Powered by Deep Web Technologies
Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links  

E-Print Network (OSTI)

2) and the concentration of 65Cu2+ estimated by the speciation model WHAM (1.0 (28)), we could]e^ equals zero and that [65 Cu2+ ] was constant (i.e., nominal [65 Cu2+ ] ) 5.2-µg L-1). That is, WHAM the speciation model WHAM (28) assuming that the lake water has a pH near 8 (30), a dissolved organic carbon

Allen, Gale


US ENC WI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

120 120 US ENC WI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC WI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC WI Site Consumption kilowatthours $0 $300 $600 $900 $1,200 $1,500 US ENC WI Expenditures dollars ELECTRICITY ONLY average per household * Wisconsin households use 103 million Btu of energy per home, 15% more than the U.S. average. * Lower electricity and natural gas rates compared to states with a similar climate, such as New York, result in households spending 5% less for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers, keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC WI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

120 120 US ENC WI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC WI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC WI Site Consumption kilowatthours $0 $300 $600 $900 $1,200 $1,500 US ENC WI Expenditures dollars ELECTRICITY ONLY average per household * Wisconsin households use 103 million Btu of energy per home, 15% more than the U.S. average. * Lower electricity and natural gas rates compared to states with a similar climate, such as New York, result in households spending 5% less for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers, keeps average site electricity consumption in the state low relative to other parts of the U.S.


WiFi-Nano: Reclaiming WiFi Efficiency Through 800 ns Eugenio Magistretti  

E-Print Network (OSTI)

WiFi-Nano: Reclaiming WiFi Efficiency Through 800 ns Slots Eugenio Magistretti Rice University of WiFi has deteriorated from over 80% at 1 Mbps to under 10% at 1 Gbps. In this paper, we propose WiFi-Nano, thereby reducing ack overhead. We validate the effectiveness of WiFi-Nano through im- plementation

Mellor-Crummey, John


WI Windinvest | Open Energy Information  

Open Energy Info (EERE)

WI Windinvest WI Windinvest Jump to: navigation, search Name WI Windinvest Place Westfalen, Germany Zip 48727 Sector Wind energy Product Westfalen based wind project developer Coordinates 43.992484°, -117.711985° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.992484,"lon":-117.711985,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Evansville WI (WWTP) | Open Energy Information  

Open Energy Info (EERE)

Evansville WI (WWTP) Evansville WI (WWTP) Jump to: navigation, search Name Evansville WI (WWTP) Facility Evansville WI (WWTP) Sector Wind energy Facility Type Small Scale Wind Facility Status In Service Owner Evansville WI (WWTP) Energy Purchaser Evansville WI (WWTP) Location Evansville WI Coordinates 42.77765315°, -89.28004146° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.77765315,"lon":-89.28004146,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Scheduling in multihop WiMAX networks  

Science Conference Proceedings (OSTI)

IEEE 802.16, popularly known as WiMAX, is at the forefront of the technology drive because of the growing demand for high-speed wireless broadband networks. Multihop WiMAX networks are particularly useful as they increase the coverage area without the ...

Debalina Ghosh; Ashima Gupta; Prasant Mohapatra



What is MoWiTT  

NLE Websites -- All DOE Office Websites (Extended Search)

the net energy flow through two window samples in side-by-side tests using ambient weather conditions. MoWiTT characterizes the net energy flow as a function of time and...


Category:Green Bay, WI | Open Energy Information  

Open Energy Info (EERE)

WI WI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Green Bay, WI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Green Bay WI Wisconsin Electric Power Co.png SVFullServiceRestauran... 79 KB SVQuickServiceRestaurant Green Bay WI Wisconsin Electric Power Co.png SVQuickServiceRestaura... 79 KB SVHospital Green Bay WI Wisconsin Electric Power Co.png SVHospital Green Bay W... 79 KB SVLargeHotel Green Bay WI Wisconsin Electric Power Co.png SVLargeHotel Green Bay... 78 KB SVLargeOffice Green Bay WI Wisconsin Electric Power Co.png SVLargeOffice Green Ba... 90 KB SVMediumOffice Green Bay WI Wisconsin Electric Power Co.png SVMediumOffice Green B... 78 KB SVMidriseApartment Green Bay WI Wisconsin Electric Power Co.png


MoWiTT: The Mobile Window Thermal Test Facility  

NLE Websites -- All DOE Office Websites (Extended Search)

Airflow schematic MoWiTT: The Mobile Window Thermal Test Facility In the MoWiTT facility, efficient window-and-frame systems are measured to understand the flow of energy through...


An efficient security framework for mobile WiMAX  

Science Conference Proceedings (OSTI)

WiMAX is a technology that provides continuous high data throughput with low delays for various user types and modes of operation. The security protocols proposed for WiMAX impose a heavy performance overhead, especially on mobile subscribers running ... Keywords: PKMv2, WiMAX, handover, hierarcical identity based cryptography, security

Mete Rodoper; Arati Baliga; Edward Jung; Wade Trappe



Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


Utilizing WiMAX mesh mode for efficient IPTV transmission  

Science Conference Proceedings (OSTI)

Providing high bit-rates, WiMAX enables IPTV multicasting for several simultaneous broadcasting channels. WiMAX base stations can offer higher capacity to users with better signal quality values, and more robust but lower capacity modulations to users ... Keywords: iptv, mesh mode, multicasting, wimax

Murat Ozyurt; Seckin Ulug; Tuna Tugcu



Detecting transmission power misbehaviour in wi-fi networks  

Science Conference Proceedings (OSTI)

In Wi-Fi networks, transmission (TX) power levels are constrained by regulatory limits. However, the emergence of flexible MAC drivers allows the easy modification of PHY and MAC layer parameters. This has enabled users to attempt to violate these limits. ... Keywords: EIRP, Wi-Fi, detection, misbehaviour, transmission power

Szymon Szott, Marek Sikora, Marek Natkaniec, Krzysztof Loziak



DOE - Office of Legacy Management -- Besley-Wells - Wisconsin - WI 03  

Office of Legacy Management (LM)

Besley-Wells - Wisconsin - WI 03 Besley-Wells - Wisconsin - WI 03 FUSRAP Considered Sites Site: Besley-Wells - Wisconsin (WI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Besley Products Co. WI.03-3 Location: Beloit , Wisconsin WI.03-1 Evaluation Year: 1994 WI.03-1 Site Operations: 1953 proposal for a trial lot of 500 uranium slugs to be machined by Besley double spindle wet grinder in order to compare production rate with that of current process; no indication proposed activities were carried out. WI.03-2 WI.03-3 Site Disposition: Eliminated - Potential for contamination considered remote based on the indication that proposed activities were not carried out WI.03-1 WI.03-3 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None WI.03-3



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

WI-TRIBE-STOCKBRIDGE-MUNSEE BAND OF MOHICAN INDIANS WI-TRIBE-STOCKBRIDGE-MUNSEE BAND OF MOHICAN INDIANS Location: Tribe WI-TRIBE- STOCKBRIDGE- MUNSEE BAND OF MOHICAN INDIANS WI American Recovery and Reinvestment Act: Proposed Action or Project Description The Stockbridge-Munsee Band of Mohican Indians proposes to conduct energy efficient audits of residential and commerical buildings. Conditions: None Categorical Exclusion(s) Applied: A9, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21 This action would not: threaten a violation of applicable statutory, regulatory, or permit requirements for environment, safety, and health, including DOE and/or Executive Orders; require siting, construction, or major expansion of waste storage, disposal, recovery, or


On the Construction of WiMax Mesh Tree  

E-Print Network (OSTI)

Abstract The IEEE 802.16 protocol, also known as WiMAX, has been designed to support long-range communications with high bitrates, using two operation modes: Point-to-Multi-Point (PMP) and Mesh. In the mesh mode, Subscriber Stations (SSs) can directly communicate with each other, thus forming a tree, and can be used to forward others data packets in a multihop fashion. On the contrary, in the PMP mode only one hop communication toward the Base Station (BS) is allowed. In this paper, we investigate the performance of the mesh mode by proposing an algorithm for constructing the WiMAX mesh tree. Our algorithm increases routes effective throughput by splitting long links into multiple shorter ones. We show through simulations that this approach leads to improving the throughput capacity of WiMAX-based wireless mesh networks. Index Terms WiMAX, wireless mesh networks. I.

Salim Nahle; Luigi Iannone; Benoit Donnet; Naceur Malouch


Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Allis-Chalmers Co - WI 01  

Office of Legacy Management (LM)

Allis-Chalmers Co - WI 01 Allis-Chalmers Co - WI 01 FUSRAP Considered Sites Site: Allis-Chalmers Co (WI.01 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Hawley Plant WI.01-1 Location: Milwaukee , Wisconsin WI.01-1 Evaluation Year: 1987 WI.01-1 Site Operations: Manufactured electrical equipment - pumps, motors, and switchgears for K-25 and Y-12. WI.01-1 Site Disposition: Eliminated - Scope of testing activities were limited - Very small amounts of Uranium metal were used for testing - Potential for residual radioactive material on the site considered remote. WI.01-1 WI.01-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Test Quantities of Uranium Metal WI.01-1 Radiological Survey(s): None Indicated


DOE - Office of Legacy Management -- Trane Co - WI 0-02  

Office of Legacy Management (LM)

Trane Co - WI 0-02 Trane Co - WI 0-02 FUSRAP Considered Sites Site: TRANE CO. (WI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: LaCross , Wisconsin WI.0-02-1 Evaluation Year: 1987 WI.0-02-1 Site Operations: Produced Aluminum cans for fuel rod experiments at Argonne Met Lab; Supplied construction materials to Oak Ridge. WI.0-02-1 Site Disposition: Eliminated - No radioactive materials used at this site WI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None WI.0-02-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to TRANE CO. WI.0-02-1 - Memorandum/Checklist; A. Wallo to the File; (Elimination


MoWiTT:Mobile Window Thermal Test Facility  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 MoWiTT: Mobile Window Thermal Test Facility The window has come a long way since the days when it was a single pane of glass in a wood frame. Low-emissivity windows were designed to help buildings retain some of the energy that would have leaked out of less efficient windows. Designing efficient window-and-frame systems requires accurate measurement of the flow of energy through windows in realistic conditions, a capability provided by the Mobile Window Thermal Test facility. Consisting of a pair of outdoor, room-sized calorimeters, MoWiTT measures the net energy flow through two window samples in side-by-side tests using ambient weather conditions. MoWiTT characterizes the net energy flow as a function of time and measures the temperatures, solar fluxes, and


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


High School Visits (WI, IL, MN and other states) Arranged in alpha order  

E-Print Network (OSTI)

High School 10/5/12 8:15 a.m. Black River Falls High School 9/21/12 9:00 a.m. Bollingbrook High School High School 10/16/12 12:00 p.m. Crystal Lake Central High School 10/15/12 9:40 a.m. Cuba City High

Saldin, Dilano


Fundamentals of WiMAX: Understanding Broadband Wireless Networking  

Science Conference Proceedings (OSTI)

This is the eBook version of the printed book. Praise for Fundamentals of WiMAX "This book is one of the most comprehensive books I have reviewed ... it is a must-read for engineers and students planning to remain current or who plan to pursue a career ...

Jeffrey Andrews; Arunabha Ghosh; Rias Muhamed



A survey of MAC based QoS implementations for WiMAX networks  

Science Conference Proceedings (OSTI)

We present a comprehensive survey of proposed Quality of Service (QoS) mechanisms in the Media Access Control (MAC) sublayer of WiMAX based wireless networks. QoS support in WiMAX is a fundamental design requirement, and is considerably more difficult ... Keywords: MAC, Media Access Control, QoS, Quality of Service, WiMAX, Wireless networks

Y. Ahmet ?ekercio?lu; Milosh Ivanovich; Alper Ye?in



QoS differentiation for IEEE 802.16 WiMAX mesh networking  

Science Conference Proceedings (OSTI)

Recently IEEE 802.16 WiMAX has attracted a lot of attention in wireless networking research and applications. To enable a flexible and cost-effective deployment, mesh networking mode is defined in WiMAX standard. In this paper, we introduce a system ... Keywords: IEEE 802.16, QoS, WiMAX mesh, interference-aware design, scheduling

Yan Zhang; Honglin Hu; Hsiao-Hwa Chen



A joint centralized scheduling and channel assignment scheme in WiMax mesh networks  

Science Conference Proceedings (OSTI)

The IEEE 802.16 standard, also known as Worldwide Interoperability for Microwave Access (WiMax), which provides a mechanism for deploying high-speed wireless mesh networks in metropolitan areas. Thus, Quality of Service (QoS) is very important for WiMax ... Keywords: MDFS algorithm, WiMax mesh networks, centralized scheduling, channel assignment

Yuliang Tang; Yan Yao; Xinrong Lin




NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...

Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Wireless wakeups revisited: energy management for voip over wi-fi smartphones  

Science Conference Proceedings (OSTI)

IP based telephony is rapidly gaining acceptance over traditional means of voice communication. Wireless LANs are also becoming ubiquitous due to their inherent ease of deployment and decreasing costs. In enterpriseWi-Fi environments, VoIP is a compelling ... Keywords: VoIP, Wi-Fi, cellular networks, power management, smartphones

Yuvraj Agarwal; Ranveer Chandra; Alec Wolman; Paramvir Bahl; Kevin Chin; Rajesh Gupta



Citywide mobile internet access using dense urban WiFi coverage  

Science Conference Proceedings (OSTI)

We investigate if it is feasible to use the WiFi coverage in urban areas for mobile Internet access and which type of applications can benefit from the Internet access provided by the already deployed WiFi Access Points (APs). Nowadays, most smartphones ... Keywords: mobile clients, mobile internet access, wifi, wireless networks

Maria Eugenia Berezin; Franck Rousseau; Andrzej Duda



WiMAX Double Movable Boundary Scheme in the Vehicle to Infrastructure Communication Scenario  

Science Conference Proceedings (OSTI)

WiMAX is an interesting technology that will be applied in vehicular networks due to the provisioning of high mobility, wide coverage, and different classes of service. In this paper, we investigate the problem of vehicular applications mapping in the ... Keywords: Intelligent Transportation System, Quality of service, Scheduling, WiMAX

Rola Naja; Melhem El Helou; Samir Tohm



Beyond deployments and testbeds: experiences with public usage on vehicular WiFi hotspots  

Science Conference Proceedings (OSTI)

We describe our experiences with deploying a vehicular Internet access service on public transit buses. Our system, called WiRover, has been running on these buses since April 2010 for about 18 months till date providing a WiFi hotspot to which bus passengers ... Keywords: network diversity, vehicular connectivity, wireless, wirover

Joshua Hare; Lance Hartung; Suman Banerjee



Applications of WiMAX-based wireless mesh network in monitoring wind farms  

Science Conference Proceedings (OSTI)

This paper has studied the feasibility of applying World Interoperability for Microwave Access (WiMAX) based Wireless Mesh Networks (WMNs) in monitoring wind farms. WMNs provide a dynamic topology which meets the requirements of communications ... Keywords: WMNs, WiMAX, World Interoperability for Microwave Access, communications, renewable energy, simulation, wind energy, wind farm monitoring, wind farms, wind power, wireless mesh networks, wireless networks

Gang Zheng; Hongbing Xu; Xinheng Wang; Jianxiao Zou



Blue-Fi: enhancing Wi-Fi performance using bluetooth signals  

Science Conference Proceedings (OSTI)

Mobile devices are increasingly equipped with multiple network interfaces with complementary characteristics. In particular, the Wi-Fi interface has high throughput and transfer power efficiency, but its idle power consumption is prohibitive. In this ... Keywords: bluetooth, context-awareness, energy-efficiency, location, mobile device, wi-fi

Ganesh Ananthanarayanan; Ion Stoica



Fast-converging scheduling and routing algorithms for WiMAX mesh networks  

Science Conference Proceedings (OSTI)

In this paper, we present fast converging algorithms that fit well WiMAX mesh networks. First, a centralized scheduling algorithm is presented. It calculates schedules by transforming the multi-hop tree into a single hop, and then repartitioning the ... Keywords: WiMAX, mesh networks, routing, scheduling

Salim Nahle; Naceur Malouch



Energy Management for the "WiFi of Things"  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Management for the "WiFi of Things" Energy Management for the "WiFi of Things" Speaker(s): Janet Peterson Date: May 6, 2010 - 12:00pm Location: 90-3122 This seminar will present an overview of the WiFi enabled energy management technologies pioneered by Our Home Spaces. Our Home Spaces provides consumer facing energy management solutions. These energy management solutions are based on using the existing consumer infrastructure and devices - this allows a lower cost of entry for both the utilities and less complexity in the home. Working with low cost low power WiFi chips from GainSpan and Marvell allow WiFi solutions to range from communicating thermostat, to energy monitoring and controlling smart plugs thru irrigation controllers. The system takes advantage of ubiquitous nature


A-GPS Assisted Wi-Fi Access Point Discovery on Mobile Devices for Energy Saving  

E-Print Network (OSTI)

Mobile devices have been shipped with multiple wireless network interfaces in order to meet their diverse communication and networking demands. In this paper, we propose an A-GPS assisted scheme that discovers the nearest Wi-Fi network access points (APs) by using user's location information. This allows the user to switch to the Wi-Fi interface in an intelligent manner when she/he arrives at the nearest Wi-Fi network AP. Therefore, it avoids the long periods in idle state and greatly reduces the number of unnecessary Wi-Fi scans on the mobile device. The experimental results demonstrate that our scheme effectively saves energy for mobile devices integrated with Wi-Fi and cellular interfaces.

Xia, Feng; Ding, Fangwei; Hao, Ruonan



MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



Super Wi-Fi is Super for Energy Too | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Super Wi-Fi is Super for Energy Too Super Wi-Fi is Super for Energy Too Super Wi-Fi is Super for Energy Too September 24, 2010 - 11:45am Addthis Super Wi-Fi is Super for Energy Too Nick Sinai Senior Advisor to the U.S. Chief Technology Officer, White House Office of Science and Technology Policy What does this mean for me? By integrating broadband into the emerging Smart Grid, consumers will have revolutionized communication with their utility -- they will have detailed information on their energy use that will help inform them how they can save on their electric bills. Editor's Note: Cross-posted from the National Broadband Plan blog, which deals with how broadband technology will integrate into the smart grid. We at the FCC are very excited about yesterday's order to free up the unused "white spaces" spectrum between television channels, intended to


Identified Patent Waiver W(I)2012-003 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3 Identified Patent Waiver W(I)2012-003 This document waives certain patent rights the Department of Energy (DOE) has to inventions conceived or first actually reduced to practice...


Identified Patent Waiver W(I)2012-004 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

4 Identified Patent Waiver W(I)2012-004 This document waives certain patent rights the Department of Energy (DOE) has to inventions conceived or first actually reduced to practice...


Identified Patent Waiver W(I)2012-005 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5 Identified Patent Waiver W(I)2012-005 This document waives certain patent rights the Department of Energy (DOE) has to inventions conceived or first actually reduced to practice...


Using unlabeled Wi-Fi scan data to discover occupancy patterns of private households  

Science Conference Proceedings (OSTI)

This poster presents the homeset algorithm, a lightweight approach to estimate occupancy schedules of private households. The algorithm relies on the mobile phones of households' occupants to collect Wi-Fi scans. The scans are then used to determine ...

Wilhelm Kleiminger, Christian Beckel, Anind Dey, Silvia Santini



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png

Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


FI St Po Crypto IPS 140 tanley ortal Ga ograph 0-2 Sec Wi-Q ...  

Science Conference Proceedings (OSTI)

... Q Portal Gat ey Wi-Q Port a wireless ga Wi-Q Comm ry 802.15.4 on tested: 3. on tested: 12 tion ... he s the nts. Page 11. ... The PG d lf Test ower-Up ...



A Silence Duration Based Uplink Scheduling Algorithm for Multiple VoIP Users in M-WiMAX  

Science Conference Proceedings (OSTI)

This paper proposes an efficient uplink scheduling algorithm that can perfectly support various VoIP CODECs with VAD/DTX/CNG in M-WiMAX considering the variants of silence duration between different voice users, solving the problems of uplink resources ... Keywords: G.729B, VAD/DTX/CNG, VoIP CODECs, WiMAX, ertPS, scheduling algorithm

Farouk Y. M. Alkadhi; Zheng Liu; Min Yang; Qiuhong Wang; Jufeng Dai



Quick GuideWindows 7 Wi-Fi set up POSTECH Wireless Network Connection Setup Guide for Windows 7  

E-Print Network (OSTI)

Quick GuideWindows 7 Wi-Fi set up POSTECH Wireless Network Connection Setup Guide for Windows 7 1 the box is unchecked. #12;Quick GuideWindows 7 Wi-Fi set up 7. Successfully added postech -> Change Connection Setup Guide for Windows 7 Make sure this box is unchecked. #12;

Kim, Yong Jung


A study on the security, the performance and the penetration of Wi-Fi networks in a Greek urban area  

Science Conference Proceedings (OSTI)

This paper presents a study on the expansion of urbanWi-Fi networks and the degree of users' awareness about their characteristics. It involves an experiment contacted at the area of Serres, a Greek city of around 70,000 inhabitants. The findings revealed ... Keywords: Wi-Fi networks usage, urban networks, war driving, wireless security

Savvas Mousionis; Alex Vakaloudis; Constantinos Hilas



A cross-layer framework for video-on-demand service in multi-hop WiMax mesh networks  

Science Conference Proceedings (OSTI)

In this work, we introduce a cross-layer framework to favor the video-on-demand service in multi-hop WiMax mesh networks. We first propose a joint solution of admission control and channel scheduling for video streams. The proposed approach guarantees ... Keywords: Cross-layer design, Simulation, Video-on-demand, WiMax, Wireless mesh network

Fei Xie; Kien A. Hua; Ning Jiang



Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


Experiences, challenges and lessons from rolling out a rural WiFi mesh network  

Science Conference Proceedings (OSTI)

The computing for development community knows that technology interventions involve consideration of social, technical and environmental factors. Research into WiFi solutions has fallen off as ubiquitous mobile solutions penetrate even the deepest rural ... Keywords: VoIP, baseline study, community co-design, inverse infrastructure, participatory and ethnographic methods, telecommunications

Carlos Rey-Moreno; Zukile Roro; William D. Tucker; Masbulele Jay Siya; Nicola J. Bidwell; Javier Simo-Reigadas




E-Print Network (OSTI)

36 SEPTEMBER | 2012 WiNd TURbiNE CAPACiTY FRONTiER FROM SCAdA ThE WORld hAS SEEN A significant contributor to this growth. The wind turbine generated energy depends on the wind potential and the turbine of wind turbines. Supervi- sory control and data acquisition (SCADA) systems record wind turbine

Kusiak, Andrew


Improvement security for RuBee radio-WiMAX mesh networks  

Science Conference Proceedings (OSTI)

Next generation communication standard integrate various access networks technology to become mesh networks. One of air interface standard is metropolitan area wireless broadband service. IEEE 802.16 is the basis for Worldwide Interoperability for Microwave ... Keywords: AAA, RuBee (IEEE 1902.1), WiMAX, gateway access point, group identity key

Tin-Yu Wu; Jhong-Ci Wu; Wei-Fang Weng



Wi-Fi/ZigBee coexistence for fault-tolerant building automation system  

Science Conference Proceedings (OSTI)

The paper presents a case study where a building automation system is investigated using two wireless standards, ZigBee and Wi-Fi 802.11b. Since each standard has specific features and advantages, a network incorporating both manifests itself as an optimal ...

Tarek K. Refaat, Mohamed A. Saleh, Ramz M. Daoud, Hassanein H. Amer, Magdy S. El-Soudani, Magdi S. Moustafa



An experimental performance comparison of 3G and Wi-Fi  

Science Conference Proceedings (OSTI)

Mobile Internet users have two options for connectivity: pay premium fees to utilize 3G or wander around looking for open Wi-Fi access points. We perform an experimental evaluation of the amount of data that can be pushed to and pulled from the Internet ...

Richard Gass; Christophe Diot



Perspectives on quality of experience for video streaming over WiMAX  

Science Conference Proceedings (OSTI)

The advent of broadband wireless networks, such as WiMAX, is paving the way for the widespread deployment of high-bandwidth video streaming services for mobile users. To provide acceptable end-to-end performance in such a network, it is important to ...

Arun Vishwanath; Partha Dutta; Malolan Chetlu; Parul Gupta; Shivkumar Kalyanaraman; Amitabha Ghosh



WiMAX-RBDS-Sim: an OPNET simulation framework for IEEE 802.16 mesh networks  

Science Conference Proceedings (OSTI)

In this paper, a simulation model for IEEE 802.16 (WiMAX) wireless mesh networks with distributed scheduling is developed. It provides a framework for the evaluation of reservation-based distributed scheduling (RBDS) policies at the medium access control ... Keywords: IEEE 802.16, OPNET, distributed scheduling, simulation, wireless mesh networks

Gustavo Vejarano; Janise McNair



St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012" Coal Consumers in the Manufacturing and Coke Sectors, 2012" "Company Name","Plant Location" "Top Ten Manufacturers" "American Crystal Sugar Co","MN, ND" "Archer Daniels Midland","IA, IL, MN, ND, NE" "Carmeuse Lime Stone Inc","AL, IL, IN, KY, MI, OH, PA, TN, VA, WI" "Cemex Inc","AL, CA, CO, FL, GA, KY, OH, TN, TX" "Dakota Gasification Company","ND" "Eastman Chemical Company","TN" "Georgia-Pacific LLC","AL, GA, OK, VA, WI" "Holcim (US) Inc","AL, CO, MD, MO, MT, OK, SC, TX, UT" "NewPage Corporation","MD, MI, WI" "U S Steel Corporation","AL, IN, MI, MN"


U.S. Energy Information Administration | Annual Coal Report 2012  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012 Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Table 25. Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Company Name Plant Location Top Ten Manufacturers American Crystal Sugar Co MN, ND Archer Daniels Midland IA, IL, MN, ND, NE Carmeuse Lime Stone Inc AL, IL, IN, KY, MI, OH, PA, TN, VA, WI Cemex Inc AL, CA, CO, FL, GA, KY, OH, TN, TX Dakota Gasification Company ND Eastman Chemical Company TN Georgia-Pacific LLC AL, GA, OK, VA, WI Holcim (US) Inc AL, CO, MD, MO, MT, OK, SC, TX, UT NewPage Corporation MD, MI, WI U S Steel Corporation AL, IN, MI, MN Other Major Manufacturers Ash Grove Cement Co


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.


Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


File:USDA-CE-Production-GIFmaps-WI.pdf | Open Energy Information  

Open Energy Info (EERE)

WI.pdf WI.pdf Jump to: navigation, search File File history File usage Wisconsin Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 326 KB, MIME type: application/pdf) Description Wisconsin Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Wisconsin External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:22, 27 December 2010 Thumbnail for version as of 16:22, 27 December 2010 1,650 × 1,275 (326 KB) MapBot (Talk | contribs) Automated bot upload


Multi-channel transmission with efficient delivery of routing information in maritime WiMAX mesh networks  

Science Conference Proceedings (OSTI)

There is a lack of broadband wireless network in sea to meet the increasing needs of modern maritime users and we have envisaged WiMAX mesh networks for high-speed and low-cost ship-to-ship/shore communications. In such a maritime WiMAX mesh network, ... Keywords: IEEE Std 802.16-2004, broadband wireless access, maritime communications, mesh network, multi-channel transmission

Ming-Tuo Zhou; Hiroshi Harada; Peng-Yong Kong; Chee-Wei Ang; Yu Ge; J. S. Pathmasuntharam



DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


Mn deposition on Ni{sub 2}MnGa(100)  

Science Conference Proceedings (OSTI)

We report the study of Mn adlayers on a Mn deficient Ni{sub 2}MnGa(100) surface by using low energy electron diffraction (LEED). The spot profile analysis indicates that after 0.2 monolayer (ML) deposition, the LEED spots become very sharp. This pattern indicates the removal of Mn vacancies formed on the surface due to Mn deficiency. But with further growth of Mn layers on this surface, the LEED spots become broad.

Nayak, J.; Rai, Abhishek; D'Souza, S. W.; Maniraj, M.; Barman, S. R. [UGC-DAE Consortium for Scientific Research, Khandwa Road, Indore, 452001, M.P. (India)



Category:Minneapolis, MN | Open Energy Information  

Open Energy Info (EERE)

MN MN Jump to: navigation, search Go Back to PV Economics By Location Media in category "Minneapolis, MN" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Minneapolis MN Northern States Power Co (Minnesota) Excel Energy.png SVFullServiceRestauran... 89 KB SVHospital Minneapolis MN Northern States Power Co (Minnesota) Excel Energy.png SVHospital Minneapolis... 85 KB SVLargeHotel Minneapolis MN Northern States Power Co (Minnesota) Excel Energy.png SVLargeHotel Minneapol... 85 KB SVLargeOffice Minneapolis MN Northern States Power Co (Minnesota) Excel Energy.png SVLargeOffice Minneapo... 82 KB SVMediumOffice Minneapolis MN Northern States Power Co (Minnesota) Excel Energy.png SVMediumOffice Minneap... 83 KB SVMidriseApartment Minneapolis MN Northern States Power Co (Minnesota) Excel Energy.png


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



The University of Texas at Austin July 11, 2012 Data Communications Wi-Fi Access Points 27 21 33-1  

E-Print Network (OSTI)

The University of Texas at Austin July 11, 2012 Data Communications Wi-Fi Access Points 27 21 33 of WAPs Up to 125 1 WAP / 25 people #12;The University of Texas at Austin July 11, 2012 Data of Texas at Austin July 11, 2012 Data Communications Wi-Fi Access Points 27 21 33-3 5. Distance limitation

Texas at Austin, University of


Human activity recognition in indoor environments by means of fusing information extracted from intensity of WiFi signal and accelerations  

Science Conference Proceedings (OSTI)

In this work, we propose an activity recognition system based on the use of a topology-based WiFi localization system combined with accelerometers for body posture recognition. The WiFi localization system is developed using a fuzzy rule-based classifier ... Keywords: Fuzzy logic, Human activity recognition, Interpretability-accuracy trade-off

Alberto Alvarez-Alvarez; Jose M. Alonso; Gracian Trivino



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Radiometric and Engineering Performance of the SeaWiFS Quality Monitor (SQM): A Portable Light Source for Field Radiometers  

Science Conference Proceedings (OSTI)

A portable and stable source of radiant flux, the Sea-viewing Wide Field-of-view Sensor (SeaWiFS) Quality Monitor (SQM), was developed as a field instrument for use in experiments away from the calibration laboratory such as those encountered ...

B. Carol Johnson; Ping-Shine Shaw; Stanford B. Hooker; Don Lynch


Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2012 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT...



Gasoline and Diesel Fuel Update (EIA)




Gasoline and Diesel Fuel Update (EIA)




Annual Energy Outlook 2012 (EIA)



U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)



Microsoft Word - Mn.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

5 5 Structural Determination of Marine Bacteriogenic Manganese Oxides John R. Bargar, Samuel M. Webb (Stanford Synchrotron Radiation Laboratory), and Bradley M. Tebo (Oregon Health and Science University) Bacterial oxidation of Mn(II) impacts the global geochemical cycling of carbon, nitrogen, sulfur, nutrients, and contaminants in the environment. Manganese is abundant in the biosphere (~10 14 Kg of suspended and dissolved manganese in the oceans) and is second only to iron in relative terrestrial abun- dance of transition metals. Manganese is an important nutrient in the marine water column and is fundamentally required for photosynthesis. The acquisition of manganese by organisms and the biogeochemistry of manganese in the oceans is therefore an


DOE - Office of Legacy Management -- Elk River Reactor - MN 01  

Office of Legacy Management (LM)

Elk River Reactor - MN 01 FUSRAP Considered Sites Site: Elk River Reactor (MN.01 ) Eliminated from consideration under FUSRAP - Reactor was dismantled and decommissioned by 1974...


Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



EIA Sh tEIA Short-T d Wi t F l O tl kTerm and Winter Fuels Outlook  

U.S. Energy Information Administration (EIA)

EIA Sh tEIA Short-T d Wi t F l O tl kTerm and Winter Fuels Outlook for Winter Fuels Outlook Conference National Association of State Energy Officials (NASEO)


Window nighttime U-values: A comparison between computer calculations and MoWiTT measurements  

SciTech Connect

The proper specification of window U-values has been a controversial area for many years, and current attempts to incorporate more careful treatment of windows into building standards and utility conservation programs and to define window energy labels has heightened the controversy. In a previous paper (Klems 1979) it was argued that current calculation techniques, as embodied in the computer program WINDOW, accurately represented field-measured window U-values, provided frame corrections and surface heat transfer coefficients were correctly estimated, and that in most cases the calculations were also consistent with test laboratory measurements on the same windows. This means that the calculation could serve both as a standard for deriving calculated U-values and as a method of comparing measurements made under different conditions to determine their consistency. This work has now been extended to form a joint US/Canadian collaborative effort to test current computer programs. For six windows the U-values measured with the MoWiTT under field conditions are compared with detailed U-value calculations for the same conditions using the programs WINDOW and ANSYS. There is good agreement between measurements and calculations. 7 refs., 3 figs., 4 tabs.

Klems, J.H.; Reilly, S.




Science Conference Proceedings (OSTI)

Residual impurities in manganese (Mn) are a big obstacle to obtaining high-performance CdMnTe (CMT) X-ray and gamma-ray detectors. Generally, the zone-refining method is an effective way to improve the material's purity. In this work, we purified the MnTe compounds combining the zone-refining method with molten Te, which has a very high solubility for most impurities. We confirmed the improved purity of the material by glow-discharge mass spectrometry (GDMS). We also found that CMT crystals from a multiply-refined MnTe source, grown by the vertical Bridgman method, yielded better performing detectors.

Kim, K.H.; Bolotnikov, A.E.; Camarda, G.S.; Tappero, R.; Hossain, A.; Cui, Y.; Yang, G.; Gul, R.; and James, R.B.



OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


Solid Solution Phases in Olivine-Type LiMnPO4/MnP4System  

NLE Websites -- All DOE Office Websites (Extended Search)

Solid Solution Phases in Olivine-Type LiMnPO4MnP4System Title Solid Solution Phases in Olivine-Type LiMnPO4MnP4System Publication Type Journal Article Year of Publication 2009...


MN Office of Energy Security | Open Energy Information  

Open Energy Info (EERE)

MN Office of Energy Security MN Office of Energy Security Jump to: navigation, search Name MN Office of Energy Security Place St. Paul, MN Website http://www.mnofficeofenergysec References MN Office of Energy Security[1] Information About Partnership with NREL Partnership with NREL Yes Partnership Type Test & Evaluation Partner Partnering Center within NREL Electricity Resources & Building Systems Integration LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! MN Office of Energy Security is a company located in St. Paul, MN. References ↑ "MN Office of Energy Security" Retrieved from "http://en.openei.org/w/index.php?title=MN_Office_of_Energy_Security&oldid=379158" Categories: Clean Energy Organizations Companies Organizations


Composition-structure-property-performance relationship inMn-substituted LiMn2O4  

DOE Green Energy (OSTI)

The spinel LiMn{sub 2}O{sub 4} has been extensively studied as a positive electrode active material in lithium rechargeable batteries. Partial substitution of Mn by another metal has also been the subject of recent study in an effort to improve the cycling performance. In general, the literature has shown that Mn substitution results in improved cycling stability at the expense of capacity (1,2). Resistance to the formation of tetragonal phase upon lithiation of the starting spinel (via a higher nominal Mn oxidation state in the substituted spinel) has been suggested as a mechanism for the improved performance. The degree of substitution is an important factor to optimize in order to minimize capacity loss and costs. The spectroscopic investigations on LiMn{sub 2}O{sub 4} described in the previous paper (LixMn2O4) confirmed that the cooperative Jahn-Teller effect (CJTE) from the [Mn{sup 3+}O{sub 6}] octahedra is the mechanism for the cubic to tetragonal phase transformation. The driving force for the CJTE is based upon the electronic structure, therefore changes in electronic structure should lead to changes in the phase behavior. The fact that the LiMn{sub 1.5}Ni{sub 0.5}O{sub 4} does not form tetragonal phase upon discharging (FUJI3, MUCK?), unlike the 100% Mn{sup 4+} spinel Li{sub 4}Mn{sub 5}O{sub 12} (THAC5), led to the hypothesis that an increased degree of covalency as a source for the behavior. An increased covalence would remove the driving force for the transformation, the increased electronic stability achieved in tetragonally-distorted [Mn{sup 3+}O{sub 6}] octahedra, due to a change in electron density and widening of the Mn 3d bands. The STH field is dependent upon the amount of unpaired spin density transferred between the magnetic (transition-metal) and diamagnetic ions through an intermittent oxygen ion, attributable to overlap and electron transfer effects. Therefore, the magnitude of the STH coupling constant reflects the degree of covalency (GESC, HUAN). In the case of LiMn{sub 2-y}Me{sub y}O{sub 4}, the STH coupling constant characterizes the amount of unpaired spin density transferred to the Li{sup +} from the Mn, Co, or Ni. Similarly, the La/Lb ratio of the Mn L-XES is sensitive to the amount of electron density at the Mn site as a higher ratio indicates that the Mn 3d{sub 5/2} level is more populated (GRUS1). An investigation into the effects of Mn-substitution on the electronic structure along with the ramifications to the phase behavior upon changing lithium content was carried out. To accomplish this, a set of LiMn{sub 2-y}Me{sub y}O{sub 4} with Me = Li, Co, or Ni over a range of y were synthesized, characterized, and subjected to changes in lithium content by various techniques.

Horne, Craig R.; Richardson, Thomas J.; Gee, B.; Tucker, Mike; Grush, Melissa M.; Bergmann, Uwe; Striebel, Kathryn A.; Cramer, StephenP.; Reimer, Jeffrey A.; Cairns, Elton J.



Category:International Falls, MN | Open Energy Information  

Open Energy Info (EERE)

MN MN Jump to: navigation, search Go Back to PV Economics By Location Media in category "International Falls, MN" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant International Falls MN Northern States Power Co (Minnesota) Excel Energy.png SVFullServiceRestauran... 88 KB SVHospital International Falls MN Northern States Power Co (Minnesota) Excel Energy.png SVHospital Internation... 84 KB SVLargeHotel International Falls MN Northern States Power Co (Minnesota) Excel Energy.png SVLargeHotel Internati... 85 KB SVLargeOffice International Falls MN Northern States Power Co (Minnesota) Excel Energy.png SVLargeOffice Internat... 83 KB SVMediumOffice International Falls MN Northern States Power Co (Minnesota) Excel Energy.png


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....

Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


Magnetoelastic Coupling in NiMnGa Ferromagnetic Shape ...  

Science Conference Proceedings (OSTI)

... Magnetoelastic Coupling in NiMnGa Ferromagnetic Shape Memory Alloys. Peng Zhao (Dept. of Materials Science and ...


First Principles Calculation for Magnetic Properties of Mn Alloys  

Science Conference Proceedings (OSTI)

The results indicate that the ? of MnAl and MnAlGe are extremely small because of ... Alloy Design and Powder Processing of Mn-Al Based Materials for Rare Earth ... Device Arrays Using Self-limiting Low-energy Glow-discharge Processing.


Electrochemical Performances of LiMnPO4 Synthesized from Non-Stoichiometric Li/Mn Ratio  

Science Conference Proceedings (OSTI)

In this paper we report the influences of the initial lithium content on the structural, electrochemical and magnetic properties of nonstoichiometric LixMnPO4 (0.5?x?1.2) nano-particles. It has been revealed Mn2P2O7 is the main impurity when Li1.0. The different functions of Mn2P2O7 and Li3PO4 impurities in the non-stoichiometric compounds have been investigated systematically. At a slow rate of C/50 the reversible capacity of both Li0.5MnPO4 and Li0.8MnPO4 increases with cycling indicating a gradual activation of more sites to accommodate a reversible diffusion of Li+ ions which may be related to the interaction between Mn2P2O7 and LiMnPO4 nanoparticles. Among all the different compositions, Li1.1MnPO4 exhibits the most stable cycling ability probably due to the existence of a trace amount of Li3PO4 impurity which functions as a solid state electrolyte on the surface. The magnetic properties and X-ray absorption spectroscopy (XAS) of MnPO4?H2O precursor, pure and carbon coated LiMnPO4 and all the other non-stoichiometric LixMnPO4 are also investigated to identify the key steps to prepare a high performance LiMnPO4.

Xiao, Jie; Chernova, Natalya; Upreti, Shailesh; Chen, Xilin; Li, Zheng; Deng, Zhiqun; Choi, Daiwon; Xu, Wu; Nie, Zimin; Graff, Gordon L.; Liu, Jun; Whittingham, M. S.; Zhang, Jiguang



miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



Low-temperature magnetization of (Ga,Mn) As semiconductors  

E-Print Network (OSTI)

We report on a comprehensive study of the ferromagnetic moment per Mn atom in (Ga,Mn)As ferromagnetic semiconductors. Theoretical discussion is based on microscopic calculations and on an effective model of Mn local moments antiferromagnetically coupled to valence band hole spins. The validity of the effective model over the range of doping studied is assessed by comparing with microscopic tight-binding/coherent-potential approximation calculations. Using the virtual crystal k center dot p model for hole states, we evaluate the zero-temperature mean-field contributions to the magnetization from the hole kinetic and exchange energies, and magnetization suppression due to quantum fluctuations of Mn moment orientations around their mean-field ground state values. Experimental low-temperature ferromagnetic moments per Mn are obtained by superconducting quantum interference device and x-ray magnetic circular dichroism measurements in a series of (Ga,Mn)As semiconductors with nominal Mn doping ranging from similar to 2 to 8%. Hall measurements in as-grown and annealed samples are used to estimate the number of uncompensated substitutional Mn moments. Based on our comparison between experiment and theory we conclude that all these Mn moments in high quality (Ga,Mn)As materials have nearly parallel ground state alignment.

Jungwirth, T.; Masek, J.; Wang, KY; Edmonds, KW; Sawicki, M.; Polini, M.; Sinova, Jairo; MacDonald, AH; Campion, RP; Zhao, LX; Farley, NRS; Johal, TK; van der Laan, G.; Foxon, CT; Gallagher, BL.



Electrochemical Performance of LiFeMnPO4  

Science Conference Proceedings (OSTI)

Symposium, Energy Storage: Materials, Systems, and Applications. Presentation Title, Electrochemical Performance of LiFeMnPO4: A Comparison of Synthesis...


,"Warroad, MN Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Warroad, MN Natural Gas Pipeline Exports to Canada (Million Cubic Feet)",1,"Annual",2003 ,"Release Date:","172014"...


,"Warroad, MN Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Warroad, MN Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"International Falls, MN Natural Gas Pipeline Imports From Canada...  

U.S. Energy Information Administration (EIA) Indexed Site

International Falls, MN Natural Gas Pipeline Imports From Canada (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of...


,"Noyes, MN Natural Gas Pipeline Imports From Canada (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Noyes, MN Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Microstructural Characterization of Fe-Mn-C Ternary Alloy under ...  

Science Conference Proceedings (OSTI)

Mercury Oxidation and Capture over SCR Catalysts in Simulated Coal Combustion Flue Gas Microstructural Characterization of Fe-Mn-C Ternary Alloy under...


Characterization of Mn-Co Electrodeposition for SOFC Interconnect ...  

Science Conference Proceedings (OSTI)

Presentation Title, Characterization of Mn-Co Electrodeposition for SOFC Interconnect Applications by QCM. Author(s), Junwei Wu, Ayyakkannu Manivannan,...


Electrodeposited Mn-Co Alloy Coating For SOFC Interconnects  

Science Conference Proceedings (OSTI)

Presentation Title, Electrodeposited Mn-Co Alloy Coating For SOFC Interconnects. Author(s), Heather McCrabb, Tim Hall, Junwei Wu, Hui Zhang, Xingbo Liu,...


Microstructure and Coercivity of Nitrided Mn-Sn Based Alloy  

Science Conference Proceedings (OSTI)

Alloy Design and Powder Processing of Mn-Al Based Materials for Rare Earth ... Enhancement of the Refrigerant Capacity in Partially Crystallized Gd-Fe-Al-B...


Microsoft Word - figure_8.doc  

Gasoline and Diesel Fuel Update (EIA)



Ni(II) Sorption on Biogenic Mn-Oxides with Varying Mn  

E-Print Network (OSTI)

Lightsource (SSRL), Menlo Park, CA. EXAFS spectra from Ni(II) organic standards were collected in transmission-3 at SSRL. This method is described in detail in Zhu et al. (6). Results Sorption Isotherms and Dissolved Mn,anationaluserfacilityoperatedbyStanfordUniversity on behalf of the U.S. Department of Energy, Office of Basic Energy Sciences. The SSRL Structural Molecular

Sparks, Donald L.


Cross-layer modeling of capacity in wireless networks: Application to UMTS/HSDPA, IEEE802.11 WLAN and IEEE802.16 WiMAX  

Science Conference Proceedings (OSTI)

We investigate in this work the cross-layer modeling of the capacity of wireless systems in the presence of two types of flows: streaming and elastic, under a dynamic configuration wherein users join the system and leave it after a finite duration. For ... Keywords: Capacity, Cross-layer design, Flow level, IEEE802.11 WLAN, IEEE802.16 WiMAX, Integrated services, MAC scheduling, UMTS/HSDPA

Mariana Dirani; Chadi Tarhini; Tijani Chahed



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.

Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)



High-Resolution Structure of the Photosynthetic Mn4Ca Catalyst from X-ray Spectroscopy  

E-Print Network (OSTI)

the Photosynthetic Mn 4 Ca Catalyst from X-ray Spectroscopystructure of the Mn 4 Ca catalyst at high-resolution whichthe structure of Mn 4 Ca catalyst as it cycles through the

Yano, Junko



MN471018, Work Planning and Control Manual  

NLE Websites -- All DOE Office Websites (Extended Search)

18, Work Planning and Control Manual 18, Work Planning and Control Manual Sponsor: Michael W. Hazen, 4000 Issue Date: January 3, 2007 Revision Date: June 1, 2009 This document is no longer a CPR. This document implements the requirements of Corporate procedure ESH100.1.WPC.1, Plan and Control Work. IMPORTANT NOTICE: A printed copy of this document may not be the document currently in effect. The official version is the online version located on the Sandia Restricted Network (SRN) MN471018 - WORK PLANNING AND CONTROL MANUAL Subject Matter Expert: Brad Elkin; CA Counterpart: Aden Jackson MN471018 Revision Date: June 1, 2009; Replaces Document: October 28, 2008 Implementation Notice: The requirements outlined in this document must be incorporated into approved comprehensive organizational procedures on or before June 30, 2009. New work planned and conducted after June 30, 2009 shall be performed in accordance with this document. Ongoing work, conducted under an existing, current, and approved PHS and TWD (if required), is authorized until the expiration of the applicable PHS, TWD, or June 30, 2010.


Electronic structure and magnetism in BaMn2As2 and BaMn2Sb2  

Science Conference Proceedings (OSTI)

We study the properties of ThCr{sub 2}Si{sub 2} structure BaMn{sub 2}As{sub 2} and BaMn{sub 2}Sb{sub 2} using density functional calculations of the electronic and magnetic properties as well as experimental measurements on single crystal samples of BaMn{sub 2}As{sub 2}. These materials are local moment magnets with moderate band gap antiferromagnetic semiconducting ground states. The electronic structures show substantial Mn-pnictogen hybridization, which stabilizes an intermediate spin configuration for the nominally d{sup 5} Mn. The results are discussed in the context of possible thermoelectric applications and the relationship with the corresponding iron/cobalt/nickel compounds Ba(Fe,Co,Ni){sub 2}As{sub 2}.

An, Jiming [ORNL; Safa-Sefat, Athena [ORNL; Singh, David J [ORNL; Du, Mao-Hua [ORNL



Study of intergranular embrittlement in Fe-12Mn alloys  

Science Conference Proceedings (OSTI)

A high resolution scanning Auger microscopic study has been performed on the intergranular fracture surfaces of Fe-12Mn steels in the as-austenitized condition. Fracture mode below the ductile-brittle transition temperature was intergranular whenever the alloy was quenched from the austenite field. The intergranular fracture surface failed to reveal any consistent segregation of P, S, As, O, or N. The occasional appearance of S or O on the fracture surface was found to be due to a low density precipitation of MnS and MnO/sub 2/ along the prior austenite boundaries. An AES study with Ar/sup +/ ion-sputtering showed no evidence of manganese enrichment along the prior austenite boundaries, but a slight segregation of carbon which does not appear to be implicated in the tendency toward intergranular fracture. Addition of 0.002% B with a 1000/sup 0/C/1h/WQ treatment yielded a high Charpy impact energy at liquid nitrogen temperature, preventing the intergranular fracture. High resolution AES studies showed that 3 at. % B on the prior austenite grain boundaries is most effective in increasing the grain boundary cohesive strength in an Fe-12Mn alloy. Trace additions of Mg, Zr, or V had negligible effects on the intergranular embrittlement. A 450/sup 0/C temper of the boron-modified alloys was found to cause tempered martensite embrittlement, leading to intergranular fracture. The embrittling treatment of the Fe-12Mn alloys with and without boron additions raised the ductile-brittle transition by 150/sup 0/C. This tempered martensite embrittlement was found to be due to the Mn enrichment of the fracture surface to 32 at. % Mn in the boron-modified alloy and 38 at. % Mn in the unmodified alloy. The Mn-enriched region along the prior austenite grain boundaries upon further tempering is believed to cause nucleation of austenite and to change the chemistry of the intergranular fracture surfaces. 61 figures.

Lee, H.J.



File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



The Role of Manganese Dioxide (MnO2) Deposition in Microbiologically Influenced Corrosion  

Science Conference Proceedings (OSTI)

This report documents the role of manganese dioxide (MnO2) in microbiologically influenced corrosion.



DOE - Office of Legacy Management -- Twin Cities Ammunition - MN 0-01  

NLE Websites -- All DOE Office Websites (Extended Search)

Twin Cities Ammunition - MN 0-01 Twin Cities Ammunition - MN 0-01 FUSRAP Considered Sites Site: TWIN CITIES AMMUNITION (MN.0-01) Eliminated from further consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: None Location: New Brighton , Minnesota MN.0-01-1 Evaluation Year: 1987 MN.0-01-2 Site Operations: Site was formerly licensed under 10CFR 70 by the NRC. MN.0-01-1 MN.0-01-2 Site Disposition: Eliminated - No Authority - Referred to DOD MN.0-01-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DOD MN.0-01-2 Also see Documents Related to TWIN CITIES AMMUNITION MN.0-01-1 - DOE Letter; Mott to Spence; Listings of Military


Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Effects of Mn Doping on the Dielectric Properties of Nnanostructured ...  

Science Conference Proceedings (OSTI)

In order to further improve the insulation resistance, manganese (Mn) was introduced (0.005 at%-1.0 at%) into the TiO2 system by a powder coating process...


International Falls, MN Natural Gas Pipeline Imports From Canada...  

U.S. Energy Information Administration (EIA) Indexed Site

per Thousand Cubic Feet) International Falls, MN Natural Gas Pipeline Imports From Canada (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5...


International Falls, MN Natural Gas Pipeline Imports From Canada...  

U.S. Energy Information Administration (EIA) Indexed Site

Million Cubic Feet) International Falls, MN Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8...


WI Radiation Protection  

Energy.gov (U.S. Department of Energy (DOE))

This statute seeks to regulate radioactive materials, to encourage the constructive uses of radiation, and to prohibit and prevent exposure to radiation in amounts which are or may be detrimental...


Wi-Fi security  

Science Conference Proceedings (OSTI)

"ALL [wireless security] mechanisms are completely in-effective" was the conclusion of a study by the Department of Computer Science at the University of Maryland. This discussion will systematically shed light on the inherent insecurities involved with ...

Paul Williams




Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration


Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of

Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."


Diluted magnetic semiconductor effects in Mn-implanted silicon carbide  

Science Conference Proceedings (OSTI)

Light transmission and Faraday rotation spectra measured at the temperature of 2 K were compared for silicon carbide single crystals of 4H polytype (4H-SiC), implanted with 3.8 x 10{sup 16} cm{sup -2} of Mn ions at the beam energy of 190 keV, and a control 4H-SiC single crystal sample, which was not implanted. Mn ion implantation led to the creation of a Mn-doped surface layer with the average Mn concentration of 10{sup 21} cm{sup -3} and a thickness of approximately 0.2 {mu}m. Transmission of light through the implanted crystal changed only slightly in comparison with the control sample, which however, corresponded to a relatively strong attenuation in the implanted layer. This was interpreted as a result of scattering, which emerges in the surface layer due to optical nonuniformities, created by the high energy ion irradiation. The presence of a thin Mn-ion-containing surface layer led, despite its small thickness, to noticeable changes in the sample Faraday rotation spectra. The estimated values of the Verdet constant for this layer were about three orders of magnitude larger and of opposite sign compared to the Verdet constant values of the undoped sample. Magnetic field dependencies of the Faraday rotation contribution from the implanted layer were found to be saturating functions, which points to a proportionality of the Faraday rotation to the magnetization of the paramagnetic Mn ion subsystem. Based on these findings we conclude that the Mn-implanted SiC layer exhibits magneto-optical properties typical of a diluted magnetic semiconductor. At the same time, no ferromagnetic ordering was observed in the studied (Si, Mn)C sample.

Komarov, A. V.; Ryabchenko, S. M. [Institute of Physics of the National Academy of Sciences of Ukraine, 46 Nauki Ave., Kiev 03028 (Ukraine); Los, A. V. [ISS Ltd., Semiconductors and Circuits Lab, 15 Bozhenko Street, Kiev 03680 (Ukraine); Freescale Semiconductor Ukraine LLC., 15 Bozhenko Street, Kiev 03680 (Ukraine); Romanenko, S. M. [ISS Ltd., Semiconductors and Circuits Lab, 15 Bozhenko Street, Kiev 03680 (Ukraine)



Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



Studies on a novel secondary battery: MH/MnO{sub 2} rechargeable battery. 2: Characteristics of the MnO{sub 2} cathode  

SciTech Connect

The characteristics of the MnO{sub 2} cathode of a MH/MnO{sub 2} battery have been studied by cyclic voltammetry, x-ray diffraction, and potentiostatic techniques. It was found that the addition of Ni(OH){sub 2} to the MnO{sub 2} can prevent overcharge of the MnO{sub 2} and decrease the imbalance of the charge/discharge states of the positive and negative electrodes, raise the working voltage of the MH/MnO{sub 2} cell, and prevent the formation of Mn{sub 3}O{sub 4}, thereby improving the rechargeability of the MnO{sub 2} electrode. The discharge mechanism is also discussed.

Xia, X.; Guo, Z. [Xinjiang Univ., Urumqi, Xinjiang (China). Dept. of Chemistry



Molecular beam epitaxy growth of exchange-biased PtMn/NiFe bilayers with a spontaneously ordered PtMn layer  

Science Conference Proceedings (OSTI)

We report the direct epitaxial growth of equiatomic ordered antiferromagnetic PtMn layers by molecular beam epitaxy. Such layers are used in giant magnetoresistance spin valve sensors as the antiferromagnetic pinning layer. Structural characterization and phase identification confirmed the spontaneous formation of the chemically ordered face-centered-tetragonal (L1{sub 0}) phase of PtMn with about 87.4% ordering. Based on the antiferromagnetic PtMn layer, we prepared exchange-biased PtMn/NiFe bilayers with various PtMn thicknesses. The exchange anisotropy field of the bilayer with NiFe grown on PtMn stabilizes at about 50 Oe beyond a PtMn thickness of 15 nm. Although the exchange anisotropy field is small compared to that of the polycrystalline system, the antiferromagnetic domain structure is stable over repetitive external magnetic field cycling and no training effect is observed.

Choi, Y. S.; Petford-Long, A. K.; Ward, R. C. C.; Fan, R.; Goff, J. P.; Hase, T. P. A. [Department of Materials, University of Oxford, Parks Road, Oxford OX1 3PH (United Kingdom); Clarendon Laboratory, University of Oxford, Parks Road, Oxford OX1 3PU (United Kingdom); Department of Physics, University of Liverpool, Liverpool L69 7ZE (United Kingdom); Department of Physics, University of Durham, Durham DH1 3LE (United Kingdom)



MN471004, Electrical Safety Manual Sponsor: Michael W. Hazen, 4000  

NLE Websites -- All DOE Office Websites (Extended Search)

MN471004, Electrical Safety Manual MN471004, Electrical Safety Manual Sponsor: Michael W. Hazen, 4000 Revision Date: June 9, 2011 Replaces Document Dated: September 4, 2007 This document is no longer a CPR. This document implements the requirements of Corporate Procedure ESH100.2.ELC.1, Manage Electrical Hazards. IMPORTANT NOTICE: A printed copy of this document may not be the document currently in effect. The official version is the online version located on the Sandia Restricted Network (SRN). Subject Matter Experts: Marc Williams and David Paoletta MN471004, Issue S Revision Date: June 9, 2011; Replaces Document Dated: April 29, 2008 Review Date: August 29, 2007 Administrative Changes: February 5, 2008, June 28, 2010, July 28, 2010, May 26, 2011, June 9, 2011, November 28, 2011, February 1, 2012


Magnetic properties of a metal-organic antiferromagnet Mn,,hfipbb...py,,H2O...0.5  

E-Print Network (OSTI)

crystallographically independent Mn atoms Mn1 and Mn2 exist in this structure, and an alternate connection ­MnMnMn are discovered. Here we report the synthesis, structure, and magnetic properties of a metal-organic coordination 0.195, 0.5 mmol , py 2 ml , and H2O 5 ml was sealed in a Teflon-lined acid digestion bomb and heated

Li, Jing


Rechargeable Zn-MnO sub 2 alkaline batteries  

SciTech Connect

In this paper progress in the development of rechargeable alkaline zinc-manganese dioxide cells is described. The advantages and limitations of the system are evaluated. Laboratory tests run on commercial primary alkaline cells as well as model simulations of a bipolar MnO{sub 2} electrode show that the rechargeable alkaline battery may be able to compete with lead-acid, nickel-cadmium, and secondary lithium cells for low- to moderate-rate applications. However, because of this poor performance at high rates and low temperatures, the alkaline MnO{sub 2} battery is not suitable for present automotive starting applications.

Wruck, W.J.; Reichman, B.; Bullock, K.R.; Kao, W.H. (Corporate Applied Research, Johnson Controls, Inc., Milwaukee, WI (US))



Measurement of single and double glazing thermal performance under realistic conditions using the mobile window thermal test (MoWiTT) facility  

SciTech Connect

The thermal performance of single glazing, clear double glazing, and double glazing with a low-emissivity coating was measured in both south-facing and north-facing orientations under realistic field conditions using the new MoWiTT field test facility. The time-dependent net heat flow through each fenestration was found to be consistent with the predictions of the standard simplified heat transfer model, provided that an angle-dependent shading coefficient is used and diffuse solar gain is included in the calculation. Summer-condition average U-values were derived for each glazing type and were found to agree with the expected values for both types of double glazing. The measured U-value for single glazing was lower than predicted.

Klems, J.; Keller, H.



