Powered by Deep Web Technologies
Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

VA's CHP Program  

NLE Websites -- All DOE Office Websites (Extended Search)

- 36,353 MWh Total Contract Cost - 70.3 million 1,900MWh generation + Extra Boilers + FREE STEAM VA's Existing CHP Plants Partnerships for Healing Environments 2010 6...

2

Elements VA VIIIB  

NLE Websites -- All DOE Office Websites (Extended Search)

2793 LIII 2p32 2677 MI 3s 544* MII 3p12 447.6 MIII 3p32 417.7 MIV 3d32 257.6 MV 3d52 253.9* Technetium 43 Rh K 1s 23220 LI 2s 3412 LII 2p12 3146 LIII 2p32 3004 MI 3s 628.1+...

3

NC STATE UNIVERSITY UNIVERSITY HOUSING  

E-Print Network (OSTI)

name to enter it on your application. Only current and accepted students will appear in the search box of the application process 1 #12;NC STATE UNIVERSITY SELECT THE FALL 2012 TERM 2 Once accepted by NC State, students accepting the terms and conditions associated with the Agreement. ELECTRONIC SIGNATURE #12;NC STATE

4

VA Energy Management Action Plan  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

VA Energy Management VA Energy Management Action Plan Ken Demers Chief, VA National Energy Business Center Purpose Cited Deficiencies Within VA's Previous Energy Program... *No comprehensive Department-wide policy *Lack of coordinated acquisition and investment strategies throughout the Administrations and Staff Offices *No uniform measurement and verification of energy usage *Unverifiable reporting mechanism *Lack of capturing "lessons learned" and best practices from previous experiences Potential Annual Savings ENERGY COST ($000) CONSUMPTION (Billion Btu) Baseline - FY 2005: $397,577 Baseline - FY 2005: 29,094 Savings Savings SOURCE OF SAVINGS FY 2007 FY 2008 Future TOTAL

5

Category:Richmond, VA | Open Energy Information  

Open Energy Info (EERE)

VA VA Jump to: navigation, search Go Back to PV Economics By Location Media in category "Richmond, VA" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Richmond VA Virginia Electric & Power Co.png SVFullServiceRestauran... 64 KB SVQuickServiceRestaurant Richmond VA Virginia Electric & Power Co.png SVQuickServiceRestaura... 64 KB SVHospital Richmond VA Virginia Electric & Power Co.png SVHospital Richmond VA... 66 KB SVLargeHotel Richmond VA Virginia Electric & Power Co.png SVLargeHotel Richmond ... 62 KB SVLargeOffice Richmond VA Virginia Electric & Power Co.png SVLargeOffice Richmond... 69 KB SVMediumOffice Richmond VA Virginia Electric & Power Co.png SVMediumOffice Richmon... 64 KB SVMidriseApartment Richmond VA Virginia Electric & Power Co.png

6

CT NC0  

Office of Legacy Management (LM)

x-L* d! x-L* d! CT NC0 - i , ,. i, .' i :.:(e.!' ,A\~, L.,t, - (iI :i' , . y- 2 .L i ._ 1 c\ :- i;! Ii $ 4. Ci:lc:i.nnati. 39, t>:::i.f> (J&l3 q-1 -3 sui3 Jrn T3 FRCM .I iirz 1 ?j ~ 1.3 bL1 T:' IP !REFOI?T TC 5YC?CZCiC~ :EWllIFl;j",tsSS L' I"JIsIc:;. .:;xli3;. iCAN !fA(=;-fL,yg-j L' sc,, E. $.iCLX:i?, -iIJ,x:q()Is. ON hL4X 24 - 25 ) 1.9tic ;i. A. Quiglel;, A.3, 3, M. ChenauEt gpxrIvB OF TP.~ The purpose of t3is trip was tc observe a proposed method for the dchy- dratim of green salt md to determine that all health and safety measures were being xrried out, SurveiU.ance of this nature provided protection against excessi3z personnel exposure, insured compliance with ICC shipping regulaticns, tion of the equ'~ and determined when adequate decontamira-

7

Category:Greensboro, NC | Open Energy Information  

Open Energy Info (EERE)

NC NC Jump to: navigation, search Go Back to PV Economics By Location Media in category "Greensboro, NC" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Greensboro NC Duke Energy Carolinas LLC.png SVFullServiceRestauran... 69 KB SVQuickServiceRestaurant Greensboro NC Duke Energy Carolinas LLC.png SVQuickServiceRestaura... 68 KB SVHospital Greensboro NC Duke Energy Carolinas LLC.png SVHospital Greensboro ... 67 KB SVLargeHotel Greensboro NC Duke Energy Carolinas LLC.png SVLargeHotel Greensbor... 66 KB SVLargeOffice Greensboro NC Duke Energy Carolinas LLC.png SVLargeOffice Greensbo... 68 KB SVMediumOffice Greensboro NC Duke Energy Carolinas LLC.png SVMediumOffice Greensb... 67 KB SVMidriseApartment Greensboro NC Duke Energy Carolinas LLC.png

8

Category:Wilmington, NC | Open Energy Information  

Open Energy Info (EERE)

NC NC Jump to: navigation, search Go Back to PV Economics By Location Media in category "Wilmington, NC" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Wilmington NC Duke Energy Carolinas LLC.png SVFullServiceRestauran... 69 KB SVQuickServiceRestaurant Wilmington NC Duke Energy Carolinas LLC.png SVQuickServiceRestaura... 68 KB SVHospital Wilmington NC Duke Energy Carolinas LLC.png SVHospital Wilmington ... 67 KB SVLargeHotel Wilmington NC Duke Energy Carolinas LLC.png SVLargeHotel Wilmingto... 65 KB SVLargeOffice Wilmington NC Duke Energy Carolinas LLC.png SVLargeOffice Wilmingt... 68 KB SVMediumOffice Wilmington NC Duke Energy Carolinas LLC.png SVMediumOffice Wilming... 68 KB SVMidriseApartment Wilmington NC Duke Energy Carolinas LLC.png

9

VA  

NLE Websites -- All DOE Office Websites (Extended Search)

and Sm 2 K 2 IrO 7 : Iridium(VI) Oxides Prepared under Ambient Pressure," Ange- wandte Chemie, International Edition, 48, 215 (2009). of one particular group of solvents: molten...

10

I'NC.£F::.-------  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

I'NC.£F::.------- I'NC.£F::.------- u.s. DEPARTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETI!lUnNATION RECIPIENT:WA Dept of Commerce PROJECT TITLE: SEP ARRA· WSU Anaerobic Digester· Nutrient Recovery Technology Page 1 of3 STATE: WA funding Opportunity Announcement Number Procurement Instrument Number NEPA Cnntrol Number CID Number EEOOOO139 GF0-0000139-Q22 EE139 Based on my ",view of the informaUon concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4SI.IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including , but not limited to, literature surveys, inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply

11

US SoAtl VA Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

SoAtl VA SoAtl VA Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US SoAtl VA Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 4,000 8,000 12,000 16,000 US SoAtl VA Site Consumption kilowatthours $0 $300 $600 $900 $1,200 $1,500 $1,800 US SoAtl VA Expenditures dollars ELECTRICITY ONLY average per household * Virginia households consume an average of 86 million Btu per year, about 4% less than the U.S. average. * Average electricity consumption and costs are higher for Virginia households than the national average, but similar to those in neighboring states where electricity is the most common heating fuel. * Virginia homes are typically newer and larger than homes in other parts of the country. CONSUMPTION BY END USE

12

US SoAtl VA Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

SoAtl VA SoAtl VA Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US SoAtl VA Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 4,000 8,000 12,000 16,000 US SoAtl VA Site Consumption kilowatthours $0 $300 $600 $900 $1,200 $1,500 $1,800 US SoAtl VA Expenditures dollars ELECTRICITY ONLY average per household * Virginia households consume an average of 86 million Btu per year, about 4% less than the U.S. average. * Average electricity consumption and costs are higher for Virginia households than the national average, but similar to those in neighboring states where electricity is the most common heating fuel. * Virginia homes are typically newer and larger than homes in other parts of the country. CONSUMPTION BY END USE

13

DOE - Office of Legacy Management -- Reynolds Metals Co - VA 04  

Office of Legacy Management (LM)

Reynolds Metals Co - VA 04 Reynolds Metals Co - VA 04 FUSRAP Considered Sites Site: REYNOLDS METALS CO. (VA.04 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Virginia-Carolina Chemical Corporation VA.04-1 Location: 818 Perry Street , Richmond , Virginia VA.04-1 Evaluation Year: 1985 VA.04-2 VA.04-3 Site Operations: Preparatory process development involving only gram quantities of uranium performed in the 1950s. VA.04-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited materials handled VA.04-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium VA.04-1 Radiological Survey(s): None Indicated VA.04-1 VA.04-4 Site Status: Eliminated from consideration under FUSRAP

14

The Atlanta VA Medical Center The Atlanta VA Medical Center http://www.atlanta.va.gov/careers/ is seeking candidates for a Speech  

E-Print Network (OSTI)

The Atlanta VA Medical Center The Atlanta VA Medical Center http regarding this position. The Atlanta VA Medical Center is comprised of 173 operating hospital beds and 100 at the Atlanta VA Medical Center. We are affiliated with the Emory University School of Medicine and are located

Peterson, Blake R.

15

DOE - Office of Legacy Management -- Norfolk Naval Station - VA 05  

NLE Websites -- All DOE Office Websites (Extended Search)

Norfolk Naval Station - VA 05 Norfolk Naval Station - VA 05 FUSRAP Considered Sites Site: NORFOLK NAVAL STATION (VA.05) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Norfolk , Virginia VA.05-1 Evaluation Year: 1993 VA.05-1 Site Operations: Demonstration of extinguishing a uranium fire at the Fire Fighters School for AEC contractors. VA.05-3 VA.05-2 Site Disposition: Eliminated - Potential for contamination considered remote based on the limited quantity of materials handled VA.05-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium VA.05-2 Radiological Survey(s): Yes - Health and Safety Monitoring during operations only VA.05-2 Site Status: Eliminated from consideration under FUSRAP

16

DOE - Office of Legacy Management -- Mobil Oil Corp - VA 01  

Office of Legacy Management (LM)

Mobil Oil Corp - VA 01 Mobil Oil Corp - VA 01 FUSRAP Considered Sites Site: Mobil Oil Corp. (VA.01 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Virginia-Carolina Chemical Corporation VA.01-1 Location: 818 Perry Street , Richmond , Virginia VA.01-1 Evaluation Year: Circa 1987 VA.01-2 VA.01-3 Site Operations: Research/Development to recover Uranium as a byproduct of phosphate production; preparatory process for pilot plant scale operation at Nichols, Florida. VA.01-1 Site Disposition: Eliminated - Potential for residual radioactive contamination from small quantities of material used at the site is considered remote VA.01-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium VA.01-1

17

KENO V.a certification package  

Science Conference Proceedings (OSTI)

KENO V.a has been certified. KENO V.a is a multigroup Monte Carlo criticality program used to calculate the k-effective of a 3-D system. It is part of the SCALE modular code system for performing Standardized Computer Analyses for Licensing Evaluation. SCALE was developed for the Nuclear Regulatory Commission to satisfy a need for a standardized method of analysis for the evaluation of nuclear fuel facility and package designs. In its present form, the system has the capability to perform criticality, shielding, and heat transfer analyses using well established functional modules tailored to the SCALE system. KENO V.a will be used at SRS to perform critical calculations related to nuclear criticality safety.

Niemer, K.A.

1994-04-01T23:59:59.000Z

18

NC Sustainable Energy Association | Open Energy Information  

Open Energy Info (EERE)

NC Sustainable Energy Association NC Sustainable Energy Association Jump to: navigation, search Name NC Sustainable Energy Association Address PO Box 6465 Place Raleigh Zip 27628 Number of employees 1-10 Year founded 1978 Phone number 919-832-7601 Website http://www.energync.org Coordinates 35.7719°, -78.6388° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.7719,"lon":-78.6388,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

19

100-kVA Intelligent Universal Transformer Development  

Science Conference Proceedings (OSTI)

This status report documents the design and development of EPRI's 100-kVA Intelligent Universal Transformer (IUT).

2008-12-16T23:59:59.000Z

20

Communication and Collaboration Keep San Francisco VA Medical Center  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Communication and Collaboration Keep San Francisco VA Medical Communication and Collaboration Keep San Francisco VA Medical Center Project on Track Communication and Collaboration Keep San Francisco VA Medical Center Project on Track October 7, 2013 - 1:56pm Addthis San Francisco VA Medical Center The San Francisco VA Medical Center is saving more than $500,000 and almost 3 million kWh every year through a retrofit financed by FEMP's Super ESPC Program. Overview The Veterans Affairs Medical Center in San Francisco is saving almost 3 million kilowatt-hours of electricity, more than 70,000 therms of natural gas, and more than $500,000 annually. The energy savings are enough to power 400 homes and supply natural gas to more than 100 homes each year in California. These savings were realized by taking advantage of Super Energy

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Microsoft Word - Moving to a Clean Energy Economy-VA 9 24 09...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Moving to a Clean Energy Economy-VA 9 24 09.doc Microsoft Word - Moving to a Clean Energy Economy-VA 9 24 09.doc Microsoft Word - Moving to a Clean Energy Economy-VA 9 24 09.doc...

22

Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...

23

US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

24

US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

25

RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.

26

NC GreenPower Production Incentive | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NC GreenPower Production Incentive NC GreenPower Production Incentive NC GreenPower Production Incentive < Back Eligibility Agricultural Commercial Industrial Institutional Local Government Nonprofit Residential Schools State Government Savings Category Bioenergy Water Buying & Making Electricity Solar Wind Program Info State North Carolina Program Type Performance-Based Incentive Rebate Amount Varies by technology and system size PV up to 5 kW: $0.06/kWh PV larger than 5 kW: must enter bid process Wind up to 10 kW: $0.09/kWh Wind larger than 10 kW: must enter bid process Provider NC GreenPower NC GreenPower, a statewide green power program designed to encourage the use of renewable energy in North Carolina, offers production payments for grid-tied electricity generated by solar, wind, small hydro (10 megawatts

27

Does nuclear matter bind at large $N_c$?  

E-Print Network (OSTI)

The existence of nuclear matter at large $N_c$ is investigated in the framework of effective hadronic models of the Walecka type. This issue is strongly related to the nucleon-nucleon attraction in the scalar channel, and thus to the nature of the light scalar mesons. Different scenarios for the light scalar sector correspond to different large $N_c$ scaling properties of the parameters of the hadronic models. In all realistic phenomenological scenarios for the light scalar field(s) responsible for the attraction in the scalar channel it is found that nuclear matter does not bind in the large $N_c$ world. We thus conclude that $N_c = 3$ is in this respect special: 3 is fortunately not large at all and allows for nuclear matter, while large $N_c$ would not.

Bonanno, Luca

2011-01-01T23:59:59.000Z

28

Hydrogen Production and Dispensing Facility Opens at W. Va. Airport |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Hydrogen Production and Dispensing Facility Opens at W. Va. Airport Hydrogen Production and Dispensing Facility Opens at W. Va. Airport Hydrogen Production and Dispensing Facility Opens at W. Va. Airport August 19, 2009 - 1:00pm Addthis Major General Allen Tackett of the National Guard's 130th Airlift Wing dispenses the first fill-up of hydrogen fuel from the Yeager facility. Major General Allen Tackett of the National Guard's 130th Airlift Wing dispenses the first fill-up of hydrogen fuel from the Yeager facility. Washington, D.C. -- A hydrogen production and dispensing station constructed and operated with support from the Office of Fossil Energy's National Energy Technology Laboratory (NETL) was officially opened Monday at the Yeager Airport in Charleston, W.Va. The facility is an example of how domestically produced fuels may be used to power a variety of vehicles

29

DOE - Office of Legacy Management -- Naval Proving Ground - VA 0-01  

NLE Websites -- All DOE Office Websites (Extended Search)

Proving Ground - VA 0-01 Proving Ground - VA 0-01 FUSRAP Considered Sites Site: NAVAL PROVING GROUND (VA.0-01 ) Eliminated from further consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: None Location: Dahlgren , Virginia VA.0-01-1 Evaluation Year: 1987 VA.0-01-1 Site Operations: Site operations were not specified; this site was identified on the 1954 Accountable Station Lists. VA.0-01-1 VA.0-01-2 Site Disposition: Eliminated - Referred to DOD VA.0-01-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DOD VA.0-01-1 Also see Documents Related to NAVAL PROVING GROUND VA.0-01-1 - DOE Letter; Fiore to Schafer; Referral of DOD or Former

30

N.C. Solar Center | Open Energy Information  

Open Energy Info (EERE)

N.C. Solar Center N.C. Solar Center Jump to: navigation, search Name N.C. Solar Center Address NCSU, Box 7401 Place Raleigh, NC Zip 27695 Number of employees 11-50 Year founded 1988 Coordinates 35.762515267°, -78.5407447815° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.762515267,"lon":-78.5407447815,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

31

LBNL-4183E-rev1 N NA AT TU UR RA AL L G GA AS S V VA AR RI  

NLE Websites -- All DOE Office Websites (Extended Search)

4183E-rev1 4183E-rev1 N NA AT TU UR RA AL L G GA AS S V VA AR RI IA AB BI IL LI IT TY Y I IN N C CA AL LI IF FO OR RN NI IA A: : E EN NV VI IR RO ON NM ME EN NT TA AL L I IM MP PA AC CT TS S A AN ND D D DE EV VI IC CE E P PE ER RF FO OR RM MA AN NC CE E E EX XP PE ER RI IM ME EN NT TA AL L E EV VA AL LU UA AT TI IO ON N O OF F I IN NS ST TA AL LL LE ED D C CO OO OK KI IN NG G E EX XH HA AU US ST T F FA AN N P PE ER RF FO OR RM MA AN NC CE E Brett C. Singer, William W. Delp and Michael G. Apte Indoor Environment Department Atmospheric Sciences Department Environmental Energy Technologies Division July 2011 (Revised February 2012) Disclaimer 1 This document was prepared as an account of work sponsored by the United States Government. While this document is believed to contain correct information, neither the United States Government nor any agency thereof, nor The Regents of the University of California, nor any of

32

DOE - Office of Legacy Management -- Reactor Site - Fort Belvoir - VA 0-02  

NLE Websites -- All DOE Office Websites (Extended Search)

Reactor Site - Fort Belvoir - VA Reactor Site - Fort Belvoir - VA 0-02 FUSRAP Considered Sites Site: REACTOR SITE - FORT BELVOIR (VA.0-02 ) Eliminated from further consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: None Location: Fort Belvoir , Virginia VA.0-02-1 Evaluation Year: 1987 VA.0-02-1 Site Operations: No evidence of AEC involvement with reactor operations. AEC conducted health and safety inspections of this site. Probably a licensed operation. VA.0-02-1 Site Disposition: Eliminated - Referred to DOD VA.0-02-1 Radioactive Materials Handled: Reactor fuel Primary Radioactive Materials Handled: Reactor Fuel Radiological Survey(s): Health and safety inspections VA.0-02-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to DOD VA.0-02-1

33

NC-1-B Wholesale Power Rate Schedule | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NC-1-B Wholesale Power Rate Schedule NC-1-B Wholesale Power Rate Schedule NC-1-B Wholesale Power Rate Schedule Area: Virginia Power/CP&L System: Kerr-Philpott This rate schedule shall be available to public bodies and cooperatives (any one of whom is hereinafter called the Customer) in Virginia and North Carolina to whom power may be transmitted pursuant to a contract between the Government and Virginia Electric and Power Company (hereinafter called the Virginia Power) and PJM Interconnection LLC (hereinafter called PJM), scheduled pursuant to a contract between the Government and Carolina Power & Light Company (hereinafter called CP&L), and billed pursuant to contracts between the Government and the Customer. This rate schedule shall be applicable to the sale at wholesale of power

34

DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility

35

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed

36

Chemical and Biomolecular Engineering at NC State University  

E-Print Network (OSTI)

for biological research and solar energy conversion. Chemical and Biomolecular Engineering at NC State #12.Biocatalysts(enzymes) are of vital importance in the production of transportation fuels from renewable resources. Bioethanol) and cellulosic biomass can be used as sources of sugars for fermentation to ethanol. Prof. Lamb's group is also

Velev, Orlin D.

37

VA-4-B Wholesale Power Rate Schedule | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

4-B Wholesale Power Rate Schedule 4-B Wholesale Power Rate Schedule VA-4-B Wholesale Power Rate Schedule Area: Virginia Power System: Kerr-Philpott This rate schedule shall be available to public bodies and cooperatives (any one of whom is hereinafter called the Customer) in Virginia and North Carolina served through the transmission facilities of Virginia Electric and Power Company (hereinafter called the Company) and PJM Interconnection LLC (hereinafter called PJM). This rate schedule shall be applicable to the sale at wholesale of power and accompanying energy generated at the John H. Kerr and Philpott Projects (hereinafter called the Projects) and sold under appropriate contracts between the Government and the Customer. Document Available for Download VA-4-B Rate Schedule More Documents & Publications

38

MI  

NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)

39

Precise global collision detection in multi-axis NC-machining  

Science Conference Proceedings (OSTI)

We introduce a new approach to the problem of collision detection in multi-axis NC-machining. Due to the directional nature (tool axis) of multi-axis NC-machining, space subdivision techniques are adopted from ray-tracing algorithms and are extended ... Keywords: 5-Axis machining, Collision detection and verification, Lower envelopes, NC-machining, Ray tracing, Space subdivision

Oleg Ilushin; Gershon Elber; Dan Halperin; Ron Wein; Myung-Soo Kim

2005-08-01T23:59:59.000Z

40

DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP

42

NC State Chemical Engineering Degrees -B and BS Graduation Name NicknamDgr Maj Grad Date H Hometown StateInitial Employer Employer City StateJob Title  

E-Print Network (OSTI)

-Employed Diggs NC Farmer Oliver Max Gardner OMax BS IC 5/27/1903 Shelby NC NC College of A&M Ar Raleigh NC Winborne White BS IC 5/27/1903 Greenville NC Raleigh Hosiery Mill Raleigh NC Dyer Edgar William Gaither BS/30/1906 Halifax NC U. Illinois Urbana IL Assistant William Graham Knox BS IC 5/30/1906 Charlotte NC Northampton

Velev, Orlin D.

43

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...

44

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...

45

Properties of the SU(Nc) Gluon Plasma  

E-Print Network (OSTI)

We investigate the deconfinement transition in SU(Nc) gauge theories, and properties of the deconfined phase. A detailed lattice study of SU(4) and SU(6) gauge theories are conducted, and finite volume and cutoff effects on thermodynamic observables are studied. The scaling of the deconfinement transition point with lattice spacing is used to calculate the scale, Lambda_MSbar. The continuum estimates of the thermodynamic quantities are used to study properties of the gluon plasma. In particular, the approach to conformal limit is studied. We do not find any evidence of a strongly coupled, conformal phase in these theories.

Saumen Datta; Sourendu Gupta

2009-10-15T23:59:59.000Z

46

ANVIL-5000 1. 1. 1 NC programming update  

SciTech Connect

ANVIL-5000 is used effectively by the staff in Sandia's Materials Process Engineering and Fabrication Directorate to develop training materials, solve mathematics problems, prepare documentation, and program machines. The computational graphics resources are reviewed, the techniques for training the craftworker staff to use ANVIL are described, and a variety of current ANVIL applications are documented. Complex ANVIL projects involving a propeller blade mold and a water cooled head are described to illustrate the utility of CAD/CAM techniques being used by the NC Engineering staff. 30 figs.

Plomp, P.W.

1987-01-01T23:59:59.000Z

47

VA-2-B Wholesale Power Rate Schedule | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2-B Wholesale Power Rate Schedule 2-B Wholesale Power Rate Schedule VA-2-B Wholesale Power Rate Schedule Area: Virginia Power System: Kerr-Philpott This rate schedule shall be available to public bodies and cooperatives (any one of whom is hereinafter called the Customer) in Virginia and North Carolina to whom power may be transmitted pursuant to contracts between the Government, Virginia Electric and Power Company (hereinafter called the Company), the Company's Transmission Operator, currently PJM Interconnection LLC (hereinafter called PJM), and the Customer. This rate schedule shall be applicable to the sale at wholesale of power and accompanying energy generated at the John H. Kerr and Philpott Projects and sold under appropriate contracts between the Government and the Customer. Document Available for Download

48

DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.

49

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either

50

Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...

51

DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical

52

DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated

53

MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab

2008-10-01T23:59:59.000Z

54

W.Va. Mom Sees Benefits of Weatherization | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

W.Va. Mom Sees Benefits of Weatherization W.Va. Mom Sees Benefits of Weatherization W.Va. Mom Sees Benefits of Weatherization April 2, 2010 - 2:43pm Addthis Joshua DeLung Not only is Rachael McCarty working full-time and going to college, but also she's a full-time single mom of two small children. After moving to Bluefield, W.Va., from California a few years ago, Rachel bought her first home, a property that needed some work. "It's a very, very old house, and it didn't really have any insulation," she says. Last year, Rachael was approved for the weatherization assistance program from Community Action of South Eastern West Virginia. The agency installed a new furnace and insulation, along with a new hot water heater and weather stripping for the doors. She says the house was much easier to heat this

55

If you reside in WASHINGTON, DC - MD -VA - WV your salary will...  

National Nuclear Security Administration (NNSA)

If you are employed in the WASHINGTON, DC Metropolitan Area (D.C., Baltimore, Northern VA, Eastern WV, and Southern PA) your salary will range from: Pay Band Pay Plan(s) Minimum...

56

Demonstration Project for a 300 kVA Dynamic Sag Corrector  

Science Conference Proceedings (OSTI)

The dynamic sag corrector (DySC) represents a relatively new technology for mitigating voltage sags in a cost-effective manner. The device -- which comes in sizes ranging from 1 kVA to 2 MVA -- can provide ride-through during voltage sags to 50 percent of nominal voltage for up to 12 cycles with no energy storage. This report documents the installation, testing, and performance of a 300-kVA ProDySC, with optional energy storage capacitors.

2001-10-23T23:59:59.000Z

57

Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)

2012-01-01T23:59:59.000Z

58

DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP

59

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state

60

Quark-Hadron Duality for Hybrid Mesons at Large-Nc  

E-Print Network (OSTI)

We investigate implications of quark-hadron duality for hybrid mesons in the large-Nc limit. A simple formalism is developed which implements duality for QCD two-point functions of currents of quark bilinears, with any number of gluons. We argue that the large-Nc meson masses share a common parameter, which is related to the QCD string tension. This parameter is fixed from correlators of conserved vector and axial-vector currents, and using lattice QCD determinations of the string tension. Our results predict towers of hybrid mesons which, within expected 1/Nc corrections, naturally accommodate the 1^(-+) experimental hybrid candidates.

S. R. Beane

2001-08-02T23:59:59.000Z

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio

2010-02-01T23:59:59.000Z

62

Toxicity of aqueous fullerene nC60 to activated sludge: nitrification inhibition and microtox test  

Science Conference Proceedings (OSTI)

The increasing production and use of fullerene nanomaterials raised their exposure potential to the activated sludge during biological wastewater treatment process. In this study, the toxicity of aqueous nanoscaled C60 (nC60) to ...

Yongkui Yang; Norihide Nakada; Ryoji Nakajima; Chao Wang; Hiroaki Tanaka

2012-01-01T23:59:59.000Z

63

pi N to Multi-pi N Scattering in the 1/N_c Expansion  

E-Print Network (OSTI)

We extend the 1/N_c meson-baryon scattering formalism to pi N to multi-pi N case. We first show that the leading-order large N_c processes proceed through resonant intermediate states (e.g., rho N or pi Delta). We find that the pole structure of baryon resonances can be uniquely identified by their (non)appearance in eta N or mixed partial-wave pi Delta final states.

Herry J. Kwee

2007-06-29T23:59:59.000Z

64

Pion Electroproduction Amplitude Relations in the 1/N_c Expansion  

E-Print Network (OSTI)

We derive expressions for pion electroproduction amplitudes in the 1/N_c expansion of QCD, and obtain from them linear relations between the electromagnetic multipole amplitudes that hold at all energies. The leading-order relations in 1/N_c compare favorably with available data (especially away from resonances), but the next-to-leading-order relations tend to provide only small or no improvement.

Lebed, Richard F

2009-01-01T23:59:59.000Z

65

HEAVY BARYONS: A COMBINED LARGE Nc AND HEAVY QUARK EXPANSION FOR ELECTROWEAK CURRENTS  

E-Print Network (OSTI)

The combined large Nc and heavy quark limit for baryons containing a single heavy quark is discussed. The combined large Nc and heavy quark expansion of the heavy quark bilinear operators is obtained. In the combined expansion the corrections proportional to mN/mQ are summed to all orders. In particular, the combined expansion can be used to determine semileptonic form factors of heavy baryons in the combined limit. 1

Boris A. Gelman

2002-01-01T23:59:59.000Z

66

Large $N_c$ QCD at non-zero chemical potential  

E-Print Network (OSTI)

The general issue of large $N_c$ QCD at nonzero chemical potential is considered with a focus on understanding the difference between large $N_c$ QCD with an isospin chemical potential and large $N_c$ QCD with a baryon chemical potential. A simple diagrammatic analysis analogous to `t Hooft's analysis at $\\mu=0$ implies that the free energy with a given baryon chemical potential is equal to the free energy with an isospin chemical potential of the same value plus $1/N_c$ corrections. Phenomenologically, these two systems behave quite differently. A scenario to explain this difference in light of the diagrammatic analysis is explored. This scenario is based on a phase transition associated with pion condensation when the isospin chemical potential exceeds $m_\\pi/2$; associated with this transition there is breakdown of the $1/N_c$ expansion--in the pion condensed phase there is a distinct $1/N_c$ expansion including a larger set of diagrams. While this scenario is natural, there are a number of theoretical issues which at least superficially challenge it. Most of these can be accommodated. However, the behavior of quenched QCD which raises a number of apparently analogous issues cannot be easily understood completely in terms of an analogous scenario. Thus, the overall issue remains open.

Thomas D. Cohen

2004-10-11T23:59:59.000Z

67

Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png

68

Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls

69

February 2006, NRAO, VA (or why H0 is the Dark Energy)  

E-Print Network (OSTI)

Wayne Hu February 2006, NRAO, VA (or why H0 is the Dark Energy) Dark Energy in Light of the CMB #12;If its not dark, it doesn't matter! · Cosmic matter-energy budget: Dark Energy Dark Matter Dark provide the high redshift cornerstone to cosmological inferences on the dark matter and dark energy WMAP

Hu, Wayne

70

Digital pioneers: computer-generated art from the v&a's collections  

Science Conference Proceedings (OSTI)

The Victoria and Albert's acquisition of major computer art collections is part of an ongoing project to document and preserve the history of this field. The V&A's pioneering work in this area is connected to the Computer Art and Technocultures project, ...

Douglas Dodds

2010-02-01T23:59:59.000Z

71

,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

72

,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

73

N.C. Agency Growing, Helping Citizens Save Money | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

N.C. Agency Growing, Helping Citizens Save Money N.C. Agency Growing, Helping Citizens Save Money N.C. Agency Growing, Helping Citizens Save Money March 12, 2010 - 5:20pm Addthis Reginald Speight, CEO of Martin County Community Action | Photo courtesy of Martin County Community Action Reginald Speight, CEO of Martin County Community Action | Photo courtesy of Martin County Community Action Joshua DeLung North Carolina will receive $132 million, or 10 times more money than in years past, for its weatherization program through the Recovery Act. Martin County Community Action is tasked with weatherizing about 1,029 units with its $7.7 million share. The agency has also surpassed its 123 units from its usual fiscal year funding. "It's been interesting ramping up like this, but we've put our agency in a position the last couple of years to be able to do more creative

74

North Carolina School of Science and Mathematics from Durham, NC and  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

North Carolina School of Science and Mathematics from Durham, NC North Carolina School of Science and Mathematics from Durham, NC and Albuquerque Academy from Albuquerque, NM Win the U.S. Department of Energy National Science Bowl North Carolina School of Science and Mathematics from Durham, NC and Albuquerque Academy from Albuquerque, NM Win the U.S. Department of Energy National Science Bowl May 3, 2010 - 12:00am Addthis WASHINGTON, D.C. - A high school team from Durham and a middle school team from Albuquerque won the 2010 U.S. Department of Energy (DOE) National Science Bowl today at the National Building Museum in Washington. North Carolina School of Science and Mathematics beat Mira Loma High School from Sacramento CA in the high school national championship match by correctly answering a chemistry question. Albuquerque Academy beat Gale

75

N.C. Agency Growing, Helping Citizens Save Money | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

N.C. Agency Growing, Helping Citizens Save Money N.C. Agency Growing, Helping Citizens Save Money N.C. Agency Growing, Helping Citizens Save Money March 12, 2010 - 5:20pm Addthis Reginald Speight, CEO of Martin County Community Action | Photo courtesy of Martin County Community Action Reginald Speight, CEO of Martin County Community Action | Photo courtesy of Martin County Community Action Joshua DeLung North Carolina will receive $132 million, or 10 times more money than in years past, for its weatherization program through the Recovery Act. Martin County Community Action is tasked with weatherizing about 1,029 units with its $7.7 million share. The agency has also surpassed its 123 units from its usual fiscal year funding. "It's been interesting ramping up like this, but we've put our agency in a position the last couple of years to be able to do more creative

76

DOE Spent Nuclear Fuel Information In Support of TSPA-VA  

SciTech Connect

RW has started the viability assessment (VA) effort to determine the feasibility of Yucca Mountain as the first geologic repository for spent nuclear fuel (SNF) and high-level waste. One component of the viability assessment will be a total system performance assessment (TSPA), based on the design concept and the scientific data and analysis available, describing the repository's probable behavior relative to the overall system performance standards. Thus, all the data collected from the Exploratory Studies Facility to-date have been incorporated into the latest TSPA model. In addition, the Repository Integration Program, an integrated probabilistic simulator, used in the TSPA has also been updated by Golder Associates Incorporated at December 1997. To ensure that the Department of Energy-owned (DOE-owned) SNF continues to be acceptable for disposal in the repository, it will be included in the TSPA-VA evaluation. A number of parameters are needed in the TSPA-VA models to predict the performance of the DOE-owned SNF materials placed into the potential repository. This report documents all of the basis and/or derivation for each of these parameters. A number of properties were not readily available at the time the TSPA-VA data was requested. Thus, expert judgement and opinion was utilized to determine a best property value. The performance of the DOE-owned SNF will be published as part of the TSPA-VA report. Each DOE site will be collecting better data as the DOE SNF program moves closer to repository license application. As required by the RW-0333P, the National Spent Nuclear Fuel Program will be assisting each site in qualifying the information used to support the performance assessment evaluations.

A. Brewer; D. Cresap; D. Fillmore; H. Loo; M. Ebner; R. McCormack

1998-09-01T23:59:59.000Z

77

Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.

78

Magneto-intersubband oscillations in triple quantum wells S. Wiedmann a,, N.C. Mamani b  

E-Print Network (OSTI)

Magneto-intersubband oscillations in triple quantum wells S. Wiedmann a,?, N.C. Mamani b , G online 24 November 2009 Keywords: Triple quantum well Magneto-intersubband oscillations a b s t r a c t We present magnetotransport studies of high-density triple quantum well samples with different

Gusev, Guennady

79

American Solar Energy Society Proc. ASES Annual Conference, Raleigh, NC, EVALUATION OF NUMERICAL WEATHER PREDICTION  

E-Print Network (OSTI)

OF NUMERICAL WEATHER PREDICTION SOLAR IRRADIANCE FORECASTS IN THE US Richard Perez ASRC, Albany, NY, Perez to solar radiation forecasting include (1) numerical weather prediction (NWP) models that infer local cloud© American Solar Energy Society ­ Proc. ASES Annual Conference, Raleigh, NC, EVALUATION

Perez, Richard R.

80

File:EIA-Appalach6-WV-VA-GAS.pdf | Open Energy Information  

Open Energy Info (EERE)

Appalach6-WV-VA-GAS.pdf Appalach6-WV-VA-GAS.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 Gas Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 18.09 MB, MIME type: application/pdf) Description Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 Gas Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States West Virginia, Virginia File history Click on a date/time to view the file as it appeared at that time.

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

File:USDA-CE-Production-GIFmaps-VA.pdf | Open Energy Information  

Open Energy Info (EERE)

VA.pdf VA.pdf Jump to: navigation, search File File history File usage Virginia Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 380 KB, MIME type: application/pdf) Description Virginia Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Virginia External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:22, 27 December 2010 Thumbnail for version as of 16:22, 27 December 2010 1,650 × 1,275 (380 KB) MapBot (Talk | contribs) Automated bot upload

82

Case Study - The Department of Veterans Affairs West Haven Campus, VA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

The Department of Veterans Affairs West Haven Campus, The Department of Veterans Affairs West Haven Campus, VA Connecticut Health Care System Case Study - The Department of Veterans Affairs West Haven Campus, VA Connecticut Health Care System October 7, 2013 - 1:59pm Addthis Overview The West Haven (Connecticut) Campus of the Veterans Affairs Connecticut Health Care System was the first Veteran's Hospital to award a shared energy savings (SES) contract (now known as energy savings performance contracts). The project involves replacement of the lighting system, installation of a cooling system, maintenance of the new chiller equipment, and several smaller efforts. Up-front costs are being provided through a $3.9 million investment by the contractor, EUA Cogenex, about $400,000 in rebates from the local utilities for gas and electric service (Southern

83

File:EIA-Appalach6-WV-VA-BOE.pdf | Open Energy Information  

Open Energy Info (EERE)

Appalach6-WV-VA-BOE.pdf Appalach6-WV-VA-BOE.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 BOE Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 17.02 MB, MIME type: application/pdf) Description Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 BOE Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States West Virginia, Virginia File history Click on a date/time to view the file as it appeared at that time.

84

Naval Station Norfolk, VA- Energy Conservation Program UESC Partnership Success Story  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Station Norfolk, VA Station Norfolk, VA Energy Conservation Program UESC Partnership Success Story 20 November 2008 2 Agenda Background Basis for Success Phase I Phase I Mod 01 Phase II Other / Future Program Aspects Why the Partnership Works 3 Background Minimal structured plan for NS Norfolk prior to 2006 Other MidLant Installations had aggressive ESPC programs in place The largest US Navy Installation in the World had only scratched the surface on all the opportunities for energy conservation Decision made to establish long term UESC partnership / program with VNG 4 NS Norfolk Basis for Success Focus on long term partnership with Utility to meet infrastructure needs and energy goals Gear project efforts to support core Mission of NS Norfolk Long term benefits more important than strict

85

KENO3D Visualization Tool for KENO V.a and KENO-VI Geometry Models  

SciTech Connect

Criticality safety analyses often require detailed modeling of complex geometries. Effective visualization tools can enhance checking the accuracy of these models. This report describes the KENO3D visualization tool developed at the Oak Ridge National Laboratory (ORNL) to provide visualization of KENO V.a and KENO-VI criticality safety models. The development of KENO3D is part of the current efforts to enhance the SCALE (Standardized Computer Analyses for Licensing Evaluations) computer software system.

Horwedel, J.E.; Bowman, S.M.

2000-06-01T23:59:59.000Z

86

U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2012 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT...

87

C:\\ANNUAL\\VENTCHAP.V8\\NGA.VP  

Gasoline and Diesel Fuel Update (EIA)

4 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99...

88

Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...

89

C:\\ANNUAL\\VENTCHAP.V8\\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...

90

C:\\ANNUAL\\VENTCHAP.V8\\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

0 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy...

91

NGA98fin5.vp  

Annual Energy Outlook 2012 (EIA)

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99...

92

U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)

3 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE...

93

File:USDA-CE-Production-GIFmaps-NC.pdf | Open Energy Information  

Open Energy Info (EERE)

NC.pdf NC.pdf Jump to: navigation, search File File history File usage North Carolina Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 355 KB, MIME type: application/pdf) Description North Carolina Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States North Carolina External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:17, 27 December 2010 Thumbnail for version as of 16:17, 27 December 2010 1,650 × 1,275 (355 KB) MapBot (Talk | contribs) Automated bot upload

94

The QCD Phase Diagram: Large Nc, Quarkyonic Matter and the Triple Point  

SciTech Connect

I discuss the phase diagram of QCD in the large N_c limit. Quarkyonic Matter is described. The properties of QCD matter as measured in the abundance of produced particles are shown to be consistent with this phase diagram. A possible triple point of Hadronic Mater, Deconfined Matter and Quarkyonic matter is shown to explain various behaviors of ratios of particles abundances seen in CERN fixed target experiments.

McLerran L.

2010-01-31T23:59:59.000Z

95

Large-Nc estimate of the chiral low-energy constants  

E-Print Network (OSTI)

Chiral low-energy constants incorporate short-distance information from the dynamics involving heavier degrees of freedom not present in the chiral Lagrangian. We have studied the contribution of the lightest resonances to the chiral low-energy constants, up to O(p^6), within a systematic procedure guided by the large-Nc limit of QCD and also including short-distance asymptotic constraints.

J. Portoles

2007-02-18T23:59:59.000Z

96

Test Map and Discreteness Criteria for Subgroups in PU(1,n;C)  

E-Print Network (OSTI)

We study the discreteness for non-elementary subgroup G in PU(1, n;C), under the assumption that G satisfies Condition A. Mainly, we present that one can use a test map, which need not to be in G, to examine the discreteness of G, and also show that G is discrete, if every two-loxodromic-generator subgroup of G is discrete.

Li, ChangJun

2011-01-01T23:59:59.000Z

97

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:

98

The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.

2005-05-01T23:59:59.000Z

99

DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;

100

DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co

102

Testing and Development of a 30-kVA Hybrid Inverter: Lessons Learned and Reliability Implications  

SciTech Connect

A 30-kVA Trace Technologies hybrid power processor was specified and tested at the Sandia inverter test facility. Trace Technologies involving the control system, in response to suggestions made modifications, primarily by Sandia and Arizona Public Service (APS) personnel. The modifications should make the inverter more universally applicable and less site-specific so that it can be applied in various sites with minimal field interaction required from the design engineer. The project emphasized the importance of battery management, generator selection, and site load management to the performance and reliability of hybrid power systems.

Ginn, J.W.

1998-12-21T23:59:59.000Z

103

Poplar breeding and testing strategies in the NC US: Demonstration of potential yield and consideration of future research needs.  

SciTech Connect

The objective of this project was to extend previous poplar breeding and selection in the NC US by implementing a regional testing system with multiple test locations in Minnesota, Iowa, Wisconsin and Michigan.

Riemenschneider, Don; Berguson, William E; Dickmann, Don; Hall, Richard

2004-06-30T23:59:59.000Z

104

The nuclear liquid-gas phase transition at large $N_c$ in the Van der Waals approximation  

E-Print Network (OSTI)

We examine the nuclear liquid-gas phase transition at large number of colors ($N_c$) within the framework of the Van Der Waals (VdW) model. We argue that the VdW equation is appropriate at describing inter-nucleon forces, and discuss how each parameter scales with $N_c$. We demonstrate that $N_c=3$ (our world) is not large with respect to the other dimensionless scale relevant to baryonic matter, the number of neighbors in a dense system $N_N$. Consequently, we show that the liquid-gas phase transition looks dramatically different at $N_c \\to \\infty$ with respect of our world: The critical point temperature becomes of the order of $\\lqcd$ rather than below it. The critical point density becomes of the order of the baryonic density, rather than an order of magnitude below it. These are precisely the characteristics usually associated with the "Quarkyonic phase". We therefore conjecture that quarkyonic matter is simply the large $N_c$ limit of the nuclear liquid, and the interplay between $N_c$ and $N_N$ is the reason why the nuclear liquid in our world is so different from quarkyonic matter. We conclude by suggesting ways our conjecture can be tested in future lattice measurements.

Giorgio Torrieri; Igor Mishustin

2010-06-12T23:59:59.000Z

105

¿A dónde se va la energía?  

NLE Websites -- All DOE Office Websites (Extended Search)

¿A dónde se va la energía? ¿A dónde se va la energía? Sólo aproximadamente el 14% -26% de la energía del combustible que usted pone en su tanque se usa para mover su coche o operar accesorios útiles, como el aire acondicionado. El resto de la energía es perdida en ineficiencias del motor, de la líínea de conducción y al estar a ralentí. Por lo tanto, el potencial para mejorar la eficiencia del combustible con tecnologías avanzadas es enorme. Combinadas Ciudad Carretera Conducir en Ciudad Los requerimientos de energía mostrados en el diagrama se calcularon conduciendo por la ciudad en el modo para-avanzar usando el procedimiento de la EPA FTP-75 Test. Perdidas de Motor En vehículos propulsados por gasolina, gran parte de la energía del combustible se pierde en el motor, primordialmente al calentarse. Pequeñas

106

Enhanced T-lymphocyte blastogenic response to tuberculin (PPD) in children of northeast (NE) Thailand supplemented with vitamin A (VA) and zinc (Zn)  

SciTech Connect

Beneficial effects of Va and/or Zn supplementation of children in NE Thailand are described in a companion abstract. In the same study, blastogenic response (BR) of T-lymphocytes to concanavalin-A (ConA) and PPD were assayed in cultures containing mononuclear cells (MNC) or whole blood (WB). Methods were previously described. Children were previously vaccinated with BCG. BR to ConA of MNC or WB from children supplemented with VA, Zn, VA + Zn or placebo were similar. BR to PPD of MNC was higher in children receiving VA + Zn than placebo, but not in children supplemented with VA or Zn alone. Data indicate that children with suboptimal VA and Zn nutriture supplemented with < 2 times RDA of these nutrients showed enhanced cellular immunity to PPD. This observation is relevant to BCG immunization program and thus may benefit public health.

Kramer, T.R.; Udomkesmalee, E.; Dhanamitta, S.; Sirisinha, S.; Charoenkiatkul, S.; Tantipopipat, S.; Banjong, O.; Rojroongwasinkul, N.; Smith, J.C. Jr. (Dept. of Agriculture, Beltsville, MD (United States) Mahidol Univ., Nakhon Pathom (Thailand))

1991-03-15T23:59:59.000Z

107

DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on

108

DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:

109

MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units

110

REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

111

Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper

2012-02-20T23:59:59.000Z

112

Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-10-01T23:59:59.000Z

113

Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel

2010-01-01T23:59:59.000Z

114

MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-12-01T23:59:59.000Z

115

Real Time Simulation and Visualization of NC Milling Processes for Inhomogeneous Materials on Low-End Graphics Hardware  

E-Print Network (OSTI)

Simulation and visualization of NC milling processes has become an important step in computer aided manufacturing. The usage of stock materials with specific locally varying properties (like density, accuracy, color,. . . ) becomes more and more important with new technologies emerging in the material industry. Our new approach, using volumetric representation, has been adapted to this needs and copes with inhomogeneous material properties. Taking color as one possible material property, our approach enables the visualization of milled wood or compound materials. Furthermore, our approach has been developed with the usage of low-end graphics hardware in mind. The algorithms have been optimized to ensure interactive update rates even on standard personal computers without hardware graphics acceleration. Keywords: NC milling simulation, dexel approach, inhomogeneous material properties 1. Introduction NC milling simulation using computer graphics techniques was proposed some years ag...

Andreas Holger Knig; Eduard Grller

1998-01-01T23:59:59.000Z

116

Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)

2011-12-01T23:59:59.000Z

117

A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)

2012-07-15T23:59:59.000Z

118

Resonance Spin Flavour Precession of Solar Neutrinos After SNO NC Data  

E-Print Network (OSTI)

We present an analysis of the solar neutrino data assuming the deficit of solar neutrinos to be originated from the interaction of their transition magnetic moments with the solar magnetic field. We perform fits to the rates only and global fits and consider separately the existing data prior to the announcement of the SNO NC results, and present data. Predictions for the Borexino experiment are also derived. The solar field profiles are taken both in the radiation zone and core of the sun, and in the convective zone. The latter are chosen so as to exhibit a rapid increase across the bottom of the convective zone and a moderate decrease towards the surface. Regarding the field profiles in the radiative zone and core, it is found that the data show a preference for those cases in which a strong field rests at the solar centre with a steep decrease thereafter. For these, the quality of the global fits is as good as the one from the best oscillation solutions and the same as for the convective zone profiles examined. It is also found that the $\\chi^2$ of the fits increases when the most recent data are considered, owing to the smaller errors involved. This in turn provides more precise predictions for Borexino than previous ones, thus resulting in a clearer possible distinction between magnetic moment and the currently favoured oscillation solutions.

Bhag C. Chauhan; Joao Pulido

2002-06-20T23:59:59.000Z

119

Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.

1997-10-01T23:59:59.000Z

120

Superscaling in electron-nucleus scattering and its link to CC and NC QE neutrino-nucleus scattering  

E-Print Network (OSTI)

The superscaling approach (SuSA) to neutrino-nucleus scattering, based on the assumed universality of the scaling function for electromagnetic and weak interactions, is reviewed. The predictions of the SuSA model for bot CC and NC differential and total cross sections are presented and compared with the MiniBooNE data. The role of scaling violations, in particular the contribution of meson exchange currents in the two-particle two-hole sector, is explored.

M. B. Barbaro; J. E. Amaro; J. A. Caballero; T. W. Donnelly; R. Gonzalez-Jimenez; M. Ivanov; J. M. Udias

2013-03-26T23:59:59.000Z

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

The theta^+ baryon in soliton models: large Nc QCD and the validity of rigid-rotor quantization  

E-Print Network (OSTI)

A light collective theta+ baryon state (with strangeness +1) was predicted via rigid-rotor collective quantization of SU(3) chiral soliton models. This paper explores the validity of this treatment. A number of rather general analyses suggest that predictions of exotic baryon properties based on this approximation do not follow from large Nc QCD. These include an analysis of the baryon's width, a comparison of the predictions with general large Nc consistency conditions of the Gervais-Sakita-Dashen-Manohar type; an application of the technique to QCD in the limit where the quarks are heavy; a comparison of this method with the vibration approach of Callan and Klebanov; and the 1/Nc scaling of the excitation energy. It is suggested that the origin of the problem lies in an implicit assumption in the that the collective motion is orthogonal to vibrational motion. While true for non-exotic motion, the Wess-Zumino term induces mixing at leading order between collective and vibrational motion with exotic quantum numbers. This suggests that successful phenomenological predictions of theta+ properties based on rigid-rotor quantization were accidental.

Thomas D. Cohen

2003-12-15T23:59:59.000Z

122

Radiological environs study at a fuel fabrication facility. [General Electric Fuel Fabrication Plant at Wilmington, NC  

SciTech Connect

Field studies were conducted to detect environmental contamination from fuel fabrication plant effluents. The plant chosen for study was operated by the General Electric Company, Nuclear Fuel Division, at Wilmington, NC. The facility operates continuously using the ammonium diuranate (ADU) process to convert 2.0 to 2.2% enriched UF/sub 6/ to UO/sub 2/ fuel. Continuous air samplers at five sites measured the concentrations of /sup 234/U and /sup 238/U in air for 36 one-week intervals. River water was sampled at nine locations above and below the plant discharge point during each of three field surveys. The atmospheric concentrations of /sup 234/U and /sup 238/U appeared to vary according to a log-normal distribution. The annual facility release of approximately 2 to 3 mCi uranium to the atmosphere would add from 0.01 to 0.2 fCi/m/sup 3/ uranium in the atmospheric environs. An individual residing continuously at the nearest residence is predicted to receive a 50-year dose commitment of 0.9 mrem to the lung. The approximately 1 Ci/y of uranium liquid effluent released would increase the uranium concentration in Northeast Cape Fear estuary about 3 kilometers downstream by 0.3 pCi/liter. Although this water is not potable and is not used for any potable water supply, ingestion of water containing uranium at this concentration for a year would deliver a 3-mrem dose commitment to the bone.

Lyon, R.J.; Shearin, R.L.; Broadway, J.A.

1978-10-01T23:59:59.000Z

123

OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown

2013-10-01T23:59:59.000Z

124

In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma

2013-06-01T23:59:59.000Z

125

NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk

126

Microsoft Word - figure_8.doc  

Gasoline and Diesel Fuel Update (EIA)

T I D O R W Y ND SD C A N V U T CO NE KS A Z NM OK TX MN WI MI IA I L IN OH MO AR M S AL GA T N KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI A K J a p a n Mexico M e x...

127

Validation of KENO V.a for highly enriched uranium systems with hydrogen and/or carbon moderation  

SciTech Connect

This paper describes the validation in accordance with ANSI/ANS-8.1-1983(R1988) of KENO V.a using the 27-group ENDF/B-IV cross-section library for systems containing highly-enriched uranium, carbon, and hydrogen and for systems containing highly-enriched uranium and carbon with high carbon to uranium (C/U) atomic ratios. The validation has been performed for two separate computational platforms: an IBM 3090 mainframe and an HP 9000 Model 730 workstation, both using the Oak Ridge Y-12 Plant Nuclear Criticality Safety Software (NCSS) code package. Critical experiments performed at the Oak Ridge Critical Experiments Facility, in support of the Rover reactor program, and at the Pajarito site at Los Alamos National Laboratory were identified as having the constituents desired for this validation as well as sufficient experimental detail to allow accurate construction of KENO V.a calculational models. Calculated values of k{sub eff} for the Rover experiments, which contain uranium, carbon, and hydrogen, are between 1.0012 {+-} 0.0026 and 1.0245 {+-} 0.0023. Calculation of the Los Alamos experiments, which contain uranium and carbon at high C/U ratios, yields values of k{sub eff} between 0.9746 {+-} 0.0028 and 0.9983 {+-} 0.0027. Safety criteria can be established using this data for both types of systems.

Elliott, E.P.; Vornehm, R.G. [Oak Ridge Y-12 Plant, TN (United States); Dodds, H.L. Jr. [Univ. of Tennessee, Knoxville, TN (United States). Nuclear Engineering Dept.

1993-06-04T23:59:59.000Z

128

Baryons and Low-Density Baryonic Matter in 1+1 Dimensional Large N_c QCD with Heavy Quarks  

E-Print Network (OSTI)

This paper studies baryons and baryonic matter in the combined large N_c and heavy quark mass limits of QCD in 1+1 dimension. In this non-relativistic limit, baryons are composed of N_c quarks that interact, at leading order in N_c, through a color Coulomb potential. Using variational techniques, very accurate calculations of single baryon masses and interaction energies of low-density baryon crystal are performed. These results are used to cross-check a general numerical approach applicable for arbitrary quark masses and baryon densities recently proposed by Bringoltz, which is based on a lattice in a finite box with periodic boundary conditions. The Bringoltz method differs from a previous approach of Salcedo, et al. in its treatment of a finite box effect - namely gauge configurations that wind around the box. One might expect these effects to be small for large enough boxes, in which the baryon density approaches zero to high accuracy at the edges. However, the effects of these windings appear to be quite large even in such boxes. The large mass infinite volume calculations performed here are consistent with the results of numerical calculations using the Bringoltz method. The calculation of the baryon crystal interaction energy requires the assumption that at low-densities the ground state is composed of individual baryons, each in a color-singlet state and orthogonal to each other. This assumption is plausible but ad hoc in that one can construct configurations in which the entire state is color-singlet but cannot be broken into individual color-singlet baryons. The interaction energy of low-density baryon crystals calculated with the assumption is consistent with numerical results based on Bringoltz's approach suggesting that the assumption is justified. This further supports a similar assumption that was made in 3+1 dimensions, where no alternative means of calculation exist.

Prabal Adhikari; Thomas D. Cohen; Arec Jamgochian; Nilay Kumar

2012-12-10T23:59:59.000Z

129

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA

130

miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay

131

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....

132

A High-Energy High-Luminosity p+-p* Collider David V. Neuffer, CEBAF', 12000 Jefferson Avenue, Newport News VA 23692  

E-Print Network (OSTI)

A High-Energy High-Luminosity p+-p* Collider David V. Neuffer, CEBAF', 12000 Jefferson Avenue be costly and does not use our ability to recirculate p's. A recirculating linac (RLA) like CEBAF" can and M. S. Zolotorev, Phys. Rev. Lett.71, 4146 (1993). 11. CEBAF Design Report, CEBAF, Newport News VA

McDonald, Kirk

133

U.S. Department of Energy Hydrogen and Fuel Cells Program 2012 Annual Merit Review and Peer Evaluation Report: May 14-18, 2012, Arlington, VA  

DOE Green Energy (OSTI)

This document summarizes the comments provided by peer reviewers on hydrogen and fuel cell projects presented at the fiscal year (FY) 2012 U.S. Department of Energy (DOE) Hydrogen and Fuel Cells Program and Vehicle Technologies Program Annual Merit Review and Peer Evaluation Meeting (AMR), held May 14-18, 2012, in Arlington, VA.

Not Available

2012-09-01T23:59:59.000Z

134

Measurement of airborne fission products in Chapel Hill, NC, USA from the Fukushima Dai-ichi reactor accident  

E-Print Network (OSTI)

We present measurements of airborne fission products in Chapel Hill, NC, USA, from 62 days following the March 11, 2011, accident at the Fukushima Dai-ichi nuclear power plant. Airborne particle samples were collected daily in air filters and radio-assayed with two high-purity germanium (HPGe) detectors. The fission products I-131 and Cs-137 were measured with maximum activities of 4.2 +/- 0.6 mBq/m^3 and 0.42 +/- 0.07 mBq/m^3 respectively. Additional activity from I-131, I-132, Cs-134, Cs-136, Cs-137 and Te-132 were measured in the same air filters using a low-background HPGe detector at the Kimballton Underground Research Facility (KURF).

S. MacMullin; G. K. Giovanetti; M. P. Green; R. Henning; R. Holmes; K. Vorren; J. F. Wilkerson

2011-11-17T23:59:59.000Z

135

Measurement of Airborne Fission Products in Chapel Hill, NC, USA from the Kukushima Dai-ichi Reactor Accident  

SciTech Connect

We present measurement results of airborne fission products in Chapel Hill, NC, USA, from 62 d following the March 11, 2011, accident at the Fukushima Dai-ichi nuclear power plant. Airborne particle samples were collected daily in air filters and radio-assayed with two high-purity germanium (HPGe) detectors. The fission products 131I and 137Cs were measured with maximum activity concentrations of 4.2 0.6 mBq/m3 and 0.42 0.07 mBq/m3 respectively. Additional activity from 131,132I, 134,136,137Cs and 132Te were measured in the same air filters using a low-background HPGe detector at the Kimballton Underground Research Facility (KURF).

MacMullin, S. [Univ, of North Carolina & Triangle Universities Nucl. Lab - Durham, NC; Giovanetti, G. K. [Univ, of North Carolina & Triangle Universities Nucl. Lab - Durham, NC; Green, M. P. [Univ, of North Carolina & Triangle Universities Nucl. Lab - Durham, NC; Henning, R. [Univ, of North Carolina & Triangle Universities Nucl. Lab - Durham, NC; Holmes, R. [Univ. North Carolina-Chapel & Univ. of Illinois-Urbana; Vorren, K. [University of North Carolina / Triangle Universities Nuclear Lababoratory, Durham; Wilkerson, J. F. [UNC/Triangle Univ. Nucl. Lab, Durham, NC/ORNL

2012-01-01T23:59:59.000Z

136

Neutrino--deuterium reactions in the 7-foot bubble chamber. [Strangeness, CVC theory, V-A theory  

DOE Green Energy (OSTI)

Recent results are reported from the analysis of 569,000 ..nu.. pictures taken in the BNL 7-ft bubble chamber filled with D/sub 2/ (and an additional 204,000 pictures in H/sub 2/). The statistics of current analysis include 648 quasielastic ..nu../sub ..mu../ d ..-->.. ..mu../sup -/pp/sub s/ events and 25 events with visible strangeness present. Using the quasielastic events in the framework of the conventional V-A theory, the values M/sub V/ = 0.87 +- 0.09 GeV and M/sub A/ = 1.03 +- 0.19 GeV are found. The value is in good agreement with the CVC prediction of M/sub V/ = 0.84 GeV. With the fixed value of M/sub V/ = 0.84 GeV, a one-parameter fit yields M/sub A/ = 1.08 +- 0.08 GeV. Also 8 events are found in the exclusive channel ..nu..n ..-->.. ..mu../sup -/K/sup +/..lambda.. in agreement with a theoretical calculation using the generalized Born approximation. 30 references.

Cnops, A M; Connolly, P L; Kahn, S A; Kirk, H G; Murtagh, M J; Palmer, R B; Samios, N P; Tanaka, M

1978-01-01T23:59:59.000Z

137

Evolutionary Significance of an Algal Gene Encoding an [FeFe]-Hydrogenase with F-Domain Homology and Hydrogenase Activity in Chlorella Variabilis NC64A  

SciTech Connect

[FeFe]-hydrogenases (HYDA) link the production of molecular H{sub 2} to anaerobic metabolism in many green algae. Similar to Chlamydomonas reinhardtii, Chlorella variabilis NC64A (Trebouxiophyceae, Chlorophyta) exhibits [FeFe]-hydrogenase (HYDA) activity during anoxia. In contrast to C. reinhardtii and other chlorophycean algae, which contain hydrogenases with only the HYDA active site (H-cluster), C. variabilis NC64A is the only known green alga containing HYDA genes encoding accessory FeS cluster-binding domains (F-cluster). cDNA sequencing confirmed the presence of F-cluster HYDA1 mRNA transcripts, and identified deviations from the in silico splicing models. We show that HYDA activity in C. variabilis NC64A is coupled to anoxic photosynthetic electron transport (PSII linked, as well as PSII-independent) and dark fermentation. We also show that the in vivo H{sub 2}-photoproduction activity observed is as O2 sensitive as in C. reinhardtii. The two C. variabilis NC64A HYDA sequences are similar to homologs found in more deeply branching bacteria (Thermotogales), diatoms, and heterotrophic flagellates, suggesting that an F-cluster HYDA is the ancestral enzyme in algae. Phylogenetic analysis indicates that the algal HYDA H-cluster domains are monophyletic, suggesting that they share a common origin, and evolved from a single ancestral F-cluster HYDA. Furthermore, phylogenetic reconstruction indicates that the multiple algal HYDA paralogs are the result of gene duplication events that occurred independently within each algal lineage. Collectively, comparative genomic, physiological, and phylogenetic analyses of the C. variabilis NC64A hydrogenase has provided new insights into the molecular evolution and diversity of algal [FeFe]-hydrogenases.

Meuser, J. E.; Boyd, E. S.; Ananyev, G.; Karns, D.; Radakovits, R.; Murthy, U. M. N.; Ghirardi, M. L.; Dismukes, G. C.; Peters, J. W.; Posewitz, M. C.

2011-10-01T23:59:59.000Z

138

miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li

2009-01-01T23:59:59.000Z

139

Advanced Battery Manufacturing (VA)  

SciTech Connect

LiFeBATT has concentrated its recent testing and evaluation on the safety of its batteries. There appears to be a good margin of safety with respect to overheating of the cells and the cases being utilized for the batteries are specifically designed to dissipate any heat built up during charging. This aspect of LiFeBATTs products will be even more fully investigated, and assuming ongoing positive results, it will become a major component of marketing efforts for the batteries. LiFeBATT has continued to receive prismatic 20 Amp hour cells from Taiwan. Further testing continues to indicate significant advantages over the previously available 15 Ah cells. Battery packs are being assembled with battery management systems in the Danville facility. Comprehensive tests are underway at Sandia National Laboratory to provide further documentation of the advantages of these 20 Ah cells. The company is pursuing its work with Hybrid Vehicles of Danville to critically evaluate the 20 Ah cells in a hybrid, armored vehicle being developed for military and security applications. Results have been even more encouraging than they were initially. LiFeBATT is expanding its work with several OEM customers to build a worldwide distribution network. These customers include a major automotive consulting group in the U.K., an Australian maker of luxury off-road campers, and a number of makers of E-bikes and scooters. LiFeBATT continues to explore the possibility of working with nations that are woefully short of infrastructure. Negotiations are underway with Siemens to jointly develop a system for using photovoltaic generation and battery storage to supply electricity to communities that are not currently served adequately. The IDA has continued to monitor the progress of LiFeBATTs work to ensure that all funds are being expended wisely and that matching funds will be generated as promised. The company has also remained current on all obligations for repayment of an IDA loan and lease payments for space to the IDA. A commercial venture is being formed to utilize the LiFeBATT product for consumer use in enabling photovoltaic powered boat lifts. Field tests of the system have proven to be very effective and commercially promising. This venture is expected to result in significant sales within the next six months.

Stratton, Jeremy

2012-09-30T23:59:59.000Z

140

Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)

2010-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)

2012-07-01T23:59:59.000Z

142

DEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE  

E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.

143

RFI for NC  

NLE Websites -- All DOE Office Websites (Extended Search)

Statement of Energy Service Requirements Statement of Energy Service Requirements & Format for Responses to a Request for Information GENERAL INFORMATION Document Type: Request for Information Posted Date: June 12, 2003 Original Response Date: June 26, 2003 Classification Code: 99-Miscellaneous-Renewable Energy/Renewable Energy Certificates (REC) DESCRIPTION The Federal Government is seeking interested parties to potentially supply renewable energy/REC in North Carolina behind the Duke Energy Service Territory, with the possibility of other locations as well. Requirements are estimated at approximately 30 million kWh. We are seeking Green-e certified (or the equivalent) REC, or renewable energy located close to North Carolina, but not necessarily within the state.

144

Durham, NC 27708  

DOE Green Energy (OSTI)

In the Krafla hydrothermal system in Iceland, both MT polarization and MEQ splitting directions align with

Malin, Peter E.; Shalev, Eylon; Onacha, Stepthen A.

2006-12-15T23:59:59.000Z

145

Entergy Grand Gulf site, MS issued on April 5, 2007. Dominion Energy North Anna site, VA issued on November 27, 2007.  

E-Print Network (OSTI)

decision expected 2009. Duke notified NRC of future planned ESP applications (as many as 2) Possibly Oconee County, SC, and Davie County, NC, no dates identified. Unspecified power company announced plans to submit an ESP application in fiscal year 2010. Combined Construction and Operating License (COL) Summary: Of nine COL applications submitted, six have been docketed for NRC review. 20 power companies, of which two are unidentified, intend to submit 23 license applications for 34 units. A Reference COL (R-COL) application has been submitted for four of the five reactor designs. Combined Construction and Operating License Applications (COLA) Submitted:

unknown authors

2008-01-01T23:59:59.000Z

146

Entergy Grand Gulf site, MS issued on April 5, 2007. Dominion Energy North Anna site, VA issued on November 27, 2007.  

E-Print Network (OSTI)

decision expected 2009. Duke notified NRC of future planned ESP applications (as many as 2) Possibly Oconee County, SC, and Davie County, NC, no dates identified. Unspecified power company announced plans to submit an ESP application in fiscal year 2010. Combined Construction and Operating License (COL) Summary: Of nine COL applications submitted, four have been docketed for NRC review. 19 power companies, of which one is unidentified, intend to submit 22 license applications for 33 units. A Reference COL (R-COL) application has been submitted for four of the five reactor designs. Combined Construction and Operating License Applications (COLA) Submitted:

unknown authors

2008-01-01T23:59:59.000Z

147

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See Block 16C I  

National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)

148

File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload

149

MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.

2011-05-01T23:59:59.000Z

150

A Main Steam Safety Valve (MSSV) With Fixed Blowdown According to ASME Section III,Part NC-7512  

Science Conference Proceedings (OSTI)

In 1986, the NRC issued the Information Notice (IN) 86-05 'Main Steam Safety Valve test failures and ring setting adjustments'. Shortly after this IN was issued, the Code was revised to require that a full flow test has to be performed on each CL.2 MSSV by the manufacturer to verify that the valve was adjusted so that it would reach full lift and thus full relieving capacity and would re-close at a pressure as specified in the valve Design Specification. In response to the concern discussed in the IN, the Westinghouse Owners Group (WOG) performed extensive full flow testing on PWR MSSVs and found that each valve required a unique setting of a combination of two rings in order to achieve full lift at accumulation of 3% and re-closing at a blowdown of 5%. The Bopp and Reuther MSSV type SiZ 2507 has a 'fixed blowdown' i.e. without any adjusting rings to adjust the 'blowdown' so that the blowdown is 'fixed'. More than 1000 pieces of this type are successfully in nuclear power plants in operation. Many of them since about 25 years. Therefore it can be considered as a proven design. It is new that an optimization of this MSSV type SiZ 2507 fulfill the requirements of part NC-7512 of the ASME Section III although there are still no adjusting rings in the flow part. In 2000, for the Qinshan Candu unit 1 and 2 full flow tests were performed with 32 MSSV type SiZ 2507 size 8'' x 12'' at 51 bar saturated steam in only 6 days. In all tests the functional performance was very stable. It was demonstrated by recording the signals lift and system pressure that all valves had acceptable results to achieve full lift at accumulation of 3% and to re-close at blowdown of 5%. This is an advantage which gives a reduction in cost for flow tests and which gives more reliability after maintenance work during outage compared to the common MSSV design with an individual required setting of the combination of the two rings. The design of the type SiZ 2507 without any adjusting rings in the flow path is presented. The stable performance depends on the interaction of flow force and spring force. The optimization of the flow path to create a suitable flow-force-curve was managed by Computational Fluid Dynamics (CFD) and flow-force-characteristic-measurements at a model 1: 2.5. The method of the flow-force-characteristic-measurement permits systematic dimensioning of valve spring forces by means of measurement of the fluid mechanical forces occurring on the valve spindle during flow. A special procedure was established to verify a spring force versus lift curve with an accuracy of 1% for each production valve. This gives high reliability at required stable performance and this can not be influenced by wrong setting of any adjusting ring during maintenance work. (authors)

Follmer, Bernhard; Schnettler, Armin [Bopp and Reuther Sicherheitsund Regelarmaturen, GmbH, Mannheim (Germany)

2002-07-01T23:59:59.000Z

151

Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab

2007-03-01T23:59:59.000Z

152

NETL Researcher Honored with 2013 Federal Laboratory Award Morgantown, W.Va. - Dr. Stephen E. Zitney of the National Energy Technology  

NLE Websites -- All DOE Office Websites (Extended Search)

Researcher Honored with 2013 Federal Laboratory Award Researcher Honored with 2013 Federal Laboratory Award Morgantown, W.Va. - Dr. Stephen E. Zitney of the National Energy Technology Laboratory (NETL) has been awarded a Mid-Atlantic region Federal Laboratory Consortium (FLC) award for Excellence in Technology Transfer for his work on the 3D Virtual Energy Plant Simulator and Immersive Training System. The 3D Virtual Energy Plant Simulator and Immersive Training System (ITS) deployed at NETL's Advanced Virtual Energy Simulation Training and Research (AVESTAR ® ) Center delivers the first virtual energy plant for training, research, and development. NETL and its training partners are using the system to deliver realistic, cost-effective, and low-risk workforce training to the energy industries. Virtual reality-based training

153

Assessment of Degree of Applicability of Benchmarks for Gadolinium Using KENO V.a and the 238-Group SCALE Cross-Section Library  

SciTech Connect

A review of the degree of applicability of benchmarks containing gadolinium using the computer code KENO V.a and the gadolinium cross sections from the 238-group SCALE cross-section library has been performed for a system that contains {sup 239}Pu, H{sub 2}O, and Gd{sub 2}O{sub 3}. The system (practical problem) is a water-reflected spherical mixture that represents a dry-out condition on the bottom of a sludge receipt and adjustment tank around steam coils. Due to variability of the mixture volume and the H/{sup 239}Pu ratio, approximations to the practical problem, referred to as applications, have been made to envelop possible ranges of mixture volumes and H/{sup 239}Pu ratios. A newly developed methodology has been applied to determine the degree of applicability of benchmarks as well as the penalty that should be added to the safety margin due to insufficient benchmarks.

Goluoglu, S.

2003-12-01T23:59:59.000Z

154

Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A

2008-01-01T23:59:59.000Z

155

Characterization of the environmental fate of Bacillus thuringiensis var. kaurstaki (Btk) after pest eradication efforts in Seattle, WA and Fairfax county, VA  

SciTech Connect

Understanding the fate of biological agents in the environment will be critical to recovery and restoration efforts after a biological attack. Los Alamos National Laboratory (LANL) is conducting experiments in the Seattle, WA and Fairfax County, VA areas to study agent fate in urban environments. As part of their gypsy moth suppression efforts, Washington State and Fairfax County have sprayed Bacillus thuringiensis var. kurstaki (Btk), a common organic pesticide for decades. Many of the spray zones have been in or near urban areas. LANL has collected surface and bulk samples from historical Seattle spray zones to characterize how long Btk persists at detectable levels in the environment, and how long it remains viable in different environmental matrices. This work will attempt to address three questions. First, how long does the agent remain viable at detectable levels? Second, what is the approximate magnitude and duration of resuspension? And third, does the agent transport into buildings? Data designed to address the first question will be presented. Preliminary results indicate Btk remains viable in the environment for at least two years.

Ticknor, Lawrence [Los Alamos National Laboratory; Van Cuyk, Sheila M [Los Alamos National Laboratory; Deshpande, Alina [Los Alamos National Laboratory; Omberg, Kristin M [Los Alamos National Laboratory

2008-01-01T23:59:59.000Z

156

Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester

2012-07-01T23:59:59.000Z

157

T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab

2012-02-11T23:59:59.000Z

158

PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos

2008-06-27T23:59:59.000Z

159

LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance

160

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential

162

NGA98fin5.vp  

Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental

163

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural

164

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration

165

Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.

166

Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.

167

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost

168

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure

169

C:\ANNUAL\VENTCHAP.V8\NGA.VP  

Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure

170

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."

171

NGA98fin5.vp  

Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure

172

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of

173

VA's Performance Contracting Program Overview  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Kristan Higgins Kristan Higgins Phyllis Stange October 17, 2012 1 Keeping our promises to veterans through sustainability OVERVIEW  Veteran - Centric  Good stewards of the taxpayers dollars.  Process is about 14 months from Agency Developed Package Award  New stream-lined process on next slide  Removed 2-3 months 2 Keeping our promises to veterans through sustainability Requirement s Package Received by NEBC; NEBC and OAEM Validate Package Phase 1 - Project Planning Assemble Acquisition Team; Engage Project Facilitator; Build RFP/NOO 6 weeks Send RFP for Technical & Legal Review Interested ESCOs respond to NOO (Can't close until legal review is complete) Technical & Legal Reviews Completed Send Invitation for Preliminary Site Survey

174

Miller, K.G., and Snyder, S.W. (Eds.), 1997 Proceedings of the Ocean Drilling Program, Scientific Results, Vol. 150X  

E-Print Network (OSTI)

COVIDIEN ­ RALEIGH, NC 2. THOMAS BAIADA DUPONT-TYVEK ­ RICHMOND, VA 3. JASON BAKER EXXON MOBIL ­ BEAUMONT ­ CHAPEL HILL, NC 9. ROBERT DEEDRICK MWV ­ RALEIGH, NC 10. AARON FRYE EXXON MOBIL - BEAUMONT, TX 11. MATTHEW LEE GRAY O'BRIEN & GERE ENGINEERS, INC. ­ RALEIGH, NC 12. JAMI GUTHRIE (HALL) EXXON MOBIL

175

U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office

176

Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.

2003-12-01T23:59:59.000Z

177

[(CH3)4N][(C5H5NH)0.8((CH3)3NH)0.2]U2Si9O23F4 (USH-8): An Organically Templated Open-Framework Uranium Silicate  

E-Print Network (OSTI)

-Framework Uranium Silicate Xiqu Wang, Jin Huang, and Allan J. Jacobson* Department of Chemistry, Uni pyramids we obtained also a number of open-framework uranium silicates.18,19 These new compounds were-framework uranium fluorosilicate [(CH3)4N][(C5H5NH)0.8((CH3)3NH)0.2]U2Si9O23F4 (USH- 8) that has been synthesized

Wang, Xiqu

178

Chemical Engineering NC State University  

E-Print Network (OSTI)

Ameristeel Christy Taylor Angelo Jonathan Rice Madeha Baqai Caldwell Natalie Scurry Austin Kizzie Jessica

Velev, Orlin D.

179

Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available

2011-10-01T23:59:59.000Z

180

Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.

2006-08-29T23:59:59.000Z

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

www.eia.gov  

U.S. Energy Information Administration (EIA)

... is through August, the latest data available",,,,, ,"Norfolk, VA","Baltimore, MD","Mobile, AL","New Orleans, LA","Detroit, MI","Seattle, ...

182

Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan

2008-01-01T23:59:59.000Z

183

Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-

2009-01-01T23:59:59.000Z

184

Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI

2012-06-01T23:59:59.000Z

185

Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah

2011-04-21T23:59:59.000Z

186

Miller, K.G., and Snyder, S.W. (Eds.), 1997 Proceedings of the Ocean Drilling Program, Scientific Results, Vol. 150X  

E-Print Network (OSTI)

2. CHRISTOPHER AUSTIN ROVISYS ­ APEX, NC 3. JEFFREY BASEY MWV ­ COVINGTON, VA 4. ERIC BLAKE EXXON. DEREK FRICK COVIDIEN ­ RALEIGH, NC 12. AARON FRYE EXXON MOBIL ­ BEAUMONT, TX 13. KATHRYN GAITHER MWV SMITH KLINE ­ MORRISVILLE, NC 25. KYLE LESLIE DOMTAR ­ BENNETSVILLE, SC 26. JORDAN LEWIS EXXON MOBIL

187

A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.

2008-06-01T23:59:59.000Z

188

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

31 - 23840 of 28,905 results. 31 - 23840 of 28,905 results. Download VA-4-B Wholesale Power Rate Schedule Area: Virginia Power System: Kerr-Philpott http://energy.gov/sepa/downloads/va-4-b-wholesale-power-rate-schedule Download VA-3-B Wholesale Power Rate Schedule Area: Virginia Power System: Kerr-Philpott http://energy.gov/sepa/downloads/va-3-b-wholesale-power-rate-schedule Download VA-2-B Wholesale Power Rate Schedule Area: Virginia Power System: Kerr-Philpott http://energy.gov/sepa/downloads/va-2-b-wholesale-power-rate-schedule Download VA-1-B Wholesale Power Rate Schedule Area: Virginia Power System: Kerr-Philpott http://energy.gov/sepa/downloads/va-1-b-wholesale-power-rate-schedule Download NC-1-B Wholesale Power Rate Schedule Area: Virginia Power/CP&L System: Kerr-Philpott http://energy.gov/sepa/downloads/nc-1-b-wholesale-power-rate-schedule

189

Better Buildings Neighborhood Program: San Jose  

NLE Websites -- All DOE Office Websites (Extended Search)

San Jose to San Jose to someone by E-mail Share Better Buildings Neighborhood Program: San Jose on Facebook Tweet about Better Buildings Neighborhood Program: San Jose on Twitter Bookmark Better Buildings Neighborhood Program: San Jose on Google Bookmark Better Buildings Neighborhood Program: San Jose on Delicious Rank Better Buildings Neighborhood Program: San Jose on Digg Find More places to share Better Buildings Neighborhood Program: San Jose on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Jose, California San Jose Leverages Partnerships to Improve Low-Income Households' Energy

190

Wind Program: Stakeholder Engagement and Outreach  

Wind Powering America (EERE)

Outreach Outreach Printable Version Bookmark and Share The Stakeholder Engagement and Outreach initiative of the U.S. Department of Energy's Wind Program is designed to educate, engage, and enable critical stakeholders to make informed decisions about how wind energy contributes to the U.S. electricity supply. Highlights Resources Wind Resource Maps State Activities What activities are happening in my state? AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Installed wind capacity maps. Features A image of a house with a residential-scale small wind turbine. Small Wind for Homeowners, Farmers, and Businesses Stakeholder Engagement & Outreach Projects

191

Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012

192

Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central

193

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2007 (Million Cubic Feet) Nigeria Algeria 37,483 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports.

194

Better Buildings Neighborhood Program: Maine - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- SEP to - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Maine - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Maine - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Maine - SEP on Google Bookmark Better Buildings Neighborhood Program: Maine - SEP on Delicious Rank Better Buildings Neighborhood Program: Maine - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Maine - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Maine - SEP Maine Makes Multifamily Units Energy-Efficient and Cost-Effective

195

Better Buildings Neighborhood Program: Seattle, Washington  

NLE Websites -- All DOE Office Websites (Extended Search)

Seattle, Seattle, Washington to someone by E-mail Share Better Buildings Neighborhood Program: Seattle, Washington on Facebook Tweet about Better Buildings Neighborhood Program: Seattle, Washington on Twitter Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Google Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Delicious Rank Better Buildings Neighborhood Program: Seattle, Washington on Digg Find More places to share Better Buildings Neighborhood Program: Seattle, Washington on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA

196

Energy Project Incentive Funds: Updates and Trends  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Project Incentive Funds Project Incentive Funds Updates and Trends Elizabeth Stuart Lawrence Berkeley National Lab FUPWG Spring Meeting - April 20, 2011 EE Funding Overview * Ratepayer-funded EE budget $5.3B in 2010 - Plus over $1B for DR/LM and $1.5B for renewables * Expected to reach $6B for EE in 2011 - Nearly double the 2008 figure ($3.1B) * Strong expansion expected to 2020 - Total expected to reach $7.5-12.4B (EE only) * It's not just the usual suspects anymore - Recent entrants: NM, MI, NC, AR, VA, OH, PA, IN... EE Funding - Current Picture * ~ 45 states have ratepayer-funded EE * 2010 budget (EE only) $5.3B (source: CEE) - $4.4B in 2009, $3.1B in 2008 and $0.8B in 1998 - ~ 80% on electric side ($4.3B); ~20% for gas EE

197

Better Buildings Neighborhood Program: San Diego  

NLE Websites -- All DOE Office Websites (Extended Search)

Diego to Diego to someone by E-mail Share Better Buildings Neighborhood Program: San Diego on Facebook Tweet about Better Buildings Neighborhood Program: San Diego on Twitter Bookmark Better Buildings Neighborhood Program: San Diego on Google Bookmark Better Buildings Neighborhood Program: San Diego on Delicious Rank Better Buildings Neighborhood Program: San Diego on Digg Find More places to share Better Buildings Neighborhood Program: San Diego on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Diego County, California Energy Upgrade California Motivates Home Improvements in San Diego County

198

Better Buildings Neighborhood Program: Alabama - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Alabama - Alabama - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Alabama - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Alabama - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Google Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Delicious Rank Better Buildings Neighborhood Program: Alabama - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Alabama - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Alabama - SEP Alabama Program Takes a Dual Approach to Energy Efficiency Upgrades

199

Better Buildings Neighborhood Program: Virginia - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Virginia - Virginia - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Virginia - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Virginia - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Google Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Delicious Rank Better Buildings Neighborhood Program: Virginia - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Virginia - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Virginia - SEP Virginia's Regional Energy Alliances Help Forge a State Program for

200

Better Buildings Neighborhood Program: Austin, Texas  

NLE Websites -- All DOE Office Websites (Extended Search)

Austin, Texas Austin, Texas to someone by E-mail Share Better Buildings Neighborhood Program: Austin, Texas on Facebook Tweet about Better Buildings Neighborhood Program: Austin, Texas on Twitter Bookmark Better Buildings Neighborhood Program: Austin, Texas on Google Bookmark Better Buildings Neighborhood Program: Austin, Texas on Delicious Rank Better Buildings Neighborhood Program: Austin, Texas on Digg Find More places to share Better Buildings Neighborhood Program: Austin, Texas on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Austin, Texas Austin Energy Accelerates Residential and Multifamily Efficiency Upgrades

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Better Buildings Neighborhood Program: Michigan - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Michigan - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Michigan - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Google Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Delicious Rank Better Buildings Neighborhood Program: Michigan - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Michigan - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Michigan - SEP Better Buildings Means Better Business for Michigan

202

Better Buildings Neighborhood Program: Toledo, Ohio  

NLE Websites -- All DOE Office Websites (Extended Search)

Toledo, Ohio Toledo, Ohio to someone by E-mail Share Better Buildings Neighborhood Program: Toledo, Ohio on Facebook Tweet about Better Buildings Neighborhood Program: Toledo, Ohio on Twitter Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Google Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Delicious Rank Better Buildings Neighborhood Program: Toledo, Ohio on Digg Find More places to share Better Buildings Neighborhood Program: Toledo, Ohio on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Toledo, Ohio A Broad Approach to Energy Efficiency in Northwest Ohio

203

Bi[NC{sub 5}H{sub 3}(CO{sub 2}){sub 2}](OH{sub 2}){sub x}F (x=1 and 2): New one-dimensional Bi-coordination materials-Reversible hydration and topotactic decomposition to {alpha}-Bi{sub 2}O{sub 3}  

SciTech Connect

Two one-dimensional bismuth-coordination materials, Bi[NC{sub 5}H{sub 3}(CO{sub 2}){sub 2}](OH{sub 2}){sub x}F (x=1 and 2), have been synthesized by hydrothermal reactions using Bi{sub 2}O{sub 3}, 2,6-NC{sub 5}H{sub 3}(CO{sub 2}H){sub 2}, HF, and water at 180 Degree-Sign C. Structures of the two materials were determined by single-crystal X-ray diffraction. Although they have different crystal structures, both Bi-organic materials shared a common structural motif, a one-dimensional chain structure consisting of Bi{sup 3+} cations and pyridine dicarboxylate linkers. Detailed structural analyses include infrared spectroscopy, thermogravimetric analysis, and reversible hydration reactions for the coordinated water molecules were reported. Also, thermal decomposition of the rod-shaped Bi[NC{sub 5}H{sub 3}(CO{sub 2}){sub 2}](OH{sub 2})F single crystals at 800 Degree-Sign C led to {alpha}-Bi{sub 2}O{sub 3} that maintained the same morphology of the original crystals. - Graphical abstract: Calcination of the Bi[NC{sub 5}H{sub 3}(CO{sub 2}){sub 2}](OH{sub 2})F single crystals at 800 Degree-Sign C results in the {alpha}-Bi{sub 2}O{sub 3} rods that maintain the original morphology of the crystals. Highlights: Black-Right-Pointing-Pointer Synthesis of one-dimensional chain Bi-organic frameworks. Black-Right-Pointing-Pointer Reversible hydration reactions of Bi[NC{sub 5}H{sub 3}(CO{sub 2}){sub 2}](OH{sub 2})F. Black-Right-Pointing-Pointer Topotactic decomposition maintaining the same morphology of the original crystals.

Jeon, Hye Rim [Department of Chemistry Education, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Dong Woo [Department of Chemistry, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Ok, Kang Min, E-mail: kmok@cau.ac.kr [Department of Chemistry, Chung-Ang University, Seoul 156-756 (Korea, Republic of)

2012-03-15T23:59:59.000Z

204

U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

4 4 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT

205

U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

2 2 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT

206

Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan

2008-09-30T23:59:59.000Z

207

VA UESC with PG&E  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Federal Utility Partnership Working Group Spring 2013: May 22-23 San Francisco, CA Hosted by: Pacific Gas and Electric Company  Review Key Challenges  Strategies Utilized to Achieve Success  Lessons Learned  Project Profile  Project Challenges  UESC Energy Saving Results  Conclusion  Facilities Targeted: ◦ 3 VAMCs and 2 clinics within VISN 21 ◦ Over 2,000,000 square feet  Project Size: $9.9 Million  Project Timeline: ◦ Business development: May 2009 ◦ Awarded: October 2011 ◦ Construction completed: July 2013 Martinez Outpatient Clinic and Community Living Center Mather VAMC San Francisco VAMC Fresno VAMC McClellan Outpatient Clinic  FEMP UESC Workshop - April 2009  Review of Existing Audits 

208

Case Study: Grand Junction VA Medical Center  

NLE Websites -- All DOE Office Websites (Extended Search)

Expansion Data - Building Additions - PV Solar Array www.antaresgroupinc.com Key Energy Usage Characteristics * Electricity Use: - Summer (Max.): 494 MWh - Winter (Min.): 367 MWh -...

209

VA Medical Device Protection Program Information Security ...  

Science Conference Proceedings (OSTI)

... Photo Source: Idaho Department of Commerce 3 ... in patient healthcare for diagnosis, treatment or monitoring; ... medical system: Any group of devices ...

2011-03-10T23:59:59.000Z

210

VA Medical Device Protection Program (MDPP)  

Science Conference Proceedings (OSTI)

... Photo Source: Idaho Department of Commerce ... in patient healthcare for diagnosis, treatment, or monitoring; ... medical system: Any group of devices ...

2011-05-11T23:59:59.000Z

211

NONPROFIT ORG DETROIT, MI  

E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor

212

Radiobiological Laboratory Beaufort, N.C.  

E-Print Network (OSTI)

concentrations were determined from specific radioactivity using calcium or the nucleotide solutions of known stirred gently with a magnetic stirrer for 30 min. Insoluble material was collected by centrifugation (20 of radioactive CaC12(600-1200 cpm/pmol). Fractions of 400 rl were collected at a flow rate of 8 ml/ h. Prior

213

Figure 23. Average price of natural gas delivered to U.S. commercial...  

Annual Energy Outlook 2012 (EIA)

Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA FL NJ AL...

214

Microsoft Word - figure_22.doc  

Gasoline and Diesel Fuel Update (EIA)

Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA FL NJ AL...

215

Microsoft Word - figure_21.doc  

Annual Energy Outlook 2012 (EIA)

of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA...

216

Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use

217

Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Mexico Trinidad Canada Canada Nigeria Oman Qatar Trinidad Gulf of Mexico Gulf of Mexico Gulf of Mexico Canada Trinidad Trinidad Gulf of Mexico Malaysia 13,623 Figure 8. Interstate Movements of Natural Gas in the United States, 2003 (Million Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Energy Information Administration / Natural Gas Annual 2003 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 366,224 655,731 666,614 633,960 144,284 43,869 536,776 63,133 36,848

218

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2008 (Million Cubic Feet) Norway Trinidad/ Tobago Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 45,772 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates.

219

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 (Million Cubic Feet) 24,891 2,895 Nigeria WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico Algeria C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada N i g e r i a O m a n Qatar Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Malaysia 2,986 Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2005 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 335,380 634,982 664,318 612,297 125,202 33,223 531,868 103,624

220

San Juan Montana Thrust Belt WY Thrust Belt Black Warrior  

U.S. Energy Information Administration (EIA) Indexed Site

San San Juan Montana Thrust Belt WY Thrust Belt Black Warrior Paradox - San Juan NW (2) Uinta- Piceance Paradox - San Juan SE (2) Florida Peninsula Appalachian- NY (1) Appalachian OH-PA (2) Appalachian Eastern PA (3) Appalachian Southern OH (4) Appalachian Eastern WV (5) Appalachian WV-VA (6) Appalachian TN-KY (7) Piceance Greater Green River Eastern OR-WA Ventura Williston Williston NE (2) Williston NW (1) Williston South (3) Eastern Great Basin Ventura West, Central, East Eastern OR-WA Eastern Great Basin Appalachian Denver Florida Peninsula Black Warrior W Y T h ru st B e lt Powder River Paradox- Uinta- Grtr Green River MT Thrust Belt Powder River North (1) Powder River South (2) Denver North (1) Denver South (3) Denver Middle (2) TX CA MT AZ ID NV NM CO IL OR UT KS WY IA NE SD MN ND OK FL WI MO AL WA GA AR LA MI IN PA NY NC MS TN KY VA OH SC

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

,833 ,833 35 Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2009 (Million Cubic Feet) Norway Trinidad/ Tobago Trinidad/ Tobago Egypt Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 111,144 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates

222

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

6 6 (Million Cubic Feet) Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 42,411 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2006 253,214 690,780 634,185 658,523 134,764 63,063 526,726 121,049 34,531 492,655 101,101 23,154 40,113 1,496,283 68,601

223

DOE/EIA-0131(96) Distribution Category/UC-960 Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

ID ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Interstate Movements of Natural Gas in the United States, 1996 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL KY (T) MA ME (T) AL LA MA NH (T) AL MO (T) MA NJ (T) AL SC MD DC CT RI RI MA DE MD VA DC MA CT (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 906,407 355,260 243,866 220 384,311 576,420 823,799 842,114 27,271 126,012 133 602,841 266 579,598 16,837 268,138 48,442 182,511 219,242 86,897 643,401 619,703 8,157 937,806 292,711 869,951 12,316 590,493 118,256

224

Microsoft Word - figure_14.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 14. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2010 (Million Cubic Feet) Norway India Trinidad/ Tobago Egypt Yemen Japan Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 53,122 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada Gulf of Mexico Canada Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates based on historical data. Energy Information

225

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Australia Australia Trinidad Qatar Malaysia Canada Mexico Interstate Movements of Natural Gas in the United States, 1999 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL TX MA NH CT RI MD DC DE MD RI MA MA CT VA DC (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 837,902 415,636 225,138 232 308,214 805,614 803,034 800,345 685 147 628,589 9,786 790,088 17,369 278,302 40,727 214,076 275,629 51,935 843,280 826,638 9,988 998,603 553,440 896,187 11,817 629,551 98,423

226

Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.

227

regionalmaps  

Gasoline and Diesel Fuel Update (EIA)

LNG Imports LNG Imports Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming

228

regionalmaps  

Gasoline and Diesel Fuel Update (EIA)

Specific LNG Terminals Specific LNG Terminals Generic LNG Terminals Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Specific LNG Terminals Generic LNG Terminals Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana

229

A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada

2005-09-01T23:59:59.000Z

230

Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:

231

SUSTAINABLE DESIGN THIRD-PARTY RATING OF HEALTHCARE FACILITIES  

E-Print Network (OSTI)

(GBCI) began requiring that all new construction and major renovation projects seeking LEED certification for inpatient, outpatient, or long-term care facilities must use the LEED for Healthcare rating system. 2. BACKGROUND: The VA Sustainable Design and Energy Reduction Manual (April 2010) requires major construction projects to achieve a third-party green building certification of at least LEED Silver or two Green Globes. VA commissioned a study to determine the impact of USGBCs new requirement on VAs construction program. The study compared LEED for Health Care (LEED HC) to LEED for New Construction (LEED NC) and determined that there will be little impact to cost or effort when using LEED HC in lieu of LEED NC. (1) Projects using the Green Building Initiatives (GBI) Green Globes rating system will not be affected. 3. NEW STANDARD: All VA healthcare projects registering for LEED

unknown authors

2012-01-01T23:59:59.000Z

232

203 Multiwalled Carbon Nanotubes Decorated with Va and Ni by ...  

Science Conference Proceedings (OSTI)

... of LiMnxFe1-xPO4 Glass and Glass-Ceramics for Lithium Ion Battery .... and Comparing the Inhibition Effect of Chromate, Bromate and Molybdate on the...

233

ENERGY STAR Success Story VA Beach Convention Center  

NLE Websites -- All DOE Office Websites (Extended Search)

STAR Success Story: STAR Success Story: The Virginia Beach Convention Center Located in Virginia's most populous city, the Virginia Beach Convention Center (VBCC) comprises more than 516,000 square feet and typically hosts 400 events a year. Fully opened in 2007, the VBCC has served as the anchor for the successful revitalization of Virginia Beach's old beach district. With historical references and maritime themes integrated into the structure's modern design, the Center features many technological advances that make it a prime location for meetings, conferences, and trade shows. However, even with a newly constructed building, the VBCC has demonstrated an important energy management principle: all buildings, regardless of their age and building systems they employ, can reduce energy consumption, save money, and offset greenhouse gas

234

Plasma driven superpermeation of hydrogen through group Va metals  

Science Conference Proceedings (OSTI)

A barrier for the absorption of hydrogen molecules generated by a nonmetallic film on a metal surface may result in superpermeation of suprathermal hydrogen particles. Virtually all the sticking or implanted particles may permeate through the metallic membrane

A. I. Livshits; F. Sube; M. N. Solovyev; M. E. Notkin; M. Bacal

1998-01-01T23:59:59.000Z

235

Communication and Collaboration Keep San Francisco VA Medical...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

project involving a substantial capital investment, "Some of our infrastructure was aging and needed to be replaced, and these replacements were going to be pretty expensive,"...

236

VA-s--- ' At&LYTlCAL DATA SHEET  

Office of Legacy Management (LM)

the fire. b&,, Ro All wore Comfo type respirators and extinguished the fire from oil PH an upwind position. Sample No. Hour Sample Description Be Th (R ( T 1 Q 331 1400 I...

237

U.S. GEOLOGICAL SURVEY Reston, VA 20192  

E-Print Network (OSTI)

and an Establishment Risk Assessment for Nine Large Species of Pythons, Anacondas, and the Boa Constrictor". Regarding

238

VA-3-B Wholesale Power Rate Schedule | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Company (hereinafter called the Company), the Company's Transmission Operator, currently PJM Interconnection LLC (hereinafter called PJM), and the Customer. This rate schedule...

239

VA-1-B Wholesale Power Rate Schedule | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Company (hereinafter called the Company), the Company's Transmission Operator, currently PJM Interconnection LLC (hereinafter called PJM), and the Customer. This rate schedule...

240

NoVaS Transformations: Flexible Inference for Volatility Forecasting  

E-Print Network (OSTI)

and Correlation Forecasting in G. Elliott, C.W.J.Handbook of Economic Forecasting, Amsterdam: North-Holland,Transformations, forthcoming in Forecasting in the Presence

Politis, Dimitris N; Thomakos, Dimitrios D

2008-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Buildings Energy Data Book: 3.9 Educational Facilities  

Buildings Energy Data Book (EERE)

6 6 2010 Regional New Construction and Renovations Expenditures for Public K-12 Schools ($Million) Region New Schools Additions Renovation Total Region 1 (CT, MA, ME, NH, RI, VT) Region 2 (NJ, NY, PA) Region 3 (DE, MD, VA, WV) Region 4 (KY, NC, SC, TN) Region 5 (AL, FL, GA, MS) Region 6 (IN, MI, OH) Region 7 (IL, MN, WI) Region 8 (IA, KS, MO, NE) Region 9 (AR, LA, OK, TX) Region 10 (CO, MT, ND, NM, SD, UT, WY) Region 11 (AZ, CA, HI, NV) Region 12 (AK, ID, OR, WA) Total Source(s): School Planning & Management, 16th Annual School Construction Report, Feb. 2011 p. CR3 8,669.5 3,074.1 2,796.8 14,540.4 1,605.4 407.3 275.2 2,287.9 258.2 181.8 158.1 598.1 1,653.9 479.6 387.8 2,521.2 548.2 130.9 93.3 772.4 309.3 206.1 135.3 650.7 217.6 231.4 187.8 636.8 1,338.0 327.6 175.9 1,841.4 359.6 286.3 278.9 924.8

242

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

6 6 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 27. Average City Gate Price of Natural Gas in the United States, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Energy Information Administration (EIA), Form EIA-857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Constant dollars: Prices were converted to 2001 dollars using the chain-type

243

Residential Demand Module  

Gasoline and Diesel Fuel Update (EIA)

and clothes drying. In addition to the major equipment-driven and clothes drying. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric Energy Information Administration/Assumptions to the Annual Energy Outlook 2006 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Figure 5. United States Census Divisions Source:Energy Information Administration,Office of Integrated Analysis and Forecasting. Report #:DOE/EIA-0554(2006) Release date: March 2006

244

Green Power Network: Can I Buy Green Power in My State?  

NLE Websites -- All DOE Office Websites (Extended Search)

Can I Buy Green Power in my State? Community Renewable Energy Development Consumer Protection Large Purchasers of Green Power Can I Buy Green Power in My State? Click on your state below to find out which organizations offer green power in your state. The results will include utility green pricing programs, retail green power products offered in competitive electricity markets, and renewable energy certificate (REC) products sold separate from electricity. For additional information about these distinct products, see our Overview of Green Power Markets. Map of the United States. AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Alabama Alaska Arizona Arkansas California Colorado Connecticut Connecticut Delaware Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Maryland Massachusetts Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Hampshire New Jersey New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Vermont Virginia Washington West Virginia Wisconsin Wyoming Washington, DC

245

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

Supply Supply 17 Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity

246

AEOSup ltr to Dear Customer  

Gasoline and Diesel Fuel Update (EIA)

WA WA OR CA ID NV UT AZ NM CO WY MT ND SD NE KS OK TX MN IA MO AR LA WI IL KY IN OH WV TN MS AL GA SC NC VA PA NY VT ME NH MA RI CT NJ DE MD D.C. FL MI Electricity Supply Regions 1 ECAR 2 ERCOT 3 MAAC 4 MAIN 5 MAPP 6 NY 7 NE 8 FL 9 STV 10 SPP 11 NWP 12 RA 13 CNV 13 11 12 2 10 5 9 8 1 6 7 3 AK 15 14 H I 14 AK 15 H I Figure 2. Electricity Market Module (EMM) Regions 1. ECAR = East Central Area Reliability Coordination Agreement 2. ERCOT = Electric Reliability Council of Texas 3. MACC = Mid-Atlantic Area Council 4. MAIN = Mid-America Interconnected Network 5. MAPP = Mid-Continent Area Power Pool 6. NY = Northeast Power Coordinating Council/ New York 7. NE = Northeast Power Coordinating Council/ New England 8. FL = Southeastern Electric Reliability Council/ Florida 9. STV = Southeastern Electric Reliability Council /excluding Florida 10. SPP

247

U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2013 Annual Energy Outlook 2013 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2013

248

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value

249

Microsoft Word - Figure_14_15.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 360 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Figure 14. Average Price of Natural Gas Delivered to Residential Consumers, 1980-2004 Figure 15. Average City Gate Price of Natural Gas in the United States, 2004 (Dollars per Thousand Cubic Feet) Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." Constant dollars: Prices were converted to 2004 dollars using the chain-type price indexes for Gross Domestic Product

250

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FOA-0000028 FOA-0000028 Prime: Cascade Sierra Solutions EE DE-EE0002613 PMC/PVT 2011 John Jason Conley 07/2011 - 02/20/2014 Multiple sites, Multiple states Interstate Electrification Improvement (SUMMARY CX) Install truck stop electrification hardware at multiple (30) truck stops nationwide. Locations in UT, IA, NM, WY, AZ, MO, VA, MA, MI, TX, AL, WA, CA, NC, NY, MT, FL, KS. 08 17 2011 John Jason Conley Digitally signed by John Jason Conley DN: cn=John Jason Conley, o=DOE, ou=NETL, email=John.Conley@netl.doe.gov, c=US Date: 2011.08.17 13:25:08 -04'00' 10 18 2011 john ganz Digitally signed by john ganz DN: cn=john ganz, o=netl, ou=environmental compliance division, email=john.ganz@netl.doe.gov, c=US Date: 2011.10.18 13:52:43 -04'00' Sub: Shorepower Technologies. Funded by DE-FOA-0000028, "Recovery Act - Transportation

251

Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act 2 Metric Tons Heavy Metal (MTHM) 3 Based on actual data through 2002 , as provided in the RW-859, and projected discharges for 2003-2010 which are rounded to two significant digits. Reflects trans-shipments as of end-2002. End of Year 2010 SNF & HLW Inventories 1 Approximately 64,000 MTHM 2 of Spent Nuclear Fuel (SNF) 3 & 275 High-Level Radioactive Waste (HLW) Canisters CT 1,900 TX 2,000 MD 1,200 VT 610 RI MT WY NE 790 SD ND OK KS 600 TX 2,000 LA 1,200 AR 1,200 IA 480 MN 1,100 WI 1,300 KY TN 1,500 MS 780 AL 3,000 GA 2,400 FL 2,900 NC 3,400 VA 2,400 WV OH 1,100 PA 5,800 ME 540 NJ 2,400 DE MI 2,500 MA 650 NH 480 IN SC 3,900 CO MO 670 IL 8,400 NY 3,300 CA 2,800 AZ 1,900 NM OR 360 NV UT WA 600 ID < 1 Commercial HLW 275 Canisters (~640 MTHM)

252

Table 25  

Gasoline and Diesel Fuel Update (EIA)

89 89 Table 25 Created on: 1/3/2014 3:10:33 PM Table 25. Natural gas home customer-weighted heating degree days, New England Middle Atlantic East North Central West North Central South Atlantic Month/Year/Type of data CT, ME, MA, NH, RI, VT NJ, NY, PA IL, IN, MI, OH, WI IA, KS, MN, MO, ND, NE, SD DE, FL, GA, MD, DC, NC, SC, VA, WV November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0 November to November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0

253

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA  

Gasoline and Diesel Fuel Update (EIA)

0.00-1.99 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1996 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1996 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: In 1996, consumption of natural gas for agricultural use

254

Microsoft Word - BSA NC Service Rev. 7 clean100410.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

7; (Oct. 2010) 1 of 20 7; (Oct. 2010) 1 of 20 BROOKHAVEN SCIENCE ASSOCIATES, LLC GENERAL TERMS AND CONDITIONS FOR NON-COMMERCIAL SERVICES AT BROOKHAVEN NATIONAL LABORATORY Section 1 - General Clauses Applicable to Fixed Price and Cost Type Agreements.....................................................2 Article 1.1 Definitions.........................................................................................................................................2 Article 1.2 Order of Precedence..........................................................................................................................2 Article 1.3 Acceptance of Agreement .................................................................................................................2 Article 1.4 Complete Agreement

255

Microsoft Word - BSA NC Items Rev11.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

NCItems, Rev. 11; (Jun-12) 1 of 21 NCItems, Rev. 11; (Jun-12) 1 of 21 BROOKHAVEN SCIENCE ASSOCIATES, LLC GENERAL TERMS AND CONDITIONS FOR NONCOMMERCIAL ITEMS AT BROOKHAVEN NATIONAL LABORATORY Table of Contents Article 1 DEFINITIONS ................................................................................................................... 3 Article 2 ORDER OF PRECEDENCE ............................................................................................. 3 Article 3 ACCEPTANCE OF AGREEMENT, SURVIVABILITY ................................................. 4

256

Microsoft Word - BSA NC Items Rev10.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

10; (Aug. 2011) 1 of 17 10; (Aug. 2011) 1 of 17 BROOKHAVEN SCIENCE ASSOCIATES, LLC GENERAL TERMS AND CONDITIONS FOR NON-COMMERCIAL ITEMS AT BROOKHAVEN NATIONAL LABORATORY Definitions 2 Article 1 Order of Precedence 2 Article 2 Acceptance of Agreement 2 Article 3 Complete Agreement 3 Article 4 Assignment 3 Article 5 Compliance with Laws and Regulations 3 Article 6 Compliance with Internet Protocol Version 6 (IPv6) In Acquiring Information Article 7 Technology. 3 Independent Contractor; Hold Harmless 4 Article 8 Notice Regarding Late Delivery 4 Article 9 Inspection and Acceptance 4 Article 10 No Waiver 5 Article 11 New Materials 5 Article 12 Suspect/Counterfeit Items 5 Article 13 Hazardous Material Identification and Material Safety Data 6 Article 14 Title and Risk of Loss 6 Article 15

257

Microsoft Word - BSA NC Service Rev 9.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

9; (Aug. 2011) 1 of 21 9; (Aug. 2011) 1 of 21 BROOKHAVEN SCIENCE ASSOCIATES, LLC GENERAL TERMS AND CONDITIONS FOR NON-COMMERCIAL SERVICES AT BROOKHAVEN NATIONAL LABORATORY Section 1 - General Clauses Applicable to Fixed Price and Cost Type Contracts. ....................................................... 2 Article 1.1 Definitions ............................................................................................................................................ 2 Article 1.2 Order of Precedence ............................................................................................................................. 2 Article 1.3 Acceptance of Agreement .................................................................................................................... 2

258

LEAVING NC STATE Find out what you can  

E-Print Network (OSTI)

in school. AWARD WINNING PERFORMANCE 8 High Performance Computing is the wave of the future. Date: February

259

Ergebnisse rtlicher NC-Verfahren Wintersemester 2007 / 2008  

E-Print Network (OSTI)

: Notendurchschnitt) Biochemie (Chemie d. Lebensw.)/ Bachelor 1,8 (0) 2 (2,2) Bioinformatik & Genomforschung-Kernfach 1,8 (2) 4 (2,6) Biologie / Bachelor-Nebenfach 1,8 (2) 4 (2,4) Deutsch als Fremdsprache / Bachelor- Kernfach 2,7 (0) 2 (3,6) Deutsch als Fremdsprache / Bachelor- Nebenfach 3,1 (2) 0 (3

Moeller, Ralf

260

MicroBlower Soil Vapor Extraction License Agreement LLC, NC,  

alternative designed to run on renewable sources of energy such as solar and wind ... A growing trend in environmental remediation is the use of ...

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Microsoft Word - BSA NC Items Rev. 8 clean100410.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

10 Article 25 Bankruptcy 10 Article 26 Walsh-Healy Public Contracts Act 10 Article 27 Patent Indemnity - Subcontracts 11 Article 28 Indemnity for Defective Cost or Pricing Data 11...

262

Avista Utilities - LEED (NC or EB) Certification Energy Efficiency...  

Open Energy Info (EERE)

a minimum of 4 points for optimized energy performance and comply with all LEED whole building modeling requirements are eligible for a 1.25 per conditioned square foot rebate...

263

NC GreenPower Production Incentive (North Carolina) | Open Energy...  

Open Energy Info (EERE)

Commercial, Industrial, Institutional, Local Government, Nonprofit, Residential, Schools, State Government Eligible Technologies Anaerobic Digestion, Biomass, Hydroelectric,...

264

Microsoft PowerPoint - Junior_ONR  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mi Mi it S i I tit ti (MSI ) Minority Serving Institutions (MSIs): Bridging the Gap between Federal g g p Agencies and MSIs Dr. Anthony Junior, Program Manager Naval Historically Black Colleges and University/Minority Institutions Program Office of Naval Research 874 North Randolph Street, Arlington, VA 22203 anthony.junior@navy.mil AVJ HBCU/MI SP Concepts V2 Agenda * The Requirement The Requirement * The Strategic Plan * HBCU/MI Full Engagement Model HBCU/MI Full Engagement Model * STEM Research Pipeline * HBCU/MI Accredited Engineering Schools * HBCU/MI Accredited Engineering Schools 2 10 USC 2362 Objective: Enhance defense-related research and education at HBCU/MIs to assist the Department in education at HBCU/MIs to assist the Department in defense-related research, development, testing, and

265

www.eia.gov  

U.S. Energy Information Administration (EIA)

MO MT NE NV NH NJ NM NY NC ND OH OK OR PA RI SC SD TN TX UT VT VA WA WV WI WY U.S. Number of states in which marketer is licensed ... Service Tech & Research Corp

266

Dept. of Materials Science & Engineering -Undergraduate Post Graduate Activities Detail & History  

E-Print Network (OSTI)

& Engineering undergraduate students from the Class of 2008. Historical data is provided to allow for comparison of activity and salary trends. Number Graduated: 36 Number Responded: 33 Response Rate: 92% 2008 Graduate Engineer Durham NC Dean Ventures Analyst Vienna VA General Electric Commercial Leadership Program

Lipson, Michal

267

Gas Prices  

NLE Websites -- All DOE Office Websites (Extended Search)

Prices Gasoline Prices for U.S. Cities Click on the map to view gas prices for cities in your state. AK VT ME NH NH MA MA RI CT CT DC NJ DE DE NY WV VA NC SC FL GA AL MS TN KY IN...

268

Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997

269

MI ROPYROLIZER FOR RAPID IOIDENTIFI ATION  

POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...

270

MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2

271

Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...

272

Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...

273

Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...

274

Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...

275

Record of Decision for the Department of Energy's Waste Management Program: Storage of High-Level Radioactive Waste (08/26/99)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

661 661 Federal Register / Vol. 64, No. 165 / Thursday, August 26, 1999 / Notices Installation State Function(s) Total au- thorizations Public an- nounce- ment date Solicitation issued or scheduled date SELFRIDGE ......................... MI FUELS MANAGEMENT ..................................................... 8 01-Jun-98 27-Apr-99. SELFRIDGE ......................... MI TRANSIENT AIRCRAFT MAINTENANCE ......................... 8 04-Jun-98 28-Apr-99. SEYMOUR JOHNSON ......... NC TRANSIENT AIRCRAFT MAINTENANCE ......................... 8 12-Nov-97 02-Jul-99. SHAW ................................... SC COMMUNICATION FUNCTIONS ....................................... 3 18-May-99 09-May-00. SHAW ................................... SC LIBRARY .............................................................................

276

Fertilization Increases Below-Ground Carbon Sequestration of Loblolly Pine Plantations  

NLE Websites -- All DOE Office Websites (Extended Search)

FERTILIZATION INCREASES BELOW-GROUND FERTILIZATION INCREASES BELOW-GROUND CARBON SEQUESTRATION OF LOBLOLLY PINE PLANTATIONS K.H. Johnsen 1,2 , J.R. Butnor 1 , C. Maier 1 , R. Oren 3 , R. Pangle 4 , L. Samuelson 5 , J. Seiler 4 , S.E. McKeand 6 , and H.L Allen 6 1 Southern Research Station, USDA Forest Service, 3041 Cornwallis Road, Research Triangle Park, NC 27709, USA 2 email: kjohnsen@fs.fed.us, ph: 919-549-4012, fax: 919-549-4047 3 School of the Environment, Duke University, Durham, NC 27708 4 Dept. of Forestry, Virginia Tech., Blacksburg, VA 24061 5 School of Forestry and Wildlife Sciences, Auburn University, Auburn, AL 36849 6 College of Natural Resources, NC State University, Raleigh, NC 27695 Abstract The extent of fertilization of southern pine forests is increasing rapidly; industrial

277

Microsoft Word - Figure_3_4.doc  

Gasoline and Diesel Fuel Update (EIA)

7 7 None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s A l a b a m a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2002 2003 2002 Figure 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2002-2003 Figure 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2003 (Million Cubic Feet) GOM = Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly and Annual Quantity and Value of Natural Gas Report," and the United States Mineral Management

278

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

6 6 Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:

279

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:

280

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

0 0 Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 2000 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1996-2000 Figure T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a O t h e r S t a t e s 0 1 2 3 4 5 6 7 0 30 60 90 120 150 180 Trillion Cubic Feet Billion Cubic Meters 1996 1997 1998 1999 2000 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012" Coal Consumers in the Manufacturing and Coke Sectors, 2012" "Company Name","Plant Location" "Top Ten Manufacturers" "American Crystal Sugar Co","MN, ND" "Archer Daniels Midland","IA, IL, MN, ND, NE" "Carmeuse Lime Stone Inc","AL, IL, IN, KY, MI, OH, PA, TN, VA, WI" "Cemex Inc","AL, CA, CO, FL, GA, KY, OH, TN, TX" "Dakota Gasification Company","ND" "Eastman Chemical Company","TN" "Georgia-Pacific LLC","AL, GA, OK, VA, WI" "Holcim (US) Inc","AL, CO, MD, MO, MT, OK, SC, TX, UT" "NewPage Corporation","MD, MI, WI" "U S Steel Corporation","AL, IN, MI, MN"

282

U.S. Energy Information Administration | Annual Coal Report 2012  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012 Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Table 25. Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Company Name Plant Location Top Ten Manufacturers American Crystal Sugar Co MN, ND Archer Daniels Midland IA, IL, MN, ND, NE Carmeuse Lime Stone Inc AL, IL, IN, KY, MI, OH, PA, TN, VA, WI Cemex Inc AL, CA, CO, FL, GA, KY, OH, TN, TX Dakota Gasification Company ND Eastman Chemical Company TN Georgia-Pacific LLC AL, GA, OK, VA, WI Holcim (US) Inc AL, CO, MD, MO, MT, OK, SC, TX, UT NewPage Corporation MD, MI, WI U S Steel Corporation AL, IN, MI, MN Other Major Manufacturers Ash Grove Cement Co

283

Category:Utility Rate Impacts on PV Economics By Location | Open Energy  

Open Energy Info (EERE)

Utility Rate Impacts on PV Economics By Location Utility Rate Impacts on PV Economics By Location Jump to: navigation, search Impact of Utility Rates on PV Economics Montgomery, AL Little Rock, AR Flagstaff, AZ Phoenix, AZ Tucson, AZ Arcata, CA LA, CA San Francisco, CA Boulder, CO Eagle County, CO Pueblo, CO Bridgeport, CT Wilmington, DE Miami, FL Tampa, FL Atlanta, GA Savannah, GA Des Moines, IA Mason, IA Boise, ID Chicago, IL Springfield, IL Indianapolis, IN Goodland, KS Wichita, KS Lexington, KY New Orleans, LA Shreveport, LA Boston, MA Baltimore, MD Caribou, ME Portland, ME Detroit, MI Houghton-Lake, MI Traverse City, MI International Falls, MN Minneapolis, MN Kansas City, MO Jackson, MS Billings, MT Greensboro, NC Wilmington, NC Bismarck, ND Minot, ND Omaha, NE Concord, NH Atlantic City, NJ Albuquerque, NM Las Vegas, NV Reno, NV New York, NY

284

EIA - Natural Gas Pipeline Network - Largest Natural Gas Pipeline Systems  

U.S. Energy Information Administration (EIA) Indexed Site

Interstate Pipelines Table Interstate Pipelines Table About U.S. Natural Gas Pipelines - Transporting Natural Gas based on data through 2007/2008 with selected updates Thirty Largest U.S. Interstate Natural Gas Pipeline Systems, 2008 (Ranked by system capacity) Pipeline Name Market Regions Served Primary Supply Regions States in Which Pipeline Operates Transported in 2007 (million dekatherm)1 System Capacity (MMcf/d) 2 System Mileage Columbia Gas Transmission Co. Northeast Southwest, Appalachia DE, PA, MD, KY, NC, NJ, NY, OH, VA, WV 1,849 9,350 10,365 Transcontinental Gas Pipeline Co. Northeast, Southeast Southwest AL, GA, LA, MD, MS, NC, NY, SC, TX, VA, GM 2,670 8,466 10,450 Northern Natural Gas Co. Central, Midwest Southwest IA, IL, KS, NE, NM, OK, SD, TX, WI, GM 1,055 7,442 15,874 Texas Eastern Transmission Corp.

285

Microsoft Word - Moving to a Clean Energy Economy-VA 9 24 09.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Virginia Virginia United States Department of Energy September 24, 2009 2 OVERVIEW: VIRGINIA HAS MAJOR ECONOMIC OPPORTUNITIES IN A CLEAN ENERGY ECONOMY The threat of climate change caused by carbon pollution poses a major challenge to the United States and the world, but it also represents an unprecedented opportunity to create new industries and build a strong, thriving clean energy economy. The clean energy sector is one of the fastest growing industries in the world -- the demand for solar panels and wind turbines, for example, has been growing exponentially over the past few years. Among industrialized nations, the race is on for the clean energy jobs of the future. China is investing $12.6 million per hour in clean energy. Denmark has made significant investments in wind capacity and is now

286

Microsoft Word - DM_VA-#121918-v2-SmartGrid_Comments_--_DOE.DOC  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

COMMENTS OF VERIZON AND VERIZON WIRELESS COMMENTS OF VERIZON AND VERIZON WIRELESS Michael Glover Of Counsel Edward Shakin William H. Johnson VERIZON 1320 North Courthouse Road Ninth Floor Arlington, Virginia 22201 (703) 351-3060 John T. Scott, III William D. Wallace VERIZON WIRELESS 1300 I Street N.W. Suite 400 West Washington, DC 20005 July 12, 2010 TABLE OF CONTENTS Page -i- I. USE OF COMMERCIAL BROADBAND NETWORKS WOULD FACILITATE THE EFFICIENT AND EFFECTIVE IMPLEMENTATION OF SMART GRID TECHNOLOGY. ............................................................................................................... 2 II. RESPONSES TO SPECIFIC QUESTIONS RAISED IN THE REQUEST FOR INFORMATION................................................................................................................

287

File:EIA-Appalach6-WV-VA-LIQ.pdf | Open Energy Information  

Open Energy Info (EERE)

LIQ.pdf LIQ.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 Liquids Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 18.77 MB, MIME type: application/pdf) Description Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 Liquids Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States West Virginia, Virginia File history Click on a date/time to view the file as it appeared at that time.

288

LORNA SUNDBERG INTERNATIONAL CENTER A division of U.Va.'s International Studies Office  

E-Print Network (OSTI)

-5 PM #12;Exploring the Caucasus: The Best of Georgia Polina Oganesyan Sunday, March 24, 1-3 PM Cavalier

Humphrey, Marty

289

NETL Researcher Wins R&D 100 Award Morgantown, W.Va.-The National...  

NLE Websites -- All DOE Office Websites (Extended Search)

oxide fuel cells from R&D Magazine. R&D Magazine held its 49 th annual R&D 100 Awards Banquet, where the awards were presented, on Thursday, October 13, 2011 in Orlando, Fla....

290

Proceedings of the American Control Conference Arlington, VA June 25-27, 2001  

E-Print Network (OSTI)

superheaters is an attemperator which regu- lates the temperature of the steam exiting the secondary su of the steam-water flow). y3-- Steam u3 -- Attemperator Temperature I SprayFlow s.....o ~ ....... [.-_900: Y3: Y4: feedwater flow rate (kg/s), fuel flow rate (kg/s), attemperator spray flow rate (kg/s), air

Marquez, Horacio J.

291

Performance Assessment of the Marathon Power 3kVA Supercapacitor UPS  

Science Conference Proceedings (OSTI)

The objective of this report is to describe and document the operation and performance of the Marathon Power Supercapacitor UPS 120V system. This report will describe the different tests that were conducted and their results to characterize the Supercapacitor UPS system. It will cover voltage sag and swell protection, interruption, recloser, and life cycle capabilities of this system. Additional characterization tests will also be discussed. The Supercapacitor UPS was tested at 50%, 77% and 99% of ...

2012-11-28T23:59:59.000Z

292

Iron carbide on titania surface modified with group VA oxides as Fisher-Tropsch catalysts  

SciTech Connect

Catalysts comprising iron carbide on a surface modified titania support wherein said support comprises a surface modifying oxide of tantalum, niobium, vanadium and mixtures thereof supported on said titania wherein at least a portion of said surface modifying oxide is in a non-crystalline form. These catalysts are useful for Fischer-Tropsch hydrocarbon synthesis reactions. Preferably, at least about 25 wt. % of said surface modifying oxide will be in a non-crystalline form.

Wachs, I. E.; Cherisch, C. C.; Fiato, R. A.

1985-12-17T23:59:59.000Z

293

Design of a 20-kWp photovoltaic concentrator experiment at Fauquier High School, Warrenton, VA  

DOE Green Energy (OSTI)

The design and systems analysis of the photovoltaic concentrator system for Fauquier High School in Warrenton, Virginia, are presented. The system provides both electrical energy from the photovoltaic modules and thermal energy from the cooling of those modules. The dc electrical energy from the photovoltaic modules will be first converted to ac and then used to provide power for lighting in the vocational/technical building and the system control building. The thermal energy collected is stored in a 6500-gallon tank for use in the wintertime to provide heat for a greenhouse located adjacent to the array. The photovoltaic system supplies 20 kWp of electrical power by means of 40 6' wide by 10' long parabolic-cylinder collectors mounted in a polar mode. (WHK)

None

1979-10-18T23:59:59.000Z

294

Cost effective solar hot water system for econo-travel motor hotel located at Hampton, VA  

SciTech Connect

This paper gives the final report of a cost effective solar hot water heating system installed on the Econo-Travel Motor Hotel at 2708 Mercury Boulevard, Hampton, Virginia. The description of the system along with the final cost breakdown, performance data and payback time are given. The payback time for the installed system will be approximately four (4) years instead of the 6.65 years estimated for the proposal. The additional savings is due to the reduction in the peak demand charge since the electric hot water heaters are not required to operate at the same time each morning as the dryers used for the laundry. As called for in the proposal to DOE, the success of the system will be determined by the reduction in the utility cost and reduced use of our fossil fuels. The results shown in the hotel's monthly electricity bills indicate that this goal has been accomplished.

1978-11-01T23:59:59.000Z

295

Microsoft Word - va_Final3a_06-04-032.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

8. Enter mailing address of employer listed in item 7. 9.-11. Enter city, state, and zip code portion of employer's mailing address. 12. Enter Applicant's home or work...

296

Validation of KENO V.a Code for High Flux Isotope Reactor (HFIR)  

Science Conference Proceedings (OSTI)

The core of the High Flux Isotope Reactor (HFIR) is composed of two concentric annular elements, inner and outer, each containing highly enriched uranium fuel as a mixture of triuranium octoxide (U3O8) and aluminum encapsulated within aluminum alloy plates. The fuel plates are of involute shape and the fuel within the plates has a distribution across the plate width. Previous KENO code validation efforts have used a relatively simple single region homogeneous fuel model for each of the two annular regions by assuming that the materials in each were homogenized within the total volume of the fueled region. The computed results have tended to be about 2 to 3% greater than experimentally measured results. To improve computed results, a multi-zone fuel model was developed and used to validate the KENO code.

Primm, Trent [ORNL

2009-01-01T23:59:59.000Z

297

Pseudnim: Ermessenda Elogi de la mentida (o l'emperador no va  

E-Print Network (OSTI)

pornografia i tothom diria la veritat. L'art i les mentides naveguen en aigües turbulentes, de clarobscurs i

Geffner, Hector

298

A VaR Black-Litterman Model for the Construction of Absolute ...  

E-Print Network (OSTI)

rithmic technique is very efficient, outperforming, in terms of both speed and ..... It can be seen that the error term vector ? does not directly enter the Black-

299

Hotel gets 9-month payback on HVAC project. [Midtown Holiday Inn, Richmond, VA  

SciTech Connect

The Midtown Holiday Inn at Richmond, Virginia, recovered its $45,200 investment in heating and cooling modifications in nine months by reducing energy consumption by 43%. Natural gas use was reduced 48% and electricity 25%, while comfort levels were improved. The retrofit involved replacing the old three-pipe design, which traditionally returns both heating and cooling water and is inefficient during fall and spring when both hot and chill water are needed. A new control strategy keeps the chiller and boiler from working simultaneously by alternating the two on 15-minute cycles. The chiller automatically cuts off when outside air goes below 55/sup 0/F, while the boiler shuts off at 75/sup 0/F. (DCK)

Deans, B.

1982-10-11T23:59:59.000Z

300

Proceedings of Human Systems Integration Symposium 2003, Engineering for Usability, Vienna, VA, June 2325, 2003.  

E-Print Network (OSTI)

.S. Usability Engineering for Complex Interactive Systems Development ABSTRACT Usability engineering is a cost. These activities are further explained in Section "Activities in Usability Engineering." Usability engineering interactive systems (Section "Usability Engineering Case Studies: Developing Complex Interactive Systems

Swan II, J. Edward

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Cost effective solar hot water system for econo-travel motor hotel located at Hampton, VA  

DOE Green Energy (OSTI)

This paper gives the final report of a cost effective solar hot water heating system installed on the Econo-Travel Motor Hotel at 2708 Mercury Boulevard, Hampton, Virginia. The description of the system along with the final cost breakdown, performance data and payback time are given. The payback time for the installed system will be approximately four (4) years instead of the 6.65 years estimated for the proposal. The additional savings is due to the reduction in the peak demand charge since the electric hot water heaters are not required to operate at the same time each morning as the dryers used for the laundry. As called for in the proposal to DOE, the success of the system will be determined by the reduction in the utility cost and reduced use of our fossil fuels. The results shown in the hotel's monthly electricity bills indicate that this goal has been accomplished.

Not Available

1978-11-01T23:59:59.000Z

302

Evaluation tests of Abacus 6 kVA utility-interactive inverter  

SciTech Connect

The voltage pattern spectra were analyzed for 100% and 50% pattern ratios and harmonics analyses are provided for the Abacus inverter. The harmonics are compared with those calculated for a simple model with no agreement. AC waveforms and inverter current spectra are given as well as basic electrical data. (LEW)

Landsman, E.E.

1981-08-01T23:59:59.000Z

303

NIST-VA Agreement Leads to New Research on Hearing Aids  

Science Conference Proceedings (OSTI)

... saturation sound pressure level, equivalent input noise level, coherence, battery drain, and ... NIST have the potential to impact the quality of life for a ...

2012-12-14T23:59:59.000Z

304

12th International Conference on Nuclear Engineering Arlington, VA, April 25-29, 2004  

E-Print Network (OSTI)

measurements of the CTE and tensile properties were performed in the BNL hot cell facility equipped with remote the measurements were confined to a hot cell where remote manipulation of the equipment as well as the mechanical handling capabilities. 2.2 Measurements Activation Measurements The irradiated samples were placed

McDonald, Kirk

305

Microsoft Word - DM_VA-#126832-v3-Smart_Grid_Comments_--_DOE...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

OF ENERGY Office of Electricity Delivery and Energy Reliability In the matter of: Smart Grid RFI: Addressing Policy and Logistical Challenges to Smart Grid Implementation...

306

Microsoft Word - BSA NC Items Rev9 draft clean _3_.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

9; (Apr. 2011) 1 of 16 9; (Apr. 2011) 1 of 16 BROOKHAVEN SCIENCE ASSOCIATES, LLC GENERAL TERMS AND CONDITIONS FOR NON-COMMERCIAL ITEMS AT BROOKHAVEN NATIONAL LABORATORY Article 1 Definitions 2 Article 2 Order of Precedence 2 Article 3 Acceptance of Agreement 2 Article 4 Complete Agreement 3 Article 5 Assignment 3 Article 6 Compliance with Laws and Regulations 3 Article 7 Independent Contractor; Hold Harmless 3 Article 8 Notice Regarding Late Delivery 4 Article 9 Inspection and Acceptance 4 Article 10 No Waiver 5 Article 11 New Materials 5 Article 12 Suspect/Counterfeit Items 5 Article 13 Hazardous Material Identification and Material Safety Data 6 Article 14 Title and Risk of Loss 6 Article 15 Warranty 6 Article 16 Payment 7 Article 17 Taxes 7 Article 18 Extras 7

307

OiNC: A Comprehensive CAD Import and Tracking System for Monte Carlo Radiation Transport Calculations  

Science Conference Proceedings (OSTI)

Technical Paper / Special Issue on the 16th Biennial Topical Meeting of the Radiation Protection and Shielding Division / Radiation Transport and Protection

Keith Searson; Fabrice Fleurot; Andrew Cooper; Pat Cowan

308

Microsoft Word - BSA NC Service Rev 8draft clean.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

8; (Apr. 2011) 1 of 21 8; (Apr. 2011) 1 of 21 BROOKHAVEN SCIENCE ASSOCIATES, LLC GENERAL TERMS AND CONDITIONS FOR NON-COMMERCIAL SERVICES AT BROOKHAVEN NATIONAL LABORATORY Section 1 - General Clauses Applicable to Fixed Price and Cost Type Agreements. .................................................... 2 Article 1.1 Definitions......................................................................................................................................... 2 Article 1.2 Order of Precedence .......................................................................................................................... 2 Article 1.3 Acceptance of Agreement ................................................................................................................. 2

309

Microsoft Word - DOE-ID-12-007 NC State EC.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

7 7 SECTION A. Project Title: A High Resolution Digital System in Support of Neutron Imaging at the PULSTAR Reactor - North Carolina State University SECTION B. Project Description The objective of this project is to establish t he capability of high resolution digital neutron imaging at the North Carolina State University (NCSU) PULSTAR reactor. It will be integrated into the existing neutron imaging facility at PULSTAR, and it will be supported by the user facility structure of the Nuclear Reactor Program at NCSU. SECTION C. Environmental Aspects / Potential Sources of Impact The action consists of funding the purchase of equipment and instruments for an existing program. The action would not create additional environmental impacts above those already occurring at the university.

310

2012 SG Peer Review - Day 2 Panel Discussion: Rogelio Sullivan, NC State University  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FREEDM Systems Center FREEDM Systems Center Future Renewable Electric Energy Delivery and Management Rogelio Sullivan Managing Director 2 * To develop an efficient and interactive power grid: * Utilizing revolutionary power electronics technology and information technology * Integrating distributed and scalable renewable energy sources and energy storage with existing power systems * Automate the management of load, generation and storage To create the "Energy Internet" Vision A Global Partnership Industry Membership Pre-College Middle & High Schools US Universities An Engine for Change Driven By: * Focused Research * Industry Participation * Comprehensive Education Programs * Innovation and Technology Commercialization International Comprehensive University Education

311

Microsoft Word - BSA_NC_Items_Rev6 eVerify Final.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

6; (Jan. 2010) 1 of 13 6; (Jan. 2010) 1 of 13 ATTACHMENT A BROOKHAVEN SCIENCE ASSOCIATES, LLC GENERAL TERMS AND CONDITIONS FOR NON-COMMERCIAL ITEMS AT BROOKHAVEN NATIONAL LABORATORY Article 1 Definitions 2 Article 2 Order of Precedence 2 Article 3 Acceptance of Agreement 2 Article 4 Complete Agreement 3 Article 5 Assignment 3 Article 6 Compliance with Laws and Regulations 3 Article 7 Independent Contractor; Hold Harmless 3 Article 8 Notice Regarding Late Delivery 3 Article 9 Inspection and Acceptance 4 Article 10 No Waiver 4 Article 11 New Materials 5 Article 12 Suspect/Counterfeit Items 5 Article 13 Hazardous Material Identification and Material Safety Data 6 Article 14 Title and Risk of Loss 6 Article 15 Warranty 6 Article 16 Payment 6 Article 17 Taxes 7 Article 18 Extras 7

312

E2E Voting Systems-A State Perspective-NC  

Science Conference Proceedings (OSTI)

... Page 14. as they are reported to the state. The improvement in speed of reporting has proven very poplar with the media and the general public. ...

2012-05-02T23:59:59.000Z

313

Quiet unlined HVAC ductwork: Using active silencing to obtain NC?35 in buildings without fibrous materials  

Science Conference Proceedings (OSTI)

Fan noise in HVAC ducts has traditionally been attenuated with fibrous internal duct liner or with passive silencers constructed with porous fill material. Now

Steve Wise; Lawrence J. Gelin; Kirk G. Burlage; Susan H. Dineen

1995-01-01T23:59:59.000Z

314

An intelligent NC program processor for CNC system of machine tool  

E-Print Network (OSTI)

8] John K.Ousterhout, Tcl and the Tk Toolkit, Addisonis further implemented in TCL, an embedded script languageMachining Function, EBNF, TCL 1 INTRODUCTION In the CNC

Liu, Y; Guo, X; Li, W; Yamazaki, K; Kashihara, K; Fujishima, M

2007-01-01T23:59:59.000Z

315

NAME: Little Oyster Creek Sanctuary LOCATION: Lower Neuse River in Pamlico Sound, Pamlico County, NC  

E-Print Network (OSTI)

is itself unstable, and evolves at long times into an essentially isotropic mound morphology which, pyramid or mound- like features. Their lateral size ~ is found to increase according to a power law. A second characteristic is the slope of the mounds' hillsides s, which - varying for different materials

US Army Corps of Engineers

316

1. ,,,, @1990"N,C60, C70,,,,,,,<...Sk'Y`fZqt[OE",--"I,  

E-Print Network (OSTI)

,?·,·,?,·,é,?·CT = 3200 K,?OE?^õS?,?^?"®,?,æ,Á,?^?·«`?·\\`¢,?,?·Ï»,ªSÏZ@,³,ê,½·DFig. 2,?T = 3200 K,?OEvZZOE·\\`¢,ª,æ,-·ª,©,é,æ,¤,?·ªZq,?DFig. 2(a) ,?,Í·C,·,?,?,?OE?^õ

Maruyama, Shigeo

317

OIT 2007-08 Annual Report 1 NC State University Office of Information Technology  

E-Print Network (OSTI)

missions. The OIT merger formalized the relationship between high performance computing (HPC) and virtual

318

Microsoft Word - BSA_NC_Service_Rev5 eVerify Final.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

AT BROOKHAVEN NATIONAL LABORATORY Section 1 - General Clauses Applicable to Fixed Price and Cost Type Contracts. ...2 Article 1.1...

319

.NC STATE Physics. www.physics.ncsu.edu NORTH CAROLINA STATE UNIVERSITY  

E-Print Network (OSTI)

Astrophysics, Atomic, Biophysics, Computational, Materials, Molecular, Nanoscale, Nuclear, Optics, Particle Carolina State University is located in Raleigh, the capital city of North Carolina and one corner covers most areas of forefront physics research Experimental: Atomic Physics and Quantum Optics

320

Implementing a mathematical model for locating EMS vehicles in Fayetteville, NC  

Science Conference Proceedings (OSTI)

Emergency medical services (EMS) aims to reduce the elapsed time to respond to an emergency. The number and location of vehicles within the service area, directly affect the attainment of this goal. In this paper, we focus on a mathematical modeling ... Keywords: bicriterion, covered demand, expected coverage, set covering

Asad Tavakoli; Constance Lightner

2004-08-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Microsoft Word - DOE-ID-13-034 NC State B1-31.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

4 SECTION A. Project Title: A Positron Microprobe Spectrometer for Defects and Nano-Vacancy Characterization in Materials - North Carolina State University SECTION B. Project...

322

NAME City State Zip Aaron, Jeremy Tyler Winston Salem NC 27104  

E-Print Network (OSTI)

, Petersham, Massachusetts 01366 (L.S., C.M.S.); and The Arnold Arboretum of Harvard University, Jamaica Plain AND METHODS Plant Material From June 2002 to August 2002 at Harvard Forest in Petersham, Massachusetts (429548

Almor, Amit

323

New large-Nc relations among the nucleon and nucleon-to-Delta GPDs  

SciTech Connect

We establish relations which express the generalized parton distributions (GPDs) describing the N {yields} {Delta} transition in terms of the nucleon GPDs. These relations are based on the known large-N{sub c} relation between the N {yields} {Delta} electric quadrupole moment and the neutron charge radius, and a newly derived large-N{sub c} relation between the electric quadrupole (E2) and Coulomb quadrupole (C2) transitions. Namely, in the large-N{sub c} limit we find C2=E2. The resulting relations among the nucleon and N {yields} {Delta} GPDs provide predictions for the N {yields} {Delta} electromagnetic form factors which are found to be in very good agreement with experiment for moderate momentum transfers.

Marc Vanderhaeghen; Vladimir Pascalutsa

2006-11-15T23:59:59.000Z

324

I Nc~vPPt~rleNuinber I 661-615-4630  

E-Print Network (OSTI)

these circurnstanccs, pursuant to Seeti011 1769 (a1 (21, CEC Staff havc the nutharity to approve the proposed chfinge~nditionsuf certification,pursuar-ttto 5rrlion 1769 (a) (2), CEC Staff havc the authority to approve thc proposed rhatlge

325

Baryons and baryonic matter in the large Nc and heavy quark limits  

E-Print Network (OSTI)

This paper explores properties of baryons and finite density baryonic matter in an artificial world in which N[subscript c], the number of colors, is large and the quarks of all species are degenerate and much larger than ...

Cohen, Thomas D.

326

MANUFACTURER OF THE FIRST 100% ROOM TEMPERATURE nc-Si SOLAR PV ...  

Nanoparticle quantum conf. Monolithic printed layers. Sintering min. ~400 C. PV Effic.: 5 19%. Economic Advantages ...

327

Inspection of aluminum components from freeze desalting facility at Wrightsville Beach, NC  

DOE Green Energy (OSTI)

An inspection was made of a freeze-type desalting pilot plant that has operated for approximately four years. The purpose of this inspection was to document the seawater service experience of the various aluminum alloys present in the plant. The components inspected include two tube-type heat exchangers, one plate-type heat exchanger, and the freezing compartment. Photographs are used to illustrate the corrosion behavior of these components.

Melton, D.G.; Lee, T.S.

1980-02-01T23:59:59.000Z

328

Nepal's New Political Landscape  

E-Print Network (OSTI)

not woken up to the new reali- ties. The popular mandate was not for a one-party mi- nority administration but for cooperation on a path for peace and change. The Nepali Congress (NC) and Communist Party of Nepal (Unified Marxist-Leninist, UML) went... - pects concrete rewards. The party has yet to secure leadership of the transitional government, and, even when it does, will have to manage a coalition or mi- nority administration while facing high expectations and problems so serious (not least...

International Crisis Group

2008-07-03T23:59:59.000Z

329

Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P

2003-01-01T23:59:59.000Z

330

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...

331

Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...

332

A FUNDAMENTAL REAKTHROUGH IN HEAT TRANSFER TE HNOLOGY FOR MI ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION

333

MI ROFA RI ATED FIELD ALI RATION ASSEM LY  

Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as

334

MI ROFA RI ATED FIELD ALI RATION ASSEM LY  

Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake

335

Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)

336

Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael

2008-01-01T23:59:59.000Z

337

NEVADA BUREAU OF MINES AND GEOLOGY SPECIAL PUBLICATION MI-1996  

E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.

338

NEVADA BUREAU OF MINES AND GEOLOGY SPECIAL PUBLICATION MI-1994  

E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.

339

Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...

340

Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...

342

Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...

343

Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...

344

Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...

345

Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...

346

Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...

347

Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...

348

Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...

349

St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...

350

Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...

351

Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...

352

St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...

353

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...

354

Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...

355

Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...

356

Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...

357

Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...

358

ENERGY SURETY MI ROGRID - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment assists in planning and analysis of potential risks

359

miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha

2012-01-01T23:59:59.000Z

360

Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

0 Structural and Geographic Characteristics of Homes in South Region, Divisions, and States, 2009" 0 Structural and Geographic Characteristics of Homes in South Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"South Census Region" ,,,"South Atlantic Census Division",,,,,,"East South Central Census Division",,,"West South Central Census Division" ,,,,,,,,,"Total East South Central",,,"Total West South Central" ,"Total U.S.1 (millions)",,"Total South Atlantic" "Structural and Geographic Characteristics",,"Total South",,,,,"DC, DE, MD, WV",,,,"AL, KY, MS",,,"AR, LA, OK" ,,,,"VA","GA","FL",,"NC, SC",,"TN",,,"TX"

362

AEM.01400-10v1.pdf  

NLE Websites -- All DOE Office Websites (Extended Search)

Oct 8, 2010 rmk Oct 8, 2010 rmk Phylogenetic, microbiological and glycoside hydrolase diversity within the extremely thermophilic, plant biomass-degrading genus Caldicellulosiruptor 5 Sara E. Blumer-Schuette, Derrick L. Lewis # , and Robert M. Kelly * Department of Chemical and Biomolecular Engineering, North Carolina State University, Raleigh, NC 27695-7905 # Present address: Novozymes Biologicals, Salem, VA 10 Submitted to: Applied and Environmental Microbiology (June, 2010) Running title: Plant biomass deconstruction by Caldicellulosiruptor species 15 Keywords: Caldicellulosiruptor, extreme thermophile, plant biomass, glycoside hydrolases *Address correspondence to: Robert M. Kelly 20 Department of Chemical and Biomolecular Engineering

363

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

0 Computers and Other Electronics in Homes in South Region, Divisions, and States, 2009" 0 Computers and Other Electronics in Homes in South Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"South Census Region" ,,,"South Atlantic Census Division",,,,,,"East South Central Census Division",,,"West South Central Census Division" ,,,,,,,,,"Total East South Central",,,"Total West South Central" ,"Total U.S.1 (millions)",,"Total South Atlantic" ,,"Total South",,,,,"DC, DE, MD, WV",,,,"AL, KY, MS",,,"AR, LA, OK" "Computers and Other Electronics",,,,"VA","GA","FL",,"NC, SC",,"TN",,,"TX"

364

Microsoft Word - DM_VA-#126832-v3-Smart_Grid_Comments_--_DOE_--_Policy_and_Logistical_Challenges.DOC  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

UNITED STATES DEPARTMENT OF ENERGY Office of Electricity Delivery and Energy Reliability In the matter of: Smart Grid RFI: Addressing Policy and Logistical Challenges to Smart Grid Implementation 75 FR 57006 COMMENTS OF VERIZON AND VERIZON WIRELESS Michael Glover Of Counsel Edward Shakin William H. Johnson VERIZON 1320 North Courthouse Road Ninth Floor Arlington, Virginia 22201 (703) 351-3060 John T. Scott, III William D. Wallace VERIZON WIRELESS 1300 I Street N.W. Suite 400 West Washington, DC 20005 November 1, 2010 As the Department of Energy (DOE) correctly notes, Smart Grid technology that "better integrates information, communication, and intelligent control technology [] into the nation's electrical system" holds "significant promise."

365

2 0 1 0 va n g u a r d 1 vanguardCOLLEGE OF HUMAN ENVIRONMENTAL SCIENCES 2010  

E-Print Network (OSTI)

Symposium on Fiber Recycling and has done much research on textile recycling and the disposal of what we and Elm Streets.The historic marker was positioned close to the ground, where it became obscured by layers of time and thought into my project ...it wasn't something I took lightly," saysTobin, who spent her

Taylor, Jerry

366

Conditional Volatility and Correlations of Weekly Returns and the VaR Analysis of 2008 Stock Market  

E-Print Network (OSTI)

intensive and requires in- tradaily observations. Although, intradaily observations are becoming increas- ingly available across a large number of assets, it would still be desirable to work with a version of ~rit that does not require intradaily... Consider a portfolio based on the m assets with the return vector rt using the m #2; 1 vector of pre-determined weights, wt#0;1. The return on this portfolio is given by #26;t = w 0 t#0;1rt: (19) Suppose that we are interested in computing the capital Value...

Pesaran, M Hashem

367

HIEU 124GS/VA 122EGS: The City in Renaissance Italy Revelle in Rome--Summer 2011  

E-Print Network (OSTI)

Spagna (4 hrs) 6/30 Thursday (Ancient Rome): S. Pietro in Vincoli, *Capitoline Museum, Crypta Balbi (4, "The Planning of Renaissance Rome" (Handout) Th 6/30 8:30 AM- 1:00 PM Ancient Rome: *Crypta Balbi

Tsien, Roger Y.

368

HIEU 124GS/VA 122EGS: The City in Renaissance Italy Revelle and Renaissance in Rome--Summer 2012  

E-Print Network (OSTI)

/04 Wed (Anc/Ren Rome): S.Pietro in Vincoli,*Capitoline Museum,*Crypta Balbi (4 hrs) 7/06 Friday (Walking/04 Anc/Ren Rome: S.Pietro in Vincoli, Capitoline Museum, Crypta Balbi Medieval Rome: From the Renaissance

Russell, Lynn

369

HIEU 124GS/VA 122EGS: The City in Renaissance Italy Revelle and Renaissance in Rome--Summer 2013  

E-Print Network (OSTI)

, Capitoline Museum, Crypta Balbi Medieval Rome: From the Renaissance of the Twelfth Century to the Avignon

Blanco, Philip R.

370

Reprinted from: Trends in new crops and new uses. 2002. J. Janick and A. Whipkey (eds.). ASHS Press, Alexandria, VA.  

E-Print Network (OSTI)

trade deficits, create jobs in rural areas, reduce air pollution, and reduce global climate change or by microbial conversion of biomass materials through fermentation. In 1995, about 93% of the ethanol sugars, one of the most common being glucose. Therefore, biomass materials containing high levels

Laughlin, Robert B.

371

WINSURE: A NEW WINDOWS INTERFACE TO THE SURE PROGRAM Ricky W. Butler, NASA Langley Research Center, Hampton, Va  

E-Print Network (OSTI)

is used: 1,2 = 0.0001; This defines a slow exponential transition from state 1 to state 2 with rate 0, the last statement defines a transition from state 7 to state 8 with rate LAMBDA. If the transitionSURE program (See CREATE button), though the more powerful Emacs text editor is recommended. The states

Butler, Ricky W.

372

Cost effective solar hot water system for Econo-Travel Motor Hotel located at Woodbrdge, VA. Final report  

SciTech Connect

The final report of a cost effective solar hot water heating system installed on the Econo-Travel Motor Hotel at 13317 Gordon Boulevard, Woodbridge, Virginia is given. The description of the system along with the final breakdown, performance data and payback time are given. The payback time for the installed system will be approximately four (4) years instead of the 7.2 years estimated for the proposal. The additional savings is due to the reduction in the peak demand charge since the electric hot water heaters are not required to operate at the same time each morning as the dryers used for the laundry. As called for in the proposal to DOE, the success of the system will be determined by the reduction in the utility cost and reduced use of our fossil fuels. The results shown in the hotel's monthly electricity bills indicate that this goal has been accomplished.

1978-11-01T23:59:59.000Z

373

Meeting of the Society for Machinery Failure Prevention Technology, March 30 April 2, 1998, Cavalier Hotel, Virginia Beach, VA.  

E-Print Network (OSTI)

organization. The fabrication plant is located in Hillsboro, Oregon (approximately 15 miles from Portland associated with resin mixing, resin transfer molding, prepregging, filament winding, and composite layup

Giurgiutiu, Victor

374

of Homeownership. Center for Community Capitalism: Chapel Hill, NC. Community Advantage Panel Study: Social Impacts of Homeownership  

E-Print Network (OSTI)

This working paper presents our theoretical approach to the study of the social impacts of homeownership. Previous studies of these social impacts have primarily focused on basic differences in economic and social outcomes or psychological status between owners and renters without providing insight into how homeownership brings about these outcomes. In an extensive review of literature on the social impact of homeownership, Rohe, McCarthy and Van Zandt (2000) identified two major shortcomings of existing research. Their first conclusion was that future research needs to do a better job of identifying processes or mechanisms through which homeownership influences the different social variables of interest. Second, they concluded that future research needs to do a better job of addressing the self-selection bias inherent in research on the impacts of homeownership. That is, these studies have been unable to isolate the effects of homeownership, making it impossible to know if the attitudes, behaviors, and social outcomes of owners are the result of homeownership or if people who hold such attitudes or are likely to experience such social outcomes are more likely to become homeowners. We propose to address these shortcomings of previous research in three ways. First, we use current social-psychological theories of rational action, the Theory of

Michael Hubbard Phd; Walter Davis; Michael Hubbard; Walter Davis

2002-01-01T23:59:59.000Z

375

Microsoft Word - DOE-ID-12-038 NC State EC B3-6 B3-10.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

8 8 SECTION A. Project Title: Nanostructured Fe-Cr Alloys for Advanced Nuclear Energy Applications - North Carolina State University SECTION B. Project Description This project will optimize alloy design and microstructure engineering of nanostructured ferritic alloys (NFAs) to increase their irradiation damage tolerance. The synthesis method will use mechanical alloying (MA) as is used for Y-Ti-O alloys. The research plan components are based on MA synthesis using high energy Spex ball mills, microstructure and mechanical property characterization, ion-irradiation testing and modeling. SECTION C. Environmental Aspects / Potential Sources of Impact Chemical Use/Storage - Chemicals are stored and used in accordance with the rules set by the Environmental and Health Safety office

376

3511 Ivy Commons Dr., Apt 302 ttian2@ncsu.edu Raleigh, NC 27606 515-708-5624  

E-Print Network (OSTI)

Jilin University, Changchun, China B.S. Polymer Science and Engineering GPA:3.79/4.0, June 2009 microscopy, SEM and TEM. · Formulated drug delivery system by encapsulating active drugs inside the polymer and surface charge distribution of particles by DLS. Jilin University, Changchun, China Research Assistant

Velev, Orlin D.

377

Microsoft Word - DOE-ID-12-038 NC State EC B3-6 B3-10.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Chemical Waste Disposal - Chemical waste consists of discarded powders for ball milling and chemicalssolvents used for preparation of microscopy samples and sample...

378

) Annu. Rev. Energy Environ. 1993. 18:567-630 Copyright @ 1993 by Annual Reviews 1nc. All rights reserved  

E-Print Network (OSTI)

to convert the biomass to fuel: biochemical or thermochemical. Second-generation ethanol or butanol would-generation thermochemical biofuels Thermochemical biomass conversion involves processes at much higher temperatures of process steps for thermochemical biofuels production Raw Biomass Gasification Drying Sizing Water Gas

379

Substituent Effects In a Series of 1,7-C60(RF)2 Compounds (RF = CF3, C2F5, n-C3F7, i-C3F7, n-C4F9, s-C4F9, n-C8F17): Electron Affinities, Reduction Potentials, and E(LUMO) Values Are Not Always Correlated  

SciTech Connect

Substituent effects are of paramount importance in virtually all fields of fundamental and applied chemistry. Classical and modern examples can be found in organic chemistry (Hammett parameters and Charton steric parameters), inorganic chemistry (trans effect and trans influence), organometallic chemistry (phosphine cone angles), physical chemistry (linear free energy relationships and DFT), biochemistry (protein tertiary structure), medicinal chemistry (SAR maps and BioMAP analysis), polymer chemistry (nonlinear optical and permeation properties and glass transition temperatures), and materials chemistry (stability and luminescent properties of electroluminescent devices and light-to-power conversion efficiencies of fullerene-derivative-based OPV devices).

Kuvychko, Igor V.; Whitaker, James B.; Larson, Bryon W.; Folsom, Travis; Shustova, Natalia; Avdoshenko, Stanislav; Chen, Yu-Sheng; Wen, Hui; Wang, Xue B.; Dunsch, Lothar; Popov, Alexey A.; Boltalina, Olga V.; Strauss, Steven H.

2012-05-01T23:59:59.000Z

380

Environmental assessment of remedial action at the Slick Rock uranium mill tailings sites, Slick Rock, Colorado. Revision 1  

SciTech Connect

The Uranium Mill Tailings Radiation Control Act of 1978 (42 USC {section}7901 et seq.), hereafter referred to as the UMTRCA, authorized the US Department of Energy (DOE) to clean up two uranium mill tailings processing sites near Slick Rock, Colorado, in San Miquel County. Contaminated materials cover an estimated 63 acres of the Union Carbide (UC) processing site and 15 ac of the North Continent (NC) processing site. The sites are within 1 mile of each other and are adjacent to the Dolores River. The sites contain concrete foundations of mill buildings, tailings piles, and areas contaminated by windblown and waterborne radioactive tailings materials. The total estimated volume of contaminated materials is approximately 621,300 cubic yards (yd{sup 3}). In addition to the contamination in the two processing site areas, four VPs were found to contain contamination. As a result of the tailings being exposed to the environment, contamination associated with the UC and NC sites has leached into shallow ground water. Surface water has not been affected. The closest residence is approximately 0.3 air mi from either site. The proposed action is to remediate the UC and NC sites by removing all contaminated materials within the designing site boundaries or otherwise associated with the sites, and relocating them to, and stabilizing them at, a location approximately 5 road mi northeast of the sites on land administered by the Bureau of Land Management (BLM).

1994-09-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Remedial action plan and site design for stabilization of the inactive uranium mill tailings sites at Slick Rock, Colorado. Remedial action selection report, Appendix B  

Science Conference Proceedings (OSTI)

The Slick Rock uranium mill tailings sites are located near the small town of Slick Rock, in San Miguel County, Colorado. There are two designated UMTRA sites at Slick Rock, the Union Carbide (UC) site and the North Continent (NC) site. Both sites are adjacent to the Dolores River. The UC site is approximately 1 mile (mi) [2 kilometers (km)] downstream of the NC site. Contaminated materials cover an estimated 55 acres (ac) [22 hectares (ha)] at the UC site and 12 ac (4.9 ha) at the NC site. The sites contain former mill building concrete foundations, tailings piles, demolition debris, and areas contaminated by windblown and waterborne radioactive materials. The total estimated volume of contaminated materials is approximately 620, 000 cubic yards (yd{sup 3}) [470,000 cubic meters (m{sup 3})]. In addition to the contamination at the two processing site areas, four vicinity properties were contaminated. Contamination associated with the UC and NC sites has leached into groundwater.

Not Available

1993-07-01T23:59:59.000Z

382

DRAFT COMMITTEE REPORT RENEWABLE ENERGY PROGRAM  

E-Print Network (OSTI)

. Bunton Wilkes County Poultry Statesville, NC Mark E. Bramlett Pilgrim's Pride Sanford, NC Samuel A. Brown

383

Environmental assessment of remedial action at the slick rock Uranium Mill Tailings sites Slick Rock, Colorado  

SciTech Connect

The Uranium Mill Tailings Radiation Control Act of 1978 (42 USC {section} 7901 et seq.), hereafter referred to as the UMTRCA, authorized the U.S. Department of Energy (DOE) to clean up two uranium mill tailings processing sites near Slick Rock, Colorado, in San Miguel County. The purpose of the cleanup is to reduce the potential health effects associated with the radioactive materials remaining on the sites and on vicinity properties (VPs) associated with the sites. Contaminated materials cover an estimated 55 acres of the Union Carbide (UC) processing site and 12 ac of the North Continent (NC) processing site. The total estimated volume of contaminated materials is approximately 61 8,300 cubic yards. In addition to the contamination in the two processing site areas, four VPs were found to contain contamination. As a result of the tailings being exposed to the environment, contamination associated with the UC and NC sites has leached into shallow ground water. Surface water has not been affected. The closest residence is approximately 0.3 air mi from either site. The proposed action is to remediate the UC and NC sites by removing all contaminated materials within the designated site boundaries or otherwise associated with the sites, and relocating them to, and stabilizing them at, a location approximately 5 road mi (8 km) northeast of the sites on land administered by the Bureau of Land Management (BLM). Remediation would be performed by the DOE`s Uranium Mill Tailings Remedial Action (UMTRA) Project. All solid contaminated materials would be buried under 5 feet (ft) of rock and soil materials. The proposed disposal site area is currently used by ranchers for cattle grazing over a 7-month period. The closest residence to the proposed disposal site is 2 air mi. An estimated 44 ac of land would be permanently transferred from the BLM to the DOE and restricted from future use.

1994-09-01T23:59:59.000Z

384

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

2000 2000 Southern California Gas Co ..................... CA 251,452,001 8.32 Nicor Gas ................................................. IL 221,009,522 6.68 Pacific Gas and Elec Co........................... CA 211,181,852 7.98 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 184,692,129 7.53 Consumers Energy Co ............................. MI 176,663,600 4.76 Michigan Consol Gas Co.......................... MI 136,124,328 5.41 Keyspan Energy Del Co ........................... NY 134,055,940 10.75 Pub Svc Elec and Gas Co........................ NJ 132,611,115 6.32 East Ohio Gas Co .................................... OH 131,187,521 7.49 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 130,622,887 8.82 Peoples Gas Lt and Coke Co................... IL 103,856,141 8.60 Pub Svc Co of Colorado...........................

385

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

5 5 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 138,239,378 5.94 Pub Svc Elec and Gas Co........................ NJ 69,738,220 5.26 Southern California Gas Co ..................... CA 63,758,073 7.26 Pacific Gas and Elec Co........................... CA 58,646,965 7.84 Keyspan Energy Del Co ........................... NY 53,501,565 7.32 Consumers Energy Co ............................. MI 51,663,333 4.26 TXU Gas Distribution................................ TX 48,112,344 5.86 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 45,021,338 7.87 Con Edison Co of New York Inc............... NY 44,076,359 8.02 Michigan Consol Gas Co.......................... MI 40,342,797 5.39 Pub Svc Co of Colorado........................... CO 39,697,152 5.22 East Ohio Gas Co ....................................

386

Better Buildings Neighborhood Program: Indianapolis, Indiana  

NLE Websites -- All DOE Office Websites (Extended Search)

Indianapolis, Indianapolis, Indiana to someone by E-mail Share Better Buildings Neighborhood Program: Indianapolis, Indiana on Facebook Tweet about Better Buildings Neighborhood Program: Indianapolis, Indiana on Twitter Bookmark Better Buildings Neighborhood Program: Indianapolis, Indiana on Google Bookmark Better Buildings Neighborhood Program: Indianapolis, Indiana on Delicious Rank Better Buildings Neighborhood Program: Indianapolis, Indiana on Digg Find More places to share Better Buildings Neighborhood Program: Indianapolis, Indiana on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC

387

Better Buildings Neighborhood Program: Jacksonville, Florida  

NLE Websites -- All DOE Office Websites (Extended Search)

Jacksonville, Jacksonville, Florida to someone by E-mail Share Better Buildings Neighborhood Program: Jacksonville, Florida on Facebook Tweet about Better Buildings Neighborhood Program: Jacksonville, Florida on Twitter Bookmark Better Buildings Neighborhood Program: Jacksonville, Florida on Google Bookmark Better Buildings Neighborhood Program: Jacksonville, Florida on Delicious Rank Better Buildings Neighborhood Program: Jacksonville, Florida on Digg Find More places to share Better Buildings Neighborhood Program: Jacksonville, Florida on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC

388

The Money Point Sustainable Revitalization Plan - Chesapeake, VA by Crisman+Petrus; UVA School of Architecture [EDRA/Places Awards 2007 -- Planning  

E-Print Network (OSTI)

meadow restoration on CITGOs Money Point site. The companymodel. Crisman+Petrus & UVA / Money Point 2007 EDRA/PlacesThe Money Point Sustainable Revitalization PlanChesapeake,

Moffat, David

2007-01-01T23:59:59.000Z

389

Electron trapping by a current vortex F. Bentosela, a;b P. Exner, c;d and V.A. Zagrebnov a;b  

E-Print Network (OSTI)

with the magnetic field due to an electric current forming a localized rotationally symmetric vortex. We show simpler example involves a Pauli electron interacting with a flux tube modelling a vortex magnetic field field Ansatz. To illustrate this point we analyze in this letter the situation where the vortex current

390

Interview du Recteur C. Conti : "Le projet du ministre Marcourt va dans le bon sens pour l'enseignement suprieur" (P7)  

E-Print Network (OSTI)

LINGUISTIQUE Faculté des arts 5-278 Répertoire 2012 Linguistique Les séquences de cours pour les linguistique ­ 120 crédits (4 ans) Total 1re année 2e année 3e année 4e année Total 120 crédits (40 cours) 30 60 crédits (20 cours) LIN1710 Introduction à la linguistique I : Des mots aux énoncés LIN1720

Glineur, François

391

A FULL-ORDER, ALMOST-DETERMINISTIC OPTICAL MATCHING Yu-Chiu Chao, Thomas Jefferson National Accelerator Facility, Newport News, VA 23606  

E-Print Network (OSTI)

to provide input to this algorithm. Preliminary on-line testing on the CEBAF accelerator has positively, the numerical tool for obtaining global solutions, adaptation to realistic matching problems at CEBAF 3.1 Transport Matching at CEBAF In the CEBAF accelerator proper where electron beam passes through 2

392

RF CONTROL REQUIREMENTS FOR THE CEBAF ENERGY UPGRADE C. Hovater, J. Delayen, L. Merminga, T. Powers, C. Reece, Jefferson Lab, Newport News, VA  

E-Print Network (OSTI)

arXiv:physics/000908727Sep2000 MEASURING AND CONTROLLING ENERGY SPREAD IN CEBAF G. A. Krafft, J spread from a CEBAF-type machine to be relatively small; the measured energy spread from CEBAF at 4 Ge, the various subsystems contributing to the energy spread of a CEBAF-type accel- erator are reviewed, as well

393

2011 The NEED Project P.O. Box 10101, Manassas, VA 20108 1.800.875.5029 www.NEED.org 43 How a Photovoltaic CellWorks  

E-Print Network (OSTI)

a Photovoltaic CellWorks Step 1 A slab (or wafer) of pure silicon is used to make a PV cell. The top of the slab electricfield PHOTONS n-type p-type p-n junction POSITIVE CHARGE NEGATIVE CHARGE SUNSTEP 3 PHOTOVOLTAIC CELLS that motivates the energetic electrons out of the cell created when light strikes the PV cell. The phosphorous

Oregon, University of

394

Final report from VFL technologies for the pilot-scale thermal treatment of Lower East Fork Poplar Creek floodplain soils. LEFPC Appendices, Volume 2, Appendix V-A  

Science Conference Proceedings (OSTI)

This document contains information concerning validation of analytical data for the pilot-scale thermal treatment of Lower East Fork Poplar Creek Floodplain soils located at the Y-12 Plant site. This volume is an appendix of compiled data from this validation process.

NONE

1994-09-01T23:59:59.000Z

395

Estimating VaR in crude oil market: A novel multi-scale non-linear ensemble approach incorporating wavelet analysis and neural network  

Science Conference Proceedings (OSTI)

Facing the complicated non-linear nature of risk evolutions, current risk measurement approaches offer insufficient explanatory power and limited performance. Thus this paper proposes wavelet decomposed non-linear ensemble value at risk (WDNEVaR), a ... Keywords: C45, C53, F31, Multi-resolution analysis, Neural networks, Non-linear ensemble algorithm, Value at risk, Wavelet analysis

Kaijian He; Chi Xie; Shou Chen; Kin Keung Lai

2009-10-01T23:59:59.000Z

397

Managing Distributed Temperature Measurements in an Embedded System of a 3-Phase 10 kVA Energy Efficient Switchable Distribution Transformer Employing a Modular Approach  

Science Conference Proceedings (OSTI)

Temperature measurements are one of the most significant factors in condition monitoring and protecting transformers as well as estimating their life expectancy. With switchable transformers, it is also significant to carry out temperature monitoring ... Keywords: Switchable Transformer, Distributed Temperature Measurement, Controller Area Network, Modular Approach

H. A. Dharmawan; S. A. M. Ali

2010-12-01T23:59:59.000Z

398

Project Award Spreadsheets 2010 12 21 1232.xlsx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

City HQ State City HQ State Congressional District(s) Population Recovery Act Funding* Asheville ** NC NC-011 500,000 $209,940 Aspen CO CO-003 5,902 $59,193 Aurora CO CO-007 319,057 $151,800 Baltimore MD MD-002 636,919 $200,000 Baton Rouge LA LA-6 223,689 $200,000 Boston MA MA-009 609,023 $300,000 Casper WY WY-001 54,047 $130,000 Chicago IL IL-005 2,853,114 $300,000 Chula Vista CA CA-051 219,318 $200,000 City and County of Denver CO CO-001 598,707 $210,040 Columbia MO MO-009 100,733 $200,000 Davenport IA IA-001 100,827 $200,000 Delray Beach FL FL-022 64,092 $130,000 Durango CO CO-003 16,416 $58,500 Flint MI MI-005 112,900 $199,814 Fort Wayne IN IN-003 251,591 $195,700 Hailey ID ID-002 7,883 $83,202 Hamilton OH OH-008 62,477 $130,000 Heber** UT UT-002 13,988 $100,000 Hoffman Estates IL IL-008 53,641 $98,556 Lake Worth FL FL-022 35,513

399

Award Recipient of the ENERGY STAR Challenge for Industry Graysburg...  

NLE Websites -- All DOE Office Websites (Extended Search)

Award Recipient of the ENERGY STAR Challenge for Industry Garysburg, NC Facility 8060 NC 46 HWY Garysburg, NC 27831 The Garysburg facility has the capacity to process...

400

SEMIPERMEA LE MEM RANES FOR MI ROMA HINED SILI ON SURFA ES 5 US ...  

co-fabricated filtration system for enhancement of ... increases functionality and integration of micro ... for the U.S. Department of Energys National Nuclear ...

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

May All Good Things Gather Here: Life, Religion and Marriage in a Mi nyag Tibetan Village  

E-Print Network (OSTI)

;#15; #29;#31;#3;#14;#12; 3 #11;#5;#12;#6;#3;#20; #8;#20; #31;#6;#7; #29;#7;#5;8#16;#11;#3; #14; #15;#7;#5;#14;#3;#19;#5;#17;.#7;#5; #5;#14; #14;#5;#7;#8; #5;#7;#8;#11;#12; #6;#5;#20;#5;9 : ?@AB@A : >C?DEFGH@AB@A : CIH@AB@A : EKDLMAB@A : N...

Bkra shis bzang po

2012-01-01T23:59:59.000Z

402

Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

DOE Green Energy (OSTI)

gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.

2006-08-29T23:59:59.000Z

403

ANRV286-MI60-17 ARI 25 May 2006 23:56 The Bacterial  

E-Print Network (OSTI)

Molecular Genetics and Microbiology, University of Texas, Austin, Texas 78712-0231; email: philipl energy-transducing membranes (133). It is widespread within the microbial world and in plants. Homologs

Georgiou, George

404

UCRL-MI-224010 ARM-06-012 ARM's Support for GCM Improvement:...  

NLE Websites -- All DOE Office Websites (Extended Search)

updrafts. Because the total mass of water condensed into clouds is controlled by thermodynamics, a greater number of droplets for the same mass of cloud water means that the...

405

Technical Section: CHuMI viewer: Compressive huge mesh interactive viewer  

Science Conference Proceedings (OSTI)

The preprocessing of large meshes to provide and optimize interactive visualization implies a complete reorganization that often introduces significant data growth. This is detrimental to storage and network transmission, but in the near future could ... Keywords: Interactive visualization, Large meshes, Lossless compression, Out-of-core

Clment Jamin; Pierre-Marie Gandoin; Samir Akkouche

2009-08-01T23:59:59.000Z

406

LAT HING MI RO OPTI AL SWIT H - Home - Energy Innovation ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2013-10084P

407

Classes Are Starting Soon! Prof"..roMI Photography G,aph~ o..,rgn  

E-Print Network (OSTI)

Simone Gori and Val HamburQer, then atthe UnOiersily of FreiburQ in Germany, is a noyel Yariation ofthe .... S~deshows > Mind~Br'" Combiml1iOll of the RO'il1illU_liKed_lilies ""d Enigma Gori and HamburQer

408

Superfund Record of Decision (EPA Region 5): Wash King Laundry, Baldwin, MI, March 1993  

SciTech Connect

This decision document presents the selected remedial action for the Wash King Laundry Superfund site in Baldwin, Pleasant Plains Township, Michigan. The groundwater remedial action consists of the following: groundwater monitoring; deed restrictions; and groundwater extraction with physical/chemical treatment. The lagoon remedial action consists of the following: excavation of contaminated sediments and soils and off-site disposal.

1993-03-01T23:59:59.000Z

409

Characterization of UNUSUAL LATERAL ORGANS : a miRNA regulated F-Box protein  

E-Print Network (OSTI)

between ULO and the HD-ZIP proteins in planta. Anotherof homodomain-leucine zipper (HD-Zip) proteins. Plant SignalKANADI and class III HD-Zip gene families regulate embryo

Smith, Peter Thomas

2009-01-01T23:59:59.000Z

410

Integrated modeling within a Hydrologic Information System: An OpenMI based approach  

Science Conference Proceedings (OSTI)

This paper presents a prototype software system for integrated environmental modeling that provides interoperability between the Consortium of Universities for the Advancement of Hydrologic Science, Inc. (CUAHSI) Hydrologic Information System (HIS) and ... Keywords: Data management, Environmental management, Integrated modeling, Systems analysis

Anthony M. Castronova; Jonathan L. Goodall; Mehmet B. Ercan

2013-01-01T23:59:59.000Z

411

"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

Puertorriquea. Humacao, Puerto Rico: Editorial Furidi,and Colonization of Puerto Rico, 1493-1599. San Juan: Centroand U.S. Imperialism in Puerto Rico. Berkeley: University of

Rivera, Petra Raquel

2010-01-01T23:59:59.000Z

412

"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn.  

E-Print Network (OSTI)

??My dissertation examines entanglements of race, place, gender, and class in Puerto Rican reggaetn. Based on ethnographic and archival research in San Juan, Puerto Rico, (more)

Rivera, Petra Raquel

2010-01-01T23:59:59.000Z

413

Ruofan Wu, Hieu Pham Trung Nguyen and Zetian Mi INTRODUCTION TO LEDs  

E-Print Network (OSTI)

-in-a-Wire Light Emitting Diodes and Prevention Method Nano-electronic Devices and Materials, Electrical Computer., Efficiency droop in nitride-based light-emitting diodes. Physica Status Solidi a-Applications and Materials history. Nature Photonics 2007, 1 (4), 189-192. [4] Holonyak, N., Is the light emitting diode (LED

Barthelat, Francois

414

"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

May ________. A vistas la pornografa. Primera Hora, 22la medida contra la pornografa. El Nuevo Da, 13 Junecomunicacin contra la pornografa. El Nuevo Da, 16 May

Rivera, Petra Raquel

2010-01-01T23:59:59.000Z

415

Informa(on and Resources Water Quality and Mi/ga/on: Bifenthrin and Fipronil  

E-Print Network (OSTI)

strategy, Pesticides fluxes, Surface water, Vineyard Introduction The intensive use of pesticides for crop on the mobilisation of pesticides and total fluxes in surface water. Moreover, the effect of the sampling strategy ranged from 1.0 to 60 g. Effect of sampling strategy on the estimation of pesticides fluxes in the river

Hammock, Bruce D.

416

Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in  

E-Print Network (OSTI)

Universidad Católica de Chile, Santiago 8331010, Chile; b Department of Plant and Soil Sciences, Delaware activated cell sorter (FACS) and extracted total RNA as described previously (9). KNO3 treat- ment induced

Green, Pamela

417

SUSTaINabIlITy PERfORmaNcE ScOREcaRd 1. Reported per 200,000 employee hours worked.  

E-Print Network (OSTI)

30% from 2003-2015 (Target: 143 kBtu/ft2 ) · At least 7.5% of electricity use from renewable sources by 2013 and thereafter · Reduce petroleum-based fuel use in fleet vehicles 20% from 2005-2015 (Target: 31

418

ESS 2012 Peer Review - Impact Study of Value-Added Functionality on Inverters in ESS - Eric Green & Vivek Ramachandran, NC State  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Results (Model Validation) Results (Model Validation) Figure 6: Real and Reactive Power Reference vs. Output Figure 7: IGBT and Diode Loss from Manufacturer (Fuji) Figure 8: IGBT and Diode Loss from Simulation Impact Study of Value-Added Functionality on Inverters in Energy Storage Systems Motivation Power conversion systems (PCS) developers are incorporating value-added functions; little is known about the on overall PCS reliability. Objective Develop electrical models to gain an understanding of the degradation of a PCS and its internal components due to value- added functionality; primarily VAR generation. Investigation and modeling of frequency support applications may be considered as a secondary objective.

419

NC State Chemical Engineering Degrees -PhD Graduation Name NicknameGrad Date Hometown StateUndergrad Chair Initial Employer Employer City State  

E-Print Network (OSTI)

of glacioeustasy and the inferred eustatic record of Exxon. Sequence boundaries are identified by lithologic, gamma of Exxon. However, there are one (O4) or two (the Mays Landing unit at ACGS#4 borehole) additional in the Exxon synthesis. We conclude that the excellent correlation between inferred glacioeustatic lowerings

Velev, Orlin D.

420

Resources, and the United States Environmental Protection AgencyDesigning Rate Structures that Support Your Objectives: Guidelines for NC Water Systems  

E-Print Network (OSTI)

The purpose for these rate setting guidelines is to provide water and wastewater utility managers and technical assistance providers with a framework in setting water and wastewater rates and rate structures that would meet the states and the utilitys policies and objectives. These guidelines provide step by step instructions and necessary information to allow the utility manager to make an informed policy-driven choice on the rate structure design. These guidelines do not provide instruction on how to project revenues and costs and how to calculate rates (dollar amounts) to balance a budget, but references other documents that provide such guidelines. These rate setting guidelines were developed by the Environmental Finance Center at the

unknown authors

2009-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Spectral quantification of nonlinear behaviour of the nearshore seabed and correlations with potential forcings at Duck, N.C., U.S.A  

E-Print Network (OSTI)

Local bathymetric quasi-periodic patterns of oscillation are identified from monthly profile surveys taken at two shore-perpendicular transects at the USACE field research facility in Duck, North Carolina, USA, spanning 24.5 years and covering the swash and surf zones. The chosen transects are the two furthest (north and south) from the pier located at the study site. Research at Duck has traditionally focused on one or more of these transects as the effects of the pier are least at these locations. The patterns are identified using singular spectrum analysis (SSA). Possible correlations with potential forcing mechanisms are discussed by 1) doing an SSA with same parameter settings to independently identify the quasi-periodic cycles embedded within three potentially linked sequences: monthly wave heights (MWH), monthly mean water levels (MWL) and the large scale atmospheric index known as the North Atlantic Oscillation (NAO) and 2) comparing the patterns within MWH, MWL and NAO to the local bathymetric patterns. The results agree well with previous patterns identified using wavelets and confirm the highly nonstationary behaviour of beach levels at Duck; the discussion of potential correlations with hydrodynamic and atmospheric phenomena is a new contribution. The study is then extended to all measured bathymetric profiles, covering an area of 1100m (alongshore) by 440m (cross-shore), to 1) analyse linear correlations between the bathymetry and the potential forcings using multivariate empirical orthogonal functions (MEOF) and linear correlation analysis and 2) identify which collective quasi-periodic bathymetric patterns are correlated with those within MWH, MWL or NAO, based on a (nonlinear) multichannel singular spectrum analysis (MSSA). (...continued in submitted paper)

V. Magar; M. Lefranc; R. B. Hoyle; D. E. Reeve

2011-07-03T23:59:59.000Z

422

NC State Chemical Engineering Degrees -MS Graduation Name NicknameGrad Date Hometown StateUndergrad Chair Initial Employer Employer City State  

E-Print Network (OSTI)

Medaillen ist die Lehramtsstudentin Romy Kinzl von der XXIII. Som- mer-Universiade in Izmir zurückgekehrt

Velev, Orlin D.

423

Superfund record of decision (EPA Region 4): New Hanover County Airport Burn Pit Site, New Hanover County, Wilmington, NC. (First remedial action), September 1992. Final report  

SciTech Connect

The New Hanover site was located on Gardner Road approximately 500 feet west of the New Hanover County Airport terminal, New Hanover, North Carolina. From 1968 to 1979, the site was used for fire-fighter training purposes. During training exercises, jet fuel, gasoline, petroleum storage bottoms, fuel oil, kerosene, and sorbent materials from oil spill cleanup were burned in a pit. During its active years, water from the pit was allowed to flow onto land surfaces. Inspections conducted after the pit was abandoned showed that most of the standing liquid in the pit was water. In addition to the burn pit area, fire-fighting activities resulted in contamination at several other site areas, including an auto burn area; a railroad tank burn area; an aircraft mock-up area; a fuel tank and pipelines area; and two stained soil areas north of the burn pit. The ROD addressed restoration of the aquifer to drinking water quality as a final action for the site. The primary contaminants of concern that affect the soil and ground water were VOCs, including benzene; and metals, including chromium and lead.

Not Available

1992-09-29T23:59:59.000Z

424

Four Minority Universities are 1999 Fossil Energy Grant Winners  

NLE Websites -- All DOE Office Websites (Extended Search)

August 19, 1999 August 19, 1999 Students, Teachers at Four Minority Universities Are 1999 Winners of Fossil Energy Research Grants For students and professors at four minority universities, the upcoming school year will include not only time in the classroom but also work in the research laboratory, looking for answers to such energy problems as air pollution and declining domestic oil production. The four institutions were named today by Energy Secretary Bill Richardson as the 1999 winners in the Department of Energy's annual competition for fossil energy research ideas from the nation's Historically Black Colleges and Universities and Other Minority Institutions. Hampton University, Hampton, VA, took top honors with three proposals selected for funding. Other grants will go to Prairie View A&M University, Prairie View, TX; North Carolina A&T State University, Greensboro, NC; and Florida International University, Miami, FL.

425

Notices 80. Mainestream Finance, Bangor,  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

51 Federal Register 51 Federal Register / Vol. 75, No. 142 / Monday, July 26, 2010 / Notices 80. Mainestream Finance, Bangor, ME, 08-8064-MR. 81. Marine Funding, Inc., South Richmond Hill, NY, 09-9324-MR. 82. Massachusetts Housing Investment Corp, Boston, MA, 09-9073- MR. 83. Member Options LLC, Charlottesville, VA, 10-1754-MRT. 84. Mid Oregon Lending, Inc., Bend, OR, 10-1756-MRT. 85. Midwest Custom Mortgage, Inc., Elgin, IL, 09-9270-MR. 86. Money Connection, Inc., Fairlawn, OH, 09-9273-MR. 87. Money Mortgage Corp., Newark, NJ, 10-1758-MRT. 88. Mortgage Approval Center LLC, Chapel Hill, NC, 10-1759-MRT. 89. Mortgage Direct, Inc., Elmhurst, IL, 10-1761-MRT. 90. Mortgage Options of America, Winchester, MA, 09-9102-MR. 91. Mortgage Security, Inc., East Falmouth, MA, 09-9289-MR.

426

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

0 Fuels Used and End Uses in Homes in South Region, Divisions, and States, 2009" 0 Fuels Used and End Uses in Homes in South Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"South Census Region" ,,,"South Atlantic Census Division",,,,,,"East South Central Census Division",,,"West South Central Census Division" ,,,,,,,,,"Total East South Central",,,"Total West South Central" ,"Total U.S.1 (millions)",,"Total South Atlantic" ,,"Total South",,,,,"DC, DE, MD, WV",,,,"AL, KY, MS",,,"AR, LA, OK" "Fuels Used and End Uses",,,,"VA","GA","FL",,"NC, SC",,"TN",,,"TX" "Total Homes",113.6,42.1,22.2,3,3.5,7,3.4,5.4,7.1,2.4,4.6,12.8,8.5,4.2

427

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

0 Appliances in Homes in South Region, Divisions, and States, 2009" 0 Appliances in Homes in South Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"South Census Region" ,,,"South Atlantic Census Division",,,,,,"East South Central Census Division",,,"West South Central Census Division" ,,,,,,,,,"Total East South Central",,,"Total West South Central" ,"Total U.S.1 (millions)",,"Total South Atlantic" ,,"Total South",,,,,"DC, DE, MD, WV",,,,"AL, KY, MS",,,"AR, LA, OK" "Appliances",,,,"VA","GA","FL",,"NC, SC",,"TN",,,"TX" "Total Homes",113.6,42.1,22.2,3,3.5,7,3.4,5.4,7.1,2.4,4.6,12.8,8.5,4.2

428

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

0 Televisions in Homes in South Region, Divisions, and States, 2009" 0 Televisions in Homes in South Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"South Census Region" ,,,"South Atlantic Census Division",,,,,,"East South Central Census Division",,,"West South Central Census Division" ,,,,,,,,,"Total East South Central",,,"Total West South Central" ,"Total U.S.1 (millions)",,"Total South Atlantic" ,,"Total South",,,,,"DC, DE, MD, WV",,,,"AL, KY, MS",,,"AR, LA, OK" "Televisions",,,,"VA","GA","FL",,"NC, SC",,"TN",,,"TX" "Total Homes",113.6,42.1,22.2,3,3.5,7,3.4,5.4,7.1,2.4,4.6,12.8,8.5,4.2

429

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

0 Household Demographics of Homes in South Region, Divisions, and States, 2009" 0 Household Demographics of Homes in South Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"South Census Region" ,,,"South Atlantic Census Division",,,,,,"East South Central Census Division",,,"West South Central Census Division" ,,,,,,,,,"Total East South Central",,,"Total West South Central" ,"Total U.S.1 (millions)",,"Total South Atlantic" ,,"Total South",,,,,"DC, DE, MD, WV",,,,"AL, KY, MS",,,"AR, LA, OK" "Household Demographics",,,,"VA","GA","FL",,"NC, SC",,"TN",,,"TX" "Total Homes",113.6,42.1,22.2,3,3.5,7,3.4,5.4,7.1,2.4,4.6,12.8,8.5,4.2

430

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

0 Air Conditioning in Homes in South Region, Divisions, and States, 2009" 0 Air Conditioning in Homes in South Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"South Census Region" ,,,"South Atlantic Census Division",,,,,,"East South Central Census Division",,,"West South Central Census Division" ,,,,,,,,,"Total East South Central",,,"Total West South Central" ,"Total U.S.1 (millions)",,"Total South Atlantic" ,,"Total South",,,,,"DC, DE, MD, WV",,,,"AL, KY, MS",,,"AR, LA, OK" "Air Conditioning",,,,"VA","GA","FL",,"NC, SC",,"TN",,,"TX" "Total Homes",113.6,42.1,22.2,3,3.5,7,3.4,5.4,7.1,2.4,4.6,12.8,8.5,4.2

431

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

0 Water Heating in U.S. Homes in South Region, Divisions, and States, 2009" 0 Water Heating in U.S. Homes in South Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"South Census Region" ,,,"South Atlantic Census Division",,,,,,"East South Central Census Division",,,"West South Central Census Division" ,,,,,,,,,"Total East South Central",,,"Total West South Central" ,"Total U.S.1 (millions)",,"Total South Atlantic" ,,"Total South",,,,,"DC, DE, MD, WV",,,,"AL, KY, MS",,,"AR, LA, OK" "Water Heating",,,,"VA","GA","FL",,"NC, SC",,"TN",,,"TX" "Total Homes",113.6,42.1,22.2,3,3.5,7,3.4,5.4,7.1,2.4,4.6,12.8,8.5,4.2

432

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

0 Space Heating in U.S. Homes in South Region, Divisions, and States, 2009" 0 Space Heating in U.S. Homes in South Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"South Census Region" ,,,"South Atlantic Census Division",,,,,,"East South Central Census Division",,,"West South Central Census Division" ,,,,,,,,,"Total East South Central",,,"Total West South Central" ,"Total U.S.1 (millions)",,"Total South Atlantic" ,,"Total South",,,,,"DC, DE, MD, WV",,,,"AL, KY, MS",,,"AR, LA, OK" "Space Heating",,,,"VA","GA","FL",,"NC, SC",,"TN",,,"TX" "Total Homes",113.6,42.1,22.2,3,3.5,7,3.4,5.4,7.1,2.4,4.6,12.8,8.5,4.2

433

Modified Bayer Process for Alumina Removal from Hanford Waste  

AREVA NC Inc. Modified Bayer Process for Alumina Removal from Hanford Waste January 24, 2007 Don Geniesse AREVA NC Inc.

434

PAD District / Refinery Location Total Atmospheric Distillation  

U.S. Energy Information Administration (EIA) Indexed Site

of Last of Last Operation Date Shutdown Table 13. Refineries Permanently Shutdown By PAD District Between January 1, 1990 and January 1, 2013 PAD District I 542,450 GNC Energy Corp Greensboro, NC 3,000 0 a Primary Energy Corp Richmond, VA 6,100 0 a Saint Mary's Refining Co Saint Mary's, WV 4,000 4,480 02/93 03/93 Cibro Refining Albany, NY 41,850 27,000 07/93 09/93 Calumet Lubricants Co LP Rouseville, PA 12,800 26,820 03/00 06/00 Young Refining Corp. Douglasville, GA 5,400 0 07/04 07/04 Sunoco Inc Westville, NJ 145,000 263,000 11/09 02/10 Western Refining Yorktown Inc Yorktown, VA 66,300 182,600 09/10 12/11 Sunoco Inc Marcus Hook, PA 178,000 278,000 12/11 12/11 ChevronUSA Inc Perth Amboy, NJ 80,000 47,000 03/08 07/12 PAD District II 460,315 Coastal Refining & Mktg El Dorado, KS 0 20,000 b Intercoastal Energy Svcs

435

Integration of Molecular Networks in the Shoot Apical Meristem that Controls Floral Specification in Arabidopsis thaliana  

E-Print Network (OSTI)

lycopersicum_miR156b Solanum_lycopersicum_miR156c Sorghum_bicolor_miR156a Sorghum_bicolor_miR156b Sorghum_bicolor_miR156c Sorghum_

Lal, Shruti

2011-01-01T23:59:59.000Z

436

AMENDMENT OF SOLlClTATlONlMODlFlCATlON OF CONTFWCT I 1 CONTRACT ID CODE PAGE I OF 2  

NLE Websites -- All DOE Office Websites (Extended Search)

CONTFWCT I CONTFWCT I 1 CONTRACT ID CODE PAGE I OF 2 PAGES MI10 I See Block 16C I REQ. NO. BWXT Pantex, LLC Route 726, Mt. Athos Road Lynchburg, VA 24506 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUISITIONIPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e l . a , U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 871 85-5400 96. DATED (SEE ITEM 1 1 ) 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 J CODE U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 DE-AC04-00AL66620 1 1 106. DATED (SEE ITEM 1 0 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)

437

The family of terpene synthases in plants: a midsize family of genes for specialized metabolism that is highly diversified throughout the kingdom  

NLE Websites -- All DOE Office Websites (Extended Search)

PLANT PLANT GENOME: AN EVOLUTIONARY VIEW ON STRUCTURE AND FUNCTION The family of terpene synthases in plants: a mid-size family of genes for specialized metabolism that is highly diversified throughout the kingdom Feng Chen 1,* , Dorothea Tholl 2 , Jo ¨ rg Bohlmann 3 and Eran Pichersky 4 1 Department of Plant Sciences, University of Tennessee, Knoxville, TN 37996, USA, 2 Department of Biological Sciences, 408 Latham Hall, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061, USA, 3 Michael Smith Laboratories, 2185 East Mall, University of British Columbia, Vancouver, BC V6T 1Z4, Canada, and 4 Department of Molecular, Cellular and Developmental Biology, University of Michigan, Ann Arbor, MI 48109, USA Received 14 October 2010; revised 19 January 2011; accepted 31 January 2011. * For correspondence (fax +1 865 974 1947; e-mail fengc@utk.edu). SUMMARY Some plant

438

Dislocation density in copper and tantalum after shock loading up to 20-80 GPa  

National Nuclear Security Administration (NNSA)

4: Materials-EOS and Thermodynamic Properties 4: Materials-EOS and Thermodynamic Properties Dislocation Density in Copper And Tantalum After Shock Loading Up To 20-100 GPA A.M. Podurets, M.I. Tkachenko, O.N. Ignatova, A.I. Lebedev, V.V. Igonin, V.A. Raevsky RFNC-VNIIEF, Institute of Physics of Explosion, Sarov, Russia Introduction A microstructure of metals at shock loading is determined by the same processes, which occur at any deformation including a competition of two basic mechanisms of plastic strain - dislocation slip and twinning. The action of a specified mechanism of plastic deformation under the conditions of dynamic loading is usually defined by the help of the analysis of samples recovered after loading. We consider the dislocation structure of two metals having various crystal lattices: face-centered cubic copper and body-

439

AMENDMENT OF SOLICITATIONIMODIFICATION OF CONTRACT I '. CONTRACT ID CODE  

National Nuclear Security Administration (NNSA)

SOLICITATIONIMODIFICATION OF CONTRACT I '. SOLICITATIONIMODIFICATION OF CONTRACT I '. CONTRACT ID CODE BWXT Pantex, LLC Route 726, Mt. Athos Road Lynchburg, VA 24506 PAGE I OF 12 PAGES Albuquerque, NM 871 85-5400 I Amarillo, TX 79120 I I 90. DATED (SEE ITEM 1 1 ) 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code) I 10A. MODIFICATION OF CONTRACTIORDER NO. 2. AMENDMENT/MODIFICATION NO. MI67 9A. AMENDMENT OF SOLICITATION NO. I 1 DE-AC04-00AL66620 100. DATED (SEE ITEM 13) 3. EFFECTIVE DATE See Block 16C Offers must acknowledge receipt of this amendment prior to the hour and date specified in the solicitation as amended, by one of the following methods: (a) By completing Items 8 and 15, and returning - copies of the amendment; (b) By acknowledging receipt of this amendment on each copy of the

440

AMENDMENT OF SOLlClTATlONlMODlFlCATlON OF CONTRACT ID PAGE I OF 2  

NLE Websites -- All DOE Office Websites (Extended Search)

/ ' / ' ID PAGE I OF 2 PAGES - . Albuquerque, NM 87185-5400 I Amarillo, TX 79120 I ( DE-AC04-00AL66620 10B. DATED (SEE ITEM 13) 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code) Babcock & W ~ ~ C O X Technical Services Pantex, LLC 800 Main Street Lynchburg, VA 24505 2 . AMENDMENTIMODIFICATION NO. MI50 9A. AMENDMENT OF SOLICITATION NO. 9B. DATED (SEE ITEM 11) 10A. MODIFICATION OF CONTRACTIORDER NO. Offers must acknowledge receipt of this amendment prior to the hour and date specified in the solicitation as amended, by one of the following methods: (a) By completing Items 8 and 15, and returning - copies of the amendment; (b) By acknowledging receipt of this amendment on each copy of the offer submitted; or (c) By separate letter or telegram which includes a reference to the solicitation and amendment numbers. FAILURE OF YOUR

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Utility-Scale Smart Meter Deployments, Plans & Proposals  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

edisonfoundation.net/IEE edisonfoundation.net/IEE Utility-Scale Smart Meter Deployments, Plans & Proposals April 2010 Utility State Target Number of Meters Notes Resources AEP 1 IN, KY, MI, OH, OK, TX, VA, WV 5,000,000 AEP plans on deploying smart meters to all customers within their service territory and have deployed 10,000 meters to customers in South Bend, IN, and are presently deploying another 700,000 to AEP-Texas customers. Timing for the remaining deployments will depend on specific conditions in each of the seven operating company subsidiaries. AEP Corporate Sustainability Report 2009 2 Allegheny Power MD, PA, WV 700,000 Allegheny launched pilots in Morgantown, WV and Urbana, MD to test smart meters and thermostats (1,140 meters installed). In PA, Act 129 (2008)

442

Presentation-SNL_RICA-CEDS_Peer_Review_v2a.pptx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Systems Systems 2010 Peer Review Alexandria, VA July 20-22, 2010 Co-PI: Jason Stamp, Ph.D. Co-PI: Laurie Phillips Sandia National Laboratories Reliability Impacts for Cyber Attack (RICA) Summary Slide: Reliability Impacts for Cyber Attack (RICA) Outcomes:
Quan&ta&ve
impact
analysis of
cyber
a5acks
against
power
grid control
systems
(that
affect
grid
topology and
opera&ons),
including
poten&al mi&ga&on
steps,
using
reliability
metrics. Analyze
large-scale
cases
using
simula&on soCware
in
a
High-Performance Compu&ng
(HPC)
environment. Roadmap
Challenges:
Develop
evidence- based
business
case
to
increase
and shape
investment
in
control
system security.

443

Data:5ccaa7a7-0863-44b5-98fe-1e44dc285b01 | Open Energy Information  

Open Energy Info (EERE)

ccaa7a7-0863-44b5-98fe-1e44dc285b01 ccaa7a7-0863-44b5-98fe-1e44dc285b01 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Wolverine Pwr Supply Coop, Inc Effective date: 2013/02/26 End date if known: Rate name: Schedule B- General Service (Single Phase) Sector: Description: Available in all territories served by the Association to members with installed transformer capacity of 25 kVa or less subject to the Association's established service rules and reg Source or reference: http://www.dleg.state.mi.us/mpsc/electric/ratebooks/ontonagon/ontonagonmemberregcur.pdf Source Parent: Comments Applicability

444

Microsoft Word - 2007hsn-infocom-paper-lehman-etal.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

2 2 Control Plane Architecture and Design Considerations for Multi-Service, Multi-Layer, Multi- Domain Hybrid Networks Tom Lehman 1 , Xi Yang 1 , Chin P. Guok 2 , Nageswara S. V. Rao 3 , Andy Lake 4 , John Vollbrecht 4 , Nasir Ghani 5 1 Information Sciences Institute East, University of Southern California, Arlington, VA 22203, USA, Email: {tlehman,xyang}@isi.edu 2 Network Engineering Services Group, ESnet, Berkeley, CA 94720, USA, Email: chin@es.net 3 Computer Science and Mathematics Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831, USA, Email: raons@ornl.edu 4 University Corporation for Advanced Internet Development, Internet2, Ann Arbor, MI 48104, USA, Email: {jrv,alake}@internet2.edu 5 Department of Electrical and Computer Engineering, Tennessee Technological University, Cookville, TN 38505, USA,

445

AMENDMENT OF SOLlClTATlONlMODlFlCATlON OF CONTRACT I ' CONTRACT ID CODE  

National Nuclear Security Administration (NNSA)

' ' CONTRACT ID CODE BWXT Pantex, LLC Route 726, Mt. Athos Road Lynchburg, VA 24506 PAGE 1 OF 12 PAGES 9B. DATED (SEE ITEM 11) 5. PROJECT NO. (If applicable) 4. REQUlSlTlONlPURCHASE REQ. NO. 2. AMENDMENTIMODIFICATION NO. MI39 extended. 6. ISSUED BY CODE U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 871 85-5400 3. EFFECTIVE DATE See Block 16C CODE I FACILITY CODE Offers must acknowledge receipt of this amendment prior to the hour and date specified in the solicitation as amended, by one of the following methods: (a) By completing Items 8 and 15, and returning - copies of the amendment; (b) By acknowledging receipt of this amendment on each copy of the

446

AMENDMENT OF SOLlClTATlONlMODlFlCATlON OF CONTRACT ID PAGE I OF 2  

National Nuclear Security Administration (NNSA)

/ ' / ' ID PAGE I OF 2 PAGES - . Albuquerque, NM 87185-5400 I Amarillo, TX 79120 I ( DE-AC04-00AL66620 10B. DATED (SEE ITEM 13) 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code) Babcock & W ~ ~ C O X Technical Services Pantex, LLC 800 Main Street Lynchburg, VA 24505 2 . AMENDMENTIMODIFICATION NO. MI50 9A. AMENDMENT OF SOLICITATION NO. 9B. DATED (SEE ITEM 11) 10A. MODIFICATION OF CONTRACTIORDER NO. Offers must acknowledge receipt of this amendment prior to the hour and date specified in the solicitation as amended, by one of the following methods: (a) By completing Items 8 and 15, and returning - copies of the amendment; (b) By acknowledging receipt of this amendment on each copy of the offer submitted; or (c) By separate letter or telegram which includes a reference to the solicitation and amendment numbers. FAILURE OF YOUR

447

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT BWXT Pantex, LLC  

NLE Websites -- All DOE Office Websites (Extended Search)

BWXT Pantex, LLC BWXT Pantex, LLC Route 726, Mt. Athos Road Lynchburg, VA 24506 . - ~ . ~ - - Albuquerque, NM 87185-5400 I Amarillo, TX 79120 9B. DATED (SEE ITEM 11) CONTRACT ID CODE 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code) DE-AC04-00AL66620 I I IOB. DATED (SEE ITEM 13) PAGE I OF 2 PAGES 2. AMENDMENTIMODIFICATION NO. MI06 9A. AMENDMENT OF SOLICITATION NO. Offers must acknowledge receipt of this amendment prior to the hour and date specified in the solicitation as amended, by one of the following methods: (a) By completing Items 8 and 15, and returning - copies of the amendment; (b) By acknowledging receipt of this amendment on each copy of the offer submitted; or (c) By separate letter or telegram which includes a reference to the solicitation and amendment numbers. FAILURE OF YOUR

448

Data:C3e4018a-013e-463c-9ff9-163e18d1374b | Open Energy Information  

Open Energy Info (EERE)

018a-013e-463c-9ff9-163e18d1374b 018a-013e-463c-9ff9-163e18d1374b No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Wolverine Pwr Supply Coop, Inc Effective date: 2013/02/26 End date if known: Rate name: Schedule B- General Service (Three Phase) Sector: Description: Available in all territories served by the Association to members with installed transformer capacity of 25 kVa or less subject to the Association's established service rules and regulations. Source or reference: http://www.dleg.state.mi.us/mpsc/electric/ratebooks/ontonagon/ontonagonmemberregcur.pdf Source Parent: Comments There is also a surcharge of $1.85/meter/month

449

,"Virginia Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050VA3","N3010VA3","N3020VA3","N3035VA3","N3045VA3" "Date","Natural Gas Citygate Price in Virginia (Dollars per Thousand Cubic Feet)","Virginia Price of...

450

U.S. Department of Energy Categorical Exclusion Determination Form  

NLE Websites -- All DOE Office Websites (Extended Search)

Proiect Title: (0288-1583) Proiect Title: (0288-1583) Arkansas Power Electronics International, Inc. - Highly-Integrated Sic Multichip Power Modules Location: *- Multiple States - AK, TN, NC,MI Proposed Action or Project Description: American Recovery and Reinvestment Act: Funding will support laboratory and bench scale research and development on a Silicon Carbide (Sic) power module to be used in Plug-In Electric Hybrid Vehicles. The proposed work is consistent with the goals of ADEPT: fundamental advances in soft magnetics, high voltage switches, and reliable, high-density charge storage. Proposed work consists entirely of pilot scale RD&D work to be completed in laboratories and facilities controlled by the entities responsible for work under this project; Arkansas Power Electronics International, Inc. and the University of Arkansas in Fayetteville, Arkansas; Oak Ridge National

451

Low-Dose Ionizing Radiation Alters the Epigenome of the Avy Mouse  

NLE Websites -- All DOE Office Websites (Extended Search)

Ionizing Radiation Alters the Epigenome of the A Ionizing Radiation Alters the Epigenome of the A vy Mouse Autumn Bernal 1,2,3 , Dale Huang 1 , Yue Li 4 , Dana Dolinoy 5 , and Randy Jirtle 1 Department of Radiation Oncology 1 , University Program in Genetics and Genomic 2 , Integrated Toxicology & Environmental Health Program 3 , Department of Community and Family Medicine 4 , Duke University Medical Center, Durham, NC, USA, Department of Environmental and Health Sciences, University of Michigan, Ann Arbor, MI, USA 4 Background: Humans have evolved and thrived amidst constant low-dose (0-10 cGy) background radiation exposure from natural sources. Currently, however, the frequency of exposures to low doses of radiation is increasing due to man-made sources such as diagnostic imaging and nuclear power. This increased exposure has led to concerns amongst the general public and the government about the

452

U.S. Spent Nuclear Fuel Data as of December 31,2002 -Table 2  

Gasoline and Diesel Fuel Update (EIA)

6 6 Table 1 | Table 3 Table 2. Nuclear Power Plant Data as of December 31, 2002 Reactor Name State Reactor Type Reactor Vendor a Core Size (number of assemblies) Startup Date (year)b License Expiration (year) Actual Retirement (year) Arkansas Nuclear 1 AR PWR B&W 177 1974 2034 Arkansas Nuclear 2 AR PWR CE 177 1978 2018 Beaver Valley 1 PA PWR WE 157 1976 2016 Beaver Valley 2 PA PWR WE 157 1987 2027 Big Rock Point MI BWR GE 84 1962 2000 1998 Braidwood 1 IL PWR WE 193 1987 2026 Braidwood 2 IL PWR WE 193 1988 2027 Browns Ferry 1 AL BWR GE 764 1973 2013 Browns Ferry 2 AL BWR GE 764 1974 2014 Browns Ferry 3 AL BWR GE 764 1976 2016 Brunswick 1 NC BWR GE 560 1976 2016

453

Advanced composites III: expanding the technology; Proceedings of the Third Annual Conference, Detroit, MI, Sept. 15-17, 1987  

Science Conference Proceedings (OSTI)

The present conference discusses topics in the design features and methods, manufacturing processes, secondary fabrication techniques, and materials science aspects of advanced composites. Attention is given to composite structural armor for ground combat vehicles, composite structures for automotive energy management, CAD/CAM of braided preforms for advanced composites, composite automobile bumper beams, preforming for structural applications, the three-dimensional braiding of thermoplastic composite preforms, and recent advancements in tooling technology. Also discussed are instrument-grade MMCs for imaging IR guidance systems, automated tape layup of a vertical stabilizer fin, the mechanical properties of thermoplastic matrix composites, surface chemistry and adhesion of SMCs, fiber-matrix bonding, and hybrid yarns for high performance thermoplastic composites.

Not Available

1987-01-01T23:59:59.000Z

454

1996 Department of Energy pre-freshman enrichment program at GMI Engineering and Management Institute, Flint, MI  

SciTech Connect

This document reports on a summer program to encourage students to pursue scientific or engineering professions. The topics of the report include a description of the recruitment program, selection criteria for participants, workshops, nine follow up activities, research projects and student`s presentation, and field trips. Course descriptions and schedule are included as appendices.

1996-12-31T23:59:59.000Z

455

Creative Reconstruction in the City: An Analysis of Art, Shrinking, and the Story of the American Dream in Detroit, MI.  

E-Print Network (OSTI)

??A right to the city is a human right that is overlooked in American cities. Cities reflect humanity in collective form, but are manipulated by (more)

Marotta, Stephen J.

2011-01-01T23:59:59.000Z

456

Atliekinio fosfogipso panaudojimas sunki?j? metal? immobilizacijai nuotek? dumble ir dumblo-dirvoemio miiniuose.  

E-Print Network (OSTI)

??Nuotek? dumble esan?i? sunki?j? metal? neigiam? poveik? aplinkai bei mogaus sveikatai galima sumainti apribojant metal? judrum? aplinkoje. Magistro darbe tiriamas sunki?j? metal? judrumas ir j? (more)

Puodi?nas,; Marius

2009-01-01T23:59:59.000Z

457

I Volume 5, Number 2 Spring 1992 A Ne\\izsletter for the RLE Community at MI'T  

E-Print Network (OSTI)

:l XI:~ri:l Ticchi. Inq~tiriesmay he ;~ddrcsscdto: RLE undercurrents Rescarcli Lahor:ltory of Electrc

458

Volume 2, Number 2 June 1989 A Nelr-sletter for the KL,t.: Communitv at MI'1'  

E-Print Network (OSTI)

Lahoratory of Electrc~nicsfor the RLE community at MIT. The following individuals contributed their time ancl

459

LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 2002 Place Time Name Group Group  

E-Print Network (OSTI)

37 192 19:28.7 John Wool 40-49 men 48 193 19:32.4 Jaimin Wan page 7 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS 1st

460

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 1996 Dummy first body page  

E-Print Network (OSTI)

-59 59 668 34:20.7 Seung-yu Rah 30-39 157 669 34:21.4 John Wool 40-49 120 670 34:25.6 Manny Gonzalez 30:42.8 Pete Valerio HISTORY OF LBL RUNAROUND WINNERS

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 14, 1990 Place Time Name Group Group  

E-Print Network (OSTI)

:56.4 John Wool 30­39 105 483 30:00.0 David O'Neill ) Group Time Name Overall Place Place 1 24:24.3 John Magee 373 2 25:41.9 Edward Lofgren 400 HISTORY OF LBL

462

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 22, 1995 Dummy first body page  

E-Print Network (OSTI)

198 16:04.7 Alan Meier 40-49 30 199 16:05.7 John Wool 40-49 31 200 16:07.5 Ginny Lackner 50-59F 1 201 Don Krieger Frances Mann Peter Morley Bob Shilling HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION

463

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 10, 1997 Place Time Name Group  

E-Print Network (OSTI)

Larnon, Frank 50-59 13 156 15:17.4 157 15:18.0 Bartholomew, J 50-59 14 158 15:18.4 Wool, John 40-49 18 159 15 Time Name Group Group Place HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN

464

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 15, 1989 Envel. Time Name Group Group  

E-Print Network (OSTI)

40-49 8 67 12:51.4 Desiderio Kovar Wool 30-39 20 69 12:56.7 Antoine Mensch Envelope Place Number 1 21:59.8 John L. Magee 354 2 26:14.8 Ed Lofgren 427 HISTORY OF LBL RUNAROUND WINNERS

465

LBL RUNAROUND RESULTS 2.95 km (1.84 mi) September 16, 1988 Envelope Time Name Group Group  

E-Print Network (OSTI)

120 14:08.2 Z. Mei 30-39 26 121 14:09.5 John Wool 30-39 27 122 14:10.3 Timothy Edberg 30-39 28 123 14 Time Name Envelope Place Number 1 30:14.0 Peter Endt 447 HISTORY OF LBL RUNAROUND WINNERS Year Distance

466

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 11, 1992 Place Time Name Group Group  

E-Print Network (OSTI)

14:26.2 Barry Freifeld Wool 30-39 39 122 14:28.2 Ken Woolfe 40-49 18 123 14 Williams HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS

467

I Volume 7, Number 2 Spring 1994 A Newsleccer for the RLE Communitv at MI'I'  

E-Print Network (OSTI)

Robert J. Birgeneau, Dean of the School of Science and a principal investigator in RLE's Surfaces has his blue belt in karate. Seventh grader Amanda's bowl~ngteam competed in the state finals

468

Corrosion mechanisms of low level vitrified radioactive waste in a loamy soil M.I. Ojovan1  

E-Print Network (OSTI)

Topic: Briefings by environmental groups, industry groups, pub- lic policy groups, and state, is the central authority responsi- ble for evaluating and supervising the nuclear industry's research and 1.95 meters in diameter. It is fabricated from forged steel with a stainless steel coating. The cask

Sheffield, University of

469

Informa(on and Resources Prac&ces for Mi&ga&ng Urban Pes&cide Runoff  

E-Print Network (OSTI)

. Producers can then use these records to analyze the effectiveness of past pesticide applications a documentation system for determining crop replant, rotation and #12;Pesticide Recordkeeping 2 prePI-20 Pesticide Recordkeeping 1 Michael Aerts, O. Norman Nesheim, and Frederick M. Fishel2 1

Hammock, Bruce D.

470

Former Worker Program - Defunct Beryllium Vendor Screening Program  

NLE Websites -- All DOE Office Websites (Extended Search)

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Wolverine Tube Division (Detroit, MI); National Beryllia (Haskell, NJ);...

471

Beryllium Vender Screening Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Speedring Systems, Inc. (Detroit, MI); Wolverine Tube Division...

472

Microsoft Word - Sample Abstract and Format Instructions.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Dearborn, MI 48128, Wayne State University 2 , Department of Physics and Astronomy, Detroit, MI 48202, Kettering University 3 , Flint, MI 48504, University of Paris-Sud 4 ,...

473

Language Assimilation Today: Bilingualism Persists More Than in the Past, But English Still Dominates  

E-Print Network (OSTI)

Somerset- Hunterdon, NJ Detroit, MI Table 2 Childrens homeSomerset- Hunterdon, NJ Detroit, MI Bergen-Passaic, NJSomerset- Hunterdon, NJ Detroit, MI Appendix Table 2

Alba, Richard

2004-01-01T23:59:59.000Z

474

1 Department of Veterans Affairs Office of Research and ...  

Science Conference Proceedings (OSTI)

... in which countries, VA will pursue international filings. ... 3: Revise VA Patent Policy for more ... finances Develop patent financial policies and metrics ...

2012-10-11T23:59:59.000Z

475

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

08 VA Dept. of Mines, Minerals & Energy EE Pulaski County IPODEE FY 2012 Jason Powers - DOE HQ 802 E Main St., Pulaski, VA Economic Development - Lighting Fixture Replacement...

476

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1006 - 911 Wytheville, VA VA-MD-DC Public E85 Refueling Project Install retail biofuel fueling infrastructure. 10 20 2010 Digitally signed by Steven Richardson Date:...

477

Static pushover analyses of pile groups in liquefied and laterally spreading ground in centrifuge tests  

E-Print Network (OSTI)

AND GEOENVIRONMENTAL ENGINEERING ASCE / SEPTEMBER 2007Special Publication No. 145, ASCE, Reston, Va. Brandenberg,Special Publication No. 145, ASCE, Reston, Va. , 204217.

Brandenberg, Scott J; Boulanger, R W; Kutter, Bruce L; Chang, Dongdong

2007-01-01T23:59:59.000Z

478

Federal Energy Management Program: Case Study - The Department...  

NLE Websites -- All DOE Office Websites (Extended Search)

VA Connecticut Health Care System to someone by E-mail Share Federal Energy Management Program: Case Study - The Department of Veterans Affairs West Haven Campus, VA Connecticut...

479

HIGH VOLTAGE TERMINAL IN COSY ELECTRON COOLER V.A. Chekavinskiy, E.A. Bekhtenev, I.A. Gusev, M.N. Kondaurov, V.R. Kozak, E.A. Kuper, V.R.  

E-Print Network (OSTI)

, and powered by multistage transformer, capable of 15 kW power at 26 kHz. Wireless control is passed through high voltage circumstances. Powering of HVT electronics is provided by cascade transformer acceleration system ­ high voltage terminal. All power and control electronics were placed in a single isolated

Kozak, Victor R.

480

HARVARD SCHOOL OF PUBLIC HEALTH A D VA N C I N G T H E P U B L I C 'S H E A LT H T H R O U G H  

E-Print Network (OSTI)

Alaska, Arizona, California, Hawaii, Nevada, Oregon, Washington, and British Columbia #12;4 An important organizations ­ Energy, utility, and pipeline companies ­ Colleges and universities ­ Trade associations capture ­ Dispatch mode and remaining life ­ Proximity to suitable geologic storage sites and pipelines

Gunawardena, Jeremy

Note: This page contains sample records for the topic "mi nc va" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Selective Catalytic Reduction (SCR) of nitric oxide with ammonia using Cu-ZSM-5 and Va-based honeycomb monolith catalysts: effect of H2 pretreatment, NH3-to-NO ratio, O2, and space velocity  

E-Print Network (OSTI)

In this work, the steady-state performance of zeolite-based (Cu-ZSM-5) and vanadium-based honeycomb monolith catalysts was investigated in the selective catalytic reduction process (SCR) for NO removal using NH3. The aim was to delineate the effect of various parameters including pretreatment of the catalyst sample with H2, NH3-to-NO ratio, inlet oxygen concentration, and space velocity. The concentrations of the species (e.g. NO, NH3, and others) were determined using a Fourier Transform Infrared (FTIR) spectrometer. The temperature was varied from ambient (25 C) to 500 C. The investigation showed that all of the above parameters (except pre-treatment with H2) significantly affected the peak NO reduction, the temperature at which peak NO reduction occurred, and residual ammonia left at higher temperatures (also known as 'NH3 slip'). Depending upon the particular values of the parameters, a peak NO reduction of around 90% was obtained for both the catalysts. However, an accompanied generation of N2O and NO2 species was observed as well, being much higher for the vanadium-based catalyst than for the Cu-ZSM-5 catalyst. For both catalysts, the peak NO reduction decreased with an increase in space velocity, and did not change significantly with an increase in oxygen concentration. The temperatures at which peak NO reduction and complete NH3 removal occurred increased with an increase in space velocity but decreased with an increase in oxygen concentration. The presence of more ammonia at the inlet (i.e. higher NH3-to-NO ratio) improved the peak NO reduction but simultaneously resulted in an increase in residual ammonia. Pretreatment of the catalyst sample with H2 (performed only for the Cu-ZSM-5 catalyst) did not produce any perceivable difference in any of the results for the conditions of these experiments.

Gupta, Saurabh

2003-08-01T23:59:59.000Z

482

In Proceedings Human Systems Integration Symposium 2003, Vienna, VA, June 23-25, 2003. Joseph L. Gabbard, M.S., Deborah Hix, Ph.D., J. Edward Swan II, Ph.D.  

E-Print Network (OSTI)

for Complex Interactive Systems Development ABSTRACT Usability engineering is a cost-effective, user- centered systems (Section "Usability Engineering Case Studies: Developing Complex Interactive Systems"). For each, M.S., Simon J. Julier, Ph.D. Dennis Brown, M.S., Yohan Baillot, M.S. Usability Engineering

Gabbard, Joseph L.

483

DOE - Office of Legacy Management -- North Carolina State University...  

Office of Legacy Management (LM)

the measurement of the thermal properties of certain granular materials in 1953 and 1954. NC.01-1 NC.01-4 NC.01-5 Site Disposition: Eliminated - Potential for contamination...

484

A d vA n c e m e n t o f t h e PRACTICEA d vA n c e m e n t o f t h e PRACTICE D I R E C T F R O M C D C E N V I R O N M E N TA L H E A LT H S E R V I C E S B R A N C H  

E-Print Network (OSTI)

development infrastructure, insufficient training budgets, and a short age of designated staff persons in carrying out daily job duties and to determine the utility of the program in preparation of the REHS/RS pro

485

A d VA N c E m E N t o f t H E PraCtICEA d VA N c E m E N t o f t H E PraCtICE D I r E C t F r o M C D C e n v I r o n m e n tA L h e A Lt h S e r v I c e S B r A n c h  

E-Print Network (OSTI)

worker and manager food safety training and experience, restaurant and food worker busyness. She helps the branch's Environmental Health Specialists Network (EHS-Net) with the design and implementation of restaurant food safety studies and analysis of eHS-Net Restaurant Food Safety Studies: What

486

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

052010 - 042014 Durham, NC 27701 Carolina Blue Skies Initiative Project will install CNG infrastructure to fuel fleets in Durham, NC area. 08 23 2011 Steven Richardson...

487

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

- 042014 S. Richardson Hendersonville, NC Carolina Blue Skies Initiative Add additional CNG fueling capacity to an existing CNG fueling station in Hendersonville, NC. Steven...

488

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Renewable Energy Systems - YMCO of Western NC, Rueter Family Branch Solar Thermal Install solar thermal collector system on existing rooftop of YMCA of Western NC. System will...

489

Johnny Kirkland  

Science Conference Proceedings (OSTI)

... BS, Physics, NC State University, 1974. BS, Mathematics, NC State University, 1974. Contact. Phone: 301-975-6179 Fax: 301-975-5334.

2012-10-01T23:59:59.000Z

490

Most states have Renewable Portfolio Standards - Today in ...  

U.S. Energy Information Administration (EIA)

Source: N.C. Solar Center at N.C. State University, Database of State Incentives for Renewables and Efficiency (accessed July 2012). (Correction: ...

491

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

S. Richardson 52010 - 42014 Waxhaw, NC Carolina Blue Skies Initative Install retail biofuel fueling infrastructure in Waxhaw, NC. 02 16 2011 Steven Richardson Digitally signed...

492

post-pareto analysis for multiobjective parabolic control systems  

E-Print Network (OSTI)

Jul 29, 2012 ... POST-PARETO ANALYSIS FOR MULTIOBJECTIVE PARABOLIC CONTROL SYSTEMS. Henri Bonnel (bonnel ***at*** univ-nc.nc). Abstract: In...

493

--No Title--  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Michigan Total Sum City, County, and SEO Allocations All 76,601,500 MI Michigan State Energy Office 19,599,600 MI Ann Arbor City 1,243,400 MI Battle Creek City 545,100...

494

Non-traumatic Shoulder Dislocation  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, MI Supervising SectionFord Hospital, 2799 W. Grand Blvd, Detroit, MI 48201. Email

Manteuffel, Jacob

2009-01-01T23:59:59.000Z

495

Whither the Keiretsu, Japan's Business Networks? How Were They Structured? What Did They Do? Why Are They Gone?  

E-Print Network (OSTI)

Construction Nippon Flour Mills Kirin Brewery Oji PaperSa Textile NIPPON FLOUR MILLS Mi Food TORAY INDUSTRIES Mi

Lincoln, James R.; Shimotani, Masahiro

2009-01-01T23:59:59.000Z

496

Epigenetic Alterations in High and Low LET Radiation Induced...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the unstable clones. Among these, altered miRNA expression could be validated by qRT-PCR for mmu-miR-466g, hsa-miR-30a and hsa- miR-195. Hsa-miR-30a and hsa-miR-195 were...

497

THE DEPARTMENT OF DEFENSE HIGH LEVEL ARCHITECTURE Judith S. Dahmann  

E-Print Network (OSTI)

Office 1901 N. Beauregard Street Alexandria, VA 22311 Richard M. Fujimoto College of Computing Georgia

498

THE DoD HIGH LEVEL ARCHITECTURE: AN UPDATE 1 Judith S. Dahmann  

E-Print Network (OSTI)

Office 1901 N. Beauregard Street Alexandria, VA 22311 Richard M. Fujimoto College of Computing Georgia

499

THE DoD HIGH LEVEL ARCHITECTURE: AN UPDATE Judith S. Dahmann  

E-Print Network (OSTI)

Office 1901 N. Beauregard Street Alexandria, VA 22311 Richard M. Fujimoto College of Computing Georgia

500

COMPARING HUMAN AND MACHINE PERFORMANCE FO R NATURAL LANGUAGE INFORMATION EXTRACTION  

E-Print Network (OSTI)

and Software Engineering Division 1801 N. Beauregard Street Alexandria, VA 2231 1 INTRODUCTION In evaluating