Powered by Deep Web Technologies
Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

NY  

Office of Legacy Management (LM)

NY NY 17.8 Prepared by Oak Ridge Associated Universities Prepgred for Office of Operationaf Safety U.S. Department of Energy Ezrt /ur / POST REMEDIAL ACTION SURVEY PROPERTY OF MODERN LANDFILL, INC. FORMER LOOW SITE LEWISTON, NEW YORK J.D. BERGER R a d i o l o g l c a l S t t e A s s e s s r n e n t P r o g r a m M a n p o t a e r E d u c a t l o n , R e s e a r c h , a n d T r a l n i n g D l v i s l o n FINAL REPORT January 1982 POST REIEDIAT ACTION SURVBY PROPERTY OF }TODBRN I.AIIDPILL' INC. rONGB LOOTI SITE LEIIISTOI, NEI{ YORK Prepared for U.S. Department of Eaergy J . D . B e r g e r P r o j e c t S t a f f R.D. Coudra C.F. Rienke P.[. Frane C.F. 9legver [f.0. Eelton L.A. Young Prepered by Radiological Site Aseessuent Progrm Dlanpower Educatioor Researchr and Training Diviaion Oak Ridge Acaociated Univereitiea Oak Ridger Tenneggee 37830 FINAL REPORT January 1982 Thls report ls based on work performed under contract number DB-AC05-760RO0033 wlth

2

DOE - Office of Legacy Management -- Buffalo NY Site - NY 54  

NLE Websites -- All DOE Office Websites (Extended Search)

Buffalo NY Site - NY 54 Buffalo NY Site - NY 54 FUSRAP Considered Sites Buffalo, NY Alternate Name(s): Bliss & Laughlin Steel Company Niagara Cold Drawn Steel Corporation Ramco Steel Incorporated NY.54-1 NY.54-4 Location: 110 Hopkins Street, Buffalo, New York NY.54-1 Historical Operations: Machined and straightened uranium rods as subcontracted work from National Lead Company, an AEC contractor. NY.54-3 NY.54-4 LTSM012601 Eligibility Determination: Eligible NY.54-4 Radiological Survey(s): Assessment Surveys, Verification Surveys NY.54-6 NY.54-7 NY.54-8 LTSM012601 Site Status: Certified- Certification Basis and Certification Statement BLS000001 LTSM012152 LTSM012584 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP

3

Category:Syracuse, NY | Open Energy Information  

Open Energy Info (EERE)

Syracuse, NY Syracuse, NY Jump to: navigation, search Go Back to PV Economics By Location Media in category "Syracuse, NY" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Syracuse NY Consolidated Edison Co-NY Inc.png SVFullServiceRestauran... 70 KB SVQuickServiceRestaurant Syracuse NY Consolidated Edison Co-NY Inc.png SVQuickServiceRestaura... 70 KB SVHospital Syracuse NY Consolidated Edison Co-NY Inc.png SVHospital Syracuse NY... 66 KB SVLargeHotel Syracuse NY Consolidated Edison Co-NY Inc.png SVLargeHotel Syracuse ... 69 KB SVLargeOffice Syracuse NY Consolidated Edison Co-NY Inc.png SVLargeOffice Syracuse... 68 KB SVMediumOffice Syracuse NY Consolidated Edison Co-NY Inc.png SVMediumOffice Syracus... 67 KB SVMidriseApartment Syracuse NY Consolidated Edison Co-NY Inc.png

4

Category:Rochester, NY | Open Energy Information  

Open Energy Info (EERE)

Rochester, NY Rochester, NY Jump to: navigation, search Go Back to PV Economics By Location Media in category "Rochester, NY" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Rochester NY Consolidated Edison Co-NY Inc.png SVFullServiceRestauran... 70 KB SVQuickServiceRestaurant Rochester NY Consolidated Edison Co-NY Inc.png SVQuickServiceRestaura... 71 KB SVHospital Rochester NY Consolidated Edison Co-NY Inc.png SVHospital Rochester N... 65 KB SVLargeHotel Rochester NY Consolidated Edison Co-NY Inc.png SVLargeHotel Rochester... 69 KB SVLargeOffice Rochester NY Consolidated Edison Co-NY Inc.png SVLargeOffice Rocheste... 67 KB SVMediumOffice Rochester NY Consolidated Edison Co-NY Inc.png SVMediumOffice Rochest... 67 KB SVMidriseApartment Rochester NY Consolidated Edison Co-NY Inc.png

5

DOE - Office of Legacy Management -- New York, NY, Site - NY 61  

Office of Legacy Management (LM)

York, NY, Site - NY 61 York, NY, Site - NY 61 FUSRAP Considered Sites New York, NY Alternate Name(s): Baker and Williams Warehouses Ralph Ferrara Company Warehouses Ralph Ferrara, Inc. NY.61-2 Location: 513-519, 521-527, and 529-535 West 20th Street, New York, New York NY.61-3 Historical Operations: Received and stored uranium ores and concentrates for MED. NY.61-5 NY.61-6 NY.61-7 Eligibility Determination: Eligible NY.61-1 NY.61-2 Radiological Survey(s): Assessment Surveys, Verification Surveys NY.61-3 NY.61-4 NY.61-8 NY.61-9 NY.61-10 Site Status: Certified - Certification Basis, Federal Register Notice Included NY.61-11 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP Also see New York, New York, Site

6

DOE - Office of Legacy Management -- Niagara Falls Storage Site NY - NY 17  

Office of Legacy Management (LM)

Niagara Falls Storage Site NY - NY Niagara Falls Storage Site NY - NY 17 FUSRAP Considered Sites Niagara Falls Storage Site, NY Alternate Name(s): Lake Ontario Ordnance Works (LOOW) Niagara Falls Storage Site (NFSS) DOE-Niagara Falls Storage Site NY.17-1 NY.17-3 Location: Lewiston, New York NY.17-5 Historical Operations: Stored, shipped, and buried radioactive equipment and waste for MED and AEC containing uranium, radium, and thorium. Contains Interim Waste Containment Structure. NY.17-1 NY.17-2 NY.17-14 Eligibility Determination: Eligible NY.17-4 Radiological Survey(s): Assessment Surveys NY.17-3 NY.17-5 NY.17-6 NY.17-7 NY.17-8 NY.17-9 NY.17-10 NY.17-11 NY.17-12 NY.17-14 Site Status: Cleanup in progress by U.S. Army Corps of Engineers. NY.17-13 NY.17-14 NY.17-15 NY.17-16 USACE Website Long-term Care Requirements: To be determined upon completion.

7

ACIM-~ NY.49  

Office of Legacy Management (LM)

' ' h:. ,,, ,_" , ACIM-~ NY.49 .,. i MEMORANDUM TO: FILE DATE FE: __~-tt_c~7' e_-_~-~------- --------- "%Kf-- ---- ---i------- Current: ~~~~~~--------__---_______ xf yee, date contacted- IVPE OF OPERATION f- ------------- Research & Development 0 Production scale testing 0 Pilot Scale 0 Bench Scale Process z Theoretical Studies Sample 84 Analysis 0 Production 0 Disposal/Storage a Facility Type 0 Manufacturing 0 University 0 Research Organization 0 Government Sponsored Fat a Other ------------------ c] Prime 0 Other information (i.e., co 0 Subcontractor + fixed fee, unit price, 0 Purchase Order time & material, +x:) G-----------^-------------- . ~~~~-----____~-~----------~ Contract/Purchase Order # ---------------------------------

8

NY-%-3 P  

Office of Legacy Management (LM)

NY-%-3 NY-%-3 P m F P F ?- P m ?- c m P P CII (I pl F F- 3?r -J-J-. _- /, i ;. / 0 Aerospace Report No. ATR-82 (796344-2 i Aq, is y !i,' Evaluation of the 1943Hto# 1946 ilid Liquid Effluent Discharge From the Linde Air Products Company Ceramics Plant December 198 I Prepared for Office of Operational Safety Assistant Secretary for Environmental Protection, Safety, and Emergency Preparedness U.S. DEPARTMENT OF ENERGY Prepared by Environment and Conservation Directorate Eastern Technical Division THE AEROSPACE CORPORATION Germantown, Maryland Contract No. DE-ACOP-81EV10532 I- ,- A e r o s p a c e R e p o r t N o . A T R - 8 2 ( 7 9 6 3 - 0 4 ) - 2 E V A L U A T IO N O F T H E 1 9 4 3 - T O - 1 9 4 6 L IQ U ID E F F L U E N T D IS C H A R G E F R O M T H E L INDE A IR P R O D U C T S C O M P A N Y C E R A M ICS P L A N T D e c e m b e r 1 9 8 1 P r e p a r e d for O

9

American Solar Energy Society Proc. ASES Annual Conference, Raleigh, NC, EVALUATION OF NUMERICAL WEATHER PREDICTION  

E-Print Network (OSTI)

OF NUMERICAL WEATHER PREDICTION SOLAR IRRADIANCE FORECASTS IN THE US Richard Perez ASRC, Albany, NY, Perez to solar radiation forecasting include (1) numerical weather prediction (NWP) models that infer local cloud© American Solar Energy Society ­ Proc. ASES Annual Conference, Raleigh, NC, EVALUATION

Perez, Richard R.

10

NC STATE UNIVERSITY UNIVERSITY HOUSING  

E-Print Network (OSTI)

name to enter it on your application. Only current and accepted students will appear in the search box of the application process 1 #12;NC STATE UNIVERSITY SELECT THE FALL 2012 TERM 2 Once accepted by NC State, students accepting the terms and conditions associated with the Agreement. ELECTRONIC SIGNATURE #12;NC STATE

11

DOE - Office of Legacy Management -- Guterl Specialty Steel - NY 12  

Office of Legacy Management (LM)

Guterl Specialty Steel - NY 12 Guterl Specialty Steel - NY 12 FUSRAP Considered Sites Guterl Specialty Steel, NY Alternate Name(s): Simonds Saw and Steel Co. Guterl Steel Allegheny Ludlum Steel Corp. NY.12-1 NY.12-2 Location: Ohio Street and Route 95, Lockport, New York NY.12-12 Historical Operations: Performed rolling mill operations on natural uranium and thorium metal. NY.12-6 NY.12-7 Eligibility Determination: NY.12-11 Radiological Survey(s): Assessment Surveys NY.12-1 NY.12-4 NY.12-8 NY.12-9 NY.12-12 Site Status: Cleanup pending by U.S. Army Corps of Engineers. NY.12-10 NY.12-11 USACE Website Long-term Care Requirements: To be determined upon completion. Also see Documents Related to Guterl Specialty Steel, NY NY.12-1 - ORNL Letter; Cottrell to Turi; Radiological Survey of the

12

CT NC0  

Office of Legacy Management (LM)

x-L* d! x-L* d! CT NC0 - i , ,. i, .' i :.:(e.!' ,A\~, L.,t, - (iI :i' , . y- 2 .L i ._ 1 c\ :- i;! Ii $ 4. Ci:lc:i.nnati. 39, t>:::i.f> (J&l3 q-1 -3 sui3 Jrn T3 FRCM .I iirz 1 ?j ~ 1.3 bL1 T:' IP !REFOI?T TC 5YC?CZCiC~ :EWllIFl;j",tsSS L' I"JIsIc:;. .:;xli3;. iCAN !fA(=;-fL,yg-j L' sc,, E. $.iCLX:i?, -iIJ,x:q()Is. ON hL4X 24 - 25 ) 1.9tic ;i. A. Quiglel;, A.3, 3, M. ChenauEt gpxrIvB OF TP.~ The purpose of t3is trip was tc observe a proposed method for the dchy- dratim of green salt md to determine that all health and safety measures were being xrried out, SurveiU.ance of this nature provided protection against excessi3z personnel exposure, insured compliance with ICC shipping regulaticns, tion of the equ'~ and determined when adequate decontamira-

13

DOE - Office of Legacy Management -- Colonie - NY 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Considered Sites > Colonie - NY 06 Considered Sites > Colonie - NY 06 FUSRAP Considered Sites Colonie, NY Alternate Name(s): Colonie Interim Storage Site National Lead Industries NY.06-1 Location: 1130 Central Avenue, Colonie, New York NY.06-1 Historical Operations: Fabricated and processed uranium metal for the AEC, resulting in contamination from thorium and natural, enriched, and depleted uranium. NY.06-1 NY.06-4 NY.06-5 Eligibility Determination: Eligible NY.06-2 NY.06-3 Radiological Survey(s): Assessment Surveys, Verification Surveys NY.06-6 NY.06-7 Site Status: Cleanup in progress by U.S. Army Corps of Engineers. NY.06-8 NY.06-9 NY.06-10 NY.06-11 USACE Website Long-term Care Requirements: To be determined upon completion. Also see Documents Related to Colonie, NY Colonie Site Aerial Photograph

14

Western NY Energy LLC | Open Energy Information  

Open Energy Info (EERE)

search Name Western NY Energy LLC Place Mount Morris, New York Zip 14510 Product Bioethanol producer. References Western NY Energy LLC1 LinkedIn Connections CrunchBase...

15

Category:Wilmington, NC | Open Energy Information  

Open Energy Info (EERE)

NC NC Jump to: navigation, search Go Back to PV Economics By Location Media in category "Wilmington, NC" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Wilmington NC Duke Energy Carolinas LLC.png SVFullServiceRestauran... 69 KB SVQuickServiceRestaurant Wilmington NC Duke Energy Carolinas LLC.png SVQuickServiceRestaura... 68 KB SVHospital Wilmington NC Duke Energy Carolinas LLC.png SVHospital Wilmington ... 67 KB SVLargeHotel Wilmington NC Duke Energy Carolinas LLC.png SVLargeHotel Wilmingto... 65 KB SVLargeOffice Wilmington NC Duke Energy Carolinas LLC.png SVLargeOffice Wilmingt... 68 KB SVMediumOffice Wilmington NC Duke Energy Carolinas LLC.png SVMediumOffice Wilming... 68 KB SVMidriseApartment Wilmington NC Duke Energy Carolinas LLC.png

16

Category:Greensboro, NC | Open Energy Information  

Open Energy Info (EERE)

NC NC Jump to: navigation, search Go Back to PV Economics By Location Media in category "Greensboro, NC" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Greensboro NC Duke Energy Carolinas LLC.png SVFullServiceRestauran... 69 KB SVQuickServiceRestaurant Greensboro NC Duke Energy Carolinas LLC.png SVQuickServiceRestaura... 68 KB SVHospital Greensboro NC Duke Energy Carolinas LLC.png SVHospital Greensboro ... 67 KB SVLargeHotel Greensboro NC Duke Energy Carolinas LLC.png SVLargeHotel Greensbor... 66 KB SVLargeOffice Greensboro NC Duke Energy Carolinas LLC.png SVLargeOffice Greensbo... 68 KB SVMediumOffice Greensboro NC Duke Energy Carolinas LLC.png SVMediumOffice Greensb... 67 KB SVMidriseApartment Greensboro NC Duke Energy Carolinas LLC.png

17

DOE - Office of Legacy Management -- Niagara Falls Vicinity Properties NY -  

Office of Legacy Management (LM)

Niagara Falls Vicinity Properties Niagara Falls Vicinity Properties NY - NY 17 FUSRAP Considered Sites Niagara Falls Vicinity Properties, NY Alternate Name(s): Lake Ontario Ordnance Works (LOOW) Niagara Falls Storage Site (NFSS) DOE-Niagara Falls Storage Site NY.17-1 NY.17-3 Location: Lewiston , New York NY.17-5 Historical Operations: Stored, shipped, and buried radioactive equipment and waste for MED and AEC containing uranium, radium, and thorium. Portions of the former site are privately owned, creating a "site" for the vicinity properties. NY.17-1 NY.17-2 NY.17-14 Eligibility Determination: Eligible NY.17-4 Radiological Survey(s): Assessment Surveys, Verification Surveys NY.17-3 NY.17-5 NY.17-6 NY.17-7 NY.17-8 NY.17-9 NY.17-10 NY.17-11 NY.17-12 NY.17-14 Site Status: Certification Basis, including Federal Register Notice for 23 properties. Cleanup in progress for additional 3 VPs. NY.17-13

18

Sylvania Corporation, Hicksville, NY and Bayside, NY Addendum to July 8, 2004  

Energy.gov (U.S. Department of Energy (DOE))

Sylvania Corporation, Hicksville, NY and Bayside, NY Addendum to July 8, 2004, additional_sylvania.pdf memorandum Date: October 6, 2004 Reply to Attn of: Department of Energy Headquarters FOIA...

19

NY.O-20- I  

Office of Legacy Management (LM)

; I.-' ; I.-' NY.O-20- I ' 3% 3 MEMORANDUM TO: FILE FKOM: An&x?! w311E? SUHYECT: .Elimination of Pyroferric Co. New Yor SITE ALT NAME: EYE&XCLG f2!Y2~!2Y 621 E. 216th St. CITY: N__ew_ yw-r; STATE: N__V _ok!kEKm. Past: P_rrof_errrLc Go: current: Qwner contacted X yes no; if yes, date co Past owner2 IYE OE C)PEEux!N g Research et Develapment Faci - Production scale testing x M XX - Experimental tests U - Henoh.Scale Process R - Theoretical Studies Gove - Sample % Analysis 0 Production Disposal/Storage "t acted 1 1/10/G iz 17 -&49s300 move !d t li ari ty TYPO "i e+i "! "7 Prime Othe X Subcontractor Furcharje Order r: + fixed time 8: n k, Elr( NY NATE NI?IME: P_YD2fC Inter" Contract/Purchase Order # 33482 with AMF ----- ---- ---

20

Rig 'dzin Tshe dbang mchog grub (1761-1829) et la constitution du rNying ma rgyud 'bum de sDe dge  

E-Print Network (OSTI)

les textes en une collection Ug palung, le fief de la ligne Zur3. Un article plus rcent encore de Mi Nyag Thubbstan chos dar fait le point sur les diverses versions existantes, mentionnantdailleurs un certain nombre dentre elles qui ne sont... and the Bai-ro- rgyud-bum, p. 9. 4 Mi nyag Thub bstan chos dar, rNying ma rgyud 'bum gyi mtshams sbyor, passim. 5 Voir Achard, La liste des Tantras du rNying mai rgyud bum selon ldition tablie par Kun mkhyen Jigs med gling pa, Revue d...

Achard, Jean-Luc

2003-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

I'NC.£F::.-------  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

I'NC.£F::.------- I'NC.£F::.------- u.s. DEPARTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETI!lUnNATION RECIPIENT:WA Dept of Commerce PROJECT TITLE: SEP ARRA· WSU Anaerobic Digester· Nutrient Recovery Technology Page 1 of3 STATE: WA funding Opportunity Announcement Number Procurement Instrument Number NEPA Cnntrol Number CID Number EEOOOO139 GF0-0000139-Q22 EE139 Based on my ",view of the informaUon concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4SI.IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including , but not limited to, literature surveys, inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply

22

DOE - Office of Legacy Management -- Bethlehem Steel Corporation - NY 02  

Office of Legacy Management (LM)

Bethlehem Steel Corporation - NY 02 Bethlehem Steel Corporation - NY 02 FUSRAP Considered Sites Site: BETHLEHEM STEEL CORPORATION (NY.02 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Lackawanna , New York NY.02-1 Evaluation Year: 1985 NY.02-2 Site Operations: Conducted high temperature alpha-phase rolling tests on uranium metal in the 1950s. NY.02-3 Site Disposition: Eliminated - Radiation levels below criteria NY.02-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium NY.02-3 Radiological Survey(s): Yes NY.02-4 NY.02-5 Site Status: Eliminated from consideration under FUSRAP NY.02-6 Also see Documents Related to BETHLEHEM STEEL CORPORATION NY.02-1 - Bethlehem Steel Corp. Letter; Subject: Completed Access

23

DOE - Office of Legacy Management -- Syracuse University - NY 29  

Office of Legacy Management (LM)

Syracuse University - NY 29 Syracuse University - NY 29 FUSRAP Considered Sites Site: SYRACUSE UNIVERSITY (NY.29) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Syracuse , New York NY.29-1 Evaluation Year: 1994 NY.29-2 Site Operations: Activities included work with uranium oxide and the precipitation of thorium iodate from homogeneous solution. NY.29-1 NY.29-3 NY.29-4 Site Disposition: Eliminated - Potential for contamination remote NY.29-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium, Thorium NY.29-3 NY.29-4 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to SYRACUSE UNIVERSITY NY.29-1 - AEC Memorandum; Belmore to Rodden; Request for Uranium

24

Category:New York, NY | Open Energy Information  

Open Energy Info (EERE)

York, NY York, NY Jump to: navigation, search Go Back to PV Economics By Location Media in category "New York, NY" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant New York NY Consolidated Edison Co-NY Inc.png SVFullServiceRestauran... 70 KB SVQuickServiceRestaurant New York NY Consolidated Edison Co-NY Inc.png SVQuickServiceRestaura... 71 KB SVHospital New York NY Consolidated Edison Co-NY Inc.png SVHospital New York NY... 64 KB SVLargeHotel New York NY Consolidated Edison Co-NY Inc.png SVLargeHotel New York ... 68 KB SVLargeOffice New York NY Consolidated Edison Co-NY Inc.png SVLargeOffice New York... 67 KB SVMediumOffice New York NY Consolidated Edison Co-NY Inc.png SVMediumOffice New Yor... 67 KB SVMidriseApartment New York NY Consolidated Edison Co-NY Inc.png

25

DOE - Office of Legacy Management -- Memorial Hospital - NY 0...  

Office of Legacy Management (LM)

Memorial Hospital - NY 0-16 FUSRAP Considered Sites Site: MEMORIAL HOSPITAL (NY.0-16 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name:...

26

Niagara Falls, NY Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) Niagara Falls, NY Natural Gas Pipeline Exports to Canada (Million Cubic Feet) Niagara Falls, NY Natural Gas Pipeline Exports...

27

Niagara Falls, NY Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) Niagara Falls, NY Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Niagara Falls, NY Natural Gas Pipeline...

28

DOE - Office of Legacy Management -- Columbia University - NY...  

Office of Legacy Management (LM)

NY.03-3 Site Operations: Early research and development -- nuclear chain reaction (fission) and gaseous diffusion during the 1940s. NY.03-4 Site Disposition: Eliminated -...

29

Buffalo, NY Liquefied Natural Gas Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Buffalo, NY Liquefied Natural Gas Exports to Canada (Dollars per Thousand Cubic Feet) Buffalo, NY Liquefied Natural Gas Exports to Canada (Dollars per Thousand Cubic Feet) Decade...

30

Massena, NY Natural Gas Pipeline Exports to Canada (Million Cubic...  

Annual Energy Outlook 2012 (EIA)

View History: Monthly Annual Download Data (XLS File) Massena, NY Natural Gas Pipeline Exports to Canada (Million Cubic Feet) Massena, NY Natural Gas Pipeline Exports to Canada...

31

Northeast - NY NJ CT PA Area | Open Energy Information  

Open Energy Info (EERE)

Northeast - NY NJ CT PA Area Northeast - NY NJ CT PA Area (Redirected from New York Area - NY NJ CT PA) Jump to: navigation, search Contents 1 Clean Energy Clusters in the Northeast - NY NJ CT PA Area 1.1 Products and Services in the Northeast - NY NJ CT PA Area 1.2 Research and Development Institutions in the Northeast - NY NJ CT PA Area 1.3 Networking Organizations in the Northeast - NY NJ CT PA Area 1.4 Investors and Financial Organizations in the Northeast - NY NJ CT PA Area 1.5 Policy Organizations in the Northeast - NY NJ CT PA Area Clean Energy Clusters in the Northeast - NY NJ CT PA Area Products and Services in the Northeast - NY NJ CT PA Area Loading map... {"format":"googlemaps3","type":"ROADMAP","types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"limit":500,"offset":0,"link":"all","sort":[""],"order":[],"headers":"show","mainlabel":"","intro":"","outro":"","searchlabel":"\u2026

32

DOE - Office of Legacy Management -- Electromet Corporation - NY 04  

Office of Legacy Management (LM)

Electromet Corporation - NY 04 Electromet Corporation - NY 04 FUSRAP Considered Sites Site: Electromet Corporation (NY.04 ) Eliminated from consideration under FUSRAP - Referred to US EPA and New York State Designated Name: Not Designated Alternate Name: None Location: 4625 Royal Avenue , Niagara Falls , New York NY.04-1 Evaluation Year: 1985 NY.04-2 NY.04-3 Site Operations: Cast zirconium sponge into ingots in the 1950s. NY.04-4 Site Disposition: Eliminated - No Authority NY.04-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium, Zirconium NY.04-4 Radiological Survey(s): Yes NY.04-6 Site Status: Eliminated from consideration under FUSRAP - Referred to US EPA and New York State NY.04-2 Also see Documents Related to Electromet Corporation

33

DOE - Office of Legacy Management -- Hooker Chemical Co - NY 05  

Office of Legacy Management (LM)

Hooker Chemical Co - NY 05 Hooker Chemical Co - NY 05 FUSRAP Considered Sites Site: Hooker Chemical Co. (NY.05) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Occidental Chemical Corporation Hooker Electrochemical Corporation NY.05-1 NY.05-2 Location: Niagara Falls , New York NY.05-3 Evaluation Year: 1985 NY.05-1 NY.05-2 Site Operations: Design, engineering, construction, equipping and operation of a plant for the manufacture of Product 45 (xylene hexachloride); MFL (Miller's fluorolubricant); P-45Cl; and recovered P-45Cl2 from residues produced in the manufacture of P-45Cl; used hydrochloric acid (a byproduct of the P-45 Program) in the chemical processing of uranium-bearing slag as a precursor to recovery. NY.05-2 NY.05-4 Site Disposition: Eliminated - Radiation levels below criteria NY.05-1

34

DOE - Office of Legacy Management -- New York University - NY 50  

Office of Legacy Management (LM)

University - NY 50 University - NY 50 FUSRAP Considered Sites Site: NEW YORK UNIVERSITY (NY.50) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: New York , New York NY.50-1 Evaluation Year: 1987 NY.50-1 Site Operations: Activities were related to equipment development. Counters and a small quantity of uranium oxide were provided by the AEC for work under contract AT(30-1)-1256. NY.50-2 NY.50-3 NY.50-4 NY.50-1 Site Disposition: Eliminated - Potential for contamination considered remote - Limited quantity of radioactive material used at this site NY.50-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium NY.50-2 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP

35

DOE - Office of Legacy Management -- Gleason Works - NY 55  

Office of Legacy Management (LM)

Gleason Works - NY 55 Gleason Works - NY 55 FUSRAP Considered Sites Site: GLEASON WORKS (NY.55 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Rochester , New York NY.55-1 Evaluation Year: 1994 NY.55-2 Site Operations: Metal fabrication operations - Rolled uranium metal. NY.55-1 Site Disposition: Eliminated - Potential for contamination considered remote NY.55-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium NY.55-1 Radiological Survey(s): Health and Safety Monitoring NY.55-1 NY.55-3 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to GLEASON WORKS NY.55-1 - NLO Report; Klein to Quigley; Trip Report to the Gleason Works, Rochester, New York on October 30 Thru November 10, 1961; December

36

Upstate NY Power Corp | Open Energy Information  

Open Energy Info (EERE)

energy Product Developer of clean energy projects in New York State, including wind and transmission assets. References Upstate NY Power Corp1 LinkedIn Connections CrunchBase...

37

DOE - Office of Legacy Management -- Rensslaer Polytechnic Institute - NY  

Office of Legacy Management (LM)

Rensslaer Polytechnic Institute - Rensslaer Polytechnic Institute - NY 18 FUSRAP Considered Sites Site: RENSSLAER POLYTECHNIC INSTITUTE (NY.18 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Troy , New York NY.18-1 Evaluation Year: 1987 NY.18-1 Site Operations: Research activities involving small quantities of radioactive materials in a controlled environment - under AEC license. NY.18-1 Site Disposition: Eliminated - Potential for residual contamination considered remote NY.18-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Not Specified NY.18-1 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to RENSSLAER POLYTECHNIC INSTITUTE

38

DOE - Office of Legacy Management -- Seneca Army Depot - NY 11  

NLE Websites -- All DOE Office Websites (Extended Search)

Seneca Army Depot - NY 11 Seneca Army Depot - NY 11 FUSRAP Considered Sites Site: SENECA ARMY DEPOT (NY.11 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Romulus , New York Evaluation Year: 1985 NY.11-2 NY.11-3 Site Operations: Eleven bunkers were used to store approximately 2,000 drums of pitchblende ore in the early 1940's. The bunkers were returned to munitions storage service after removal of the ore drums. NY.11-4 Site Disposition: Eliminated - Referred to The Department of the Army NY.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Pitchblende Ore NY.11-3 Radiological Survey(s): Yes NY.11-5 Site Status: Eliminated from consideration under FUSRAP NY.11-2 Also see Documents Related to SENECA ARMY DEPOT

39

DOE - Office of Legacy Management -- Radiation Applications Inc - NY 57  

NLE Websites -- All DOE Office Websites (Extended Search)

Radiation Applications Inc - NY 57 Radiation Applications Inc - NY 57 FUSRAP Considered Sites Site: RADIATION APPLICATIONS, INC. ( NY.57 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: RAI NY.57-1 Location: 370 Lexington Avenue , New York , New York NY.57-3 Evaluation Year: 1991 NY.57-4 Site Operations: Developed foam separation techniques and proposed investigations to remove cesium and strontium from fission product waste solutions. No indication that a substantial quantity of radioactive material was involved. NY.57-3 NY.57-5 Site Disposition: Eliminated - Potential for contamination considered remote NY.57-4 Radioactive Materials Handled: None Indicated NY.57-1 Primary Radioactive Materials Handled: None Indicated Radiological Survey(s): None Indicated

40

DOE - Office of Legacy Management -- Love Canal - NY 24  

Office of Legacy Management (LM)

Love Canal - NY 24 Love Canal - NY 24 FUSRAP Considered Sites Site: LOVE CANAL (NY.24 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None NY.24-1 Location: Region running from Old Military Road from the 16-acre rectangular piece of land in the southeast corner of Niagara Falls into the Township of Lewiston , Niagara Falls , New York NY.24-3 Evaluation Year: 1987 NY.24-1 Site Operations: Chemical storage and disposal. NY.24-1 NY.24-3 Site Disposition: Eliminated - No residual radioactive material found NY.24-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Indicated Radiological Survey(s): Yes NY.24-5 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to LOVE CANAL

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

DOE - Office of Legacy Management -- Markite Co - NY 49  

Office of Legacy Management (LM)

Markite Co - NY 49 Markite Co - NY 49 FUSRAP Considered Sites Site: MARKITE CO. (NY.49 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 155 Waverly Place , New York , New York NY.49-1 Evaluation Year: 1987 NY.49-2 Site Operations: Conducted experiments with very small amounts of uranium and thorium. NY.49-2 Site Disposition: Eliminated - Handled limited amounts of radioactive materials - Potential for contamination remote NY.49-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium, Thorium NY.49-2 NY.49-3 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MARKITE CO. NY.49-1 - AEC Memorandum; Morgan to Youngs; Accountability at

42

Northeast - NY NJ CT PA Area | Open Energy Information  

Open Energy Info (EERE)

Northeast - NY NJ CT PA Area Northeast - NY NJ CT PA Area Jump to: navigation, search Contents 1 Clean Energy Clusters in the Northeast - NY NJ CT PA Area 1.1 Products and Services in the Northeast - NY NJ CT PA Area 1.2 Research and Development Institutions in the Northeast - NY NJ CT PA Area 1.3 Networking Organizations in the Northeast - NY NJ CT PA Area 1.4 Investors and Financial Organizations in the Northeast - NY NJ CT PA Area 1.5 Policy Organizations in the Northeast - NY NJ CT PA Area Clean Energy Clusters in the Northeast - NY NJ CT PA Area Products and Services in the Northeast - NY NJ CT PA Area Loading map... {"format":"googlemaps3","type":"ROADMAP","types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"limit":500,"offset":0,"link":"all","sort":[""],"order":[],"headers":"show","mainlabel":"","intro":"","outro":"","searchlabel":"\u2026

43

DOE - Office of Legacy Management -- National Carbon Co - NY 48  

Office of Legacy Management (LM)

Carbon Co - NY 48 Carbon Co - NY 48 FUSRAP Considered Sites Site: NATIONAL CARBON CO (NY.48) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: New York , New York NY.48-1 Evaluation Year: 1987 NY.48-2 Site Operations: Produced graphite for the MED/AEC. NY.48-1 NY.48-2 NY.48-3 Site Disposition: Eliminated - Potential for residual radioactive contamination considered remote - No indication that radioactive material was used on the site NY.48-2 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to NATIONAL CARBON CO NY.48-1 - AEC Letter; Crenshaw to National Carbon Company (Attn.:

44

DOE - Office of Legacy Management -- Buflovak Co - NY 56  

Office of Legacy Management (LM)

Buflovak Co - NY 56 Buflovak Co - NY 56 FUSRAP Considered Sites Site: Buflovak Co. (NY.56 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 1543 Fillmore Ave. , Buffalo , New York NY.56-1 Evaluation Year: 1991 NY.56-2 Site Operations: Research and testing with uranium raffinate. NY.56-1 Site Disposition: Eliminated - Possibility for contamination considered remote due to scope of tests conducted and indication of cleanup operations after tests NY.56-1 NY.56-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Raffinate NY.56-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Buflovak Co.

45

DOE - Office of Legacy Management -- Sylvania Corning Plant - NY 19  

Office of Legacy Management (LM)

Plant - NY 19 Plant - NY 19 FUSRAP Considered Sites Sylvania-Corning, NY Alternate Name(s): Sylvania Electric Products, Inc. Sylvania Corp. NY.19-1 NY.19-4 Location: Cantiaque Road, Hicksville, Long Island, New York NY.19-5 Historical Operations: Pilot-scale production of powdered metal uranium slugs for AEC's Hanford reactor. NY.19-4 Eligibility Determination: Eligible Radiological Survey(s): Assessment Survey NY.19-3 Site Status: Cleanup in progress by U.S. Army Corps of Engineers. USACE Website Long-term Care Requirements: To be determined upon completion. Also see Documents Related to Sylvania-Corning, NY Historical documents may contain links which are no longer valid or to outside sources. LM can not attest to the accuracy of information provided by these links. Please see the Leaving LM Website page for more details.

46

DOE - Office of Legacy Management -- Staten Island Warehouse - NY 22  

Office of Legacy Management (LM)

Staten Island Warehouse - NY 22 Staten Island Warehouse - NY 22 FUSRAP Considered Sites Staten Island Warehouse, NY Alternate Name(s): Archer-Daniels Midland Company NY.22-3 Location: 2393 Richmond Terrace, Port Richmond, New York NY.22-2 Historical Operations: Stored pitchblende (high-grade uranium ore), which was purchased by the MED for the first atomic bomb. NY.22-3 Eligibility Determination: Eligible Radiological Survey(s): Assessment Survey NY.22-5 Site Status: Referred by DOE, evaluation in progess by U.S. Army Corps of Engineers. USACE Website Long-term Care Requirements: To be determined upon completion. Also see Documents Related to Staten Island Warehouse, NY NY.22-1 - MED Trip Report Summary; Authors: Ruhoff (Corps of Engineers) and Geddes (Stone & Webster); Subject: Trip to New York;

47

DOE - Office of Legacy Management -- American Railway Express Office - NY  

Office of Legacy Management (LM)

Railway Express Office - Railway Express Office - NY 0-03 FUSRAP Considered Sites Site: American Railway Express Office (NY.0-03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: American Railway Express (Downtown) , New York , New York NY.0-03-1 Evaluation Year: 1987 NY.0-03-1 Site Operations: None - Involved with a fire during transport of uranium scrap. NY.0-03-2 Site Disposition: Eliminated - Potential for contamination remote NY.0-03-1 NY.0-03-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium scrap NY.0-03-2 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP NY.0-03-1 Also see Documents Related to American Railway Express Office

48

DOE - Office of Legacy Management -- Ledoux and Co - NY 37  

NLE Websites -- All DOE Office Websites (Extended Search)

Ledoux and Co - NY 37 Ledoux and Co - NY 37 FUSRAP Considered Sites Site: LEDOUX AND CO. (NY.37 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 155 Avenue of the Americas , New York , New York NY.37-1 Evaluation Year: 1987 NY.37-1 Site Operations: Prime contractor to AEC, African Metals. LeDoux handled radioactive materials under this contract at other locations; records indicate that radioactive materials were not sent to the New York office. NY.37-1 Site Disposition: Eliminated - Potential for contamination considered remote - Radioactive materials were not handled NY.37-2 NY.37-3 Radioactive Materials Handled: No NY.37-2 Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated

49

DOE - Office of Legacy Management -- Polytechnic Institute of Brooklyn - NY  

Office of Legacy Management (LM)

Polytechnic Institute of Brooklyn - Polytechnic Institute of Brooklyn - NY 0-19 FUSRAP Considered Sites Site: NY.0-19 (POLYTECHNIC INSTITUTE OF BROOKLYN) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: New York , New York NY.0-19-1 Evaluation Year: 1987 NY.0-19-1 Site Operations: Research and development involving only small quantities of radiological material in a controlled environment. NY.0-19-1 Site Disposition: Eliminated - Potential for contamination remote NY.0-19-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Not specified NY.0-19-1 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to NY.0-19 NY.0-19-1 - Aerospace Letter; Young to Wallo; Subject: Elimination

50

US MidAtl NY Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MidAtl NY MidAtl NY Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 $3,000 US MidAtl NY Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US MidAtl NY Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US MidAtl NY Expenditures dollars ELECTRICITY ONLY average per household * New York households consume an average of 103 million Btu per year, 15% more than the U.S. average. * Electricity consumption in New York homes is much lower than the U.S. average, because many households use other fuels for major energy end uses like space heating, water heating, and cooking. Electricity costs are closer to the national average due to higher than average electricity prices in the state.

51

US MidAtl NY Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MidAtl NY MidAtl NY Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 $3,000 US MidAtl NY Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US MidAtl NY Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US MidAtl NY Expenditures dollars ELECTRICITY ONLY average per household * New York households consume an average of 103 million Btu per year, 15% more than the U.S. average. * Electricity consumption in New York homes is much lower than the U.S. average, because many households use other fuels for major energy end uses like space heating, water heating, and cooking. Electricity costs are closer to the national average due to higher than average electricity prices in the state.

52

DOE - Office of Legacy Management -- Sacandaga - NY 51  

Office of Legacy Management (LM)

New York NY.51-1 Evaluation Year: 1992 NY.51-2 Site Operations: Plant operated by General Electric during period spanning 1947 to 1951. Facilities housed studies involving radar,...

53

NC Sustainable Energy Association | Open Energy Information  

Open Energy Info (EERE)

NC Sustainable Energy Association NC Sustainable Energy Association Jump to: navigation, search Name NC Sustainable Energy Association Address PO Box 6465 Place Raleigh Zip 27628 Number of employees 1-10 Year founded 1978 Phone number 919-832-7601 Website http://www.energync.org Coordinates 35.7719°, -78.6388° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.7719,"lon":-78.6388,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

54

DOE - Office of Legacy Management -- Linde Air Products Division - NY 08  

NLE Websites -- All DOE Office Websites (Extended Search)

Division - NY 08 Division - NY 08 FUSRAP Considered Sites Linde Air Products Division - Towanda, NY Alternate Name(s): Praxair Linde Aire Products Div. of Union Carbide Corp. Linde Ceramics Plant Uranium Refinery, Linde Site NY.08-4 Location: East Park Drive and Woodward, Tonawanda, New York NY.08-5 Historical Operations: Processed uranium compounds for MED and AEC. Includes Towanda Landfill as a VP. NY.08-1 NY.08-2 Eligibility Determination: Eligible NY.08-9 Radiological Survey(s): Assessment Surveys NY.08-3 NY.08-5 NY.08-6 NY.08-7 Site Status: Cleanup in progress by U.S. Army Corps of Engineers. NY.08-8 USACE Website Long-term Care Requirements: To be determined upon completion. Also see Linde FUSRAP Site Documents Related to Linde Air Products Division - Towanda, NY

55

,"Massena, NY Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Massena, NY Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

56

,"Champlain, NY Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Champlain, NY Natural Gas Pipeline Imports From Canada (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...

57

,"Waddington, NY Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Waddington, NY Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

58

NlZWYORK4,N.Y.  

Office of Legacy Management (LM)

AFRICAN .METALS~ C~RPO~~XON AFRICAN .METALS~ C~RPO~~XON 41 BROAD STREET . i. ,,J iI: : LE OCT 2 2 1945 NlZWYORK4,N.Y. :October 5, 1945. Af-2-a L.: I.__: '../ . ._ The Area Engineer, U.S. Engineer Office, P.O. BOX 42, Station F., New York 16, N.Y. Gentlemen: Contract W-7405 eng-4. Reference is made to your letter EIDM A-33 MS of August 27th, 1945. Contract W-7405 eng-4 called for the delivery of 100 T of M-31, the M308 content of which was sold to you, whereas we reserved all rights to the R-l contained therein. We hereby certify that the liability of the Gouvernment in connection with the M308 contained--has .3*,., been completely fulfilled, and that the R-l%ontained has been returned to us in accordance with separate contract entered into between this Corporation and the Eldorado

59

DOE - Office of Legacy Management -- Naval Supply Depot AEC Warehouse - NY  

Office of Legacy Management (LM)

Supply Depot AEC Warehouse - Supply Depot AEC Warehouse - NY 36 FUSRAP Considered Sites Site: NAVAL SUPPLY DEPOT, AEC WAREHOUSE (NY.36) Eliminated from further consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: None Location: Building 546 , Scotia , New York NY.36-1 Evaluation Year: 1987 NY.36-1 Site Operations: This facility served as a storage and transshipment point for feed materials between the Hanford and commercial metal fabricators in the northeastern states. NY.36-1 NY.36-2 NY.36-3 Site Disposition: Eliminated - Referred to DOD NY.36-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium, Thorium Metals NY.36-1 NY.36-2 NY.36-3 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DOD NY.36-1

60

Northern Westchester Energy Action Consortium (NY) | Open Energy  

Open Energy Info (EERE)

Energy Action Consortium (NY) Energy Action Consortium (NY) Jump to: navigation, search Logo: Northern Westchester Energy Action Consortium (NY) Name Northern Westchester Energy Action Consortium (NY) Address PO Box 681 Place Somers, New York Zip 10589 Region Northeast - NY NJ CT PA Area Year founded 2009 Website http://www.nweac.org Coordinates 41.3278772°, -73.6948234° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.3278772,"lon":-73.6948234,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Property:EIA/861/IsoNy | Open Energy Information  

Open Energy Info (EERE)

IsoNy IsoNy Jump to: navigation, search Property Name ISO_NY Property Type Boolean Description Indicates that the organization conducts operations in the NY ISO region [1] References ↑ "EIA Form EIA-861 Final Data File for 2010 - 861 Webfile Layout for 2010.doc" Pages using the property "EIA/861/IsoNy" Showing 25 pages using this property. (previous 25) (next 25) A AES Eastern Energy LP + true + AP Holdings LLC + true + Agway Energy Services, LLC + true + B Bath Electric Gas & Water Sys + true + Bluerock Energy, Inc. + true + C Central Hudson Gas & Elec Corp + true + City of Salamanca, New York (Utility Company) + true + City of Sherrill, New York (Utility Company) + true + City of Watertown, New York (Utility Company) + true +

62

DOE - Office of Legacy Management -- Tonawanda North Units 1 and 2 - NY 10  

NLE Websites -- All DOE Office Websites (Extended Search)

Tonawanda North Units 1 and 2 - NY Tonawanda North Units 1 and 2 - NY 10 FUSRAP Considered Sites Tonawanda North, NY, Units 1 and 2 Alternate Name(s): Ashland #1 and Ashland #2 Haist Property Seaway Area D Rattlesnake Creek NY.10-1 Location: State Highway 266, east of Interstate Highway 190, Tonawanda, NY NY.10-4 Historical Operations: Served as a repository for refined uranium and vanadium residues containing thorium and radium, generated by Linde Air Products. NY.10-4 NY.10-5 NY.10-6 NY.10-7 NY.10-9 Eligibility Determination: Eligible NY.10-1 NY.10-2 NY.10-3 Radiological Survey(s): Assessment Survey NY.10-4 Site Status: Certified - Certification Basis, Declaration of Completion Included NY.10-11 NY.10-13 NY.10-14 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP

63

DOE - Office of Legacy Management -- Radium Chemical Co Inc - NY 60  

NLE Websites -- All DOE Office Websites (Extended Search)

Radium Chemical Co Inc - NY 60 Radium Chemical Co Inc - NY 60 FUSRAP Considered Sites Site: RADIUM CHEMICAL CO., INC (NY.60 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: New York , New York NY.60-1 Evaluation Year: 1987 NY.60-1 Site Operations: Commercial Producer of Radium. NY.60-1 Site Disposition: Eliminated - Commercial site - EPA cleanup project NY.60-1 Radioactive Materials Handled: Yes NY.60-1 Primary Radioactive Materials Handled: Radium NY.60-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to RADIUM CHEMICAL CO., INC NY.60-1 - Memorandum; A. Wallo to the File; Subject: FUSRAP review and elimination of the Radium Chemical Co. site in New York, NY; November

64

DOE - Office of Legacy Management -- Utica Street Warehouse - NY 0-23  

Office of Legacy Management (LM)

Street Warehouse - NY 0-23 Street Warehouse - NY 0-23 FUSRAP Considered Sites Site: UTICA STREET WAREHOUSE (NY.0-23) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 240 West Utica Street , Buffalo , New York NY.0-23-2 Evaluation Year: 1987 NY.0-23-1 Site Operations: Stored and rebarrelled uranium process residues from operations at Linde. NY.0-23-3 Site Disposition: Eliminated - Original building demolished. Current land use - Parking facility. Potential for residual radioactive contamination considered remote. NY.0-23-1 Radioactive Materials Handled: Yes NY.0-23-1 Primary Radioactive Materials Handled: Natural Uranium Process Residues NY.0-23-1 Radiological Survey(s): None Indicated NY.0-23-1 Site Status: Eliminated from consideration under FUSRAP NY.0-23-1

65

DOE - Office of Legacy Management -- Eastman Kodak Laboratory - NY 0-09  

Office of Legacy Management (LM)

Eastman Kodak Laboratory - NY 0-09 Eastman Kodak Laboratory - NY 0-09 FUSRAP Considered Sites Site: Eastman Kodak Laboratory (NY.0-09 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Eastman Kodak Rochester Lab NY.0-09-1 Location: Rochester , New York NY.0-09-1 Evaluation Year: 1987 NY.0-09-1 NY.0-09-2 Site Operations: Research and development with natural uranium solutions in 1943. NY.0-09-1 Site Disposition: Eliminated - Potential for contamination remote NY.0-09-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium NY.0-09-1 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Eastman Kodak Laboratory NY.0-09-1 - Memorandum/Checklist; Wallo to the File; Subject:

66

DOE - Office of Legacy Management -- Simmons Machine and Tool Inc - NY 35  

NLE Websites -- All DOE Office Websites (Extended Search)

Simmons Machine and Tool Inc - NY Simmons Machine and Tool Inc - NY 35 FUSRAP Considered Sites Site: SIMMONS MACHINE AND TOOL, INC (NY.35) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 1000 North Broadway , Albany , New York NY.35-1 Evaluation Year: 1987 NY.35-2 Site Operations: Tested equipment and machined uranium to test the equipment (one time event). NY.35-1 NY.35-2 Site Disposition: Eliminated - Potential for contamination considered remote due to limited scope and duration of activity performed at the site NY.35-2 NY.35-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium NY.35-1 NY.35-2 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP

67

Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...

68

US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

69

US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

70

RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.

71

DOE - Office of Legacy Management -- ACF Industries Inc - NY...  

Office of Legacy Management (LM)

Subject: Support of Findings and Determination - ACF Production Contract; February 15, 1954 NY.13-3 - AEC Letter; Donnelly to Pittman; Subject: Contaminated Ex-AEC-Owned or Leased...

72

Los Alamos technology to be featured on CSI: NY  

NLE Websites -- All DOE Office Websites (Extended Search)

device developed at Los Alamos National Laboratory will be used in an episode of Crime Scene Investigation-New York (CSI: NY) scheduled to air at 9 p.m. Mountain Daylight...

73

Yi-Jen Chiang Polytechnic University, NY, USA  

E-Print Network (OSTI)

Yi-Jen Chiang Xiang Lu Polytechnic University, NY, USA (appeared in Eurographics, Sept. 2003) #12] does not capture genus-change-only events) 1. Classify all vertices as critical / non-critical [Chiang

Chiang, Yi-Jen

74

RenewableNY - An Industrial Energy Conservation Initiative  

SciTech Connect

The New York Industrial Retention Network (NYIRN) manages the RenewableNY program to assist industrial companies in New York City to implement energy efficiency projects. RenewableNY provides companies with project management assistance and grants to identify opportunities for energy savings and implement energy efficiency projects. The program helps companies identify energy efficient projects, complete an energy audit, and connect with energy contractors who install renewable energy and energy efficient equipment. It also provides grants to help cover the costs of installation for new systems and equipment. RenewableNY demonstrates that a small grant program that also provides project management assistance can incentivize companies to implement energy efficiency projects that might otherwise be avoided. Estimated savings through RenewableNY include 324,500 kWh saved through efficiency installations, 158 kW of solar energy systems installed, and 945 thm of gas avoided.

Lubarr, Tzipora

2009-09-30T23:59:59.000Z

75

Niagara Falls, NY Natural Gas Pipeline Imports From Canada ...  

U.S. Energy Information Administration (EIA)

Niagara Falls, NY Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 9,497: 6,894: 4,421: 2,459 ...

76

DOE - Office of Legacy Management -- Allegheny-Ludlum Steel Corp - NY 0-02  

Office of Legacy Management (LM)

Allegheny-Ludlum Steel Corp - NY Allegheny-Ludlum Steel Corp - NY 0-02 FUSRAP Considered Sites Site: ALLEGHENY-LUDLUM STEEL CORP. (NY.0-02 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Al-Tech Specialty Steel NY.0-02-1 Location: Watervliet and Dunkirk , New York NY.0-02-1 Evaluation Year: 1985 NY.0-02-2 Site Operations: Processed uranium metal for the AEC in the early 1950s; rolled uranium billets into rods. NY.0-02-3 Site Disposition: Eliminated - Potential for contamination remote - Confirmed by radiological survey NY.0-02-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal NY.0-02-3 Radiological Survey(s): Yes NY.0-02-4 Site Status: Eliminated from consideration under FUSRAP Also see

77

DOE - Office of Legacy Management -- Lucius Pitkin - NY 0-15  

Office of Legacy Management (LM)

Lucius Pitkin - NY 0-15 Lucius Pitkin - NY 0-15 FUSRAP Considered Sites Site: Lucius Pitkin (NY.0-15 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 47 Fulton Street , New York , New York NY.0-15-1 Evaluation Year: 1987 NY.0-15-1 Site Operations: No MED or AED work done at this site. Contractor supervised activities at Middlesex Sampling Plant in Middlesex, NJ such as assaying, sampling and weighing of ore. NY.0-15-1 NY.0-15-2 Site Disposition: Eliminated - No radioactive material handled at this site NY.0-15-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None NY.0-15-1 NY.0-15-2 Radiological Survey(s): No Site Status: Eliminated from consideration under FUSRAP Also see

78

DOE - Office of Legacy Management -- American Machine and Foundry Co - NY  

NLE Websites -- All DOE Office Websites (Extended Search)

Machine and Foundry Co - Machine and Foundry Co - NY 26 FUSRAP Considered Sites Site: American Machine and Foundry Co ( NY.26 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Lutheran Medical Center NY.26-1 Location: Second Avenue and 56th Street , Brooklyn , New York NY.26-2 Evaluation Year: 1992 NY.26-1 Site Operations: 1951 - 1954 conducted metal fabrication operation on uranium and thorium metals. NY.26-3 NY.26-4 Site Disposition: Eliminated - Potential for contamination considered remote based on results of radiological monitoring and sampling and extensive renovation of the site NY.26-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium and Thorium metal NY.26-1 Radiological Survey(s): Yes NY.26-5

79

NC GreenPower Production Incentive | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NC GreenPower Production Incentive NC GreenPower Production Incentive NC GreenPower Production Incentive < Back Eligibility Agricultural Commercial Industrial Institutional Local Government Nonprofit Residential Schools State Government Savings Category Bioenergy Water Buying & Making Electricity Solar Wind Program Info State North Carolina Program Type Performance-Based Incentive Rebate Amount Varies by technology and system size PV up to 5 kW: $0.06/kWh PV larger than 5 kW: must enter bid process Wind up to 10 kW: $0.09/kWh Wind larger than 10 kW: must enter bid process Provider NC GreenPower NC GreenPower, a statewide green power program designed to encourage the use of renewable energy in North Carolina, offers production payments for grid-tied electricity generated by solar, wind, small hydro (10 megawatts

80

Does nuclear matter bind at large $N_c$?  

E-Print Network (OSTI)

The existence of nuclear matter at large $N_c$ is investigated in the framework of effective hadronic models of the Walecka type. This issue is strongly related to the nucleon-nucleon attraction in the scalar channel, and thus to the nature of the light scalar mesons. Different scenarios for the light scalar sector correspond to different large $N_c$ scaling properties of the parameters of the hadronic models. In all realistic phenomenological scenarios for the light scalar field(s) responsible for the attraction in the scalar channel it is found that nuclear matter does not bind in the large $N_c$ world. We thus conclude that $N_c = 3$ is in this respect special: 3 is fortunately not large at all and allows for nuclear matter, while large $N_c$ would not.

Bonanno, Luca

2011-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

DOE - Office of Legacy Management -- Union Mines Development Corp - NY 0-22  

Office of Legacy Management (LM)

Mines Development Corp - NY Mines Development Corp - NY 0-22 FUSRAP Considered Sites Site: UNION MINES DEVELOPMENT CORP. (NY.0-22) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Union Carbide NY.0-22-1 Location: New York , New York NY.0-22-1 Evaluation Year: 1987 NY.0-22-1 Site Operations: The company owned uranium mines or reserves located in the western U.S. NY.0-22-1 Site Disposition: Eliminated - No reason to believe radioactive material was used at this site NY.0-22-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Indicated NY.0-22-1 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to UNION MINES DEVELOPMENT CORP.

82

DOE - Office of Legacy Management -- Fordham University - NY 0-12  

Office of Legacy Management (LM)

Fordham University - NY 0-12 Fordham University - NY 0-12 FUSRAP Considered Sites Site: Fordham University (NY.0-12 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: New York , New York NY.0-12-1 Evaluation Year: 1987 NY.0-12-1 Site Operations: Research and development involving small quantities of radioactive material in a controlled environment NY.0-12-1 Site Disposition: Eliminated - Potential for contamination remote NY.0-12-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Not Specified NY.0-12-1 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Fordham University NY.0-12-1 - Aerospace Letter; Young to Wallo; Subject: Elimination

83

DOE - Office of Legacy Management -- Floyd Bennett Field - NY 0-11  

Office of Legacy Management (LM)

Floyd Bennett Field - NY 0-11 Floyd Bennett Field - NY 0-11 FUSRAP Considered Sites Site: Floyd Bennett Field (NY.0-11 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Naval Air Station NY.0-11-1 Location: Buildings 67 and 69 , Brooklyn , New York NY.0-11-1 Evaluation Year: 1987 NY.0-11-1 Site Operations: The Air station was considered by the AEC but was not used. NY.0-11-1 Site Disposition: Eliminated - No involvement with MED/AEC operations NY.0-11-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None Radiological Survey(s): No Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Floyd Bennett Field NY.0-11-1 - Memorandum/Checklist; Wallo to the File; Subject: Elimination of Floyd Bennett Field; December 7, 1987

84

DOE - Office of Legacy Management -- Wolff-Alport and Co - NY 30  

Office of Legacy Management (LM)

Wolff-Alport and Co - NY 30 Wolff-Alport and Co - NY 30 FUSRAP Considered Sites Site: Wolff-Alport and Co (NY.30) Eliminated from consideration under FUSRAP - Referred to US EPA Region II and New York City Department of Health Designated Name: Not Designated Alternate Name: None Location: 1127 Irving Avenue , Brooklyn , New York NY.30-1 Evaluation Year: 1987 NY.30-1 Site Operations: Commercial operation -- sold thorium residues to the AEC, which in turn shipped the residues to Maywood for storage. NY.30-2 Site Disposition: Eliminated - No Authority NY.30-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium NY.30-2 Radiological Survey(s): No Site Status: Eliminated from consideration under FUSRAP - Referred to US EPA Region II and New York City Department of Health NY.30-1

85

DOE - Office of Legacy Management -- Frederick Flader Inc - NY 0-13  

NLE Websites -- All DOE Office Websites (Extended Search)

Frederick Flader Inc - NY 0-13 Frederick Flader Inc - NY 0-13 FUSRAP Considered Sites Site: Frederick Flader, Inc. (NY.0-13 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Frederick Flader Division of Eaton Manufacturing Co. NY.0-13-1 Location: 583 Division Street , N. Tonawanda , New York NY.0-13-1 Evaluation Year: 1987 NY.0-13-1 Site Operations: Provided consulting services and supported development of auxiliary equipment related to nuclear power NY.0-13-1 Site Disposition: Eliminated NY.0-13-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Indicated NY.0-13-1 Radiological Survey(s): No Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Frederick Flader, Inc.

86

RECIPIENT:Town of Brookhaven STATE: NY PROJECT  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Town of Brookhaven STATE: NY Town of Brookhaven STATE: NY PROJECT EECBG (S) - Brookhaven (NY): Henrietta Acampora Recreation Center TITLE: Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number cm Number DE-FOA-0000013 DE-EE0000688 GFO-0000688-002 Based on my review of the information concerning tbe proposed action, as NEPA Compliance Officer (autborized under DOE Order 4St.tA), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy. demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state

87

Consolidated Edison Co-NY Inc | Open Energy Information  

Open Energy Info (EERE)

NY Inc NY Inc Jump to: navigation, search Name Consolidated Edison Co-NY Inc Place New York, New York Service Territory New York Website www.coned.com Green Button Reference Page www.whitehouse.gov/sites/ Green Button Committed Yes Utility Id 4226 Utility Location Yes Ownership I NERC Location NPCC NERC NPCC Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] SGIC[3] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Consolidated Edison Company of New York, Inc. Smart Grid Demonstration

88

DOE - Office of Legacy Management -- Wilson Warehouse - NY 64  

Office of Legacy Management (LM)

Wilson Warehouse - NY 64 Wilson Warehouse - NY 64 FUSRAP Considered Sites Site: Wilson Warehouse (NY.64) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: This site is one of a group of 77 FUSRAP considered sites for which few, if any records are available in their respective site files to provide an historical account of past operations and their relationship, if any, with MED/AEC operations. Reviews of contact lists, accountable station lists, health and safety records and other documentation of the period do not provide sufficient information to warrant further search of historical records for information on these sites. These site files remain "open" to

89

DOE - Office of Legacy Management -- Pfohl Brothers Landfill - NY 66  

Office of Legacy Management (LM)

Pfohl Brothers Landfill - NY 66 Pfohl Brothers Landfill - NY 66 FUSRAP Considered Sites Site: Pfohl Brothers Landfill (NY.66 ) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: Also see Five-Year Review Report Pfohl Brothers Landfill Superfund Site Erie County Town of Cheektowaga, New York EPA REGION 2 Congressional District(s): 30 Erie Cheektowaga NPL LISTING HISTORY Documents Related to Pfohl Brothers Landfill Historical documents may contain links which are no longer valid or to outside sources. LM can not attest to the accuracy of information provided by these links. Please see the Leaving LM Website page for more details.

90

Consolidated Edison Co-NY Inc | Open Energy Information  

Open Energy Info (EERE)

Consolidated Edison Co-NY Inc Consolidated Edison Co-NY Inc (Redirected from ConEdison) Jump to: navigation, search Name Consolidated Edison Co-NY Inc Place New York, New York Service Territory New York Website www.coned.com Green Button Landing Page www.coned.com/customercen Green Button Reference Page www.whitehouse.gov/blog/2 Green Button Implemented Yes Utility Id 4226 Utility Location Yes Ownership I NERC Location NPCC NERC NPCC Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] SGIC[3] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now!

91

Business Council of Westchester County (NY) | Open Energy Information  

Open Energy Info (EERE)

of Westchester County (NY) of Westchester County (NY) Jump to: navigation, search Name Business Council of Westchester County (NY) Address 108 Corporate Park Drive, Suite 101 Place White Plains, New York Zip 10604 Sector Services Product Green Power Marketer Website http://www.westchesterny.org/ Coordinates 41.0200884°, -73.7206631° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.0200884,"lon":-73.7206631,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

92

N.C. Solar Center | Open Energy Information  

Open Energy Info (EERE)

N.C. Solar Center N.C. Solar Center Jump to: navigation, search Name N.C. Solar Center Address NCSU, Box 7401 Place Raleigh, NC Zip 27695 Number of employees 11-50 Year founded 1988 Coordinates 35.762515267°, -78.5407447815° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.762515267,"lon":-78.5407447815,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

93

DOE - Office of Legacy Management -- Linde Air Products Div - Buffalo - NY  

Office of Legacy Management (LM)

Linde Air Products Div - Buffalo - Linde Air Products Div - Buffalo - NY 65 FUSRAP Considered Sites Site: LINDE AIR PRODUCTS DIV. BUFFALO (NY.65 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Linde Chandler Street Plant NY.65-1 Location: Buffalo , New York NY.65-1 Evaluation Year: 1987 NY.65-1 Site Operations: Developed and produced non-radioactive material for the Oak Ridge Gaseous Diffusion Plant under contract with the AEC. NY.65-2 Site Disposition: Eliminated - No indication that radioactive materials were used at the site NY.65-3 Radioactive Materials Handled: No NY.65-1 Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP

94

DOE - Office of Legacy Management -- Long Island College of Medicine - NY  

Office of Legacy Management (LM)

Long Island College of Medicine - Long Island College of Medicine - NY 0-14 FUSRAP Considered Sites Site: Long Island College of Medicine (NY.0-14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: New York , New York NY.0-14-1 Evaluation Year: 1987 NY.0-14-1 Site Operations: Performed research utilizing small quantities of radioactive materials in a controlled environment. NY.0-14-1 Site Disposition: Eliminated - Potential for contamination remote NY.0-14-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Not Specified NY.0-14-1 Radiological Survey(s): None Indicated NY.0-14-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Long Island College of Medicine

95

DOE - Office of Legacy Management -- Colorado Fuel and Iron - NY 0-08  

Office of Legacy Management (LM)

Fuel and Iron - NY 0-08 Fuel and Iron - NY 0-08 FUSRAP Considered Sites Site: Colorado Fuel and Iron (NY.0-08 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Watervliet , New York NY.0-08-1 Evaluation Year: 1987 NY.0-08-1 Site Operations: Site was a contractor to DuPont. Exact nature of operations is not clear. No records to indicate that radioactive materials were handled at the site. NY.0-08-1 Site Disposition: Eliminated NY.0-08-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Indicated Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Colorado Fuel and Iron NY.0-08-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:

96

DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility

97

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed

98

Assessment of Summer RBOB Supply for NY & CT  

Gasoline and Diesel Fuel Update (EIA)

Update of Summer Reformulated Gasoline Supply Update of Summer Reformulated Gasoline Supply Assessment for New York and Connecticut May 5, 2004 In October 2003, EIA published a review of the status of the methyl tertiary butyl ether (MTBE) ban transition in New York (NY) and Connecticut (CT) 1 that noted significant uncertainties in gasoline supply for those States for the summer of 2004. To obtain updated information, EIA spoke to major suppliers to the two States over the past several months as the petroleum industry began the switch from winter- to summer-grade gasoline. As discussed on our earlier report, the NY and CT bans on MTBE mainly affect reformulated gasoline (RFG), which in recent years has been provided by domestic refineries on the East Coast (PADD 1) and imports. Our recent findings indicate that

99

NC-1-B Wholesale Power Rate Schedule | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NC-1-B Wholesale Power Rate Schedule NC-1-B Wholesale Power Rate Schedule NC-1-B Wholesale Power Rate Schedule Area: Virginia Power/CP&L System: Kerr-Philpott This rate schedule shall be available to public bodies and cooperatives (any one of whom is hereinafter called the Customer) in Virginia and North Carolina to whom power may be transmitted pursuant to a contract between the Government and Virginia Electric and Power Company (hereinafter called the Virginia Power) and PJM Interconnection LLC (hereinafter called PJM), scheduled pursuant to a contract between the Government and Carolina Power & Light Company (hereinafter called CP&L), and billed pursuant to contracts between the Government and the Customer. This rate schedule shall be applicable to the sale at wholesale of power

100

Characterization of TiOxNy nanoparticles embedded in HfOxNy as charge trapping nodes for nonvolatile memory device applications  

Science Conference Proceedings (OSTI)

Silicon-oxide-nitride-oxide-silicon devices with nanoparticles (NPs) as charge trapping nodes (CTNs) are important to provide enhanced performance for nonvolatile memory devices. To study these topics, the TiO"xN"y metal oxide NPs embedded in the HfO"xN"y ... Keywords: Charge trapping nodes, HfOxNy, Nanoparticles, Nonvolatile memory devices, TiOxNy

Chien-Wei Liu; Chin-Lung Cheng; Kuei-Shu Chang-Liao; Jin-Tsong Jeng; Bau-Tong Dai; Chen-Pang Tsai

2009-07-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Chemical and Biomolecular Engineering at NC State University  

E-Print Network (OSTI)

for biological research and solar energy conversion. Chemical and Biomolecular Engineering at NC State #12.Biocatalysts(enzymes) are of vital importance in the production of transportation fuels from renewable resources. Bioethanol) and cellulosic biomass can be used as sources of sugars for fermentation to ethanol. Prof. Lamb's group is also

Velev, Orlin D.

102

MI  

NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)

103

Trends, seasonal cycles and synpotic scale episodes of halocarbons observed in Ny-lesund, Spitsbergen.  

E-Print Network (OSTI)

??A study of the important gases in the air at the Ny-lesund measuring station at Svalbard is presented in this thesis. The monitoring station is (more)

Fjraa, Ann Mari

2005-01-01T23:59:59.000Z

104

DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4

105

DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP

106

Precise global collision detection in multi-axis NC-machining  

Science Conference Proceedings (OSTI)

We introduce a new approach to the problem of collision detection in multi-axis NC-machining. Due to the directional nature (tool axis) of multi-axis NC-machining, space subdivision techniques are adopted from ray-tracing algorithms and are extended ... Keywords: 5-Axis machining, Collision detection and verification, Lower envelopes, NC-machining, Ray tracing, Space subdivision

Oleg Ilushin; Gershon Elber; Dan Halperin; Ron Wein; Myung-Soo Kim

2005-08-01T23:59:59.000Z

107

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...

108

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...

109

Renewable Energy Network of Entrepreneurs in Western New York RENEW NY |  

Open Energy Info (EERE)

Network of Entrepreneurs in Western New York RENEW NY Network of Entrepreneurs in Western New York RENEW NY Jump to: navigation, search Name Renewable Energy Network of Entrepreneurs in Western New York (RENEW NY) Place Rochester, New York Zip 14623 Sector Renewable Energy Product US-based incubator fund, Renewable Energy Network of Entrepreneurs in Western New York, helps early stage renewable energy companies to start and grow in Western New York. References Renewable Energy Network of Entrepreneurs in Western New York (RENEW NY)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Renewable Energy Network of Entrepreneurs in Western New York (RENEW NY) is a company located in Rochester, New York . References ↑ "Renewable Energy Network of Entrepreneurs in Western New York

110

DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.

111

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either

112

NC State Chemical Engineering Degrees -B and BS Graduation Name NicknamDgr Maj Grad Date H Hometown StateInitial Employer Employer City StateJob Title  

E-Print Network (OSTI)

-Employed Diggs NC Farmer Oliver Max Gardner OMax BS IC 5/27/1903 Shelby NC NC College of A&M Ar Raleigh NC Winborne White BS IC 5/27/1903 Greenville NC Raleigh Hosiery Mill Raleigh NC Dyer Edgar William Gaither BS/30/1906 Halifax NC U. Illinois Urbana IL Assistant William Graham Knox BS IC 5/30/1906 Charlotte NC Northampton

Velev, Orlin D.

113

Properties of the SU(Nc) Gluon Plasma  

E-Print Network (OSTI)

We investigate the deconfinement transition in SU(Nc) gauge theories, and properties of the deconfined phase. A detailed lattice study of SU(4) and SU(6) gauge theories are conducted, and finite volume and cutoff effects on thermodynamic observables are studied. The scaling of the deconfinement transition point with lattice spacing is used to calculate the scale, Lambda_MSbar. The continuum estimates of the thermodynamic quantities are used to study properties of the gluon plasma. In particular, the approach to conformal limit is studied. We do not find any evidence of a strongly coupled, conformal phase in these theories.

Saumen Datta; Sourendu Gupta

2009-10-15T23:59:59.000Z

114

ANVIL-5000 1. 1. 1 NC programming update  

SciTech Connect

ANVIL-5000 is used effectively by the staff in Sandia's Materials Process Engineering and Fabrication Directorate to develop training materials, solve mathematics problems, prepare documentation, and program machines. The computational graphics resources are reviewed, the techniques for training the craftworker staff to use ANVIL are described, and a variety of current ANVIL applications are documented. Complex ANVIL projects involving a propeller blade mold and a water cooled head are described to illustrate the utility of CAD/CAM techniques being used by the NC Engineering staff. 30 figs.

Plomp, P.W.

1987-01-01T23:59:59.000Z

115

DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical

116

DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated

117

Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...

118

MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab

2008-10-01T23:59:59.000Z

119

Integrys Energy Services of N.Y., Inc. | Open Energy Information  

Open Energy Info (EERE)

Services of N.Y., Inc. Services of N.Y., Inc. (Redirected from Integrys) Jump to: navigation, search Name Integrys Energy Services of N.Y., Inc. Place New York Utility Id 21258 Utility Location Yes Ownership R ISO NY Yes Activity Retail Marketing Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.0625/kWh Commercial: $0.0809/kWh Industrial: $0.0631/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Integrys_Energy_Services_of_N.Y.,_Inc.&oldid=410875

120

DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)

2012-01-01T23:59:59.000Z

122

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state

123

Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio

2010-02-01T23:59:59.000Z

124

Submit Your Ideas for the NY Energy Data Jam | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Submit Your Ideas for the NY Energy Data Jam Submit Your Ideas for the NY Energy Data Jam Submit Your Ideas for the NY Energy Data Jam June 19, 2013 - 11:03am Q&A What idea would you present at the Data Jam? Join the Conversation Addthis Applications powered by open energy data were on display at the Energy Datapalooza in June 2012. | Photo by Sarah Gerrity, Energy Department. Applications powered by open energy data were on display at the Energy Datapalooza in June 2012. | Photo by Sarah Gerrity, Energy Department. Alex Cohen Alex Cohen Senior Digital Information Strategist How can I participate? Even if you cannot attend in person, we still want you to participate. Help us by starting the conversation. Email us at newmedia@hq.doe.gov and tell us your idea. Tweet questions to @ENERGY with the hashtag #EnergyJam.

125

New York Battery and Energy Storage Technology Consortium NY BEST | Open  

Open Energy Info (EERE)

Storage Technology Consortium NY BEST Storage Technology Consortium NY BEST Jump to: navigation, search Name New York Battery and Energy Storage Technology Consortium (NY-BEST) Place Albany, New York Zip 12203 Product Albany-based project of NYSERDA promoting battery and energy storage in New York. Coordinates 42.707237°, -89.436378° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.707237,"lon":-89.436378,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

126

DOE Awards Small Business Contract for West Valley NY Services | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Contract for West Valley NY Services Contract for West Valley NY Services DOE Awards Small Business Contract for West Valley NY Services September 26, 2012 - 12:00pm Addthis Media Contact Bill Taylor bill.taylor@srs.gov 803-952-8564 CINCINNATI - The Department of Energy (DOE) today awarded a task order (contract) to Chenega Global Services, LLC of Anchorage, Alaska, for administrative and technical support services at the West Valley Demonstration Project, West Valley, New York. The contract has a one-year performance period with a value of $1.3 million, and contains two one-year extension options with a total value of $4.12 million. Chenega Global Services is a certified small and disadvantaged business under the Small Business Administration. The West Valley Demonstration Project is a former commercial nuclear fuel

127

Weatherization Subgrantees Reach More N.Y. Homes | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Subgrantees Reach More N.Y. Homes Subgrantees Reach More N.Y. Homes Weatherization Subgrantees Reach More N.Y. Homes April 22, 2010 - 4:37pm Addthis Lindsay Gsell Thanks to funds from the Recovery Act, New York expanded its network of weatherization subgrantees. The state has added nine additional subgrantees to its network of 66 community-based organizations that provide energy conservation services on a local level. New York's Division of Housing and Community Renewal received slightly more than $100 million for Weatherization Assistance Program in 2009, a significant increase from its previous annual allotment of approximately $60 million. In addition to this increase in annual funding, DHCR also received $394 million in WAP stimulus funding from the Recovery Act. "New York's success has been built on a network of sub grantees and

128

DOE - Office of Legacy Management -- West Milton Reactor Site - NY 21  

Office of Legacy Management (LM)

Milton Reactor Site - NY 21 Milton Reactor Site - NY 21 FUSRAP Considered Sites Site: West Milton Reactor Site (NY.21) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: This site is one of a group of 77 FUSRAP considered sites for which few, if any records are available in their respective site files to provide an historical account of past operations and their relationship, if any, with MED/AEC operations. Reviews of contact lists, accountable station lists, health and safety records and other documentation of the period do not provide sufficient information to warrant further search of historical records for information on these sites. These site files remain "open" to

129

Submit Your Ideas for the NY Energy Data Jam | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Submit Your Ideas for the NY Energy Data Jam Submit Your Ideas for the NY Energy Data Jam Submit Your Ideas for the NY Energy Data Jam June 19, 2013 - 11:03am Q&A What idea would you present at the Data Jam? Join the Conversation Addthis Applications powered by open energy data were on display at the Energy Datapalooza in June 2012. | Photo by Sarah Gerrity, Energy Department. Applications powered by open energy data were on display at the Energy Datapalooza in June 2012. | Photo by Sarah Gerrity, Energy Department. Alex Cohen Alex Cohen Senior Digital Information Strategist How can I participate? Even if you cannot attend in person, we still want you to participate. Help us by starting the conversation. Email us at newmedia@hq.doe.gov and tell us your idea. Tweet questions to @ENERGY with the hashtag #EnergyJam.

130

DOE - Office of Legacy Management -- Pier 38 - NY 0-18  

Office of Legacy Management (LM)

Pier 38 - NY 0-18 Pier 38 - NY 0-18 FUSRAP Considered Sites Site: Pier 38 (NY.0-18 ) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: This site is one of a group of 77 FUSRAP considered sites for which few, if any records are available in their respective site files to provide an historical account of past operations and their relationship, if any, with MED/AEC operations. Reviews of contact lists, accountable station lists, health and safety records and other documentation of the period do not provide sufficient information to warrant further search of historical records for information on these sites. These site files remain "open" to

131

Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png

132

Quark-Hadron Duality for Hybrid Mesons at Large-Nc  

E-Print Network (OSTI)

We investigate implications of quark-hadron duality for hybrid mesons in the large-Nc limit. A simple formalism is developed which implements duality for QCD two-point functions of currents of quark bilinears, with any number of gluons. We argue that the large-Nc meson masses share a common parameter, which is related to the QCD string tension. This parameter is fixed from correlators of conserved vector and axial-vector currents, and using lattice QCD determinations of the string tension. Our results predict towers of hybrid mesons which, within expected 1/Nc corrections, naturally accommodate the 1^(-+) experimental hybrid candidates.

S. R. Beane

2001-08-02T23:59:59.000Z

133

Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls

134

Toxicity of aqueous fullerene nC60 to activated sludge: nitrification inhibition and microtox test  

Science Conference Proceedings (OSTI)

The increasing production and use of fullerene nanomaterials raised their exposure potential to the activated sludge during biological wastewater treatment process. In this study, the toxicity of aqueous nanoscaled C60 (nC60) to ...

Yongkui Yang; Norihide Nakada; Ryoji Nakajima; Chao Wang; Hiroaki Tanaka

2012-01-01T23:59:59.000Z

135

Pion Electroproduction Amplitude Relations in the 1/N_c Expansion  

E-Print Network (OSTI)

We derive expressions for pion electroproduction amplitudes in the 1/N_c expansion of QCD, and obtain from them linear relations between the electromagnetic multipole amplitudes that hold at all energies. The leading-order relations in 1/N_c compare favorably with available data (especially away from resonances), but the next-to-leading-order relations tend to provide only small or no improvement.

Lebed, Richard F

2009-01-01T23:59:59.000Z

136

HEAVY BARYONS: A COMBINED LARGE Nc AND HEAVY QUARK EXPANSION FOR ELECTROWEAK CURRENTS  

E-Print Network (OSTI)

The combined large Nc and heavy quark limit for baryons containing a single heavy quark is discussed. The combined large Nc and heavy quark expansion of the heavy quark bilinear operators is obtained. In the combined expansion the corrections proportional to mN/mQ are summed to all orders. In particular, the combined expansion can be used to determine semileptonic form factors of heavy baryons in the combined limit. 1

Boris A. Gelman

2002-01-01T23:59:59.000Z

137

pi N to Multi-pi N Scattering in the 1/N_c Expansion  

E-Print Network (OSTI)

We extend the 1/N_c meson-baryon scattering formalism to pi N to multi-pi N case. We first show that the leading-order large N_c processes proceed through resonant intermediate states (e.g., rho N or pi Delta). We find that the pole structure of baryon resonances can be uniquely identified by their (non)appearance in eta N or mixed partial-wave pi Delta final states.

Herry J. Kwee

2007-06-29T23:59:59.000Z

138

Large $N_c$ QCD at non-zero chemical potential  

E-Print Network (OSTI)

The general issue of large $N_c$ QCD at nonzero chemical potential is considered with a focus on understanding the difference between large $N_c$ QCD with an isospin chemical potential and large $N_c$ QCD with a baryon chemical potential. A simple diagrammatic analysis analogous to `t Hooft's analysis at $\\mu=0$ implies that the free energy with a given baryon chemical potential is equal to the free energy with an isospin chemical potential of the same value plus $1/N_c$ corrections. Phenomenologically, these two systems behave quite differently. A scenario to explain this difference in light of the diagrammatic analysis is explored. This scenario is based on a phase transition associated with pion condensation when the isospin chemical potential exceeds $m_\\pi/2$; associated with this transition there is breakdown of the $1/N_c$ expansion--in the pion condensed phase there is a distinct $1/N_c$ expansion including a larger set of diagrams. While this scenario is natural, there are a number of theoretical issues which at least superficially challenge it. Most of these can be accommodated. However, the behavior of quenched QCD which raises a number of apparently analogous issues cannot be easily understood completely in terms of an analogous scenario. Thus, the overall issue remains open.

Thomas D. Cohen

2004-10-11T23:59:59.000Z

139

Joint Metering and Conflict Resolution in Air Traffic Control Jerome Le Ny  

E-Print Network (OSTI)

Joint Metering and Conflict Resolution in Air Traffic Control Jerome Le Ny and George J. Pappas programming. A key feature of this approach is its ability to also take into account various metering and metering in order to support this task. This paper addresses this problem by presenting a trajectory

Plotkin, Joshua B.

140

A parameterization of the Fermat curves satisfying x^(2N)+y^(2N)=1  

E-Print Network (OSTI)

Note that the family of closed curves C_N={(x,y)\\in R^2;x^(2N)+y^(2N)=1} for N=1,2,3,... approaches the boundary of [-1,1]^2 as N \\to \\infty. In this paper we exhibit a natural parameterization of these curves and generalize to a larger class of equations.

Kerry M. Soileau

2007-07-20T23:59:59.000Z

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

142

,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

143

C:\\ANNUAL\\VENTCHAP.V8\\NGA.VP  

Gasoline and Diesel Fuel Update (EIA)

4 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99...

144

Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...

145

C:\\ANNUAL\\VENTCHAP.V8\\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...

146

C:\\ANNUAL\\VENTCHAP.V8\\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

0 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy...

147

NGA98fin5.vp  

Annual Energy Outlook 2012 (EIA)

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99...

148

U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)

3 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE...

149

North Carolina School of Science and Mathematics from Durham, NC and  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

North Carolina School of Science and Mathematics from Durham, NC North Carolina School of Science and Mathematics from Durham, NC and Albuquerque Academy from Albuquerque, NM Win the U.S. Department of Energy National Science Bowl North Carolina School of Science and Mathematics from Durham, NC and Albuquerque Academy from Albuquerque, NM Win the U.S. Department of Energy National Science Bowl May 3, 2010 - 12:00am Addthis WASHINGTON, D.C. - A high school team from Durham and a middle school team from Albuquerque won the 2010 U.S. Department of Energy (DOE) National Science Bowl today at the National Building Museum in Washington. North Carolina School of Science and Mathematics beat Mira Loma High School from Sacramento CA in the high school national championship match by correctly answering a chemistry question. Albuquerque Academy beat Gale

150

N.C. Agency Growing, Helping Citizens Save Money | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

N.C. Agency Growing, Helping Citizens Save Money N.C. Agency Growing, Helping Citizens Save Money N.C. Agency Growing, Helping Citizens Save Money March 12, 2010 - 5:20pm Addthis Reginald Speight, CEO of Martin County Community Action | Photo courtesy of Martin County Community Action Reginald Speight, CEO of Martin County Community Action | Photo courtesy of Martin County Community Action Joshua DeLung North Carolina will receive $132 million, or 10 times more money than in years past, for its weatherization program through the Recovery Act. Martin County Community Action is tasked with weatherizing about 1,029 units with its $7.7 million share. The agency has also surpassed its 123 units from its usual fiscal year funding. "It's been interesting ramping up like this, but we've put our agency in a position the last couple of years to be able to do more creative

151

N.C. Agency Growing, Helping Citizens Save Money | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

N.C. Agency Growing, Helping Citizens Save Money N.C. Agency Growing, Helping Citizens Save Money N.C. Agency Growing, Helping Citizens Save Money March 12, 2010 - 5:20pm Addthis Reginald Speight, CEO of Martin County Community Action | Photo courtesy of Martin County Community Action Reginald Speight, CEO of Martin County Community Action | Photo courtesy of Martin County Community Action Joshua DeLung North Carolina will receive $132 million, or 10 times more money than in years past, for its weatherization program through the Recovery Act. Martin County Community Action is tasked with weatherizing about 1,029 units with its $7.7 million share. The agency has also surpassed its 123 units from its usual fiscal year funding. "It's been interesting ramping up like this, but we've put our agency in a position the last couple of years to be able to do more creative

152

Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.

153

File:USDA-CE-Production-GIFmaps-NY.pdf | Open Energy Information  

Open Energy Info (EERE)

NY.pdf NY.pdf Jump to: navigation, search File File history File usage New York Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 324 KB, MIME type: application/pdf) Description New York Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States New York External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:19, 27 December 2010 Thumbnail for version as of 16:19, 27 December 2010 1,650 × 1,275 (324 KB) MapBot (Talk | contribs) Automated bot upload

154

MHK Projects/GCK Technology Shelter Island NY US | Open Energy Information  

Open Energy Info (EERE)

Shelter Island NY US Shelter Island NY US < MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.0682,"lon":-72.3387,"alt":0,"address":"","icon":"http:\/\/prod-http-80-800498448.us-east-1.elb.amazonaws.com\/w\/images\/7\/74\/Aquamarine-marker.png","group":"","inlineLabel":"","visitedicon":""}]}

155

DOE - Office of Legacy Management -- Pfaltz and Bauer Inc - New York - NY  

Office of Legacy Management (LM)

New York - New York - NY 45 FUSRAP Considered Sites Site: Pfaltz and Bauer Inc - New York (NY.45) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: This site is one of a group of 77 FUSRAP considered sites for which few, if any records are available in their respective site files to provide an historical account of past operations and their relationship, if any, with MED/AEC operations. Reviews of contact lists, accountable station lists, health and safety records and other documentation of the period do not provide sufficient information to warrant further search of historical records for information on these sites. These site files remain "open" to

156

File:EIA-Appalach1-NY-BOE.pdf | Open Energy Information  

Open Energy Info (EERE)

EIA-Appalach1-NY-BOE.pdf EIA-Appalach1-NY-BOE.pdf Jump to: navigation, search File File history File usage Appalachian Basin, New York Area Oil and Gas Fields By 2001 BOE Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 12.75 MB, MIME type: application/pdf) Description Appalachian Basin, New York Area Oil and Gas Fields By 2001 BOE Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States New York File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment

157

Affirmatively furthering fair housing : overcoming barriers to implementation of the Westchester County, NY false claims case settlement  

E-Print Network (OSTI)

Westchester County, NY was sued by the Anti-Discrimination Center of Metro New York, Inc. (ADC) under the False Claims Act for allegedly failing to meet its Affirmatively Further Fair Housing obligation for Community ...

Stein, Julie Iris

2010-01-01T23:59:59.000Z

158

Built waterfront through edge, connection, and exchange : reclaiming a waterfront for Greenpoint, a project in Brooklyn, N.Y.  

E-Print Network (OSTI)

Currently the waterfront of Brooklyn N.Y. between the Gowanus Canal of Redhook and the Newton Creek of Greenpoint is predominantly lined with various types of industrial and manufacturing uses. Scattered throughout are ...

Ziesemann, Rodney P. (Rodney Paul), 1967-

1998-01-01T23:59:59.000Z

159

Magneto-intersubband oscillations in triple quantum wells S. Wiedmann a,, N.C. Mamani b  

E-Print Network (OSTI)

Magneto-intersubband oscillations in triple quantum wells S. Wiedmann a,?, N.C. Mamani b , G online 24 November 2009 Keywords: Triple quantum well Magneto-intersubband oscillations a b s t r a c t We present magnetotransport studies of high-density triple quantum well samples with different

Gusev, Guennady

160

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.

2005-05-01T23:59:59.000Z

162

DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP

163

DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;

164

DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co

165

File:USDA-CE-Production-GIFmaps-NC.pdf | Open Energy Information  

Open Energy Info (EERE)

NC.pdf NC.pdf Jump to: navigation, search File File history File usage North Carolina Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 355 KB, MIME type: application/pdf) Description North Carolina Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States North Carolina External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:17, 27 December 2010 Thumbnail for version as of 16:17, 27 December 2010 1,650 × 1,275 (355 KB) MapBot (Talk | contribs) Automated bot upload

166

The QCD Phase Diagram: Large Nc, Quarkyonic Matter and the Triple Point  

SciTech Connect

I discuss the phase diagram of QCD in the large N_c limit. Quarkyonic Matter is described. The properties of QCD matter as measured in the abundance of produced particles are shown to be consistent with this phase diagram. A possible triple point of Hadronic Mater, Deconfined Matter and Quarkyonic matter is shown to explain various behaviors of ratios of particles abundances seen in CERN fixed target experiments.

McLerran L.

2010-01-31T23:59:59.000Z

167

Test Map and Discreteness Criteria for Subgroups in PU(1,n;C)  

E-Print Network (OSTI)

We study the discreteness for non-elementary subgroup G in PU(1, n;C), under the assumption that G satisfies Condition A. Mainly, we present that one can use a test map, which need not to be in G, to examine the discreteness of G, and also show that G is discrete, if every two-loxodromic-generator subgroup of G is discrete.

Li, ChangJun

2011-01-01T23:59:59.000Z

168

Large-Nc estimate of the chiral low-energy constants  

E-Print Network (OSTI)

Chiral low-energy constants incorporate short-distance information from the dynamics involving heavier degrees of freedom not present in the chiral Lagrangian. We have studied the contribution of the lightest resonances to the chiral low-energy constants, up to O(p^6), within a systematic procedure guided by the large-Nc limit of QCD and also including short-distance asymptotic constraints.

J. Portoles

2007-02-18T23:59:59.000Z

169

Structural, optical and electrical properties of WOxNy filmsdeposited by reactive dual magnetron sputtering  

SciTech Connect

Thin films of tungsten oxynitride were prepared by dual magnetron sputtering of tungsten using argon/oxygen/nitrogen gas mixtures with various nitrogen/oxygen ratios. The presence of even small amounts of oxygen had a great effect not only on the composition but on the structure of WOxNy films, as shown by Rutherford backscattering and x-ray diffraction, respectively. Significant incorporation of nitrogen occurred only when the nitrogen partial pressure exceeded 89 percent of the total reactive gas pressure. Sharp changes in the stoichiometry, deposition rate, room temperature resistivity, electrical activation energy and optical band gap were observed when the nitrogen/oxygen ratio was high.The deposition rate increased from 0.31 to 0.89 nm/s, the room temperature resistivity decreased from 1.65 x 108 to 1.82 x 10-2 ?cm, the electrical activation energy decreased from 0.97 to 0.067 eV, and the optical band gap decreased from 3.19 to 2.94 eV upon nitrogen incorporation into the films. WOxNy films were highly transparent as long as the nitrogen incorporation was low, and were brownish (absorbing) and partially reflecting as nitrogen incorporation became significant.

Mohamed, Sodky H.; Anders, Andre

2006-06-05T23:59:59.000Z

170

DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on

171

DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:

172

Poplar breeding and testing strategies in the NC US: Demonstration of potential yield and consideration of future research needs.  

SciTech Connect

The objective of this project was to extend previous poplar breeding and selection in the NC US by implementing a regional testing system with multiple test locations in Minnesota, Iowa, Wisconsin and Michigan.

Riemenschneider, Don; Berguson, William E; Dickmann, Don; Hall, Richard

2004-06-30T23:59:59.000Z

173

REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

174

MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units

175

Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper

2012-02-20T23:59:59.000Z

176

The nuclear liquid-gas phase transition at large $N_c$ in the Van der Waals approximation  

E-Print Network (OSTI)

We examine the nuclear liquid-gas phase transition at large number of colors ($N_c$) within the framework of the Van Der Waals (VdW) model. We argue that the VdW equation is appropriate at describing inter-nucleon forces, and discuss how each parameter scales with $N_c$. We demonstrate that $N_c=3$ (our world) is not large with respect to the other dimensionless scale relevant to baryonic matter, the number of neighbors in a dense system $N_N$. Consequently, we show that the liquid-gas phase transition looks dramatically different at $N_c \\to \\infty$ with respect of our world: The critical point temperature becomes of the order of $\\lqcd$ rather than below it. The critical point density becomes of the order of the baryonic density, rather than an order of magnitude below it. These are precisely the characteristics usually associated with the "Quarkyonic phase". We therefore conjecture that quarkyonic matter is simply the large $N_c$ limit of the nuclear liquid, and the interplay between $N_c$ and $N_N$ is the reason why the nuclear liquid in our world is so different from quarkyonic matter. We conclude by suggesting ways our conjecture can be tested in future lattice measurements.

Giorgio Torrieri; Igor Mishustin

2010-06-12T23:59:59.000Z

177

CRANE CO. 757 THIRD AVENUE NEW YORK. N.Y. THOMAS UNGERLAND ASSOCIATE GENERAL COUNSEL  

Office of Legacy Management (LM)

? ? z _ - c 0-e . CRANE CO. 757 THIRD AVENUE NEW YORK. N.Y. THOMAS UNGERLAND ASSOCIATE GENERAL COUNSEL December 14, 1987 James J. Fiore Director Office of Nuclear Energy Department of Energy Washington, D.C. Re: Crane - Indian Orchard Dear M r. Fiore: W e acknowledge receipt of your letter to Paul Hundt, dated September 29, 1987, which requests certain information about Crane's plant site in Indian Orchard, Massachusetts. The plant is not currently operating. Crane was unable to locate any records concerning the machining of uranium in the 1947-48 period for a customer, Brookhaven Labs, at the Indian Orchard, facility. It is believed that the records, which were kept on the second floor at 305 Hamshire Street, Indian Orchard, Massachusetts were moved ten or fifteen years ago

178

DOE Challenge Home Case Study, Ferguson Design and Construction, Inc., Sagaponak, NY, Custom Home  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Ferguson Design & Ferguson Design & Construction, Inc. Sagaponack, NY BUILDING TECHNOLOGIES OFFICE DOE Challenge Home builders are in the top 1% of builders in the country meeting the extraordinary levels of excellence and quality specifi ed by the U.S. Department of Energy. Every DOE Challenge Home starts with ENERGY STAR for Homes Version 3 for an energy-effi cient home built on a solid foundation of building science research. Then, even more advanced technologies are designed in for a home that goes above and beyond current code to give you the superior quality construction, HVAC, appliances, indoor air quality, safety, durability, comfort, and solar-ready components along with ultra-low or no utility bills. This provides homeowners with a quality home that will last for generations to come.

179

DECONTAMINATION OF DREDGED MATERIAL FROM PORT OF NY/NJ DECONTAMINATION OF DREDGED MATERIAL FROM THE PORT OF  

E-Print Network (OSTI)

of Liters Transported (Source: New Jersey Petroleum Council) Rank Port Liters 1 New York Harbor, NY/NJ 106 Jersey ranks first in the United States in volume of petroleum products handled each year. In addition to the discharge of significant amounts of petroleum hydrocarbons into the waters of the New York/New Jersey region

Brookhaven National Laboratory

180

LJUPKA ARSOVA 30-65 Steinway Street, Astoria, 11103 NY1-305-582-2559ljarsova@caa.columbia.edu  

E-Print Network (OSTI)

, NY Consultant for anaerobic digestion Nov. 2010- present Clinton Global Initiative- Cason Family Master Thesis research - "Anaerobic digestion of the food waste: current status, problems and alternative" "Microbial populations and their interactions in Anaerobic Digestion reactors" "A CO2-to-CH4 recycle loop

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-10-01T23:59:59.000Z

182

Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel

2010-01-01T23:59:59.000Z

183

MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-12-01T23:59:59.000Z

184

Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)

2011-12-01T23:59:59.000Z

185

The sGang steng-b rNying ma'i rGyud manuscript from Bhutan  

E-Print Network (OSTI)

first folios, itsimply gives the volume identification and pagination in gold ink. 6 Volumes Ka, Pa, Ra, Ha to Ki, Gi, Ci, Chi, Nyi, Thi, Ni, Pi, Bi, and Mi 7 This is unlike the Rig 'dzin edition, where...

Cathy Cantwell; Mayer, Rob

2006-01-01T23:59:59.000Z

186

Real Time Simulation and Visualization of NC Milling Processes for Inhomogeneous Materials on Low-End Graphics Hardware  

E-Print Network (OSTI)

Simulation and visualization of NC milling processes has become an important step in computer aided manufacturing. The usage of stock materials with specific locally varying properties (like density, accuracy, color,. . . ) becomes more and more important with new technologies emerging in the material industry. Our new approach, using volumetric representation, has been adapted to this needs and copes with inhomogeneous material properties. Taking color as one possible material property, our approach enables the visualization of milled wood or compound materials. Furthermore, our approach has been developed with the usage of low-end graphics hardware in mind. The algorithms have been optimized to ensure interactive update rates even on standard personal computers without hardware graphics acceleration. Keywords: NC milling simulation, dexel approach, inhomogeneous material properties 1. Introduction NC milling simulation using computer graphics techniques was proposed some years ag...

Andreas Holger Knig; Eduard Grller

1998-01-01T23:59:59.000Z

187

A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)

2012-07-15T23:59:59.000Z

188

2012 SG Peer Review - Interoperability of Demand Response Resources in New York - Andre Wellington, ConEd NY  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Interoperability of Demand Response Interoperability of Demand Response Resources in NY Andre Wellington Con Edison June 8, 2012 December 2008 Interoperability of Demand Resource Resources in NY Objective Life-cycle Funding ($M) FY08 - FY13 $6.8 million Technical Scope (Insert graphic here) Develop and demonstrate technology required to integrate customer owned resources into the electrical distribution system * Evaluate interconnection designs * Design and install thermal storage plant with enhanced capabilities * Develop AutoDR application for targeted distributed resources 2 December 2008 Needs and Project Targets Develop the technology required to integrate customer owned distributed resources into the distribution system to enable the of deferment capital investments. * Remote dispatch of customer resources

189

STATE OF NEW YORK DEPARTMENT OF PUBLIC SERVICE THREE EMPIRE STATE PLAZA, ALBANY, NY 12223-1350  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NEW YORK DEPARTMENT OF PUBLIC SERVICE NEW YORK DEPARTMENT OF PUBLIC SERVICE THREE EMPIRE STATE PLAZA, ALBANY, NY 12223-1350 www.dps.ny.gov PUBLIC SERVICE COMMISSIO~ PETER McGOWAN GARRY A. BROWN General Counsel Chairman PATRICIA L. ACAMPORA MAUREEN F. HARRIS JACLYN A, BRILLING ROBERT E. CURRY JR. Secretary JAMES L. LAROCCA Commissioners January 31, 2012 FILED ELECTRONICALLY @ http://energy.gov/oelcongestion-study-2012 Office of Electricity Delivery and Energy Reliability, OE-20 U.S. Department of Energy 1000 Independence Avenue, SW Washington, D.C. i0585 Re: Preparation ofthe 2012 Congestion Study Dear Sir or Madam: I am writing in response to the Notice of Regional Workshops and Request For Written Comments, 76 Federal Register No. 218, 70122 (November 10,2011). Enclosed please find the comments of

190

Microsoft Word - figure_8.doc  

Gasoline and Diesel Fuel Update (EIA)

T I D O R W Y ND SD C A N V U T CO NE KS A Z NM OK TX MN WI MI IA I L IN OH MO AR M S AL GA T N KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI A K J a p a n Mexico M e x...

191

Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.

1997-10-01T23:59:59.000Z

192

Resonance Spin Flavour Precession of Solar Neutrinos After SNO NC Data  

E-Print Network (OSTI)

We present an analysis of the solar neutrino data assuming the deficit of solar neutrinos to be originated from the interaction of their transition magnetic moments with the solar magnetic field. We perform fits to the rates only and global fits and consider separately the existing data prior to the announcement of the SNO NC results, and present data. Predictions for the Borexino experiment are also derived. The solar field profiles are taken both in the radiation zone and core of the sun, and in the convective zone. The latter are chosen so as to exhibit a rapid increase across the bottom of the convective zone and a moderate decrease towards the surface. Regarding the field profiles in the radiative zone and core, it is found that the data show a preference for those cases in which a strong field rests at the solar centre with a steep decrease thereafter. For these, the quality of the global fits is as good as the one from the best oscillation solutions and the same as for the convective zone profiles examined. It is also found that the $\\chi^2$ of the fits increases when the most recent data are considered, owing to the smaller errors involved. This in turn provides more precise predictions for Borexino than previous ones, thus resulting in a clearer possible distinction between magnetic moment and the currently favoured oscillation solutions.

Bhag C. Chauhan; Joao Pulido

2002-06-20T23:59:59.000Z

193

PATTERNS OF UNITED STATES MORTALITY FOR TEN SELECTED CAUSES OF DEATH  

E-Print Network (OSTI)

NY NY NJ OH PA NY IN NJ Rate Score Cancer of the Rectum :-Bergen New York Lake NJ IL NJ NY OH Rate Score Cancer of theNew York Middlesex Rate Score IL NJ MI OH NY PA NY IL NY MA

Selvin, S.

2013-01-01T23:59:59.000Z

194

Superscaling in electron-nucleus scattering and its link to CC and NC QE neutrino-nucleus scattering  

E-Print Network (OSTI)

The superscaling approach (SuSA) to neutrino-nucleus scattering, based on the assumed universality of the scaling function for electromagnetic and weak interactions, is reviewed. The predictions of the SuSA model for bot CC and NC differential and total cross sections are presented and compared with the MiniBooNE data. The role of scaling violations, in particular the contribution of meson exchange currents in the two-particle two-hole sector, is explored.

M. B. Barbaro; J. E. Amaro; J. A. Caballero; T. W. Donnelly; R. Gonzalez-Jimenez; M. Ivanov; J. M. Udias

2013-03-26T23:59:59.000Z

195

The theta^+ baryon in soliton models: large Nc QCD and the validity of rigid-rotor quantization  

E-Print Network (OSTI)

A light collective theta+ baryon state (with strangeness +1) was predicted via rigid-rotor collective quantization of SU(3) chiral soliton models. This paper explores the validity of this treatment. A number of rather general analyses suggest that predictions of exotic baryon properties based on this approximation do not follow from large Nc QCD. These include an analysis of the baryon's width, a comparison of the predictions with general large Nc consistency conditions of the Gervais-Sakita-Dashen-Manohar type; an application of the technique to QCD in the limit where the quarks are heavy; a comparison of this method with the vibration approach of Callan and Klebanov; and the 1/Nc scaling of the excitation energy. It is suggested that the origin of the problem lies in an implicit assumption in the that the collective motion is orthogonal to vibrational motion. While true for non-exotic motion, the Wess-Zumino term induces mixing at leading order between collective and vibrational motion with exotic quantum numbers. This suggests that successful phenomenological predictions of theta+ properties based on rigid-rotor quantization were accidental.

Thomas D. Cohen

2003-12-15T23:59:59.000Z

196

Radiological environs study at a fuel fabrication facility. [General Electric Fuel Fabrication Plant at Wilmington, NC  

SciTech Connect

Field studies were conducted to detect environmental contamination from fuel fabrication plant effluents. The plant chosen for study was operated by the General Electric Company, Nuclear Fuel Division, at Wilmington, NC. The facility operates continuously using the ammonium diuranate (ADU) process to convert 2.0 to 2.2% enriched UF/sub 6/ to UO/sub 2/ fuel. Continuous air samplers at five sites measured the concentrations of /sup 234/U and /sup 238/U in air for 36 one-week intervals. River water was sampled at nine locations above and below the plant discharge point during each of three field surveys. The atmospheric concentrations of /sup 234/U and /sup 238/U appeared to vary according to a log-normal distribution. The annual facility release of approximately 2 to 3 mCi uranium to the atmosphere would add from 0.01 to 0.2 fCi/m/sup 3/ uranium in the atmospheric environs. An individual residing continuously at the nearest residence is predicted to receive a 50-year dose commitment of 0.9 mrem to the lung. The approximately 1 Ci/y of uranium liquid effluent released would increase the uranium concentration in Northeast Cape Fear estuary about 3 kilometers downstream by 0.3 pCi/liter. Although this water is not potable and is not used for any potable water supply, ingestion of water containing uranium at this concentration for a year would deliver a 3-mrem dose commitment to the bone.

Lyon, R.J.; Shearin, R.L.; Broadway, J.A.

1978-10-01T23:59:59.000Z

197

OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown

2013-10-01T23:59:59.000Z

198

In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma

2013-06-01T23:59:59.000Z

199

NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk

200

Category:Utility Rate Impacts on PV Economics By Location | Open Energy  

Open Energy Info (EERE)

Utility Rate Impacts on PV Economics By Location Utility Rate Impacts on PV Economics By Location Jump to: navigation, search Impact of Utility Rates on PV Economics Montgomery, AL Little Rock, AR Flagstaff, AZ Phoenix, AZ Tucson, AZ Arcata, CA LA, CA San Francisco, CA Boulder, CO Eagle County, CO Pueblo, CO Bridgeport, CT Wilmington, DE Miami, FL Tampa, FL Atlanta, GA Savannah, GA Des Moines, IA Mason, IA Boise, ID Chicago, IL Springfield, IL Indianapolis, IN Goodland, KS Wichita, KS Lexington, KY New Orleans, LA Shreveport, LA Boston, MA Baltimore, MD Caribou, ME Portland, ME Detroit, MI Houghton-Lake, MI Traverse City, MI International Falls, MN Minneapolis, MN Kansas City, MO Jackson, MS Billings, MT Greensboro, NC Wilmington, NC Bismarck, ND Minot, ND Omaha, NE Concord, NH Atlantic City, NJ Albuquerque, NM Las Vegas, NV Reno, NV New York, NY

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Matrix SHERMAN1  

Science Conference Proceedings (OSTI)

SHERMAN1: Oil reservoir simulation challenge matrices Black oil simulation, shale barriers (NX = NY = NZ = 10, NC = 1 ). ...

2008-10-16T23:59:59.000Z

202

ACEEE Summer Study on Energy in Industry, West Point, NY, July 19-22. 1 Benchmarking Approaches: An Alternate Method to Determine Best  

E-Print Network (OSTI)

ACEEE Summer Study on Energy in Industry, West Point, NY, July 19-22. 1 Benchmarking Approaches: An Alternate Method to Determine Best Practice by Examining Plant-Wide Energy Signatures Yogesh Patil and John Seryak, Energy & Resource Solutions, Inc. Kelly Kissock, University of Dayton ABSTRACT Baselining

Kissock, Kelly

203

Baryons and Low-Density Baryonic Matter in 1+1 Dimensional Large N_c QCD with Heavy Quarks  

E-Print Network (OSTI)

This paper studies baryons and baryonic matter in the combined large N_c and heavy quark mass limits of QCD in 1+1 dimension. In this non-relativistic limit, baryons are composed of N_c quarks that interact, at leading order in N_c, through a color Coulomb potential. Using variational techniques, very accurate calculations of single baryon masses and interaction energies of low-density baryon crystal are performed. These results are used to cross-check a general numerical approach applicable for arbitrary quark masses and baryon densities recently proposed by Bringoltz, which is based on a lattice in a finite box with periodic boundary conditions. The Bringoltz method differs from a previous approach of Salcedo, et al. in its treatment of a finite box effect - namely gauge configurations that wind around the box. One might expect these effects to be small for large enough boxes, in which the baryon density approaches zero to high accuracy at the edges. However, the effects of these windings appear to be quite large even in such boxes. The large mass infinite volume calculations performed here are consistent with the results of numerical calculations using the Bringoltz method. The calculation of the baryon crystal interaction energy requires the assumption that at low-densities the ground state is composed of individual baryons, each in a color-singlet state and orthogonal to each other. This assumption is plausible but ad hoc in that one can construct configurations in which the entire state is color-singlet but cannot be broken into individual color-singlet baryons. The interaction energy of low-density baryon crystals calculated with the assumption is consistent with numerical results based on Bringoltz's approach suggesting that the assumption is justified. This further supports a similar assumption that was made in 3+1 dimensions, where no alternative means of calculation exist.

Prabal Adhikari; Thomas D. Cohen; Arec Jamgochian; Nilay Kumar

2012-12-10T23:59:59.000Z

204

miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay

205

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....

206

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA

207

DOE/EA-1631: Final Environmental Assessment for Department of Energy Loan Guarantee for Beacon Power Corporation Frequency Regulation Facility in Stephentown, NY (February 2009)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

31 31 Environmental Assessment for DEPARTMENT OF ENERGY LOAN GUARANTEE FOR BEACON POWER CORPORATION FREQUENCY REGULATION FACILITY IN STEPHENTOWN, N.Y. U.S. Department of Energy Loan Guarantee Program Office Washington, DC 20585 February 2009 FINAL ENVIRONMENTAL ASSESSMENT Environmental Assessment for Department of Energy Loan Guarantee for Beacon Power Corporation Frequency Regulation Facility in Stephentown, N.Y. DOE/EA-1631 TABLE OF CONTENTS LIST OF ACRONYMS iii 1.0 PURPOSE AND NEED 1 1.1 Introduction 1 1.2 Purpose and Need for Agency Action 1 2.0 DESCRIPTION OF PROPOSED ACTION AND NO ACTION ALTERNATIVE 3 2.1 Location 3 2.2 Proposed Action 3 2.2.1 Flywheel 3 2.2.2 Project Elements 4 2.2.3 Project Systems 5 2.2.4 Construction

208

Measurement of airborne fission products in Chapel Hill, NC, USA from the Fukushima Dai-ichi reactor accident  

E-Print Network (OSTI)

We present measurements of airborne fission products in Chapel Hill, NC, USA, from 62 days following the March 11, 2011, accident at the Fukushima Dai-ichi nuclear power plant. Airborne particle samples were collected daily in air filters and radio-assayed with two high-purity germanium (HPGe) detectors. The fission products I-131 and Cs-137 were measured with maximum activities of 4.2 +/- 0.6 mBq/m^3 and 0.42 +/- 0.07 mBq/m^3 respectively. Additional activity from I-131, I-132, Cs-134, Cs-136, Cs-137 and Te-132 were measured in the same air filters using a low-background HPGe detector at the Kimballton Underground Research Facility (KURF).

S. MacMullin; G. K. Giovanetti; M. P. Green; R. Henning; R. Holmes; K. Vorren; J. F. Wilkerson

2011-11-17T23:59:59.000Z

209

Measurement of Airborne Fission Products in Chapel Hill, NC, USA from the Kukushima Dai-ichi Reactor Accident  

SciTech Connect

We present measurement results of airborne fission products in Chapel Hill, NC, USA, from 62 d following the March 11, 2011, accident at the Fukushima Dai-ichi nuclear power plant. Airborne particle samples were collected daily in air filters and radio-assayed with two high-purity germanium (HPGe) detectors. The fission products 131I and 137Cs were measured with maximum activity concentrations of 4.2 0.6 mBq/m3 and 0.42 0.07 mBq/m3 respectively. Additional activity from 131,132I, 134,136,137Cs and 132Te were measured in the same air filters using a low-background HPGe detector at the Kimballton Underground Research Facility (KURF).

MacMullin, S. [Univ, of North Carolina & Triangle Universities Nucl. Lab - Durham, NC; Giovanetti, G. K. [Univ, of North Carolina & Triangle Universities Nucl. Lab - Durham, NC; Green, M. P. [Univ, of North Carolina & Triangle Universities Nucl. Lab - Durham, NC; Henning, R. [Univ, of North Carolina & Triangle Universities Nucl. Lab - Durham, NC; Holmes, R. [Univ. North Carolina-Chapel & Univ. of Illinois-Urbana; Vorren, K. [University of North Carolina / Triangle Universities Nuclear Lababoratory, Durham; Wilkerson, J. F. [UNC/Triangle Univ. Nucl. Lab, Durham, NC/ORNL

2012-01-01T23:59:59.000Z

210

miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li

2009-01-01T23:59:59.000Z

211

Evolutionary Significance of an Algal Gene Encoding an [FeFe]-Hydrogenase with F-Domain Homology and Hydrogenase Activity in Chlorella Variabilis NC64A  

SciTech Connect

[FeFe]-hydrogenases (HYDA) link the production of molecular H{sub 2} to anaerobic metabolism in many green algae. Similar to Chlamydomonas reinhardtii, Chlorella variabilis NC64A (Trebouxiophyceae, Chlorophyta) exhibits [FeFe]-hydrogenase (HYDA) activity during anoxia. In contrast to C. reinhardtii and other chlorophycean algae, which contain hydrogenases with only the HYDA active site (H-cluster), C. variabilis NC64A is the only known green alga containing HYDA genes encoding accessory FeS cluster-binding domains (F-cluster). cDNA sequencing confirmed the presence of F-cluster HYDA1 mRNA transcripts, and identified deviations from the in silico splicing models. We show that HYDA activity in C. variabilis NC64A is coupled to anoxic photosynthetic electron transport (PSII linked, as well as PSII-independent) and dark fermentation. We also show that the in vivo H{sub 2}-photoproduction activity observed is as O2 sensitive as in C. reinhardtii. The two C. variabilis NC64A HYDA sequences are similar to homologs found in more deeply branching bacteria (Thermotogales), diatoms, and heterotrophic flagellates, suggesting that an F-cluster HYDA is the ancestral enzyme in algae. Phylogenetic analysis indicates that the algal HYDA H-cluster domains are monophyletic, suggesting that they share a common origin, and evolved from a single ancestral F-cluster HYDA. Furthermore, phylogenetic reconstruction indicates that the multiple algal HYDA paralogs are the result of gene duplication events that occurred independently within each algal lineage. Collectively, comparative genomic, physiological, and phylogenetic analyses of the C. variabilis NC64A hydrogenase has provided new insights into the molecular evolution and diversity of algal [FeFe]-hydrogenases.

Meuser, J. E.; Boyd, E. S.; Ananyev, G.; Karns, D.; Radakovits, R.; Murthy, U. M. N.; Ghirardi, M. L.; Dismukes, G. C.; Peters, J. W.; Posewitz, M. C.

2011-10-01T23:59:59.000Z

212

Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)

2010-01-01T23:59:59.000Z

213

DEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE  

E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.

214

Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)

2012-07-01T23:59:59.000Z

215

Program on Technology Innovation: Oxy-Fired CFB with CO2 Capture and Storage at Jamestown (NY) Board of Public Utilities  

Science Conference Proceedings (OSTI)

Oxy-combustion of coal has been proposed as a way of reducing the costs of capturing CO2 (at a purity sufficient for geological storage) from coal-fired steam-electric power plants. To date, only lab and test-stand studies have been conducted, focusing primarily on the combustion process. The next major development step is to field an integrated oxy-coal power plant. Such a project has been proposed and is being developed for deployment at the Jamestown (NY) Board of Public Utilities (BPU) Carlson Genera...

2009-05-15T23:59:59.000Z

216

RFI for NC  

NLE Websites -- All DOE Office Websites (Extended Search)

Statement of Energy Service Requirements Statement of Energy Service Requirements & Format for Responses to a Request for Information GENERAL INFORMATION Document Type: Request for Information Posted Date: June 12, 2003 Original Response Date: June 26, 2003 Classification Code: 99-Miscellaneous-Renewable Energy/Renewable Energy Certificates (REC) DESCRIPTION The Federal Government is seeking interested parties to potentially supply renewable energy/REC in North Carolina behind the Duke Energy Service Territory, with the possibility of other locations as well. Requirements are estimated at approximately 30 million kWh. We are seeking Green-e certified (or the equivalent) REC, or renewable energy located close to North Carolina, but not necessarily within the state.

217

Durham, NC 27708  

DOE Green Energy (OSTI)

In the Krafla hydrothermal system in Iceland, both MT polarization and MEQ splitting directions align with

Malin, Peter E.; Shalev, Eylon; Onacha, Stepthen A.

2006-12-15T23:59:59.000Z

218

File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload

219

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See Block 16C I  

National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)

220

MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.

2011-05-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Better Buildings Neighborhood Program: Jacksonville, Florida  

NLE Websites -- All DOE Office Websites (Extended Search)

Jacksonville, Jacksonville, Florida to someone by E-mail Share Better Buildings Neighborhood Program: Jacksonville, Florida on Facebook Tweet about Better Buildings Neighborhood Program: Jacksonville, Florida on Twitter Bookmark Better Buildings Neighborhood Program: Jacksonville, Florida on Google Bookmark Better Buildings Neighborhood Program: Jacksonville, Florida on Delicious Rank Better Buildings Neighborhood Program: Jacksonville, Florida on Digg Find More places to share Better Buildings Neighborhood Program: Jacksonville, Florida on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC

222

Better Buildings Neighborhood Program: Indianapolis, Indiana  

NLE Websites -- All DOE Office Websites (Extended Search)

Indianapolis, Indianapolis, Indiana to someone by E-mail Share Better Buildings Neighborhood Program: Indianapolis, Indiana on Facebook Tweet about Better Buildings Neighborhood Program: Indianapolis, Indiana on Twitter Bookmark Better Buildings Neighborhood Program: Indianapolis, Indiana on Google Bookmark Better Buildings Neighborhood Program: Indianapolis, Indiana on Delicious Rank Better Buildings Neighborhood Program: Indianapolis, Indiana on Digg Find More places to share Better Buildings Neighborhood Program: Indianapolis, Indiana on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC

223

Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab

2007-03-01T23:59:59.000Z

224

A Main Steam Safety Valve (MSSV) With Fixed Blowdown According to ASME Section III,Part NC-7512  

Science Conference Proceedings (OSTI)

In 1986, the NRC issued the Information Notice (IN) 86-05 'Main Steam Safety Valve test failures and ring setting adjustments'. Shortly after this IN was issued, the Code was revised to require that a full flow test has to be performed on each CL.2 MSSV by the manufacturer to verify that the valve was adjusted so that it would reach full lift and thus full relieving capacity and would re-close at a pressure as specified in the valve Design Specification. In response to the concern discussed in the IN, the Westinghouse Owners Group (WOG) performed extensive full flow testing on PWR MSSVs and found that each valve required a unique setting of a combination of two rings in order to achieve full lift at accumulation of 3% and re-closing at a blowdown of 5%. The Bopp and Reuther MSSV type SiZ 2507 has a 'fixed blowdown' i.e. without any adjusting rings to adjust the 'blowdown' so that the blowdown is 'fixed'. More than 1000 pieces of this type are successfully in nuclear power plants in operation. Many of them since about 25 years. Therefore it can be considered as a proven design. It is new that an optimization of this MSSV type SiZ 2507 fulfill the requirements of part NC-7512 of the ASME Section III although there are still no adjusting rings in the flow part. In 2000, for the Qinshan Candu unit 1 and 2 full flow tests were performed with 32 MSSV type SiZ 2507 size 8'' x 12'' at 51 bar saturated steam in only 6 days. In all tests the functional performance was very stable. It was demonstrated by recording the signals lift and system pressure that all valves had acceptable results to achieve full lift at accumulation of 3% and to re-close at blowdown of 5%. This is an advantage which gives a reduction in cost for flow tests and which gives more reliability after maintenance work during outage compared to the common MSSV design with an individual required setting of the combination of the two rings. The design of the type SiZ 2507 without any adjusting rings in the flow path is presented. The stable performance depends on the interaction of flow force and spring force. The optimization of the flow path to create a suitable flow-force-curve was managed by Computational Fluid Dynamics (CFD) and flow-force-characteristic-measurements at a model 1: 2.5. The method of the flow-force-characteristic-measurement permits systematic dimensioning of valve spring forces by means of measurement of the fluid mechanical forces occurring on the valve spindle during flow. A special procedure was established to verify a spring force versus lift curve with an accuracy of 1% for each production valve. This gives high reliability at required stable performance and this can not be influenced by wrong setting of any adjusting ring during maintenance work. (authors)

Follmer, Bernhard; Schnettler, Armin [Bopp and Reuther Sicherheitsund Regelarmaturen, GmbH, Mannheim (Germany)

2002-07-01T23:59:59.000Z

225

Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A

2008-01-01T23:59:59.000Z

226

EIA-877 WINTER HEATING FUELS TELEPHONE SURVEY INSTRUCTIONS  

U.S. Energy Information Administration (EIA)

designed to collect data on State-level stocks and residential prices of No. 2 heating oil and propane during ... New Jersey NY - New York NC - North Carolina

227

ITP_Data_Centers.xls  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Center HQs: Yorktown Heights, NY Project Location: Research Triangle Park, NC Reducing Data Center Cooling Energy through Software-Based Management Tools. The project will develop...

228

Matrix Set SHERMAN  

Science Conference Proceedings (OSTI)

... [sherman1 Icon] SHERMAN1 (real symmetric, 1000 by 1000, 3750 entries), Black oil simulation, shale barriers (NX = NY = NZ = 10, NC = 1 ); ...

2008-10-16T23:59:59.000Z

229

NGA98fin5.vp  

Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental

230

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural

231

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration

232

Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.

233

Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.

234

NGA98fin5.vp  

Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure

235

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of

236

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental

237

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential

238

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost

239

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure

240

C:\ANNUAL\VENTCHAP.V8\NGA.VP  

Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."

242

T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab

2012-02-11T23:59:59.000Z

243

Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester

2012-07-01T23:59:59.000Z

244

PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos

2008-06-27T23:59:59.000Z

245

LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance

246

U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office

247

Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.

2003-12-01T23:59:59.000Z

248

Ny historia?; A new history?.  

E-Print Network (OSTI)

?? This essay aims to examine how three active history teachers in the upper secondary school interprets the new course plan for history in gy11. (more)

Axelsson, Christofer

2010-01-01T23:59:59.000Z

249

ny_50m_wind  

NLE Websites -- All DOE Office Websites (Extended Search)

ataTechnologySpecificUnitedStatesWindHighResolutionNewYorkWindHighResolution.zip> Description: Abstract: Annual average wind resource potential for New York at a 50...

250

Past Chairmen of the Conference  

Science Conference Proceedings (OSTI)

... 73rd 1988 Grand Rapids, MI D. Guensler, CA 74th 1989 Seattle, WA J. Bartfai, NY 75th 1990 Washington, DC F. Gerk, NM ...

2013-07-08T23:59:59.000Z

251

[(CH3)4N][(C5H5NH)0.8((CH3)3NH)0.2]U2Si9O23F4 (USH-8): An Organically Templated Open-Framework Uranium Silicate  

E-Print Network (OSTI)

-Framework Uranium Silicate Xiqu Wang, Jin Huang, and Allan J. Jacobson* Department of Chemistry, Uni pyramids we obtained also a number of open-framework uranium silicates.18,19 These new compounds were-framework uranium fluorosilicate [(CH3)4N][(C5H5NH)0.8((CH3)3NH)0.2]U2Si9O23F4 (USH- 8) that has been synthesized

Wang, Xiqu

252

Chemical Engineering NC State University  

E-Print Network (OSTI)

Ameristeel Christy Taylor Angelo Jonathan Rice Madeha Baqai Caldwell Natalie Scurry Austin Kizzie Jessica

Velev, Orlin D.

253

GTdemo (.mw) - CECM  

E-Print Network (OSTI)

Algorithm: Backtracking (Branch & Bound) MaximumIndependentSet(G); NygiIiMiIiQiIiYiIiciIigiIzc= MaximumClique(G); NyUiIiMiIikiIio= ChromaticNumber( G...

254

Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available

2011-10-01T23:59:59.000Z

255

Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:

256

Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.

2006-08-29T23:59:59.000Z

257

AEOSup ltr to Dear Customer  

Gasoline and Diesel Fuel Update (EIA)

WA WA OR CA ID NV UT AZ NM CO WY MT ND SD NE KS OK TX MN IA MO AR LA WI IL KY IN OH WV TN MS AL GA SC NC VA PA NY VT ME NH MA RI CT NJ DE MD D.C. FL MI Electricity Supply Regions 1 ECAR 2 ERCOT 3 MAAC 4 MAIN 5 MAPP 6 NY 7 NE 8 FL 9 STV 10 SPP 11 NWP 12 RA 13 CNV 13 11 12 2 10 5 9 8 1 6 7 3 AK 15 14 H I 14 AK 15 H I Figure 2. Electricity Market Module (EMM) Regions 1. ECAR = East Central Area Reliability Coordination Agreement 2. ERCOT = Electric Reliability Council of Texas 3. MACC = Mid-Atlantic Area Council 4. MAIN = Mid-America Interconnected Network 5. MAPP = Mid-Continent Area Power Pool 6. NY = Northeast Power Coordinating Council/ New York 7. NE = Northeast Power Coordinating Council/ New England 8. FL = Southeastern Electric Reliability Council/ Florida 9. STV = Southeastern Electric Reliability Council /excluding Florida 10. SPP

258

Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-

2009-01-01T23:59:59.000Z

259

Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan

2008-01-01T23:59:59.000Z

260

Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah

2011-04-21T23:59:59.000Z

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI

2012-06-01T23:59:59.000Z

262

Better Buildings Neighborhood Program: San Diego  

NLE Websites -- All DOE Office Websites (Extended Search)

Diego to Diego to someone by E-mail Share Better Buildings Neighborhood Program: San Diego on Facebook Tweet about Better Buildings Neighborhood Program: San Diego on Twitter Bookmark Better Buildings Neighborhood Program: San Diego on Google Bookmark Better Buildings Neighborhood Program: San Diego on Delicious Rank Better Buildings Neighborhood Program: San Diego on Digg Find More places to share Better Buildings Neighborhood Program: San Diego on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Diego County, California Energy Upgrade California Motivates Home Improvements in San Diego County

263

Better Buildings Neighborhood Program: Alabama - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Alabama - Alabama - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Alabama - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Alabama - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Google Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Delicious Rank Better Buildings Neighborhood Program: Alabama - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Alabama - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Alabama - SEP Alabama Program Takes a Dual Approach to Energy Efficiency Upgrades

264

Better Buildings Neighborhood Program: Virginia - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Virginia - Virginia - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Virginia - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Virginia - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Google Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Delicious Rank Better Buildings Neighborhood Program: Virginia - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Virginia - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Virginia - SEP Virginia's Regional Energy Alliances Help Forge a State Program for

265

Better Buildings Neighborhood Program: Austin, Texas  

NLE Websites -- All DOE Office Websites (Extended Search)

Austin, Texas Austin, Texas to someone by E-mail Share Better Buildings Neighborhood Program: Austin, Texas on Facebook Tweet about Better Buildings Neighborhood Program: Austin, Texas on Twitter Bookmark Better Buildings Neighborhood Program: Austin, Texas on Google Bookmark Better Buildings Neighborhood Program: Austin, Texas on Delicious Rank Better Buildings Neighborhood Program: Austin, Texas on Digg Find More places to share Better Buildings Neighborhood Program: Austin, Texas on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Austin, Texas Austin Energy Accelerates Residential and Multifamily Efficiency Upgrades

266

Better Buildings Neighborhood Program: Michigan - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Michigan - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Michigan - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Google Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Delicious Rank Better Buildings Neighborhood Program: Michigan - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Michigan - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Michigan - SEP Better Buildings Means Better Business for Michigan

267

Better Buildings Neighborhood Program: Toledo, Ohio  

NLE Websites -- All DOE Office Websites (Extended Search)

Toledo, Ohio Toledo, Ohio to someone by E-mail Share Better Buildings Neighborhood Program: Toledo, Ohio on Facebook Tweet about Better Buildings Neighborhood Program: Toledo, Ohio on Twitter Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Google Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Delicious Rank Better Buildings Neighborhood Program: Toledo, Ohio on Digg Find More places to share Better Buildings Neighborhood Program: Toledo, Ohio on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Toledo, Ohio A Broad Approach to Energy Efficiency in Northwest Ohio

268

Better Buildings Neighborhood Program: San Jose  

NLE Websites -- All DOE Office Websites (Extended Search)

San Jose to San Jose to someone by E-mail Share Better Buildings Neighborhood Program: San Jose on Facebook Tweet about Better Buildings Neighborhood Program: San Jose on Twitter Bookmark Better Buildings Neighborhood Program: San Jose on Google Bookmark Better Buildings Neighborhood Program: San Jose on Delicious Rank Better Buildings Neighborhood Program: San Jose on Digg Find More places to share Better Buildings Neighborhood Program: San Jose on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Jose, California San Jose Leverages Partnerships to Improve Low-Income Households' Energy

269

Wind Program: Stakeholder Engagement and Outreach  

Wind Powering America (EERE)

Outreach Outreach Printable Version Bookmark and Share The Stakeholder Engagement and Outreach initiative of the U.S. Department of Energy's Wind Program is designed to educate, engage, and enable critical stakeholders to make informed decisions about how wind energy contributes to the U.S. electricity supply. Highlights Resources Wind Resource Maps State Activities What activities are happening in my state? AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Installed wind capacity maps. Features A image of a house with a residential-scale small wind turbine. Small Wind for Homeowners, Farmers, and Businesses Stakeholder Engagement & Outreach Projects

270

Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012

271

Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central

272

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2007 (Million Cubic Feet) Nigeria Algeria 37,483 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports.

273

Better Buildings Neighborhood Program: Maine - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- SEP to - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Maine - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Maine - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Maine - SEP on Google Bookmark Better Buildings Neighborhood Program: Maine - SEP on Delicious Rank Better Buildings Neighborhood Program: Maine - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Maine - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Maine - SEP Maine Makes Multifamily Units Energy-Efficient and Cost-Effective

274

Better Buildings Neighborhood Program: Seattle, Washington  

NLE Websites -- All DOE Office Websites (Extended Search)

Seattle, Seattle, Washington to someone by E-mail Share Better Buildings Neighborhood Program: Seattle, Washington on Facebook Tweet about Better Buildings Neighborhood Program: Seattle, Washington on Twitter Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Google Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Delicious Rank Better Buildings Neighborhood Program: Seattle, Washington on Digg Find More places to share Better Buildings Neighborhood Program: Seattle, Washington on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA

275

U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

4 4 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT

276

U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

2 2 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT

277

A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.

2008-06-01T23:59:59.000Z

278

Figure 23. Average price of natural gas delivered to U.S. commercial...  

Annual Energy Outlook 2012 (EIA)

Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA FL NJ AL...

279

Microsoft Word - figure_22.doc  

Gasoline and Diesel Fuel Update (EIA)

Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA FL NJ AL...

280

Microsoft Word - figure_21.doc  

Annual Energy Outlook 2012 (EIA)

of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA...

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Bi[NC{sub 5}H{sub 3}(CO{sub 2}){sub 2}](OH{sub 2}){sub x}F (x=1 and 2): New one-dimensional Bi-coordination materials-Reversible hydration and topotactic decomposition to {alpha}-Bi{sub 2}O{sub 3}  

SciTech Connect

Two one-dimensional bismuth-coordination materials, Bi[NC{sub 5}H{sub 3}(CO{sub 2}){sub 2}](OH{sub 2}){sub x}F (x=1 and 2), have been synthesized by hydrothermal reactions using Bi{sub 2}O{sub 3}, 2,6-NC{sub 5}H{sub 3}(CO{sub 2}H){sub 2}, HF, and water at 180 Degree-Sign C. Structures of the two materials were determined by single-crystal X-ray diffraction. Although they have different crystal structures, both Bi-organic materials shared a common structural motif, a one-dimensional chain structure consisting of Bi{sup 3+} cations and pyridine dicarboxylate linkers. Detailed structural analyses include infrared spectroscopy, thermogravimetric analysis, and reversible hydration reactions for the coordinated water molecules were reported. Also, thermal decomposition of the rod-shaped Bi[NC{sub 5}H{sub 3}(CO{sub 2}){sub 2}](OH{sub 2})F single crystals at 800 Degree-Sign C led to {alpha}-Bi{sub 2}O{sub 3} that maintained the same morphology of the original crystals. - Graphical abstract: Calcination of the Bi[NC{sub 5}H{sub 3}(CO{sub 2}){sub 2}](OH{sub 2})F single crystals at 800 Degree-Sign C results in the {alpha}-Bi{sub 2}O{sub 3} rods that maintain the original morphology of the crystals. Highlights: Black-Right-Pointing-Pointer Synthesis of one-dimensional chain Bi-organic frameworks. Black-Right-Pointing-Pointer Reversible hydration reactions of Bi[NC{sub 5}H{sub 3}(CO{sub 2}){sub 2}](OH{sub 2})F. Black-Right-Pointing-Pointer Topotactic decomposition maintaining the same morphology of the original crystals.

Jeon, Hye Rim [Department of Chemistry Education, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Dong Woo [Department of Chemistry, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Ok, Kang Min, E-mail: kmok@cau.ac.kr [Department of Chemistry, Chung-Ang University, Seoul 156-756 (Korea, Republic of)

2012-03-15T23:59:59.000Z

282

Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan

2008-09-30T23:59:59.000Z

283

NONPROFIT ORG DETROIT, MI  

E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor

284

Distributed Generation and Renewable Energy in  

E-Print Network (OSTI)

-Logan Cherry Point, NC (Propane) P 1st Rochdale CG New York, NY First Energy, OH A P #12;Co-op Renewables;#12;Co-op Basics Customer owned Serve 35 million people in 47 states 75 percent of nation's area 2 (Propane) Chugach EA Anchorage, AK Flint Energies Reynolds, GA Delaware County EC Delhi, NY (Propane) TVA

285

San Juan Montana Thrust Belt WY Thrust Belt Black Warrior  

U.S. Energy Information Administration (EIA) Indexed Site

San San Juan Montana Thrust Belt WY Thrust Belt Black Warrior Paradox - San Juan NW (2) Uinta- Piceance Paradox - San Juan SE (2) Florida Peninsula Appalachian- NY (1) Appalachian OH-PA (2) Appalachian Eastern PA (3) Appalachian Southern OH (4) Appalachian Eastern WV (5) Appalachian WV-VA (6) Appalachian TN-KY (7) Piceance Greater Green River Eastern OR-WA Ventura Williston Williston NE (2) Williston NW (1) Williston South (3) Eastern Great Basin Ventura West, Central, East Eastern OR-WA Eastern Great Basin Appalachian Denver Florida Peninsula Black Warrior W Y T h ru st B e lt Powder River Paradox- Uinta- Grtr Green River MT Thrust Belt Powder River North (1) Powder River South (2) Denver North (1) Denver South (3) Denver Middle (2) TX CA MT AZ ID NV NM CO IL OR UT KS WY IA NE SD MN ND OK FL WI MO AL WA GA AR LA MI IN PA NY NC MS TN KY VA OH SC

286

Microsoft Word - FUSRAP Colonie NY.rtf  

Office of Legacy Management (LM)

Colonie Interim Storage Site Colonie Interim Storage Site (CISS) Colonie, New York FACT SHEET Jan 2004 DESCRIPTION: The site consists of a total area of 11.2 acres plus 56 vicinity properties. The site was owned and operated by National Lead Industries (NL) from 1937-1984. The facility was used for electroplating and manufacturing various components from uranium and thorium. Radioactive materials released from the plant exhaust stacks spread to site buildings, portions of the grounds, and 56 commercial and residential vicinity properties (VPs). NL also dumped contaminated casting sand into the former Patroon Lake. The New York State Supreme Court shut down the NL plant in 1984. AUTHORIZATION/PROJECT DESCRIPTION: Responsibility for the Colonie site was assigned to the U.S. Department of Energy (DOE) as a decontamination research and development project by the U.S.

287

Microsoft Word - NY.17-16.doc  

Office of Legacy Management (LM)

Printed with soy ink on recycled paper Printed with soy ink on recycled paper Department of Energy Washington, DC 20585 Ms. Judith Leithner Project Manager, Buffalo District U.S. Army Corps of Engineers Department of the Army 1776 Niagara Street Buffalo, New York 14207-3199 Dear Ms. Leithner: This is in reference to the Niagara Falls Storage Site (NFSS) Vicinity Properties E', E, and G located in Lewiston, New York. In accordance with the terms of the March 1999 Memorandum of Understanding (MOU) between the Department of Energy (DOE) and the U.S. Army Corps of Engineers (U.S. ACE), DOE is in the process of completing closure documentation for several sites remediated by DOE prior to assignment of the Formerly Utilized Sites Remedial Action Program (FUSRAP) to the U.S. ACE. Under contract to the U.S. ACE (U.S. ACE Contract

288

AER NY Kinetics LLC | Open Energy Information  

Open Energy Info (EERE)

Database. This company is involved in the following MHK Projects: Ogdensburg Kinetic Energy Project This article is a stub. You can help OpenEI by expanding it. Retrieved...

289

SIENA RESEARCH INSTITUTE SIENA COLLEGE, LOUDONVILLE, NY  

E-Print Network (OSTI)

fully reflected in the price they pay at the pump. Voters are overwhelmingly opposed to a pay raise of voters lay the blame at the feet of the President and the oil companies but it is clear they are looking-third of voters don't think they'd see any relief at the pump and another 43 percent think they'd only see about

290

Waddington, NY Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

2007 2008 2009 2010 2011 View History Pipeline Volumes 0 0 0 0 30,731 2007-2011 Pipeline Prices -- -- -- -- 4.71 2007...

291

Massena, NY Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba...

292

Offshore Wind in NY State (New York)  

Energy.gov (U.S. Department of Energy (DOE))

NYSERDA has expressed support for the development of offshore wind and committed funding to several publicly-available assessments that measure the potential energy benefits and environmental...

293

Livscykelbaserad miljvrdering av en ny kontorsbyggnad.  

E-Print Network (OSTI)

?? This Masters Thesis aims to illustrate in what ways the two Swedish environmental assessment tools, the Environmental Load Profile and EcoEffect differ and if (more)

Brick, Karolina

2005-01-01T23:59:59.000Z

294

Waddington, NY Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

422,315 395,758 349,980 267,227 231,831 241,506 1996-2012 Pipeline Prices 7.57 9.42 4.60 5.44 4.99 3.87...

295

Acceleration Of Wound Healing Ny Photodynamic Therapy  

DOE Patents (OSTI)

Disclosed is a method for accelerating wound healing in a mammal. The method includes identifying an unhealed wound site or partially-healed wound site in a mammal; administering a photosensitizer to the mammal; waiting for a time period wherein the photosensitizer reaches an effective tissue concentration at the wound site; and photoactivating the photosensitizer at the wound site. The dose of photodynamic therapy is selected to stimulate the production of one or more growth factor by cells at the wound site, without causing tissue destruction.

Hasan, Tayyaba (Arlington, MA); Hamblin, Michael R. (Revere, MA); Trauner, Kenneth (Sacramento, CA)

2000-08-22T23:59:59.000Z

296

Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use

297

Radiobiological Laboratory Beaufort, N.C.  

E-Print Network (OSTI)

concentrations were determined from specific radioactivity using calcium or the nucleotide solutions of known stirred gently with a magnetic stirrer for 30 min. Insoluble material was collected by centrifugation (20 of radioactive CaC12(600-1200 cpm/pmol). Fractions of 400 rl were collected at a flow rate of 8 ml/ h. Prior

298

regionalmaps  

Gasoline and Diesel Fuel Update (EIA)

Specific LNG Terminals Specific LNG Terminals Generic LNG Terminals Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Specific LNG Terminals Generic LNG Terminals Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana

299

regionalmaps  

Gasoline and Diesel Fuel Update (EIA)

LNG Imports LNG Imports Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming

300

Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada

2005-09-01T23:59:59.000Z

302

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

,833 ,833 35 Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2009 (Million Cubic Feet) Norway Trinidad/ Tobago Trinidad/ Tobago Egypt Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 111,144 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates

303

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

6 6 (Million Cubic Feet) Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 42,411 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2006 253,214 690,780 634,185 658,523 134,764 63,063 526,726 121,049 34,531 492,655 101,101 23,154 40,113 1,496,283 68,601

304

U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2013 Annual Energy Outlook 2013 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2013

305

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value

306

DOE/EIA-0131(96) Distribution Category/UC-960 Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

ID ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Interstate Movements of Natural Gas in the United States, 1996 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL KY (T) MA ME (T) AL LA MA NH (T) AL MO (T) MA NJ (T) AL SC MD DC CT RI RI MA DE MD VA DC MA CT (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 906,407 355,260 243,866 220 384,311 576,420 823,799 842,114 27,271 126,012 133 602,841 266 579,598 16,837 268,138 48,442 182,511 219,242 86,897 643,401 619,703 8,157 937,806 292,711 869,951 12,316 590,493 118,256

307

Microsoft Word - figure_14.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 14. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2010 (Million Cubic Feet) Norway India Trinidad/ Tobago Egypt Yemen Japan Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 53,122 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada Gulf of Mexico Canada Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates based on historical data. Energy Information

308

Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act 2 Metric Tons Heavy Metal (MTHM) 3 Based on actual data through 2002 , as provided in the RW-859, and projected discharges for 2003-2010 which are rounded to two significant digits. Reflects trans-shipments as of end-2002. End of Year 2010 SNF & HLW Inventories 1 Approximately 64,000 MTHM 2 of Spent Nuclear Fuel (SNF) 3 & 275 High-Level Radioactive Waste (HLW) Canisters CT 1,900 TX 2,000 MD 1,200 VT 610 RI MT WY NE 790 SD ND OK KS 600 TX 2,000 LA 1,200 AR 1,200 IA 480 MN 1,100 WI 1,300 KY TN 1,500 MS 780 AL 3,000 GA 2,400 FL 2,900 NC 3,400 VA 2,400 WV OH 1,100 PA 5,800 ME 540 NJ 2,400 DE MI 2,500 MA 650 NH 480 IN SC 3,900 CO MO 670 IL 8,400 NY 3,300 CA 2,800 AZ 1,900 NM OR 360 NV UT WA 600 ID < 1 Commercial HLW 275 Canisters (~640 MTHM)

309

Table 25  

Gasoline and Diesel Fuel Update (EIA)

89 89 Table 25 Created on: 1/3/2014 3:10:33 PM Table 25. Natural gas home customer-weighted heating degree days, New England Middle Atlantic East North Central West North Central South Atlantic Month/Year/Type of data CT, ME, MA, NH, RI, VT NJ, NY, PA IL, IN, MI, OH, WI IA, KS, MN, MO, ND, NE, SD DE, FL, GA, MD, DC, NC, SC, VA, WV November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0 November to November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0

310

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA  

Gasoline and Diesel Fuel Update (EIA)

0.00-1.99 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1996 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1996 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: In 1996, consumption of natural gas for agricultural use

311

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Australia Australia Trinidad Qatar Malaysia Canada Mexico Interstate Movements of Natural Gas in the United States, 1999 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL TX MA NH CT RI MD DC DE MD RI MA MA CT VA DC (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 837,902 415,636 225,138 232 308,214 805,614 803,034 800,345 685 147 628,589 9,786 790,088 17,369 278,302 40,727 214,076 275,629 51,935 843,280 826,638 9,988 998,603 553,440 896,187 11,817 629,551 98,423

312

Buildings Energy Data Book: 3.9 Educational Facilities  

Buildings Energy Data Book (EERE)

6 6 2010 Regional New Construction and Renovations Expenditures for Public K-12 Schools ($Million) Region New Schools Additions Renovation Total Region 1 (CT, MA, ME, NH, RI, VT) Region 2 (NJ, NY, PA) Region 3 (DE, MD, VA, WV) Region 4 (KY, NC, SC, TN) Region 5 (AL, FL, GA, MS) Region 6 (IN, MI, OH) Region 7 (IL, MN, WI) Region 8 (IA, KS, MO, NE) Region 9 (AR, LA, OK, TX) Region 10 (CO, MT, ND, NM, SD, UT, WY) Region 11 (AZ, CA, HI, NV) Region 12 (AK, ID, OR, WA) Total Source(s): School Planning & Management, 16th Annual School Construction Report, Feb. 2011 p. CR3 8,669.5 3,074.1 2,796.8 14,540.4 1,605.4 407.3 275.2 2,287.9 258.2 181.8 158.1 598.1 1,653.9 479.6 387.8 2,521.2 548.2 130.9 93.3 772.4 309.3 206.1 135.3 650.7 217.6 231.4 187.8 636.8 1,338.0 327.6 175.9 1,841.4 359.6 286.3 278.9 924.8

313

Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Mexico Trinidad Canada Canada Nigeria Oman Qatar Trinidad Gulf of Mexico Gulf of Mexico Gulf of Mexico Canada Trinidad Trinidad Gulf of Mexico Malaysia 13,623 Figure 8. Interstate Movements of Natural Gas in the United States, 2003 (Million Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Energy Information Administration / Natural Gas Annual 2003 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 366,224 655,731 666,614 633,960 144,284 43,869 536,776 63,133 36,848

314

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

6 6 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 27. Average City Gate Price of Natural Gas in the United States, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Energy Information Administration (EIA), Form EIA-857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Constant dollars: Prices were converted to 2001 dollars using the chain-type

315

Residential Demand Module  

Gasoline and Diesel Fuel Update (EIA)

and clothes drying. In addition to the major equipment-driven and clothes drying. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric Energy Information Administration/Assumptions to the Annual Energy Outlook 2006 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Figure 5. United States Census Divisions Source:Energy Information Administration,Office of Integrated Analysis and Forecasting. Report #:DOE/EIA-0554(2006) Release date: March 2006

316

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2008 (Million Cubic Feet) Norway Trinidad/ Tobago Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 45,772 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates.

317

Green Power Network: Can I Buy Green Power in My State?  

NLE Websites -- All DOE Office Websites (Extended Search)

Can I Buy Green Power in my State? Community Renewable Energy Development Consumer Protection Large Purchasers of Green Power Can I Buy Green Power in My State? Click on your state below to find out which organizations offer green power in your state. The results will include utility green pricing programs, retail green power products offered in competitive electricity markets, and renewable energy certificate (REC) products sold separate from electricity. For additional information about these distinct products, see our Overview of Green Power Markets. Map of the United States. AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Alabama Alaska Arizona Arkansas California Colorado Connecticut Connecticut Delaware Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Maryland Massachusetts Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Hampshire New Jersey New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Vermont Virginia Washington West Virginia Wisconsin Wyoming Washington, DC

318

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

Supply Supply 17 Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity

319

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 (Million Cubic Feet) 24,891 2,895 Nigeria WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico Algeria C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada N i g e r i a O m a n Qatar Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Malaysia 2,986 Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2005 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 335,380 634,982 664,318 612,297 125,202 33,223 531,868 103,624

320

Microsoft Word - Figure_14_15.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 360 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Figure 14. Average Price of Natural Gas Delivered to Residential Consumers, 1980-2004 Figure 15. Average City Gate Price of Natural Gas in the United States, 2004 (Dollars per Thousand Cubic Feet) Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." Constant dollars: Prices were converted to 2004 dollars using the chain-type price indexes for Gross Domestic Product

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FOA-0000028 FOA-0000028 Prime: Cascade Sierra Solutions EE DE-EE0002613 PMC/PVT 2011 John Jason Conley 07/2011 - 02/20/2014 Multiple sites, Multiple states Interstate Electrification Improvement (SUMMARY CX) Install truck stop electrification hardware at multiple (30) truck stops nationwide. Locations in UT, IA, NM, WY, AZ, MO, VA, MA, MI, TX, AL, WA, CA, NC, NY, MT, FL, KS. 08 17 2011 John Jason Conley Digitally signed by John Jason Conley DN: cn=John Jason Conley, o=DOE, ou=NETL, email=John.Conley@netl.doe.gov, c=US Date: 2011.08.17 13:25:08 -04'00' 10 18 2011 john ganz Digitally signed by john ganz DN: cn=john ganz, o=netl, ou=environmental compliance division, email=john.ganz@netl.doe.gov, c=US Date: 2011.10.18 13:52:43 -04'00' Sub: Shorepower Technologies. Funded by DE-FOA-0000028, "Recovery Act - Transportation

322

Microsoft Word - NY17-15 01-50.rtf  

Office of Legacy Management (LM)

OR/20722-84 OR/20722-84 Formerly Utilized Sites Remedial Action Program (FUSRAP) Contract No. DE-ACO5-810R20722 POST-REMEDIAL ACTION REPORT FOR THE NIAGARA FALLS STORAGE SITE VICINITY PROPERTIES - 1983 AND 1984 Lewiston, New York December 1986 Bechtel National, Inc. This report was prepared as an account of work sponsored by the United States Government. Neither the United States nor the United States Department of Energy, nor any of their employees, nor any of their contractors, subcontractors, or their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness or usefulness of any information, apparatus, product disclosed, or represents that its use would not infringe privately owned rights.

323

William H. Schlesinger Cary Institute of Ecosystem Studies, Millbrook, NY  

E-Print Network (OSTI)

used in drilling and fracking · Recent increase in permit fee to fund new DEP enforcement · Permit fluids ­ return fluids from fracking ­ mixture of water, sand and chemicals Production fluids ­ fluids, manganese, barium, arsenic, etc.) Surfactants/detergents Total suspended solids Oil/Grease Fracking

324

Methane Gas Utilization Project from Landfill at Ellery (NY)  

DOE Green Energy (OSTI)

Landfill Gas to Electric Energy Generation and Transmission at Chautauqua County Landfill, Town of Ellery, New York. The goal of this project was to create a practical method with which the energy, of the landfill gas produced by the decomposing waste at the Chautauqua County Landfill, could be utilized. This goal was accomplished with the construction of a landfill gas to electric energy plant (originally 6.4MW and now 9.6MW) and the construction of an inter-connection power-line, from the power-plant to the nearest (5.5 miles) power-grid point.

Pantelis K. Panteli

2012-01-10T23:59:59.000Z

325

Nancy Ide, Jean Vronis Vassar College (Poughkeepsie, NY)  

E-Print Network (OSTI)

for encoding a wide range of dictionaries, and is flexible enough to accomodate many esoteric dictionaries

Ide, Nancy

326

Mill Seat Landfill Bioreactor Renewable Green Power (NY)  

DOE Green Energy (OSTI)

for end use. A landfill gas to energy facility was also previously constructed at the site, which utilized generator engines, designed to be powered with landfill methane gas, to produce electricity, to be utilized on site and to be sold to the utility grid. The landfill gas generation rate at the site had exceeded the capacity of the existing generators, and the excess landfill gas was therefore being burned at a candlestick flare for destruction. The funded project consisted of the procurement and installation of two (2) additional 800 KW Caterpillar 3516 generator engines, generator sets, switchgear and ancillary equipment.

Barton & Loguidice, P.C.

2010-01-07T23:59:59.000Z

327

Grand Island, NY Natural Gas Imports by Pipeline from Canada  

Gasoline and Diesel Fuel Update (EIA)

GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba...

328

Champlain, NY Natural Gas Imports by Pipeline from Canada  

Gasoline and Diesel Fuel Update (EIA)

GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba...

329

Niagara Falls, NY Natural Gas Imports by Pipeline from Canada  

Annual Energy Outlook 2012 (EIA)

GA Lake Charles, LA LNG Imports from Indonesia Lake Charles, LA LNG Imports from Malaysia Gulf Gateway, LA Lake Charles, LA LNG Imports from Nigeria Cove Point, MD Elba...

330

DOE - Office of Legacy Management -- Colonie - NY 06  

Office of Legacy Management (LM)

Site Fairfield Site Falls City Site Fernald Preserve Gasbuggy Site General Atomics Geothermal Gnome-Coach Site Grand Junction Sites Granite City Site Green River Site Gunnison...

331

Mill Seat Landfill Bioreactor Renewable Green Power (NY)  

Science Conference Proceedings (OSTI)

The project was implemented at the Mill Seat landfill located in the Town of Bergen, Monroe County, New York. The landfill was previously equipped with a landfill gas collection system to collect methane gas produced by the bioreactor landfill and transport it to a central location for end use. A landfill gas to energy facility was also previously constructed at the site, which utilized generator engines, designed to be powered with landfill methane gas, to produce electricity, to be utilized on site and to be sold to the utility grid. The landfill gas generation rate at the site had exceeded the capacity of the existing generators, and the excess landfill gas was therefore being burned at a candlestick flare for destruction. The funded project consisted of the procurement and installation of two (2) additional 800 KW Caterpillar 3516 generator engines, generator sets, switchgear and ancillary equipment.

Barton & Loguidice, P.C.

2010-01-07T23:59:59.000Z

332

BRIEFINGS ON PHYSICAL SECURITY OF ELECTRICITY SUBSTATIONS NEW YORK, NY  

Energy.gov (U.S. Department of Energy (DOE))

The Department of Energy (DOE) and Department of Homeland Security (DHS), in coordination with the Federal Bureau of Investigation, the Federal Energy Regulatory Commission's Office of Energy Infrastructure Security, the Electricity Sector Information Sharing and Analysis Center (ES-ISAC), North American Electricity Reliability Corporation (NERC), and industry experts, will conduct a series of briefings across the country with electricity sector owners and operators, and local law enforcement on the physical security of electricity substations.

333

143 Caldwell Hall Ithaca, NY 14853-2602  

E-Print Network (OSTI)

a conference in Washington, D.C., may receive $225). Awards will not, under any circumstances, exceed $675 Manitoba 335 Ontario (Toronto, Ottawa) 335 Quebec (Montreal) 235 Central & South America 675 Washington, DC will need to be picked up at the cashier's window in 260 Day Hall. If a student does not attend

Keinan, Alon

334

143 Caldwell Hall Ithaca, NY 14853-2602  

E-Print Network (OSTI)

in Washington, D.C., may receive $225). Awards will not, under any circumstances, exceed $675. The Graduate Manitoba 335 Ontario (Toronto, Ottawa) 335 Quebec (Montreal) 235 Central & South America 675 Washington, DC up at the cashier's window in 260 Day Hall. If a student does not attend the conference, s/he should

Walter, M.Todd

335

The Wellness Center 365 Fifth Ave. New York, NY 10016  

E-Print Network (OSTI)

to student · Episodic Treatment for Acute Health Problems · Routine Physical Exams · Laboratory Services.817.1602 wellness@gc.cuny.edu www.tinyurl.com/gcwellness Table of Contents Student Health Services · Health Workshops and Special Events *A note on costs Laboratory fees as well as screening costs

Dennehy, John

336

RECIPIENT:Town of Brookhaven STATE: NY PROJECT  

NLE Websites -- All DOE Office Websites (Extended Search)

DOE legislation. Rational for determination: The Town of Brookhaven will be performing an energy audit and associated recommended retrofit work (possibly including some renewables...

337

Fortlpande miljanalys vid SLU Ny metod fr bedmning av aluminiumrisker  

E-Print Network (OSTI)

.cory@ma.slu.se www.ma.slu.se (1) Neil Cory et al. (2004). "Application of WHAM to nationale scale environmental

338

New York, NY Vehicle Purchase & Infrastructure Development Incentives...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Authority (NYSERDA) administers the New York City Private Fleet Alternative FuelElectric Vehicle Program (Program) in cooperation with New York City Department of...

339

Champlain, NY Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.29 3.40 3.53 3.68 2000's 3.86 4.03 4.17 4.34 4.53 4.81 5.04 5.23 5.63 5.21 2010's 6.02 6.11...

340

Niagara Falls, NY Natural Gas Pipeline Exports to Canada (Dollars ...  

U.S. Energy Information Administration (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: NA: NA: 2000's: NA: 2.49: 5.04: 6.77: 6.99----- 2010's--4.76: 4.08-

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Massena, NY Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 6.63 6.67 7.13 6.84 6.97 5.92 5.48 6.42 5.84 4.29 4.30 5.81 2012 6.07 5.83 5.26 5.21 5.09 5.16 5.01 5.21 5.29 6.03 6.64...

342

Champlain, NY Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 16,104 16,669 15,258 17,171 2000's 17,436 17,329 16,904 12,579 16,502 17,142 17,721 17,666...

343

Massena, NY Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 13,642 12,927 9,184 7,258 2000's 7,309 6,931 7,662 6,817 7,357 6,989 6,588 6,887 6,588 5,730...

344

Waddington, NY Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 35,222 28,023 21,841 13,715 12,079 14,620 21,184 14,405 12,504 15,162 18,131 24,944 2012 30,005 25,448 20,375 12,699...

345

Champlain, NY Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,825 1,988 1,676 394 292 100 462 224 178 189 214 751 2012 1,070 862 537 288 186 347 644 403 427 469 640 892 2013 1,174...

346

Waddington, NY Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 5.32 5.46 5.14 5.14 5.20 5.22 5.22 5.00 4.71 4.55 4.32 4.20 2012 4.31 3.57 3.26 2.86 2.76 3.03 3.43 3.52 3.46 3.77 5.25...

347

Waddington, NY Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 288,807 295,568 293,234 324,400 2000's 337,989 290,981 285,188 296,989 331,234 349,230 406,033...

348

Massena, NY Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 873 767 704 412 240 192 197 188 135 37 53 167 2012 573 505 424 324 197 201 211 179 174 224 418 562 2013 588 581 537 346 91...

349

Grand Island, NY Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 42,832 42,302 44,981 33,140 2000's 49,012 95,639 110,417 76,421 66,612 92,474 80,907 88,886...

350

Waddington, NY Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 2000's 0 0 0 2010's 0 30,731 38,791...

351

Champlain, NY Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 7.34 6.56 5.91 5.40 5.47 5.45 5.64 5.26 4.94 4.57 4.49 4.78 2012 5.18 4.34 3.70 2.84 3.04 3.46 4.07 3.84 3.85 4.32 6.07...

352

Massena, NY Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.92 3.04 2.78 2.81 2000's 4.25 4.96 4.08 6.08 7.06 9.34 8.95 7.78 9.69 6.85 2010's 6.48 6.55...

353

Waddington, NY Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 580 1,310 2,522 3,252 3,026 2,668 2,170 2,445 2,379 2,066 5,121 3,191 2012 898 4,000 6,745 4,975 2,721 1,978 1,202 2,306...

354

Waddington, NY Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.92 2.82 2.38 2.54 2000's 4.24 4.81 3.60 5.81 6.51 9.38 7.62 7.57 9.42 4.60 2010's 5.44 4.99...

355

Niagara Falls, NY Natural Gas Pipeline Exports to Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 734: 660: 860: 860: 194: 307: 295: 1,107: 376: 151: 415: 576: 2012: 583: 468: 175: 58: 8,823: 13,281: 2013 ...

356

www.eia.gov  

U.S. Energy Information Administration (EIA)

MO MT NE NV NH NJ NM NY NC ND OH OK OR PA RI SC SD TN TX UT VT VA WA WV WI WY U.S. Number of states in which marketer is licensed ... Service Tech & Research Corp

357

Gas Prices  

NLE Websites -- All DOE Office Websites (Extended Search)

Prices Gasoline Prices for U.S. Cities Click on the map to view gas prices for cities in your state. AK VT ME NH NH MA MA RI CT CT DC NJ DE DE NY WV VA NC SC FL GA AL MS TN KY IN...

358

Microsoft Word - BSA NC Items Rev11.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

NCItems, Rev. 11; (Jun-12) 1 of 21 NCItems, Rev. 11; (Jun-12) 1 of 21 BROOKHAVEN SCIENCE ASSOCIATES, LLC GENERAL TERMS AND CONDITIONS FOR NONCOMMERCIAL ITEMS AT BROOKHAVEN NATIONAL LABORATORY Table of Contents Article 1 DEFINITIONS ................................................................................................................... 3 Article 2 ORDER OF PRECEDENCE ............................................................................................. 3 Article 3 ACCEPTANCE OF AGREEMENT, SURVIVABILITY ................................................. 4

359

Microsoft Word - BSA NC Items Rev10.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

10; (Aug. 2011) 1 of 17 10; (Aug. 2011) 1 of 17 BROOKHAVEN SCIENCE ASSOCIATES, LLC GENERAL TERMS AND CONDITIONS FOR NON-COMMERCIAL ITEMS AT BROOKHAVEN NATIONAL LABORATORY Definitions 2 Article 1 Order of Precedence 2 Article 2 Acceptance of Agreement 2 Article 3 Complete Agreement 3 Article 4 Assignment 3 Article 5 Compliance with Laws and Regulations 3 Article 6 Compliance with Internet Protocol Version 6 (IPv6) In Acquiring Information Article 7 Technology. 3 Independent Contractor; Hold Harmless 4 Article 8 Notice Regarding Late Delivery 4 Article 9 Inspection and Acceptance 4 Article 10 No Waiver 5 Article 11 New Materials 5 Article 12 Suspect/Counterfeit Items 5 Article 13 Hazardous Material Identification and Material Safety Data 6 Article 14 Title and Risk of Loss 6 Article 15

360

Microsoft Word - BSA NC Service Rev 9.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

9; (Aug. 2011) 1 of 21 9; (Aug. 2011) 1 of 21 BROOKHAVEN SCIENCE ASSOCIATES, LLC GENERAL TERMS AND CONDITIONS FOR NON-COMMERCIAL SERVICES AT BROOKHAVEN NATIONAL LABORATORY Section 1 - General Clauses Applicable to Fixed Price and Cost Type Contracts. ....................................................... 2 Article 1.1 Definitions ............................................................................................................................................ 2 Article 1.2 Order of Precedence ............................................................................................................................. 2 Article 1.3 Acceptance of Agreement .................................................................................................................... 2

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Microsoft Word - BSA NC Service Rev. 7 clean100410.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

7; (Oct. 2010) 1 of 20 7; (Oct. 2010) 1 of 20 BROOKHAVEN SCIENCE ASSOCIATES, LLC GENERAL TERMS AND CONDITIONS FOR NON-COMMERCIAL SERVICES AT BROOKHAVEN NATIONAL LABORATORY Section 1 - General Clauses Applicable to Fixed Price and Cost Type Agreements.....................................................2 Article 1.1 Definitions.........................................................................................................................................2 Article 1.2 Order of Precedence..........................................................................................................................2 Article 1.3 Acceptance of Agreement .................................................................................................................2 Article 1.4 Complete Agreement

362

Microsoft Word - BSA NC Items Rev. 8 clean100410.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

10 Article 25 Bankruptcy 10 Article 26 Walsh-Healy Public Contracts Act 10 Article 27 Patent Indemnity - Subcontracts 11 Article 28 Indemnity for Defective Cost or Pricing Data 11...

363

Avista Utilities - LEED (NC or EB) Certification Energy Efficiency...  

Open Energy Info (EERE)

a minimum of 4 points for optimized energy performance and comply with all LEED whole building modeling requirements are eligible for a 1.25 per conditioned square foot rebate...

364

NC GreenPower Production Incentive (North Carolina) | Open Energy...  

Open Energy Info (EERE)

Commercial, Industrial, Institutional, Local Government, Nonprofit, Residential, Schools, State Government Eligible Technologies Anaerobic Digestion, Biomass, Hydroelectric,...

365

LEAVING NC STATE Find out what you can  

E-Print Network (OSTI)

in school. AWARD WINNING PERFORMANCE 8 High Performance Computing is the wave of the future. Date: February

366

Ergebnisse rtlicher NC-Verfahren Wintersemester 2007 / 2008  

E-Print Network (OSTI)

: Notendurchschnitt) Biochemie (Chemie d. Lebensw.)/ Bachelor 1,8 (0) 2 (2,2) Bioinformatik & Genomforschung-Kernfach 1,8 (2) 4 (2,6) Biologie / Bachelor-Nebenfach 1,8 (2) 4 (2,4) Deutsch als Fremdsprache / Bachelor- Kernfach 2,7 (0) 2 (3,6) Deutsch als Fremdsprache / Bachelor- Nebenfach 3,1 (2) 0 (3

Moeller, Ralf

367

MicroBlower Soil Vapor Extraction License Agreement LLC, NC,  

alternative designed to run on renewable sources of energy such as solar and wind ... A growing trend in environmental remediation is the use of ...

368

U.S. Natural Gas Pipeline Exports by Point of Exit  

U.S. Energy Information Administration (EIA) Indexed Site

25,575 142,032 133,749 128,589 130,297 122,391 1997-2013 25,575 142,032 133,749 128,589 130,297 122,391 1997-2013 To Canada 70,735 81,695 75,846 66,473 68,325 69,733 1973-2013 Eastport, ID 6 2011-2013 Calais, ME 2,021 1,528 433 652 122 185 2011-2013 Detroit, MI 3,571 4,430 3,769 3,933 4,131 3,885 2011-2013 Marysville, MI 2,983 1,470 995 1,856 1,521 1,400 2011-2013 Sault Ste. Marie, MI 1,531 1,171 935 1,231 849 911 2011-2013 St. Clair, MI 43,917 56,075 54,114 42,609 45,524 47,795 2011-2013 Noyes, MN 76 171 316 1,331 447 445 2011-2013 Babb, MT 2011-2011 Havre, MT 184 188 174 177 183 166 2011-2013 Pittsburg, NH 2011-2013 Grand Island, NY 47 20 10 10 11 2011-2013 Massena, NY 2012-2012 Niagara Falls, NY 13,738 13,789 13,174 13,904 13,939 13,022 2011-2013 Waddington, NY

369

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA  

Gasoline and Diesel Fuel Update (EIA)

176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY...

370

Google Maps -highland hospital rochester new york http://maps.google.com/ 1 of 2 9/29/05 13:21  

E-Print Network (OSTI)

Google Maps - highland hospital rochester new york http://maps.google.com/ 1 of 2 9/29/05 13 Hospital: Gift Shop 1000 South Ave, Rochester, NY 14620 (585) 341-8040 - 1.4 mi S Google Maps highland hospital rochester new york #12;Google Maps - highland hospital rochester new york http://maps.google

Richmond, Michael W.

371

Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997

372

MI ROPYROLIZER FOR RAPID IOIDENTIFI ATION  

POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...

373

MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2

374

Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...

375

Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...

376

Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...

377

Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...

378

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

6 6 Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:

379

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:

380

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

0 0 Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 2000 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1996-2000 Figure T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a O t h e r S t a t e s 0 1 2 3 4 5 6 7 0 30 60 90 120 150 180 Trillion Cubic Feet Billion Cubic Meters 1996 1997 1998 1999 2000 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Microsoft Word - Figure_3_4.doc  

Gasoline and Diesel Fuel Update (EIA)

7 7 None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s A l a b a m a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2002 2003 2002 Figure 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2002-2003 Figure 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2003 (Million Cubic Feet) GOM = Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly and Annual Quantity and Value of Natural Gas Report," and the United States Mineral Management

382

Record of Decision for the Department of Energy's Waste Management Program: Storage of High-Level Radioactive Waste (08/26/99)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

661 661 Federal Register / Vol. 64, No. 165 / Thursday, August 26, 1999 / Notices Installation State Function(s) Total au- thorizations Public an- nounce- ment date Solicitation issued or scheduled date SELFRIDGE ......................... MI FUELS MANAGEMENT ..................................................... 8 01-Jun-98 27-Apr-99. SELFRIDGE ......................... MI TRANSIENT AIRCRAFT MAINTENANCE ......................... 8 04-Jun-98 28-Apr-99. SEYMOUR JOHNSON ......... NC TRANSIENT AIRCRAFT MAINTENANCE ......................... 8 12-Nov-97 02-Jul-99. SHAW ................................... SC COMMUNICATION FUNCTIONS ....................................... 3 18-May-99 09-May-00. SHAW ................................... SC LIBRARY .............................................................................

383

U.S. Department of Energy Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

898) Silicon Power Corporation - 898) Silicon Power Corporation - Optically-Switched 15kV SiC Single-Bias High-Frequency Thyristor Program or Field Office: Advanced Research Projects Agency- Energy (ARPA-E) Location(s) (City/County/State): Clifton Park, NY; Malvern, PA; Durham, NC; Chicago, IL Proposed Action Description: Funding will support efforts to develop and test an optical-based, globally compliant switching device that can be used for photovoltaic grid power- electronics systems and other high-power, high-voltage applications. Project tasks will be conducted on a small-scale, pilot basis in dedicated industrial and university laboratory, testing, and fabrication facilities at Silicon Power Corporation (Clifton Park, NY; Malvern, PA), Cree Inc. (Durham, NC), and University of Illinois-

384

EIA - Natural Gas Pipeline Network - Largest Natural Gas Pipeline Systems  

U.S. Energy Information Administration (EIA) Indexed Site

Interstate Pipelines Table Interstate Pipelines Table About U.S. Natural Gas Pipelines - Transporting Natural Gas based on data through 2007/2008 with selected updates Thirty Largest U.S. Interstate Natural Gas Pipeline Systems, 2008 (Ranked by system capacity) Pipeline Name Market Regions Served Primary Supply Regions States in Which Pipeline Operates Transported in 2007 (million dekatherm)1 System Capacity (MMcf/d) 2 System Mileage Columbia Gas Transmission Co. Northeast Southwest, Appalachia DE, PA, MD, KY, NC, NJ, NY, OH, VA, WV 1,849 9,350 10,365 Transcontinental Gas Pipeline Co. Northeast, Southeast Southwest AL, GA, LA, MD, MS, NC, NY, SC, TX, VA, GM 2,670 8,466 10,450 Northern Natural Gas Co. Central, Midwest Southwest IA, IL, KS, NE, NM, OK, SD, TX, WI, GM 1,055 7,442 15,874 Texas Eastern Transmission Corp.

385

U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2012 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT...

386

Funding for state, city, and county governments in the state includes:  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NY NY New York Total Sum City, County, and SEO Allocations All $175,122,300 NY New York State Energy Office $29,760,600 NY Albany City $1,104,000 NY Amherst City $1,052,700 NY Babylon City $1,545,200 NY Binghamton City $204,200 NY Brookhaven City $4,141,200 NY Buffalo City $2,736,900 NY Cheektowaga City $718,800 NY Clarkstown City $751,300 NY Clay City $515,100 NY Clifton Park City $149,200 NY Colonie City $661,900 NY Freeport City $173,100 NY Greece City $831,900 NY Greenburgh City $186,000 NY Hamburg City $187,300 NY Hempstead City $4,577,700 NY Hempstead City $479,800 NY Henrietta City $213,700 NY Huntington City $1,725,200 NY Irondequoit City $440,000 NY Islip City $3,026,100 NY

387

NETL: NEPA Categorical Exclusions - January 2012 to March 2012  

NLE Websites -- All DOE Office Websites (Extended Search)

2 to March 2012 2 to March 2012 Archive (November 2009 - December 2011) ARRA Date Title Recipient Name Location DOE/NETL Sponsors N 3/29/2012 High Efficiency Colloidal Quantum Dot Phosphors (New Location) University of Buffalo Amherst, NY EE/PMC/BETD Y 3/29/2012 Recovery Act - Clean Energy Coalition Michigan Green Fleets (Summary CX) Prime: Clean Energy Coalition Sub: Multiple Ann Arbor, MI EE/PMC/PVT Y 3/29/2012 New York State Alternative Fuel Vehicle & Infrastructure Deployment Prime: NYSERDA Sub: Village of Minoa Minoa, NY EE/PMC/PVT Y 3/29/2012 New York State Alternative Fuel Vehicle & Infrastructure Deployment Prime: NYSERDA Sub: Roosevelt Island Roosevelt Island, NY EE/PMC/PVT Y 3/29/2012 JDC Phosphate Prime: State of Florida

388

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

5 5 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 138,239,378 5.94 Pub Svc Elec and Gas Co........................ NJ 69,738,220 5.26 Southern California Gas Co ..................... CA 63,758,073 7.26 Pacific Gas and Elec Co........................... CA 58,646,965 7.84 Keyspan Energy Del Co ........................... NY 53,501,565 7.32 Consumers Energy Co ............................. MI 51,663,333 4.26 TXU Gas Distribution................................ TX 48,112,344 5.86 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 45,021,338 7.87 Con Edison Co of New York Inc............... NY 44,076,359 8.02 Michigan Consol Gas Co.......................... MI 40,342,797 5.39 Pub Svc Co of Colorado........................... CO 39,697,152 5.22 East Ohio Gas Co ....................................

389

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

3 3 Con Edison Co of New York Inc............... NY 102,311,001 3.84 Pub Svc Elec and Gas Co........................ NJ 73,839,186 3.05 Southern California Gas Co ..................... CA 62,380,076 5.55 Pacific Gas and Elec Co........................... CA 58,692,831 6.82 Keyspan Energy Del Co ........................... NY 53,162,984 6.07 Minnegasco .............................................. MN 52,910,769 4.25 Entex Div of Noram Energy Corp ............. TX,LA,MS 47,337,378 4.81 Lone Star Gas Co..................................... TX 45,843,050 4.67 Consumers Energy Co ............................. MI 45,391,308 4.50 Michigan Consol Gas Co.......................... MI 41,336,416 5.38 Pub Svc Co of Colorado........................... CO 39,230,403 4.47 Columbia Gas Dist Co.............................. KY,PA,MD,OH 35,550,535 6.78

390

Los linajes de transmision de Nyag bla Padma bdud'dul  

E-Print Network (OSTI)

tradicin a los que hetenido acceso. Entre los lamas ms reconocidos de la transmisin de Padma bdud dul(tanto en el papel de maestros como de discpulos) hay que destacar mDomkhyen brtse Ye shes rdo rje, Mi gyur nam mkhai rdo rje, rDza dPal sprulRin po... importantes, tanto por la singularidad de estos personajes posesores de un gran carisma en la orden rNying ma pa como por lasenseanzas y consejos que dieron al joven yogui. Mi gyur nam mkha rdo rje (1793-?), cuarta encarnacin de rDzogs chenPadma rig...

Aguillar, Oriol

2005-01-01T23:59:59.000Z

391

File:EIA-Appalach1-NY-LIQ.pdf | Open Energy Information  

Open Energy Info (EERE)

LIQ.pdf LIQ.pdf Jump to: navigation, search File File history File usage Appalachian Basin, New York Area Oil and Gas Fields By 2001 Liquids Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 12.86 MB, MIME type: application/pdf) Description Appalachian Basin, New York Area Oil and Gas Fields By 2001 Liquids Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States New York File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment

392

Sylvania Corning Plant/Former Sylvania Electric Products Facility Hicksville, NY  

E-Print Network (OSTI)

characterization is required for identification. Size and Weight Reduction Through the Use of Depleted Uranium of depleted uranium as a result of enrichment processes. The cost of disposing of this mate- rial has been estimated from $240million to 1.5 billion. Finding a practi- cal use for the depleted uranium would save

US Army Corps of Engineers

393

THERMAL PROPERTIES AND PROCESSES D Hillel, Columbia University, New York, NY, USA  

E-Print Network (OSTI)

be the infiltration of warm waste water (from, e.g., a power plant) into an initially cold soil. Conduction, the third influences biological processes such as seed germination, seedling emergence and growth, root development- lengths, is proportional to the fourth power of the absolute temperature Tof the body's surface. This law

394

Thermal sludge dryer demonstration: Bird Island Wastewater Treatment Plant, Buffalo, NY. Final report  

DOE Green Energy (OSTI)

The Buffalo Sewer Authority (BSA), in cooperation with the New York State Energy Research and Development Authority (Energy Authority), commissioned a demonstration of a full scale indirect disk-type sludge dryer at the Bird Island Wastewater Treatment Plant (BIWWTP). The purpose of the project was to determine the effects of the sludge dryer on the sludge incineration process at the facility. Sludge incineration is traditionally the most expensive, energy-intensive unit process involving solids handling at wastewater treatment plants; costs for incineration at the BIWWTP have averaged $2.4 million per year. In the conventional method of processing solids, a series of volume reduction measures, which usually includes thickening, digestion, and mechanical dewatering, is employed prior to incineration. Usually, a high level of moisture is still present within sewage sludge following mechanical dewatering. The sludge dryer system thermally dewaters wastewater sludge to approximately 26%, (and as high as 38%) dry solids content prior to incineration. The thermal dewatering system at the BIWWTP has demonstrated that it meets its design requirements. It has the potential to provide significant energy and other cost savings by allowing the BSA to change from an operation employing two incinerators to a single incinerator mode. While the long-term reliability of the thermal dewatering system has yet to be established, this project has demonstrated that installation of such a system in an existing treatment plant can provide the owner with significant operating cost savings.

NONE

1995-01-01T23:59:59.000Z

395

Wastetoenergy an important topic to explore Albany Times Union Albany NY  

E-Print Network (OSTI)

waste daily, have minimal emissions equal to those of a few cars. Europe provides heat and electricity

Columbia University

396

MARCEL DEKKER, INC. 270 MADISON AVENUE NEW YORK, NY 10016 MULTIVARIATE CALIBRATION FOR  

E-Print Network (OSTI)

, Universidade Estadual de Campinas, C.P. 6154, CEP 13083-970, SP, Brazil 3 Suzano Papel e Celulose Research and better process monitoring is recommended. ACKNOWLEDGMENTS Support from Suzano Papel e Celulose

Ferreira, Márcia M. C.

397

Scott M. Kaufman US Project Manager The Carbon Trust Brooklyn, NY January 2009 -present  

E-Print Network (OSTI)

using SimaPro software; waste data collection and analysis; waste treatment technologies; political and direction for research. Crafted strategy for data collection and analysis from waste management partners aspects of fieldwork, including operation of front-end loader for composting, truck loading, and potting

398

Microsoft Word - PowerBridgeNY Sample Pre-Proposal Questions  

We also recommend that you read the evaluation criteria that the judges will be using as guidance for how you answer ... and supports innovations in the clean energy ...

399

ADVANCES IN HIGH-POWER TARGETS* H. KIRK, BNL, UPTON, NY 11973, U.S.A.  

E-Print Network (OSTI)

of material properties to be modified as a result of exposure to radiation is an important consideration, the application which most interests the international physics community is the prospects for the production: · Thermal management o Target melting o Target vaporization o Heat removal · Radiation o Radiation

McDonald, Kirk

400

File:EIA-Appalach1-NY-GAS.pdf | Open Energy Information  

Open Energy Info (EERE)

GAS.pdf GAS.pdf Jump to: navigation, search File File history File usage Appalachian Basin, New York Area Oil and Gas Fields By 2001 Gas Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 12.75 MB, MIME type: application/pdf) Description Appalachian Basin, New York Area Oil and Gas Fields By 2001 Gas Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States New York File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Microsoft Word - DOE-ID-12-007 NC State EC.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

7 7 SECTION A. Project Title: A High Resolution Digital System in Support of Neutron Imaging at the PULSTAR Reactor - North Carolina State University SECTION B. Project Description The objective of this project is to establish t he capability of high resolution digital neutron imaging at the North Carolina State University (NCSU) PULSTAR reactor. It will be integrated into the existing neutron imaging facility at PULSTAR, and it will be supported by the user facility structure of the Nuclear Reactor Program at NCSU. SECTION C. Environmental Aspects / Potential Sources of Impact The action consists of funding the purchase of equipment and instruments for an existing program. The action would not create additional environmental impacts above those already occurring at the university.

402

2012 SG Peer Review - Day 2 Panel Discussion: Rogelio Sullivan, NC State University  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FREEDM Systems Center FREEDM Systems Center Future Renewable Electric Energy Delivery and Management Rogelio Sullivan Managing Director 2 * To develop an efficient and interactive power grid: * Utilizing revolutionary power electronics technology and information technology * Integrating distributed and scalable renewable energy sources and energy storage with existing power systems * Automate the management of load, generation and storage To create the "Energy Internet" Vision A Global Partnership Industry Membership Pre-College Middle & High Schools US Universities An Engine for Change Driven By: * Focused Research * Industry Participation * Comprehensive Education Programs * Innovation and Technology Commercialization International Comprehensive University Education

403

Microsoft Word - BSA NC Items Rev9 draft clean _3_.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

9; (Apr. 2011) 1 of 16 9; (Apr. 2011) 1 of 16 BROOKHAVEN SCIENCE ASSOCIATES, LLC GENERAL TERMS AND CONDITIONS FOR NON-COMMERCIAL ITEMS AT BROOKHAVEN NATIONAL LABORATORY Article 1 Definitions 2 Article 2 Order of Precedence 2 Article 3 Acceptance of Agreement 2 Article 4 Complete Agreement 3 Article 5 Assignment 3 Article 6 Compliance with Laws and Regulations 3 Article 7 Independent Contractor; Hold Harmless 3 Article 8 Notice Regarding Late Delivery 4 Article 9 Inspection and Acceptance 4 Article 10 No Waiver 5 Article 11 New Materials 5 Article 12 Suspect/Counterfeit Items 5 Article 13 Hazardous Material Identification and Material Safety Data 6 Article 14 Title and Risk of Loss 6 Article 15 Warranty 6 Article 16 Payment 7 Article 17 Taxes 7 Article 18 Extras 7

404

Microsoft Word - BSA NC Service Rev 8draft clean.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

8; (Apr. 2011) 1 of 21 8; (Apr. 2011) 1 of 21 BROOKHAVEN SCIENCE ASSOCIATES, LLC GENERAL TERMS AND CONDITIONS FOR NON-COMMERCIAL SERVICES AT BROOKHAVEN NATIONAL LABORATORY Section 1 - General Clauses Applicable to Fixed Price and Cost Type Agreements. .................................................... 2 Article 1.1 Definitions......................................................................................................................................... 2 Article 1.2 Order of Precedence .......................................................................................................................... 2 Article 1.3 Acceptance of Agreement ................................................................................................................. 2

405

OiNC: A Comprehensive CAD Import and Tracking System for Monte Carlo Radiation Transport Calculations  

Science Conference Proceedings (OSTI)

Technical Paper / Special Issue on the 16th Biennial Topical Meeting of the Radiation Protection and Shielding Division / Radiation Transport and Protection

Keith Searson; Fabrice Fleurot; Andrew Cooper; Pat Cowan

406

Inspection of aluminum components from freeze desalting facility at Wrightsville Beach, NC  

DOE Green Energy (OSTI)

An inspection was made of a freeze-type desalting pilot plant that has operated for approximately four years. The purpose of this inspection was to document the seawater service experience of the various aluminum alloys present in the plant. The components inspected include two tube-type heat exchangers, one plate-type heat exchanger, and the freezing compartment. Photographs are used to illustrate the corrosion behavior of these components.

Melton, D.G.; Lee, T.S.

1980-02-01T23:59:59.000Z

407

Implementing a mathematical model for locating EMS vehicles in Fayetteville, NC  

Science Conference Proceedings (OSTI)

Emergency medical services (EMS) aims to reduce the elapsed time to respond to an emergency. The number and location of vehicles within the service area, directly affect the attainment of this goal. In this paper, we focus on a mathematical modeling ... Keywords: bicriterion, covered demand, expected coverage, set covering

Asad Tavakoli; Constance Lightner

2004-08-01T23:59:59.000Z

408

1. ,,,, @1990"N,C60, C70,,,,,,,<...Sk'Y`fZqt[OE",--"I,  

E-Print Network (OSTI)

,?·,·,?,·,é,?·CT = 3200 K,?OE?^õS?,?^?"®,?,æ,Á,?^?·«`?·\\`¢,?,?·Ï»,ªSÏZ@,³,ê,½·DFig. 2,?T = 3200 K,?OEvZZOE·\\`¢,ª,æ,-·ª,©,é,æ,¤,?·ªZq,?DFig. 2(a) ,?,Í·C,·,?,?,?OE?^õ

Maruyama, Shigeo

409

An intelligent NC program processor for CNC system of machine tool  

E-Print Network (OSTI)

8] John K.Ousterhout, Tcl and the Tk Toolkit, Addisonis further implemented in TCL, an embedded script languageMachining Function, EBNF, TCL 1 INTRODUCTION In the CNC

Liu, Y; Guo, X; Li, W; Yamazaki, K; Kashihara, K; Fujishima, M

2007-01-01T23:59:59.000Z

410

NAME: Little Oyster Creek Sanctuary LOCATION: Lower Neuse River in Pamlico Sound, Pamlico County, NC  

E-Print Network (OSTI)

is itself unstable, and evolves at long times into an essentially isotropic mound morphology which, pyramid or mound- like features. Their lateral size ~ is found to increase according to a power law. A second characteristic is the slope of the mounds' hillsides s, which - varying for different materials

US Army Corps of Engineers

411

Microsoft Word - DOE-ID-13-034 NC State B1-31.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

4 SECTION A. Project Title: A Positron Microprobe Spectrometer for Defects and Nano-Vacancy Characterization in Materials - North Carolina State University SECTION B. Project...

412

E2E Voting Systems-A State Perspective-NC  

Science Conference Proceedings (OSTI)

... Page 14. as they are reported to the state. The improvement in speed of reporting has proven very poplar with the media and the general public. ...

2012-05-02T23:59:59.000Z

413

Quiet unlined HVAC ductwork: Using active silencing to obtain NC?35 in buildings without fibrous materials  

Science Conference Proceedings (OSTI)

Fan noise in HVAC ducts has traditionally been attenuated with fibrous internal duct liner or with passive silencers constructed with porous fill material. Now

Steve Wise; Lawrence J. Gelin; Kirk G. Burlage; Susan H. Dineen

1995-01-01T23:59:59.000Z

414

NAME City State Zip Aaron, Jeremy Tyler Winston Salem NC 27104  

E-Print Network (OSTI)

, Petersham, Massachusetts 01366 (L.S., C.M.S.); and The Arnold Arboretum of Harvard University, Jamaica Plain AND METHODS Plant Material From June 2002 to August 2002 at Harvard Forest in Petersham, Massachusetts (429548

Almor, Amit

415

New large-Nc relations among the nucleon and nucleon-to-Delta GPDs  

SciTech Connect

We establish relations which express the generalized parton distributions (GPDs) describing the N {yields} {Delta} transition in terms of the nucleon GPDs. These relations are based on the known large-N{sub c} relation between the N {yields} {Delta} electric quadrupole moment and the neutron charge radius, and a newly derived large-N{sub c} relation between the electric quadrupole (E2) and Coulomb quadrupole (C2) transitions. Namely, in the large-N{sub c} limit we find C2=E2. The resulting relations among the nucleon and N {yields} {Delta} GPDs provide predictions for the N {yields} {Delta} electromagnetic form factors which are found to be in very good agreement with experiment for moderate momentum transfers.

Marc Vanderhaeghen; Vladimir Pascalutsa

2006-11-15T23:59:59.000Z

416

I Nc~vPPt~rleNuinber I 661-615-4630  

E-Print Network (OSTI)

these circurnstanccs, pursuant to Seeti011 1769 (a1 (21, CEC Staff havc the nutharity to approve the proposed chfinge~nditionsuf certification,pursuar-ttto 5rrlion 1769 (a) (2), CEC Staff havc the authority to approve thc proposed rhatlge

417

Baryons and baryonic matter in the large Nc and heavy quark limits  

E-Print Network (OSTI)

This paper explores properties of baryons and finite density baryonic matter in an artificial world in which N[subscript c], the number of colors, is large and the quarks of all species are degenerate and much larger than ...

Cohen, Thomas D.

418

MANUFACTURER OF THE FIRST 100% ROOM TEMPERATURE nc-Si SOLAR PV ...  

Nanoparticle quantum conf. Monolithic printed layers. Sintering min. ~400 C. PV Effic.: 5 19%. Economic Advantages ...

419

OIT 2007-08 Annual Report 1 NC State University Office of Information Technology  

E-Print Network (OSTI)

missions. The OIT merger formalized the relationship between high performance computing (HPC) and virtual

420

Microsoft Word - BSA_NC_Service_Rev5 eVerify Final.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

AT BROOKHAVEN NATIONAL LABORATORY Section 1 - General Clauses Applicable to Fixed Price and Cost Type Contracts. ...2 Article 1.1...

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

.NC STATE Physics. www.physics.ncsu.edu NORTH CAROLINA STATE UNIVERSITY  

E-Print Network (OSTI)

Astrophysics, Atomic, Biophysics, Computational, Materials, Molecular, Nanoscale, Nuclear, Optics, Particle Carolina State University is located in Raleigh, the capital city of North Carolina and one corner covers most areas of forefront physics research Experimental: Atomic Physics and Quantum Optics

422

Microsoft Word - BSA_NC_Items_Rev6 eVerify Final.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

6; (Jan. 2010) 1 of 13 6; (Jan. 2010) 1 of 13 ATTACHMENT A BROOKHAVEN SCIENCE ASSOCIATES, LLC GENERAL TERMS AND CONDITIONS FOR NON-COMMERCIAL ITEMS AT BROOKHAVEN NATIONAL LABORATORY Article 1 Definitions 2 Article 2 Order of Precedence 2 Article 3 Acceptance of Agreement 2 Article 4 Complete Agreement 3 Article 5 Assignment 3 Article 6 Compliance with Laws and Regulations 3 Article 7 Independent Contractor; Hold Harmless 3 Article 8 Notice Regarding Late Delivery 3 Article 9 Inspection and Acceptance 4 Article 10 No Waiver 4 Article 11 New Materials 5 Article 12 Suspect/Counterfeit Items 5 Article 13 Hazardous Material Identification and Material Safety Data 6 Article 14 Title and Risk of Loss 6 Article 15 Warranty 6 Article 16 Payment 6 Article 17 Taxes 7 Article 18 Extras 7

423

Nepal's New Political Landscape  

E-Print Network (OSTI)

not woken up to the new reali- ties. The popular mandate was not for a one-party mi- nority administration but for cooperation on a path for peace and change. The Nepali Congress (NC) and Communist Party of Nepal (Unified Marxist-Leninist, UML) went... - pects concrete rewards. The party has yet to secure leadership of the transitional government, and, even when it does, will have to manage a coalition or mi- nority administration while facing high expectations and problems so serious (not least...

International Crisis Group

2008-07-03T23:59:59.000Z

424

Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P

2003-01-01T23:59:59.000Z

425

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...

426

Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...

427

A FUNDAMENTAL REAKTHROUGH IN HEAT TRANSFER TE HNOLOGY FOR MI ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION

428

Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)

429

Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael

2008-01-01T23:59:59.000Z

430

MI ROFA RI ATED FIELD ALI RATION ASSEM LY  

Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as

431

MI ROFA RI ATED FIELD ALI RATION ASSEM LY  

Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake

432

NEVADA BUREAU OF MINES AND GEOLOGY SPECIAL PUBLICATION MI-1996  

E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.

433

NEVADA BUREAU OF MINES AND GEOLOGY SPECIAL PUBLICATION MI-1994  

E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.

434

Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...

435

Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...

436

Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...

437

Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...

438

Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...

439

Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...

440

Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...

442

Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...

443

Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...

444

St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...

445

Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...

446

Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...

447

St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...

448

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...

449

Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...

450

Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...

451

Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...

452

Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...

453

ENERGY SURETY MI ROGRID - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment assists in planning and analysis of potential risks

454

NETL: NEPA Categorical Exclusions - January 2011 to March 2011  

NLE Websites -- All DOE Office Websites (Extended Search)

1 to March 2011 1 to March 2011 Archive (November 2009 -March 2011) ARRA Date Title Recipient Name Location DOE/NETL Sponsors N 3/31/2011 The Oil Recovery Tool: Acoustic Source for Increased Oil Production Hydroacoustics Inc. Torrey, NY FE/SCNGO N 3/31/2011 National Biodiesel Foundation: Biodiesel Terminal Installation Project National Biodiesel Foundation Port Chester, NY EE/VT/PVT N 3/31/2011 Portable Raman Gas Composition Monitor Benjamin Chorpening Morgantown, WV FE/ORD Y 3/29/2011 Grant for State Sponsored RE and EE Projects - Montclair State University Solar Farm New Jersey Board of Public Utilities Montclair, NJ EE/PMC/IPOD Y 3/29/2011 RI Non-Utility Scale Renewable Energy Program Rhode Island Warwick, RI EE/PMC/IPOD Y 3/28/2011 Workforce Development Initiative Market Title North Carolina Multiple sites, NC EERE/PMC/IPOD

455

miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha

2012-01-01T23:59:59.000Z

456

Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.

457

An Assessment of Suburban-Targeted Transit Service Strategies in the United States  

E-Print Network (OSTI)

TRANSPORTATION AUTHORITY ALBANY NY NEW YORK MTASUBURBANTRANSPORTAtION AUTHORITY ALBANY NY NEW YORK MTA SUBURBAN

Cervero, Robert; Dunzo, Mark

1993-01-01T23:59:59.000Z

458

University of Kansas Department of Environment, Health & Safety  

E-Print Network (OSTI)

Storage Cabinets Flammable / Combustible Acids / Corrosives Compressed Gas, Vented Y N NY NY Y N NY NY NY: Centrifuge, (high- or ultra- speed) Distillation Equipment Solvent Still High Risk Electrical ( >25

Peterson, Blake R.

459

2012 SG Peer Review - Recovery Act: Secure Interoperable Open Smart Grid Demonstration Project - Tom Magee, ConEd NY  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Demonstration Project Demonstration Project Patricia Robison Con Edison June 8, 2012 December 2008 Smart Grid Demonstration Project Objective Life-cycle Funding FY10 - FY13 $45.4 m Technical Scope (Insert graphic here) 2 *Integrate Legacy and Smart Grid information systems *Integrate external DR into distribution grid systems: - EV/Battery storage - Building Management Systems (BMS) - Standby generation - Photovoltaic Demonstrate secure interoperable services between utility distribution systems and customer owned distributed resources (DR) December 2008 Needs and Project Targets Integrate customer owned resources into distribution operations to enable customer participation and defer capital investment *Integrate DR resources into operator platform *Implement secure communications to DR resources

460

58-25 Queens Blvd., Woodside, NY 11377 T: (718) 204-7077; (800) 627-1244  

E-Print Network (OSTI)

of Christendom ­ the tomb where Christ was buried and was resurrected. Exit via the Damascus Gate and continue beverages. · Laundry and other items of a personal nature. · Personal, trip cancellation, accident Tax/Customs Fees/Security Charge. · Optional insurance coverage is available for Baggage, Accident

Marsh, David

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Design Intern: New York, NY Global Green USA's Coalition for Resource Recovery is an industry working group dedicated to generating  

E-Print Network (OSTI)

, and locally recover wasted food to power the city with green energy. For more information visit thecorr working group dedicated to generating business value through turning waste into assets. The Coalition identifies and promotes effective waste diversion technologies and programs through conducting pilot programs

Colorado at Boulder, University of

462

A corporate fitness center : an example for the reuse of the Empire Stores, Brooklyn, N.Y.  

E-Print Network (OSTI)

The proliferation of over 500 fitness programs for the employees of American corporations marks a turning point for the way American corporations regard employee and corporate health. Typically, sports facilities were the ...

Georgopulos, Diane Theodora

1982-01-01T23:59:59.000Z

463

Ann. N.Y. Acad. Sci. ISSN 0077-8923 ANNALS OF THE NEW YORK ACADEMY OF SCIENCES  

E-Print Network (OSTI)

year as a pathology resident at Sinai Hospital in Baltimore. After receiving his master's degree from began his academic career at Stanford University in the Department of Pharmacology in 1973, and joined Foundation Commonwealth Fund Exxon Mobil Foundation Fleischmann Family Fund Mary Moody Northen Endowment

Vermont, University of

464

NY/NJ distributed wind power field verification project. Quarterly report for the period November - December 1999  

DOE Green Energy (OSTI)

This report details the Significant Accomplishments for this quarter. The accomplishments are: (1) began preparations for host site installations; and (2) data acquisition system installation at the National Wind Technology Center (NWTC) near Boulder, CO.

Putnam, Robert Jr.

2000-01-01T23:59:59.000Z

465

Assessment of microbial processes on radionuclide mobility in shallow land burial. [West Valley, NY; Beatty, Nevada; Maxey Flats, Kentucky  

Science Conference Proceedings (OSTI)

The impact of microbial metabolism of the organic substituents of low level radioactive wastes on radionuclide mobility in disposal sites, the nature of the microbial transformations involved in this metabolism and the effect of the prevailing environmental parameters on the quantities and types of metabolic intermediates accumulated were examined. Since both aerobic and anaerobic periods can occur during trench ecosystem development, oxidation capacities of the microbial community in the presence and absence of oxygen were analyzed. Results of gas studies performed at three commercial low level radioactive waste disposal sites were reviewed. Several deficiencies in available data were determined. Further research needs are suggested. This assessment has demonstrated that the biochemical capabilities expressed within the low level radioactive waste disposal site are common to a wide variety of soil bacteria. Hence, assuming trenches would not be placed in sites with such extreme abiotic conditions that all microbial activity is precluded, the microbial populations needed for colonization and decomposition of the organic waste substances are readily provided from the waste itself and from the soil of existing and any proposed disposal sites. Indeed, considering the ubiquity of occurrence of the microorganisms responsible for waste decomposition and the chemical nature of the organic waste material, long-term prevention of biodecomposition is difficult, if not impossible.

Colombo, P.; Tate, R.L. III; Weiss, A.J.

1982-07-01T23:59:59.000Z

466

Proceedings of NAACL HLT 2007, pages 324331, Rochester, NY, April 2007. c 2007 Association for Computational Linguistics  

E-Print Network (OSTI)

of the one­rotational 2 \\Gamma (6; 3; 2) SDS: (1; 0; 1)(0; 2; 4), then we only have two options here; either construction for a BIBD(31; 6; 1) (i.e., [1; 5; 11; 24; 25; 27]) yields the fol­ lowing 6 \\Gamma (31; 5; 4) SDS: [1; 5; \\Gamma11; \\Gamma24; \\Gamma25]; [1; \\Gamma5; 11; \\Gamma24; \\Gamma27]; [\\Gamma1; 5; 11; \\Gamma25

467

Neutron contribution to CaF2:Mn thermoluminescent dosimeter response in mixed (n/y) field environments.  

SciTech Connect

Thermoluminescent dosimeters (TLDs), particularly CaF{sub 2}:Mn, are often used as photon dosimeters in mixed (n/{gamma}) field environments. In these mixed field environments, it is desirable to separate the photon response of a dosimeter from the neutron response. For passive dosimeters that measure an integral response, such as TLDs, the separation of the two components must be performed by postexperiment analysis because the TLD reading system cannot distinguish between photon- and neutron-produced response. Using a model of an aluminum-equilibrated TLD-400 (CaF{sub 2}:Mn) chip, a systematic effort has been made to analytically determine the various components that contribute to the neutron response of a TLD reading. The calculations were performed for five measured reactor neutron spectra and one theoretical thermal neutron spectrum. The five measured reactor spectra all have experimental values for aluminum-equilibrated TLD-400 chips. Calculations were used to determine the percentage of the total TLD response produced by neutron interactions in the TLD and aluminum equilibrator. These calculations will aid the Sandia National Laboratories-Radiation Metrology Laboratory (SNL-RML) in the interpretation of the uncertainty for TLD dosimetry measurements in the mixed field environments produced by SNL reactor facilities.

DePriest, Kendall Russell; Griffin, Patrick Joseph

2003-07-01T23:59:59.000Z

468

Neutron Contribution to CaF2:Mn Thermoluminescent Dosimeter Response in Mixed (n/y) Field Environments  

SciTech Connect

Thermoluminescent dosimeters (TLDs), particularly CaF{sub 2}:Mn, are often used as photon dosimeters in mixed (n/{gamma}) field environments. In these mixed field environments, it is desirable to separate the photon response of a dosimeter from the neutron response. For passive dosimeters that measure an integral response, such as TLDs, the separation of the two components must be performed by post-experiment analysis because the TLD reading system cannot distinguish between photon and neutron produced response. Using a model of an aluminum-equilibrated TLD-400 chip, a systematic effort has been made to analytically determine the various components that contribute to the neutron response of a TLD reading. The calculations were performed for five measured reactor neutron spectra and one theoretical thermal neutron spectrum. The five measured reactor spectra all have dosimetry quality experimental values for aluminum-equilibrated TLD-400 chips. Calculations were used to determined the percentage of the total TLD response produced by neutron interactions in the TLD and aluminum equilibrator. These calculations will aid the Sandia National Laboratories-Radiation Metrology Laboratory (SNL-RML) in the interpretation of the uncertainty for TLD dosimetry measurements in the mixed field environments produced by SNL reactor facilities.

DEPRIEST, KENDALL R.

2002-11-01T23:59:59.000Z

469

Application of FACTS Devices to Increase the NY State Central-East/Total-East Interface Transfer Limits  

Science Conference Proceedings (OSTI)

This report presents a discussion of the work and investigations performed to identify a FACTS device or devices suitable for a pilot project on the New York State transmission system. The study concluded that implementation of FACTS devices would offer cost-effective solutions for both near-term and long-term operational concerns.

1997-10-15T23:59:59.000Z

470

Ann. N.Y. Acad. Sci. ISSN 0077-8923 ANNALS OF THE NEW YORK ACADEMY OF SCIENCES  

E-Print Network (OSTI)

wind, solar, and other forms of nonfossil fuel power generation, along with investments in efficiency power generation (one gigaton = one billiontons;onemetricton=2,204pounds.)1 Non­ power-generation uses that coal power is responsible for much of the U.S. power generation-related emissions of PM2.5 (51%), NOx

Vermont, University of

471

Vacuum vapor deposition of PFPE molecules on CHxNy and CHxFy amorphous carbon surfaces  

Science Conference Proceedings (OSTI)

According to the demand of increasing storage density for the magnetic data storage, a contact recording system is proposed, in which the head constantly makes contact with the disk surface during read/write cycles. In this system a stronger lubricant ...

Masahiro Kawaguchi; Junho Choi; Takahisa Kato

2007-04-01T23:59:59.000Z

472

Better Buildings Neighborhood Program: Better Buildings Partners  

NLE Websites -- All DOE Office Websites (Extended Search)

Better Better Buildings Partners to someone by E-mail Share Better Buildings Neighborhood Program: Better Buildings Partners on Facebook Tweet about Better Buildings Neighborhood Program: Better Buildings Partners on Twitter Bookmark Better Buildings Neighborhood Program: Better Buildings Partners on Google Bookmark Better Buildings Neighborhood Program: Better Buildings Partners on Delicious Rank Better Buildings Neighborhood Program: Better Buildings Partners on Digg Find More places to share Better Buildings Neighborhood Program: Better Buildings Partners on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY

473

PowerPoint Presentation  

NLE Websites -- All DOE Office Websites (Extended Search)

R. Gupta, M. Anerella, J. Cozzolino, R. Gupta, M. Anerella, J. Cozzolino, W. Sampson, Peter Wanderer, BNL, NY USA A Zeller, FRIB, MI, USA Superconducting Magnet Division HTS Quad for FRIB Ramesh Gupta , ..., BNL, Al Zeller, FRIB Slide No. 2 ASC2012 October 10, 2012 Outline * Motivation for HTS magnets in FRIB - HTS is now the baseline design for some critical magnets * First Generation Design - 30 K operation * Second Generation Design - 50 K operation and higher gradient * Summary and future outlook Superconducting Magnet Division HTS Quad for FRIB Ramesh Gupta , ..., BNL, Al Zeller, FRIB Slide No. 3 ASC2012 October 10, 2012 FRIB * Facility for Rare Isotope Beams (FRIB) will create rare isotopes

474

A simple Bayesian estimate of direct RNAi gene regulation events from differential gene expression profiles  

E-Print Network (OSTI)

,13]. * Correspondence: paul.a.wilson@gsk.com 1Computational Biology, GlaxoSmithKline Medicine Research Centre, Gunnels Wood Road, Stevenage, SG1 2NY, UK Full list of author information is available at the end of the article Wilson and Plucinski BMC Genomics 2011, 12... differential expression profile. Hierarchical clustering and heat map representations of the most differentially expressed tran- scripts (Additional File 1 Figure S9) suggest that the KSHV-miR-k12-11 transfected dataset is more similar to the control data than...

Wilson, Paul A; Plucinski, Mathew

2011-05-20T23:59:59.000Z

475

4th Annual DOE-ERSP PI Meeting: Abstracts  

E-Print Network (OSTI)

Sciences Department, Brookhaven National Lab, Upton, NY (Biology Department, Brookhaven National Lab, Upton, NY, DevDepartment, Brookhaven National Lab, Upton, NY, Safiyh

Hazen, Terry C.

2009-01-01T23:59:59.000Z

476

Basic Energy Sciences Directorate  

NLE Websites -- All DOE Office Websites (Extended Search)

andor outreach to the following initiatives: NY State Smart Grid Consortium, NY Battery and Energy Storage Technology (NY-BEST) Teams, and the SBUNYS Small Business...

477

Microsoft Word - DOE-ID-12-038 NC State EC B3-6 B3-10.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

8 8 SECTION A. Project Title: Nanostructured Fe-Cr Alloys for Advanced Nuclear Energy Applications - North Carolina State University SECTION B. Project Description This project will optimize alloy design and microstructure engineering of nanostructured ferritic alloys (NFAs) to increase their irradiation damage tolerance. The synthesis method will use mechanical alloying (MA) as is used for Y-Ti-O alloys. The research plan components are based on MA synthesis using high energy Spex ball mills, microstructure and mechanical property characterization, ion-irradiation testing and modeling. SECTION C. Environmental Aspects / Potential Sources of Impact Chemical Use/Storage - Chemicals are stored and used in accordance with the rules set by the Environmental and Health Safety office

478

of Homeownership. Center for Community Capitalism: Chapel Hill, NC. Community Advantage Panel Study: Social Impacts of Homeownership  

E-Print Network (OSTI)

This working paper presents our theoretical approach to the study of the social impacts of homeownership. Previous studies of these social impacts have primarily focused on basic differences in economic and social outcomes or psychological status between owners and renters without providing insight into how homeownership brings about these outcomes. In an extensive review of literature on the social impact of homeownership, Rohe, McCarthy and Van Zandt (2000) identified two major shortcomings of existing research. Their first conclusion was that future research needs to do a better job of identifying processes or mechanisms through which homeownership influences the different social variables of interest. Second, they concluded that future research needs to do a better job of addressing the self-selection bias inherent in research on the impacts of homeownership. That is, these studies have been unable to isolate the effects of homeownership, making it impossible to know if the attitudes, behaviors, and social outcomes of owners are the result of homeownership or if people who hold such attitudes or are likely to experience such social outcomes are more likely to become homeowners. We propose to address these shortcomings of previous research in three ways. First, we use current social-psychological theories of rational action, the Theory of

Michael Hubbard Phd; Walter Davis; Michael Hubbard; Walter Davis

2002-01-01T23:59:59.000Z

479

3511 Ivy Commons Dr., Apt 302 ttian2@ncsu.edu Raleigh, NC 27606 515-708-5624  

E-Print Network (OSTI)

Jilin University, Changchun, China B.S. Polymer Science and Engineering GPA:3.79/4.0, June 2009 microscopy, SEM and TEM. · Formulated drug delivery system by encapsulating active drugs inside the polymer and surface charge distribution of particles by DLS. Jilin University, Changchun, China Research Assistant

Velev, Orlin D.

480

) Annu. Rev. Energy Environ. 1993. 18:567-630 Copyright @ 1993 by Annual Reviews 1nc. All rights reserved  

E-Print Network (OSTI)

to convert the biomass to fuel: biochemical or thermochemical. Second-generation ethanol or butanol would-generation thermochemical biofuels Thermochemical biomass conversion involves processes at much higher temperatures of process steps for thermochemical biofuels production Raw Biomass Gasification Drying Sizing Water Gas

Note: This page contains sample records for the topic "mi nc ny" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Microsoft Word - DOE-ID-12-038 NC State EC B3-6 B3-10.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Chemical Waste Disposal - Chemical waste consists of discarded powders for ball milling and chemicalssolvents used for preparation of microscopy samples and sample...

482

Substituent Effects In a Series of 1,7-C60(RF)2 Compounds (RF = CF3, C2F5, n-C3F7, i-C3F7, n-C4F9, s-C4F9, n-C8F17): Electron Affinities, Reduction Potentials, and E(LUMO) Values Are Not Always Correlated  

SciTech Connect

Substituent effects are of paramount importance in virtually all fields of fundamental and applied chemistry. Classical and modern examples can be found in organic chemistry (Hammett parameters and Charton steric parameters), inorganic chemistry (trans effect and trans influence), organometallic chemistry (phosphine cone angles), physical chemistry (linear free energy relationships and DFT), biochemistry (protein tertiary structure), medicinal chemistry (SAR maps and BioMAP analysis), polymer chemistry (nonlinear optical and permeation properties and glass transition temperatures), and materials chemistry (stability and luminescent properties of electroluminescent devices and light-to-power conversion efficiencies of fullerene-derivative-based OPV devices).

Kuvychko, Igor V.; Whitaker, James B.; Larson, Bryon W.; Folsom, Travis; Shustova, Natalia; Avdoshenko, Stanislav; Chen, Yu-Sheng; Wen, Hui; Wang, Xue B.; Dunsch, Lothar; Popov, Alexey A.; Boltalina, Olga V.; Strauss, Steven H.

2012-05-01T23:59:59.000Z

483

NGA98fin5.vp  

Gasoline and Diesel Fuel Update (EIA)

8 8 Southern California Gas Co ..................... CA 269,739,909 7.31 Pacific Gas and Elec Co........................... CA 224,402,286 6.32 Northern Illinois Gas Co ........................... IL 196,608,329 4.63 Consumers Pwr Co .................................. MI 153,128,350 4.92 Columbia Gas Dist Co.............................. OH,KY,PA,MD 138,064,908 7.21 Pub Svc Elec and Gas Co........................ NJ 126,142,540 6.61 Michigan Consol Gas Co.......................... MI 125,456,377 5.35 East Ohio Gas Co .................................... OH 117,574,196 6.21 Peoples Gas Lt and Coke Co................... IL 89,685,006 6.81 Atlanta Gas Lt Co ..................................... GA 89,103,601 6.69 Lone Star Gas Co..................................... TX 84,559,915 5.95 Brooklyn Union Gas Co............................ NY

484

Northern Illinois Gas Co IL  

Gasoline and Diesel Fuel Update (EIA)

Northern Northern Illinois Gas Co ............................ IL 254,574,988 4.60 Southern California Gas Co ...................... CA 233,632,354 6.89 Columbia Gas Dist Co............................... OH,KY,PA,MD 196,322,935 6.64 Pacific Gas and Elec Co............................ CA 190,864,262 5.83 Consumers Pwr Co ................................... MI 188,587,672 4.81 Michigan Consol Gas Co........................... MI 160,809,168 5.16 East Ohio Gas Co ..................................... OH 146,802,045 5.44 Pub Svc Elec and Gas Co......................... NJ 140,712,209 6.62 Peoples Gas Lt and Coke Co.................... IL 126,356,925 6.40 Brooklyn Union Gas Co............................. NY 106,349,594 9.43 Atlanta Gas Lt Co ...................................... GA 106,075,815 6.66 Lone Star Gas Co......................................

485

Categorical Exclusion Determination Form Proposed Action Title: (0675-1534) GE Global Research -  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

34) GE Global Research - 34) GE Global Research - Control Enabling Solutions with Ultrathin Strain and Temperature Sensor System for Reduced Battery Life Cycle Cost Program or Field Office: Advanced Research Projects Agency - Energy LocationCs) CCity/County/State): Niskayuna, NY; Ann Arbor, MI; Dearborn, MI Proposed Action Description: Funding will support efforts to develop a a novel sensor system with supporting multi-physics models to increase battery cell lifetime and extend battery range for electric vehicle applications. Proposed work will consist of: (1) development and fabrication a novel multi-measurand sensor capable of measuring strain and temperature across multiple battery cells; (2) performance of strain and temperature testing and development and validation of multi-physics models; (3)

486

C:\ANNUAL\VENTCHAP.V8\NGA.VP  

Gasoline and Diesel Fuel Update (EIA)

4 4 Con Edison Co. of New York Inc.............. NY 88,830,005 5.25 Pub Svc Elec and Gas Co........................ NJ 70,705,783 5.28 Columbia Gas Dist Co.............................. OH,KY,PA,MD 63,746,659 7.11 Southern California Gas Co ..................... CA 57,000,043 6.63 Minnegasco .............................................. MN 55,213,151 4.69 Pacific Gas and Elec Co........................... CA 54,854,821 6.15 Entex Div of Noram Energy Corp ............. LA,MS,TX 51,551,370 5.31 Consumers Pwr Co .................................. MI 50,657,354 4.44 Michigan Consol Gas Co.......................... MI 50,589,626 5.55 Northern Illinois Gas Co ........................... IL 47,159,304 5.26 Pub Svc Co. of Colorado.......................... CO 46,479,502 3.88 East Ohio Gas Co .................................... OH 41,561,614 5.92

487

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

2000 2000 Southern California Gas Co ..................... CA 251,452,001 8.32 Nicor Gas ................................................. IL 221,009,522 6.68 Pacific Gas and Elec Co........................... CA 211,181,852 7.98 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 184,692,129 7.53 Consumers Energy Co ............................. MI 176,663,600 4.76 Michigan Consol Gas Co.......................... MI 136,124,328 5.41 Keyspan Energy Del Co ........................... NY 134,055,940 10.75 Pub Svc Elec and Gas Co........................ NJ 132,611,115 6.32 East Ohio Gas Co .................................... OH 131,187,521 7.49 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 130,622,887 8.82 Peoples Gas Lt and Coke Co................... IL 103,856,141 8.60 Pub Svc Co of Colorado...........................

488

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

Energy Information Administration / Natural Gas Annual 1999 Southern California Gas Co ..................... CA 275,767,714 6.50 Pacific Gas and Elec Co........................... CA 234,195,449 6.61 Nicor Gas ................................................. IL 211,147,988 4.71 Consumers Energy Co ............................. MI 167,318,229 4.89 Michigan Consol Gas Co.......................... MI 134,432,032 5.42 Pub Svc Elec and Gas Co........................ NJ 133,426,119 6.86 East Ohio Gas Co .................................... OH 127,141,913 5.81 Keyspan Energy Del Co ........................... NY 125,709,092 9.79 Columbia Gas Dist Co.............................. KY,PA,MD,OH 121,011,064 7.32 Peoples Gas Lt and Coke Co................... IL 98,758,164 6.77 Pub Svc Co of Colorado........................... CO 84,115,032 5.28

489

Pub Svc Elec  

Gasoline and Diesel Fuel Update (EIA)

Pub Pub Svc Elec and Gas Co......................... NJ 81,712,678 5.82 Columbia Gas Dist Co............................... OH,KY,PA,MD 76,048,915 5.95 Con Edison Co. of New York Inc............... NY 69,809,658 5.99 Consumers Pwr Co ................................... MI 58,661,306 4.46 Pacific Gas and Elec Co............................ CA 57,793,522 5.67 Minnegasco ............................................... MN 57,154,912 4.57 Southern California Gas Co ...................... CA 54,772,058 6.16 Michigan Consol Gas Co........................... MI 53,635,433 5.16 Entex Div of Noram Energy Corp.............. LA,TX,MS 49,485,836 4.80 Northern Illinois Gas Co ............................ IL 48,165,624 4.62 Pub Svc Co. of Colorado........................... CO 47,339,959 3.51 Atlanta Gas Lt Co ......................................

490

Environmental assessment of remedial action at the Slick Rock uranium mill tailings sites, Slick Rock, Colorado. Revision 1  

SciTech Connect

The Uranium Mill Tailings Radiation Control Act of 1978 (42 USC {section}7901 et seq.), hereafter referred to as the UMTRCA, authorized the US Department of Energy (DOE) to clean up two uranium mill tailings processing sites near Slick Rock, Colorado, in San Miquel County. Contaminated materials cover an estimated 63 acres of the Union Carbide (UC) processing site and 15 ac of the North Continent (NC) processing site. The sites are within 1 mile of each other and are adjacent to the Dolores River. The sites contain concrete foundations of mill buildings, tailings piles, and areas contaminated by windblown and waterborne radioactive tailings materials. The total estimated volume of contaminated materials is approximately 621,300 cubic yards (yd{sup 3}). In addition to the contamination in the two processing site areas, four VPs were found to contain contamination. As a result of the tailings being exposed to the environment, contamination associated with the UC and NC sites has leached into shallow ground water. Surface water has not been affected. The closest residence is approximately 0.3 air mi from either site. The proposed action is to remediate the UC and NC sites by removing all contaminated materials within the designing site boundaries or otherwise associated with the sites, and relocating them to, and stabilizing them at, a location approximately 5 road mi northeast of the sites on land administered by the Bureau of Land Management (BLM).

1994-09-01T23:59:59.000Z

491

The Bulletin - BNL's Weekly Newspaper  

NLE Websites -- All DOE Office Websites (Extended Search)

Richard D. Baulch, Jr. Richard D. Baulch, Jr. A | B | C | D | E | F | G | H | I | J | K | L | M N | O | P | Q | R | S | T | U | V | W | X | Y | Z In Memoriam Home | Bulletin Home Posted: June 2, 2009 Richard Baulch, Jr., who first joined the Supply & Materiel Division as a warehouseman on October 2, 1961, died at age 69 on December 31, 2008. He had left BNL as a stores clerk on March 1, 1968, then re-joined as a patrolman trainee on October 14, 1968. In April 1982, he was named Police Captain; and he left the Lab on May 22, 1991. ***** Richard Baulch, 69, of Cape Carteret, N.C., formally of Speonk, N.Y., died on December 24,2008, at Craven Regional Medical Center in New Bern, N.C. A memorial service was held at St. Mildred Catholic Church in Swansboro, N.C., and his burial, with military honors in memory of his service in the U.S. Air Force, was held at Coastal Carolina State Veterans Cemetery.

492

U.S. Liquefied Natural Gas Exports To Brazil  

Annual Energy Outlook 2012 (EIA)

Babb, MT Havre, MT Port of Morgan, MT Pittsburg, NH Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Sweetgrass, MT Total to Chile Sabine Pass, LA Total to...

493

Remedial action plan and site design for stabilization of the inactive uranium mill tailings sites at Slick Rock, Colorado. Remedial action selection report, Appendix B  

Science Conference Proceedings (OSTI)

The Slick Rock uranium mill tailings sites are located near the small town of Slick Rock, in San Miguel County, Colorado. There are two designated UMTRA sites at Slick Rock, the Union Carbide (UC) site and the North Continent (NC) site. Both sites are adjacent to the Dolores River. The UC site is approximately 1 mile (mi) [2 kilometers (km)] downstream of the NC site. Contaminated materials cover an estimated 55 acres (ac) [22 hectares (ha)] at the UC site and 12 ac (4.9 ha) at the NC site. The sites contain former mill building concrete foundations, tailings piles, demolition debris, and areas contaminated by windblown and waterborne radioactive materials. The total estimated volume of contaminated materials is approximately 620, 000 cubic yards (yd{sup 3}) [470,000 cubic meters (m{sup 3})]. In addition to the contamination at the two processing site areas, four vicinity properties were contaminated. Contamination associated with the UC and NC sites has leached into groundwater.

Not Available

1993-07-01T23:59:59.000Z

494

Utility Perspective of mCHP  

Science Conference Proceedings (OSTI)

... Market Development ?Dedicated Natural Gas rates for CHP in NY ... Upstate NY ? 29 Mw steam turbine at Healthcare facility ...

2012-08-28T23:59:59.000Z

495

From the Frontlines to the Bottom Line: Medical Marijuana, the War on Drugs, and the Drug Policy Reform Movement  

E-Print Network (OSTI)

Experience. Albany, NY: State University of New York Press.Intellectual. Albany, NY: State University of New York

Heddleston, Thomas Reed

2012-01-01T23:59:59.000Z

496

DRAFT COMMITTEE REPORT RENEWABLE ENERGY PROGRAM  

E-Print Network (OSTI)

. Bunton Wilkes County Poultry Statesville, NC Mark E. Bramlett Pilgrim's Pride Sanford, NC Samuel A. Brown

497

The Greenness of Cities: Carbon Dioxide Emissions and Urban Development  

E-Print Network (OSTI)

Portland, OR Syracuse, NY Albany, NY New York, NY Salt LakeRI Syracuse, NY New York, NY Albany, NY Tacoma, WA Salt LakeTN/A~S Tulsa, OK Albany-Schene~Y MO~L St. New York-Nort~J

Glaeser, Edward L.; Kahn, Matthew E.

2008-01-01T23:59:59.000Z

498

Environmental assessment of remedial action at the slick rock Uranium Mill Tailings sites Slick Rock, Colorado  

SciTech Connect

The Uranium Mill Tailings Radiation Control Act of 1978 (42 USC {section} 7901 et seq.), hereafter referred to as the UMTRCA, authorized the U.S. Department of Energy (DOE) to clean up two uranium mill tailings processing sites near Slick Rock, Colorado, in San Miguel County. The purpose of the cleanup is to reduce the potential health effects associated with the radioactive materials remaining on the sites and on vicinity properties (VPs) associated with the sites. Contaminated materials cover an estimated 55 acres of the Union Carbide (UC) processing site and 12 ac of the North Continent (NC) processing site. The total estimated volume of contaminated materials is approximately 61 8,300 cubic yards. In addition to the contamination in the two processing site areas, four VPs were found to contain contamination. As a result of the tailings being exposed to the environment, contamination associated with the UC and NC sites has leached into shallow ground water. Surface water has not been affected. The closest residence is approximately 0.3 air mi from either site. The proposed action is to remediate the UC and NC sites by removing all contaminated materials within the designated site boundaries or otherwise associated with the sites, and relocating them to, and stabilizing them at, a location approximately 5 road mi (8 km) northeast of the sites on land administered by the Bureau of Land Management (BLM). Remediation would be performed by the DOE`s Uranium Mill Tailings Remedial Action (UMTRA) Project. All solid contaminated materials would be buried under 5 feet (ft) of rock and soil materials. The proposed disposal site area is currently used by ranchers for cattle grazing over a 7-month period. The closest residence to the proposed disposal site is 2 air mi. An estimated 44 ac of land would be permanently transferred from the BLM to the DOE and restricted from future use.

1994-09-01T23:59:59.000Z

499

Gulf Stream Locale P. Michael and M. L. Daum Brookhaven National Laboratory  

NLE Websites -- All DOE Office Websites (Extended Search)

P. Michael and M. L. Daum P. Michael and M. L. Daum Brookhaven National Laboratory Upton, NY 11973 S. Raman and M. leach North Carolina State University Raleigh, NC 27695-8028 Locale Characteristics climate models. These modules usually assume uniformity of surface conditions overdomains of several hundreds of kilometers. 4. The anthropogenic aerosol loading off the east coast of the United States is highly variable; thus, the locale provides a testbed for hypotheses on the effects of changes in cloud condensation nuclei (CCN) concentrations upon cloud optical properties, structure and life cycle. Of the five primary CART sites, the Gulf Stream locale, a western boundary current location, uniquely experiences positive sensible and latent heat fluxes that span wide ranges and are likely the largest on the earth (item 1

500

ITP_Data_Centers.xls  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Project Description Total DOE Project Description Total DOE Funding IBM T.J. Watson Research Center HQs: Yorktown Heights, NY Project Location: Research Triangle Park, NC Reducing Data Center Cooling Energy through Software-Based Management Tools. The project will develop and field test data center and telecommunication facility management tools to reduce power consumption from cooling components. Using real-time temperature, humidity, hot-spot management, air-leakage measurement, and corrosion monitoring, this tool will optimize air conditioning systems and use of outside air in computing facilities. This technology has the potential to save 10% of average data center and telecommunication center energy requirements. $1,666,550 SeaMicro Santa Clara, CA Reducing Volume-Server Energy Use by Re-Architecting Server Components. This project will field test re-