Thermal Instability of Olivine-type LiMnPO4 Cathodes  

NLE Websites -- All DOE Office Websites (Extended Search)

Thermal Instability of Olivine-type LiMnPO4 Cathodes Title Thermal Instability of Olivine-type LiMnPO4 Cathodes Publication Type Journal Article Year of Publication 2010 Authors...


Electrodeposited Al-Mn Alloys with Microcrystalline, Nanocrystalline, Amorphous and Nano-quasicrystalline Structures  

E-Print Network (OSTI)

AlMn alloys with Mn content ranging from 0 to 15.8 at.% are prepared by electrodeposition from an ionic liquid at room temperature, and exhibit a remarkably broad range of structures. The alloys are characterized through ...

Ruan, Shiyun


Disentangling the Mn moments on different sublattices in the half-metallic ferrimagnet Mn3?xCoxGa  

SciTech Connect

Ferrimagnetic Mn{sub 3-x}Co{sub x}Ga compounds have been investigated by magnetic circular dichroism in x-ray absorption (XMCD). Compounds with x > 0.5 crystallize in the CuHg{sub 2}Ti structure. A tetragonal distortion of the cubic structure occurs for x {le} 0.5. For the cubic phase, magnetometry reveals a linearly increasing magnetization of 2x Bohr magnetons per formula unit obeying the generalized Slater-Pauling rule. XMCD confirms the ferrimagnetic character with Mn atoms occupying two different sublattices with antiparallel spin orientation and different degrees of spin localization and identifies the region 0.6 < x {le} 0.8 as most promising for a high spin polarization at the Fermi level. Individual Mn moments on inequivalent sites are compared to theoretical predictions.

Klaer, P.; Jenkins, C.A.; Alijani, V.; Winterlik, J.; Balke, B.; Felser, C.; Elmers, H.J.



Assessment of the Diffusive Gradients in Thin-films (DGT) technique to assess the plant availability of Mn in soils.  

E-Print Network (OSTI)

predicts copper availability to plants. EnvironmentalAttempts to assess Mn availability have been impeded due towill influence the Mn availability. Often flooding of soils

Mundus, Simon; Husted, Sren; Lombi, Enzo



Control of magnetic properties of MnBi and MnBiCu thin films by Kr{sup +} ion irradiation  

SciTech Connect

Mn{sub 52}Bi{sub 48} (15 nm) and Mn{sub 54}Bi{sub 24}Cu{sub 21} (15 nm) thin films were prepared by the magnetron sputtering and vacuum annealing at 350 deg. C, and the variations of their structures and magnetic properties with 30 keV Kr{sup +} ion irradiation were studied. The MnBi and MnBiCu films exhibited saturation magnetizations M{sub s} of 180 emu/cc and 210 emu/cc, the coercivities H{sub c} of 10 kOe and 3.4 kOe, respectively. The M{sub s} and H{sub c} of the MnBi abruptly vanished by the irradiation of ion dose at 3 x 10{sup 14} ions/cm{sup 2}, while those of the MnBiCu film gradually decreased with increasing the ion dose and became zero at 5 x 10{sup 13} ions/cm{sup 2}. The different trend on the ion irradiation between MnBi and MnBiCu films is understood by the surface structure of the film, i.e., the MnBi has convex islands on its surface, which protect the underneath NiAs-type MnBi from the irradiation, while the MnBiCu has rather flat surface, and its crystal structure was uniformly modified by the irradiation. From the surface flatness and the uniformity of the MnBiCu film, as well as the low annealing temperature of 350 deg. C, it was concluded that the MnBiCu film is one of the attractive materials for high-density ion irradiation bit patterned media.

Xu Qianqian; Kanbara, Ryutarou; Kato, Takeshi; Iwata, Satoshi [Department of Quantum Engineering, Nagoya University Furo-cho, Chikusa-ku, Nagoya, 464-8603 (Japan); Tsunashima, Shigeru [Department of Research, Nagoya Industrial Science Research Institute, 1-13 Yotsuya-dori, Chikusa-ku, Nagoya 460-0819 (Japan)



Thermoelectric figure of merit of LSCoO-Mn perovskites  

Science Conference Proceedings (OSTI)

Oxide ceramics with nominal composition of La"0"."8Sr"0"."2Co"1"-"xMn"xO"3(0= Keywords: 72.20.Pa, 84.60.Bk, 84.60.Rb, 85.80.Fi, LSCoO compounds, Thermoelectric figure of merit, Thermoelectric materials

J. E. Rodrguez; D. Cadavid; L. C. Moreno



Clarification of enhanced ferromagnetism in Be-codoped InMnP fabricated using Mn/InP:Be bilayers grown by molecular beam epitaxy  

Science Conference Proceedings (OSTI)

The p-type InMnP:Be epilayers were prepared by the sequential growth of Mn/InP:Be bilayers using molecular-beam-epitaxy and the subsequent in-situ annealing at 200-300 deg. C. In triple-axis x-ray diffraction patterns, the samples revealed a shoulder peak indicative of intrinsic InMnP. The ferromagnetic transition in InMnP:Be was observed to occur at the elevated temperature of {approx}140 K, and the ferromagnetic spin-domains clearly appeared in magnetic force microscopy images. The improved ferromagnetic properties are attributed to the increased p-d hybridation due to high p-type conductivity of InMnP:Be (p {approx} 10{sup 20 }cm{sup -3}). The results suggest that enhanced ferromagnetism can be effectively obtained from Be-codoped InMnP.

Shon, Yoon; Lee, Sejoon; Taek Yoon, Im; Jeon, H. C.; Lee, D. J.; Kang, T. W. [Quantum-functional Semiconductor Research Center, Dongguk University-Seoul, Seoul 100-715 (Korea, Republic of); Song, J. D. [Center for Spintronics Research, Korea Institute of Science and Technology, Seoul 136-791 (Korea, Republic of); Yoon, Chong S. [Department of Materials Science and Engineering, Hanyang University, Seoul 133-791 (Korea, Republic of); Kim, D. Y. [Department of Semiconductor Science, Dongguk University-Seoul, Seoul 100-715 (Korea, Republic of); Park, C. S. [School of Electrical Engineering, Korea University, Anam-dong, Seongbuk-gu, Seoul 136-713 (Korea, Republic of)



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos


Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


The Mn effect on magnetic structure of FeMn-B amorphous metals , D.M.C. Nicholson2  

E-Print Network (OSTI)

usually less than 1mm in thickness, because fast cooling rate is (~ 106 °K/sec) required for retaining] for a historical summary on the discovery of bulk amorphous metals.) They have been proposed for a range in transformers and electrical motors. Lately, high Mn content, Fe-based bulk amorphous metals have been

Widom, Michael


Plutonium Oxidation and Subsequent Reduction by Mn (IV) Minerals  

Science Conference Proceedings (OSTI)

Plutonium sorbed to rock tuff was preferentially associated with manganese oxides. On tuff and synthetic pyrolusite (Mn{sup IV}O{sub 2}), Pu(IV) or Pu(V) was initially oxidized, but over time Pu(IV) became the predominant oxidation state of sorbed Pu. Reduction of Pu(V/VI), even on non-oxidizing surfaces, is proposed to result from a lower Gibbs free energy of the hydrolyzed Pu(IV) surface species versus that of the Pu(V) or Pu(VI) surface species. This work suggests that despite initial oxidation of sorbed Pu by oxidizing surfaces to more soluble forms, the less mobile form of Pu, Pu(IV), will dominate Pu solid phase speciation during long term geologic storage. The safe design of a radioactive waste or spent nuclear fuel geologic repository requires a risk assessment of radionuclides that may potentially be released into the surrounding environment. Geochemical knowledge of the radionuclide and the surrounding environment is required for predicting subsurface fate and transport. Although difficult even in simple systems, this task grows increasingly complicated for constituents, like Pu, that exhibit complex environmental chemistries. The environmental behavior of Pu can be influenced by complexation, precipitation, adsorption, colloid formation, and oxidation/reduction (redox) reactions (1-3). To predict the environmental mobility of Pu, the most important of these factors is Pu oxidation state. This is because Pu(IV) is generally 2 to 3 orders of magnitude less mobile than Pu(V) in most environments (4). Further complicating matters, Pu commonly exists simultaneously in several oxidation states (5, 6). Choppin (7) reported Pu may exist as Pu(IV), Pu(V), or Pu(VI) oxic natural groundwaters. It is generally accepted that plutonium associated with suspended particulate matter is predominantly Pu(IV) (8-10), whereas Pu in the aqueous phase is predominantly Pu(V) (2, 11-13). The influence of the character of Mn-containing minerals expected to be found in subsurface repository environments on Pu oxidation state distributions has been the subject of much recent research. Kenney-Kennicutt and Morse (14), Duff et al. (15), and Morgenstern and Choppin (16) observed oxidation of Pu facilitated by Mn(IV)-bearing minerals. Conversely, Shaughnessy et al. (17) used X-ray Absorption near-edge spectroscopy (XANES) to show reduction of Pu(VI) by hausmannite (Mn{sup II}Mn{sub 2}{sup III}O{sub 4}) and manganite ({gamma}-Mn{sup III}OOH) and Kersting et al., (18) observed reduction of Pu(VI) by pyrolusite (Mn{sup IV}O{sub 2}). In this paper, we attempt to reconcile the apparently conflicting datasets by showing that Mn-bearing minerals can indeed oxidize Pu, however, if the oxidized species remains on the solid phase, the oxidation step competes with the formation of Pu(IV) that becomes the predominant solid phase Pu species with time. The experimental approach we took was to conduct longer term (approximately two years later) oxidation state analyses on the Pu sorbed to Yucca Mountain tuff (initial analysis reported by Duff et al., (15)) and measure the time-dependant changes in the oxidation state distribution of Pu in the presence of the Mn mineral pyrolusite.




Electrodeposited Mn-Co Alloy Coating For SOFC Interconnects  

NLE Websites -- All DOE Office Websites (Extended Search)

Electrodeposited Electrodeposited Mn-Co Alloy Coating For SOFC Interconnects H. McCrabb * , T. Hall * , J. Wu # , H. Zhang # , X. Liu # , E.J. Taylor * * Faraday Technology Inc., 315 Huls Dr., Clayton, OH 45315, USA # West Virginia University, Dept. of Mechanical and Aerospace Eng.ESB, Morgantown, WV, 26506, USA Overall Objective Overall Objective Principal Investigator: Heather McCrabb, Company Name: Faraday Technology, Inc., Address: 315 Huls Drive, Clayton, OH 45315, Phone: 937-836-7749, E-mail: heathermccrabb@faradaytechnology.com, Company website: faradaytechnology.com Previous Work at WVU Results Develop an inexpensive manufacturing process for depositing (Mn,Co) 3 O 4 spinel coatings onto SOFC interconnects. Introduction The decrease in the SOFC operating temperatures from 1000°C to between 650 and 850°C has enabled the use of chromia-forming ferritic stainless steels as interconnects


Charge transport properties of CdMnTe radiation detectors  

Science Conference Proceedings (OSTI)

Growth, fabrication and characterization of indium-doped cadmium manganese telluride (CdMnTe)radiation detectors have been described. Alpha-particle spectroscopy measurements and time resolved current transient measurements have yielded an average charge collection efficiency approaching 100 %. Spatially resolved charge collection efficiency maps have been produced for a range of detector bias voltages. Inhomogeneities in the charge transport of the CdMnTe crystals have been associated with chains of tellurium inclusions within the detector bulk. Further, it has been shown that the role of tellurium inclusions in degrading chargecollection is reduced with increasing values of bias voltage. The electron transit time was determined from time of flight measurements. From the dependence of drift velocity on applied electric field the electron mobility was found to be n = (718 55) cm2/Vs at room temperature.

Kim K.; Rafiel, R.; Boardman, M.; Reinhard, I.; Sarbutt, A.; Watt, G.; Watt, C.; Uxa, S.; Prokopovich, D.A.; Belas, E.; Bolotnikov, A.E.; James, R.B.



High-Resolution Mn EXAFS of the Oxygen-Evolving Complex inPhotosystem II: Structural Implications for the Mn4Ca Cluster  

DOE Green Energy (OSTI)

The biological generation of oxygen by the oxygen-evolving complex in photosystem II (PS II) is one of natures most important reactions. The recent X-ray crystal structures, while limited by resolutions of 3.2 to 3.5 A, have located the electron density associated with the Mn4Ca complex within the multi-protein PS II complex. Detailed structures critically depend on input from spectroscopic techniques such as EXAFS and EPR/ENDOR, as the XRD resolution does not allow for accurate determination of the position of Mn/Ca or the bridging and terminal ligand atoms. The number and distances of Mn-Mn/Ca/ligand interactions determined from EXAFS provide important constraints for the structure of the Mn cluster. Here we present data from a high-resolution EXAFS method using a novel multi-crystal monochromator that show three short Mn-Mn distances between 2.7 and 2.8 A and hence the presence of three di-mu-oxobridged units in the Mn4Ca cluster. This result imposes clear limitations on the proposed structures based on spectroscopic and diffraction data and provides input for refining such structures.

Yano, Junko; Pushkar, Yulia; Glatzel, Pieter; Lewis, Azul; Sauer,Kenneth; Messinger, Johannes; Bergmann, Uwe; Yachandra, Vittal



Structural and magnetic properties of MnAs nanoclusters formed by Mn ion implantation in GaAs  

SciTech Connect

Ferromagnetic (FM) nanostructures embedded in semiconductors are of fundamental interest since their physical properties could be used in new devices such as memories, sensors or spintronics. In this work, we present results obtained on the synthesis and characterization of nanosized MnAs ferromagnets buried in GaAs. These nanocrystals are formed either by single Mn implantation or Mn + As co-implantation at room temperature into GaAs wafers at 141 and 180 keV respectively. Two doses, 1 x 10{sup 16} and 2 x 10{sup 16} ions {center_dot} cm{sup -2} for each impurity, are tested. Pieces of the wafers are then annealed by RTA or classical furnace annealing at various temperatures under N{sub 2} atmosphere for increasing times. HRTEM and diffraction analysis show that under such conditions MnAs precipitates form with a regular hexagonal structure, the 3m orientation-relationship of precipitates with respect to the matrix offers the most energetically stable configuration. Size distributions are systematically extracted from statistical analysis of ''2 beam'' TEM images. The precipitate mean diameters of nanocrystals populations range from 9 to 13 nm depending on the annealing conditions. Magnetization measurements by SQUID magnetometry on the same samples reveal a progressive transition from a superparamagnetic behavior at room temperature to an FM one at 2K, reflecting a distribution of blocking temperature, due to distribution of size and to dipolar interactions. Curie temperatures in the range of 360K were measured.

Serres, A.; Benassayag, G.; Respaud, M.; Armand, C.; Pesant, J.C.; Mari, A.; Liliental-Weber, Z.; Claverie, A.



Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Effect of a high electric field on the conductivity of MnGa{sub 2}S{sub 4}, MnIn{sub 2}S{sub 4}, and MnGaInS{sub 4} single crystals  

Science Conference Proceedings (OSTI)

The results of studying the effect of a high electric field on the conductivity of MnGa{sub 2}S{sub 4}, MnIn{sub 2}S{sub 4}, and MnGaInS{sub 4} single crystals are reported. The activation energy is determined in high and low electric fields. It is established that the decrease in the activation energy with increasing the external voltage is associated with decreasing the depth of the potential well, in which the electron is located.

Niftiev, N. N. [Azerbaijan State Pedagogical University (Azerbaijan); Tagiev, O. B. [National Academy of Sciences of Azerbaijan, Institute of Physics (Azerbaijan)



Time resolved magneto-optical studies of ferromagnetic InMnSb films  

SciTech Connect

We report time resolved magneto-optical measurements in InMnSb ferromagnetic films with 2% and 2.8% Mn contents grown by low temperature molecular beam epitaxy. In order to probe a possible interaction between the spins of photoexcited carriers and the Mn ions, we measured spin dynamics before and after aligning the Mn ions by applying an external magnetic field at temperatures above and below the samples' Curie temperatures. We observed no significant temperature or magnetic field dependence in the relaxation times and attribute the observed dynamics entirely to the relaxation of photoexcited electrons in the conduction band where the s-d coupling with the localized Mn ions is significantly weaker compared to the p-d exchange coupling. We observed several differences in the optical response of our InMnSb samples which could have been influenced mainly by the samples' growth conditions.

Frazier, M.; Kini, R. N.; Nontapot, K.; Khodaparast, G. A. [Department of Physics, Virginia Tech, Blacksburg, Virginia 24061 (United States); Wojtowicz, T. [Institute of Physics, Polish Academy of Sciences 02-668 Warsaw (Poland); Liu, X.; Furdyna, J. K. [Department of Physics, University of Notre Dame, Notre Dame, Indiana 46556 (United States)



Investigation of structure, magnetic, and transport properties of Mn-doped SiC films  

SciTech Connect

Mn-doped SiC films were fabricated by radio frequency magnetron sputtering technique. The structure, composition, and magnetic and transport properties of the films were investigated. The results show the films have the 3C-SiC crystal structure and the doped Mn atoms in the form of Mn{sup 2+} ions substitute for C sites in SiC lattice. All the films are ferromagnetic at 300 K, and the ferromagnetism in films arises from the doped Mn atoms and some extended defects. In addition, the saturation magnetization increases with the Mn-doped concentration increasing. The Mn doping does not change the semiconductor characteristics of the SiC films.

Sun Xianke [School of Material Science and Engineering, Tianjin University, Tianjin 300172 (China); Tianjin Key Laboratory for Photoelectric Materials and Devices, Tianjin University of Technology, Tianjin 300384 (China); Guo Ruisong [School of Material Science and Engineering, Tianjin University, Tianjin 300172 (China); An Yukai [Tianjin Key Laboratory for Photoelectric Materials and Devices, Tianjin University of Technology, Tianjin 300384 (China); School of Material Science and Engineering, Tianjin University of Technology, Tianjin 300384 (China); Liu Jiwen [School of Material Science and Engineering, Tianjin University, Tianjin 300172 (China); Tianjin Key Laboratory for Photoelectric Materials and Devices, Tianjin University of Technology, Tianjin 300384 (China); School of Material Science and Engineering, Tianjin University of Technology, Tianjin 300384 (China)



Ga{sub 1-x}Mn{sub x}N epitaxial films with high magnetization  

Science Conference Proceedings (OSTI)

We report on the fabrication of pseudomorphic wurtzite Ga{sub 1-x}Mn{sub x}N grown on GaN with Mn concentrations up to 10% using molecular beam epitaxy. According to Rutherford backscattering, the Mn ions are mainly at the Ga-substitutional positions, and they are homogeneously distributed according to depth-resolved Auger-electron spectroscopy and secondary-ion mass-spectroscopy measurements. A random Mn distribution is indicated by transmission electron microscopy, and no Mn-rich clusters are present for optimized growth conditions. A linear increase of the c-lattice parameter with increasing Mn concentration is found using x-ray diffraction. The ferromagnetic behavior is confirmed by superconducting quantum-interference measurements showing saturation magnetizations of up to 150 emu/cm{sup 3}.

Kunert, G.; Kruse, C.; Figge, S.; Hommel, D. [Semiconductor Epitaxy, Institute of Solid State Physics, University of Bremen, D-28359 Bremen (Germany); Dobkowska, S.; Jakiela, R.; Stefanowicz, W.; Sawicki, M. [Institute of Physics, Polish Academy of Science, PL-02-668 Warszawa (Poland); Li, Tian; Bonanni, A. [Institute for Semiconductor and Solid State Physics, Johannes Kepler University Linz, A 4040 Linz (Austria); Reuther, H.; Grenzer, J.; Borany, J. von [Helmholtz-Zentrum Dresden-Rossendorf, Institute of Ion Beam Physics and Materials Research, Bautzner Landstrasse 400, 01328 Dresden (Germany); Dietl, T. [Institute of Physics, Polish Academy of Science, PL-02-668 Warszawa (Poland); Institute of Theoretical Physics, Faculty of Physics, University of Warsaw, PL-00-681 Warszawa (Poland)



Electronic Structure and Oxidation State Changes in the Mn (4) Ca Cluster of Photosystem II  

Science Conference Proceedings (OSTI)

Oxygen-evolving complex (Mn{sub 4}Ca cluster) of Photosystem II cycles through five intermediate states (S{sub i}-states, i = 0-4) before a molecule of dioxygen is released. During the S-state transitions, electrons are extracted from the OEC, either from Mn or alternatively from a Mn ligand. The oxidation state of Mn is widely accepted as Mn{sub 4}(III{sub 2},IV{sub 2}) and Mn{sub 4}(III,IV{sub 3}) for S{sub 1} and S{sub 2} states, while it is still controversial for the S{sub 0} and S{sub 3} states. We used resonant inelastic X-ray scattering (RIXS) to study the electronic structure of Mn{sub 4}Ca complex in the OEC. The RIXS data yield two-dimensional plots that provide a significant advantage by obtaining both K-edge pre-edge and L-edge-like spectra (metal spin state) simultaneously. We have collected data from PSII samples in the each of the S-states and compared them with data from various inorganic Mn complexes. The spectral changes in the Mn 1s2p{sub 3/2} RIXS spectra between the S-states were compared to those of the oxides of Mn and coordination complexes. The results indicate strong covalency for the electronic configuration in the OEC, and we conclude that the electron is transferred from a strongly delocalized orbital, compared to those in Mn oxides or coordination complexes. The magnitude for the S{sub 0} to S{sub 1}, and S{sub 1} to S{sub 2} transitions is twice as large as that during the S{sub 2} to S{sub 3} transition, indicating that the electron for this transition is extracted from a highly delocalized orbital with little change in charge density at the Mn atoms.

Yano, J.; Pushkar, Y.; Messinger, J.; Bergmann, U.; Glatzel, P.; Yachandra, V.K.; /SLAC



Distinct local electronic structure and magnetism for Mn in amorphous Si and Ge  

SciTech Connect

Transition metals such as Mn generally have large local moments in covalent semiconductors due to their partially filled d shells. However, Mn magnetization in group-IV semiconductors is more complicated than often recognized. Here we report a striking crossover from a quenched Mn moment (<0.1 {mu}{sub B}) in amorphous Si (a-Si) to a large distinct local Mn moment ({ge}3{mu}{sub B}) in amorphous Ge (a-Ge) over a wide range of Mn concentrations (0.005-0.20). Corresponding differences are observed in d-shell electronic structure and the sign of the Hall effect. Density-functional-theory calculations show distinct local structures, consistent with different atomic density measured for a-Si and a-Ge, respectively, and the Mn coordination number N{sub c} is found to be the key factor. Despite the amorphous structure, Mn in a-Si is in a relatively well-defined high coordination interstitial type site with broadened d bands, low moment, and electron (n-type) carriers, while Mn in a-Ge is in a low coordination substitutional type site with large local moment and holes (p-type) carriers. Moreover, the correlation between N{sub c} and the magnitude of the local moment is essentially independent of the matrix; the local Mn moments approach zero when N{sub c} > 7 for both a-Si and a-Ge.

Zeng, Li; Cao, J. X.; Helgren, E.; Karel, J.; Arenholz, E.; Ouyang, Lu; Smith, David J.; Wu, R. Q.; Hellman, F.



Ion-exchanged MnO2 nanoparticles as cathodes of lithium ion ...  

Science Conference Proceedings (OSTI)

Presentation Title, Ion-exchanged MnO2 nanoparticles as cathodes of lithium ion batteries at elevated temperatures. Author(s), Dawei Liu, Jasper Wright, Wei...


Ageing and Toughness of a Mn-Ni-Mo PWR Steel  

Science Conference Proceedings (OSTI)

Abstract Scope, Mn-Ni-Mo steels are widely used in the fabrication of pressurisers, steam generators and pressure vessels of pressurised water reactors (PWR).


Investigation of Structural Stability of Monolayer MnO 2 Sheet under ...  

Science Conference Proceedings (OSTI)

Presentation Title, Investigation of Structural Stability of Monolayer MnO2 Sheet under Electron Beam Irradiation. Author(s), Yong Wang, Chenghua Sun, Jin Zou ...


Optimization of Na 0.44 MnO 2 Cathode Material - Programmaster.org  

Science Conference Proceedings (OSTI)

Symposium, Energy Storage: Materials, Systems, and Applications. Presentation Title, Optimization of Na0.44MnO2 Cathode Material for Use in Aqueous...


Low-energy structure of 61Mn populated following $\\beta$ decay of 61Cr  

E-Print Network (OSTI)

$\\beta$ decay of the $^{61}$Cr$_{37}$ ground state has been studied. A new half-life of 233 +/- 11 ms has been deduced, and seven delayed $\\gamma$ rays have been assigned to the daughter, $^{61}$Mn$_{36}$. The low-energy level structure of $^{61}$Mn$_{36}$ is similar to that of the less neutron-rich $^{57,59}$Mn nuclei. The odd-A $_{25}$Mn isotopes follow the systematic trend in the yrast states of the even-even, Z + 1 $_{26}$Fe isotopes, and not that of the Z - 1 $_{24}$Cr isotopes, where a possible onset of collectivity has been suggested to occur already at N = 36.

Crawford, H L; Berryman, J S; Broda, R; Fornal, B; Hoffman, C R; Hoteling, N; Janssens, R V F; Lenzi, S M; Pereira, J; Stoker, J B; Tabor, S L; Walters, W B; Wang, X; Zhu, S



Low-energy structure of 61Mn populated following $?$ decay of 61Cr  

E-Print Network (OSTI)

$\\beta$ decay of the $^{61}$Cr$_{37}$ ground state has been studied. A new half-life of 233 +/- 11 ms has been deduced, and seven delayed $\\gamma$ rays have been assigned to the daughter, $^{61}$Mn$_{36}$. The low-energy level structure of $^{61}$Mn$_{36}$ is similar to that of the less neutron-rich $^{57,59}$Mn nuclei. The odd-A $_{25}$Mn isotopes follow the systematic trend in the yrast states of the even-even, Z + 1 $_{26}$Fe isotopes, and not that of the Z - 1 $_{24}$Cr isotopes, where a possible onset of collectivity has been suggested to occur already at N = 36.

H. L. Crawford; P. F. Mantica; J. S. Berryman; R. Broda; B. Fornal; C. R. Hoffman; N. Hoteling; R. V. F. Janssens; S. M. Lenzi; J. Pereira; J. B. Stoker; S. L. Tabor; W. B. Walters; X. Wang; S. Zhu


Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


F-8: Modeling of Mn-Ni-Si-Cu Precipitation in Reactor Pressure ...  

Science Conference Proceedings (OSTI)

Presentation Title, F-8: Modeling of Mn-Ni-Si-Cu Precipitation in Reactor .... Steels 316 and Comparison with the Rate Theory Model of a Multicomponent System.


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1-07 0 1-07 0 USS Honolulu (SSN 718) and Locals 280 miles from North Pole PROGRAM RECORD * Program founded in 1948 * 5,800 reactor- years of safe operations * 136,000,000 miles safely steamed * 103 operating naval reactors * Welcomed in over 150 ports worldwide and 50 countries BROAD RESPONSIBILITIES * Research, Development, Design * Acquisition, Specification, Construction, Testing * Operation, Training, Maintenance * Overhaul, Refueling, Disposal * Reactor Safety, Radiological Controls, Environmental Safety, Occupational Health * Security, Nuclear Safeguards, Transportation * Administration (Public Information) NAVAL NUCLEAR PROPULSION PROGRAM TEC 1-07 1 WA OR ID MT ND SD WY NE MN WI IA IL MI IN OH KY


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Appliances in Homes in Midwest Region, Divisions, and States, 2009" 9 Appliances in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Appliances",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Cooking Appliances" "Stoves (Units With Both" "an Oven and a Cooktop)"


Giant tunneling magnetoresistance in Co{sub 2}MnSi/Al-O/Co{sub 2}MnSi magnetic tunnel junctions  

SciTech Connect

Magnetic tunnel junctions (MTJs) with a stacking structure of Co{sub 2}MnSi/Al-O/Co{sub 2}MnSi were fabricated using magnetron sputtering system. Fabricated MTJ exhibited an extremely large tunneling magnetoresistance (TMR) ratio of 570% at low temperature, which is the highest TMR ratio reported to date for an amorphous Al-O tunneling barrier. The observed dependence of tunneling conductance on bias voltage clearly reveals the half-metallic energy gap of Co{sub 2}MnSi. The origins of large temperature dependence of TMR ratio were discussed on the basis of the present results.

Sakuraba, Y.; Hattori, M.; Oogane, M.; Ando, Y.; Kato, H.; Sakuma, A.; Miyazaki, T.; Kubota, H. [Department of Applied Physics, Graduate School of Engineering, Tohoku University, Aoba-yama 6-6-05, Aramaki, Aoba-ku, Sendai 980-8579 (Japan); Nanoelectronics Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), 1-1-1 Umezono, Tsukuba 305-8568 (Japan)



Large energy absorption in Ni-Mn-Ga/polymer composites  

SciTech Connect

Ferromagnetic shape memory alloys can respond to a magnetic field or applied stress by the motion of twin boundaries and hence they show large hysteresis or energy loss. Ni-Mn-Ga particles made by spark erosion have been dispersed and oriented in a polymer matrix to form pseudo 3:1 composites which are studied under applied stress. Loss ratios have been determined from the stress-strain data. The loss ratios of the composites range from 63% to 67% compared to only about 17% for the pure, unfilled polymer samples.

Feuchtwanger, Jorge; Richard, Marc L.; Tang, Yun J.; Berkowitz, Ami E.; O'Handley, Robert C.; Allen, Samuel M. [Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States); University of California, San Diego, La Joya, California 92093 (United States); Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States)



Specific DNA cleavage mediated by [SalenMn(III)][sup +  

Science Conference Proceedings (OSTI)

The combination of [SalenMn(III)][sup +] and a terminal oxidant affords efficient and specific cleavage of right-handed double-helical DNA in regions rich in A:T base pairs. Metal complexes of the tetradentate chelating ligands Salen (Salen = N,N[prime]-ethylenebis(salicylideneaminato)) have been part of the inorganic chemistry literature for several decades. The cationic manganese(III) complex [SalenMn(III)][sup +] (1) is an efficient catalyst for the epoxidation of olefins with terminal oxidants such as iodosylbenzene. 1 also catalyzes oxidative C-H bond activation. The flat, crescent shape of 1, its aromatic and cationic nature, and its ability to catalyze hydrocarbon oxidation are features shared in whole or in part by metal complexes which bind to DNA and cleave it via oxidative processes. These similarities prompted the authors to evaluate the DNA-cleaving properties of 1, and they now report that 1 mediates specific cleavage of right-handed double-helical DNA in a reaction requiring a terminal oxidant. 20 refs., 3 figs., 1 tab.

Gravert, D.J.; Griffin, J.H. (Stanford Univ., CA (United States))



Dietary resveratrol administration increases MnSOD expression and activity in mouse brain  

E-Print Network (OSTI)

SOD protein level (140%) and activity (75%). The increase in MnSOD was not due to a substantial proliferationDietary resveratrol administration increases MnSOD expression and activity in mouse brain Ellen L oxidative stress. In vitro studies have shown an increase in antioxidant enzyme activities following

Stuart, Jeffrey A.


Synthesis and Characterization of MnO2-Based Mixed Oxides as Supercapacitors  

E-Print Network (OSTI)

Synthesis and Characterization of MnO2-Based Mixed Oxides as Supercapacitors Hansung Kim. Available electronically January 28, 2003. The development of a high-power-density supercapacitor made to develop supercapacitors based on non-noble oxides.13 Hydrous manganese oxide (a-MnO2 · nH2O

Popov, Branko N.


Element-specific study of the temperature dependent magnetization of Co-Mn-Sb thin films  

SciTech Connect

Magnetron sputtered thin Co-Mn-Sb films were investigated with respect to their element-specific magnetic properties. Stoichiometric Co{sub 1}Mn{sub 1}Sb{sub 1} crystallized in the C1{sub b} structure has been predicted to be half-metallic and is therefore of interest for spintronics applications. It should show a characteristic antiferromagnetic coupling of the Mn and Co magnetic moments and a transition temperature T{sub C} of about 480K. Although the observed transition temperature of our 20nm thick Co{sub 32.4}Mn{sub 33.7}Sb{sub 33.8}, Co{sub 37.7}Mn{sub 34.1}Sb{sub 28.2} and Co{sub 43.2}Mn{sub 32.6}Sb{sub 24.2} films is in quite good agreement with the expected value, we found a ferromagnetic coupling of the Mn and Co magnetic moments which indicates that the films do not crystallize in the C1{sub b} structure and are probably not fully spin-polarized. The ratio of the Co and Mn moments does not change up to the transition temperature and the temperature dependence of the magnetic moments can be well described by the mean field theory.

Schmalhorst, J.; Ebke, D.; Meinert, M.; Thomas, A.; Reiss, G.; Arenholz, E.



Cation Effects on the Layer Structure of Biogenic Mn-Oxides  

E-Print Network (OSTI)

Radiation Lightsource (SSRL). Wet sample slurries were placed in an aluminum sample cell with Lexan windows-bs (Samuel Webb, SSRL). Two Mn-oxide references, triclinic birnessite (TcBir) and -MnO2 were synthesized and Environmental and Quality (ISEQ) Graduate Fellowship. M.Z. also thanks Dr. Samuel Webb at SSRL for his help

Sparks, Donald L.


[Characterization of lignin and Mn peroxidases from Phanerochaete chrysosporium]. Progress report  

DOE Green Energy (OSTI)

Lignin peroxidases were investigated with respect to enzyme kinetics and NMR spectroscopy of the heme domain. MN peroxidases were studied with respect to the role of oxalate in enzyme activity, the NMR spectroscopy of the heme domain. Gene expression of both lignin and MN peroxidases were examined as well as expression of site-directed mutants aimed at scale up production of these enzymes.

Not Available



Electric-Field Modulation of Curie Temperature in (Ga, Mn)As Field-Effect Transistor Structures with Varying Channel Thickness and Mn Compositions  

SciTech Connect

We have investigated the change of T{sub C} of ferromagnetic semiconductor (Ga, Mn)As by changing hole concentration p. The field effect transistor structure was utilized to change p. The relation T{sub C}propor top{sup 0.2} is obtained for three samples, despite the difference of their Mn composition and thickness, indicating that the relation holds over 2 decades of p.

Nishitani, Y.; Endo, M. [Laboratory for Nanoelectronics and Spintronics, Research Institute of Electrical Communication, Tohoku University, Katahira 2-1-1, Aoba-ku, Sendai 980-8577 (Japan); Chiba, D. [Semiconductor Spintronics Project, Exploratory Research for Advanced Technology, Japan Science and Technology Agency, Sanban-cho 5, Chiyoda-ku, Tokyo 102-0075 (Japan); Laboratory for Nanoelectronics and Spintronics, Research Institute of Electrical Communication, Tohoku University, Katahira 2-1-1, Aoba-ku, Sendai 980-8577 (Japan); Matsukura, F.; Ohno, H. [Laboratory for Nanoelectronics and Spintronics, Research Institute of Electrical Communication, Tohoku University, Katahira 2-1-1, Aoba-ku, Sendai 980-8577 (Japan); Semiconductor Spintronics Project, Exploratory Research for Advanced Technology, Japan Science and Technology Agency, Sanban-cho 5, Chiyoda-ku, Tokyo 102-0075 (Japan)



Estudo das propriedades termomecnicas da liga cu 78,3% - al 9,8% mn 11,9%.  

E-Print Network (OSTI)

??The alloys Cu 78,3% - Al 9,8% - Mn 11,9 and 77.5% Cu - Al 9.8% - Mn 11,9% -% Nb 0.5 - 0.3% Ni (more)

Rafael Evaristo Calute



Scanning tunneling microscopy reveals LiMnAs is a room temperature anti-ferromagnetic semiconductor  

SciTech Connect

We performed scanning tunneling microscopy and spectroscopy on a LiMnAs(001) thin film epitaxially grown on an InAs(001) substrate by molecular beam epitaxy. While the in situ cleavage exposed only the InAs(110) non-polar planes, the cleavage continued into the LiMnAs thin layer across several facets. We combined both topography and current mappings to confirm that the facets correspond to LiMnAs. By spectroscopy we show that LiMnAs has a band gap. The band gap evidenced in this study, combined with the known Neel temperature well above room temperature, confirms that LiMnAs is a promising candidate for exploring the concepts of high temperature semiconductor spintronics based on antiferromagnets.

Wijnheijmer, A. P.; Koenraad, P. M. [COBRA Inter-University Research Institute, Department of Applied Physics, Eindhoven University of Technology, P. O. Box 513, NL-5600 MB Eindhoven (Netherlands); Marti, X. [Faculty of Mathematics and Physics, Charles University in Prague, Ke Karlovu 3, 121 16 Prague 2 (Czech Republic); Institute of Physics ASCR, v.v.i., Cukrovarnicka 10, 162 53 Prague 6 (Czech Republic); Holy, V. [Faculty of Mathematics and Physics, Charles University in Prague, Ke Karlovu 3, 121 16 Prague 2 (Czech Republic); Cukr, M.; Novak, V. [Institute of Physics ASCR, v.v.i., Cukrovarnicka 10, 162 53 Prague 6 (Czech Republic); Jungwirth, T. [Institute of Physics ASCR, v.v.i., Cukrovarnicka 10, 162 53 Prague 6 (Czech Republic); School of Physics and Astronomy, University of Nottingham, Nottingham NG7 2RD (United Kingdom)



Improvement of Thermal Stability of Li-Ion Batteries by Polymer Coating of LiMn2O4  

E-Print Network (OSTI)

lithium-ion battery by arresting the Mn + dissolution, thereby increasing the battery stability. Key Words: Lithium Battery, Cathode,

Stroeve, Pieter; Vidu, Ruxandra



Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Manganese trends in a sample of thin and thick disk stars. The origin of Mn  

E-Print Network (OSTI)

CONTEXT: Manganese is an iron-peak element and although the nucleosynthesis path that leads to its formation is fairly well understood, it remains unclear which objects, SN II and/or SN Ia, that contribute the majority of Mn to the interstellar medium. It also remains unclear to which extent the supernovae Mn yields depend on the metallicity of the progenitor star or not. AIMS: By using a well studied and well defined sample of 95 dwarf stars we aim at further constraining the formation site(s) of Mn. METHODS: We derive Mn abundances through spectral synthesis of four Mn I lines at 539.4, 549.2, 601.3, and 601.6 nm. Stellar parameters and data for oxygen are taken from Bensby et al. (2003, 2004, 2005). RESULTS: When comparing our Mn abundances with O abundances for the same stars we find that the abundance trends in the stars with kinematics of the thick disk can be explained by metallicity dependent yields from SN II. We go on and combine our data for dwarf stars in the disks with data for dwarf and giant stars in the metal-poor thick disk and halo from the literature. We find that dwarf and giant stars show the same trends, which indicates that neither non-LTE nor evolutionary effects are a major concern for Mn. Furthermore, the [Mn/O] vs [O/H] trend in the halo is flat. CONCLUSIONS: We conclude that the simplest interpretation of our data is that Mn is most likely produced in SN II and that the Mn yields for such SNae must be metallicity dependent. Contribution from SN Ia in the metal-rich thin disk can not, however, be excluded.

S. Feltzing; M. Fohlman; T. Bensby



Low temperature hydrothermally synthesized nanocrystalline orthorhombic LiMnO2 cathode material for lithium-ion cells  

Science Conference Proceedings (OSTI)

Nanocrystalline orthorhombic LiMnO2 particles with an average particle size of about 35 nm in diameter were successfully synthesized by a hydrothermal process at 160-180 C from trimanganese tetroxide (Mn3O4) prepared ... Keywords: hydrothermal process, lithium ion battery, nanocrystalline, orthorhombic LiMnO2, solvothermal process

Mengqiang Wu; Ai Chen; Rongqing Xu; Yue Li



A rational self-sacrificing template route to LiMn2O4nanotubes and nanowires  

Science Conference Proceedings (OSTI)

Single-crystalline LiMn2O4 nanotubes and nanowires have been synthesized via a low-temperature molten salt synthesis method, using the prepared ?-MnO2 nanotubes and ?-MnO2 nanowires as the precursors ...

Baojun Yang; Xinsong Yuan; Duoli Chai



sqas wi9 final document  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SQAS96-001 SQAS96-001 Quality Report SQAS96-001 Preparation for a Software Quality Audit June 1996 Software Quality Assurance Subcommittee of the Nuclear Weapons Complex Quality Managers United States Department of Energy Albuquerque Operations Office Abstract This document will enable a site to prepare for a software quality audit by providing specific guidance. It will also provide guidance to a site that would enable it to perform a software quality audit. Preparation for a Software Quality Audit SQAS96-001 ACKNOWLEDGMENT This document was prepared for the Department of Energy (DOE) by a Working Group of the Nuclear Weapons Complex (NWC) Quality Managers' Software Quality Assurance Subcommittee (SQAS). The following contributed towards the creation of this document:

Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Recrystallization behavior of a supersaturated Al Mn alloy  

SciTech Connect

The effect of concurrent precipitation on recrystallization behavior during the isothermal annealing of a supersaturated and deformed Al-Mn alloy was investigated. It is found that concurrent precipitation strongly affects the recrystallization behavior of this alloy. At low temperatures, concurrent precipitation retards recrystallization and results in large flat grains. The size of recrystallized grains decreases significantly with increasing temperature. The kinetics of recrystallization was determined by measurements of hardness. The JMAK exponent decreases from 3.0 to 0.8 as the annealing temperature increases from 371 C to 427 C. The activation energy for recrystallization of the alloy is about 456 kJ/mol. Concurrent precipitation enhances the activation energy for recrystallization of aluminum alloys.

Radhakrishnan, Balasubramaniam [ORNL; Liu, W C [Yanshan University



Metalloantibiotic Mn(II)-bacitracin complex mimicking manganese superoxide dismutase  

SciTech Connect

Superoxide dismutase (SOD) activities of various metallobacitracin complexes were evaluated using the riboflavin-methionine-nitro blue tetrazolium assay. The radical scavenging activity of various metallobacitracin complexes was shown to be higher than those of the negative controls, e.g., free transition metal ions and metal-free bacitracin. The SOD activity of the complex was found to be in the order of Mn(II) > Cu(II) > Co(II) > Ni(II). Furthermore, the effect of bacitracin and their complexation to metals on various microorganisms was assessed by antibiotic susceptibility testing. Moreover, molecular modeling and quantum chemical calculation of the metallobacitracin complex was performed to evaluate the correlation of electrostatic charge of transition metal ions on the SOD activity.

Piacham, Theeraphon [Department of Clinical Microbiology, Faculty of Medical Technology, Mahidol University, Bangkok 10700 (Thailand); Pure and Applied Biochemistry, Chemical Center, Lund University, P.O. Box 124, 22100 Lund (Sweden); Isarankura-Na-Ayudhya, Chartchalerm [Department of Clinical Microbiology, Faculty of Medical Technology, Mahidol University, Bangkok 10700 (Thailand); Nantasenamat, Chanin [Department of Clinical Microbiology, Faculty of Medical Technology, Mahidol University, Bangkok 10700 (Thailand); Yainoy, Sakda [Department of Clinical Microbiology, Faculty of Medical Technology, Mahidol University, Bangkok 10700 (Thailand); Ye Lei [Pure and Applied Biochemistry, Chemical Center, Lund University, P.O. Box 124, 22100 Lund (Sweden); Buelow, Leif [Pure and Applied Biochemistry, Chemical Center, Lund University, P.O. Box 124, 22100 Lund (Sweden); Prachayasittikul, Virapong [Department of Clinical Microbiology, Faculty of Medical Technology, Mahidol University, Bangkok 10700 (Thailand)]. E-mail: mtvpr@mucc.mahidol.ac.th



Interfacial studies of a thin-film Li2Mn4O9 electrode  

NLE Websites -- All DOE Office Websites (Extended Search)

Interfacial studies of a thin-film Li2Mn4O9 electrode Interfacial studies of a thin-film Li2Mn4O9 electrode Title Interfacial studies of a thin-film Li2Mn4O9 electrode Publication Type Journal Article Year of Publication 1999 Authors Kostecki, Robert, Fanping Kong, Yoshiaki Matsuo, and Frank R. McLarnon Journal Electrochimica Acta Volume 45 Pagination 225-233 Keywords interfacial films, manganese oxide electrode Abstract A thin-film spinel Li2Mn4O9 electrode was prepared by spin coating onto a Pt substrate. Spectroscopic ellipsometry, X-ray diffraction and current-sensing atomic force microscopy (CSAFM) were used to characterize interfacial processes and film formation at this electrode in the presence of 1.0 M LiPF6, EC:DMC (1:1 by volume) electrolyte. Prolonged exposure of the film to the electrolyte at ambient temperature resulted in spontaneous decomposition of the spinel to λ-MnO2 without disruption of the original structure. The surface of the resulting λ-MnO2 film exhibited no significant change in morphology, however a thin passive electrode surface layer was detected by the CSAFM probe. This electrode surface layer exhibited insulating properties and most likely contained Li2O, a by-product of Li2Mn4O9 decomposition.


Ferromagnetism in Mn-Implanted Epitaxially Grown Ge on Si(100)  

SciTech Connect

We have studied ferromagnetism of Mn-implanted epitaxial Ge films on silicon. The Ge films were grown by ultrahigh vacuum chemical vapor deposition using a mixture of germane (GeH{sub 4}) and methylgermane (CH{sub 3}GeH{sub 3}) gases with a carbon concentration of less than 1 at. %, and observed surface rms roughness of 0.5 nm, as measured by atomic force microscopy. Manganese ions were implanted in epitaxial Ge films grown on Si (100) wafers to an effective concentration of 16, 12, 6, and 2 at. %. Superconducting quantum interference device measurements showed that only the three highest Mn concentration samples are ferromagnetic, while the fourth sample, with [Mn] = 2 at. %, is paramagnetic. X-ray absorption spectroscopy and x-ray magnetic circular dichroism measurements indicate that localized Mn moments are ferromagnetically coupled below the Curie temperature. Isothermal annealing of Mn-implanted Ge films with [Mn] = 16 at. % at 300 C for up to 1200 s decreases the magnetization but does not change the Curie temperature, suggesting that the amount of the magnetic phase slowly decreases with time at this anneal temperature. Furthermore, transmission electron microscopy and synchrotron grazing incidence x-ray diffraction experiments show that the Mn-implanted region is amorphous, and we believe that it is this phase that is responsible for the ferromagnetism. This is supported by our observation that high-temperature annealing leads to recrystallization and transformation of the material into a paramagnetic phase.

Guchhait, S.; Jamil, M.; Ohldag, H.; Mehta, A.; Arenholz, E.; Lian, G.; Li Fatou, A.; Ferrer, D. A.; Markert, J. T.; Colombo, L.; Banerjee, S. K.



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Energy Transfer Dynamics and Dopant Luminescence in Mn-Doped CdS/ZnS Core/Shell Nanocrystals  

E-Print Network (OSTI)

Mn-doped II-VI semiconductor nanocrystals exhibit bright dopant photoluminescence that has potential usefulness for light emitting devices, temperature sensing, and biological imaging. The bright luminescence comes from the 4T1?6A1 transition of the Mn2+ d electrons after the exciton-dopant energy transfer, which reroutes the exciton relaxation through trapping processes. The driving force of the energy transfer is the strong exchange coupling between the exciton and Mn2+ due to the confinement of exciton in the nanocrystal. The exciton-Mn spatial overlap affecting the exchange coupling strength is an important parameter that varies the energy transfer rate and the quantum yield of Mn luminescence. In this dissertation, this correlation is studied in radial doping location-controlled Mn-doped CdS/ZnS nanocrystals. Energy transfer rate was found decreasing when increasing the doping radius in the nanocrystals at the same core size and shell thickness and when increasing the size of the nanocrystals at a fixed doping radius. In addition to the exciton-Mn energy transfer discussed above, two consecutive exciton-Mn energy transfers can also occur if multiple excitons are generated before the relaxation of Mn (lifetime ~10^-4 - 10^-2 s). The consecutive exciton-Mn energy transfer can further excite the Mn2+ d electrons high in conduction band and results in the quenching of Mn luminescence. The highly excited electrons show higher photocatalytic efficiency than the electrons in undoped nanocrystals. Finally, the effect of local lattice strain on the local vibrational frequency and local thermal expansion was observed via the temperature-dependent Mn luminescence spectral linewidth and peak position in Mn-doped CdS/ZnS nanocrystals. The local lattice strain on the Mn2+ ions is varied using the large core/shell lattice mismatch (~7%) that creates a gradient of lattice strain at various radial locations. When doping the Mn2+ closer to the core/shell interface, the stronger lattice strain softens the vibrational frequency coupled to the 4T1?6A1 transition of Mn2+ (Mn luminescence) by ~50%. In addition, the lattice strain also increases the anharmonicity, resulting in larger local thermal expansion observed from the nearly an order larger thermal shift of the Mn luminescence compared to the Mn-doped ZnS nanocrystals without the core/shell lattice mismatch.

Chen, Hsiang-Yun



Ni spin switching induced by magnetic frustration in FeMn/Ni/Cu(001)  

SciTech Connect

Epitaxially grown FeMn/Ni/Cu(001) films are investigated by Photoemission Electron Microscopy and Magneto-Optic Kerr Effect. We find that as the FeMn overlayer changes from paramagnetic to antiferromagnetic state, it could switch the ferromagnetic Ni spin direction from out-of-plane to in-plane direction of the film. This phenomenon reveals a new mechanism of creating magnetic anisotropy and is attributed to the out-of-plane spin frustration at the FeMn-Ni interface.

Wu, J.; Choi, J.; Scholl, A.; Doran, A.; Arenholz, E.; Hwang, Chanyong; Qiu, Z. Q.



Quantum Anomalous Hall Effect in Hg_1-yMn_yTe Quantum Wells  

SciTech Connect

The quantum Hall effect is usually observed when the two-dimensional electron gas is subjected to an external magnetic field, so that their quantum states form Landau levels. In this work we predict that a new phenomenon, the quantum anomalous Hall effect, can be realized in Hg{sub 1-y}Mn{sub y}Te quantum wells, without the external magnetic field and the associated Landau levels. This effect arises purely from the spin polarization of the Mn atoms, and the quantized Hall conductance is predicted for a range of quantum well thickness and the concentration of the Mn atoms. This effect enables dissipationless charge current in spintronics devices.

Liu, Chao-Xing; /Tsinghua U., Beijing /Stanford U., Phys. Dept.; Qi, Xiao-Liang; /Stanford U., Phys. Dept.; Dai, Xi; Fang, Zhong; /Beijing, Inst. Phys.; Zhang, Shou-Cheng; /Stanford U., Phys. Dept.



Demonstration of molecular beam epitaxy and a semiconducting band structure for I-Mn-V compounds  

SciTech Connect

Our ab initio theory calculations predict a semiconducting band structure of I-Mn-V compounds. We demonstrate on LiMnAs that high-quality materials with group-I alkali metals in the crystal structure can be grown by molecular beam epitaxy. Optical measurements on the LiMnAs epilayers are consistent with the theoretical electronic structure. Our calculations also reproduce earlier reports of high antiferromagnetic ordering temperature and predict large, spin-orbit-coupling-induced magnetic anisotropy effects. We propose a strategy for employing antiferromagnetic semiconductors in high-temperature semiconductor spintronics.

Jungwirth, T. [Institute of Physics ASCR, v.v.i., Cukrovarnicka 10, 162 53 Praha 6 (Czech Republic); School of Physics and Astronomy, University of Nottingham, Nottingham NG7 2RD (United Kingdom); Novak, V.; Cukr, M.; Zemek, J. [Institute of Physics ASCR, v.v.i., Cukrovarnicka 10, 162 53 Praha 6 (Czech Republic); Marti, X.; Horodyska, P.; Nemec, P.; Holy, V. [Faculty of Mathematics and Physics, Charles University in Prague, Ke Karlovu 3, 121 16 Prague 2 (Czech Republic); Maca, F.; Shick, A. B.; Masek, J.; Kuzel, P. [Institute of Physics ASCR, v.v.i., Na Slovance 2, 182 21 Praha 8 (Czech Republic); Nemec, I. [Faculty of Science, Charles University in Prague, Hlavova 2030, 128 40 Prague 2 (Czech Republic); Gallagher, B. L.; Campion, R. P.; Foxon, C. T. [School of Physics and Astronomy, University of Nottingham, Nottingham NG7 2RD (United Kingdom); Wunderlich, J. [Institute of Physics ASCR, v.v.i., Cukrovarnicka 10, 162 53 Praha 6 (Czech Republic); Hitachi Cambridge Laboratory, Cambridge CB3 0HE (United Kingdom)



Anomalous Stoichiometry Layered Structure and Magnetic Ordering of the Prussian Blue Analog [NEt4]2MnII3(CN)8  

Science Conference Proceedings (OSTI)

Atypical of Prussian blue structured materials, Mn{sup II} and [NEt{sub 4}]CN react to form [NEt{sub 4}]{sub 2}Mn{sub 3}(CN){sub 8} possessing layers of octahedral [Mn{sup II}(CN){sub 6}]{sup 4-} bonded to two high-spin tetrahedral Mn{sup II} sites.

J Her; P Stephens; C Kareis; J Moore; J Miller



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



100- The Effect of Mn and Pr Co-Doping on Electrical Properties of ...  

Science Conference Proceedings (OSTI)

144- The Role of Mn Content on Microstructure and Phases of High Alloyed White Cast Irons 145- The Synergy of XRD and XRF in a Shale and Slate Analysis.


Characterization of LiNi?.?Mn?.?O? Thin Film Cathode Prepared by Pulsed Laser Deposition  

E-Print Network (OSTI)

LiNi?.?Mn?.?O? thin films have been grown by pulsed laser deposition (PLD) on stainless steel (SS) substrates. The crystallinity and structure of thin films were investigated by X-ray diffraction (XRD). Microstructure and ...

Xia, Hui


D11: Thermodynamic and Electrochemical Properties of the Mg-Mn ...  

Science Conference Proceedings (OSTI)

B7: Synthesis and Electrical Properties of K2NiF4-Type (Ca2-xLnx)MnO4 (Ln=Nd and Sm) B8: Monitoring Oxygen Diffusion in Gd-Doped Ceria by Null...


Mn solid solutions in self-assembled Ge/Si (001) quantum dot heterostructures  

SciTech Connect

Heteroepitaxial Ge{sub 0.98}Mn{sub 0.02} quantum dots (QDs) on Si (001) were grown by molecular beam epitaxy. The standard Ge wetting layer-hut-dome-superdome sequence was observed, with no indicators of second phase formation in the surface morphology. We show that Mn forms a dilute solid solution in the Ge quantum dot layer, and a significant fraction of the Mn partitions into a sparse array of buried, Mn-enriched silicide precipitates directly underneath a fraction of the Ge superdomes. The magnetic response from the ultra-thin film indicates the absence of robust room temperature ferromagnetism, perhaps due to anomalous intermixing of Si into the Ge quantum dots.

Kassim, J.; Nolph, C.; Reinke, P.; Floro, J. [Department of Materials Science and Engineering, University of Virginia, Charlottesville, Virginia 22904 (United States); Jamet, M. [Institut Nanosciences et Cryogenie/SP2M, CEA-UJF, F-38054 Grenoble (France)



Synthesis, characterization, and microwave-absorbing properties of polypyrrole/MnFe2O4 nanocomposite  

Science Conference Proceedings (OSTI)

Conductive polypyrrole (PPy)-manganese ferrite (MnFe2O4) nanocomposites with core-shell structure were synthesized by in situ polymerization in the presence of dodecyl benzene sulfonic acid (DBSA) as the surfactant and dopant and ...

Seyed Hossein Hosseini; Ahmad Asadnia



Aliovalent titanium substitution in layered mixed Li Ni-Mn-Co oxides for lithium battery applications  

Science Conference Proceedings (OSTI)

Improved electrochemical characteristics are observed for Li[Ni1/3Co1/3-yMyMn1/3]O2 cathode materials when M=Ti and ycapacity.

Kam, Kinson; Doeff, Marca M.



Electrophysical properties of semimagnetic solid solutions Hg 1?x Mn x Te  

Science Conference Proceedings (OSTI)

A comprehensive study of the electrophysical properties of the semimagnetic ternary solid solution Hg 1?x Mn x Te an alternative material to Hg 1?x Cd x Te is reported. The charge-carrier scattering

I. M. Nesmelova; V. N. Ryzhkov; M. I. Ibragimova; V. Yu. PetukhovKazan Physicotechnical Institute, Kazan Research Center of the Russian Academy of Sciences, Kazan?420029, Russia



Spin current switching and spin-filtering effects in Mn-doped boron nitride nanoribbons  

Science Conference Proceedings (OSTI)

The spin transport properties are investigated by means of the first principle approach for boron nitride nanoribbons with one or two substitutional Mn impurities, connected to graphene electrodes. The spin current polarization is evaluated using the ...

G. A. Nemnes


Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Mn Monolayer Modified Rh for Syngas-to-Ethanol Conversion: A First-Principles Study  

SciTech Connect

Rh is unique in its ability to convert syngas to ethanol with the help of promoters. We performed systematic first-principles computations to examine the catalytic performance of pure and Mn modified Rh(100) surfaces for ethanol formation from syngas. CO dissociation on the surface as well as CO insertion between the chemisorbed CH{sub 3} and the surface are the two key steps. The CO dissociation barrier on the Mn monolayer modified Rh(100) surface is remarkably lowered by {approx}1.5 eV compared to that on Rh(100). Moreover, the reaction barrier of CO insertion into the chemisorbed CH{sub 3} group on the Mn monolayer modified Rh(100) surface is 0.34 eV lower than that of methane formation. Thus the present work provides new mechanistic insight into the role of Mn promoters in improving Rh's selectivity to convert syngas to ethanol.

Li, Fengyu [University of Puerto Rico; Jiang, Deen [ORNL; Zeng, X.C. [University of Nebraska, Lincoln; Chen, Zhongfang [University of Puerto Rico



Southwest MN IPM STUFF All the pestilence that's fit to print  

E-Print Network (OSTI)

and soybeans during hot dry weather. Twospotted spider mites are favored by high temperatures and drought Southwest Research and Outreach Center 23669 130th Street Lamberton, MN 56152 Phone: 507.752.5066 Cell: 507

Amin, S. Massoud


Southwest MN IPM STUFF All the pestilence that's fit to print  

E-Print Network (OSTI)

started to show up. This could be a bad year for this disease. Cool wet spring and hot, dry late seasons Research and Outreach Center 23669 130th Street Lamberton, MN 56152 Phone: 507.752.5066 Cell: 507

Amin, S. Massoud


Formation of nano-crystalline todorokite from biogenic Mn Xiong Han Feng a,1  

E-Print Network (OSTI)

Formation of nano-crystalline todorokite from biogenic Mn oxides Xiong Han Feng a,1 , Mengqiang Zhu oxides in the environment. Additionally this method may be a viable biosynthesis route for porous, nano

Sparks, Donald L.


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural



Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure


Building of a Novel Mn12 Single Molecule Magnet by Assembly of Anisotropic  

NLE Websites -- All DOE Office Websites (Extended Search)

Building of a Novel Mn12 Single Building of a Novel Mn12 Single Molecule Magnet by Assembly of Anisotropic Triangles Building of a Novel Mn12 Single Molecule Magnet by Assembly of Anisotropic Triangles Print Wednesday, 06 July 2011 12:58 Assembly of triangular {MnIII3(O)(salox)3}+ fragments mediated by azido ligands, results in the dodecanuclear [Mn12O4(salox)12(N3)4(MeOH)4(H2O)2] complex with S = 8 ground state and SMM response. After the discovery of the Single-Molecule-Magnet (SMM) behaviour of [Mn6(O)2(salox)6(R-COO)2] (salox = salicylaldoxime, R = Me, Ph) complexes in 2004,1 the chemistry of this family of [Mn6] clusters has been studied in depth: the systematic change of the carboxylato ligands, the study of substitutedR-saloxH2 related ligands,2 the effect of variation of the oxidation state,3 the response under pressure4 or the one-dimensional assembly of [Mn6] units into chains of clusters5 with Single-Chain-Magnet behaviour in some cases,5c,d turn this system into one of the best known in the SMM field. One of the main goals of this work, developed by Brechin et al. has been to modulate the value of the ground spin level, reaching the maximum possible spin S = 12 by means of the adequate choice of methyl or ethyl substituted salicylaldoximes and the understanding of the structural features that control the coupling inside the triangles. Article Link (PDF)



SciTech Connect

The structure and chemical order of a Heusler alloy of non-stoichiometric composition Ni-Mn-Ga were studied using constant-wavelength (1.538 ) neutron diffraction at 363K and the diffraction pattern was refined using the FullProf software. At this temperature the structure is austenite (cubic) with Fm-3m space group and lattice constant of a = 5.83913(4) [ ]. The chemical order is of critical importance in these alloys, as Mn becomes antiferromagnetic when the atoms are closer than the radius of the 3d shell. In the studied alloy the refinement of the site occupancy showed that the 4b (Ga site) contained as much as 22% Mn; that significantly alters the distances between the Mn atoms in the crystal and, as a result, also the exchange energy between some of the Mn atoms. Based on the refinement, the composition was determined to be Ni1.91Mn1.29Ga0.8

Ari-Gur, Pnina [Western Michigan University; Garlea, Vasile O [ORNL



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Effects of laser irradiation on the self-assembly of MnAs nanoparticles in a GaAs matrix  

SciTech Connect

We investigate the effects of laser irradiation on the self-assembly of MnAs nanoparticles during solid-phase decomposition in a GaAs matrix. It is found that laser irradiation suppresses the growth of MnAs nanoparticles from small to large size, and that the median diameter D{sub 1} in the size distribution of small MnAs nanoparticles depends on the incident photon energy E following D{sub 1} {approx} E{sup -1/5}. We explain this behavior by the desorption of Mn atoms on the MnAs nanoparticle surface due to resonant optical absorption, in which incident photons excite intersubband electronic transitions between the quantized energy levels in the MnAs nanoparticles.

Hai, Pham Nam; Nomura, Wataru [Department of Electrical Engineering and Information Systems, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan); Yatsui, Takashi; Ohtsu, Motoichi; Tanaka, Masaaki [Department of Electrical Engineering and Information Systems, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan); Nanophotonics Research Center, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan)



Magnetic field-induced phase transformation and variant reorientation in Ni2MnGa and NiMnCoIn magnetic shape memory alloys  

E-Print Network (OSTI)

The purpose of this work is to reveal the governing mechanisms responsible for the magnetic field-induced i) martensite reorientation in Ni2MnGa single crystals, ii) stress-assisted phase transformation in Ni2MnGa single crystals and iii) phase transformation in NiMnCoIn alloys. The ultimate goal of utilizing these mechanisms is to increase the actuation stress levels in magnetic shape memory alloys (MSMAs). Extensive experimental work on magneto-thermo-mechanical (MTM) characterization of these materials enabled us to i) better understand the ways to increase the actuation stress and strain and decrease the required magnetic field for actuation in MSMAs, ii) determine the effects of main MTM parameters on reversible magnetic field induced phase transformation, such as magnetocrystalline anisotropy energy (MAE), Zeeman energy (ZE), stress hysteresis, thermal hysteresis, critical stress for the stress induced phase transformation and crystal orientation, iii) find out the feasibility of employing polycrystal MSMAs, and iv) formulate a thermodynamical framework to capture the energetics of magnetic field-induced phase transformations in MSMAs. Magnetic shape memory properties of Ni2MnGa single crystals were characterized by monitoring magnetic field-induced strain (MFIS) as a function of compressive stress and stress-induced strain as a function of magnetic field. It is revealed that the selection of the operating temperature with respect to martensite start and Curie temperatures is critical in optimizing actuator performance. The actuation stress of 5 MPa and work output of 157 kJm?3 are obtained by the field-induced variant reorientation in NiMnGa alloys. Reversible and one-way stress-assisted field-induced phase transformations are observed in Ni2MnGa single crystals under low field magnitudes (transformation and shape memory characteristics of NiMnCoIn single crystals are also studied. Reversible field-induced phase transformation is observed only under high magnetic fields (>4T). Necessary magnetic and mechanical conditions, and materials design and selection guidelines are proposed to search for field-induced phase transformation in other ferromagnetic materials that undergo thermoelastic martensitic phase transformation.

Karaca, Haluk Ersin



Categorical Exclusion Determination Form It Submit by E-_  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

It Submit by E-_ It Submit by E-_ I'llail - ] Proposed Action Title: (0672- 1610) Eaton Corporation - Highly Efficient, Nea r-Isothermal Liquid-Piston Compressor fo r Low Cost At-Home Natural Gas Refueli ng Program or Field Office: Advanced Research Projects Agency - Energy LocationCs) CCity/County/State): Southfield, MI ; Eden Prairie, MN; Minneapolis, MN; and Milwaukee, WI Proposed Action Description: Funding will support efforts to develop a highly efficient, near isothermal liquid piston compressor for low cost, at-home natu ral gas refueling Proposed work will consist of: (1) develop and optimize a concept compressor design to achieve established performance and cost targets; (2) characterize and verify the expected performance for the compressor design; and (3) develop a compressor system prototype to test proof of


Properties of Ga{sub 1-x}Mn{sub x}As with high x (>0.1)  

SciTech Connect

We have investigated the magnetic and the crystalline properties of a set of Ga{sub 1-x}Mn{sub x}As layers with high nominal Mn compositions (x=0.101-0.198). Magnetization measurements and combined channeling Rutherford backscattering (c-RBS) and particle induced x-ray emission (c-PIXE) measurements have been performed to determine the effective Mn composition x{sub eff} and the fraction of Mn atoms at various lattice sites. Here, x{sub eff} determined from magnetization measurements, which increases with increasing x, is consistent with the results determined from c-RBS-PIXE measurements.

Chiba, D. [Semiconductor Spintronics Project, Exploratory Research for Advanced Technology, Japan Science and Technology Agency, Sendai 980-0023 (Japan); Laboratory for Nanoelectronics and Spintronics, Research Institute of Electrical Communication, Tohoku University, Katahira 2-1-1, Aoba-ku, Sendai 980-8577 (Japan); Yu, K. M.; Walukiewicz, W. [Electronic Materials Program, Materials Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94549 (United States); Nishitani, Y. [Laboratory for Nanoelectronics and Spintronics, Research Institute of Electrical Communication, Tohoku University, Katahira 2-1-1, Aoba-ku, Sendai 980-8577 (Japan); Matsukura, F.; Ohno, H. [Laboratory for Nanoelectronics and Spintronics, Research Institute of Electrical Communication, Tohoku University, Katahira 2-1-1, Aoba-ku, Sendai 980-8577 (Japan); Semiconductor Spintronics Project, Exploratory Research for Advanced Technology, Japan Science and Technology Agency, Sendai 980-0023 (Japan)


Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Mn-Stabilized Zirconia: From Imitation Diamonds to a New Potential High-T{sub C} Ferromagnetic Spintronics Material  

SciTech Connect

From the basis of ab initio electronic structure calculations which include the effects of thermally excited magnetic fluctuations, we predict Mn-stabilized cubic zirconia to be ferromagnetic above 500 K. We find this material, which is well known both as an imitation diamond and as a catalyst, to be half-metallic with the majority and minority spin Mn impurity states lying in zirconia's wide gap. The Mn concentration can exceed 40%. The high-T{sub C} ferromagnetism is robust to oxygen vacancy defects and to how the Mn impurities are distributed on the Zr fcc sublattice. We propose this ceramic as a promising future spintronics material.

Ostanin, S. [Max-Planck-Institut fuer Mikrostrukturphysik, Weinberg 2, D-06120 Halle (Saale) (Germany); Department of Physics, University of Warwick, Coventry CV4 7AL (United Kingdom); Ernst, A.; Sandratskii, L. M.; Bruno, P. [Max-Planck-Institut fuer Mikrostrukturphysik, Weinberg 2, D-06120 Halle (Saale) (Germany); Daene, M.; Hergert, W.; Mertig, I. [Martin-Luther-Universitaet Halle-Wittenberg, Fachbereich Physik, D-06099 Halle (Germany); Hughes, I. D.; Staunton, J. B. [Department of Physics, University of Warwick, Coventry CV4 7AL (United Kingdom); Kudrnovsky, J. [Max-Planck-Institut fuer Mikrostrukturphysik, Weinberg 2, D-06120 Halle (Saale) (Germany); Institute of Physics, Academy of Sciences of the Czech Republic, Na Slovance 2, CZ-18221 Prague 8 (Czech Republic)



Magnetic order near 270 K in mineral and synthetic Mn 2 FeSbO 6 ilmenite  

Science Conference Proceedings (OSTI)

The structural and magnetic properties of Mn 2 FeSbO 6 single-crystalline mineral and ceramic samples synthesized under thermobaric treatment have been investigated

R. Mathieu; S. A. Ivanov; G. V. Bazuev; M. Hudl; P. Lazor; I. V. Solovyev; P. Nordblad



Flexible Zn2SnO4/MnO2 Core/Shell Nanocable-Carbon Microfiber ...  

Science Conference Proceedings (OSTI)

Presentation Title, Flexible Zn2SnO4/MnO2 Core/Shell Nanocable-Carbon Microfiber Hybrid Composites for High-Performance Supercapacitor Electrodes.


Novel Solar Energy Conversion Materials by Design of Mn(II) Oxides  

Science Conference Proceedings (OSTI)

Solar energy conversion materials need to fulfill simultaneously a number of requirements in regard of their band-structure, optical properties, carrier transport, and doping. Despite their desirable chemical properties, e.g., for photo-electrocatalysis, transition-metal oxides usually do not have desirable semiconducting properties. Instead, oxides with open cation d-shells are typically Mott or charge-transfer insulators with notoriously poor transport properties, resulting from large effective electron/hole masses or from carrier self-trapping. Based on the notion that the electronic structure features (p-d interaction) supporting the p-type conductivity in d10 oxides like Cu2O and CuAlO2 occurs in a similar fashion also in the d5 (high-spin) oxides, we recently studied theoretically the band-structure and transport properties of the prototypical binary d5 oxides MnO and Fe2O3 [PRB 85, 201202(R)]. We found that MnO tends to self-trap holes by forming Mn+III, whereas Fe2O3 self-traps electrons by forming Fe+II. However, the self-trapping of holes is suppressed by when Mn is tetrahedrally coordinated, which suggests specific routes to design novel solar conversion materials by considering ternary Mn(II) oxides or oxide alloys. We are presenting theory, synthesis, and initial characterization for these novel energy materials.

Lany, S.; Peng, H.; Ndione, P.; Zakutayev, A.; Ginley, D. S.



Carbon/lambda-MnO{sub 2} composites for supercapacitor electrodes  

Science Conference Proceedings (OSTI)

In the present work a composite of carbon with lambda-MnO{sub 2} have been synthesized by a simple two-step route. In the first step, to obtain LiMn{sub 2}O{sub 4}/carbon material, mesoporous activated carbon was impregnated with the solution of precursor metal salts and heated subsequently. As-prepared materials were acid treated which resulted in the formation of lambda-MnO{sub 2}/carbon. Physical properties, structure and specific surface area of electrode materials were studied by TEM, X-ray diffraction and nitrogen sorption measurements. Voltammetry cycling, galvanostatic charge/discharge and impedance spectroscopy measurements performed in two- and three-electrode cells have been applied in order to measure electrochemical parameters. TEM images confirmed well dispersed lambda-MnO{sub 2} particles on the surface of carbon material. The carbon in the composite plays an important role as the surface area enhancing component and a support of pseudocapacitive material. Furthermore, the through-connected porosity serves as a continuous pathway for electrolyte transport. A synergetic effect of the porous carbon framework and of the redox properties of the lambda-MnO{sub 2} is at the origin of improvement of specific capacitance values which has been observed for composites after delithiation. - Comparison of capacitance characteristics for initial carbon and synthesised composites for CB in 1 mol L{sup -1} Na{sub 2}SO{sub 4} solution.

Malak-Polaczyk, A., E-mail: agnieszka-malak@wp.p [Institute of Chemistry and Technical Electrochemistry, Poznan University of Technology, Piotrowo 3, 60-695 Poznan (Poland); Institut de Sciences des Materiaux de Mulhouse, CNRS LRC 7228, 15 Rue Starcky, 68057 Mulhouse (France); Matei-Ghimbeu, C.; Vix-Guterl, C. [Institut de Sciences des Materiaux de Mulhouse, CNRS LRC 7228, 15 Rue Starcky, 68057 Mulhouse (France); Frackowiak, E. [Institute of Chemistry and Technical Electrochemistry, Poznan University of Technology, Piotrowo 3, 60-695 Poznan (Poland)



High-Resolution Structure of the Photosynthetic Mn4Ca Catalyst from X-ray Spectroscopy  

Science Conference Proceedings (OSTI)

The application of high-resolution X-ray spectroscopy methods to study the photosynthetic water oxidizing complex, which contains a unique hetero-nuclear catalytic Mn4Ca cluster, are described. Issues of X-ray damage especially at the metal sites in the Mn4Ca cluster are discussed. The structure of the Mn4Ca catalyst at high-resolution which has so far eluded attempts of determination by X-ray diffraction, EXAFS and other spectroscopic techniques has been addressed using polarized EXAFS techniques applied to oriented PS II membrane preparations and PS II single crystals. A review of how the resolution of traditional EXAFS techniques can be improved, using methods such as range-extended EXAFS is presented, and the changes that occur in the structure of the cluster as it advances through the catalytic cycle are described. X-ray absorption and emission techniques (XANES and K? emission) have been used earlier to determine the oxidation states of the Mn4Ca cluster, and in this report we review the use of X-ray resonant Raman spectroscopy to understand the electronic structure of the Mn4Ca cluster as it cycles through the intermediate S-states.

Yachandra, Vittal; Yano, Junko; Kern, Jan; Pushkar, Yulia; Sauer, Kenneth; Glatzel, Pieter; Bergmann, Uwe; Messinger, Johannes; Zouni, Athina; Yachandra, Vittal K.



Investigation of Modified Ni-Cr-Mn Base Alloys for SOFC Interconnect Applications  

Science Conference Proceedings (OSTI)

Two Ni-Cr-W-Mn base alloys based on Haynes 230 were developed and evaluated against criteria relevant to SOFC interconnect applications, which included oxidation behavior under SOFC operating conditions, scale electrical conductivity, and thermal expansion. It was found that, similar to the ferritic stainless steel Crofer22 APU, additions of Mn led to the formation of a unique scale that was comprised of a M3O4 (M=Mn, Cr, Ni, ) spinel-rich top layer and Cr2O3-rich sub-layer. The modified alloys demonstrated reasonable oxidation resistance under SOFC operating conditions, though the Mn additions increased the scale growth rate and thus sacrificed to some extent the oxidation resistance of the base alloy (Haynes 230). The formation of a spinel-rich top layer improved the scale conductivity, especially during the early stages of oxidation, but the higher scale growth rate resulted in a higher rate of increase in the area-specific electrical resistance. Due to their FCC crystal structure, the Ni-Cr-W-Mn base alloys demonstrated a CTE that was higher than that of anode-supported cells and candidate ferritic stainless steels such as Crofer22 APU.

Yang, Z Gary; Singh, Prabhakar; Stevenson, Jeffry W.; Xia, Gordon



A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



Alison Silverstein Alison Silverstein Consulting  

E-Print Network (OSTI)

ND: 10% x 2015 SD: 10% x 2015 IA: 105 MW MN: 25% x 2025 (Xcel: 30% x 2020) MO: 15% x 2021 WI: Varies

Sheridan, Jennifer


Xcel Energy - Solar*Rewards Program and MN Made PV Rebate Program |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Xcel Energy - Solar*Rewards Program and MN Made PV Rebate Program Xcel Energy - Solar*Rewards Program and MN Made PV Rebate Program Xcel Energy - Solar*Rewards Program and MN Made PV Rebate Program < Back Eligibility Commercial Local Government Nonprofit Residential Savings Category Solar Buying & Making Electricity Maximum Rebate $90,000 (as determined by the incentive level and maximum system size) Program Info Start Date 03/01/2010 State Minnesota Program Type Utility Rebate Program Rebate Amount REC Rebate Program 2010-2012:$2.25/W DC REC Rebate Program 2013:$1.50/W DC Minnesota Made Bonus 2010-2012:Up to an additional $2.75/W DC (paired with REC Rebate) Provider Xcel Energy '''''Note: All 2012 funding for the Solar*Rewards program and Minnesota Made Bonus has been reserved as of July 11, 2012. On October 1, 2012, the


In-situ spectro-microscopy on organic films: Mn-Phthalocyanine on Ag(100)  

SciTech Connect

Metal phthalocyanines are attracting significant attention, owing to their potential for applications in chemical sensors, solar cells and organic magnets. As the electronic properties of molecular films are determined by their crystallinity and molecular packing, the optimization of film quality is important for improving the performance of organic devices. Here, we present the results of in situ low-energy electron microscopy / photoemission electron microscopy (LEEM/PEEM) studies of incorporation-limited growth [1] of manganese-phthalocyanine (MnPc) on Ag(100) surfaces. MnPc thin films were grown on both, bulk Ag(100) surface and thin Ag(100)/Fe(100) films, where substrate spin-polarized electronic states can be modified through tuning the thickness of the Ag film [2]. We also discuss the electronic structure and magnetic ordering in MnPc thin films, investigated by angle- and spin-resolved photoemission spectroscopy.

Al-Mahboob A.; Vescovo, E.; Sadowski, J.T.



Magnetism, chemical spots, and stratification in the HgMn star phi Phoenicis  

E-Print Network (OSTI)

Mercury-manganese (HgMn) stars have been considered as non-magnetic and non-variable chemically peculiar (CP) stars for a long time. However, recent discoveries of the variability in spectral line profiles suggested an inhomogeneous surface distribution of chemical elements in some HgMn stars. From the studies of other CP stars it is known that magnetic field plays a key role in the formation of surface spots. All attempts to find magnetic fields in HgMn stars yielded negative results. In this study, we investigate a possible presence of the magnetic field in phi Phe (HD 11753) and reconstruct surface distribution of chemical elements that show variability in spectral lines. We also test a hypothesis that magnetic field is concentrated in chemical spots and look into the possibility that some chemical elements are stratified with depth in the stellar atmosphere.

Makaganiuk, V; Piskunov, N; Jeffers, S V; Johns-Krull, C M; Keller, C U; Rodenhuis, M; Snik, F; Stempels, H C; Valenti, J A



Growth and Magnetic Properties of Mn-doped Germanium near the Kinetic Solubility Limit  

Science Conference Proceedings (OSTI)

Growth of high-quality dilute magnetic semiconductor (DMS) material is often compromised by the low solubility of magnetic dopants, leading to formation of precipitates. Here, we explore the feasibility of growing precipitate-free Mn-doped Ge at doping levels near the kinetic solubility limit. Ge:Mn DMS films were grown at low temperature so as to minimize precipitate formation. Meanwhile, epitaxial quality was maintained by employing a very low growth rate. The magnetic properties of these lightly doped films exhibit both interesting contrasts and similarities with those of heavily-doped DMS reported in the literature, indicating that the substitutional Mn contents are very similar. Films grown at 95 degree C are free of intermetallic precipitates, offering useful opportunities for studying the fundamentals of carrier mediated exchange and metal insulator transitions without complications arising from precipitate formation.

Ozer, Mustafa M [University of Tennessee, Knoxville (UTK); Thompson, James R [ORNL; Weitering, Harm H [ORNL



Microwave-assisted fast vapor-phase transport synthesis of MnAPO-5 molecular sieves  

Science Conference Proceedings (OSTI)

MnAPO-5 was prepared by a microwave-assisted vapor-phase transport method at 180 deg. C in short times. The products were characterized by X-ray diffraction, scanning electron microscopy, Fourier transform infrared spectra, UV-vis spectroscopic measurement, NH{sub 3}-temperature-programmed desorption and esterification reaction. It was found that dry gels prepared with aluminum isopropoxide, phosphoric acid and manganese acetate could be transferred to MnAPO-5 in the vapors of triethylamine and water by the microwave-assisted vapor-phase transport method at 180 deg. C for less than 30 min. The crystallization time was greatly reduced by the microwave heating compared with the conventional heating. The resulting MnAPO-5 exhibited much smaller particle sizes, higher surface areas and slightly higher catalytic activity in the esterification of acetic acid and butyl alcohol than those prepared by the conventional vapor-phase transport method and hydrothermal synthesis.

Shao Hui [State Key Laboratory of Materials-Oriented Chemical Engineering, College of Chemistry and Chemical Engineering, Nanjing University of Technology, Nanjing 210009 (China); Department of Chemical Engineering, Jiangsu Polytechnic University, Changzhou 213016 (China); Yao Jianfeng; Ke Xuebin [State Key Laboratory of Materials-Oriented Chemical Engineering, College of Chemistry and Chemical Engineering, Nanjing University of Technology, Nanjing 210009 (China); Zhang Lixiong [State Key Laboratory of Materials-Oriented Chemical Engineering, College of Chemistry and Chemical Engineering, Nanjing University of Technology, Nanjing 210009 (China)], E-mail: lixiongzhang@yahoo.com; Xu Nanping [State Key Laboratory of Materials-Oriented Chemical Engineering, College of Chemistry and Chemical Engineering, Nanjing University of Technology, Nanjing 210009 (China)



Neutron and X-ray diffraction studies on the high temperature phase of Mn{sub 3}(VO{sub 4}){sub 2}, the new isostructural compound NaMn{sub 4}(VO{sub 4}){sub 3} and their mixed crystals Na{sub x}Mn{sub 4.5-x/2}(VO{sub 4}){sub 3} (0{<=}x{<=}1)  

SciTech Connect

This paper presents a detailed structure analysis (combined Rietveld analysis of X-ray and neutron powder diffraction data as well as quantum mechanical calculations) of the high temperature phase of Mn{sub 3}(VO{sub 4}){sub 2} (space group I4 Macron 2d). Special attention is directed to the analysis of the local coordination around Mn{sup 2+} ions or vacancies within a stella quadrangula configuration of anions. Furthermore, the new compound NaMn{sub 4}(VO{sub 4}){sub 3} is described as well as a range of mixed crystals between NaMn{sub 4}(VO{sub 4}){sub 3} and Mn{sub 3}(VO{sub 4}){sub 2} (described by the formula Na{sub x}Mn{sub 4.5-x/2}(VO{sub 4}){sub 3}, 0{<=}x{<=}1) which were synthesized by a solid state route. All compounds were shown to be isostructural to the high temperature phase Mn{sub 3}(VO{sub 4}){sub 2}. - Graphical abstract: The crystal structure of the new compound NaMn{sub 4}(VO{sub 4}){sub 3}. Highlights: Black-Right-Pointing-Pointer We present neutron and X-ray diffraction studies on high temperature-Mn{sub 3}(VO{sub 4}){sub 2}. Black-Right-Pointing-Pointer Structural details of partly filled stellae quadrangulae positions are discussed. Black-Right-Pointing-Pointer Refined structural parameters and theoretical calculations are compared. Black-Right-Pointing-Pointer We investigate the mixed crystal system Mn{sub 3}(VO{sub 4}){sub 2}-NaMn{sub 4}(VO{sub 4}){sub 3}.

Clemens, Oliver [Universitaet des Saarlandes, Institut fuer Anorganische und Analytische Chemie und Radiochemie, Am Markt, Zeile 5, 66125 Saarbruecken (Germany)] [Universitaet des Saarlandes, Institut fuer Anorganische und Analytische Chemie und Radiochemie, Am Markt, Zeile 5, 66125 Saarbruecken (Germany); Haberkorn, Robert [Universitaet des Saarlandes, Anorganische Festkoerperchemie, Am Markt, Zeile 3, 66125 Saarbruecken (Germany)] [Universitaet des Saarlandes, Anorganische Festkoerperchemie, Am Markt, Zeile 3, 66125 Saarbruecken (Germany); Springborg, Michael [Universitaet des Saarlandes, Physikalische und Theoretische Chemie, Campus B2 2, 66123 Saarbruecken (Germany)] [Universitaet des Saarlandes, Physikalische und Theoretische Chemie, Campus B2 2, 66123 Saarbruecken (Germany); Beck, Horst Philipp, E-mail: hp.beck@mx.uni-saarland.de [Universitaet des Saarlandes, Institut fuer Anorganische und Analytische Chemie und Radiochemie, Am Markt, Zeile 5, 66125 Saarbruecken (Germany)



Stoichiometric growth of high Curie temperature heavily alloyed GaMnAs  

SciTech Connect

Heavily alloyed, 100 nm Ga{sub 1-x}Mn{sub x}As (x>0.1) films are obtained via low-temperature molecular beam epitaxy by utilizing a combinatorial technique which allows systematic control of excess arsenic during growth. Reproducible electronic, magnetic, and structural properties are optimized in a narrow range of stoichiometric growth conditions. In contrast to a prediction of the Zener model of hole-mediated ferromagnetism, the Curie temperature of the stoichiometric material is independent of x (for x>0.1), while substitutional Mn content is proportional to x within a large window of growth conditions.

Mack, S.; Myers, R. C.; Heron, J. T.; Gossard, A. C.; Awschalom, D. D. [Center for Spintronics and Quantum Computation, University of California, Santa Barbara, California 93106 (United States)



Ultrafast Enhancement of Ferromagnetism via Photoexcited Holes inGaMnAs  

SciTech Connect

We report on the observation of ultrafast photo-enhanced ferromagnetism in GaMnAs. It is manifested as a transient magnetization increase on a 100-ps time scale, after an initial sub-ps demagnetization. The dynamic magnetization enhancement exhibits a maximum below the Curie temperature {Tc} and dominates the demagnetization component when approaching {Tc}. We attribute the observed ultrafast collective ordering to the p-d exchange interaction between photoexcited holes and Mn spins, leading to a correlation-induced peak around 20K and a transient increase in {Tc}.

Wang, J.; Cotoros, I.; Dani, K.M.; Liu, X.; Furdyna, J.K.; Chemla, D.S.



Relaxation of photoinduced spins and carriers in ferromagnetic InMnSb films  

SciTech Connect

The authors report time resolved measurements and control of photoinduced spin and carrier relaxations in InMnSb ferromagnetic films with 2% Mn content (grown by low-temperature molecular beam epitaxy) using femtosecond laser pulses, and compare them to analogous measurements on InBeSb and InSb films. In this work, magneto-optical Kerr effect and standard pump-probe techniques provided a direct measure of the photoexcited spin and carrier lifetimes, respectively. They observe decrease in relaxations times in the high laser fluence regime and an absence of temperature dependence of the relaxation times.

Nontapot, K.; Kini, R. N.; Gifford, A.; Merritt, T. R.; Khodaparast, G. A.; Wojtowicz, T.; Liu, X.; Furdyna, J. K. [Department of Physics, Virginia Tech, Blacksburg, Virginia 24061 (United States); Institute of Physics, Polish Academy of Sciences, 02-668 Warsaw (Poland); Department of Physics, University of Notre Dame, Notre Dame, Indiana 46556 (United States)



Fabrication of (Mn,Co)3O4 Surface Coatings onto Alloy Substrates  

DOE Green Energy (OSTI)

Ferritic stainless steels are promising candidates for IT-SOFC interconnect applications due to their low cost and resistance to oxidation at SOFC operating temperatures. However, several challenges remain, including long term electrical conductivity and surface stability under interconnect exposure conditions and chromia scale evaporation. One means of extending interconnect lifetime and improving performance is to apply a protective coating, such as (Mn,Co)3O4 spinel, to the cathode side of the interconnect. These coatings have proven effective in reducing scale growth kinetics and Cr volatility. This report describes several procedures developed at PNNL for fabricating (Mn,Co)3O4 spinel coatings onto ferritic stainless steels.

Yang, Zhenguo; Xia, Guanguang; Li, Xiaohong S.; Singh, Prabhakar; Stevenson, Jeffry W.



Multisegmented Au-MnO2/Carbon Nanotube Hybrid Coaxial Arrays for High-Power Supercapacitor Applications  

E-Print Network (OSTI)

Multisegmented Au-MnO2/Carbon Nanotube Hybrid Coaxial Arrays for High-Power SupercapacitorVised Manuscript ReceiVed: NoVember 4, 2009 The present work reports on synthesis and supercapacitor applications hybrid coaxial arrays are efficient electrodes for supercapacitor applications. Au-segmented MnO2/CNT

Ajayan, Pulickel M.

Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Growth of single-crystal {alpha}-MnO{sub 2} nanorods on multi-walled carbon nanotubes  

Science Conference Proceedings (OSTI)

Single-crystal {alpha}-MnO{sub 2} nanorods were grown on multi-walled carbon nanotubes (MWNTs) in H{sub 2}SO{sub 4} aqueous solution. The morphology and microstructure of the composites were examined by transmission electron microscopy, high-resolution transmission electron microscopy (HRTEM), X-ray diffractometry and energy dispersive spectroscopy (EDS). The results show that {alpha}-MnO{sub 2} single-crystal nanorods with a mean diameter of 15 nm were densely grown on the surface of MWNTs. Those MWNTs/MnO{sub 2} composites were used as an electrode material for supercapacitors, and it was found that the supercapacitor performance using MWNTs/MnO{sub 2} composites was improved largely compared to that using pure MWNTs and {alpha}-MnO{sub 2} nanorod mechanically mixed with MWNTs.

Chen Yong [Shenyang National Laboratory for Materials Science, Institute of Metal Research, Chinese Academy of Sciences, 72 Wenhua Road, Shenyang 110016 (China); Key Laboratory of Tropic Biological Resources, MOE, Hainan University, 58 Renmin Road, Haikou 570228 (China); Liu Chenguang; Liu Chang [Shenyang National Laboratory for Materials Science, Institute of Metal Research, Chinese Academy of Sciences, 72 Wenhua Road, Shenyang 110016 (China); Lu Gaoqing [ARC Centre for Functional Nanomaterials, Australian Institute of Bioengineering and Nanotechnology, University of Queensland, QLD 4072 (Australia); Cheng Huiming [Shenyang National Laboratory for Materials Science, Institute of Metal Research, Chinese Academy of Sciences, 72 Wenhua Road, Shenyang 110016 (China)], E-mail: cheng@imr.ac.cn



Effect of solution hardening on the shape memory effect of Fe-Mn based alloys  

SciTech Connect

Fe-high Mn-Si alloys, which undergo {gamma} (fcc) to {var_epsilon} (hcp) martensitic transformation, exhibit a pronounced shape memory effect. The origin of shape memory effect of these alloys is the reversion of stress-induced {var_epsilon} martensite. A shape change must hence be accomplish3ed by stress-induced martensitic transformation without permanent slip in austenite ({gamma}) in order to obtain a good shape memory effect. It is clear that the intrusion of permanent slip can be suppressed by increasing the strength of austenite and by decreasing the applied stress required for a shape change due to stress-induced martensitic transformation. It has been reported that the addition of the interstitial elements of C and N as well as the substitutional elements of Mo and V increases the 0.2% proof stress of austenite in Fe-high Mn alloys. However, there have been few studies on the effect of these alloying elements on the shape memory effect of Fe-high Mn based alloys. In the present study, it was aimed to improve the shape memory effect of Fe-high Mn based alloys by the strengthening of austenite through solution hardening due to C and Mo.

Tsuzaki, K.; Natsume, Y.; Maki, T. [Kyoto Univ. (Japan). Dept. of Materials Science and Engineering; Tomota, Y. [Ibaraki Univ., Hitachi (Japan)



Magnetic characterizations of sol-gel-produced mn-doped ZnO  

Science Conference Proceedings (OSTI)

Nanoparticles of ZnO doped with 6 at.% Mn were produced by a sol-gel method. X-ray diffraction confirms the hexagonal structure as that of the parent compound ZnO, and high-resolution electron transmission microscopy reveals a single-crystallite lattice. ...

R. Asmatulu; H. Haynes; M. Shinde; Y. H. Lin; Y. Y. Chen; J. C. Ho




E-Print Network (OSTI)

It is argued that the magnetic behavior of Sr2MnMoO6 is determined by the existence of two total energy minima corresponding to the metallic ferromagnetic and insulating antiferromagnetic states, which may be nearly degenerate depending on the magnitude of the breathing distortion. PACS: 71.20.Be; 71.70.Gm; 72.25.Ba; 75.30.Et

I. V. Solovyev



Electrodeposition of Mn-Co Alloys on Stainless Steels for SOFC Interconnect Application  

Science Conference Proceedings (OSTI)

Chromium-containing ferritic stainless steels are the most popular materials for solid oxide fuel cell (SOFC) interconnect applications because of its oxidation resistance and easy fabrication process. However, excessive scale growth and chromium evaporation will degrade the cell performance. Highly conductive coatings that resist oxide scale growth and chromium evaporation may prevent both of these problems. Mn1.5Co1.5O4 spinel is one of the most promising coatings for interconnect application because of its high conducitivy, good chromium retention capability, as well as good CTE match. Electroplating of alloys or thin film multilayers followed by controlled oxidation to the desired spinel phase offers an additional deposition option. In the present study binary Mn/Co alloys was fabricated by electrodeposition, and polarization curves were used to characterize the cathodic reactions on substrate surface. By controlling the current density precisely, coatings with Mn/Co around 1:1 has been successfully deposited in Mn/Co =10 solutions, SEM and EDX was used to characterize the surface morphology and composition.

Wu, J. (West Virginia University); Jiang, Y. (West Virginia University); Johnson, C.; Gong, M. (West Virginia University); Liu, X. (West Virginia University)



Modulation on Ni{sub 2}MnGa(001) surface  

SciTech Connect

We report periodic modulation on (001) surface of Ni2MnGa ferromagnetic shape memory alloy. For the stoichiometric surface, analysis of the low energy electron diffraction (LEED) spot profiles shows that the modulation is incommensurate. The modulation appears at 200 K, concomitant with the first order structural transition to the martensitic phase.

D'Souza, S. W.; Rai, Abhishek; Nayak, J.; Maniraj, M.; Dhaka, R. S.; Barman, S. R.; Schlagel, D. L.; Lograsso, T. A. [UGC-DAE Consortium for Scientific Research, Khandwa Road, Indore, 452001, Madhya Pradesh (India); Ames Laboratory U. S. DOE, Iowa State University, Ames, Iowa 50011-3020 (United States)



Cycling performance of nanocrystalline LiMn2O4 thin films via electrophoresis  

Science Conference Proceedings (OSTI)

The present study demonstrates a novel approach by which titanium foils coated with LiMn2O4 nanocrystals can be processed into a high-surface-area electrode for rechargeable batteries. A detailed study has been performed to elucidate ...

S. Parvathy; R. Ranjusha; K. Sujith; K. R. V. Subramanian; N. Sivakumar; Shantikumar V. Nair; Avinash Balakrishnan



Frustration and multiferroic behavior in Ca3CoMnO6  

Science Conference Proceedings (OSTI)

Lu{sub 2}MnCoO{sub 6} and Ca{sub 3}MnCoO{sub 6} satisfy one of the primary goals of multiferroics research, namely ferromagnetic-like magnetization coupled to ferroelectric-like polarization. Thus the mechanism for magnetoelectric coupling in these materials deserves careful study. New data shows that the physics of these compound may be related to the classic 'ANNNI' model. Frustration between ferromagnetic nearest-neighbor and antiferromagnetic next-nearest-neighbor interactions between Ising spins creates an 'up up down down' magnetic structure in zero magnetic field, along c-axis chains that consist of alternating Co and Mn ions. In applied magnetic fields 'up up down,' 'up up up down' and other metastable variations can evolve, yielding hysteretic ferromagnetic-like magnetization. The key is that the phase slips between regions of 'up' and 'down' carries an electric polarization due to broken spatial inversion symmetry. Thus these phase slips can be manipulated with both electric and magnetic fields. The result is a profusion of magnetic and electric states that are closely-spaced in temperature, electric, and magnetic field. We present experimental studies of the magnetic, electric, and structural properties of these two compounds. We include very new data up to 100 Ton Ca{sub 3}CoMnO{sub 6} that resolves a key controversy of over the magnetic structure and the size of the moments.

Zapf, Vivien [Los Alamos National Laboratory



Hydrogen Storage in a Microporous Metal-Organic Framework with Exposed Mn2+ Coordination Sites  

E-Print Network (OSTI)

Hydrogen Storage in a Microporous Metal-Organic Framework with Exposed Mn2+ Coordination Sites and 90 bar, which at 60 g H2/L provides a storage density 85% of that of liquid hydrogen. The material-358. (2) EERE: Hydrogen, Fuel Cells, & Infrastructure Technologies Program Homepage, www.eere.energy


Aliovalent titanium substitution in layered mixed Li Ni-Mn-Co oxides for lithium battery applications  

SciTech Connect

Improved electrochemical characteristics are observed for Li[Ni1/3Co1/3-yMyMn1/3]O2 cathode materials when M=Ti and y<0.07, compared to the baseline material, with up to 15percent increased discharge capacity.

Kam, Kinson; Doeff, Marca M.



Southwest MN IPM STUFF All the pestilence that's fit to print  

E-Print Network (OSTI)

in heavily infested fields in the near future. Hatch will continue for some time,. After a hot, humid day and Outreach Center 23669 130th Street Lamberton, MN 56152 Phone: 507.752.5066 Cell: 507.276.1184 Fax: 507

Amin, S. Massoud


Southwest MN IPM STUFF All the pestilence that's fit to print  

E-Print Network (OSTI)

of fields (hot spots) or field edges. Alate aphids depositing nymphs can rapidly increase the percentage for larva in square foot areas on the ground. During hot weather armyworms may hide under litter. In small 130th Street Lamberton, MN 56152 Phone: 507.752.5066 Cell: 507.276.1184 Fax: 507.752.5097 E

Amin, S. Massoud


Southwest MN IPM STUFF All the pestilence that's fit to print  

E-Print Network (OSTI)

indeed treated and the infestation was not a localized hot spot, this may signal the beginning of the end 23669 130th Street Lamberton, MN 56152 Phone: 507.752.5066 Cell: 507.276.1184 Fax: 507.752.5097 E

Amin, S. Massoud


Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan



Local atomic and electronic structure in LaMnO{sub 3} across the orbital ordering transition  

SciTech Connect

The local atomic disorder and electronic structure in the environment of manganese atoms in LaMnO{sub 3} has been studied by x-ray absorption spectroscopy over a temperature range (300-870 K) covering the orbital ordering transition ({approx}710 K). The Mn-O distance splitting into short and long bonds (1.95 and 2.15 A) is kept across the transition temperature, so that the MnO{sub 6} octahedra remain locally Jahn-Teller distorted. Discontinuities in the Mn local structure are identified in the extended x-ray fine structure spectra at this temperature, associated with a reduction of the disorder in the superexchange angle and to the removal of the anisotropy in the radial disorder within the coordination shell. Subtle changes in the electronic local structure also take place at the Mn site at the transition temperature. The near-edge spectra show a small drop of the Mn 4p hole count and a small enhancement in the pre-edge structures at the transition temperature. These features are associated with an increase of the covalence of the Mn-O bonds. Our results shed light on the local electronic and structural phenomena in a model of order-disorder transition, where the cooperative distortion is overcome by the thermal disorder.

Souza, Raquel A.; Souza-Neto, Narcizo M.; Ramos, Aline Y.; Tolentino, Helio C.N.; Granado, Eduardo [Laboratorio Nacional de Luz Sincrotron (LNLS), P.O. Box 6192, 13084-971, Campinas, Sao Paulo, Brazil and (Brazil); Instituto de Fisica Gleb Wataghin, IFGW-UNICAMP, Campinas, SP (Brazil); Laboratorio Nacional de Luz Sincrotron (LNLS), P.O. Box 6192, 13084-971, Campinas, Sao Paulo, Brazil and (Brazil); Departamento de Fisica dos Materiais e Mecanica, DFMT-IF-USP, Sao Paulo, SP (Brazil); Laboratorio Nacional de Luz Sincrotron (LNLS), P.O. Box 6192, 13084-971, Campinas, Sao Paulo, Brazil and (Brazil); Laboratoire de Mineralogie-Cristallographie de Paris, LMCP-UMR 7590-CNRS, Paris (France); Laboratorio Nacional de Luz Sincrotron (LNLS), P.O. Box 6192, 13084-971, Campinas, Sao Paulo (Brazil); Laboratorio Nacional de Luz Sincrotron (LNLS), P.O. Box 6192, 13084-971, Campinas, Sao Paulo, Brazil and (Brazil); Instituto de Fisica Gleb Wataghin, IFGW-UNICAMP, Campinas, SP (Brazil)



In situ synchrotron x-ray studies of LiMn{sub 2}O{sub 4} cathodes  

DOE Green Energy (OSTI)

LiCoO{sub 2} cathodes are now used in most commercial lithium ion batteries. LiMn{sub 2}O{sub 4} is an attractive low cost alternative. However, it is difficult to make reproducibly. At Brookhaven National Laboratory two in situ synchrotron x-ray techniques, that are available at the National Synchrotron Light Source (NSLS), have been used to investigate LiMn{sub 2}O{sub 4}. The techniques are x-ray absorption and high resolution x-ray diffraction. With x-ray absorption it is possible to follow the changes in the Mn oxidation state and the changes in the Mn-O and Mn-Mn bond lengths on cycling. Also it is possible to detect amorphous phases. The high energy x-rays at the diffraction Beam Lines at the NSLS (up to 24 KeV) permit in situ x-ray diffraction, in the transmission mode, in thin lithium and lithium ion cells. The evolution of the structural chances that occur on cycling can be followed. These in situ measurements were done on Li/LiMn{sub 2}O{sub 4} cells with a liquid electrolyte (1 M LiPF{sub 6} in a 1:1:3 PC:EC:DMC solvent).

McBreen, J.; Mukerjee, S.; Yang, X.Q. [and others



Electrochemical and structural characterization of titanium-substituted manganese oxides based on Na0.44MnO2  

DOE Green Energy (OSTI)

A series of titanium-substituted manganese oxides, Li{sub x}Ti{sub y}Mn{sub 1-y}O{sub 2} (y = 0.11, 0.22, 0.33, 0.44, and 0.55) with the Na{sub 0.44}MnO{sub 2} structure were prepared from Na{sub x}Ti{sub y}Mn{sub 1-y}O{sub 2} (x {approx} 0.44) precursors. The electrochemical characteristics of these compounds, which retain the unique double-tunnel structure during ion exchange, were examined in lithium/polymer electrolyte cells operating at 85 C. All of the substituted cathode materials intercalated lithium reversibly, with Li{sub x}Ti{sub 0.22}Mn{sub 0.78}O{sub 2} exhibiting the highest capacity in polymer cells, about 10-20% greater than that of unsubstituted Li{sub x}MnO{sub 2} made from Na{sub 0.44}MnO{sub 2}. In common with Li{sub x}MnO{sub 2}, the Ti-substituted materials exhibited good capacity retention over one hundred or more cycles, with some compositions exhibiting a fade rate of less than 0.03% per cycle.

Doeff, Marca M.; Richardson, Thomas J.; Hwang, Kwang-Taek



Magnetic order near 270 K in mineral and synthetic Mn{sub 2}FeSbO{sub 6} ilmenite  

SciTech Connect

The structural and magnetic properties of Mn{sub 2}FeSbO{sub 6} single-crystalline mineral and ceramic samples synthesized under thermobaric treatment have been investigated, and compared to theoretical predictions based on first-principles electronic structure calculations. This ilmenite system displays a sharp magnetic transition just below the room temperature related to a ferrimagnetic ordering of the Mn{sup 2+} and Fe{sup 3+} cations, which makes Mn{sub 2}FeSbO{sub 6} a promising candidate for designing functional magnetic materials.

Mathieu, R.; Hudl, M.; Nordblad, P. [Department of Engineering Sciences, Uppsala University, Box 534, SE-75121 Uppsala (Sweden); Ivanov, S. A. [Department of Engineering Sciences, Uppsala University, Box 534, SE-75121 Uppsala (Sweden); Department of Inorganic Materials, Karpov' Institute of Physical Chemistry, Vorontsovo pole, 10 105064, Moscow K-64 (Russian Federation); Bazuev, G. V. [Institute of Solid-State Chemistry, Ural Branch of the Russian Academy of Science, 620999, Ekaterinburg GSP-145 (Russian Federation); Lazor, P. [Department of Earth Sciences, Uppsala University, Villavaegen 16, SE-75236 Uppsala (Sweden); Solovyev, I. V. [National Institute for Materials Science, 1-2-1 Sengen, Tsukuba, Ibaraki 305-0047 (Japan)



In situ X-ray absorption fine structure studies of a manganese dioxide electrode in a rechargeable MnO{sub 2}/Zn alkaline battery environment  

DOE Green Energy (OSTI)

Electronic and structural aspects of a MnO{sub 2} electrode in a rechargeable MnO{sub 2}/Zn battery environment have been investigated by in situ Mn K-edge X-ray absorption fine structure (XAFS). The relative amplitudes of the three major Fourier transform shells of the EXAFS (extended XAFS) function of the rechargeable MnO{sub 2} electrode in the undischarged state were found to be similar to those found for ramsdellite, a MnO{sub 2} polymorph with substantial corner-sharing linkages among the basic MnO{sub 6} octahedral units. The analyses of the background-subtracted pre-edge peaks and absorption edge regions for the nominally 1-e{sup {minus}} discharged electrode were consistent with Mn{sup 3+} as being the predominant constituent species, rather than a mixture of Mn{sup 4+} and Mn{sup 2+} sites. Furthermore, careful inspection of both the XANES (X-ray absorption near edge structure) and EXAFS indicated that the full recharge of MnO, which had been previously discharged either by a 1- or 2-equivalent corner-sharing linkages compared to the original undischarged MnO{sub 2}.

Mo, Y.; Hu, Y.; Bae, I.T.; Miller, B.; Scherson, D.A. [Case Western Reserve Univ., Cleveland, OH (United States). Dept. of Chemistry; Antonio, M.R. [Argonne National Lab., IL (United States). Chemistry Div.



X-ray spectroscopic study of the charge state and local orderingof room-temperature ferromagnetic Mn oped ZnO  

Science Conference Proceedings (OSTI)

The charge state and local ordering of Mn doped into a pulsed laser deposited single-phase thin film of ZnO are investigated by using X-ray absorption spectroscopy at the O K-, Mn K- and L-edges, and X-ray emission spectroscopy at the O K- and Mn L-edge. This film is found to be ferromagnetic at room temperature. EXAFS measurement shows that Mn{sup 2+} replaces Zn site in tetrahedral symmetry, and there is no evidence for either metallic Mn or MnO in the film. Upon Mn doping, the top of O 2p valence band extends into the bandgap indicating additional charge carries being created.

Guo, J.-H.; Gupta, Amita; Sharma, Parmanand; Rao, K.V.; Marcus,M.A.; Dong, C.L.; Guillen, J.M.O.; Butorin, S.M.; Mattesini, M.; Glans,P.A.; Smith, K.E.; Chang, C.L.; Ahuja, R.


Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


The preparation of carbon nanotube/MnO2 composite fiber and its application to flexible micro-supercapacitor  

Science Conference Proceedings (OSTI)

In recent years, flexible electronic devices pursued for potential applications. The design and the fabrication of a novel flexible nanoarchitecture by coating electrical conductive MWCNT fiber with ultrathin films of MnO2 to achieve high ...

Li Li, Chen Chen, Jing Xie, Zehuai Shao, Fuxin Yang



Preparation of Mn{sub 2}SnO{sub 4} nanoparticles as the anode material for lithium secondary battery  

Science Conference Proceedings (OSTI)

The ultrafine Mn{sub 2}SnO{sub 4} nanoparticles with diameters of 5-10 nm have been prepared by thermal decomposition of precursor MnSn(OH){sub 6}. The MnSn(OH){sub 6} nanoparticles precursor was synthesized by a hydrothermal microemulsion method. X-ray diffraction, transmission electron microscopy, high-resolution transmission electron microscopy and electron diffraction have been employed to characterize the crystal structures and morphologies of the as-prepared samples. High-resolution transmission electron microscopy observations revealed that the as-synthesized nanoparticles were single crystals. The thermal characterization was studied by differential thermal analysis and thermogravimetry analysis measurements. Electrochemical test showed that the Mn{sub 2}SnO{sub 4} nanoparticles exhibited a high initial charge-discharge capacity of 1320 mAh/g.

Lei Shuijin [School of Materials Science and Engineering, Nanchang University, No. 999, Xuefu Avenue Honggutan New District, Nanchang, Jiangxi 330031 (China)], E-mail: shjlei@ncu.edu.cn; Tang Kaibin [Nanomaterial and Nanochemistry, Hefei National Laboratory for Physical Sciences at Micro-scale, University of Science and Technology of China, Hefei, Anhui 230026 (China)], E-mail: kbtang@ustc.edu.cn; Chen Chunhua; Jin Yi [Department of Materials Science and Engineering, University of Science and Technology of China, Hefei, Anhui 230026 (China); Zhou Lang [School of Materials Science and Engineering, Nanchang University, No. 999, Xuefu Avenue Honggutan New District, Nanchang, Jiangxi 330031 (China)



Synthesis and Electrochemical Properties of Monoclinic LiMnBO[subscript 3] as a Li Intercalation Material  

E-Print Network (OSTI)

We investigated the structural stability and electrochemical properties of LiMnBO3 in the hexagonal and monoclinic form with ab initio computations and, for the first time, report electrochemical data on monoclinic ...

Kim, Jae Chul


Synthesis and Electrochemical Properties of Monoclinic LiMnBO[subscript 3] as a Li Intercalation Material  

E-Print Network (OSTI)

We investigated the structural stability and electrochemical properties of LiMnBO[subscript 3] in the hexagonal and monoclinic form with ab initio computations and, for the first time, report electrochemical data on ...

Kim, Jae Chul


Thermal Stabilities of Delithiated Olivine MPO[subscript 4] (M=Fe,Mn) Cathodes investigated using First Principles Calculations  

E-Print Network (OSTI)

We present an analysis of the thermal reduction of delithiated LiMnPO[subscript 4] and LiFePO[subscript 4] based on the quarternary phase diagrams as calculated from first principles. Our results confirm the recent ...

Ong, Shyue Ping


Electrode properties of Mn2O3 nanospheres synthesized by combined sonochemical/solvothermal method for use in electrochemical capacitors  

Science Conference Proceedings (OSTI)

We report here an efficient single step combined sonochemical and solvothermal synthesis process to obtain bulk quantities of nanospherical particles of cubic Mn2O3 and characterized its pseudocapacitive characteristics in relevance ...

Teressa Nathan; Michael Cloke; S. R. S. Prabaharan



Electrochemical and structural characterization of titanium-substituted manganese oxides based on Na0.44MnO2  

E-Print Network (OSTI)

by heating them in a molten salt- mixture of 68-mol% LiNOtakes place during the molten salt exchange. Because the850 C. c) prepared by molten salt exchange of Na x Ti y Mn

Doeff, Marca M.; Richardson, Thomas J.; Hwang, Kwang-Taek



Synthesis and Electrochemical Characterization of M2Mn3O8 (M=Ca, Cu) Compounds and Derivatives  

E-Print Network (OSTI)

surprising, because the molten salt environment at elevatedthe product of the molten salt reaction can be considered tothat is formed during the molten salt reaction with Ca 2 Mn

Park, Yong Joon; Doeff, Marca M.



RECIPIENT:Minnesota Department of Commerce, Office of Energy Security SEP ARRA STATE: MN  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Minnesota Department of Commerce, Office of Energy Security SEP ARRA STATE: MN Minnesota Department of Commerce, Office of Energy Security SEP ARRA STATE: MN PROJECT TITLE: SEP - Residential Ground Source Heat Pump Installation - Schmitz, Mary C. Funding Opportunity Announcement Number DE FOA 0000052 Procurement Instrument Number EE0000164 NEPA Control Number cm Number GFO-0000164-018 0 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical


File:USDA-CE-Production-GIFmaps-MN.pdf | Open Energy Information  

Open Energy Info (EERE)

MN.pdf MN.pdf Jump to: navigation, search File File history File usage Minnesota Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 311 KB, MIME type: application/pdf) Description Minnesota Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Minnesota External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,650 × 1,275 (311 KB) MapBot (Talk | contribs) Automated bot upload


Charge Melting & Polaron Collapse in LA1.2SR1.8MN207  

NLE Websites -- All DOE Office Websites (Extended Search)

Charge Melting & Polaron Collapse in LA1.2SR1.8MN207 Charge Melting & Polaron Collapse in LA1.2SR1.8MN207 Recent studies carried out on the Synchrotron Radiation Instrumentation Collaborative Access Team's beamline I-ID-C at the Advanced Photon Source provide new insights into charge melting and polaron collapse. X-ray and neutron scattering measurements directly demonstrate the existence of polarons in the paramagnetic phase of optimally doped colossal magnetoresistive oxides. The polarons exhibit short-range correlations that grow with decreasing temperature, but disappear abruptly at the ferromagnetic transition because of the sudden charge delocalization. The "melting" of the charge ordering as we cool through TC occurs with the collapse of the quasistatic polaron scattering, and provides important new



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MN-IAGEMENT CENTER MN-IAGEMENT CENTER NEPA DETERMINATION Page 1 of4 RECIPIENT:A1aska Energy Authority STATE: AK PROJECT TITLE: Alaska Wind Energy PrOject Funding Opportunity Announcement Number PnK:urcmcntlnstrumcnl Numbcr NEPA Control Number CID Number DE-FG-36-05GOO85038 DE-FG-36-05GOO85038 GFO-G085038-002 G085038 Bastd on my review orthe information concuning the proposed adion, as NEPA Compliance Officer (authorized under DOE Order 45 1.IA), I have made the following determination: ex, EA. [IS APPENDIX AND NUMBER: Description: 61 .19 Microwave, Siting, construction, modification. operation, and removal of microwave, radio communication, and meteorological , meteorological towers and assOCIated facilities, prOVided that the towers and associated facilitJes would


Optical transitions in MnGa{sub 2}Se{sub 4}  

Science Conference Proceedings (OSTI)

The dependence of the absorption coefficient on incident photon energy in a MnGa{sub 2}Se{sub 4} single crystal has been investigated in the temperature range 110-295 K. Using group-theory analysis of the electron state symmetry and comparison of the symmetry of the energy spectrum of MnGa{sub 2}Se{sub 4} and its isoelectronic analogs, a conclusion about the character of optical transitions has been drawn. It is shown that the features observed at 2.31 and 2.45 eV are related to the intracenter transitions {sup 6}A{sub 1}{sup 1} {yields} {sup 4}T{sub 2}({sup 4}G) and {sup 6}A{sub 1}{sup 2} {yields} {sup 4}T{sub 2}({sup 4}G). The {sup 6}A{sub 1} state is split by the crystal field.

Tagiev, B. G.; Kerimova, T. G., E-mail: ktaira@physics.ab.az; Tagiev, O. B.; Asadullayeva, S. G.; Mamedova, I. A. [National Academy of Sciences of Azerbaijan, Institute of Physics (Azerbaijan)



Structural and magnetic properties of MBE grown GeMnN2 thin films  

Science Conference Proceedings (OSTI)

Epitaxial GeMnN{sub 2} thin films are synthesized by plasma-assisted molecular beam epitaxy. Transmission electron microscopy and x-ray diffraction measurements confirm that it is the orthorhombic variant, consistent with the predictions of first-principles calculations. The magnetic properties of the films are related to defects, with samples grown under Ge-rich conditions exhibiting a net magnetic moment above room temperature. These results are explained by first-principles calculations, indicating that the preferential substitution of one magnetic sublattice of GeMnN{sub 2} by impurities and/or intrinsic defects such as Ge antisites produces a net magnetic moment in an antiferromagnetic background, and also introduces spin-polarized carriers near the Fermi level.

Liu, Y [University of Wisconsin, Milwaukee; Lazarov, V. K. [University of Wisconsin, Milwaukee; Cheung, S.H. [University of Wisconsin, Milwaukee; Keavney, D.J. [Argonne National Laboratory (ANL); Gai, Zheng [ORNL; Gajdardziska-Josifovska, M [University of Wisconsin, Milwaukee; Weinert, M [University of Wisconsin, Milwaukee; Li, Lian [University of Wisconsin, Milwaukee



High capacitive performance of nanostructured Mn-Ni-Co oxide composites for supercapacitor  

SciTech Connect

Nanostructured Mn-Ni-Co oxide composites (MNCO) were prepared by thermal decomposition of the precursor obtained by chemical co-precipitation of Mn, Ni and Co salts. The chemical composition and morphology were characterized by X-ray diffraction (XRD), energy dispersive spectroscopy (EDS) and scanning electron microscopy (SEM). The electrochemical capacitance of MNCO electrode was examined by cyclic voltammetry, impedance and galvanostatic charge-discharge measurements. The results showed that MNCO electrode exhibited the good electrochemical characteristics. A maximum capacitance value of 1260 F g{sup -1} could be obtained within the potential range of -0.1 to 0.4 V versus saturated calomel electrode (SCE) in 6 mol L{sup -1} KOH electrolyte.

Luo Jianmin [Institute of Applied Chemistry, Xinjiang University, Urumqi 830046 (China); Gao Bo [College of Material Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 210016 (China); Zhang Xiaogang [College of Material Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 210016 (China)], E-mail: azhangxg@163.com



Irradiation-controlled giant magnetoresistance of PtMn-based spin valve  

Science Conference Proceedings (OSTI)

He{sup +}-ion irradiation resulted in the direct ordering of PtMn without postannealing. Samples were irradiated with 2 MeV He{sup +} ions and a beam current of 1.08 {mu}A/cm{sup 2} such that the corresponding surface temperature was 190 deg. C. The exchange bias direction was set in situ during irradiation in a field of 900 Oe. A high giant magnetoresistance (GMR) ratio of 11% was obtained in PtMn-based spin valves after He{sup +} irradiation. The GMR is completely eliminated after it is irradiated with oxygen ions at 42 keV. Combining He{sup +} with oxygen-ion irradiation can provide magnetic patterning for GMR sensors.

Huang, S.-H.; Lai, C.-H.; Chiang, C. C.; Yang, C.-H. [Department of Materials Science and Engineering, National Tsing Huang University, 101, Section 2, Kuang Fu Road, Hsinchu, Taiwan 30013 (China)



FTIR and Raman Study of LixTiyMn1-y2(y=0,0.11) Cathodes in  

NLE Websites -- All DOE Office Websites (Extended Search)

FTIR and Raman Study of LixTiyMn1-y2(y=0,0.11) Cathodes in FTIR and Raman Study of LixTiyMn1-y2(y=0,0.11) Cathodes in Pyrrolidinium-based Ionic Liquid Electrolyte Systems Title FTIR and Raman Study of LixTiyMn1-y2(y=0,0.11) Cathodes in Pyrrolidinium-based Ionic Liquid Electrolyte Systems Publication Type Journal Article Year of Publication 2009 Authors Hardwick, Laurence J., Juliette A. Saint, Ivan T. Lucas, Marca M. Doeff, and Robert Kostecki Journal J. Electrochemical Society Volume 156 Issue 2 Pagination A120-A127 Keywords electrochemical electrodes, Fourier transform spectra, infrared spectra, lithium compounds, manganese compounds, Raman spectra, titanium compounds Abstract This work demonstrates the protective effect of partial titanium substitution in LixTi0.11Mn0.89O2 against surface decomposition in room-temperature ionic liquid (RTILs) cells. Raman microscopy and reflectance Fourier transform IR (FTIR) spectroscopy were used to analyze electrodes recovered from cycled Li/LixTiyMn1-yO2 (y=0,0.11) cells containing the 0.5mol/kg LiTFSI in P13FSI RTIL electrolyte. [TFSI=bis(trifluoromethanesulfonyl)imide .] Raman and FTIR spectra of cycled LixMnO2 cathodes showed many distinct bands that can be attributed to both the electrolyte and electrode decomposition products. The thickness of the amorphous porous layer on the LixMnO2 cathode increased during cycling. The surface degradation of LixMnO2 and precipitation of electrolyte decomposition products contributed to the film growth. Improved cycling behavior was observed in cells containing LixTi0.11Mn0.89O2 , yet Raman spectroscopy also showed possible surface degradation. The FTIR spectra of cycled LixMnO2 and LixTi0.11Mn0.89O2 cathodes displayed bands characteristic for LiSO3CF3 and Li2NSO2CF3 , which originate from the reaction of the TFSI anion with traces of water present in the cell.


LiFe(x)Mn(1-x)PO(4): A Cathode for Lithium-ion Batteries  

DOE Green Energy (OSTI)

The high redox potential of LiMnPO{sub 4}, {approx}4.0 vs. (Li{sup +}/Li), and its high theoretical capacity of 170 mAh g{sup -1} makes it a promising candidate to replace LiCoO{sub 2} as the cathode in Li-ion batteries. However, it has attracted little attention because of its severe kinetic problems during cycling. Introducing iron into crystalline LiMnPO{sub 4} generates a solid solution of LiFe{sub x}Mn{sub 1-x}PO{sub 4} and increases kinetics; hence, there is much interest in determining the Fe-to-Mn ratio that will optimize electrochemical performance. To this end, we synthesized a series of nanoporous LiFe{sub x}Mn{sub 1-x}PO{sub 4} compounds (with x = 0, 0.05, 0.1, 0.15, and 0.2), using an inexpensive solid-state reaction. The electrodes were characterized using X-ray diffraction and energy-dispersive spectroscopy to examine their crystal structure and elemental distribution. Scanning-, tunneling-, and transmission-electron microscopy (viz., SEM, STEM, and TEM) were employed to characterize the micromorphology of these materials; the carbon content was analyzed by thermogravimetric analyses (TGAs). We demonstrate that the electrochemical performance of LiFe{sub x}Mn{sub 1-x}PO{sub 4} rises continuously with increasing iron content. In situ synchrotron studies during cycling revealed a reversible structural change when lithium is inserted and extracted from the crystal structure. Further, introducing 20% iron (e.g., LiFe{sub 0.2}Mn{sub 0.8}PO{sub 4}) resulted in a promising capacity (138 mAh g{sup -1} at C/10), comparable to that previously reported for nano-LiMnPO{sub 4}.

J Hong; F Wang; X Wang; J Graetz



Modeling, synthesis and characterization of LiMn{sub 2}O{sub 4} spinels  

DOE Green Energy (OSTI)

The authors report on an integrated program to understand the fundamentals of LiMn{sub 2}O{sub 4} performance as a cathode for lithium ion rechargeable batteries. Specifically, this program is designed to address the effects of doping on the crystal chemistry, lattice constants, and electrochemical performance. The work is being expanded to include studies on LiCoO{sub 2} and LiNiO{sub 2}.

Doughty, D.H.; Ingersoll, D.; Cygan, R.T.; Westrich, H.R.; Rodriguez, M.A.; Boyle, T.J.; Voigt, J.A. [Sandia National Labs., Albuquerque, NM (United States); Johnson, B.J. [3M Co., St. Paul, MN (United States). Specialty Chemicals Div.


Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Elastic Properties of the Zintl Ferromagnet Yb14MnSb11  

SciTech Connect

We report measurements of the elastic moduli as a function of temperature (5-300) K and magnetic field (0-2 T) for the Zintl ferromagnet Yb{sub 14}MnSb{sub 11}, which is believed to be a rare example of an underscreened Kondo lattice. The elastic moduli measured below the Curie temperature in this complex ferromagnet exhibit unusual lattice stiffening that is independent of the magnetic field and can be adequately modeled using the Landau theory.

Bhattacharya, Sriparna [University of Tennessee, Knoxville (UTK); Marinescu, D. C. [Clemson University; Morris, James R [ORNL; Sergienko, Ivan A [ORNL; Sales, Brian C [ORNL; Mandrus, D. [University of Tennessee, Knoxville (UTK) & Oak Ridge National Laboratory (ORNL); Keppens, V. [University of Tennessee, Knoxville (UTK)



Annealing effect on the giant magnetoresistance of La-Ca-Mn-O thin films  

SciTech Connect

Thin films of perovskite-like (La,Ca)MnO{sub {delta}} with (001) orientation were grown epitaxially on (100) MgO substrates by a simple facing-target sputtering technique. The as-deposited films already possess a significant low field giant magnetoresistance. Further post-annealing experiments on these samples indicate that the high electrical resistivity is not a prerequisite of the giant magnetoresistance effect.

Zeng, X.T.; Wong, H.K. [Chinese Univ. of Hong Kong, Chatin (Hong Kong). Physics Dept.



Inhomogeneous distribution of mercury on the surfaces of rapidly rotating HgMn stars  

E-Print Network (OSTI)

Starspots are usually associated with the action of magnetic fields at the stellar surfaces. However, recently an inhomogeneous chemical distribution of mercury was found for the mercury-manganese (HgMn) star alpha And -- a well-established member of a non-magnetic subclass of the chemically peculiar stars of the upper main sequence. In this study we present first results of the high-resolution survey of the HgII 3984 resonance line in the spectra of rapidly rotating HgMn stars with atmospheric parameters similar to those of alpha And. We use spectrum synthesis modelling and take advantage of the Doppler resolution of the stellar surfaces to probe horizontal structure of mercury distribution. Clear signatures of spots are found in the HgII 3984 line profiles of HR 1185 and HR 8723. Two observations of the latter star separated by two days give evidence for the line profile variability. We conclude that inhomogeneous distribution of Hg is a common phenomenon for the rapidly rotating HgMn stars in the 13000--13800 K effective temperature range independently of the stellar evolutionary stage. These results establish existence of a new class of spectrum variable spotted B-type stars. It is suggested that the observed Hg inhomogeneities arise from dynamical instabilities in the chemical diffusion processes and are unrelated to magnetic phenomena.

O. Kochukhov; N. Piskunov; M. Sachkov; D. Kudryavtsev



Redox Active Layer-by-Layer Structures containing MnO2 Nanoparticles  

Science Conference Proceedings (OSTI)

Nanoscale materials provide unique properties that will enable new technologies and enhance older ones. One area of intense activity in which nanoscale materials are being used is in the development of new functional materials for battery applications. This effort promises superior materials with properties that circumvent many of the problems associated with traditional battery materials. Previously we have worked on several approaches for using nanoscale materials for application as cathode materials in rechargeable Li batteries. Our recent work has focused on synthesizing MnO2 nanoparticles and using these in layer-by-layer (LbL) structures to probe the redox properties of the nanoparticles. We show that the aqueous colloidal nanoparticles produced by butanol reduction of tetramethylammonium permanganate can be trapped in thin films using a layer-by-layer deposition approach, and that these films are both redox active and exhibit kinetically facile electrochemical responses. We show cyclic voltammetry of MnO2 colloidal nanoparticles entrapped in a LbL thin film at an ITO electrode surface using poly(diallyldimethylammonium chloride) (PDDA). CV experiments demonstrate that Li+ insertion accompanies Mn(IV) reduction in LiClO4 supporting electrolytes, and that reduction is hindered in supporting electrolytes containing only tetrabutylammonium cations. We also show that electron propagation through multilayer films is facile, suggesting that electrons percolate through the films via electron exchange between nanoparticles.

Bazito, Fernanda; O'Brien, Robert; Buttry, Daniel A.



Thin-film Li-LiMn{sub 2}O{sub 4} batteries  

DOE Green Energy (OSTI)

Thin-film rechargeable Li-LiMn{sub 2}O{sub 4} batteries have been fabricated and characterized. Following deposition by electron beam evaporation of LiMn{sub 2}O{sub 4}, the amorphous as-deposited cathode films 1 cm{sup 2} in area by 0.3 to 4 {mu}m thick were annealed at 700{degree}C to 800{degree}C in oxygen in order to form the crystalline spinel phase. The capacity of the cells between 4.5 V to 3.8 V depended on the annealing conditions and ranged from 50 {mu}Ah/mg to 120 {mu}Ah/mg. When cycled over this range, the batteries exhibited excellent secondary performance with capacity losses as low as 0.001% per cycle. On charging to 5.3 V, a plateau with a median voltage of 5.1 V was observed. The total charge extracted between 3.8 V to 5.3 V corresponded to about 1Li/Mn{sub 2}O{sub 4}.

Bates, J.B.; Lubben, D.; Dudney, N.J.



Development of (Mn,Co)3O4 Protection Layers for Ferritic Stainless Steel Interconnects  

DOE Green Energy (OSTI)

A spinel-based surface protection layer has been developed for alloy SOFC current collectors and bi-polar gas separators. The (Mn,Co)3O4 spinel with a nominal composition of Mn1.5Co1.5O4 demonstrates an excellent electrical conductivity and thermal expansion match to ferritic stainless steel interconnects. A slurry-coating technique provides a viable approach for fabricating protective layers of the spinel onto the steel interconnects. Thermally grown protection layers of Mn1.5Co1.5O4 have been found not only to significantly decrease the contact resistance between a LSF cathode and stainless steel interconnect, but also inhibits the sub-scale growth on the stainless steel. The combination of the inhibited sub-scale growth, good thermal expansion matching between the spinel and the stainless steel, and the closed-pore structure contribute to the excellent structural and thermomechanical stability of these spinel protection layers, which was verified by a long-term thermal-cycling test. The spinel protection layers can also act effectively to prevent outward diffusion of chromium from the interconnect alloy, preventing subsequent chromium migration into the cathode and contact materials. PNNL is currently engaged in studies intended to optimize the composition, microstructure, and fabrication procedure for the spinel protection layers.

Yang, Zhenguo; Simner, Steven P.; Singh, Prabhakar; Xia, Guanguang; Stevenson, Jeffry W.



Investigation of the Charge Collection Efficiency of CdMnTe Radiation Detectors  

SciTech Connect

This paper presents the growth, fabrication and characterization of indium-doped cadmium manganese telluride (CdMnTe) crystals grown by the vertical Bridgman technique. The 10 x 10 x 1.9 mm{sup 3} samples have been fabricated, and the charge collection properties of the CdMnTe detectors have been measured. Alpha-particle spectroscopy measurements have yielded an average charge collection efficiency approaching 100%. Ion beam induced charge (IBIC) measurements have been performed by raster scanning focused 5.5 MeV {sup 4}He beams onto the detectors. Spatially resolved charge collection efficiency maps have been produced for a range of detector bias voltages. Inhomogeneities in the charge transport of the CdMnTe crystals have been associated with chains of Te inclusions within the detector bulk, and the reduction in charge collection efficiency in their locality has been quantified. It has been shown that the role of Te inclusions in degrading charge collection is reduced with increasing values of bias voltage. IBIC measurements for a range of low biases have highlighted the evolution of the charge collection uniformity across the detectors.

Bolotnikov A.; Rafiei, R.; Boardman, D.; Sarbutt, A.; Prokopovich, A.; Kim, K.; Reinhard, M.I.; James, R.B.



Carriers-mediated ferromagnetic enhancement in Al-doped ZnMnO dilute magnetic semiconductors  

SciTech Connect

Nano-crystalline Zn{sub 0.95-x}Mn{sub 0.05}Al{sub x}O (x = 0, 0.05, 0.10) dilute magnetic semiconductors (DMS) were synthesized by sol-gel derived auto-combustion. X-ray diffraction (XRD) analysis shows that the samples have pure wurtzite structure typical of ZnO without the formation of secondary phases or impurity. Crystallite sizes were approximated by Scherrer formula while surface morphology and grain sizes were measured by field emission scanning electron microscopy. Incorporation of Mn and Al into the ZnO structure was confirmed by energy-dispersive X-ray analysis. Temperature dependent electrical resistivity measurements showed a decreasing trend with the doping of Al in ZnMnO, which is attributable to the enhancement of free carriers. Vibrating sample magnetometer studies confirmed the presence of ferromagnetic behavior at room temperature. The results indicate that Al doping results in significant variation in the concentration of free carriers and correspondingly the carrier-mediated magnetization and room temperature ferromagnetic behavior, showing promise for practical applications. We attribute the enhanced saturation magnetization and electrical conductivity to the exchange interaction mediated by free electrons.

Saleem, Murtaza [Centre of Excellence in Solid State Physics, University of the Punjab, Lahore-54590 (Pakistan); Siddiqi, Saadat A. [Centre of Excellence in Solid State Physics, University of the Punjab, Lahore-54590 (Pakistan); Interdisciplinary Research Centre in Biomedical Materials (IRCBM), COMSATS Institute of Information Technology, Defence Road, Off Raiwind Road, Lahore (Pakistan); Atiq, Shahid, E-mail: shahidatiqpasrur@yahoo.com [Centre of Excellence in Solid State Physics, University of the Punjab, Lahore-54590 (Pakistan); Anwar, M. Sabieh; Hussain, Irshad [School of Science and Engineering (SSE), Lahore University of Management Sciences (LUMS), Opposite Sector U, D.H.A. Lahore Cantt-54792 (Pakistan); Alam, Shahzad [Pakistan Council for Scientific and Industrial Research (PCSIR) Laboratories Complex, Lahore (Pakistan)



Mn-doped Ga(As,P) and (Al,Ga)As ferromagnetic semiconductors: Electronic structure calculations  

E-Print Network (OSTI)

A remarkable progress towards functional ferromagnetic semiconductor materials for spintronics has been achieved in p-type (Ga,Mn)As. Robust hole-mediated ferromagnetism has, however, been observed also in other III-V hosts such as antimonides, GaP, or (Al,Ga)As, which opens a wide area of possibilities for optimizing the host composition towards higher ferromagnetic Curie temperatures. Here we explore theoretically hole-mediated ferromagnetism and Mn incorporation in Ga(As,P) and (Al,Ga)As ternary hosts. While alloying (Ga,Mn)As with Al has only a small effect on the Curie temperature we predict a sizable enhancement of Curie temperatures in the smaller lattice constant Ga(As,P) hosts. Mn-doped Ga(As,P) is also favorable, as compared to (Al,Ga)As, with respect to the formation of carrier and moment compensating interstitial Mn impurities. In (Ga,Mn) (As,P) we find a marked decrease of the partial concentration of these detrimental impurities with increasing P content.

Masek, J.; Kudrnovsky, J.; Maca, F.; Sinova, Jairo; MacDonald, A. H.; Campion, R. P.; Gallagher, B. L.; Jungwirth, T.



Fischer Tropsch synthesis : influence of Mn on the carburization rates and activities of Fe-based catalysts by TPR-EXAFS/XANES and catalyst testing.  

Science Conference Proceedings (OSTI)

Fe-based catalysts containing different amounts of Mn were tested for Fischer-Tropsch synthesis using a stirred tank reactor at 270 C, 1.21 MPa, and H{sub 2}:CO = 0.7. Catalyst activation by carburization with 10% CO/He was followed by Temperature Programmed Reduction/X-ray Absorption Spectroscopy (TPR-EXAFS/XANES) from room temperature to 300 C. {gamma}-Fe{sub 2}O{sub 3} was converted into iron carbides, whereas MnO{sub x} was reduced to oxygen deficient MnO. Mn hindered Fe carburization, such that the carburized catalyst displayed higher Fe{sub 3}O{sub 4} content than the catalyst without Mn. EXAFS fitting indicates that the carburized catalyst contained a mixture of Hgg carbide, Fe{sub 3}O{sub 4}, and Mn oxides. Increasing Mn content led to higher CH{sub 4} and light product selectivities, and lower light olefin selectivities. Higher and stable conversions were obtained with a catalyst containing an almost equimolar Fe/Mn ratio relative to the catalyst without Mn. Selectivity trends are attributed to the higher WGS rates observed on the FeMn catalysts, consistent with the structural differences observed.

Ribeiro, M. C.; Jacobs, G.; Pendyala, R.; Davis, B. H.; Cronauer, D. C.; Kropf, A. J.; Marshall, C. L. (Chemical Sciences and Engineering Division); (Univ. of Kentucky)



Ab initio calculations and synthesis of the off-stoichiometric half-Heusler phase Ni{sub 1-x}Mn{sub 1+x}Sb  

SciTech Connect

We perform a combined theoretical and experimental study of the phase stability and magnetism of the off-stoichiometric Ni{sub 1-x}Mn{sub 1+x}Sb in the half-Heusler crystal phase. Our work is motivated by the need for strategies to engineer the magnetism of potentially half-metallic materials, such as NiMnSb, for improved performance at elevated temperatures. By means of ab initio calculations we investigate Ni{sub 1-x}Mn{sub 1+x}Sb over the whole composition range 0{<=}x{<=}1 of Ni replacing Mn and show that at relevant temperatures, the half-Heusler phase should be thermodynamically stable up to at least x=0.20 with respect to the competing C38 structure of Mn{sub 2}Sb. Furthermore we find that half-Heusler Ni{sub 1-x}Mn{sub 1+x}Sb retains half-metallic band structure over the whole concentration range and that the magnetic moments of substitutional Mn{sub Ni} atoms display magnetic exchange interactions an order of magnitude larger than the Ni-Mn interaction in NiMnSb. We also demonstrate experimentally that the alloys indeed can be created by synthesizing off-stoichiometric Ni{sub 1-x}Mn{sub 1+x}Sb films on MgO substrates by means of magnetron sputtering.

Ekholm, M.; Larsson, P.; Alling, B.; Helmersson, U.; Abrikosov, I. A. [Department of Physics, Chemistry and Biology (IFM), Linkoeping University, SE-58183 Linkoeping (Sweden)



Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


Why MnIn{sub 2}O{sub 4} spinel is not a transparent conducting oxide?  

SciTech Connect

The title compound has been synthesized by a citrate technique. The crystal structure has been investigated at room temperature from high-resolution neutron powder diffraction (NPD) data. It crystallizes in a cubic spinel structure, space group Fd3-bar m, Z=8, with a=9.0008(1) A at 295 K. It exhibits a crystallographic formula (Mn{sub 0.924(2)}In{sub 0.076(2)}){sub 8a}(In{sub 1.804(2)}Mn{sub 0.196(2)}){sub 16d}O{sub 4}, where 8a and 16d stand for the tetrahedral and octahedral sites of the spinel structure, respectively, with a slight degree of inversion, {lambda}=0.08. MnIn{sub 2}O{sub 4} shows antiferromagnetic interactions below T{sub N} Almost-Equal-To 40 K, due to the statistical distribution of Mn ions over the two available sites. Unlike the related MgIn{sub 2}O{sub 4} and CdIn{sub 2}O{sub 4} spinels, well known as transparent conducting oxides, MnIn{sub 2}O{sub 4} is not transparent and shows a poor conductivity ({sigma}=0.38 S cm{sup -1} at 1123 K): the presence of Mn ions, able to adopt mixed valence states, localizes the charges that, otherwise, would be delocalized in the spinel conduction band. - Graphical Abstract: From NPD data the crystallographic formula (Mn{sub 0.924(2)}In{sub 0.076(2)}){sub 8a}(In{sub 1.804(2)}Mn{sub 0.196(2)}){sub 16d}O{sub 4}, shows a slight degree of inversion, {lambda}=0.08 and a certain In deficiency. The presence of Mn ions, able to adopt mixed oxidation states, localize the charges that, otherwise, would be delocalized in the spinel conduction band; the presence of localized Mn{sup 2+} and Mn{sup 3+} ions provides the characteristic brown color. Highlights: Black-Right-Pointing-Pointer Accurate structural determination from NPD data: inversion degree (8%), and In deficiency. Black-Right-Pointing-Pointer Bond-valence indicates Mn{sup 2+}-Mn{sup 3+} ions; edge-sharing octahedra contain 90% In{sup 3+}+10% Mn{sup 3+} cations. Black-Right-Pointing-Pointer Conductivity several orders of magnitude lower than those of MgIn{sub 2}O{sub 4} or CdIn{sub 2}O{sub 4}. Black-Right-Pointing-Pointer Variability of Mn oxidation states cancels any electron-doping effect, emptying conduction band of mobile charge carriers. Black-Right-Pointing-Pointer Curie-Weiss behavior confirming the determined charge distribution.

Martinez-Lope, M.J. [Instituto de Ciencia de Materiales de Madrid, C.S.I.C., Cantoblanco E-28049 Madrid (Spain); Retuerto, M. [Instituto de Ciencia de Materiales de Madrid, C.S.I.C., Cantoblanco E-28049 Madrid (Spain); Department of Chemistry, Rutgers State University of New Jersey, Piscataway, NJ 08854-8087 (United States); Calle, C. de la [Instituto de Ciencia de Materiales de Madrid, C.S.I.C., Cantoblanco E-28049 Madrid (Spain); Porcher, Florence [Laboratoire Leon Brillouin, CEA/Saclay, 91191 Gif Sur Ivette Cedex, France. (France); Alonso, J.A., E-mail: ja.alonso@icmm.csic.es [Instituto de Ciencia de Materiales de Madrid, C.S.I.C., Cantoblanco E-28049 Madrid (Spain)



In situ XRD Studies of Li-ion Cells with Mixed LiMn2O4 and LiCo1/3Ni1/3Mn1/3O2 Composite Cathode  

Science Conference Proceedings (OSTI)

The structural changes of the composite cathode made by mixing spinel LiMn2O4 and layered LiNi1/3Co1/3Mn1/3O2 in 1:1 wt% in both Li-half and Li-ion cells during charge/discharge are studied by in situ XRD. During the first charge up to {approx}5.2 V vs. Li/Li+, the in situ XRD spectra for the composite cathode in the Li-half cell track the structural changes of each component. At the early stage of charge, the lithium extraction takes place in the LiNi1/3Co1/3Mn1/3O2 component only. When the cell voltage reaches at {approx}4.0 V vs. Li/Li+, lithium extraction from the spinel LiMn2O4 component starts and becomes the major contributor for the cell capacity due to the higher rate capability of LiMn2O4. When the voltage passed 4.3 V, the major structural changes are from the LiNi1/3Co1/3Mn1/3O2 component, while the LiMn2O4 component is almost unchanged. In the Li-ion cell using a MCMB anode and a composite cathode cycled between 2.5 V and 4.2 V, the structural changes are dominated by the spinel LiMn2O4 component, with much less changes in the layered LiNi1/3Co1/3Mn1/3O2 component, comparing with the Li-half cell results. These results give us valuable information about the structural changes relating to the contributions of each individual component to the cell capacity at certain charge/discharge state, which are helpful in designing and optimizing the composite cathode using spinel- and layered-type materials for Li-ion battery research.

Nam, K.; Yoon, W; Shin, H; Chung, K; Choi, S; Yang, X



Growth kinetics and micromorphology of NH{sub 4}Cl:Mn{sup 2+} crystals formed in the NH{sub 4}Cl-MnCl{sub 2}-H{sub 2}O-CONH{sub 3} system  

Science Conference Proceedings (OSTI)

The growth kinetics and elementary growth processes on the surface of NH{sub 4}Cl:Mn{sup 2+} heterogeneous crystals formed in the NH{sub 4}Cl-MnCl{sub 2}-H{sub 2}O-CONH{sub 3} system are experimentally studied. It is found that a change in the composition of complexes in an NH{sub 4}Cl crystal from Mn(NH{sub 4}){sub 2}Cl{sub 4} {center_dot} 2H{sub 2}O to MnCl{sub 2} {center_dot} 2CONH{sub 3} leads to the occurrence of a local maximum in the kinetic curve and a change in the shape of dislocation growth centers from flat to conical. The growth kinetics of {l_brace}100{r_brace} faces of heterogeneous NH{sub 4}Cl:Mn{sup 2+} crystals is described within the Bliznakov model using the Fowler-Guggenheim adsorption isotherm, which takes into account the lateral interaction of adsorbed particles.

Pyankova, L. A., E-mail: lyuba_pyan@mail.ru; Punin, Yu. O.; Bocharov, S. N.; Shtukenberg, A. G. [Petersburg State University (Russian Federation)



Probing The Electrode/Electrolyte Interface in The Lithium Excess Layered Oxide Li1.2Ni0.2Mn0.6O2  

Science Conference Proceedings (OSTI)

A detailed surface investigation of the lithium-excess nickel manganese layered oxide Li1.2Ni0.2Mn0.6O2 structure was carried out using x-ray photoelectron spectroscopy (XPS), total electron yield and transmission x-ray absorption spectroscopy (XAS), and electron energy loss spectroscopy (EELS) during the first two electrochemical cycles. All spectroscopy techniques consistently showed the presence of Mn4+ in the pristine material and a surprising reduction of Mn at the voltage plateau during the first charge. The Mn reduction is accompanied by the oxygen loss revealed by EELS. Upon the first discharge, the Mn at the surface never fully returns back to Mn4+. The electrode/electrolyte interface of this compound consists of the reduced Mn at the crystalline defect-spinel inner layer and an oxidized Mn species simultaneously with the presence of a superoxide species in amorphous outer layer. This proposed model signifies that oxygen vacancy formation and lithium removal result in electrolyte decomposition and superoxide formation, leading to Mn activation/dissolution and surface layer-spinel phase transformation. The results also indicate that the role of oxygen is complex and significant in contributing to the extra capacity of this class of high energy density cathode materials.

Carroll, Kyler J [University of California, San Diego; Qian, Danna [University of California, San Diego; Fell, Chris [University of Florida, Gainesville; Calvin, Scott [Sarah Lawrence College; Veith, Gabriel M [ORNL; Chi, Miaofang [ORNL; Dudney, Nancy J [ORNL; Meng, Ying Shirley [University of California, San Diego



In situ and ex situ spectroelectrochemical and X-ray absorption studies on rechargeable, chemically-modified and other MnO{sub 2} materials  

DOE Green Energy (OSTI)

A combined series of in situ and ex situ UV spectroelectrochemical and X-ray absorption studies have been made on MnO{sub 2}, chemically-modified by small amounts of Bi(III), and comparatively on other MnO{sub 2} materials such as a blank (Bi-free) and {gamma}-MnO{sub 2}. These procedures are applied in order to follow the oxidation-states of Bi and of Mn during the course of discharge and recharge of MnO{sub 2} as a battery cathode material, and the extents of rechargeability that can be achieved with such materials. Presence of Bi appears to provide a preferred ``heterogeneous`` discharge/recharge pathway involving a soluble Mn(III) intermediate, over the alternative ``electron-proton`` hopping, solid-state mechanism. From XAS results, it is concluded that presence of Bi, although not affecting the O-coordination, does influence the Mn-Mn coordination, determining the way the MnO{sub 2} coordination octahedra are connected.

Conway, B.E.; Qu, D.; McBreen, J. [Ottawa Univ., ON (Canada). Dept. of Chemistry]|[Brookhaven National Lab., Upton, NY (United States)



Effect of Mn Substitution for Multiferroic BiFeO3 Probed by High-Resolution Soft-X-Ray Spectroscopy  

E-Print Network (OSTI)

sensor devices. low electrical resistivity, which affectstemperature. The low electrical resistivity of BF thin filmsFurthermore, the electrical resistivity also increases by Mn

Hattori, T.



Novel synthesis process and structure refinements of Li{sub 4}Mn{sub 5}O{sub 12} for rechargeable lithium batteries  

DOE Green Energy (OSTI)

Well crystallized Li4Mn5O12 was prepared from LiOAc-Mn(NO3)2 under flowing oxygen. Rietveld refinement with XRD and neutron powder diffraction indicated that Li4Mn5O12 has cubic spinel structure in which the Li ions occupy both the tetrahedral sites 8a and part of the octahedral sites 16d but not the 16c sites, while all the Mn ions occupy the 16d sites of the space group Fd{bar 3}m. The lattice parameter was found to be sensitive to synthesis temperature owing to variation in Mn valence. Sample prepared at 500 C showed better electrode performance: a rechargeable capacity of 135 mAh/g for the cell Li/Li4Mn5O12 at cell voltages 2.5-3.6 V. It is found that Mn oxidation state in Li4Mn5O12 has a strong effect on electrode performance of Li/Li4Mn5O12 cell.

Takada, Toshimi; Hayakawa, Hiroshi; Akiba, Etsuo [National Inst. of Materials and Chemical Research, Tsukuba, Ibaraki (Japan); Izumi, Fujio [National Inst. for Research in Inorganic Materials, Tsukuba (Japan); Chakoumakos, B.C. [Oak Ridge National Lab., TN (United States)



" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Computers and Other Electronics in Homes in Midwest Region, Divisions, and States, 2009" 9 Computers and Other Electronics in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Computers and Other Electronics",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Computers" "Number of Computers" 0,27.4,6.7,4.7,1.1,1.1,0.6,2,2,0.6,1,0.5

Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Fuels Used and End Uses in Homes in Midwest Region, Divisions, and States, 2009" 9 Fuels Used and End Uses in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Fuels Used and End Uses",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Fuels Used for Any Use" "Electricity",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

HC4.9 Televisions in Homes in Midwest Region, Divisions, and States, 2009" HC4.9 Televisions in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Televisions",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Televisions" "Number of Televisions" 0,1.5,0.3,0.2,"Q","Q","Q","Q",0.1,"Q","Q","Q"


Related Links | Building Energy Codes Program  

NLE Websites -- All DOE Office Websites (Extended Search)

Related Links Related Links Regional Energy Efficiency Organizations MEEA NEEP NEEA SEEA SWEEP SPEER Midwest Energy Efficiency Alliance (MEEA) IL, IN, IA, KS, KY, ND, NE, MI, MN, MO, OH, SD, WI The Midwest Energy Efficiency Alliance (MEEA) is a collaborative network advancing energy efficiency in the Midwest to support sustainable economic development and environmental preservation. MEEA raises awareness, facilitates energy efficiency programs and strengthens policy across the nine-state region. MEEA brings together a respected network of members, partners, board and staff, and inspires others to create new technologies, new products and new ways of thinking when it comes to energy efficiency. Codes Contact Isaac Elnecave Senior Policy Manager ielnecave@mwalliance.org phone: (312)784-7253


Wind Program: Stakeholder Engagement and Outreach  

Wind Powering America (EERE)

Outreach Outreach Printable Version Bookmark and Share The Stakeholder Engagement and Outreach initiative of the U.S. Department of Energy's Wind Program is designed to educate, engage, and enable critical stakeholders to make informed decisions about how wind energy contributes to the U.S. electricity supply. Highlights Resources Wind Resource Maps State Activities What activities are happening in my state? AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Installed wind capacity maps. Features A image of a house with a residential-scale small wind turbine. Small Wind for Homeowners, Farmers, and Businesses Stakeholder Engagement & Outreach Projects


Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Structural and Geographic Characteristics of Homes in Midwest Region, Divisions, and States, 2009" 9 Structural and Geographic Characteristics of Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" "Structural and Geographic Characteristics",,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" ,,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Urban and Rural2" "Urban",88.1,19.9,14.6,4.1,2.9,1.8,5.8,5.3,1.6,2.4,1.4


Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2007 (Million Cubic Feet) Nigeria Algeria 37,483 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports.


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Household Demographics of Homes in Midwest Region, Divisions, and States, 2009" 9 Household Demographics of Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Household Demographics",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Number of Household Members" "1 Person",31.3,7.4,5.1,1.4,1,0.6,2.1,2.3,0.6,1.1,0.6


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Water Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" 9 Water Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,,,,,"IA, MN, ND, SD" "Water Heating",,,,"IL","MI","WI","IN, OH",,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Number of Storage Tank Water Heaters" 0,2.9,0.4,0.3,"Q","Q","Q","Q",0.1,"Q","Q","Q"


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Air Conditioning in Homes in Midwest Region, Divisions, and States, 2009" 9 Air Conditioning in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Air Conditioning",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Air Conditioning Equipment" "Use Air Conditioning Equipment",94,22.4,15,4.3,3.1,1.8,5.9,7.4,2.3,3.4,1.7


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Space Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" 9 Space Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" " ",,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Space Heating",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Space Heating Equipment" "Use Space Heating Equipment",110.1,25.8,17.8,4.7,3.8,2.3,7,8.1,2.3,3.9,1.8


Magnetic and electrical properties of layered magnets Tl(Cr,Mn,Co)Se{sub 2}  

Science Conference Proceedings (OSTI)

Tl(Cr,Mn,Co)Se{sub 2} crystals were synthesized at T {approx} 1050 K. X-ray diffraction analysis showed that TlCrSe{sub 2}, TlMnSe{sub 2}, and TlCoSe{sub 2} compounds crystallize in the hexagonal crystal system with the lattice parameters: a = 3.6999 A, c = 22.6901 A, c/a {approx} 6.133, z = 3, {rho}{sub x} = 6.209 g/cm{sup 3}; a = 6.53 A, c = 23.96 A, c/a {approx} 3.669, z = 8, {rho}{sub x} = 6.71 g/cm{sup 3}; and a = 3.747 A, c = 22.772 A, c/a {approx} 6.077, z = 3, {rho}{sub x} = 7.577 g/cm{sup 3}, respectively. Magnetic and electrical studies in the temperature range from 80-400 K showed that TlCrSe{sub 2} is a semiconductor ferromagnet, TlMnSe{sub 2} is a semiconductor antiferromagnet, and TlCoSe{sub 2} is a ferrimagnet with a conductivity characteristic of metals. A rather large deviation in the experimental effective magnetic moment for TlCrSe{sub 2} (3.05 {mu}B) from the theoretical value (3.85 {mu}B) is attributed to two-dimensional magnetic ordering in the paramagnetic region of the noticeably layered ferromagnet TlCrSe{sub 2}. In TlCrSe{sub 2}, a correlation between magnetic and electrical properties was detected.

Veliyev, R. G.; Sadikhov, R. Z.; Kerimova, E. M., E-mail: ekerimova@physics.ab.az; Asadov, Yu. G.; Jabbarov, A. I. [National Academy of Sciences of Azerbaijan, Institute of Physics (Azerbaijan)



Pressure and field tuning the magnetostructural phases of Mn3O4: Raman scattering and x-ray diffraction studies  

Science Conference Proceedings (OSTI)

We present temperature-, magnetic-field-, and pressure-dependent Raman scattering studies of single crystal Mn{sub 3}O{sub 4}, combined with temperature- and field-dependent x-ray diffraction studies, revealing the novel magnetostructural phases in Mn{sub 3}O{sub 4}. Our temperature-dependent studies showed that the commensurate magnetic transition at T{sub 2} = 33K in the binary spinel Mn{sub 3}O{sub 4} is associated with a structural transition from tetragonal to orthorhombic structures. Field-dependent studies showed that the onset and nature of this structural transition can be controlled with an applied magnetic field, and revealed evidence for a field-tuned quantum phase transition to a tetragonal spin-disordered phase for H {parallel} [1{bar 1}0]. Pressure-dependent Raman measurements showed that the magnetic easy axis direction in Mn{sub 3}O{sub 4} can be controlled - and the ferrimagnetic transition temperature increased - with applied pressure. Finally, combined pressure- and magnetic-field-tuned Raman measurements revealed a rich magnetostructural phase diagram - including a pressure- and field-induced magnetically frustrated tetragonal phase in the PH phase diagram - that can be generated in Mn{sub 3}O{sub 4} with applied pressure and magnetic field.

Kim, M.; Nelson, C.; Chen, X.M.; Wang, X.; Budakian, R.; Abbamonte, P. & Cooper, S.L.



Spinel LiMn(2)O(4)/Reduced Graphene Oxide Hybrid for High Rate Lithium Ion Batteries  

DOE Green Energy (OSTI)

A well-crystallized and nano-sized spinel LiMn{sub 2}O{sub 4}/reduced graphene oxide hybrid cathode material for high rate lithium-ion batteries has been successfully synthesized via a microwave-assisted hydrothermal method at 200 C for 30 min without any post heat-treatment. The nano-sized LiMn{sub 2}O{sub 4} particles were evenly dispersed on the reduced graphene oxide template without agglomeration, which allows the inherent high active surface area of individual LiMn{sub 2}O{sub 4} nanoparticles in the hybrid. These unique structural and morphological properties of LiMn{sub 2}O{sub 4} on the highly conductive reduced graphene oxide sheets in the hybrid enable achieving the high specific capacity, an excellent high rate capability and stable cycling performance. An analysis of the cyclic voltammogram data revealed that a large surface charge storage contribution of the LiMn{sub 2}O{sub 4}/reduced graphene oxide hybrid plays an important role in achieving faster charge/discharge.

Bak, S.M.; Nam, K.; Lee, C.-W.; Kim, K.-H.; Jung, H.-C.; Yang, X-Q.; Kim, K.-B.



Investigation of thermal, mechanical and magnetic behaviors of the Cu-11%Al alloy with Ag and Mn additions  

SciTech Connect

The investigation of thermal, mechanical and magnetic behaviors of the Cu-11%Al, Cu-11%Al-3%Ag, Cu-11%Al-10%Mn and Cu-11%Al-10%Mn-3%Ag alloys was made using microhardness measurements, differential scanning calorimetry, X-ray diffractometry, scanning electron microscopy, energy dispersion X-ray spectroscopy and magnetic moment change with applied field measurement. The results indicated that the Mn addition changes the phase stability range, the microhardness values and makes undetectable the eutectoid reaction in annealed Cu-11%Al and Cu-11%Al-3%Ag alloys while the presence of Ag does not modify the phase transformation sequence neither microhardness values of the annealed Cu-11%Al and Cu-11%Al-10%Mn alloys, but it increases the magnetic moment of this latter at about 2.7 times and decreases the rates of eutectoid and peritectoid reactions of the former. - Highlights: Black-Right-Pointing-Pointer The microstructure of Cu-Al alloy is modified in the Ag presence. Black-Right-Pointing-Pointer ({alpha} + {gamma}) phase is stabilized down to room temperature when Ag is added to Cu-Al alloy. Black-Right-Pointing-Pointer Ag-rich phase modifies the magnetic characteristics of Cu-Al-Mn alloy.

Silva, R.A.G., E-mail: galdino.ricardo@gmail.com [Departamento de Ciencias Exatas e da Terra-UNIFESP, Diadema-SP (Brazil)] [Departamento de Ciencias Exatas e da Terra-UNIFESP, Diadema-SP (Brazil); Paganotti, A.; Gama, S. [Departamento de Ciencias Exatas e da Terra-UNIFESP, Diadema-SP (Brazil)] [Departamento de Ciencias Exatas e da Terra-UNIFESP, Diadema-SP (Brazil); Adorno, A.T.; Carvalho, T.M.; Santos, C.M.A. [Instituto de Quimica - UNESP, Araraquara-SP (Brazil)] [Instituto de Quimica - UNESP, Araraquara-SP (Brazil)



Synthesis and Electrochemical Characterization of M2Mn3O8 (M=Ca,Cu) Compounds and Derivatives  

DOE Green Energy (OSTI)

M{sub 2}Mn{sub 3}O{sub 8} (M=Ca{sup 2+}, Cu{sup 2+}) compounds were synthesized and characterized in lithium cells. The M{sup 2+} cations, which reside in the van der Waal's gaps between adjacent sheets of Mn{sub 3}O{sub 8}{sup 4-}, may be replaced chemically (by ion-exchange) or electrochemically with Li. More than 7 Li{sup +}/Cu{sub 2}Mn{sub 3}O{sub 8} may be inserted electrochemically, with concomitant reduction of Cu{sup 2+} to Cu metal, but less Li can be inserted into Ca{sub 2}Mn{sub 3}O{sub 8}. In the case of Cu{sup 2+}, this process is partially reversible when the cell is charged above 3.5 V vs. Li, but intercalation of Cu{sup +} rather than Cu{sup 2+} and Li{sup +}/Cu{sup +} exchange occurs during the subsequent discharge. If the cell potential is kept below 3.4 V, the Li in excess of 4Li{sup +}/Cu{sub 2}Mn{sub 3}O{sub 8} can be cycled reversibly. The unusual mobility of +2 cations in a layered structure has important implications both for the design of cathodes for Li batteries and for new systems that could be based on M{sup 2+} intercalation compounds.

Park, Yong Joon; Doeff, Marca M.



a beneficial manner. The three projects wi  

NLE Websites -- All DOE Office Websites (Extended Search)

beneficial manner. The three projects will demonstrate technologies beneficial manner. The three projects will demonstrate technologies that: (1) make progress toward DOE's target CO 2 capture efficiency of 90 percent; (2) make progress toward DOE's capture and sequestration goal of less than 10 percent increase in the cost of electricity for gasification systems and less than 35 percent for combustion and oxy-combustion systems; and (3) capture and sequester, or put to


Microsoft Word - topic_B_WI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Western Interconnection on Electric Resource Western Interconnection on Electric Resource Planning and Priorities The awardee must complete the following at a minimum: 1. Continued development of the Western Renewable Energy Zone (WREZ) analysis, currently performed by the Western Governors' Association (WGA) under DOE Cooperative Agreement (DE-FC26-08NT01788) in order to identify those areas in the West with vast renewable resources to expedite the development and delivery of renewable energy to where it is needed. Specifically, the awardee must complete the following tasks. a. Coordinating Energy Purchasing from the WREZs Aggregating demand for renewable energy can stimulate the development of commercial renewable generation and supporting transmission projects. Many public power, cooperative, state, federal and provincial electric systems have


WiH1950s poster  

Science Conference Proceedings (OSTI)

... definitive work on the thermochemical properties of ions: Gas-Phase Ion ... Despite working under a very tight deadline, she successfully designed a ...


Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tiling theory applied to the surface structure of icosahedral AlPdMn quasicrystals  

E-Print Network (OSTI)

Surfaces in i-Al68Pd23Mn9 as observed with STM and LEED experiments show atomic terraces in a Fibonacci spacing. We analyze them in a bulk tiling model due to Elser which incorporates many experimental data. The model has dodecahedral Bergman clusters within an icosahedral tiling T^*(2F) and is projected from the 6D face-centered hypercubic lattice. We derive the occurrence and Fibonacci spacing of atomic planes perpendicular to any 5fold axis, compute the variation of planar atomic densities, and determine the (auto-) correlation functions. Upon interpreting the planes as terraces at the surface we find quantitative agreement with the STM experiments.

Peter Kramer; Zorka Papadopolos; Harald Teuscher



Neutron scattering study of MnSi proving no exchange hole  

SciTech Connect

Neutron scattering experiments have been performed in MnSi below T/sub c/ with the double-axis powder scattering technique using unpolarized neutrons, and also with the polarization analysis technique. The magnetic scattering intensity has not shown any anomaly around q = 0.5 A/sup -1/, in contrast to the previous results of Ziebeck et al. who found a large intensity peak at this momentum transfer. Thus the hypothesis of Ziebeck et al. of observing an Exchange Hole is excluded.

Uemura, Y.J.; Majkrzak, C.F.; Shirane, G.; Ishikawa, Y.



Enhancement of spin-asymmetry by L2{sub 1}-ordering in Co{sub 2}MnSi/Cr/Co{sub 2}MnSi current-perpendicular-to-plane magnetoresistance devices  

SciTech Connect

Co{sub 2}MnSi/Cr/Co{sub 2}MnSi (001)-fully epitaxial current-perpendicular-to-plane giant magnetoresistance (CPP-GMR) devices were fabricated via an UHV magnetron sputtering system. The relationship between the degree of chemical ordering in Co{sub 2}MnSi (CMS) and the CPP-GMR characteristics was investigated systematically against the annealing temperature of the devices. X-ray diffraction profiles and reflection high-energy electron diffraction images indicated that annealing improved L2{sub 1}-ordering. The MR ratio also increased upon annealing and the maximum MR ratio of 5.2% and {delta}RA of 6.5 m{omega} {mu}m{sup 2} were achieved by annealing at 400 deg. C. These results indicate that promoting the degree of L2{sub 1}-ordering in CMS enhances the bulk and/or interface spin-asymmetry coefficients.

Sakuraba, Y.; Iwase, T.; Saito, K.; Mitani, S.; Takanashi, K. [Institute for Materials Research, Tohoku University, Katahira 2-1-1, Aoba-ku, Sendai 980-8577 (Japan)



Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

4 4 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

2 2 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


Low Dose Radiation Research Program: Regulation of NF-kB and MnSOD in Low  

NLE Websites -- All DOE Office Websites (Extended Search)

NF-kB and MnSOD in Low Dose Radiation-Induced Adaptive NF-kB and MnSOD in Low Dose Radiation-Induced Adaptive Responses in Mouse and Human Skin Cells Jian Jian Li School of Health Sciences, Purdue University West Lafayette, Indiana Why this Project? To determine if low dose ionizing radiation-induced adaptive responses in skin cells are mediated by activation of signaling networks. Project Goals To evaluate the signaling networks involving transcription factor NF-kB and the mitochondrial antioxidant protein MnSOD. To determine if NF-kB is activated by low dose radiation in vivo. To determine if NF-kB activation is critical in the pathways that produce adaptive responses. Experimental Approach Cells transfected with NF-kB luciferase responder genes will be used to define a dose-response relationship for activation of the NF-kB gene. NF-kB


MN Workshop  

Science Conference Proceedings (OSTI)

Page 1. NIST Special Publication 1093 Mass Notification Messages: Workshop Proceedings Erica D. Kuligowski Richard ...



Room temperature ferromagnetism in Mn, Ni and Co ions doped Cu{sub 2}O nanorods  

SciTech Connect

Here we report the synthesis and characterization of Cu{sub 2}O nanorods doped with Mn, Ni and Co transition metal ions and the study of their magnetic properties. Synthesis of the nanorods was carried out by the modified polyol method. Powder X-ray diffraction patterns clearly showed them to be polycrystalline single phase material. They exhibited ferromagnetic behavior at room temperature, however no such behavior was observed for the reference undoped sample, which indicated that unintentionally introduced magnetic impurities were not responsible for the observed phenomenon. Ferromagnetic behavior was found to be dependent on the dopant concentration and increased consistently with its increment in the material. The total magnetic moments contribution was calculated for the dopant concentration and was found to be insignificant to account for the observed ferromagnetism, therefore it was suggested that ferromagnetism could have conjured up from the induced magnetic moment in the defects created as cation vacancies in the material. The presence of the defects was supported by the room temperature photoluminescence study which showed that intensity of the peaks was dependent on the dopant concentration and increased consistently with it. There was strong correlation between the magnitude of the photoluminescence peak and the observed ferromagnetic property in the doped samples. -- Graphical Abstract: Room temperature ferromagnetism was observed in the Cu{sub 2}O nanorods doped with Mn, Ni and Co ions. The origin seems to be the defects of cation vacancies created by the dopant ions. Display Omitted

Ahmed, Asar [Department of Chemistry, SL-214, Southern Lab, Indian Institute of Technology Kanpur, Kanpur, Uttar Pradesh (India); Gajbhiye, Namdeo S., E-mail: nsg@iitk.ac.i [Department of Chemistry, SL-214, Southern Lab, Indian Institute of Technology Kanpur, Kanpur, Uttar Pradesh (India)



Microstructure and Magnetic Properties of PrMnO{sub 3} Bulk and Thin Film  

Science Conference Proceedings (OSTI)

Perovskite PrMnO{sub 3}(PMO) had been prepared in bulk by solid state reaction and thin films on corning glass, fused silica and MgO (100) glass substrate by pulsed laser deposition technique. SEM micrographs show that grains with size 2{approx}3 {mu}m is observed in bulk PMO while thin films PMO show strongly connected grain structure with particle size that not larger than 100 nm. X-ray diffraction analysis shows that all samples are in single phase with orthorhombic crystal structure. Bulk PMO sample had lattice strain of 0.134% which is the lowest value among others. However, larger lattice strain was observed in thin film samples due to lattice mismatch between film-substrate and caused the MnO{sub 6} to deform. All samples shown paramagnetic or antiferromagnetic behavior, enhancement in magnetization value occurred for all PMO grew as film. We believe that larger lattice strain favor the grain growth of PMO towards more order phase. In summary, formation of structure and microstructure of thin film PMO depends on type of substrate used and it affect the magnetic property.

Lim, K. P.; Halim, S. A.; Chen, S. K.; Ng, S. W.; Wong, J. K.; Gan, H. M. Albert [Department of Physics, Faculty of Science, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor (Malaysia); Woon, H. S. [College of Engineering, Universiti Tenaga Nasional, Jalan IKRAM-UNITEN, 43000 Kajang, Selangor (Malaysia)



Defect Levels of Indium-doped CdMnTe Crystals  

Science Conference Proceedings (OSTI)

Using photoluminescence (PL) and current deep-level transient spectroscopy (I-DLTS), we investigated the electronic defects of indium-doped detector-grade CdMnTe:In (CMT:In) crystals grown by the vertical Bridgman method. We similarly analyzed CdZnTe:In (CZT:In) and undoped CdMnTe (CMT) crystals grown under the amount of same level of excess Te and/or indium doping level to detail the fundamental properties of the electronic defect structure more readily. Extended defects, existing in all the samples, were revealed by synchrotron white beam x-ray diffraction topography and scanning electron microscopy. The electronic structure of CMT is very similar to that of CZT, with shallow traps, A-centers, Cd vacancies, deep levels, and Te antisites. The 1.1-eV deep level, revealed by PL in earlier studies of CZT and CdTe, were attributed to dislocation-induced defects. In our I-DLTS measurements, the 1.1-eV traps showed different activation energies with applied bias voltage and an exponential dependence on the trap-filling time, which are typical characteristics of dislocation-induced defects. We propose a new defect-trap model for indium-doped CMT crystals.

K Kim; A Bolotinikov; G Camarda; R Gul; A Hossain; G Yang; Y Cui; R James



Exact Enumeration of the Phase Space of an Ising Model of Ni2MnGa  

Science Conference Proceedings (OSTI)

Exact evaluations of partition functions are generally prohibitively expensive due to exponential growth of phase space with the number of degrees of freedom. For an Ising model with sites the number of possible states is requiring the use of better scaling methods such as importance sampling Monte-Carlo calculations for all but the smallest systems. Yet the ability to obtain exact solutions for as large as possible systems can provide important benchmark results and opportunities for unobscured insight into the underlying physicsofthesystem.HerewepresentanIsingmodelforthemagneticsublatticesoftheimportantmagneto-caloricmaterialNi MnGa and use an exact enumeration algorithm to calculate the number of states for each energy and sublattice magne- tizations and . This allows the efficient calculation of the partition function and derived thermodynamic quantities such as specific heat and susceptibility. Utilizing the jaguarpf system at Oak Ridge we are able to calculate for systems of up to48sites,whichprovidesimportantinsightintothemechanismforthelargemagnet-caloriceffectinNi MnGaaswellasanimportant benchmark for Monte-Carlo (esp. Wang-Landau method).

Eisenbach, Markus [ORNL; Brown, Greg [ORNL; Rusanu, Aurelian [ORNL; Odbadrakh, Khorgolkhuu [ORNL; Nicholson, Don M [ORNL; McCarthy, Carrie V. [University of Georgia, Athens, GA



Magnetic phase diagram of disordered Ni-Mn near the multicritical point  

Science Conference Proceedings (OSTI)

From detailed magnetization data taken under various field-cooling conditions, the magnetic phase diagram of temperature versus composition is determined for disordered Ni-Mn of Mn concentration (x) near 25 at. %. With increasing x, the ferromagnetic Curie-point (T/sub c/) line descends and meets the ascending line for the spin-glass reentrance temperature (T/sub f//sub g/) at a multicritical point (MCP) located at x = 23.9, T = 102 K, from which the spin-glass freezing-temperature (T/sub g/) line emerges and reaches a maximum at higher x. The reentrant spin-glass (SG) ordering is accompanied by a net ferromagnetic (FM) moment, thus describing a mixed ferro-spin-glass (FSG) state, which is separated from the normal SG state by a boundary line that extends essentially vertically down in temperature from the MCP. Moreover, it is shown that the SG ordering of the FSG state probably persists into the FM regime above T/sub f//sub g/, where T/sub f//sub g/ (like T/sub g/) remains defined operationally by the appearance of irreversible and time-dependent magnetic effects.

Abdul-Razzaq, W.; Kouvel, J.S.



Tb0.5Bi0.5MnO3: New material. A DFT study  

Science Conference Proceedings (OSTI)

In the present work we have determined the band structure and the densities of states (DOS) of Tb0.5Bi0.5MnO3 in cubic phase using the density functional theory (DFT). The determination of the lattice constant was ... Keywords: 61.50.-f, 62.20.-x, 71.15.Nc, 71.20.-b, 71.55.Ht, 75.20.En, Band structure, DFT, Density of states, Magnetic properties, Mechanical and structural properties, Tb1-xBixMnO3

Miguel Grizalez; M. Jairo Arbey Rodrguez; Jess Heiras; P. Prieto



Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...


Identification of Mn site in Pb(Zr,Ti)O{sub 3} by synchrotron x-ray absorption near-edge structure: Theory and experiment  

SciTech Connect

Synchrotron x-ray absorption near-edge structure (XANES) experiments are performed on Mn-doped PbZr{sub 1-x}Ti{sub x}O{sub 3} samples (PZT) and compared with first-principles XANES simulations. The features of the measured Mn K-edge XANES are consistent with the first-principles XANES of Mn on the Ti/Zr site and inconsistent with Mn on other sites. The clear agreement between measured and first-principles theoretical XANES spectra reported here is by far the strongest evidence of Mn substituting for Ti/Zr in PZT. This work illustrates that a first-principles supercell framework, which is popularly used to study impurities in crystals, can be used in conjunction with XANES measurement in order to identify an impurity structure with a high degree of confidence. This approach may thus be broadly applicable to study impurities in other crystals.

Limpijumnong, Sukit; Rujirawat, Saroj; Boonchun, Adisak; Smith, M. F.; Cherdhirunkorn, B. [National Synchrotron Research Center, Nakhon Ratchasima 30000, Thailand and School of Physics, Suranaree University of Technology, Nakhon Ratchasima 30000 (Thailand); National Synchrotron Research Center, Nakhon Ratchasima 30000 (Thailand); Department of Physics, Thammasat University, Patum Thani 12121 (Thailand)



Radiation-induced instability of MnS precipitates and its possible consequences on irradiation-induced stress corrosion cracking of austenitic stainless steels  

SciTech Connect

Irradiation-assisted stress corrosion cracking (IASCC) is a significant materials issue for the light water reactor (LWR) industry and may also pose a problem for fusion power reactors that will use water as coolant. A new metallurgical process is proposed that involves the radiation-induced release into solution of minor impurity elements not usually thought to participate in IASCC. MnS-type precipitates, which contain most of the sulfur in stainless steels, are thought to be unstable under irradiation. First, Mn transmutes strongly to Fe in thermalized neutron spectra. Second, cascade-induced disordering and the inverse Kirkendall effect operating at the incoherent interfaces of MnS precipitates are thought to act as a pump to export Mn from the precipitate into the alloy matrix. Both of these processes will most likely allow sulfur, which is known to exert a deleterious influence on intergranular cracking, to re-enter the matrix. To test this hypothesis, compositions of MnS-type precipitates contained in several unirradiated and irradiated heats of Type 304, 316, and 348 stainless steels (SSs) were analyzed by Auger electron spectroscopy. Evidence is presented that shows a progressive compositional modification of MnS precipitates as exposure to neutrons increases in boiling water reactors. As the fluence increases, the Mn level in MnS decreases, whereas the Fe level increases. The S level also decreases relative to the combined level of Mn and Fe. MnS precipitates were also found to be a reservoir of other deleterious impurities such as F and O which could be also released due to radiation-induced instability of the precipitates.

Chung, H.M.; Sanecki, J.E. [Argonne National Lab., IL (United States); Garner, F.A. [Pacific Northwest National Lab., Richland, WA (United States)



ASHRAE 2000 Annual Meeting, June 24-28, 2000, Minneapolis, MN, and published in ASHRAE Transactions, 106(2) 2000.  

E-Print Network (OSTI)

LBNL-44422 Mo-420 ASHRAE 2000 Annual Meeting, June 24-28, 2000, Minneapolis, MN, and published in ASHRAE Transactions, 106(2) 2000. This work was supported by the Assistant Secretary for Energy-factors of predominantly planar, vertical windows has been made by both ASHRAE and NFRC, and as increasing consensus has


EXAFS and FT-IR Characterization of Mn and Li Promoted Titania-Supported Rh Catalysts for CO Hydrogenation  

DOE Green Energy (OSTI)

The effect of Li and Mn promoters on the structure and selectivity of supported Rh catalysts for CO hydrogenation reaction was examined. Infrared spectroscopy and X-ray absorption were used to investigate the adsorption of reactants and local structure of Rh. These techniques were used in combination with reactivity, H{sub 2} chemisorption, and temperature programmed studies to correlate structural characteristics with activity and selectivity during CO hydrogenation of unpromoted Rh/TiO{sub 2} and three promoted Rh catalysts: Rh-Li/TiO{sub 2}, Rh-Mn/TiO{sub 2}, and Rh-Li-Mn/TiO{sub 2}. The presence of a promoter slightly decreases the Rh clusters size; however, no evidence for an electronic effect induced by the presence of Li and Mn was found. Higher turnover frequencies were found for the promoted catalysts, which also showed the lower dispersion. The Li promoter introduces a weakened CO adsorption site that appears to enhance the selectivity to C{sub 2+} oxygenates. The selectivity to C{sub 2+} oxygenates varies inversely with the reducibility of Rh metal, that is, the lower the Rh reducibility, the higher the selectivity.

V Schwartz; A Campos; A Egbebi; J Spivey; S Overbury



Observations on the oxidation of Mn-modified Ni-base Haynes 230 alloy under SOFC exposure conditions  

Science Conference Proceedings (OSTI)

The commercial Ni-base Haynes 230 alloy (Ni-Cr-Mo-W-Mn) was modified with two increased levels of Mn (1 and 2 wt per cent) and evaluated for its oxidation resistance under simulated SOFC interconnect exposure conditions. