong Kong (China)



HIV/AIDS Information Resources from the National Library of Medicine-STOP  

SciTech Connect

The HIV/AIDS Information Resources from the National Library of Medicine training is designed specifically for the UNCFSP HBCU Screening, Testing, Outreach, and Prevention (STOP) HIV/AIDS Program project members to provide valuable health information resources from the National Library of Medicine and other reliable sources to increase awareness of the wealth of treatment information and educational materials that are available on the Internet and to improve prevention and treatment education for their clients. These resources will also meet the needs of community-based organizations

Templin-Branner, W. and N. Dancy



Cycle timer for testing electric vehicles. [Device to assist test driver to follow stop-and-go driving cycles  

DOE Green Energy (OSTI)

A cycle timer was developed to assist the driver of an electric vehicle in more accurately following and repeating SAE driving schedules. These schedules require operating an electric vehicle in a selected stop-and-go driving cycle and repeating this pattern until the vehicle ceases to meet the requirements of the cycle. The heart of the system is a programmable read-only memory (PROM) that has the required test profiles permanently recorded on plug-in cards, one card for each different driving schedule. The PROM generates a direct-current analog signal that drives a speedometer displayed on one scale of a dual-movement meter. The second scale of the dual-movement meter displays the actual speed of the vehicle as recorded by the fifth wheel. The vehicle operator controls vehicle speed to match the desired profile speed. One second before a speed transition (such as acceleration to cruise or cruise to coast), a small buzzer sounds for /sup 1///sub 2/ s to forewarn the operator of a change. A longer signal of 1 s is used to emphasize the start of a new cycle. The PROM controls the recycle start time as well as the buzzer activation. The cycle programmer is powered by the test vehicle's 12-V accessory battery, through a 5-V regulator and a 12-V dc-to-dc converter.

Soltis, R.F.



Stopping Power of Different Ions in Si Measured with a Bulk Sample Method and Bayesian Inference Data Analysis  

SciTech Connect

The accuracy of ion beam analysis experiments depends critically on the stopping power values available. While for H and He ions accuracies normally better than 5% are achieved by usual interpolative schemes such as SRIM, for heavier ions the accuracy is worse. One of the main reasons is that the experimental data bases are very sparse, even for important materials such as Si. New measurements are therefore needed. Measurement of stopping power is often made with transmission in thin films, with the usual problems of film thickness homogeneity. We have previously developed an alternative method based on measuring bulk spectra, and fitting the yield by treating the stopping power as a fit parameter in a Bayesian inference Markov chain Monte Carlo procedure included in the standard IBA code NDF. We report on improvements of the method and on its application to the determination of the stopping power of {sup 7}Li in Si. To validate the method, we also apply it to the stopping of {sup 4}He in Si, which is known with 2% accuracy.

Barradas, N. P.; Alves, E. [Instituto Tecnologico e Nuclear, E.N. 10, Sacavem 2686-953 (Portugal); Centro de Fisica Nuclear da Universidade de Lisboa, Av. Prof. Gama Pinto 2, Lisboa (Portugal); Siketic, Z.; Radovic, I. Bogdanovic [Ruder Boskovic Institute, P.O. Box 180, Zagreb 10002 (Croatia)



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)



A study of nuclear stopping in central symmetric nuclear collisions at intermediate energies  

E-Print Network (OSTI)

Nuclear stopping has been investigated in central symmetric nuclear collisions at intermediate energies. Firstly, it is found that the isotropy ratio, Riso, reaches a minimum near the Fermi energy and saturates or slowly increases depending on the mass of the system as the beam energy increases. An approximate scaling based on the size of the system is found above the Fermi energy suggesting the increasing role of in-medium nucleon-nucleon collisions. Secondly, the charge density distributions in velocity space, dZ/dvk and dZ/dv?, reveal a strong memory of the entrance channel and, as such, a sizeable nuclear transparency in the intermediate energy range. Lastly, it is shown that the width of the transverse velocity distribution is proportional to the beam velocity.

C. Escano-Rodriguez; D. Durand; A. Chbihi; J. D. Frankland; the INDRA Collaboration



Microsoft Word - EXT-12-27320_Idle-Stop_Light_Duty_Passenger_Vehicles.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

7320 7320 Quantifying the Effects of Idle-Stop Systems on Fuel Economy in Light- Duty Passenger Vehicles Jeffrey Wishart Matthew Shirk Contract No. DE-FC26-05NT42486 December 2012 DISCLAIMER This information was prepared as an account of work sponsored by an agency of the U.S. Government. Neither the U.S. Government nor any agency thereof, nor any of their employees, makes any warranty, expressed or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness, of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights. References herein to any specific commercial product, process, or service by trade name, trade mark, manufacturer, or otherwise,


Enhancement of the neutral-beam stopping cross section in fusion plasmas due to multistep collision processes  

DOE Green Energy (OSTI)

Multistep processes involving excited atomic states are found to produce a substantial increase in the stopping cross section for a neutral hydrogen beam injected into a plasma, and thus to reduce the beam penetration. For typical plasma and beam parameters of current large tokamak experiments, the stopping cross-sectional enhancement is found to vary from 25% to 50% depending on the beam energy, plasma density, and impurity level. For neutral hydrogen beams with energies greater than or equal to 500 keV, envisioned in tokamak amd mirror reactor designs, the enhancement can be as large as 80 to 90%.

Boley, C.D.; Janev, R.K.; Post, D.E.



Enhancement of the neutral-beam stopping cross section in fusion plasmas due to multistep collision processes  

DOE Green Energy (OSTI)

Multistep processes involving excited atomic states are found to produce a substantial increase in the stopping cross section for a neutral hydrogen beam injected into a plasma, and thus to reduce the beam penetration. For typical plasma and beam parameters of current large tokamak experiments, the stopping-cross-sectional enhancement is found to vary from 25% to 50%, depending on the beam energy, plasma density, and impurity level. For neutral hydrogen beams with energies > or approx. =500 keV, envisioned in tokamak and mirror reactor designs, the enhancement can be as large as 80%--90%.

Boley, C.D.; Janev, R.K.; Post, D.E.



Transcranial magnetic stimulation and functional mri reveal cortical and subcortical interactions during stop-signal response inhibition  

Science Conference Proceedings (OSTI)

Stopping an action requires suppression of the primary motor cortex M1. Inhibitory control over M1 relies on a network including the right inferior frontal cortex rIFC and the supplementary motor complex SMC, but how these regions interact to exert inhibitory ...

Bram B. Zandbelt; Mirjam Bloemendaal; Janna Marie Hoogendam; Ren S. Kahn; Matthijs Vink




National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


LHCb: LHCb High Level Trigger design issues for post Long Stop 1 running  

E-Print Network (OSTI)

The LHCb High Level Trigger uses two stages of software running on an Event Filter Farm (EFF) to select events for offline reconstruction and analysis. The first stage (Hlt1) processes approximately 1 MHz of events accepted by a hardware trigger. In 2012, the second stage (Hlt2) wrote 5 kHz to permanent storage for later processing. Following the LHC's Long Stop 1 (anticipated for 2015), the machine energy will increase from 8 TeV in the center-of-mass to 13 TeV and the cross sections for beauty and charm are expected to grow proportionately. We plan to increase the Hlt2 output to 12 kHz, some for immediate offline processing, some for later offline processing, and some ready for immediate analysis. By increasing the absolute computing power of the EFF, and buffering data for processing between machine fills, we should be able to significantly increase the efficiency for signal while improving signal-to-background ratios. In this poster we will present several strategies under consideration and some of th...

Albrecht, J; Raven, G; Sokoloff, M D; Williams, M



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Particle distribution and nuclear stopping in Au-Au collisions at $\\sqrt{s_{NN}}$=200 GeV  

E-Print Network (OSTI)

The transverse momentum distribution of produced charged particles is investigated for gold-gold collisions at $\\sqrt{s_{NN}}=200$ GeV. A simple parameterization is suggested for the particle distribution based on the nuclear stopping effect. The model can fit very well both the transverse momentum distributions at different pseudo-rapidities and the pseudo-rapidity distributions at different centralities. The ratio of rapidity distributions for peripheral and central collisions is calculated and compared with the data.

L. L. Zhu; C. B. Yang



Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A


Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 2002 Place Time Name Group Group  

E-Print Network (OSTI)

37 192 19:28.7 John Wool 40-49 men 48 193 19:32.4 Jaimin Wan page 7 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS 1st


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 15, 1989 Envel. Time Name Group Group  

E-Print Network (OSTI)

40-49 8 67 12:51.4 Desiderio Kovar Wool 30-39 20 69 12:56.7 Antoine Mensch Envelope Place Number 1 21:59.8 John L. Magee 354 2 26:14.8 Ed Lofgren 427 HISTORY OF LBL RUNAROUND WINNERS


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 11, 1992 Place Time Name Group Group  

E-Print Network (OSTI)

14:26.2 Barry Freifeld Wool 30-39 39 122 14:28.2 Ken Woolfe 40-49 18 123 14 Williams HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS


Deliberate Fertility Control in Late Imperial China: Spacing and Stopping in the Qing Imperial Lineage  

E-Print Network (OSTI)

Liaoning, life-event and time-series analysis, 1792-1867."discrete-time event-history analysis by means of logisticspecific control, an event history analysis that does not

Campbell, Cameron D.; Lee, James Z.



Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


Book Review: Thieves of Book Row: New York's Most Notorious Rare Book Ring and the Man Who Stopped It by Travis McDade  

E-Print Network (OSTI)

Thieves of Book Row: New York'sMost Notorious Rare Book Ring and the Man Who Stopped It bypp. ISBN 0199922667. In Thieves of Book Row: New Yorks Most

Montoya, Robert D.



Knowing when to act: an optimal stopping method for smart grid demand response  

Science Conference Proceedings (OSTI)

A major benefit of the smart grid is that it can provide real-time pricing, which enables residential electricity customers to reduce their electricity expenses by scheduling their appliance use. A commonly utilized technique is to operate electrical ...

Abiodun Iwayemi; Peizhong Yi; Xihua Dong; Chi Zhou



Stop Paying for Energy You Aren't Using | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

them; you wouldn't, for instance, unplug your digital clock when you leave the room and plug it back in and reset it each time you re-enter. But how many items do you leave...


Time-aging time-stress superposition in soft glass under tensile deformation field  

E-Print Network (OSTI)

We have studied the tensile deformation behaviour of thin films of aging aqueous suspension of Laponite, a model soft glassy material, when subjected to a creep flow field generated by a constant engineering normal stress. Aqueous suspension of Laponite demonstrates aging behaviour wherein it undergoes time dependent enhancement of its elastic modulus as well as its characteristic relaxation time. However, under application of the normal stress, the rate of aging decreases and in the limit of high stress, the aging stops with the suspension now undergoing a plastic deformation. Overall, it is observed that the aging that occurs over short creep times at small normal stresses is same as the aging that occurs over long creep times at large normal stresses. This observation allows us to suggest an aging time - process time - normal stress superposition principle, which can predict rheological behaviour at longer times by carrying out short time tests.

Asima Shaukat; Ashutosh Sharma; Yogesh M. Joshi



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 16, 1994 Place Time Name GroupGroup Place Time Name GroupGroup  

E-Print Network (OSTI)

-49 8 30 11:56.7 Dan Gheng Wool 40-49 1 89 13 of the participants. The official number of finishers was 780, including babies in strollers page 7 #12;HISTORY OF LBL


Managing time  

Science Conference Proceedings (OSTI)

Professionals overwhelmed with information glut can find hope from new insights about time management.

Peter J. Denning



ANL/APS/TB-54, Dose Calculations using MARS for Bremsstrahlung Beam Stops and Collimators in APS Beamline Stations  

NLE Websites -- All DOE Office Websites (Extended Search)

4 4 DOSE CALCULATIONS USING MARS FOR BREMSSTRAHLUNG BEAM STOPS AND COLLIMATORS IN APS BEAMLINE STATIONS Jeffrey C. Dooling Accelerator Systems Division Advanced Photon Source August 2010 This work is sponsored by the US Department of Energy Office of Science The submitted manuscript has been created by UChicago Argonne, LLC, Operator of Argonne National Laboratory ("Argonne"). Argonne, a U.S. Department of Energy Office of Science laboratory, is operated under Contract No. DE-AC02-06CH11357. The U.S. Government retains for itself, and others acting on its behalf, a paid-up nonexclusive, irrevocable worldwide license in said article to reproduce, prepare derivative works, distribute copies to the public, and perform publicly and display


Nuclear interactions of 160 MeV protons stopping in copper: A test of Monte Carlo nuclear models  

Science Conference Proceedings (OSTI)

To estimate the influence of nuclear interactions on dose or biological effect one uses Monte Carlo programs which include nuclear models. We introduce an experimental method to check these models at proton therapy energies. We have measured the distribution of charge deposited by 160 MeV protons stopping in a stack of insulated copper plates. A buildup region ahead of the main peak contains ?20% of the total charge and is entirely due to charged secondaries from inelastic nuclear interactions. The acceptance for charged secondaries is 100%. Therefore the data are a good benchmark for nuclear models. We have simulated the stack using GEANT with two nuclear models.FLUKA agrees fairly well with the measurement but GHEISHA

Bernard Gottschalk; Rachel Platais; Harald Paganetti



Nano-hillock formation in diamond-like carbon induced by swift heavy projectiles in the electronic stopping regime: Experiments and atomistic simulations  

Science Conference Proceedings (OSTI)

The formation of surface hillocks in diamond-like carbon is studied experimentally and by means of large-scale molecular dynamics simulations with 5 Multiplication-Sign 10{sup 6} atoms combined with a thermal spike model. The irradiation experiments with swift heavy ions cover a large electronic stopping range between {approx}12 and 72 keV/nm. Both experiments and simulations show that beyond a stopping power threshold, the hillock height increases linearly with the electronic stopping, and agree extremely well assuming an efficiency of approximately 20% in the transfer of electronic energy to the lattice. The simulations also show a transition of sp{sup 3} to sp{sup 2} bonding along the tracks with the hillocks containing almost no sp{sup 3} contribution.

Schwen, D. [Department of Materials Science and Engineering, University of Illinois at Urbana-Champaign, Illinois 61801 (United States); Bringa, E. [CONICET and Instituto de Ciencias Basicas, Universidad Nacional de Cuyo, Mendoza 5500 (Argentina); Krauser, J. [Hochschule Harz, Friedrichstrasse 57-59, 38855 Werningerode (Germany); Weidinger, A. [Helmholtz-Zentrum Berlin fuer Materialien und Energie, 14109 Berlin (Germany); Trautmann, C. [GSI Helmholtzzentrum, Planckstr. 1, 64291, Darmstadt (Germany); Hofsaess, H. [II. Physikalisches Institut, Universitaet Goettingen, Friedrich-Hund-Platz 1, 37077 Goettingen (Germany)



Truck Stop Electrification: Codes and Standards Ensure Safety for The Trucking Industry  

Science Conference Proceedings (OSTI)

Every day in the United States as many as 677,600 heavy-duty trucks are on the road; and, at some point during that day, they are idling. Over the course of a year, long-duration idling of truck and locomotive engines consumes more than 1 billion gallons of diesel fuel and emits 11 million tons of carbon dioxide. Drivers often idle their main engines during the U.S. Department of Transportation mandated rest time of 10 hours after driving for 11 hours, to power heating, air conditioning, lighting, and ap...



Regression Model Predicting Appraised Unit Value of Land in San Francisco County from Number of and Distance to Public Transit Stops using GIS  

E-Print Network (OSTI)

The objective of this study is to develop a quantifying model that predicts the appraised unit value of parcels in San Francisco County based on number of LEED-NC Public Transportation Access (PTA) qualified bus, light rail and commuter rail stops, distance to closest bus, light rail and commuter rail stops, zoning class and parcel size. As a population of interest, San Francisco County was chosen since it is known as a region having well-organized transportation systems including bus, light rail and commuter rail systems. According to the correlation results, for mixed zone, an appraised unit value increases as the number of LEED qualified transit stops increases (bus, light rail, and commuter rail). In addition, the appraised unit value increases as the distance to LEED qualified bus stops light rail stops decreases. For residential zone, the appraised unit value increases as the number of LEED qualified bus and light rail stations increases. Furthermore, the appraised unit value increases as the distance to LEED qualified bus stops decreases. When it comes to the predictive regression model for mixed zone, the adjusted R-square of the transformed model was 0.713, which indicates that 71.3 percent variability in transformed unit value of parcels could be explained by these variables. In addition, for the predictive model of residential zone, the adjusted R-square for the model was 0.622 thus the independent variables together accounted for 62.2 percent variability in the transformed unit value of parcels. The predicting models for mixed and residential zones were significant that suggests that the components of LEED-NC PTA criteria, number and distance from parcels, this could affect land development strategies. In addition, an appraised unit value of parcels in San Francisco County can be estimated by using the predictive models developed in this study. Therefore, the findings of this study could encourage real-estate developers to site their projects according to the LEED-NC PTA criteria.

Son, Kiyoung



Entropic Time  

Science Conference Proceedings (OSTI)

The formulation of quantum mechanics within the framework of entropic dynamics includes several new elements. In this paper we concentrate on one of them: the implications for the theory of time. Entropic time is introduced as a book-keeping device to keep track of the accumulation of changes. One new feature is that, unlike other concepts of time appearing in the so-called fundamental laws of physics, entropic time incorporates a natural distinction between past and future.

Caticha, Ariel [Department of Physics, University at Albany-SUNY, Albany, NY 12222 (United States)



Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.


Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tests of Micro-Pattern Gaseous Detectors for Active1 Target Time Projection Chambers in nuclear physics2  

E-Print Network (OSTI)

Tests of Micro-Pattern Gaseous Detectors for Active1 Target Time Projection Chambers in nuclear the gas used as the detection medium10 is also a target for nuclear reactions, have been used for a wide variety of11 nuclear physics applications since the eighties. Improvements in MPGD (Mi-12 cro Pattern

Recanati, Catherine



DOE Patents (OSTI)

The timing device comprises an escapement wheel and pallet, a spring drive to rotate the escapement wheel to a zero position, means to wind the pretensioned spring proportional to the desired signal time, and a cam mechanism to control an electrical signal switch by energizing the switch when the spring has been wound to the desired position, and deenergizing it when it reaches the zero position. This device produces an accurately timed signal variably witain the control of the operator.

Bennett, A.E.; Geisow, J.C.H.



As you prepare for your upcoming beam time, please be aware that construction is planned to update SLAC Gate 17 with RFID proximity card access hardware and to change the stairs next to the Security hut to an ADA compliant ramp. Please forward this to your proposal collaborators (and ensure that all users have registered and completed training before they arrive). This construction is scheduled to begin Tuesday 5/28 and be completed by 6/28. During this construction, access to the LCLS and SSRL buildings and experimental facilities will be provided as follows: VEHICLES ONLY THROUGH GATE 17 5/28-6/28 0600-1530 (6 am-3:30 pm) Construction Zone. Only VEHICLE traffic will be allowed access through Gate 17 and flagman will provide traffic control. 1530-1800 (3:30-6:00 pm) Assumes construction will have stopped for the day; both traffic lanes will be open for vehicles. 1800-0600 (6 pm-6 am) As now, Gate 17 will be closed or barricaded overnight. PEDESTRIANS ONLY THROUGH GATE 16 5/28-6/28 The pedestrian turnstile at Gate 16A will not change. The turnstile is available for pedestrian use 24/7 as long as the individual has a valid SLAC ID badge (and there is a guard at Gate 30 to 'buzz' them through). 0700-1600 (6 am-4 pm) Pedestrians who would normally walk through Gate 17 will instead follow the detour to Gate 16 swing gate which will be unlocked and staffed by Security. A valid SLAC ID badge is needed to enter; new users without IDs will be allowed to proceed for check-in and badging after confirmation with the User Research Administration Office (see detour map attached). FYI - After the construction is completed and proximity card readers are fully functional, users and staff will enter Gates 17 and 30 using an activated RFID proximity card. More details to follow.  

NLE Websites -- All DOE Office Websites (Extended Search)

Automated Proximity Access at Gate 17 and Sector 30 Automated Proximity Access at Gate 17 and Sector 30 New SLAC ID badges with embedded RFID are used to activate these gates and for off-hours access at the main entrance off Sand Hill Road as well as Alpine Road (gates will be accessible 24/7) . New user badges include this proximity gate activation feature, but older photo IDs need to be updated. Users are advised to register, complete training and contact the User Research Administration (URA) office before arrival for beam time to help facilitate access. During the transition period, July 26-August 9, 2013 users can inform Security at Gate 17 that they are checking in and proceed to the URA office in Building 120; however, after August 9 th , users without a proximity activated ID need to stop at


Stop/Start: Overview  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

a combination of regenerative and conventional friction braking to slow the vehicle. In regenerative braking, energy from the wheels turns the electric generator, creating...


Stop/Start: Driving  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

generator to the gasoline engine to start it. Battery: The battery is used to store energy generated from the gasoline engine or, during regenerative braking, from the...


Stop Whining about Outsourcing!  

Science Conference Proceedings (OSTI)

Im sick of hearing all the whining about how outsourcing is going to migrate all IT jobs to the country with the lowest wages. The paranoia inspired by this domino theory of job migration causes American and West European programmers to worry ...

David Patterson



Stopping outgoing spam  

Science Conference Proceedings (OSTI)

We analyze the problem of preventing outgoing spam. We show that some conventional techniques for limiting outgoing spam are likely to be ineffective. We show that while imposing per message costs would work, less annoying techniques also work. In particular, ... Keywords: junk email, spam

Joshua T. Goodman; Robert Rounthwaite



Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Time Brightness  

NLE Websites -- All DOE Office Websites (Extended Search)

Perlmutter, et al., in Thermonuclear Supernovae, NATO ASI, v. 486 (1997) Perlmutter, et al., in Thermonuclear Supernovae, NATO ASI, v. 486 (1997) Cosmology from . . . Time Brightness ... . . . 50-100 Fields Lunar Calendar Scheduled Follow-Up Imaging at Hubble, Cerro Tololo, WIYN, Isaac Newton Scheduled Follow-Up Spectroscopy at Keck Almost 1000 Galaxies per Field RESULT: ~24 Type Ia supernovae discovered while still brightening, at new moon Berkeley Lab Keck WIYN Cerro Tololo Isaac Newton Hubble Strategy We developed a strategy to guarantee a group of supernova discoveries on a certain date. Just after a new moon, we observe some 50 to 100 high-galactic lattitute fields-each containing almost a thousand high-redshift galaxies-in two nights on the Cerro Tololo 4-meter telescope with Tyson & Bernstein's wide-field camera. We return three weeks later to observe the same


Lumenhaus Shows Off Solar in Times Square | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Lumenhaus Shows Off Solar in Times Square Lumenhaus Shows Off Solar in Times Square Lumenhaus Shows Off Solar in Times Square February 1, 2010 - 10:00am Addthis Photo by Kelly Shimoda Photo by Kelly Shimoda Joshua DeLung How can I participate? The next Solar Decathlon will be held Sept. 23-Oct. 2, 2011, at the National Mall's West Potomac Park in Washington, D.C. Virginia Tech's Lumenhaus - a net-zero energy, solar-powered, 650-square-foot home - made a stop in New York on its tour, right in the middle of Times Square. The house was previously featured at the U.S. Department of Energy's Solar Decathlon in October, and the team will head to Madrid in June for Solar Decathlon Europe as the only U.S. team to participate in both competitions. While in Times Square, the team and the house were featured on "Good


Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



Cosmological scenario of the stop as the next lightest supersymmetric particle with the gravitino as the lightest supersymmetric particle, and the cosmic lithium problem  

SciTech Connect

The discrepancy on {sup 7}Li and {sup 6}Li abundances between the observational data and the standard big-bang nucleosynthesis theory prediction has been a nagging problem in astrophysics and cosmology, given the highly attractive and successful big-bang paradigm. One possible solution of this lithium problem is through hadronic decays of a massive metastable particle which alter the primordial element abundances. We explore this possibility using a gravitino dark matter framework in which the next lightest supersymmetric particle is typically long-lived. We found that the stop as the next lightest supersymmetric particle may provide an attractive solution to the lithium problem.

Kohri, Kazunori [Physics Department, Lancaster University, Lancaster LA1 4YB (United Kingdom); Santoso, Yudi [Institute for Particle Physics Phenomenology, Department of Physics, University of Durham, Durham DH1 3LE (United Kingdom)



Streamlining the Government Contracting Process, One System at a Time |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Streamlining the Government Contracting Process, One System at a Streamlining the Government Contracting Process, One System at a Time Streamlining the Government Contracting Process, One System at a Time July 31, 2012 - 1:31pm Addthis Streamlining the Government Contracting Process, One System at a Time Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity It's no secret that small business owners have very busy schedules. They must manage business development, operations, finances, personnel, as well as accessing passwords to access the numerous websites necessary to do business with the federal government. To assist small businesses to alleviate the burden of managing many different user names and passwords for various business websites, we are streamlining online resources to create a one-stop-shop to registering your


A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



Linear electronic field time-of-flight ion mass spectrometers  

DOE Patents (OSTI)

Time-of-flight mass spectrometer comprising a first drift region and a second drift region enclosed within an evacuation chamber; a means of introducing an analyte of interest into the first drift region; a pulsed ionization source which produces molecular ions from said analyte of interest; a first foil positioned between the first drift region and the second drift region, which dissociates said molecular ions into constituent atomic ions and emits secondary electrons; an electrode which produces secondary electrons upon contact with a constituent atomic ion in second drift region; a stop detector comprising a first ion detection region and a second ion detection region; and a timing means connected to the pulsed ionization source, to the first ion detection region, and to the second ion detection region.

Funsten, Herbert O. (Los Alamos, NM)



Development of a one-stop beam verification system using electronic portal imaging devices for routine quality assurance  

Science Conference Proceedings (OSTI)

In this study, a computer-based system for routine quality assurance (QA) of a linear accelerator (linac) was developed by using the dosimetric properties of an amorphous silicon electronic portal imaging device (EPID). An acrylic template phantom was designed such that it could be placed on the EPID and be aligned with the light field of the collimator. After irradiation, portal images obtained from the EPID were transferred in DICOM format to a computer and analyzed using a program we developed. The symmetry, flatness, field size, and congruence of the light and radiation fields of the photon beams from the linac were verified simultaneously. To validate the QA system, the ion chamber and film (X-Omat V2; Kodak, New York, NY) measurements were compared with the EPID measurements obtained in this study. The EPID measurements agreed with the film measurements. Parameters for beams with energies of 6 MV and 15 MV were obtained daily for 1 month using this system. It was found that our QA tool using EPID could substitute for the film test, which is a time-consuming method for routine QA assessment.

Lim, Sangwook, E-mail: medicalphysics@hotmail.com [Department of Radiation Oncology, Kosin University College of Medicine, Seo-gu, Busan (Korea, Republic of); Ma, Sun Young; Jeung, Tae Sig [Department of Radiation Oncology, Kosin University College of Medicine, Seo-gu, Busan (Korea, Republic of); Yi, Byong Yong [Department of Radiation Oncology, University of Maryland School of Medicine, Baltimore, MD (United States); Lee, Sang Hoon [Department of Radiation Oncology, Cheil General Hospital and Women's Healthcare Center, Kwandong University College of Medicine, Jung-gu, Seoul (Korea, Republic of); Lee, Suk [Department of Radiation Oncology, College of Medicine, Korea University, Seongbuk-gu, Seoul (Korea, Republic of); Cho, Sam Ju [Department of Radiation Oncology, Eulji University School of Medicine, Eulji General Hospital, Nowon-gu, Seoul (Korea, Republic of); Choi, Jinho [Department of Radiation Oncology, Gachon University of Medicine and Science, Namdong-gu, Incheon (Korea, Republic of)


Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan



Topeka's "Green Light Tunnel" Saves Fuel and Time | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Topeka's "Green Light Tunnel" Saves Fuel and Time Topeka's "Green Light Tunnel" Saves Fuel and Time Topeka's "Green Light Tunnel" Saves Fuel and Time April 22, 2011 - 1:50pm Addthis Topeka, Kansas, has activated the first of three key traffic corridors to receive a "green light tunnel," a real-time adaptive traffic signal system that synchronizes signals to create a series of green lights for motorists. The result is fewer stops, less travel time and -- most importantly -- a lot of saved gasoline. Sallie Glaize Project Officer, Office of Energy Efficiency & Renewable Energy What does this project do? Saves motorists in Topeka time and money. The first of three key traffic corridors in Topeka, Kansas has received a "green light tunnel," a real-time adaptive traffic signal system that


Time and Frequency Portal  

Science Conference Proceedings (OSTI)

NIST Home > Time and Frequency Portal. Time and Frequency Portal. Programs and Projects. CODATA values of the fundamental constants ...



Time Series and Forecasting  

Science Conference Proceedings (OSTI)

Time Series and Forecasting. Leigh, Stefan and Perlman, S. (1991). "An Index for Comovement of Time Sequences With ...



E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Why California Stopped Building Freeways  

E-Print Network (OSTI)

Why California S toppeJ Building Freeways BY Planning BRIANUniversity Chapel of California, Hill, Los NC 275QQ-31other modes Constructed in California of transportation. The

Taylor, Brian D.



Volume 2, Number 2 June 1989 A Nelr-sletter for the KL,t.: Communitv at MI'1'  

E-Print Network (OSTI)

Lahoratory of Electrc~nicsfor the RLE community at MIT. The following individuals contributed their time ancl


Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


TREK: A Search for Time Reversal Symmetry Violation in Charged Kaon Decays  

Science Conference Proceedings (OSTI)

The Time Reversal Experiment with Kaons (TREK) at J?PARC aims to find New Physics beyond the Standard Model by measuring the T?violating transverse polarization P T of muons in the K ?3 + decay of stopped kaons. TREK will use a high?intensity kaon beam and the upgraded apparatus of the E?246 experiment from KEK?PS. The sensitivity for P T of 10 ?4 at J?PARC is improved by a factor of 20 compared to the current E?246 limit

Michael Kohl; The TREK collaboration



An FPGA Wave Union TDC for Time-of-Flight Applications  

SciTech Connect

An 18-channel time-of-flight (TOF) grade time-to-digit converter (TDC) has been implemented in a low cost FPGA device. The TDC has the following unique features. (1) The time recording structures of the TDC is based on the 'wave union TDC' we developed in our previous work. A leading edge of the input hit launches a bit pattern, or wave union into the delay chain-register array structure which yields two usable measurements. The two measurements effectively sub-divide timing bins for each other especially the 'ultra-wide bins' caused by the FPGA logic array block (LAB) structure and improves measurement precision both in terms of maximum bin width and RMS resolution. A coarser measurement on input signal trailing edge is also provided for time-over-threshold (TOT) applications. (2) The TDC supports advanced timing reference distribution schemes that are superior to conventional common start/stop schemes. The TDC has 16 regular measurement channels plus two channels for timing reference. The timing reference is established with multiple measurements rather than single shot common start/stop. An advanced scheme, the mean-timing approach even eliminates needs of high quality timing distribution media. (3) The ASIC-like encapsulation of the FPGA TDC significantly shorten the learning curve for potential users while maintain certain flexibility for various applications. Necessary digital post-processing functions including semicontinuous automatic calibration, data buffer, data link jam prevention logic etc. are integrated into the firmware to provide a turn-key solution for users.

Wu, J.; /Fermilab



Compiling for time predictability  

Science Conference Proceedings (OSTI)

Within the T-CREST project we work on hardware/software architectures and code-generation strategies for time-predictable embedded and cyber-physical systems. In this paper we present the single-path code generation approach that we plan to explore and ... Keywords: compilers, real-time systems, time predictability, worst-case execution-time analysis

Peter Puschner; Raimund Kirner; Benedikt Huber; Daniel Prokesch



Certifying execution time  

Science Conference Proceedings (OSTI)

In this paper we present the framework Abstraction-Carrying CodE Platform for Timing validation (ACCEPT), designed for timing analysis of embedded real-time systems using the worst-case execution time (WCET) as the safety parameter. In the context ...

Vtor Rodrigues; Joo Pedro Pedroso; Mrio Florido; Simo Melo de Sousa




NLE Websites -- All DOE Office Websites (Extended Search)

Time-Resolved Time-Resolved Time-Resolved Print Of the four fundamental parameters that we use to perceive the physical world (energy, momentum, position, and time) three correspond to the three broad categories of synchrotron experimental measurement techniques: spectroscopy (energy), scattering (momentum), and imaging (position). The fourth parameter-time-can in principle be applied to all the techniques. At the ALS, many experiments can be carried out in real time, with data being recorded from the same sample as it changes over time. Some time-resolved experiments take advantage of the pulsed nature of the ALS's synchrotron radiation, which, like a strobe light, can capture a series of "snapshots" of a process that, when viewed sequentially, show us how a given process evolves over time. Other experiments simply require two pulses: one to "pump" energy into the sample system and a second to probe the system's excited state.


Managing time, part 2  

Science Conference Proceedings (OSTI)

Masterful time management means not just tracking of messages in your personal environment, but managing your coordination network with others.

Peter J. Denning; Ritu Raj




Science Conference Proceedings (OSTI)

... STRATWARM observed and FLARES expected ... observed and PROTON FLARE expected (- - ) STRATWARM ... time of observed solar or geophysical ...



QuickTime VR  

Science Conference Proceedings (OSTI)

QuickTime VR. Christine Piatko and Sandy Ressler. ... Sandy Ressler's Office. Plant Floor of Black & Decker in Fayetteville NC. ...


Timed Property Sequence Chart  

Science Conference Proceedings (OSTI)

Property Sequence Chart (PSC) is a novel scenario-based notation, which has been recently proposed to represent temporal properties of concurrent systems. This language balances expressive power and simplicity of use. However, the current version of ... Keywords: Property Sequence Chart, Real-time specification patterns, Timed Property Sequence Chart, Timing properties

Pengcheng Zhang; Bixin Li; Lars Grunske



Noncommutative Two Time Physics  

E-Print Network (OSTI)

We present a classical formalism describing two-time physics with Abelian canonical gauge field backgrounds. The formalism can be used as a starting point for the construction of an interacting quantized two-time physics theory in a noncommutative soace-time.

W. Chagas-Filho



Quantum Operation Time Reversal  

E-Print Network (OSTI)

The dynamics of an open quantum system can be described by a quantum operation, a linear, complete positive map of operators. Here, I exhibit a compact expression for the time reversal of a quantum operation, which is closely analogous to the time reversal of a classical Markov transition matrix. Since open quantum dynamics are stochastic, and not, in general, deterministic, the time reversal is not, in general, an inversion of the dynamics. Rather, the system relaxes towards equilibrium in both the forward and reverse time directions. The probability of a quantum trajectory and the conjugate, time reversed trajectory are related by the heat exchanged with the environment.

Crooks, Gavin E



Quantum Operation Time Reversal  

E-Print Network (OSTI)

The dynamics of an open quantum system can be described by a quantum operation, a linear, complete positive map of operators. Here, I exhibit a compact expression for the time reversal of a quantum operation, which is closely analogous to the time reversal of a classical Markov transition matrix. Since open quantum dynamics are stochastic, and not, in general, deterministic, the time reversal is not, in general, an inversion of the dynamics. Rather, the system relaxes towards equilibrium in both the forward and reverse time directions. The probability of a quantum trajectory and the conjugate, time reversed trajectory are related by the heat exchanged with the environment.

Gavin E. Crooks


Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


On the Time Times Temperature Bound  

E-Print Network (OSTI)

Recently Hod proposes a lower bound on the relaxation time of a perturbed thermodynamic system. For gravitational systems this bound transforms into a condition on the fundamental quasinormal frequency. We test the bound in some spacetimes whose quasinormal frequencies are calculated exactly, as the three-dimensional BTZ black hole, the D-dimensional de Sitter spacetime, and the D-dimensional Nariai spacetime. We find that for some of these spacetimes their fundamental quasinormal frequencies do not satisfy the bound proposed by Hod.

A. Lopez-Ortega



Prompt Neutron Time Decay in Single HEU and DU Metal Annular Storage Castings  

SciTech Connect

Previous measurements of highly enriched uranium (HEU) storage castings performed by Oak Ridge National Laboratory (ORNL) at the Y-12 National Security Complex showed a prompt neutron time decay that is not exponential. These measurements showed that multiple time constants originating from multiplication, time-of-flight, scattering in the assembly and room return could be associated with this prompt neutron decay. In this work, the contribution not associated with neutron multiplication was investigated via measurements with a depleted uranium (DU) casting. The measurements at ORNL used an annular (5.0-in OD, 3.5-in ID, 6.0-in H) DU casting with a time-tagged 252Cf source, centered vertically on the axis, and four closely coupled 1 1 6-in.-long plastic scintillators with -in.- thick lead shielding adjacent to the outer surface of the casting. This setup was identical to the configuration used in the previously performed measurements with HEU castings at Y-12. The time correlation between fission events and detections in the plastic scintillators was measured, as well as the time distribution of coincidences between multiple detectors within a 512-ns time window. The measurement results were then compared to MCNP-PoliMi calculations and the previous HEU measurements. Time constants from decay fits to the HEU and DU data were compared to characterize the contributions resulting from multiplication, time-of-flight, and scattering.

Pena, Kirsten E [ORNL; McConchie, Seth M [ORNL; Mihalczo, John T [ORNL



What Time is It?  

Science Conference Proceedings (OSTI)

... These are sometimes marketed as "atomic clocks", but ... problems include incorrectly setting your local time zone on the clock, batteries that need ...




DOE Patents (OSTI)

The time calibrator of an electric signal displayed on an oscilloscope is described. In contrast to the conventional technique of using time-calibrated divisions on the face of the oscilloscope, this invention provides means for directly superimposing equal time spaced markers upon a signal displayed upon an oscilloscope. More explicitly, the present invention includes generally a generator for developing a linear saw-tooth voltage and a circuit for combining a high-frequency sinusoidal voltage of a suitable amplitude and frequency with the saw-tooth voltage to produce a resultant sweep deflection voltage having a wave shape which is substantially linear with respect to time between equal time spaced incremental plateau regions occurring once each cycle of the sinusoidal voltage. The foregoing sweep voltage when applied to the horizontal deflection plates in combination with a signal to be observed applied to the vertical deflection plates of a cathode ray oscilloscope produces an image on the viewing screen which is essentially a display of the signal to be observed with respect to time. Intensified spots, or certain other conspicuous indications corresponding to the equal time spaced plateau regions of said sweep voltage, appear superimposed upon said displayed signal, which indications are therefore suitable for direct time calibration purposes.

Owren, H.M.; Johnson, B.M.; Smith, V.L.



Semantics, experience and time  

Science Conference Proceedings (OSTI)

The computational hypothesis, with its inherent representationalism, and the dynamical hypothesis, with its apparent absence of representations and its commitment to continuous time, stand at an impasse. It is unclear how the dynamical stance can handle ... Keywords: Computation, Experience, Invariance, Semantics, Situatedness, Time

Stephen E. Robbins



Real-time shading  

Science Conference Proceedings (OSTI)

Real-time procedural shading was once seen as a distant dream. When the first version of this course was offered four years ago, real-time shading was possible, but only with one-of-a-kind hardware or by combining the effects of tens to hundreds of rendering ...

Marc Olano; Kurt Akeley; John C. Hart; Wolfgang Heidrich; Michael McCool; Jason L. Mitchell; Randi Rost




DOE Patents (OSTI)

This patent relates to means for ascertaining the instant of arrival of a shock wave in an exploslve charge and apparatus utilizing this means to coordinate the timing of two operations involving a short lnterval of time. A pair of spaced electrodes are inserted along the line of an explosive train with a voltage applied there-across which is insufficient to cause discharge. When it is desired to initiate operation of a device at the time the explosive shock wave reaches a particular point on the explosive line, the device having an inherent time delay, the electrodes are located ahead of the point such that the ionization of the area between the electrodes caused by the traveling explosive shock wave sends a signal to initiate operation of the device to cause it to operate at the proper time. The operated device may be photographic equipment consisting of an x-ray illuminating tube.

Tuck, J.L.



Digital time delay  

DOE Patents (OSTI)

Method and apparatus are provided for generating an output pulse following a trigger pulse at a time delay interval preset with a resolution which is high relative to a low resolution available from supplied clock pulses. A first lumped constant delay provides a first output signal at predetermined interpolation intervals corresponding to the desired high resolution time interval. Latching circuits latch the high resolution data to form a first synchronizing data set. A selected time interval has been preset to internal counters and corrected for circuit propagation delay times having the same order of magnitude as the desired high resolution. Internal system clock pulses count down the counters to generate an internal pulse delayed by an internal which is functionally related to the preset time interval. A second LCD corrects the internal signal with the high resolution time delay. A second internal pulse is then applied to a third LCD to generate a second set of synchronizing data which is complementary with the first set of synchronizing data for presentation to logic circuits. The logic circuits further delay the internal output signal with the internal pulses. The final delayed output signal thereafter enables the output pulse generator to produce the desired output pulse at the preset time delay interval following input of the trigger pulse.

Martin, A.D.



Environment Induced Time Arrow  

E-Print Network (OSTI)

The spread of the time arrows from the environment to an observed subsystem is followed within a harmonic model. A similarity is pointed out between irreversibility and a phase with spontaneously broken symmetry. The causal structure of interaction might be lost in the irreversible case, as well. The Closed Time Path formalism is developed for classical systems and shown to handle the time arrow problem in a clear and flexible manner. The quantum case is considered, as well, and the common origin of irreversibility and decoherence is pointed out.

Janos Polonyi




DOE Patents (OSTI)

An electrically variable time delay line is described which may be readily controlled simuitaneously with variable impedance matching means coupied thereto such that reflections are prevented. Broadly, the delay line includes a signal winding about a magnetic core whose permeability is electrically variable. Inasmuch as the inductance of the line varies directly with the permeability, the time delay and characteristic impedance of the line both vary as the square root of the permeability. Consequently, impedance matching means may be varied similariy and simultaneously w:th the electrically variable permeability to match the line impedance over the entire range of time delay whereby reflections are prevented.

Clemensen, R.E.



Real-time observation of Escherichia coli cells under irradiation with a 2-MeV H{sup +} microbeam  

SciTech Connect

A high-energy H{sup +} microbeam generated by tapered glass capillary optics was applied to a single Escherichia coli cell, in order to evaluate the effects of irradiation on the activity of the flagellar motor and cell growth in real time. The flagellar motor of the tethered cells was stopped by irradiation with an average ion fluence of 2.0 x 10{sup 12} protons/cm{sup 2}. When a lower dose was applied to the cells attached to the substrate, an elongated cell, which seemed ready to divide, divided into two daughter cells; however, the daughter cells did not elongate, neither did further cell division occur.

Kato, Mikio [Department of Biological Science, Graduate School of Science, Osaka Prefecture University, 1-1 Gakuencho, Naka-ku, Sakai 599-8531 (Japan); Meissl, Walter; Ikeda, Tokihiro; Yamazaki, Yasunori [Atomic Physics Laboratory, RIKEN, 2-1 Hirosawa, Wako 351-0198 (Japan); Umezawa, Kenji [Department of Physical Science, Graduate School of Science, Osaka Prefecture University, 1-1 Gakuencho, Naka-ku, Sakai 599-8531 (Japan)



Time, energy & form  

E-Print Network (OSTI)

Physical manifestations of time occur in natural forms of all sizes. Architectural form serves as shelter while providing a built envelope of human life, simultaneously influencing and influenced by energetic activities ...

McInnis, Martha Jane



Dogs and Time  

NLE Websites -- All DOE Office Websites (Extended Search)

Question: I travel often and worry how leaving for long periods of time (and boarding my dog) will affect her. I wouldn't think that dogs could understand the concept of...


Wood Use Across Time  

E-Print Network (OSTI)

?Forest products history and use ?Forest resource- the big picture ?Consumption- the big picture ?Trends forest products industry ? pulp & paper ? solid woodBack in Time ?1492 ? Columbus sailed the ocean blue! ? wood use- fuelwood American Indians ?1634: Jean Nicolet

Scott Bowe; United States Wood Use



Technical Talks Timing  

NLE Websites -- All DOE Office Websites (Extended Search)

Talks Timing The technical talks should last a maximum of 15 minutes with 5 minutes for set-up and 5 minutes for Q&A. No teamgroup presentations are allowed. The objective of...


Aggregationn of Space-Time Processes  

E-Print Network (OSTI)

irfxvrq LhihiUi? |_tU ttL? t@? _@TT*U@|L? tLu| i5T@UiA4i -i|@*i_hiuihi? Uit@? _@_tU ttL? Lui} |4@|h tTiU U@|L? U@?i? |% | uhL4| i5T@UiA4i tTL? |i_L |M)`i@? _ -@hiM@ti_L? |

Giacomini, Raffaella; Granger, Clive W.J.



Symmetry breaking in optimal timing of traffic signals on an idealized two-way street  

E-Print Network (OSTI)

Simple physical models based on fluid mechanics have long been used to understand the flow of vehicular traffic on freeways; analytically tractable models of flow on an urban grid, however, have not been as extensively explored. In an ideal world, traffic signals would be timed such that consecutive lights turned green just as vehicles arrived, eliminating the need to stop at each block. Unfortunately, this "green wave" scenario is generally unworkable due to frustration imposed by competing demands of traffic moving in different directions. Until now this has typically been resolved by numerical simulation and optimization. Here, we develop a theory for the flow in an idealized system consisting of a long two-way road with periodic intersections. We show that optimal signal timing can be understood analytically and that there are counter-intuitive asymmetric solutions to this signal coordination problem. We further explore how these theoretical solutions degrade as traffic conditions vary and automotive dens...

Panaggio, Mark J; Hu, Peiguang; Abrams, Daniel M



Modeling and Analysis of Load and Time Dependent Software Rejuvenation Policies  

E-Print Network (OSTI)

Due to repeated and potentially faulty usage of continuously running client-server type software systems by many clients, such software "ages" with time and eventually fails. Huang et. al. proposed a technique called "software rejuvenation" [3] in which the software is periodically stopped and then restarted in a "robust" state after proper maintenance. This "renewal " of software prevents, or at least postpones, the crash failure. In this paper, we present a quantitative analysis of two software rejuvenation policies. The first one considers only the ageing behaviour of the system by time, while the second one considers the actual load of the system as well. The behaviour of the system is represented through a Markov Regenerative Stochastic Petri Net (MRSPN) model. Numerical analysis of the system performance regarding the probability of successful service of clients is provided. Keywords: Continuously running client-server software systems, Software rejuvenation, Markov Regenerati...

S. Garg; A. Pfening; A. Puliafito; M. Telek; K. S. Trivedi




NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Number of trips 1,610 Distance traveled (mi) 372 Percent of total distance traveled (%) 72% Average Trip Distance (mi) 0.2 Average Driving Speed (mph) 5.2 Average Stops per mile 32.1 Percent of Regen Braking Energy Recovery (%) 13% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 383 Number of trips 114 Distance traveled (mi) 144 Percent of total distance traveled (%) 28% Average Trip Distance (mi) 1.3 Average Driving Speed (mph) 18.3 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 16% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 549 Number of trips 5 Distance traveled (mi) 2 Percent of total distance traveled (%) 0% Average Trip Distance (mi) 0.4 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

530 530 Number of trips 1,308 Distance traveled (mi) 495 Percent of total distance traveled (%) 69% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 5.6 Average Stops per mile 31.4 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 471 Number of trips 91 Distance traveled (mi) 175 Percent of total distance traveled (%) 24% Average Trip Distance (mi) 1.9 Average Driving Speed (mph) 16.6 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 357 Number of trips 2 Distance traveled (mi) 49 Percent of total distance traveled (%) 7% Average Trip Distance (mi) 24.7 Average Driving Speed (mph)

Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

74 74 Number of trips 399 Distance traveled (mi) 148 Percent of total distance traveled (%) 73% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 6.3 Average Stops per mile 35.5 Percent of Regen Braking Energy Recovery (%) 11% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 423 Number of trips 27 Distance traveled (mi) 54 Percent of total distance traveled (%) 27% Average Trip Distance (mi) 2.0 Average Driving Speed (mph) 20.7 Average Stops per mile 3.5 Percent of Regen Braking Energy Recovery (%) 15% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 0 Number of trips 0 Distance traveled (mi) 0 Percent of total distance traveled (%) 0% Average Trip Distance (mi) 0.0 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Number of trips 493 Distance traveled (mi) 189 Percent of total distance traveled (%) 38% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 4.9 Average Stops per mile 28.7 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 377 Number of trips 67 Distance traveled (mi) 275 Percent of total distance traveled (%) 56% Average Trip Distance (mi) 4.1 Average Driving Speed (mph) 17.9 Average Stops per mile 3.7 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 438 Number of trips 1 Distance traveled (mi) 29 Percent of total distance traveled (%) 6% Average Trip Distance (mi) 28.7 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

505 505 Number of trips 601 Distance traveled (mi) 245 Percent of total distance traveled (%) 62% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 5.4 Average Stops per mile 34.8 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 373 Number of trips 35 Distance traveled (mi) 124 Percent of total distance traveled (%) 31% Average Trip Distance (mi) 3.5 Average Driving Speed (mph) 23.0 Average Stops per mile 3.7 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 319 Number of trips 3 Distance traveled (mi) 25 Percent of total distance traveled (%) 6% Average Trip Distance (mi) 8.5 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

613 613 Number of trips 89 Distance traveled (mi) 9 Percent of total distance traveled (%) 30% Average Trip Distance (mi) 0.1 Average Driving Speed (mph) 7.0 Average Stops per mile 44.5 Percent of Regen Braking Energy Recovery (%) 9% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 487 Number of trips 8 Distance traveled (mi) 5 Percent of total distance traveled (%) 16% Average Trip Distance (mi) 0.6 Average Driving Speed (mph) 25.0 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 6% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 487 Number of trips 7 Distance traveled (mi) 16 Percent of total distance traveled (%) 54% Average Trip Distance (mi) 2.3 Average Driving Speed (mph)


Quantum tunneling time  

E-Print Network (OSTI)

A simple model of a quantum clock is applied to the old and controversial problem of how long a particle takes to tunnel through a quantum barrier. The model I employ has the advantage of yielding sensible results for energy eigenstates, and does not require the use of time-dependant wave packets. Although the treatment does not forbid superluminal tunneling velocities, there is no implication of faster-than-light signaling because only the transit duration is measurable, not the absolute time of transit. A comparison is given with the weak-measurement post-selection calculations of Steinberg.

P. C. W. Davies



Deflection gating for time-resolved x-ray magnetic circular dichroism-photoemission electron microscopy using synchrotron radiation  

SciTech Connect

In this paper, we present a newly developed gating technique for a time-resolving photoemission microscope. The technique makes use of an electrostatic deflector within the microscope's electron optical system for fast switching between two electron-optical paths, one of which is used for imaging, while the other is blocked by an aperture stop. The system can be operated with a switching time of 20 ns and shows superior dark current rejection. We report on the application of this new gating technique to exploit the time structure in the injection bunch pattern of the synchrotron radiation source BESSY II at Helmholtz-Zentrum Berlin for time-resolved measurements in the picosecond regime.

Wiemann, C.; Kaiser, A. M.; Cramm, S. [Peter Gruenberg Institut PGI-6 'Electronic Properties', Research Centre Juelich, D-52425 Juelich (Germany); Schneider, C. M. [Peter Gruenberg Institut PGI-6 'Electronic Properties', Research Centre Juelich, D-52425 Juelich (Germany); Fakultaet fuer Physik and Center for Nanointegration Duisburg-Essen (CeNIDE), Universitaet Duisburg-Essen, D-47048 Duisburg (Germany)



NSIT Computer Time Services: Internet Time Service (ITS) ...  

Science Conference Proceedings (OSTI)

Page 1. NIST Special Publication 250-59 NIST Computer Time Services: Internet Time Service (ITS), Automated Computer Time Service (ACTS), ...



Probabilistic timed behavior trees  

Science Conference Proceedings (OSTI)

The Behavior Tree notation has been developed as a method for systematically and traceably capturing user requirements. In this paper we extend the notation with probabilistic behaviour, so that reliability, performance, and other dependability properties ... Keywords: behavior trees, model checking, probabilities, timed automata

Robert Colvin; Lars Grunske; Kirsten Winter



Genepool Time Heatmaps  

NLE Websites -- All DOE Office Websites (Extended Search)

Genepool Time Heatmaps Genepool Time Heatmaps Heatmap of Time and Slots Requested vs Time Waited (in hours) | Queue: All | Last 7 Days Time Requested Slots 1wk Job Count Longest Wait 1 23.0 (233) 0.37 (1819) 27.54 (49888) 5.85 (124593) 1.23 (39835) 0.34 (732) 0 0.4 (224) 0.02 (1) 217325 538.96 2 0 0.01 (19) 2.54 (78) 0.2 (140) 0.99 (2683) 0 0 0 0 2920 9.1 4 0.08 (1) 0 2.82 (141) 0.36 (143) 1.07 (12) 0.06 (5) 0.01 (5) 0.06 (1) 1.3 (5) 313 20.48 6 0.01 (2) 0 0.09 (32) 0.07 (1) 0 0 0 0 0 35 1.22 8 0.04 (24) 4.32 (7423) 5.31 (1999) 0.53 (316) 13.14 (2486) 0.01 (2) 1.21 (88) 1.3 (34) 8.33 (68) 12440 46.16 10 0 0 0 0 0 0 0 8.56 (1) 0 1 8.56 16 0 0 0 0.03 (1) 0 0 0 0 0 1 0.03 24 0 0 0 0 0 0 0 0 0.01 (1) 1 0.01 32 0 0 0 0.04 (14) 0 0 0 0.01 (6) 0 20 0.26


Timed fast charger  

Science Conference Proceedings (OSTI)

In a charger for rechargeable electrochemical cells, a transformer charging circuit supplies a charging current to the battery at a fast charge rate for a predetermined time followed by a continuous slow charge rate. A normally closed automatic reset thermostat in series with the rectifier diodes in the charging circuit, and thermally coupled to them, opens after a period of time, dependent upon the heat generated by the rectifier diodes and upon the thermal mass of the thermostat and diodes, and terminates the fast charge current. A resistor, shunted across the thermostat and thermally coupled to it, establishes a slow charge rate current path when the thermostat opens. Heat generated in the resistor causes the thermostat to remain open as long as the battery is connected and ac power is supplied to the transformer primary winding.

Mullersman, F.H.



Internet Topology over Time  

E-Print Network (OSTI)

There are few studies that look closely at how the topology of the Internet evolves over time; most focus on snapshots taken at a particular point in time. In this paper, we investigate the evolution of the topology of the Autonomous Systems graph of the Internet, examining how eight commonly-used topological measures change from January 2002 to January 2010. We find that the distributions of most of the measures remain unchanged, except for average path length and clustering coefficient. The average path length has slowly and steadily increased since 2005 and the average clustering coefficient has steadily declined. We hypothesize that these changes are due to changes in peering policies as the Internet evolves. We also investigate a surprising feature, namely that the maximum degree has changed little, an aspect that cannot be captured without modeling link deletion. Our results suggest that evaluating models of the Internet graph by comparing steady-state generated topologies to snapshots of the real data ...

Edwards, Benjamin; Stelle, George; Forrest, Stephanie



Space Time Matter inflation  

E-Print Network (OSTI)

We study a model of power-law inflationary inflation using the Space-Time-Matter (STM) theory of gravity for a five dimensional (5D) canonical metric that describes an apparent vacuum. In this approach the expansion is governed by a single scalar (neutral) quantum field. In particular, we study the case where the power of expansion of the universe is $p \\gg 1$. This kind of model is more successful than others in accounting for galaxy formation.

Mariano Anabitarte; Mauricio Bellini



Depth profiling of tritium by neutron time-of-flight  

SciTech Connect

A method was developed to measure the depth profile of tritium implanted or absorbed in materials. The sample to be analyzed is bombarded with a pulsed proton beam and the energy of neutrons produced by the T(p,n) reaction is measured by the time-of-flight technique. From the neutron energy the depth in the target of the T atoms may be inferred. A sensitivity of 0.1 at. percent T or greater is possible. The technique is non-destructive and may be used with thick or radioactive host materials. Samples up to 20 $mu$m in thickness may be profiled with resolution limited by straggling of the proton beam for depths greater than 1 $mu$m. Deuterium depth profiling has been demonstrated using the D(d,n) reaction. The technique has been used to observe the behavior of an implantation spike of T produced by a 400 keV T$sup +$ beam stopping at a depth of 3 $mu$m in 11 $mu$m thick layers of Ti and TiH. The presence of H in the Ti lattice is observed to inhibit the diffusion of T through the lattice. Effects of the total hydrogen concentration (H + T) being forced above stoichiometry at the implantation site are suggested by the shapes of the implanation spikes. (auth)

Davis, J.C.; Anderson, J.D.; Lefevre, H.W.



Gamma bang time/reaction history diagnostics for the National Ignition Facility using 90 deg. off-axis parabolic mirrors  

Science Conference Proceedings (OSTI)

Gas Cherenkov detectors (GCDs) have been used to convert fusion gamma into photons to achieve gamma bang time and reaction history measurements. The GCDs designed for OMEGA used Cassegrain reflector optics in order to fit inside a 10 in. manipulator. A novel design for the National Ignition Facility using 90 deg. off-axis parabolic mirrors will increase light collection efficiency from fusion gammas and achieve minimum time dispersion. The broadband Cherenkov light (from 200 to 800 nm) is relayed into a high-speed detector using three parabolic mirrors. Because light is collected from many source planes throughout the CO{sub 2} gas volume, the detector is positioned at the stop position rather than at an image position. The stop diameter and its position are independent of the light-generation location along the gas cell. The current design collects light from a 100 mm diameter by 500 mm long gas volume. Optical ray tracings demonstrate how light can be collected from different angled trajectories of the Compton electrons as they fly through the CO{sub 2} gas volume. A cluster of four channels will allow for increased dynamic range as well as for different gamma energy threshold sensitivities.

Malone, R. M. [National Security Technologies, P.O. Box 809, Los Alamos, New Mexico 87544 (United States); Herrmann, H. W.; Mack, J. M.; Young, C. S. [Los Alamos National Laboratory, P.O. Box 1663, Los Alamos, New Mexico 87545 (United States); Stoeffl, W. [Lawrence Livermore National Laboratory, P.O. Box 808, Livermore, California 94551 (United States)




Science Conference Proceedings (OSTI)

The Los Alamos National Laboratory Monte Carlo N-Particle radiation transport code, MCNP, is widely used around the world for many radiation protection and shielding applications. As a well-known standard it is also an excellent vehicle for assessing the relative performance of scientific computing platforms. Every three-to-four years a new version of MCNP is released internationally by the Radiation Safety Information Computational Center (RSICC) in Oak Ridge, Tennessee. For each of the past few releases, we have also done a timing study to assess the progress of scientific computing platforms and software. These quadrennial timing studies are valuable to the radiation protection and shielding community because (a) they are performed by a recognized scientific team, not a computer vendor, (b) they use an internationally recognized code for radiation protection and shielding calculations, (c) they are eminently reproducible since the code and the test problems are internationally distributed. Further, if one has a computer platform, operating system, or compiler not presented in our results, its performance is directly comparable to the ones we report because it can use the same code, data, and test problems as we used. Our results, using a single processor per platform, indicate that hardware advances during the past three years have improved performance by less than a factor of two and software improvements have had a marginal effect on performance. The most significant impacts on performance have resulted from developments in multiprocessing and multitasking. The other most significant advance in the last three years has been the accelerated improvements in personal computers. In the last timing study, the tested personal computer was approximately a factor of four slower that the fastest machine tested, a DEC Alphastation 500. In the present study, the fastest PC tested was less than a factor of two slower than the fastest platform, which is a Compaq (previously DEC) Alpha XP1000.




Exploiting VERITAS Timing Information  

E-Print Network (OSTI)

The 499 pixel photomultiplier cameras of the VERITAS gamma ray telescopes are instrumented with 500MHz sampling Flash ADCs. This paper describes a preliminary investigation of the best methods by which to exploit this information so as to optimize the signal-to-noise ratio for the detection of Cherenkov light pulses. The FADCs also provide unprecedented resolution for the study of the timing characteristics of Cherenkov images of cosmic-ray and gamma-ray air showers. This capability is discussed, together with the implications for gamma-hadron separation.

J. Holder; for the VERITAS Collaboration



Microsoft PowerPoint - Real-Time Dynamic Brake Assessment poster.ppt [Compatibility Mode]  

NLE Websites -- All DOE Office Websites (Extended Search)

Dynamic Brake Assessment Dynamic Brake Assessment Purpose Conduct a proof-of-concept test to examine the feasibility of developing an on-board system to assess a vehicle's ability to stop based on typical low-pressure in-service braking events. Partnerships H.T. Hackney Company MGM Brakes Overview Funded through the Federal Motor Carrier Safety Administration's Vehicle and Roadside Operations Division Concept stemming from on the Department of Energy's Medium Truck Duty Cycle research as well as previous research conducted for the National Highway Transportation Safety Administration. Signals to be collected Real-time brake application pressure Vehicle speed and acceleration GPS location and grade information Vehicle weight (current load) Engine parameters such as RPM and torque To be conducted October 2010 -


Good Timing: NIST/CU Collaboration Adds Timing Capability ...  

Science Conference Proceedings (OSTI)

... With the added capability to track the timing of dynamic biochemical reactions, cell ... to measure sensor signals at two points in time at a rate of up to ...



A Time Bucket Formulation for the TSP with Time Windows  

E-Print Network (OSTI)

Nov 10, 2009 ... The Traveling Salesman Problem with Time Windows (TSPTW) is the problem of finding a ... To obtain a good partition of the time windows, we.


The Heliosphere in Time  

E-Print Network (OSTI)

Because of the dynamic nature of the interstellar medium, the Sun should have encountered a variety of different interstellar environments in its lifetime. As the solar wind interacts with the surrounding interstellar medium to form a heliosphere, different heliosphere shapes, sizes, and particle contents result from the different environments. Some of the large possible interstellar parameter space (density, velocity, temperature) is explored here with the help of global heliosphere models, and the features in the resulting heliospheres are compared and discussed. The heliospheric size, expressed as distance of the nose of the heliopause to the Sun, is set by the solar wind - interstellar pressure balance, even for extreme cases. Other heliospheric boundary locations and neutral particle results correlate with the interstellar parameters as well. If the H0 clouds identified in the Millennium Arecibo survey are typical of clouds encountered by the Sun, then the Sun spends ~99.4% of the time in warm low density ISM, where the typical upwind heliosphere radii are up to two orders of magnitude larger than at present.

H. -R. Mller; P. C. Frisch; B. D. Fields; G. P. Zank


Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


NIST Time Scale Data Archive  

Science Conference Proceedings (OSTI)

NIST Time Scale Data Archive. ... The AT1 scale is run in real time using data from an ensemble of cesium standards and hydrogen masers. ...



Time and Frequency Division Homepage  

Science Conference Proceedings (OSTI)

... Controlled ClocksTelephone TimeDivision HistoryFrequently Asked Questions (FAQ)Time and Frequency from A to Z: An illustrated glossaryA Walk ...



Time dependent Directional Profit Model for Financial Time Series Forecasting  

E-Print Network (OSTI)

Time dependent Directional Profit Model for Financial Time Series Forecasting Jingtao YAO Chew Lim@comp.nus.edu.sg Abstract Goodness­of­fit is the most popular criterion for neural network time series forecasting. In the context of financial time series forecasting, we are not only concerned at how good the forecasts fit

Yao, JingTao


On-chip single-copy real-time reverse-transcription PCR in isolated picoliter droplets  

SciTech Connect

The first lab-on-chip system for picoliter droplet generation and RNA isolation, followed by reverse transcription, and PCR amplification with real-time fluorescence detection in the trapped droplets has been developed. The system utilized a shearing T-junction in a fused silica device to generate a stream of monodisperse picoliter-scale droplets that were isolated from the microfluidic channel walls and each other by the oil phase carrier. An off-chip valving system stopped the droplets on-chip, allowing thermal cycling for reverse transcription and subsequent PCR amplification without droplet motion. This combination of the established real-time reverse transcription-PCR assay with digital microfluidics is ideal for isolating single-copy RNA and virions from a complex environment, and will be useful in viral discovery and gene-profiling applications.

Beer, N R; Wheeler, E; Lee-Houghton, L; Watkins, N; Nasarabadi, S; Hebert, N; Leung, P; Arnold, D; Bailey, C; Colston, B



First-passage-time problems in time-aware networks  

E-Print Network (OSTI)

First passage time or the first time that a stochastic process crosses a boundary is a random variable whose probability distribution is sought in engineering, statistics, finance, and other disciplines. The probability ...

Suwansantisuk, Watcharapan, 1978-



NIST: A Walk Through Time - The "Atomic Age" of Time ...  

Science Conference Proceedings (OSTI)

... Transportation, communication, financial transactions, manufacturing, electric power and many ... The next generation of time standards is presently ...



On-chip real-time single-copy polymerase chain reaction in picoliter droplets  

Science Conference Proceedings (OSTI)

The first lab-on-chip system for picoliter droplet generation and PCR amplification with real-time fluorescence detection has performed PCR in isolated droplets at volumes 10{sup 6} smaller than commercial real-time PCR systems. The system utilized a shearing T-junction in a silicon device to generate a stream of monodisperse picoliter droplets that were isolated from the microfluidic channel walls and each other by the oil phase carrier. An off-chip valving system stopped the droplets on-chip, allowing them to be thermal cycled through the PCR protocol without droplet motion. With this system a 10-pL droplet, encapsulating less than one copy of viral genomic DNA through Poisson statistics, showed real-time PCR amplification curves with a cycle threshold of {approx}18, twenty cycles earlier than commercial instruments. This combination of the established real-time PCR assay with digital microfluidics is ideal for isolating single-copy nucleic acids in a complex environment.

Beer, N R; Hindson, B; Wheeler, E; Hall, S B; Rose, K A; Kennedy, I; Colston, B



Heave Compensator stopsHeave Compensator stopsHeave Compensator stopsDrillingDrilling Displacement (bottom)Displacement (bottom)  

E-Print Network (OSTI)

Application system last fall. The problem has now been fixed, but an unknown number of applic- ations at the downstream end of the Lambert Gla- cier-Amery Ice Shelf drainage system, the largest single ice stream of the Lambert-Amery system. Three holes were drilled, each one aimed at providing insights into different


NIST Time Scale Data Archive  

Science Conference Proceedings (OSTI)

NIST Time Scale Data Archive. Updated monthly. Return to Archive index Leap second and UT1-UTC information. This page ...



Personalised time-dependent learning  

Science Conference Proceedings (OSTI)

Time-dependent instruction appears to shape next-generation learning systems, where the value of instruction is as important as the time it takes to learn. The ability to grasp the exact knowledge required to accomplish a specific task, in the ... Keywords: adaptive learning, authoring tools, knowledge management, learning granularity, learning objects, learning resources, learning technology, learning web, ontology, personalised learning, semantic web, time constraints, time-dependent learning, timeliness

R. Benlamri; Y. Atif; J. Berri



Assured Reconfiguration of Fail-Stop Systems  

Science Conference Proceedings (OSTI)

Hardware dependability improvements have led to a situation in which it is sometimes unnecessary to employ extensive hardware replication to mask hardware faults. Expanding upon our previous work on assured reconfiguration for single processes and building ...

Elisabeth A. Strunk; John C. Knight; M. Anthony Aiello



Idle Stop Vehicle Testing Downloadable Dynamometer Database  

E-Print Network (OSTI)

Battery Electric Vehicle (BEV) PHEV EREV Charge Sustaining (CS) Hybrid Electric Vehicle (HEV) Fuel Cell vehicle terminology map for SAE J1715 Increased electric power and energy Increasedelectricpowerandenergy #12;Note: Manual Transmission Vehicle Shift schedules for Dynamometers Most cars in the US use

Kemner, Ken


LBNL -45423 Stopping Duct Quacks: Longevity of  

E-Print Network (OSTI)

in CIBSE and ASHRAE data as well as to k-factors calculated from pitot tube measurements by the authors. They found that the k-factors estimated from tracer gas measurements were similar to those given in the CIBSE


Spectral hole burning for stopping light  

E-Print Network (OSTI)

We propose a novel protocol for storage and retrieval of photon wave packets in a $\\Lambda$-type atomic medium. This protocol derives from spectral hole burning and takes advantages of the specific properties of solid state systems at low temperature, such as rare earth ion doped crystals. The signal pulse is tuned to the center of the hole that has been burnt previously within the inhomogeneously broadened absorption band. The group velocity is strongly reduced, being proportional to the hole width. This way the optically carried information and energy is carried over to the off-resonance optical dipoles. Storage and retrieval are performed by conversion to and from ground state Raman coherence by using brief $\\pi$-pulses. The protocol exhibits some resemblance with the well known electromagnetically induced transparency process. It also presents distinctive features such as the absence of coupling beam. In this paper we detail the various steps of the protocol, summarize the critical parameters and theoretically examine the recovery efficiency.

R. Lauro; T. Chaneliere; J. -L. Le Gouet



Where to Stop Reading a Ranked List?  

Science Conference Proceedings (OSTI)

... We initialize those equations as described above, and iter- ate them until the absolute differences between the old and new values for , ??1, and ...



The LCLS Timing Event System  

Science Conference Proceedings (OSTI)

The Linac Coherent Light Source requires precision timing trigger signals for various accelerator diagnostics and controls at SLAC-NAL. A new timing system has been developed that meets these requirements. This system is based on COTS hardware with a mixture of custom-designed units. An added challenge has been the requirement that the LCLS Timing System must co-exist and 'know' about the existing SLC Timing System. This paper describes the architecture, construction and performance of the LCLS timing event system.

Dusatko, John; Allison, S.; Browne, M.; Krejcik, P.; /SLAC




NLE Websites -- All DOE Office Websites (Extended Search)

Judges 9:00- 9:25 Materials Science Mathew Cherukara Shock Induced Chemistry of NiAl Nano-Composites Chen, X. Gyrya, V. 9:25- 9:50 Materials Science Christian Sorensen Explosive...


All Time, All the Time: Improving NIST Radio  

Science Conference Proceedings (OSTI)

... need for manual adjustments when Daylight Saving Time begins and ends, and allowing automatic resetting of clocks following a power outage.



A Time Bucket Formulation for the TSP with Time Windows  

E-Print Network (OSTI)

Nov 5, 2009 ... Abstract: The Traveling Salesman Problem with Time Windows (TSPTW) is the problem of finding a minimum-cost path visiting a set of cities...


NIST: A Walk Through Time - World Time Scales  

Science Conference Proceedings (OSTI)

... A Walk Through Time - Home Page ... and technologists recognized the inadequacy of timekeeping based on the motion of the Earth, which fluctuates ...


Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Gamma Bang Time/Reaction History Diagnostics for the National Ignition Facility (NIF) Using 90-degree Off-axis Parabolic Mirrors  

SciTech Connect

Gas Cherenkov detectors (GCD) have been used to convert fusion gamma into photons to achieve gamma bang time (GBT) and reaction history measurements. The GCD designed for Omega used Cassegrain reflector optics in order to fit inside a 10-inch manipulator. A novel design for the National Ignition Facility (NIF) using 90 off-axis parabolic (OAP) mirrors will increase light collection efficiency from fusion gammas and achieve minimum time dispersion. The broadband Cherenkov light (from 200 to 800 nm) is relayed into a high-speed detector using three parabolic mirrors. Because light is collected from many source planes throughout the CO2 gas volume, the detector is positioned at the stop position rather than an image position. The stop diameter and its position are independent of the light-generation location along the gas cell. The current design collects light from a 100-mm-diameter by 500-mm-long gas volume. Optical ray tracings demonstrate how light can be collected from different angled trajectories of the Compton electrons as they fly through the CO2 gas volume. A cluster of four channels will allow for increased dynamic range, as well as different gamma energy threshold sensitivities.

R.M. Malone, H.W. Herrmann, J.M. Mack, C.S. Young, W. Stoeffl



Gamma Bang Time/Reaction History Diagnostics for the National Ignition Facility (NIF) Using 90-degree Off-axis Parabolic Mirrors  

SciTech Connect

Gas Cherenkov detectors (GCD) have been used to convert fusion gamma into photons to achieve gamma bang time (GBT) and reaction history measurements. The GCD designed for Omega used Cassegrain reflector optics in order to fit inside a ten-inch manipulator. A novel design for the National Ignition Facility (NIF) using 90 Off-Axis Parabolic (OAP) mirrors will increase light collection efficiency from fusion gammas and achieve minimum time dispersion. The broadband Cherenkov light (from 200 to 800 nm) is relayed into a high-speed detector using three parabolic mirrors. Because light is collected from many source planes throughout the CO2 gas volume, the detector is positioned at the stop position rather than an image position. The stop diameter and its position are independent of the light-generation location along the gas cell. The current design collects light from a 100-mm diameter by 500-mm-long gas volume. Optical ray tracings demonstrate how light can be collected from different angled trajectories of the Compton electrons as they fly through the CO2 gas volume. A cluster of four channels will allow for increased dynamic range as well as different gamma energy threshold sensitivities. 52.70.La, 29.40.Ka, 42.15.Eq, 07.60.-j, 07.85.-m

H.W. Herrmann, R.M. Malone, W. Stoeffl, J.M. Mack, C.S. Young



TACO-DTN: A Time-Aware COntent-based dissemination system for Delay Tolerant Networks  

E-Print Network (OSTI)

Content dissemination applications are becoming more and more popular on fixed infrastructure: in this paper we introduce TACO-DTN, a content dissemination system which, by virtue of being time-aware in terms of subscriptions and events, is appropriate for delay tolerant networks, where a number of nodes act as infostations, enjoying some form of connectivity to the backbone, and other nodes are mobile devices, reachable sometimes only through intermittent connectivity of carriers. Examples of applications benefiting from such a system could be travel information dissemination systems in large cities (exploiting infostations at bus stops) or on highways, advertisements dissemination at specific times, and information dissemination to remote villages. The approach is based on a novel concept of temporal utility of subscriptions and events. The temporal utility is used to govern the routing of the events to the right infostation (i.e., the one reached by the interested subscribers at the right time), avoiding unnecessary information transfer on slow links and the buffer management, in case buffer limitations are an issue. We give a description of our protocol and discuss its validation through simulation.

Mirco Musolesi



Date centerdTimes New Roman  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Fermi National Accelerator Fermi National Accelerator Laboratory's NOvA Project OAS-RA-L-10-02 April 2010 DOE F 1325.8 (08-93) United States Government Department of Energy memorandum INTRODUCTION AND OBJECTIVE The NuMI Off-Axis electron neutrino (v e ) Appearance (NOvA) experiment is a neutrino physics research project conducted by the Office of Science's Fermi National Accelerator Laboratory (Fermilab). The goal of the NOvA experiment is to advance the understanding of neutrino particles. Fermilab, in coordination with the University of Minnesota (University), must complete an accelerator and detector system needed for the experiment. Fermilab is upgrading its accelerator complex to increase beam power and constructing a 220 ton "Near Detector" that will monitor the neutrino beam as it leaves Fermilab. The University is


Time-lock Puzzles and Timed-release Crypto  

Science Conference Proceedings (OSTI)

Our motivation is the notion of ``timed-release crypto,'''' where the goal is to encrypt a message so that it can not be decrypted by anyone, not even the sender, until a pre-determined amount of time has passed. The goal is to ``send information into ...

R. L. Rivest; A. Shamir; D. A. Wagner



Reactor control rod timing system  

DOE Patents (OSTI)

A fluid driven jet-edge whistle timing system for control rods of a nuclear reactor for producing real-time detection of the timing of each control rod in its scram operation. An important parameter in reactor safety, particularly for liquid metal fast breeder reactors (LMFBR), is the time deviation between the time the control rod is released and the time the rod actually reaches the down position. The whistle has a nearly pure tone signal with center frequency (above 100 kHz) far above the frequency band in which the energy of the background noise is concentrated. Each control rod can be fitted with a whistle with a different frequency so that there is no ambiguity in differentiating the signal from each control rod.

Wu, Peter T. K. (Clifton Park, NY)




DOE Patents (OSTI)

This patent relates to a pulse generator and more particularly to a time interval generator wherein the time interval between pulses is precisely determined. The variable time generator comprises two oscillators with one having a variable frequency output and the other a fixed frequency output. A frequency divider is connected to the variable oscillator for dividing its frequency by a selected factor and a counter is used for counting the periods of the fixed oscillator occurring during a cycle of the divided frequency of the variable oscillator. This defines the period of the variable oscillator in terms of that of the fixed oscillator. A circuit is provided for selecting as a time interval a predetermined number of periods of the variable oscillator. The output of the generator consists of a first pulse produced by a trigger circuit at the start of the time interval and a second pulse marking the end of the time interval produced by the same trigger circuit.

Gross, J.E.



Essays in time and risk  

E-Print Network (OSTI)

lists yield systematically higher discount rates and utilityList methodology: identifying time preferences with MPLs and utilityrisk price list to inform curvature of the utility function

Sprenger, Charles



Time-critical information services  

Science Conference Proceedings (OSTI)

Emergency medical services have never been more ready for the implementation of time-critical interorganizational information services for the public good.

Thomas A. Horan; Benjamin L. Schooley



Time and Frequency Users Manual  

Science Conference Proceedings (OSTI)

... 9 TERMS USED 11 ... 135 GLOSSARY 137 INDEX ... The OIL INDUSTRY needs accurate timing to help automate oil well drilling, especially offshore. ...



Automated Computer Time Service (ACTS)  

Science Conference Proceedings (OSTI)

... provided since 1988 for users who need to synchronize computer clocks to ... For computers with Internet access, the Internet Time Service should be ...



Real time wind turbine simulator.  

E-Print Network (OSTI)

??A novel dynamic real-time wind turbine simulator (WTS) is developed in this thesis, which is capable of reproducing dynamic behavior of real wind turbine. The (more)

Gong, Bing



Assessing the Emerging Global Financial Architecture: Measuring the Trilemma's Configurations over Time  

E-Print Network (OSTI)

Fiscal Procyclicality Oil Shock Total Reserve/GDP MonetaryProcyclicality Oil Shock Total Reserve/GDP PC of MI & ERSFiscal Procyclicality Oil Shock Total Reserve/GDP Monetary

Aizenman, Joshua; Chinn, Menzie David; Ito, Hiro



Lu1-xI3:Cex--A Scintillator for gamma ray spectroscopy and time-of-flight PET  

DOE Patents (OSTI)

The present invention concerns very fast scintillator materials comprising lutetium iodide doped with Cerium Lu.sub.1-xI.sub.3:Ce.sub.x; LuI.sub.3:Ce). The LuI.sub.3 scintillator material has surprisingly good characteristics including high light output, high gamma ray stopping efficiency, fast response, low cost, good proportionality, and minimal afterglow that the material is useful for gamma ray spectroscopy, medical imaging, nuclear and high energy physics research, diffraction, non-destructive testing, nuclear treaty verification and safeguards, and geological exploration. The timing resolution of the scintillators of the present invention provide compositions capable of resolving the position of an annihilation event within a portion of a human body cross-section.

Shah, Kanai S. (Newton, MA)



A Simulator for Timed CSP  

E-Print Network (OSTI)

Time is an integral aspect of computer systems. It is essential for modelling a systems performance, but may also affect its safety or security. Timed CSP [Sch00] conservatively extends the process algebra CSP with timed primitives, where real numbers ? 0 model how time passes with reference to a single, conceptually global, clock. While there have been approaches for model checking Timed CSP ([Sch00, DHSZ06]), to the best of our knowledge we are the first to present a simulator for Timed CSP. Here, we restrict time to rational values only. Theoretically, this limits the expressibility of the language. Practically, this limitation turns out to be negligible (for instance all examples of Schneiders book [Sch00] can be dealt with in our simulator). The simulator is the outcome of an undergraduate project at Swansea University [Dra11]. Our Timed CSP simulator extends the open source tool ProB [Leu]. ProBs CSP simulator works as follows: The CSP specification is analyzed by a parser (written in Haskell) and translated to a representation in Prolog. A CSP Interpreter (in Prolog) stores the firing rules of CSPs operational semantics. The Simulator (also in Prolog) determines the actions available and the resultant states. A GUI (written in Tcl/Tk) allows the user to interact with the Simulator. Timed CSP is closed under rational time [DNR11]. Consider, for example, the following firing rule ( t ? stands for a timed transition of duration t): P d? ? P ? (P ?d Q) d?

Marc Dragon; Andy Gimblett; Markus Roggenbach; Jens Bendisposto; Cliff Jones; Michael Leuschel; Er Romanovsky; Tiziana Margaria; Julia Padberg; Gabriele Taentzer; Marc Dragon; Andy Gimblett; Markus Roggenbach



Electric Time in Quantum Cosmology  

E-Print Network (OSTI)

Effective quantum cosmology is formulated with a realistic global internal time given by the electric vector potential. New possibilities for the quantum behavior of space-time are found, and the high-density regime is shown to be very sensitive to the specific form of state realized.

Stephon Alexander; Martin Bojowald; Antonino Marciano; David Simpson



Time-Constrained Loop Pipelining  

Science Conference Proceedings (OSTI)

This paper addresses the problem of Time-Constrained Loop Pipelining, i.e. given a fixed throughput, finding a schedule of a loop which minimizes resource requirements. This paper proposes a methodology, called TCLP, based on dividing the problem into ... Keywords: loop pipelining, scheduling, timing and resource contraints, register optimization

Fermin Sanchez



Beam Time Allocation Committee (BAC)  

NLE Websites -- All DOE Office Websites (Extended Search)

Time Allocation Committee (BAC) Time Allocation Committee (BAC) Charter Purpose: Allocates general user beam time by instrument to promote diverse and high- impact science and a broad-based user community to meet DOE and NSSD goals. Participants: BAC Chair (appointed by NSSD Director), Instrument Group Leaders, User Office Schedule: Tied to proposal calls - expected to meet at least 2 times/year with meetings scheduled about 6 weeks after the proposal call has closed and at least 1 month prior to scheduled operations. Process: 1. Instrument Group Leaders (with group members): a. Confirm feasibility (equipment requirements and instrument capabilities) and safe operations b. Review amount of beam time requested and adjust as needed with consideration for instrument and sample environment availability.


Finding patterns in timed data with spike timing dependent plasticity  

E-Print Network (OSTI)

My research focuses on finding patterns in events - in sequences of data that happen over time. It takes inspiration from a neuroscience phenomena believed to be deeply involved in learning. I propose a machine learning ...

Oliveira, Alexandre (Alexandre S.)



Upgrade of NSLS timing system  

SciTech Connect

We report on the progress of the new NSLS timing system. There are three types of requirements for NSLS timing system: clocks, synchronization and trigger circuits. All ring revolution frequency clocks are generated using ECL and high speed TTL logic. The synchronization circuits allows to fill both storage rings with any bunch pattern. The triggers are generated by using commercially available digital delay generators. The delay unit`s outputs are ultrastable, with a resolution of 5 ps, and are programmed by computer via IEEE 488 interface. The block diagrams, description of all major timing components and the present status are provided in this paper.

Singh, O.; Ramamoorthy, S.; Sheehan, J.; Smith, J.


Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Silicon photomultiplier timing performance study  

E-Print Network (OSTI)

Many characteristics of Silicon Photomultipliers can be tuned with temperature and operation voltage. We present preliminary results of a study of the effect of these two operation parameters on the time resolution of large active area Multi-Pixel Photon Counters (MPPCs) manufactured by Hamamatsu. Measurements at -10 C, 0 C, and 10 C at different bias voltages were performed. The time resolution is best at low temperature and high over-voltage. Most significant improvements can be achieved in cases with low number of fired pixels (40 pixels) the effect of temperature and operation voltage becomes smaller. The timing performance still improves with decreasing temperature (~ factor of 2) but it hardly depends on the operation voltage. The study shows, that especially in applications where only few photons are available for detection a careful optimization of temperature and operation voltage are advisable to obtain optimum timing results with the MPPC.

Gama Ahmed; Paul Bhler; Johann Marton; Ken Suzuki



Logarithmic time parallel Bayesian inference  

Science Conference Proceedings (OSTI)

I present a parallel algorithm for exact probabilistic inference in Bayesian networks. For polytree networks with n variables, the worstcase time complexity is O(logn) on a CREW PRAM (concurrent-read, exclusive-write parallel random-access ...

David M. Pennock



The structure of cosmic time  

E-Print Network (OSTI)

Following the approach of Julien Lesgourgues [1], we analyze the mathematical structure of the time co-ordinate of present day cosmological models, where these models include a cosmological constant term to account for the observed acceleration of the universe [2], [3]: we find that in all cases, except for a set of measure zero in the parameter space, the time is given by an (abelian) integral on a torus; the imaginary period of this integral then gives a natural periodicity in imaginary time for the universe; following Stephen Hawking [4], [5], this periodicity may be interpreted either as giving a fundamental mass scale for the universe, or (using Plancks constant) a fundamental temperature, or both. The precise structure that emerges suggests that the structure of time can be regarded as an order parameter arising perhaps in a phase transition in the early universe; one might hope that this structure

George Sparling



A real time priority scheduler  

Science Conference Proceedings (OSTI)

The real time priority scheduler reported herein evolved from a design effort to provide software aids for handling the interrupts that occur in hybrid computation. Since these interrupts are both internal and external (i.e., generated internal and external ...

Karl Ramsay; Jon C. Strauss



Time-Constrained Loop Pipelining  

E-Print Network (OSTI)

This paper addresses the problem of Time-Constrained Loop Pipelining, i.e. given a fixed throughput, finding a schedule of a loop which minimizes resource requirements. We propose a methodology, called TCLP, based on dividing the problem into two simpler and independent tasks: retiming and scheduling. TCLP explores different sets of resources, searchingfor a maximum resource utilization. This reduces area requirements. After a minimum set of resourceshas been found, the execution throughput is increased and the number of registers required by the loop schedule is reduced. TCLP attempts to generate a schedule which minimizes cost in time and area (resources and registers). The results show that TCLP obtains optimal schedules in most cases. 1 Introduction This paper presents TCLP, a methodology to solve TimeConstrained Loop Pipelining. TCLP is NP-complete [3]. Two types of timing constraints (TCs) have been considered in the literature: local TCs to specify minimum and/or maximum TCs ...

Fermn Sanchez; Jordi Cortadella



Discrete space-time symmetries  

SciTech Connect

Symmetries have always fascinated human beings; they are found in nature, art, and architecture. Physicists, like other scientists have often used symmetries as a basis of their understanding of nature. When the dynamics is unknown, symmetries serve to delineate and define it. When the dynamics is known, symmetries are used to study structure. These two lectures review the theory and present understanding and status of two discrete space-time symmetries,, namely parity (P) and time reversal (T).

Henley, E.M.



Discrete space-time symmetries  

SciTech Connect

Symmetries have always fascinated human beings; they are found in nature, art, and architecture. Physicists, like other scientists have often used symmetries as a basis of their understanding of nature. When the dynamics is unknown, symmetries serve to delineate and define it. When the dynamics is known, symmetries are used to study structure. These two lectures review the theory and present understanding and status of two discrete space-time symmetries,, namely parity (P) and time reversal (T).

Henley, E.M.



Reduction in maximum time uncertainty of paired time signals  

DOE Patents (OSTI)

Reduction in the maximum time uncertainty (t/sub max/ - t/sub min/) of a series of paired time signals t/sub 1/ and t/sub 2/ varying between two input terminals and representative of a series of single events where t/sub 1/ less than or equal to t/sub 2/ and t/sub 1/ + t/sub 2/ equals a constant, is carried out with a circuit utilizing a combination of OR and AND gates as signal selecting means and one or more time delays to increase the minimum value (t/sub min/) of the first signal t/sub 1/ closer to t/sub max/ and thereby reduce the difference. The circuit may utilize a plurality of stages to reduce the uncertainty by factors of 20 to 800.

Theodosiou, G.E.; Dawson, J.W.



Tough Times for the Muskrats  

NLE Websites -- All DOE Office Websites (Extended Search)

Tough Times for the Muskrats Tough Times for the Muskrats Nature Bulletin No. 3 February 24, 1945 Forest Preserve District of Cook County Clayton F Smith, President Roberts Mann, Superintendent of Conservation TOUGH TIMES FOR THE MUSKRATS This has been a sorry year for the muskrats. The long drought, last summer and fall, dried up many of the smaller marshes and ponds where they had been living and forced them to migrate overland to new homes. Many undoubtedly were killed while enroute by mink, hawks, or dogs. Even the larger marshes and ponds were made smaller and more shallow by the drought and now this severe winter, with its long, bitter cold, has caused many of them to freeze solid to the very bottom; thus sealing the muskrats up in their lodges and preventing them from swimming around under the ice to get food.


May 2008 Y-12 Times  

NLE Websites -- All DOE Office Websites (Extended Search)

5 5 May 2008 www.y12.doe.gov/news/times.php P.O. Box 2009 Oak Ridge, TN 37831-8245 Managing Editor Melissa Leinart 865-574-1621 (6ml) Associate Editors Amy Alley Heidi Spurling Layout/Design Lisa Harris Contributors Ellen Boatner Ken Davis Kathy Fahey Stuart Hames Sharon McConathy Patrick McCoy I N S I D E Page 3 Fire department members come to the rescue Page 4 Driving green to protect our natural resources Page 5 73s: Best regards from Y-12's hams Page8 What's the secret? Mary Murray Brett Pate Ray Smith Donna Watson Bill Wilburn Lisa Xiques times times the B&W Technical Services Y-12, LLC, a partnership between Babcock & Wilcox Technical Services Group Inc. and Bechtel National Inc., operates the Y-12 National Security Complex. When you see information regarding the recent Voluntary Separation Payment


Dielectric Analog Space-Times  

E-Print Network (OSTI)

We generalize the notion of a dielectric analog Schwarzschild black hole model to analog models of arbitrary space-times; in particular, the approach is not restricted to static space-times. This is done by establishing a correspondence between electrodynamics on a curved, vacuum manifold, with electrodynamics in a general linear dielectric residing in Minkowski space-time. The mapping is not unique, allowing for some freedom in the specification of equivalent materials, which could be useful for exploiting recent developments in the production of metamaterials. Some examples are considered, with special attention paid to the dielectric analog of the exterior Kerr geometry, which is found to be reproducible with regular, linear, dielectrics.

Robert T. Thompson; Jrg Frauendiener



Time-Off Awards Scale  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

/1/2010 /1/2010 TIME OFF AWARD SCALE The following chart is recommended and should be used unless another time-off award scale has been adopted by the servicing human resources office. TIME OFF SCALE VALUE OF THE EMPLOYEE'S CONTRIBUTION HOURS TO BE AWARDED MODERATE - A contribution to a product, program or service to the public which is of sufficient value to merit formal recognition. Beneficial change or modification of operating principles or procedures. 1 - 10 Hours SUBSTANTIAL - An important contribution to the value of a product, activity, program or service to the public. Significant change or modification or operating principles or procedures. 11 - 20 Hours HIGH - A significant contribution to the value of a product, activity, program or service to


Assessing Energy Impact of Plug-In Hybrid Electric Vehicles: Significance of Daily Distance Variation over Time and Among Drivers  

Science Conference Proceedings (OSTI)

Accurate assessment of the impact of plug-in hybrid electric vehicles (PHEVs) on petroleum and electricity consumption is a necessary step toward effective policies. Variations in daily vehicle miles traveled (VMT) over time and among drivers affect PHEV energy impact, but the significance is not well understood. This paper uses a graphical illustration, a mathematical derivation, and an empirical study to examine the cause and significance of such an effect. The first two methods reveal that ignoring daily variation in VMT always causes underestimation of petroleum consumption and overestimation of electricity consumption by PHEVs; both biases increase as the assumed PHEV charge-depleting (CD) range moves closer to the average daily VMT. The empirical analysis based on national travel survey data shows that the assumption of uniform daily VMT over time and among drivers causes nearly 68% underestimation of expected petroleum use and nearly 48% overestimation of expected electricity use by PHEVs with a 40-mi CD range (PHEV40s). Also for PHEV40s, consideration of daily variation in VMT over time but not among drivers similar to the way the utility factor curve is derived in SAE Standard SAE J2841 causes underestimation of expected petroleum use by more than 24% and overestimation of expected electricity use by about 17%. Underestimation of petroleum use and overestimation of electricity use increase with larger-battery PHEVs.

Lin, Zhenhong [ORNL; Greene, David L [ORNL




DOE Patents (OSTI)

A tine-delay circuit which produces a delay time in d. The circuit a capacitor, an te back resistance, connected serially with the anode of the diode going to ground. At the start of the time delay a negative stepfunction is applied to the series circuit and initiates a half-cycle transient oscillatory voltage terminated by a transient oscillatory voltage of substantially higher frequency. The output of the delay circuit is taken at the junction of the inductor and diode where a sudden voltage rise appears after the initiation of the higher frequency transient oscillations.

Creveling, R.



Time of flight mass spectrometer  

DOE Patents (OSTI)

A time-of-flight mass spectrometer is described in which ions are desorbed from a sample by nuclear fission fragments, such that desorption occurs at the surface of the sample impinged upon by the fission fragments. This configuration allows for the sample to be of any thickness, and eliminates the need for complicated sample preparation.

Ulbricht, Jr., William H. (Arvada, CO)



The TESLA Time Projection Chamber  

E-Print Network (OSTI)

A large Time Projection Chamber is proposed as part of the tracking system for a detector at the TESLA electron positron linear collider. Different ongoing R&D studies are reviewed, stressing progress made on a new type readout technique based on Micro-Pattern Gas Detectors.

Nabil Ghodbane



Waste to Energy Time Activities  

E-Print Network (OSTI)

SEMINAR Waste to Energy Time Activities 9:30-9:40 Brief introduction of participants 9:40-10:10 Presentation of Dr. Kalogirou, "Waste to Energy: An Integral Part of Worldwide Sustainable Waste Management" 10. Sofia Bethanis, "Production of synthetic aggregates for use in structural concrete from waste to energy

Columbia University


Vocal Timing in the Bat  

E-Print Network (OSTI)

Bats are social organisms that live in large colonies. However, reliance upon echolocation in order to hunt and navigate, means that bats also face pressing acoustic challenges due to overlap with surrounding noise. Bats also possess fine control over the properties of their echolocation pulses. This study's goal was to determine how bats are able to effectively function in large groups despite the interfering noise generated by conspecifics. Mexican free-tailed bats (Tadarida brasiliensis) were exposed to both artificially generated interfering noises and noise generated by conspecifics, and the temporal characteristics of their resulting echolocation calls were analyzed. In addition, bats were given injections of dopaminergic and serotonergic drugs, in an effort to determine which monoamine(s) were capable of altering vocal motor timing and to determine which regions of the brain play a role in regulating the timing of echolocation. I hypothesized that bats would alter the timing of emission of their own echolocation pulses in response to noise, and that drugs affecting the 5HT2A receptor would shift the timing of emission of echolocation pulses. The first part of this dissertation describes a novel temporal alteration behavior that occurs in response to artificially generated intermittent noise, and is characterized by a period of pulse suppression followed by a gradual return to normal call rates. Bats alter the timing of emission of their echolocation pulses to avoid overlap with noise and call within silent periods. The second part of this study investigated whether dopamine or serotonin, or both, could alter the timing of this vocal behavior. The results of this study were inconclusive, although I found some evidence that 5HT2A agonists can produce faster responses. Finally, I show that echolocating bats suppress pulse emission in nearby conspecifics. The resulting decrease in call rate leads to an overall increase in information throughput. This study also demonstrates that bats respond to continuous noise by increasing their call rate, and that the switch between the responses to intermittent noise and continuous noise occurs at a duty cycle of 50% or higher. Overall, this dissertation establishes that bats alter the timing of emission of their echolocation calls in response to noise, and that these mechanisms may be regulated by serotoninergic mechanisms.

Jarvis, Jenna N



Predictable real-time software synthesis  

Science Conference Proceedings (OSTI)

Formal theories for real-time systems (such as timed process algebra, timed automata and timed petri nets) have gained great success in the modeling of concurrent timing behavior and in the analysis of real-time properties. However, due to the ineliminable ... Keywords: Formal methods, Program synthesis, Real-time systems

Jinfeng Huang; Jeroen Voeten; Henk Corporaal



Not going home: Army changes program for active duty Stop Loss, Stop Movement  

E-Print Network (OSTI)

WASHINGTON Active-duty Soldiers nearing the end of their service contract may not be getting out of the Army as soon as they might have expected. Army officials announced June 1 the latest Active Army

Story Karla; L. Gonzalez


Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

MARCH 2013 MARCH 2013 inside this issue ... FIRP draws to a close Page 2 Reminisce: Y-12 turns 70 Page 4 Russia's secret city Page 5 Development retools its CONOPS Page 6 ... and other Y-12 news Miss an issue? Find us online, http://www.y12.doe.gov/news/times.php MISSION, cont. on pg. 2 The National Nuclear Security Administration's Performance Evaluation Report for B&W Y-12, released Feb. 11, gave "Very Good" ratings to B&W Y-12 in areas related to all three core missions: maintaining the nuclear weapons stockpile, powering the nuclear Navy and nonproliferation. The report evaluates B&W Y-12's performance based on the Performance Evaluation Plan approved at the beginning of fi scal 2012. Programs The Y-12 Times highlighted the success of fi


Time-parareal parallel in time integrator solver for time-dependent neutron diffusion equation  

E-Print Network (OSTI)

-dependent spatial flux distribution in nuclear reactor is required for nuclear safety and design. The motivation present a time-parallel algorithm that simulate the kinetic of neutron2 in a nuclear reactor. We consider engine behavior and in particular its energy4 production.5 The flux distribution on the nuclear reactor


Why Time is Future Oriented  

E-Print Network (OSTI)

We assume that the universe consists of clusters which in turns have sub-clusters and the sub-clusters have sub-subclusters and so on. Confining to three-dimensional space, it is shown that the universe is expanding if entropy of the universe increases. It is also shown that clocks slow down when time progresses towards future. Our model also justifies the big bang theory.

Shahid N. Afridi; M. Khalid Khan



Determining optimum dose--time--area relationships in curative radiotherapy of cancer. A review and evaluation  

SciTech Connect

The old and vital problem of optimum dosage determination in radiotherapy of cancer is reviewed in chronological order from empirical to mathematical concepts. The magnitude of the problem is explained. Doubt is expressed whether a mathematical formula will ever be found that could safely predict an optimum dose-timearea relationship and that could be applied with impunity to the particular patient, without fear of radiation damage to the normal tissues involved. The use of Strandqvist mathematical formula and iso- effect curves and dose-time-area tables representing normal tissue tolerance effects for orthovoltage and telecobalt therapy was evaluated based on experience with patients treated over the past decades. These tables are used as a guide in planning a treatment schedule for a particular patient, but optimum treatment is determined on clinical grounds, on the reactions of the normal tissues, the response of the tumor, and the condition of the patient, and treatment is stopped when the normal tissues have reached tolerance, irrespective of whether the treatment schedule has been completed or not. (auth)

Fichardt, T.



General Interest NIST Time and Frequency Publications  

Science Conference Proceedings (OSTI)

... Time and Frequency Users Manual A detailed ... Fundamentals of Time and Frequency An overview of ... Lombardi, The Mechatronics Handbook, 2001. ...




SciTech Connect

Two major accomplishments resulted from Phase I. One is the success of the surface geochemistry program, which collected over 800 samples from the site of the 1st demonstration well in Vernon Field and has pretty well provided us with the tools to delineate favorable ground from unfavorable. The second is the recent detailed mapping of the Central Michigan Basin that for the first time revealed the presence of at least two major faults that control the location of many of the reservoirs in the Michigan Basin. These faults were located from structure maps obtained by contouring the surface of the Dundee Formation using top picks from 9861 wells in 14 counties. Faults were inferred where the contour lines were most dense (''stacked'').

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan




SciTech Connect

The geochemical sampling team collected additional 148 samples at Vernon Field along 5 new traverses. Most of the locations were sampled for three types of analyses: microbial, iodine and enzyme leach; no results from the second batch of samples were available in time for this report. In addition to the sampling, a study was begun on the feasibility of collecting and analyzing hydrocarbon gases (C1-C8) directly. Although several companies offer these services, the cost ($200-300/sample w/o sampling fee) is high, on par with the cost of a 3D seismic survey, and may not include the raw data. However direct sampling of reservoir gases collecting in the soil appear to offer the best approach and should be included in this study. It would probably work well at Vernon Field. It may be possible to lower costs considerably; initial estimates of $20/sample for GCMS (Gas Chromatography--mass spectrometry) analysis are attractive and might induce to Michigan producers to include soil surveys in their routine field work-ups. A complete set of digital data was assembled for Vernon Field and nearby locations. The set consists of well locations, formation top picks, lithologies and scanned images of driller's reports and scout tickets. Well logs are still being located. The annual meeting for the Class Revisit work group is tentatively scheduled for the week of March 1-7 in Tampa, Fl. By that time all of the geochemical data will be available and final decisions regarding drilling can be made.

James R. Wood; T.J. Bornhorst; S.D. Chittichk; William B. Harrison; W. Quinlan



Real time infrared aerosol analyzer  

DOE Patents (OSTI)

Apparatus for analyzing aerosols in essentially real time includes a virtual impactor which separates coarse particles from fine and ultrafine particles in an aerosol sample. The coarse and ultrafine particles are captured in PTFE filters, and the fine particles impact onto an internal light reflection element. The composition and quantity of the particles on the PTFE filter and on the internal reflection element are measured by alternately passing infrared light through the filter and the internal light reflection element, and analyzing the light through infrared spectrophotometry to identify the particles in the sample.

Johnson, Stanley A. (Countryside, IL); Reedy, Gerald T. (Bourbonnais, IL); Kumar, Romesh (Naperville, IL)



Global Warming in Geologic Time  

Science Conference Proceedings (OSTI)

The notion is pervasive in the climate science community and in the public at large that the climate impacts of fossil fuel CO2 release will only persist for a few centuries. This conclusion has no basis in theory or models of the atmosphere/ ocean carbon cycle, which we review here. The largest fraction of the CO2 recovery will take place on time scales of centuries, as CO2 invades the ocean, but a significant fraction of the fossil fuel CO2, ranging in published models in the literature from 20-60%, remains airborne for a thousand years or longer. Ultimate recovery takes place on time scales of hundreds of thousands of years, a geologic longevity typically associated in public perceptions with nuclear waste. The glacial/interglacial climate cycles demonstrate that ice sheets and sea level respond dramatically to millennial-timescale changes in climate forcing. There are also potential positive feedbacks in the carbon cycle, including methane hydrates in the ocean, and peat frozen in permafrost, that are most sensitive to the long tail of the fossil fuel CO2 in the atmosphere.

Archer, David (University of Chicago)




SciTech Connect

One of the principal objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, microbial samples were collected from the Trusty Steed prospect area in Grand Traverse County, Michigan. The samples were analyzed using the Microbial Oil Surveying Technique (MOST) technique and revealed only a local (1-point) anomaly. A decision to resample over that point is pending, but drilling has been postponed for the time being. The main news this reporting period is that in the Bear Lake area, northwest Michigan, Federated Oil & Gas Properties' Charlich-Fauble 2-9HD horizontal lateral, has cumulative production of more than 72,000 barrels of oil and is still producing 50 to 75 bopd from a Silurian Niagaran reef reservoir eighteen months after the well was completed. Surface geochemical surveys conducted in the demonstration area were consistent with production results although the ultimate decision to drill was based on interpretation of conventional subsurface and 2D seismic data. The surface geochemical techniques employed were Solid Phase MicroExtraction (SPME) and MOST. The geochemical results have been submitted to World Oil for publication. New geochemical surveys are planned for November in the Springdale quadrangle in Manistee County, Michigan. These surveys will concentrate on sampling over the trace of the proposed horizontal wells rather than a broad grid survey.

James R. Wood; A. Wylie; W. Quinlan




NLE Websites -- All DOE Office Websites (Extended Search)

7 7 July 2010 www.y12.doe.gov/news/times.php P.O. Box 2009 Oak Ridge, TN 37831-8245 W H A T ' S I N S I D E Page 2 Want to know about Y-12's budget? Read what Darrel Kohlhorst said. Page 3 Y-12 employees get a LIFE Center Pages 4 and 5 Safeguards, Security and Emergency Services' Sentinel Page 6 Employees raise money for Relay for Life Page 8 Refl ections of Y-12's history B&W Technical Services Y-12, LLC, a partnership between Babcock & Wilcox Technical Services Group Inc. and Bechtel National Inc., operates the Y-12 National Security Complex. A newsletter for employees and friends of the Y-12 National Security Complex Managing Editors Amy Alley: alleyab@y12.doe.gov Heidi Spurling: spurlinghw@y12.doe.gov Layout Lisa Harris Contributors Mary Bryant Cynthia Ensor Ryn Etter



NLE Websites -- All DOE Office Websites (Extended Search)

1 1 December 2011 www.y12.doe.gov/news/times.php P.O. Box 2009 Oak Ridge, TN 37831-8245 W H A T ' S I N S I D E Page 2 Governance Transformation at Y-12 Page 3 Employees bring benefi ts to life Pages 4 and 5 A healthy start to 2012 Page 6 A visit from Christmas past Page 8 Have a plan - just in case B&W Technical Services Y-12, LLC, a partnership between Babcock & Wilcox Technical Services Group Inc. and Bechtel National Inc., operates the Y-12 National Security Complex. A newsletter for employees and friends of the Y-12 National Security Complex Managing Editors Amy Alley: alleyab@y12.doe.gov Heidi Spurling: spurlinghw@y12.doe.gov Layout Lisa Harris Contributors Mary Bryant Ellen Boatner Ashley Douglas Kathy Fahey Scott Fraker John Holbrook David Keim Terry Marlar Jill McNutt


Variable residence time vortex combustor  

DOE Patents (OSTI)

A variable residence time vortex combustor including a primary combustion chamber for containing a combustion vortex, and a plurality of louvres peripherally disposed about the primary combustion chamber and longitudinally distributed along its primary axis. The louvres are inclined to impel air about the primary combustion chamber to cool its interior surfaces and to impel air inwardly to assist in driving the combustion vortex in a first rotational direction and to feed combustion in the primary combustion chamber. The vortex combustor also includes a second combustion chamber having a secondary zone and a narrowed waist region in the primary combustion chamber interconnecting the output of the primary combustion chamber with the secondary zone for passing only lower density particles and trapping higher density particles in the combustion vortex in the primary combustion chamber for substantial combustion.

Melconian, Jerry O. (76 Beaver Rd., Reading, MA 01867)



1. First Time Designer's Guide  

E-Print Network (OSTI)

Altera provides various tools for development of hardware and software for embedded systems. This handbook complements the primary documentation for these tools by describing how to most effectively use some of these tools. It recommends design styles and practices for developing, debugging, and optimizing embedded systems using Altera-provided tools such as the Software Build Tools for Eclipse and SOPC Builder. The handbook introduces concepts to new users of Alteras embedded solutions, and helps to increase the design efficiency of the experienced user. This handbook is not a comprehensive reference guide. For general reference and detailed information, refer to the primary documentation cited in this handbook. This first chapter of the handbook contains information about the Altera embedded development process and procedures for the first time user. The remaining chapters focus on specific aspects of embedded development for Altera FPGAs. This handbook does not provide information about the Qsys system integration tool.

unknown authors



Time-Varying z-Transform for the Analysis of Discrete-Time Linear Time Periodic Systems  

Science Conference Proceedings (OSTI)

This article deals with a new representation of linear discrete-time periodic systems. This representation, based on the time-varying z-transform, turns out to be highly efficient in the field of automatic control, when an appropriate choice of ... Keywords: Nyquist criterion, final value theorem, initial value theorem, linear discrete-time periodic systems, time-varying z-transform, time-varying frequency response, time-varying systems

A. Garcia Iturricha; J. Sabatier; A. Oustaloup



Towards Integrated Verification of Timed Transition Models  

Science Conference Proceedings (OSTI)

This paper describes an attempt to combine theorem proving and model-checking to formally verify real-time systems in a discrete time setting. The Timed Automata Modeling Environment (TAME) has been modified to provide a formal model for Time Transition ... Keywords: PVS, Real-time, SAL, equivalence verification, model reduction, model-checking, theorem proving

Mark Lawford; Vera Pantelic; Hong Zhang



March 2009 Y-12 Times  

NLE Websites -- All DOE Office Websites (Extended Search)

3 3 March 2009 www.y12.doe.gov/news/times.php P.O. Box 2009 Oak Ridge, TN 37831-8245 Managing Editors Amy Alley: alleyab@y12.doe.gov Heidi Spurling: spurlinghw@y12.doe.gov Layout/Design Lisa Harris Contributors Ellen Boatner Ken Davis Kathy Fahey Vicki Hinkel Jamie Loveday Mary Murray W H A T ' S I N S I D E W H A T ' S I N S I D E Page 2 Page 2 New UPF room is out of sight Page 3 Page 3 Training simulates terrorist attack, prepares fi rst responders Page 3 Page 3 Tanker cars on the right track Page 5 Page 5 Third-generation employee follows his father's sage advice Page 7 Page 7 Car enthusiasts go into overdrive Brett Pate Ray Smith Donna Watson Mona Wright Lisa Xiques B&W Technical Services Y-12, LLC, a partnership between Babcock & Wilcox Technical Services Group Inc. and Bechtel National Inc., operates the


User manual for Timed-CSP Simulator  

E-Print Network (OSTI)

Timed Csp Simulator is based on the presentation of Timed Csp in [4]. For a brief discussion of the tool architecture see [1, 2]. The semantical questions regarding simulating Timed Csp are discussed in [3].

Hoang Nga Nguyen; Markus Roggenbach



Real time estimation of Bayesian networks  

Science Conference Proceedings (OSTI)

For real time evaluation of a Bayesian network when there is not sufficient time to obtain an exact solution, a guaranteed response time, approximate solution is required. It is shown that non traditional methods utilizing estimators based on an archive ...

Robert L. Welch



Probabilistic timing analysis on conventional cache designs  

Science Conference Proceedings (OSTI)

Probabilistic timing analysis (PTA), a promising alternative to traditional worst-case execution time (WCET) analyses, enables pairing time bounds (named probabilistic WCET or pWCET) with an exceedance probability (e.g., 10-16), resulting ...

Leonidas Kosmidis, Charlie Curtsinger, Eduardo Quiones, Jaume Abella, Emery Berger, Francisco J. Cazorla


Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Smolt Condition and Timing of Arrival at Lower Granite Reservoir, 1984 Annual Report.  

DOE Green Energy (OSTI)

Hatcheries released 9.3 million chinook salmon and 6.3 million steelhead smolts and presmolts upriver from Lower Granite Reservoir for migration in spring, 1984. Peak passage of yearling chinook salmon occurred the third week in April at both Whitebird and Snake River traps. Passage of steelhead was still increasing when high water stopped trapping in mid-May. Average migration rate between release sites and Snake River (the head of Lower Granite Reservoir) was 13.2 miles/day and from that point on through the reservoir to the dam, 1.9 miles/day. Salmon River discharge, when considered along with other environmental factors, had the greatest effect on migration rate of smolts branded both at hatcheries and at the Whitebird trap and migrating to the head of Lower Granite Reservoir. Migration rate for steelhead released from Dworshak Hatchery and recaptured at the Clearwater trap was 34 miles/day. Survival rates to the Snake River trap of branded chinook salmon smolts released at Hells Canyon Dam, Rapid River, South Fork Salmon and Decker Flat were 52%, 65%, 68% and 35%, respectively. Classical descaling, where at least 40% of the scales are missing from at least two of five areas on the side of a smolt, ranged from 0 to 5.3% at hatcheries for chinook salmon and was less than 1% for steelhead. Scattered descaling, where at least 10% of scales are missing from at least one side of a fish, was always more extensive than was classical descaling, ranging from 2.5 times greater for Clearwater hatchery steelhead to 6.8 times greater for Clearwater wild steelhead. Mean total length of chinook salmon yearlings was the same at all the traps, i.e., 128 mm (117 mm fork length) +- 1 mm.

Scully, Richard J.; Buettner, Edwin W.



Nanosecond time resolved thermal emission measurements during...  

NLE Websites -- All DOE Office Websites (Extended Search)

Nanosecond time resolved thermal emission measurements during pulse excimer laser interaction with materials Title Nanosecond time resolved thermal emission measurements during...


Training Reciprocity Achieves Greater Consistency, Saves Time...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Training Reciprocity Achieves Greater Consistency, Saves Time and Money for Idaho, Other DOE Sites Training Reciprocity Achieves Greater Consistency, Saves Time and Money for...


Time Trends in Dutch Children's Mental Health.  

E-Print Network (OSTI)

??This study investigated time trends in Dutch children's and adolescent's mental health problems by comparing population samples from different time periods. From 1983 to 2003, (more)

Tick, N.T.



Spatial diversity in passive time reversal communications  

E-Print Network (OSTI)

Song et al. : Spatial diversity in passive time reversaland J. Ritcey, Spatial diversity equalization applied toSpatial diversity in passive time reversal communications H.



Undergraduate Program Time Limits and Work Schedules  

NLE Websites -- All DOE Office Websites (Extended Search)

Time Limits and Work Schedules Undergraduate Program Time Limits and Work Schedules Point your career towards LANL: work with the best minds on the planet in an inclusive...



SciTech Connect

A principal goal of the Budget Period I was to demonstrate that surface geochemistry could be used to locate bypassed hydrocarbons in old fields. This part of the program was successful. A surface geochemical survey, employing 5 different techniques, was carried out in the Spring and Summer of 2000 and a demonstration well, the State Vernon & Smock 13-23 HD1 (permit number: PN 53945) was drilled in Vernon Township, Isabella County, Michigan in the late fall of 2000. A demonstration well was selected and drilled based on geologic considerations and surface geochemistry. Over 460 soil samples were collected and analyzed over the drill site. A good anomaly was detected near the proposed well site and the demonstration well, the Smock 13-23, was drilled to a depth of 3157 feet by November 17, 2000. Two laterals were drilled, and hydrocarbons were located in a zone approximately 175 feet in length. However, it was determined that the pay zone was too small and difficult reservoir conditions (water production) prevented putting the well in production. The Smock 13-23 was shut in and abandoned January 15, 2001. A post-mortem determined that the main reason the well was not economic was because the zone was nearly completely flushed by earlier recovery operations. The post mortem also revealed the presence of an unmapped shale plug crossing the first lateral. It appears that this shale was detected by the geochemical survey, but its significance was not appreciated at the time. It is possible that sections of the well were faulty, ''porposing'' up and down so as to create water blockages. We are continuing to use the Vernon Field and the demonstration well to calibrate the geochemical data. Eventually, this study may provide a standard site that can be used to test and calibrate geochemical anomalies, something that does not presently exist. A postmortem report on the well, including the geology and geochemistry used to site the well, is presented in Appendix I. Five geochemical techniques have been tested in Phase I. These include surface iodine, microbial, enzyme leaching, soil gas and subsurface iodine. We are most comfortable with the results of the microbial surveys but feel that direct measurement of soil gas is the best method if analytical difficulties can be overcome. The reason the microbial surveys are presently favored is because they provide a logical, consistent picture that is easy to interpret and easy to explain. This in turn is because the microbial anomaly is manifested as an ''apical'' as opposed to an ''edge'' or ''halo'' anomaly. Several lessons were learned during Phase I activities. The main one was that surface geochemistry could locate anomalies over old fields such as Vernon. We also learned that horizontal drilling has advantages and disadvantages in situations such as this. On the plus side, it does provide a means to probe for pockets of bypassed oil, but it is expensive relative to vertical (or slant wells?) and is difficult to control in a narrow pay zone. We tentatively conclude that horizontal wells do not provide a cost-effective solution in this setting and suggest that geochemical anomalies be investigated via a single vertical well or multiple vertical wells.

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan; E. Taylor



Neutrino mass sensitivity by MAC-E-Filter based time-of-flight spectroscopy with the example of KATRIN  

E-Print Network (OSTI)

The KATRIN experiment aims at a measurement of the neutrino mass with a 90 % C.L. sensitivity of 0.2 eV/c$^2$ by measuring the endpoint region of the tritium $\\beta$ decay spectrum from a windowless gaseous molecular tritium source using an integrating spectrometer of the MAC-E-Filter type. We discuss the idea of using the MAC-E-Filter in a time-of-flight mode (MAC-E-TOF) in which the neutrino mass is determined by a measurement of the electron time-of-flight (TOF) spectrum that depends on the neutrino mass. MAC-E-TOF spectroscopy here is a very sensitive method since the $\\beta$-electrons are slowed down to distinguishable velocities by the MAC-E-Filter. Their velocity depends strongly on their surplus energy above the electric retarding potential. Using MAC-E-TOF, a statistical sensitivity gain is expected. Because a small number of retarding-potential settings is sufficient for a complete measurement, in contrast to about 40 different retarding potentials used in the standard MAC-E-Filter mode, there is a gain in measurement time and hence statistical power. The improvement of the statistical uncertainty of the squared neutrino mass has been determined by Monte Carlo simulation to be a factor 5 for an ideal case neglecting background and timing uncertainty. Additionally, two scenarios to determine the time-of-flight of the $\\beta$-electrons are discussed, which use the KATRIN detector for creating the stop signal and different methods for obtaining a start signal. These comprise the hypothetical case of an `electron tagger' which detects passing electrons with minimal interference and the more realistic case of `gated filtering', where the electron flux is periodically cut off by pulsing the pre-spectrometer potential.

Nicholas Steinbrink; Volker Hannen; Eric L. Martin; R. G. Hamish Robertson; Michael Zacher; Christian Weinheimer



Neutrino mass sensitivity by MAC-E-Filter based time-of-flight spectroscopy with the example of KATRIN  

E-Print Network (OSTI)

The KArlsruhe TRItium Neutrino (KATRIN) experiment aims at a measurement of the neutrino mass with a 90 % confidence limit (C.L.) sensitivity of 0.2 eV/c$^2$ by measuring the endpoint region of the tritium $\\beta$ decay spectrum from a windowless gaseous molecular tritium source using an integrating spectrometer of the MAC-E-Filter type. We discuss the idea of using the MAC-E-Filter in a time-of-flight mode (MAC-E-TOF) in which the neutrino mass is determined by a measurement of the electron time-of-flight (TOF) spectrum that depends on the neutrino mass. MAC-E-TOF spectroscopy here is a very sensitive method since the $\\beta$-electrons are slowed down to distinguishable velocities by the MAC-E-Filter. Their velocity depends strongly on their surplus energy above the electric retarding potential. Using MAC-E-TOF, a statistical sensitivity gain is expected. Because a small number of retarding-potential settings is sufficient for a complete measurement, in contrast to about 40 different retarding potentials used in the standard MAC-E-Filter mode, there is a gain in measurement time and hence statistical power. The improvement of the statistical uncertainty of the squared neutrino mass has been determined by Monte Carlo simulation to be a factor 5 for an ideal case neglecting background and timing uncertainty. Additionally, two scenarios to determine the time-of-flight of the $\\beta$-electrons are discussed, which use the KATRIN detector for creating the stop signal and different methods for obtaining a start signal. These comprise the hypothetical case of an `electron tagger' which detects passing electrons with minimal interference and the more realistic case of `gated filtering', where the electron flux is periodically cut off by pulsing the pre-spectrometer potential.

Nicholas Steinbrink; Volker Hannen; Eric L. Martin; R. G. Hamish Robertson; Michael Zacher; Christian Weinheimer



Timed CSP: A Retrospective Joel Ouaknine 1  

E-Print Network (OSTI)

APC 2005 Timed CSP: A Retrospective Jo¨el Ouaknine 1 Oxford University Computing Laboratory, UK Timed CSP, from its inception nearly twenty years ago to very recent semantical and algorithmic developments. Key words: Process algebra, Timed CSP. Timed CSP was first proposed in 1986 by Reed and Roscoe

Schneider, Steve


A review on time series data mining  

Science Conference Proceedings (OSTI)

Time series is an important class of temporal data objects and it can be easily obtained from scientific and financial applications. A time series is a collection of observations made chronologically. The nature of time series data includes: large in ... Keywords: Representation, Segmentation, Similarity measure, Time series data mining, Visualization

Tak-chung Fu



Real-Time Airborne Particle Analyzer  

Geology, biology, and environmental science HAZMAT Weapons inspection : Real-time method for measuring elemental composition


Time Constant Estimates for Radiosonde Temperature Sensors  

Science Conference Proceedings (OSTI)

To correct time lag errors in radiosonde temperatures the sensor time constant has to be known. Time constants are not published for some widely used sensors and, in some cases, available time constants disagree. This study focuses on ML-405, ML-...

Marcel E. Tschudin; Steven R. Schroeder



Growth, Cycles and Convergence in US Regional Time Series  

E-Print Network (OSTI)

;i UL?t|@?|t #16;? #17; UL?|@#16;? #16;?uLh4@|#16;L? L? |#4;i UL44L? t*LTic qc @?_ L? |#4;i _#16;gihi?Uit #16;? |#4;i *i#15;i*t Lu |#4;i tih#16;itc @t UL?|@#16;?i_ #16;? |#4;i #15;iU|Lh #14;#21; A#4;iti _#16;gihi?Uit 4#16;}#4;| Mi T@h@4i|ih#16;ti_ #22... ;#16;|#4; _h#16;u|c qc @?_ #16;u #14; #16;t _i??i_ t#3;U#4; |#4;@| #14; #30; ! fc i@U#4; i*i4i?| Lu #14; #16;t @ _i#15;#16;@|#16;L? uhL4 |#4;i UL44L? |hi?_#21; N?LMtih#15;i_ UL4TL?i?|t 4L_i*t A#4;i 4L_i* #16;? Ee#28; 4@) Mi i |i?_i_ tL @t |L #16;?U*#3;_i U...

Carvalho, Vasco; Harvey, Andrew C



Multiple output timing and trigger generator  

SciTech Connect

In support of the development of a multiple stage pulse modulator at the Los Alamos National Laboratory, we have developed a first generation, multiple output timing and trigger generator. Exploiting Commercial Off The Shelf (COTS) Micro Controller Units (MCU's), the timing and trigger generator provides 32 independent outputs with a timing resolution of about 500 ns. The timing and trigger generator system is comprised of two MCU boards and a single PC. One of the MCU boards performs the functions of the timing and signal generation (the timing controller) while the second MCU board accepts commands from the PC and provides the timing instructions to the timing controller. The PC provides the user interface for adjusting the on and off timing for each of the output signals. This system provides 32 output or timing signals which can be pre-programmed to be in an on or off state for each of 64 time steps. The width or duration of each of the 64 time steps is programmable from 2 {micro}s to 2.5 ms with a minimum time resolution of 500 ns. The repetition rate of the programmed pulse train is only limited by the time duration of the programmed event. This paper describes the design and function of the timing and trigger generator system and software including test results and measurements.

Wheat, Robert M. [Los Alamos National Laboratory; Dale, Gregory E [Los Alamos National Laboratory



Criss-Crossing in Global Space and Time: Fatih Ak?ns The Edge of Heaven (2007)  

E-Print Network (OSTI)

begins with a shot at a gas stationa stopping point thatthrough dialogue when the gas-station attendant explains toof the film. 4 The gas station attendant also introduces the

Mennel, Barbara



Time-of-flight radio location system  

DOE Patents (OSTI)

A bi-static radar configuration measures the direct time-of-flight of a transmitted RF pulse and is capable of measuring this time-of-flight with a jitter on the order of about one pico-second, or about 0.01 inch of free space distance for an electromagnetic pulse over a range of about one to ten feet. A transmitter transmits a sequence of electromagnetic pulses in response to a transmit timing signal, and a receiver samples the sequence of electromagnetic pulses with controlled timing in response to a receive timing signal, and generates a sample signal in response to the samples. A timing circuit supplies the transmit timing signal to the transmitter and supplies the receive timing signal to the receiver. The receive timing signal causes the receiver to sample the sequence of electromagnetic pulses such that the time between transmission of pulses in the sequence and sampling by the receiver sweeps over a range of delays. The receive timing signal sweeps over the range of delays in a sweep cycle such that pulses in the sequence are sampled at the pulse repetition rate, and with different delays in the range of delays to produce a sample signal representing magnitude of a received pulse in equivalent time. Automatic gain control circuitry in the receiver controls the magnitude of the equivalent time sample signal. A signal processor analyzes the sample signal to indicate the time-of-flight of the electromagnetic pulses in the sequence.

McEwan, Thomas E. (Livermore, CA)



Time-of-flight radio location system  

DOE Patents (OSTI)

A bi-static radar configuration measures the direct time-of-flight of a transmitted RF pulse and is capable of measuring this time-of-flight with a jitter on the order of about one pico-second, or about 0.01 inch of free space distance for an electromagnetic pulse over a range of about one to ten feet. A transmitter transmits a sequence of electromagnetic pulses in response to a transmit timing signal, and a receiver samples the sequence of electromagnetic pulses with controlled timing in response to a receive timing signal, and generates a sample signal in response to the samples. A timing circuit supplies the transmit timing signal to the transmitter and supplies the receive timing signal to the receiver. The receive timing signal causes the receiver to sample the sequence of electromagnetic pulses such that the time between transmission of pulses in the sequence and sampling by the receiver sweeps over a range of delays. The receive timing signal sweeps over the range of delays in a sweep cycle such that pulses in the sequence are sampled at the pulse repetition rate, and with different delays in the range of delays to produce a sample signal representing magnitude of a received pulse in equivalent time. Automatic gain control circuitry in the receiver controls the magnitude of the equivalent time sample signal. A signal processor analyzes the sample signal to indicate the time-of-flight of the electromagnetic pulses in the sequence. 7 figs.

McEwan, T.E.



Time-Dependent Behavior of RC Beams Retrofitted with CFRP Straps  

E-Print Network (OSTI)

, J.M. (2007). "Nonlinear FE Analysis of Cracks in Tension and Shear", Magazine of Concrete Research, 59(4), 233-244. Khalifa, A., Gold, W.J., Nanni, A. and Abdel Aziz, M.I. (1998). Contribution of Externally Bonded FRP to Shear Capacity of RC...

Hoult, Neil A.; Lees, Janet M.



Modeling data with multiple time dimensions  

Science Conference Proceedings (OSTI)

A large class of problems in time series analysis can be represented by a set of overlapping time series with different starting times. These time series may be treated as different probes of the same underlying process. Such probes may follow a characteristic ... Keywords: Dendrochronology, Douglas fir, Dual-time dynamics, El Malpais, Generalized additive models, Global climate change, Non-linear dynamics, Non-linear modeling, Pinon pine, Ponderosa pine, Portfolio forecasting, Retail lending, SETI@home, Scenario-based forecasting, Search for extraterrestrial intelligence, Time series, Tree rings

Joseph L. Breeden


Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...


Climatological Time Series with Periodic Correlation  

Science Conference Proceedings (OSTI)

Many climatological time series display a periodic correlation structure. This paper examines three issues encountered when analyzing such time series: detection of periodic correlation, modeling periodic correlation, and trend estimation under ...

Robert Lund; Harry Hurd; Peter Bloomfield; Richard Smith



Statistical Timing Analysis using Levelized Covariance Propagation  

Science Conference Proceedings (OSTI)

Variability in process parameters is making accurate timing analysis of nano-scale integrated circuits an extremely challenging task. In this paper, we propose a new algorithm for statistical timing analysis using Levelized Covariance Propagation (LCP). ...

Kunhyuk Kang; Bipul C. Paul; Kaushik Roy



Apply for Beam Time | Advanced Photon Source  

NLE Websites -- All DOE Office Websites (Extended Search)

Apply for Beam Time Apply for Beam Time NEXT PROPOSAL DEADLINE: March 7, 2014 @ 11:59 PM (Chicago time) Submit Proposal » SEE ALSO: Calendar: deadlines, run & review dates Help Page: frequently asked questions, tips for success, common errors, blank forms, instructions Review Criteria Sectors Directory: check CAT websites for info about managed beam time The Run 2014-2 proposal submission deadline is 11:59 p.m. (Chicago time) March 7, 2014. The system will open to accept proposals beginning December 20, 2013. NEW USERS: to avoid delays and to make the most of your time on site, read Become a User. You must register as a user and receive a badge number before submitting a proposal. About the Beam Time Request Process All beam time at the APS must be requested each cycle through the web-based


Statistical characterization of library timing performance  

Science Conference Proceedings (OSTI)

With the scaling of technology, the variability of timing performances of digital circuits is increasing. In this paper, we propose a first order analytical modeling of the standard deviations of basic CMOS cell timings. The proposed model is then used ...

V. Migairou; R. Wilson; S. Engels; N. Azemard; P. Maurine



Phoenix: an epidemic approach to time reconstruction  

Science Conference Proceedings (OSTI)

Harsh deployment environments and uncertain run-time conditions create numerous challenges for postmortem time reconstruction methods. For example, motes often reboot and thus lose their clock state, considering that the majority of mote platforms lack ...

Jayant Gupchup; Douglas Carlson; R?zvan Mus?loiu-E.; Alex Szalay; Andreas Terzis



Graduate Program Time Limits and Work Schedules  

NLE Websites -- All DOE Office Websites (Extended Search)

Time Limits and Work Schedules Graduate Program Time Limits and Work Schedules Point your career towards LANL: work with the best minds on the planet in an inclusive environment...


Space does not exist, so time can  

E-Print Network (OSTI)

It is often said that in general relativity time does not exist. This is because the Einstein equations generate motion in time that is a symmetry of the theory, not true time evolution. In quantum gravity, the timelessness of general relativity clashes with time in quantum theory and leads to the ``problem of time'' which, in its various forms, is the main obstacle to a successful quantum theory of gravity. I argue that the problem of time is a paradox, stemming from an unstated faulty premise. Our faulty assumption is that space is real. I propose that what does not fundamentally exist is not time but space, geometry and gravity. The quantum theory of gravity will be spaceless, not timeless. If we are willing to throw out space, we can keep time and the trade is worth it.

Fotini Markopoulou



Precision Timing for Smart Grid Systems  

Science Conference Proceedings (OSTI)

... how new features and requirements for time synchronization can impact the performance of next-generation power distribution applications. ...



Scalable Time Warp on Blue Gene Supercomputers  

Science Conference Proceedings (OSTI)

n this paper we illustrate scalable parallel performance for the TimeWarp synchronization protocol on the L and P variants of the IBM BlueGene supercomputer. Scalable Time Warp performance for models that communicate a large percentage of the event population ... Keywords: Time Warp, Blue Gene Supercomputer

David W. Bauer Jr.; Christopher D. Carothers; Akintayo Holder



Time-of-flight radio location system  

DOE Patents (OSTI)

A bi-static radar configuration measures the direct time-of-flight of a transmitted RF pulse and is capable of measuring this time-of-flight with a jitter on the order of about one pico-second, or about 0.01 inch of free space distance for an electromagnetic pulse over a range of about one to ten feet. A transmitter transmits a sequence of electromagnetic pulses in response to a transmit timing signal, and a receiver samples the sequence of electromagnetic pulses with controlled timing in response to a receive timing signal, and generates a sample signal in response to the samples. A timing circuit supplies the transmit timing signal to the transmitter and supplies the receive timing signal to the receiver. The receive timing signal causes the receiver to sample the sequence of electromagnetic pulses such that the time between transmission of pulses in the sequence and sampling by the receiver sweeps over a range of delays. The receive timing signal sweeps over the range of delays in a sweep cycle such that pulses in the sequence are sampled at the pulse repetition rate, and with different delays in the range of delays to produce a sample signal representing magnitude of a received pulse in equivalent time. Automatic gain control circuitry in the receiver controls the magnitude of the equivalent time sample signal. A signal processor analyzes the sample signal to indicate the time-of-flight of the electromagnetic pulses in the sequence. The sample signal in equivalent time is passed through an envelope detection circuit, formed of an absolute value circuit followed by a low pass filter, to convert the sample signal to a unipolar signal to eliminate effects of antenna misorientation.

McEwan, Thomas E. (Livermore, CA)



Time-of-flight radio location system  

DOE Patents (OSTI)

A bi-static radar configuration measures the direct time-of-flight of a transmitted RF pulse and is capable of measuring this time-of-flight with a jitter on the order of about one pico-second, or about 0.01 inch of free space distance for an electromagnetic pulse over a range of about one to ten feet. A transmitter transmits a sequence of electromagnetic pulses in response to a transmit timing signal, and a receiver samples the sequence of electromagnetic pulses with controlled timing in response to a receive timing signal, and generates a sample signal in response to the samples. A timing circuit supplies the transmit timing signal to the transmitter and supplies the receive timing signal to the receiver. The receive timing signal causes the receiver to sample the sequence of electromagnetic pulses such that the time between transmission of pulses in the sequence and sampling by the receiver sweeps over a range of delays. The receive timing signal sweeps over the range of delays in a sweep cycle such that pulses in the sequence are sampled at the pulse repetition rate, and with different delays in the range of delays to produce a sample signal representing magnitude of a received pulse in equivalent time. Automatic gain control circuitry in the receiver controls the magnitude of the equivalent time sample signal. A signal processor analyzes the sample signal to indicate the time-of-flight of the electromagnetic pulses in the sequence. The sample signal in equivalent time is passed through an envelope detection circuit, formed of an absolute value circuit followed by a low pass filter, to convert the sample signal to a unipolar signal to eliminate effects of antenna misorientation. 8 figs.

McEwan, T.E.



High-Level Real-Time Concurrency  

E-Print Network (OSTI)

The primary goal of all real-time systems is predictability. Achieving this goal requires all levels of the system to be well de ned and have a xed worst-case execution time. These needs have resulted in the creation of overly restrictive commercial real-time systems providing only ad-hoc scheduling facilities and basic concurrent functionality. Ad-hoc scheduling makes developing, verifying, and maintaining a real-time system extremely dicult and time consuming. Basic concurrent functionality forces programmers to develop complex concurrent programs without the aid of high-level concurrency features.

Ashif S. Harji; C Ashif S. Harji



Author's personal copy The time dependent vehicle routing problem with time windows  

E-Print Network (OSTI)

Author's personal copy The time dependent vehicle routing problem with time windows: Benchmark routing problems with hard or soft time windows without any alteration in its structure is presented of congested urban settings are proposed. Solution quality, time window pertur- bations, and computational time

Bertini, Robert L.

Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Time-Energy Measure for Quantum Processes  

E-Print Network (OSTI)

Quantum mechanics sets limits on how fast quantum processes can run given some system energy through time-energy uncertainty relations, and they imply that time and energy are tradeoff against each other. Thus, we propose to measure the time-energy as a single unit for quantum channels. We consider a time-energy measure for quantum channels and compute lower and upper bounds of it using the channel Kraus operators. For a special class of channels (which includes the depolarizing channel), we can obtain the exact value of the time-energy measure. One consequence of our result is that erasing quantum information requires $\\sqrt{(n+1)/n}$ times more time-energy resource than erasing classical information, where $n$ is the system dimension.

Chi-Hang Fred Fung; H. F. Chau



Average Predictability Time. Part II: Seamless Diagnoses of Predictability on Multiple Time Scales  

Science Conference Proceedings (OSTI)

This paper proposes a new method for diagnosing predictability on multiple time scales without time averaging. The method finds components that maximize the average predictability time (APT) of a system, where APT is defined as the integral of ...

Timothy DelSole; Michael K. Tippett



JAVA & Parallelism/Real-time systems  

E-Print Network (OSTI)

Windowing Toolkit (AWT) in a memory-efficient way. JAVA Application Environment (JAE) Support enables the same applets and applications to run on other servers or platforms running the JAVA Virtual Machine. CHAPTER 2 Embedded and Real-Time JAVA According to the designers at Sun Microsystems, is JAVA also suitable for Embedded or Real-Time systems. Before proceeding further it is worth trying to define the phrase `real-time system' more precisely. 2.1 Definition of a real-time system There are many interpretations of the exact nature of a real-time system; however, they all have in common the notion of response time, the time taken for the system to generate output from some associated input. The Oxford Dictionary of Computing [48] gives the following definition of a real-time system. A real-time system is... Any system in which the time at which output is produced is significant. This is usually because the input corresponds to some movement in the physical world, and the output ha...

D. F. Nooren



Preserving the U.S. Underground and Alternative Press of the 1960s and '70s: History, Prospects, and Microform Sources  

E-Print Network (OSTI)

Reporter, Washington, DC, 1985- , UMI Navajo Times, WindowWashington, DC Native Sun, Detroit, MI Navajo Times, Window

Tsang, Daniel C



Time and Tide Wait for No Diagram  

E-Print Network (OSTI)

Time plays an important role in some application domains, and can be quite difficult to deal with in diagrams. This is not only true for temporal uncertainty, but also for periodic events. We compare nine different representations that include a notion of time or that are mainly used for temporal information: Time Lines/LifeLines, AsbruView, Gantt- and PERT-Charts, Shinkansen timetables, Temporal Objects, Sets of Possible Occurrences (SOPOs), the Time Cube and Concentric Circles. Features of the different methods are presented and compared to other representations. This paper is meant to help the designer of a diagram or visualization who has to deal with time get an overview over different design ideas, and maybe get an inspiration for their own ideas. Keywords Information Visualization, Time in Problem Solving Methods, Knowledge Acquisition, Knowledge Engineering and Modeling Methodologies

Robert Kosara; Peter Messner; Silvia Miksch



Property:Event/Time | Open Energy Information  

Open Energy Info (EERE)

Time Time Jump to: navigation, search Property Name Event/Time Property Type String Description The time an event occurs. For events which span an entire day, please use 'All Day'. When entering a specific time, please be sure to include the timezone information, for example: '2:45 PM MDT' or '10:00 AM GST'. Pages using the property "Event/Time" Showing 25 pages using this property. (previous 25) (next 25) A April Fool's Day + All Day + B Blane Harvey co-facilitating a session on use of climate decision making tools with CARE and Tearfund + 13:00-14:00 + Blane Harvey facilitating a lunchtime session on Indigenous Knowledge and Adaptation + 13:00-14:00 + Blane Harvey facilitating a lunchtime session on knowledge platforms and online communities of practice + 13:00-14:00 +


Reactor control rod timing system. [LMFBR  

DOE Patents (OSTI)

A fluid driven jet-edge whistle timing system is described for control rods of a nuclear reactor for producing real-time detection of the timing of each control rod in its scram operation. An important parameter in reactor safety, particularly for liquid metal fast breeder reactors (LMFBR), is the time deviation between the time the control rod is released and the time the rod actually reaches the down position. The whistle has a nearly pure tone signal with center frequency (above 100 kHz) far above the frequency band in which the energy of the background noise is concentrated. Each control rod can be fitted with a whistle with a different frequency so that there is no ambiguity in differentiating the signal from each control rod.

Wu, P.T.K.



Time dependence of liquid-helium fluorescence  

SciTech Connect

The time dependence of extreme ultraviolet (EUV) fluorescence following an ionizing radiation event in liquid helium is observed and studied in the temperature range from 250 mK to 1.8 K. The fluorescence exhibits significant structure including a short ({approx}10 ns) strong initial pulse followed by single photons whose emission rate decays exponentially with a 1.6-{mu}s time constant. At an even longer time scale, the emission rate varies as '1/time' (inversely proportional to the time after the initial pulse). The intensity of the '1/time' component from {beta} particles is significantly weaker than those from {alpha} particles or neutron capture on {sup 3}He. It is also found that for {alpha} particles, the intensity of this component depends on the temperature of the superfluid helium. Proposed models describing the observed fluorescence are discussed.

McKinsey, D.N.; Brome, C.R.; Dzhosyuk, S.N.; Mattoni, C.E.H.; Yang, L.; Doyle, J.M. [Department of Physics, Harvard University, Cambridge, Massachusetts 02138 (United States); Golub, R.; Habicht, K.; Korobkina, E. [Hahn-Meitner Institut, Berlin-Wannsee (Germany); Huffman, P.R.; Thompson, A.K. [National Institute of Standards and Technology, Gaithersburg, Maryland 20899 (United States); Lamoreaux, S.K. [Los Alamos National Laboratory, Los Alamos, New Mexico 87544 (United States)



Statistical criteria for characterizing irradiance time series.  

SciTech Connect

We propose and examine several statistical criteria for characterizing time series of solar irradiance. Time series of irradiance are used in analyses that seek to quantify the performance of photovoltaic (PV) power systems over time. Time series of irradiance are either measured or are simulated using models. Simulations of irradiance are often calibrated to or generated from statistics for observed irradiance and simulations are validated by comparing the simulation output to the observed irradiance. Criteria used in this comparison should derive from the context of the analyses in which the simulated irradiance is to be used. We examine three statistics that characterize time series and their use as criteria for comparing time series. We demonstrate these statistics using observed irradiance data recorded in August 2007 in Las Vegas, Nevada, and in June 2009 in Albuquerque, New Mexico.

Stein, Joshua S.; Ellis, Abraham; Hansen, Clifford W.



Tests of timing properties of silicon photomultipliers  

Science Conference Proceedings (OSTI)

Timing measurements of Silicon Photomultipliers (SiPM) [1] and [2] at the picosecond level were performed at Fermilab. The core timing resolution of the electronic measurement technique is approximately 2 ps. The single photoelectron time resolution (SPTR) was measured for the signals coming from the SiPM's. A SPTR of about one hundred picoseconds was obtained for SiPM's illuminated by laser pulses. The dependence of the SPTR on applied bias voltage and on the wavelength of the light was measured. A simple model is proposed to explain the difference in the SPTR for blue and red light. A time of flight system based on the SiPM's, with quartz Cherenkov radiators, was tested in a proton beam at Fermilab. The time resolution obtained is 35 ps per SiPM. Finally, requirements for the SiPM's temperature and bias voltage stability to maintain the time resolution are discussed.

Ronzhin, A.; Albrow, M.; /Fermilab; Byrum, K.; /Argonne; Demarteau, M.; Los, S.; /Fermilab; May, E.; /Argonne; Ramberg, A.; /Fermilab; Va'vra, J.; /SLAC; Zatserklyaniy, A.; /Puerto Rico U., Mayaguez



Bell's Jump Process in Discrete Time  

E-Print Network (OSTI)

The jump process introduced by J. S. Bell in 1986, for defining a quantum field theory without observers, presupposes that space is discrete whereas time is continuous. In this letter, our interest is to find an analogous process in discrete time. We argue that a genuine analog does not exist, but provide examples of processes in discrete time that could be used as a replacement.

Jonathan Barrett; Matthew Leifer; Roderich Tumulka



Time-parallel multiscale/multiphysics framework  

Science Conference Proceedings (OSTI)

We introduce the time-parallel compound wavelet matrix method (tpCWM) for modeling the temporal evolution of multiscale and multiphysics systems. The method couples time parallel (TP) and CWM methods operating at different spatial and temporal scales. ... Keywords: 02.00.00, 02.10.Jf, 05.10.-a, 46.15.-x, 47.70.Fw, Parallel-in-time, Wavelet-based multiscaling

G. Frantziskonis; K. Muralidharan; P. Deymier; S. Simunovic; P. Nukala; S. Pannala



Runtime Monitoring of Timing Constraints in Distributed Real-Time Systems  

E-Print Network (OSTI)

. Embedded real-time systems often operate under strict timing and dependability constraints. To ensure responsiveness, these systems must be able to provide the expected services in a timely manner even in the presence of faults. In this paper, we describe a run-time environment for monitoring of timing constraints in distributed real-time systems. In particular, we focus on the problem of detecting violations of timing assertions in an environment in which the real-time tasks run on multiple processors, and timing constraints can be either inter-processor or intra-processor constraints. Constraint violations are detected at the earliest possible time by deriving and checking intermediate constraints from the user-specified constraints. If the violations must be detected as early as possible, then the problem of minimizing the number of messages to be exchanged between the processors becomes intractable. We characterize a sub-class of timing constraints that occur commonly in distribu...

Farnam Jahanian; Ragunathan Rajkumar; Sitaram C. V. Raju



Sponsors : Daylighting The New York Times Building  

NLE Websites -- All DOE Office Websites (Extended Search)

researchindex.html In-kind cost-share The New York Times Company Advance Transformer Co. Lutron Electronics, Inc. MechoShade Systems, Inc. Siemens Building...


Special education teachers' personal time and money.  

E-Print Network (OSTI)

??Because of state and federal budget deficits. teachers are using thcir own time and rnoney to meet student nceds. This research seeks to determine the (more)

Tewalt, Brandon



Real Time Grid Reliability Management 2005  

E-Print Network (OSTI)

Environmental Research Energy Systems Integration Real Time2) integration with CA ISO energy management system (EMS);2) integration with CA ISO energy management system (EMS);

Eto, Joe



Construction Timing and Expectations | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Construction Timing and Expectations Construction Timing and Expectations Construction Timing and Expectations October 16, 2013 - 5:07pm Addthis Creating a detailed construction schedule that allows all the project elements to be coordinated in a timely manner is fundamental to any successful construction project. The construction schedule should take into account that many tasks cannot be started before others are finished. It should also account for special schedule considerations related to renewable energy systems. Key elements of most new construction or major renovation projects include landscape, structural, architectural, mechanical, electrical, plumbing, communication systems, and renewable energy systems. Maintaining the highest quality of construction across all elements is fundamental to any


'Dead Time' Limits Quantum Cryptography Speeds  

Science Conference Proceedings (OSTI)

... Not only does dead time limit the transmission rate of a message ... effects and paralyzability in high-speed quantum key distribution, New Journal of ...



Time Series Prediction Forecasting the Future and ...  

Science Conference Proceedings (OSTI)

Time Series Prediction Forecasting the Future and Understanding the Past Santa Fe Institute Proceedings on the Studies in the Sciences of ...



NIST Time and Frequency Division 1993 - Technical ...  

Science Conference Proceedings (OSTI)

... can be reached with commercial red diode ... the time scale when building and remodelling ... American Geophysical Union meeting in San Francisco. ...

Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Commuting time geometry of ergodic Markov chains  

E-Print Network (OSTI)

We show how to map the states of an ergodic Markov chain to Euclidean space so that the squared distance between states is the expected commuting time. We find a minimax characterization of commuting times, and from this we get monotonicity of commuting times with respect to equilibrium transition rates. All of these results are familiar in the case of time-reversible chains, where techniques of classical electrical theory apply. In presenting these results, we take the opportunity to develop Markov chain theory in a `conformally correct' way

Doyle, Peter G



Meykhana - The poetics of time and space.  

E-Print Network (OSTI)

??Right before the rhythmic, improvisational and poetic genre called meykhana was forbidden to practice in Soviet Azerbaijan, it bloomed for a short time in the (more)

Zakariyya, Zulaim



NIST Time Measurement and Analysis Service (TMAS)  

Science Conference Proceedings (OSTI)

... Analysis Service (TMAS) was designed to assist ... and calibrated time measurement system which includes ... easy-to-read instruction manual makes ...



SIM Time and Frequency Working Group  

Science Conference Proceedings (OSTI)

... SIM Time and Frequency Metrology Course at INTI. Buenos Aires, Argentina (February 4th through February 7th, 2008). Schedule in PDF format. ...


SIM Time and Frequency Working Group  

Science Conference Proceedings (OSTI)

... file). Schedule and Slides from Time and Frequency Metrology Course in Buenos Aires, Argentina (2/4/08 to 02/07/08). Schedule ...


Time fractional development of quantum systems  

Science Conference Proceedings (OSTI)

In this study, the effect of time fractionalization on the development of quantum systems is taken under consideration by making use of fractional calculus. In this context, a Mittag-Leffler function is introduced as an important mathematical tool in the generalization of the evolution operator. In order to investigate the time fractional evolution of the quantum (nano) systems, time fractional forms of motion are obtained for a Schroedinger equation and a Heisenberg equation. As an application of the concomitant formalism, the wave functions, energy eigenvalues, and probability densities of the potential well and harmonic oscillator are time fractionally obtained via the fractional derivative order {alpha}, which is a measure of the fractality of time. In the case {alpha}=1, where time becomes homogenous and continuous, traditional physical conclusions are recovered. Since energy and time are conjugate to each other, the fractional derivative order {alpha} is relevant to time. It is understood that the fractionalization of time gives rise to energy fluctuations of the quantum (nano) systems.

Ertik, Hueseyin; Demirhan, Dogan; Sirin, Hueseyin; Bueyuekkilic, Fevzi [Department of Physics, Science Faculty, Ege University, Bornova, Izmir 35100 (Turkey)



A misuse of time and energy .  

E-Print Network (OSTI)

??In this exegesis, A Misuse of Time and Energy, I set out a contextual framework for my practice-based sculptural project. I consider two flawed and (more)

Blackburn, Nikolas Alexander




The present invention provides a flexible noncontact source of wave energy through the use of time reversal. In the preferred embodiment a ...


NIST Time and Frequency Division History  

Science Conference Proceedings (OSTI)

... of accurate measurements of mean solar time (from ... needs of the broadcast industry, NIST initiated ... Concurrent with the development of more recent ...



Multiplicative cascades and seismicity in natural time  

Science Conference Proceedings (OSTI)

Natural time chi enables the distinction of two origins of self-similarity, i.e., the process memory and the process increments infinite variance. Employing multiplicative cascades in natural time, the most probable value of the variance kappa{sub 1}(ident to-{sup 2}) is explicitly related with the parameter b of the Gutenberg-Richter law of randomly shuffled earthquake data. Moreover, the existence of temporal and magnitude correlations is studied in the original earthquake data. Magnitude correlations are larger for closer in time earthquakes, when the maximum interoccurrence time varies from half a day to 1 min.

Sarlis, N. V.; Skordas, E. S.; Varotsos, P. A. [Department of Physics, Solid State Section and Solid Earth Physics Institute, University of Athens, Panepistimiopolis, Zografos, 157 84 Athens (Greece)



Four Time Periods - Energy Information Administration  

U.S. Energy Information Administration (EIA)

... we will be seeing a downward trend in differentials as time moves on. We expect the recent upturn in the light-heavy differentials to be ...


Publishers of Time and Frequency Software  

Science Conference Proceedings (OSTI)

... 1 Ace Software, X, Windows. Acrovista, X, Windows. Apple Computer, X, Macintosh. Atom Time, X, Windows. Beagle Software, X, X, Windows. ...



Time synchronization for underwater acoustic sensor networks.  

E-Print Network (OSTI)

??The unique properties of underwater acoustic communications, such as large and time-varying propagation, low and range dependent bandwidth, and adverse operating environment make the synchronization (more)

Khandoker, Tarik-Ul Islam



Nordic Journal of Computing 10(2003), 135. TIMED CSP = CLOSED TIMED -AUTOMATA  

E-Print Network (OSTI)

Nordic Journal of Computing 10(2003), 1­35. TIMED CSP = CLOSED TIMED -AUTOMATA JO¨EL OUAKNINE CSP which significantly increase expressiveness. As a result, we are able to capture some of the most of the finite-state fragment of this augmented version of Timed CSP as that of closed timed -automata

Ouaknine, Joël


Nordic Journal of Computing 10(2003), 1--35. TIMED CSP = CLOSED TIMED #AUTOMATA  

E-Print Network (OSTI)

Nordic Journal of Computing 10(2003), 1--35. TIMED CSP = CLOSED TIMED #­AUTOMATA JO ? EL OUAKNINE CSP which significantly increase expressiveness. As a result, we are able to capture some of the most of the finite­state fragment of this augmented version of Timed CSP as that of closed timed #­automata

Ouaknine, Joël


Continuous-time nonlinear model predictive control of time-delayed Wiener-type systems  

Science Conference Proceedings (OSTI)

This paper deals with a novel method of continuous-time model predictive control for nonlinear time-delayed systems. The problems regarding time delays are solved by incorporating delayed and undelayed model outputs in the control-law derivation. Nonlinear-mapping ... Keywords: Wiener-type model, continuous system, nonlinear predictive control, time-delayed system

Simon Oblak; Igor krjanc



Fractal analysis of time varying data  

DOE Patents (OSTI)

Characteristics of time varying data, such as an electrical signal, are analyzed by converting the data from a temporal domain into a spatial domain pattern. Fractal analysis is performed on the spatial domain pattern, thereby producing a fractal dimension D.sub.F. The fractal dimension indicates the regularity of the time varying data.

Vo-Dinh, Tuan (Knoxville, TN); Sadana, Ajit (Oxford, MS)



Iterative Time Reversal with Tunable Convergence  

E-Print Network (OSTI)

We propose and test an iterative technique for improving the temporal focusing of a time reversal mirror. A single amplification parameter is introduced to tune the convergence of the iteration. The tunable iterative technique is validated by tests on an experimental electromagnetic time reversal mirror, as well as on a novel numerical model.

Biniyam Tesfaye Taddese; Thomas M. Antonsen; Edward Ott; Steven M. Anlage



Real-time var control by SCADA  

SciTech Connect

This paper outlines the operation and advantages of the SCADA capacitor control called CAPCON, developed by the Virginia Electric and Power Company (Virginia Power). CAPCON is used to control vars system-wide by switching substation capacitor banks based on real-time var and voltage data instead of the traditional time clock method.

Girotti, T.B.; Tweed, N.B.; Houser, N.R. (Virginia Power Co., Richmond, VA (USA))



Practical reporting times for environmental samples  

Science Conference Proceedings (OSTI)

Preanalytical holding times for environmental samples are specified because chemical and physical characteristics may change between sampling and chemical analysis. For example, the Federal Register prescribes a preanalytical holding time of 14 days for volatile organic compounds in soil stored at 4{degrees}C. The American Society for Testing Materials (ASTM) uses a more technical definition that the preanalytical holding time is the day when the analyte concentration for an environmental sample falls below the lower 99% confidence interval on the analyte concentration at day zero. This study reviews various holding time definitions and suggest a new preanalytical holding time approach using acceptable error rates for measuring an environmental analyte. This practical reporting time (PRT) approach has been applied to nineteen volatile organic compounds and four explosives in three environmental soil samples. A PRT nomograph of error rates has been developed to estimate the consequences of missing a preanalytical holding time. This nomograph can be applied to a large class of analytes with concentrations that decay linearly or exponentially with time regardless of sample matrices and storage conditions.

Bayne, C.K.; Schmoyer, D.D.; Jenkins, R.A.


Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Predicting time series with advanced hybrid systems  

Science Conference Proceedings (OSTI)

Autogressive moving average (ARMA) has been widely used to model processes that generate linear time-series. Recent research activities in forecasting with artificial neutral networks (ANNs) suggest that ANNs can be a promising alternative to the traditional ... Keywords: ARMA models, fuzzy system, hybrid system, neutral networks, time series

O. Valenzuela; I. Rojas; F. Rojas; H. Pomares; J. Gonzalez; L. J. Herrera; A. Guillen



Gravity in Complex Hermitian Space-Time  

E-Print Network (OSTI)

A generalized theory unifying gravity with electromagnetism was proposed by Einstein in 1945. He considered a Hermitian metric on a real space-time. In this work we review Einstein's idea and generalize it further to consider gravity in a complex Hermitian space-time.

Ali H. Chamseddine



Efficient forecasting for hierarchical time series  

Science Conference Proceedings (OSTI)

Forecasting is used as the basis for business planning in many application areas such as energy, sales and traffic management. Time series data used in these areas is often hierarchically organized and thus, aggregated along the hierarchy levels based ... Keywords: forecasting, hierarchies, optimization, time series

Lars Dannecker; Robert Lorenz; Philipp Rsch; Wolfgang Lehner; Gregor Hackenbroich



Tritium Time Series from Ocean Station P  

Science Conference Proceedings (OSTI)

We present time series of tritium (3H) concentrations at varying depths in the water column at Ocean Station P(50N, 145W) in the northeast Pacific. Measurements started in the fall of 1974, at the time of the GEOSECS mapping of the North ...

A. E. Gargett; G. Ostlund; C. S. Wong



Integrated method for chaotic time series analysis  

DOE Patents (OSTI)

Methods and apparatus for automatically detecting differences between similar but different states in a nonlinear process monitor nonlinear data. Steps include: acquiring the data; digitizing the data; obtaining nonlinear measures of the data via chaotic time series analysis; obtaining time serial trends in the nonlinear measures; and determining by comparison whether differences between similar but different states are indicated.

Hively, Lee M. (Philadelphia, TN); Ng, Esmond G. (Concord, TN)



Is the notion of time really fundamental?  

E-Print Network (OSTI)

From the Physics point of view, time is now best described through General Relativity, as part of space-time which is a dynamical object encoding gravity. Time possesses also some intrinsic irreversibility due to thermodynamics, quantum mechanical effects... This irreversibility can look puzzling since time-like loops (and hence time machines) can appear in General Relativity (for example in the Goedel universe, a solution of Einstein's equations). We take this apparent discrepancy as a warning bell pointing to us that time as we understand it, might not be fundamental and that whatever theory, lying beyond General Relativity, may not include time as we know it as a fundamental structure. We propose therefore, following the philosophy of analog models of gravity, that time and gravity might not be fundamental per se, but only emergent features. We illustrate our proposal using a toy-model where we show how the Lorentzian signature and Nordstroem gravity (a diffeomorphisms invariant scalar gravity theory) can emerge from a timeless non-dynamical space.

Florian Girelli; Stefano Liberati; Lorenzo Sindoni



Airport Gate Scheduling with Time Windows  

Science Conference Proceedings (OSTI)

In contrast to the existing airport gate assignment studies where flight have fixed schedules, we consider the more realistic situation where flight arrival and departure times can change. Although we minimize walking distances (or travel time) in our ... Keywords: aircraft gate scheduling, memetic algorithm, tabu search

A. Lim; B. Rodrigues; Y. Zhu



Time series forecasting with Qubit Neural Networks  

Science Conference Proceedings (OSTI)

This paper proposes a quantum learning scheme approach for time series forecasting, through the application of the new non-standard Qubit Neural Network (QNN) model. The QNN description was adapted in this work in order to resemble classical Artificial ... Keywords: artificial intelligence, artificial neural networks, quantum computing, qubit neural networks, time series forecasting

Carlos R. B. Azevedo; Tiago A. E. Ferreira



Computing Needs Time Edward A. Lee  

E-Print Network (OSTI)

, and Toyota. #12;Computing Needs Time Edward A. Lee UC Berkeley eal@eecs.berkeley.edu February 18, 2009, and Toyota. 1 #12;E. A. Lee, Berkeley Computing Needs Time "It seems to have a computer; need I say more."1


EnergyPlus Run Time Analysis  

SciTech Connect

EnergyPlus is a new generation building performance simulation program offering many new modeling capabilities and more accurate performance calculations integrating building components in sub-hourly time steps. However, EnergyPlus runs much slower than the current generation simulation programs. This has become a major barrier to its widespread adoption by the industry. This paper analyzed EnergyPlus run time from comprehensive perspectives to identify key issues and challenges of speeding up EnergyPlus: studying the historical trends of EnergyPlus run time based on the advancement of computers and code improvements to EnergyPlus, comparing EnergyPlus with DOE-2 to understand and quantify the run time differences, identifying key simulation settings and model features that have significant impacts on run time, and performing code profiling to identify which EnergyPlus subroutines consume the most amount of run time. This paper provides recommendations to improve EnergyPlus run time from the modeler?s perspective and adequate computing platforms. Suggestions of software code and architecture changes to improve EnergyPlus run time based on the code profiling results are also discussed.

Hong, Tianzhen; Buhl, Fred; Haves, Philip



Integrated method for chaotic time series analysis  

DOE Patents (OSTI)

Methods and apparatus for automatically detecting differences between similar but different states in a nonlinear process monitor nonlinear data are disclosed. Steps include: acquiring the data; digitizing the data; obtaining nonlinear measures of the data via chaotic time series analysis; obtaining time serial trends in the nonlinear measures; and determining by comparison whether differences between similar but different states are indicated. 8 figs.

Hively, L.M.; Ng, E.G.



FAST: Frequency-aware static timing analysis  

Science Conference Proceedings (OSTI)

Energy is a valuable resource in embedded systems as the lifetime of many such systems is constrained by their battery capacity. Recent advances in processor design have added support for dynamic frequency/voltage scaling (DVS) for saving energy. Recent ... Keywords: Real-time systems, dynamic voltage scaling, scheduling, worst-case execution time analysis

Kiran Seth; Aravindh Anantaraman; Frank Mueller; Eric Rotenberg



It's Time to ACT | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

It's Time to ACT It's Time to ACT It's Time to ACT May 25, 2011 - 10:32am Addthis John Lippert In my November 29, 2010 and my February 15, 2011 blog postings, I described some tools and strategies based on behavioral psychology that some companies and organizations are using to encourage people to use less energy and purchase clean energy. Here's another one. I was reading an article the other day in which University of Nevada, Reno, psychologist Steven Hayes gave his explanation of why we Americans are so reluctant to adjust our thermostats. He believes our culture has conditioned us to avoid all discomfort. In other words, we believe that we should feel good all the time. The funny thing is that I heard multiple times essentially the same message at religious services I attended. The common thread in these messages and


Fermilab | Fermilab Time and Labor | Launch  

NLE Websites -- All DOE Office Websites (Extended Search)

Go to FTL timecard Click here to create and submit your timecard on the Fermilab Time and Labor system. Alternate System Login This link uses html only and may work on your mobile device. It is provided for ease of use only. If it doesn't work for you, please use the other link. Fermilab Time and Labor All employees use a single, standard system to report their time and effort electronically. Log in to the system here. This has modernized our time and labor reporting system and helps Fermilab comply with DOE requirements. Use this page to access tools that will help you use the Fermilab Time & Labor electronic timecard. You can login to your timecard, access training materials and documentation and ensure that your browser has the settings and software it needs to access the system.


It's Time to ACT | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

It's Time to ACT It's Time to ACT It's Time to ACT May 25, 2011 - 10:32am Addthis John Lippert In my November 29, 2010 and my February 15, 2011 blog postings, I described some tools and strategies based on behavioral psychology that some companies and organizations are using to encourage people to use less energy and purchase clean energy. Here's another one. I was reading an article the other day in which University of Nevada, Reno, psychologist Steven Hayes gave his explanation of why we Americans are so reluctant to adjust our thermostats. He believes our culture has conditioned us to avoid all discomfort. In other words, we believe that we should feel good all the time. The funny thing is that I heard multiple times essentially the same message at religious services I attended. The common thread in these messages and


Changes in risk perception over time  

SciTech Connect

The focus of this paper is on changes in perceptions of the risks associated with nuclear waste management over time. In particular, we are interested in the kinds of change that take place when the management programs, and those who are charged with implementing them, are subject to intensive public debate over an extended period of time. We are undertaken an over-time study of perceived risks in Colorado and New Mexico by implementing sequential random household surveys in each state, timed at six month intervals. This study employs three of these surveys, spanning the period from summer, 1990 to summer, 1991. Using these data, we examine the dynamics that may underlie variations in perceived risks over time. In particular, our analysis is focused on changes in the roles played by (1) basic political orientations (i.e. political ideology) and (2) trust in those who advocate conflicting policy positions.

Gomez, L.S. [Sandia National Labs., Albuquerque, NM (United States); Jenkins-Smith, H.C.; Miller, K.W. [New Mexico Univ., Albuquerque, NM (United States)



A novel method for modeling the neutron time of flight (nTOF) detector response in current mode to inertial confinement fusion experiments.  

SciTech Connect

There are several machines in this country that produce short bursts of neutrons for various applications. A few examples are the Zmachine, operated by Sandia National Laboratories in Albuquerque, NM; the OMEGA Laser Facility at the University of Rochester in Rochester, NY; and the National Ignition Facility (NIF) operated by the Department of Energy at Lawrence Livermore National Laboratory in Livermore, California. They all incorporate neutron time of flight (nTOF) detectors which measure neutron yield, and the shapes of the waveforms from these detectors contain germane information about the plasma conditions that produce the neutrons. However, the signals can also be %E2%80%9Cclouded%E2%80%9D by a certain fraction of neutrons that scatter off structural components and also arrive at the detectors, thereby making analysis of the plasma conditions more difficult. These detectors operate in current mode - i.e., they have no discrimination, and all the photomultiplier anode charges are integrated rather than counted individually as they are in single event counting. Up to now, there has not been a method for modeling an nTOF detector operating in current mode. MCNPPoliMiwas developed in 2002 to simulate neutron and gammaray detection in a plastic scintillator, which produces a collision data output table about each neutron and photon interaction occurring within the scintillator; however, the postprocessing code which accompanies MCNPPoliMi assumes a detector operating in singleevent counting mode and not current mode. Therefore, the idea for this work had been born: could a new postprocessing code be written to simulate an nTOF detector operating in current mode? And if so, could this process be used to address such issues as the impact of neutron scattering on the primary signal? Also, could it possibly even identify sources of scattering (i.e., structural materials) that could be removed or modified to produce %E2%80%9Ccleaner%E2%80%9D neutron signals? This process was first developed and then applied to the axial neutron time of flight detectors at the ZFacility mentioned above. First, MCNPPoliMi was used to model relevant portions of the facility between the source and the detector locations. To obtain useful statistics, variance reduction was utilized. Then, the resulting collision output table produced by MCNPPoliMi was further analyzed by a MATLAB postprocessing code. This converted the energy deposited by neutron and photon interactions in the plastic scintillator (i.e., nTOF detector) into light output, in units of MeVee%D1%84 (electron equivalent) vs time. The time response of the detector was then folded into the signal via another MATLAB code. The simulated response was then compared with experimental data and shown to be in good agreement. To address the issue of neutron scattering, an %E2%80%9CIdeal Case,%E2%80%9D (i.e., a plastic scintillator was placed at the same distance from the source for each detector location) with no structural components in the problem. This was done to produce as %E2%80%9Cpure%E2%80%9D a neutron signal as possible. The simulated waveform from this %E2%80%9CIdeal Case%E2%80%9D was then compared with the simulated data from the %E2%80%9CFull Scale%E2%80%9D geometry (i.e., the detector at the same location, but with all the structural materials now included). The %E2%80%9CIdeal Case%E2%80%9D was subtracted from the %E2%80%9CFull Scale%E2%80%9D geometry case, and this was determined to be the contribution due to scattering. The time response was deconvolved out of the empirical data, and the contribution due to scattering was then subtracted out of it. A transformation was then made from dN/dt to dN/dE to obtain neutron spectra at two different detector locations.

Nelson, Alan J. [University of New Mexico, Albuquerque, NM; Cooper, Gary Wayne [University of New Mexico, Albuquerque, NM; Ruiz, Carlos L.; Chandler, Gordon Andrew; Fehl, David Lee; Hahn, Kelly Denise; Leeper, Ramon Joe; Smelser, Ruth Marie; Torres, Jose A.



Time-Domain Electromagnetics | Open Energy Information  

Open Energy Info (EERE)

Time-Domain Electromagnetics Time-Domain Electromagnetics Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Technique: Time-Domain Electromagnetics Details Activities (10) Areas (10) Regions (0) NEPA(0) Exploration Technique Information Exploration Group: Geophysical Techniques Exploration Sub Group: Electrical Techniques Parent Exploration Technique: Electromagnetic Sounding Techniques Information Provided by Technique Lithology: Detection of rock units or geological features with contrasting apparent resistivity. Stratigraphic/Structural: Structural information may be inferred from TDEM data. Hydrological: Hydrological information such as depth to groundwater table may be determined. Thermal: Extent of hydrothermal alteration mineralogy may be inferred. Cost Information


Real time sensor for therapeutic radiation delivery  

DOE Patents (OSTI)

The invention is a real time sensor for therapeutic radiation. A probe is placed in or near the patient that senses in real time the dose at the location of the probe. The strength of the dose is determined by either an insertion or an exit probe. The location is determined by a series of vertical and horizontal sensing elements that gives the operator a real time read out dose location relative to placement of the patient. The increased accuracy prevents serious tissue damage to the patient by preventing overdose or delivery of a dose to a wrong location within the body. 14 figs.

Bliss, M.; Craig, R.A.; Reeder, P.L.



Real time sensor for therapeutic radiation delivery  

DOE Patents (OSTI)

The invention is a real time sensor for therapeutic radiation. A probe is placed in or near the patient that senses in real time the dose at the location of the probe. The strength of the dose is determined by either an insertion or an exit probe. The location is determined by a series of vertical and horizontal sensing elements that gives the operator a real time read out dose location relative to placement of the patient. The increased accuracy prevents serious tissue damage to the patient by preventing overdose or delivery of a dose to a wrong location within the body.

Bliss, Mary (West Richland, WA); Craig, Richard A. (West Richland, WA); Reeder, Paul L. (Richland, WA)


Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Proper Time Flow Equation for Gravity  

E-Print Network (OSTI)

We analyze a proper time renormalization group equation for Quantum Einstein Gravity in the Einstein-Hilbert truncation and compare its predictions to those of the conceptually different exact renormalization group equation of the effective average action. We employ a smooth infrared regulator of a special type which is known to give rise to extremely precise critical exponents in scalar theories. We find perfect consistency between the proper time and the average action renormalization group equations. In particular the proper time equation, too, predicts the existence of a non-Gaussian fixed point as it is necessary for the conjectured nonperturbative renormalizability of Quantum Einstein Gravity.

Bonanno, A



Nuclear dynamics in time-dependent picture  

E-Print Network (OSTI)

Using the time-dependent theory of quantum mechanics, we investigate nuclear electric dipole responses. The time evolution of a wave function is explicitly calculated in the coordinate-space representation. The particle continuum is treated with the absorbing boundary condition. Calculated time-dependent quantities are transformed into those of familiar energy representation. We apply the method to a three-body model for 11Li and to the mean-field model for 22O, then discuss properties of E1 response.

Takashi Nakatsukasa; Makoto Ito; Kazuhiro Yabana



Graduate Program Time Limits and Work Schedules  

NLE Websites -- All DOE Office Websites (Extended Search)

Time Limits and Work Schedules Time Limits and Work Schedules Graduate Program Time Limits and Work Schedules Point your career towards LANL: work with the best minds on the planet in an inclusive environment that is rich in intellectual vitality and opportunities for growth. Contact Student Programs (505) 665-8899 Email Time Limits The length of participation in the graduate program is limited as follows: With a bachelor's pursuing a master's degree: 4 years With a bachelor's pursuing a PhD: 7 years With a master's pursuing a second master's degree: 2 years With a master's pursuing a PhD: 4 years With a master's pursuing a master's and PhD in a new field: 6 years Students may remain in the GRA program for up to three months after receiving their PhD. Work schedules Year-round students Students participating in the MBA program, post-baccalaureate appointments,


Space-Time Insight | Open Energy Information  

Open Energy Info (EERE)

Space-Time Insight Space-Time Insight Jump to: navigation, search Name Space-Time Insight Address 45680 Northport Loop East Place Fremont, California Zip 94538 Sector Efficiency Product SpaceTime Awareness Server Year founded 2008 Number of employees 11-50 Website http://www.spacetimeinsight.co Coordinates 37.4923832°, -121.9532879° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.4923832,"lon":-121.9532879,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Property:Real-Time | Open Energy Information  

Open Energy Info (EERE)

Real-Time Real-Time Jump to: navigation, search Property Name Real-Time Property Type String Pages using the property "Real-Time" Showing 25 pages using this property. (previous 25) (next 25) 1 1.5-ft Wave Flume Facility + No + 10-ft Wave Flume Facility + No + 11-ft Wave Flume Facility + No + 2 2-ft Flume Facility + No + 3 3-ft Wave Flume Facility + No + 5 5-ft Wave Flume Facility + No + 6 6-ft Wave Flume Facility + No + A Alden Large Flume + Yes + Alden Small Flume + Yes + Alden Tow Tank + Yes + Alden Wave Basin + Yes + B Breakwater Research Facility + No + Bucknell Hydraulic Flume + No + C Carderock 2-ft Variable Pressure Cavitation Water Tunnel + No + Carderock 3-ft Variable Pressure Cavitation Water Tunnel + No + Carderock Circulating Water Channel + No +


Unraveling life four letters at a time  

NLE Websites -- All DOE Office Websites (Extended Search)

Unraveling life four letters at a time Unraveling life four letters at a time 1663 Los Alamos science and technology magazine Latest Issue:November 2013 All Issues » submit Unraveling life four letters at a time Major advances in sequencing since the official end of the Human Genome Project are fueling a revolution in genomics research. November 25, 2013 Unraveling life four letters at a time Reading the genetic code of life keeps getting faster and cheaper, bringing more and more new discoveries within reach. The genomics revolution that came after the Human Genome Project The Human Genome Project officially ended in 2003, but the 10 years since have seen dramatic improvements in genomics technology and discovery. New, rapid sequencing machines provide high throughput conversion of genetic material (DNA or RNA) into data to be arranged into its proper order by a


Energy drift in reversible time integration  

E-Print Network (OSTI)

Energy drift is commonly observed in reversible integrations of systems of molecular dynamics. We show that this drift can be modelled as a diffusion and that the typical energy error after time T is O(?T).

R I McLachlan; M Perlmutter



Fun with sub-linear time algorithms  

Science Conference Proceedings (OSTI)

Provided that one is willing to use randomness and to tolerate an approximate answer, many computational problems admit ultrafast algorithms that run in less than linear time in the length of the input. In many interesting cases, even algorithms that ...

Luca Trevisan



Undergraduate Program Time Limits and Work Schedules  

NLE Websites -- All DOE Office Websites (Extended Search)

Time Limits and Work Schedules Time Limits and Work Schedules Undergraduate Program Time Limits and Work Schedules Point your career towards LANL: work with the best minds on the planet in an inclusive environment that is rich in intellectual vitality and opportunities for growth. Contact Student Programs (505) 665-8899 Email Time limits The length of participation in the undergraduate program is limited to a maximum of six years for students pursuing a bachelor's degree and three years for students pursuing an associate's degree. Work schedules Year-round students Students participating in some special undergraduate programs, post-baccalaureate appointments, post-master's appointments, and GRA students working on a thesis or dissertation are excluded from the 30-hour per week work restriction.


NSLS User Access | Requesting Beam Time  

NLE Websites -- All DOE Office Websites (Extended Search)

Requesting Beam Time Requesting Beam Time Use one of the following options depending on your research: General User Proposal General User proposals are peer reviewed for scientific merit by a Proposal Review Panel (PRP). General User proposals compete for beamtime with other General User Proposals based on scientific merit. Once the original proposal and beam time request is reviewed and rated in the PASS System, additional beam time requests can be submitted against the original proposal for its lifetime, a period of up to six cycles (two years). Data taken during experiments associated with a General User proposal is considered to be in the public domain. There is no charge for General User beamtime. Rapid Access Rapid Access proposals are a subset of General User proposals available for


Estimates of Characteristic Times for Precipitation Scavenging  

Science Conference Proceedings (OSTI)

We address the problem of using climatological data to estimate residence times in the atmosphere of particles subjected to precipitation scavenging. Basic parameters are the scavenging coefficient ?, the rainfall intensity R and the length of ...

Henning Rodhe; Jan Grandell



Casimir forces in the time domain: Applications  

E-Print Network (OSTI)

Our previous article [Phys. Rev. A 80, 012115 (2009)] introduced a method to compute Casimir forces in arbitrary geometries and for arbitrary materials that was based on a finite-difference time-domain (FDTD) scheme. In ...

Johnson, Steven G.


Real Time Energy Pricing Web Services Implementation  

NLE Websites -- All DOE Office Websites (Extended Search)

Real Time Energy Pricing Web Services Implementation Speaker(s): Jim Boch Kim McCaffrey Robert Nawy Date: December 15, 2010 - 12:00pm Location: 90-3122 Seminar HostPoint of...


SpaceTime Correlations of Lightning Distributions  

Science Conference Proceedings (OSTI)

Lightning location data are used to calculate the autocorrelation function of lightning distributions, which is a function of distances and time intervals between the single lightning events. This function is utilized for the characterization of ...

Ulli Finke



Time Scales of Land Surface Hydrology  

Science Conference Proceedings (OSTI)

This paper intends to investigate the time scales of land surface hydrology and enhance the understanding of the hydrological cycle between the atmosphere, vegetation, and soil. A three-layer model for land surface hydrology is developed to study ...

Aihui Wang; Xubin Zeng; Samuel S. P. Shen; Qing-Cun Zeng; Robert E. Dickinson



Virtual stationary timed automata for mobile networks  

E-Print Network (OSTI)

In this thesis, we formally define a programming abstraction for mobile networks called the Virtual Stationary Automata programming layer, consisting of real mobile clients, virtual timed I/O automata called virtual ...

Nolte, Tina Ann, 1979-



The Aging Workforce and Paid Time Off  

E-Print Network (OSTI)

The Aging Workforce and Paid Time Off Draft 07/08/09 Gilliana matter of the workforce aging as the population ages. Thephysical changes with aging that can affect performance. 10

Lester, Gillian



Real-time rendering systems in 2010  

Science Conference Proceedings (OSTI)

We present a case for future real-time rendering systems that support non-physically-correct global illumination techniques by using ray tracing visibility algorithms, by integrating scene management with rendering, and by executing on general-purpose ...

William R. Mark; Donald Fussell



It's About Time: Investing in Transportation to  

E-Print Network (OSTI)

MARCH 2011 It's About Time: Investing in Transportation to Keep Texas Economically Competitive #12 of Contents Preface 1 The Challenge Facing Texans 3 Texas Transportation Action Principles 6 Texas' Deteriorating Transportation System: Background and Measurement 8 Baseline Scenario: Unacceptable Conditions


Thermodynamics and time-directional invariance  

E-Print Network (OSTI)

Time directions are not invariant in conventional thermodynamics. We broadly follow ideas of Ludwig Boltzmann and investigate implications of postulating time-directional invariance in thermodynamics. In this investigation, we require that thermodynamic descriptions are not changed under time reversal accompanied by replacement of matter by antimatter (i.e. CPT-invariant thermodynamics). The matter and antimatter are defined as thermodynamic concepts without detailing their physical structure. Our analysis stays within the limits of conceptual thermodynamics and leads to effective negative temperatures, to thermodynamic restrictions on time travel and to inherent antagonism of matter and antimatter. This antagonism is purely thermodynamic; it explains the difficulty in achieving thermodynamic equilibrium between matter and antimatter and does not postulate their mutual annihilation on contact. We believe that the conclusions of this work can be of interest not only for people researching or teaching thermodyn...

Klimenko, A Y


Note: This page contains sample records for the topic "mi stop time" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


book review: A book for our time  

E-Print Network (OSTI)

important thing in this book isnt actually written down innews and update ISSN 1948-6596 book reviewA book for our time Spatial Conservation Prioritization

Grenyer, Richard



Advective Time Lags in Box Models  

Science Conference Proceedings (OSTI)

A box model of the thermohaline circulation with mixed boundary conditions in which advective processes are incorporated via an explicit time delay mechanism is considered. The pipes that connect the subtropical and subpolar boxes have a finite ...

Douglas A. Kurtze; Juan M. Restrepo



Real-Time Mesoscale Prediction on workstations  

Science Conference Proceedings (OSTI)

Experience in performing real-time mesoscale numerical prediction forecasts using the Regional Atmospheric Modeling System (RAMS) over Colorado for a winter season on high-performance workstations is summarized. Performance evaluation is done for ...

William R. Cotton; Gregory Thompson; Paul W. Mieike Jr.



Real time PCR measurement by fluorescence anisotropy  

E-Print Network (OSTI)

Real-time polymerase chain reaction (PCR) is the gold-standard for quantitation in both mutation and gene expression analyses. Already this technique has found valuable clinical application in disease diagnosis and progression ...

Crane, Bryan Lee, 1976-



Near Real-Time Push Middleware  

E-Print Network (OSTI)

Architecture.. 102 System Trial .. 109 Chapter 6 Electric vehicle smart charging and vehicle-to-gridSmart Grid, to address deficiencies in existing research, and to advance the state of the art in near real-time push architectures.

Mal, Siddhartha Byron




Science Conference Proceedings (OSTI)

The Real Time System Operations (RTSO) 2006-2007 project focused on two parallel technical tasks: (1) Real-Time Applications of Phasors for Monitoring, Alarming and Control; and (2) Real-Time Voltage Security Assessment (RTVSA) Prototype Tool. The overall goal of the phasor applications project was to accelerate adoption and foster greater use of new, more accurate, time-synchronized phasor measurements by conducting research and prototyping applications on California ISO's phasor platform - Real-Time Dynamics Monitoring System (RTDMS) -- that provide previously unavailable information on the dynamic stability of the grid. Feasibility assessment studies were conducted on potential application of this technology for small-signal stability monitoring, validating/improving existing stability nomograms, conducting frequency response analysis, and obtaining real-time sensitivity information on key metrics to assess grid stress. Based on study findings, prototype applications for real-time visualization and alarming, small-signal stability monitoring, measurement based sensitivity analysis and frequency response assessment were developed, factory- and field-tested at the California ISO and at BPA. The goal of the RTVSA project was to provide California ISO with a prototype voltage security assessment tool that runs in real time within California ISO?s new reliability and congestion management system. CERTS conducted a technical assessment of appropriate algorithms, developed a prototype incorporating state-of-art algorithms (such as the continuation power flow, direct method, boundary orbiting method, and hyperplanes) into a framework most suitable for an operations environment. Based on study findings, a functional specification was prepared, which the California ISO has since used to procure a production-quality tool that is now a part of a suite of advanced computational tools that is used by California ISO for reliability and congestion management.

Eto, Joseph H.; Parashar, Manu; Lewis, Nancy Jo



Polynomial Time Algorithms for Minimum Energy Scheduling  

E-Print Network (OSTI)

The aim of power management policies is to reduce the amount of energy consumed by computer systems while maintaining satisfactory level of performance. One common method for saving energy is to simply suspend the system during the idle times. No energy is consumed in the suspend mode. However, the process of waking up the system itself requires a certain fixed amount of energy, and thus suspending the system is beneficial only if the idle time is long enough to compensate for this additional energy expenditure. In the specific problem studied in the paper, we have a set of jobs with release times and deadlines that need to be executed on a single processor. Preemptions are allowed. The processor requires energy L to be woken up and, when it is on, it uses one unit of energy per one unit of time. It has been an open problem whether a schedule minimizing the overall energy consumption can be computed in polynomial time. We solve this problem in positive, by providing an O(n^5)-time algorithm. In addition we pr...

Baptiste, Philippe; Durr, Christoph



Gain Time Reclaiming in High Performance Real-Time Java Systems  

E-Print Network (OSTI)

The run-time characteristics of Java, such as high frequency of method invocation, dynamic dispatching and dynamic loading, make Java more difficult than other object-oriented programming languages, such as C++, for conducting Worst-Case Execution Time (WCET) analysis. To offer a more flexible way to develop object-oriented real-time applications in the realtime Java environment without loss of predicability and performance, we propose a novel gain time reclaiming framework integrated with WCET analysis. This paper demonstrates how to improve the utilisation and performance of the whole system by reclaiming gain time at run-time. Our approach shows that integrating WCET with gain time reclaiming can not only provide a more flexible environment, but it also does not necessarily result in unsafe or unpredictable timing behaviour.

Erik Yu-Shing Hu; Andy Wellings; Guillem Bernat



Exploiting sparsity in time-of-flight range acquisition using a single time-resolved sensor  

E-Print Network (OSTI)

Range acquisition systems such as light detection and ranging (LIDAR) and time-of-flight (TOF) cameras operate by measuring the time difference of arrival between a transmitted pulse and the scene reflection. We introduce ...

Kirmani, Ahmed


A new time-invariant fuzzy time series forecasting method based on genetic algorithm  

Science Conference Proceedings (OSTI)

In recent years, many fuzzy time series methods have been proposed in the literature. Some of these methods use the classical fuzzy set theory, which needs complex matricial operations in fuzzy time series methods. Because of this problem, many studies ...

Erol E?rio?lu



Blind calibration of timing skew in time-interleaved analog-to-digital converters  

E-Print Network (OSTI)

The performance of time-interleaved analog-to-digital converters is often significantly degraded by timing mismatch errors. We develop methods for performing blind calibration of such converters, i.e., for estimating the ...

Divi, Vijay


On Time-Invariant Purified-Output-Based Discrete Time Control  

E-Print Network (OSTI)

Oct 14, 2005 ... On Time-Invariant Purified-Output-Based Discrete Time Control. Aharon Ben-Tal (abental ***at*** ie.technion.ac.il) Stephen Boyd (boyd ***at***...


Classification of the Entangled states L\\times N\\times N  

E-Print Network (OSTI)

We presented a general classification scheme for the tripartite $L\\times N\\times N$ entangled system under stochastic local operation and classical communication. The whole classification procedure consists of two correlated parts: the simultaneous similarity transformation of a commuting matrix pair into a canonical form and the study of internal symmetry of parameters in the canonical form. Based on this scheme, a concrete example of entanglement classification for a $3\\times N\\times N$ system is given.

Jun-Li Li; Shi-Yuan Li; Cong-Feng Qiao



Extending quantum control of time-independent systems to time-dependent systems  

E-Print Network (OSTI)

We establish that if a scheme can control a time-independent system arbitrarily coupled to a generic finite bath over a short period of time $T$ with control precision $O(T^{N+1})$, it can also realize the control with the same order of precision on smoothly time-dependent systems. This result extends the validity of various universal dynamical control schemes to arbitrary analytically time-dependent systems.

Zhen-Yu Wang; Ren-Bao Liu



Pulmonary crackle detection using time-frequency and time-scale analysis  

Science Conference Proceedings (OSTI)

Pulmonary crackles are used as indicators for the diagnosis of different pulmonary disorders in auscultation. Crackles are very common adventitious transient sounds. From the characteristics of crackles such as timing and number of occurrences, the type ... Keywords: Crackle detection, Denoising, Dual-tree complex wavelet transform, Ensemble methods, Lung sounds, Support vector machines, Time-frequency and time-scale analysis

Gorkem Serbes; C. Okan Sakar; Yasemin P. Kahya; Nizamettin Aydin
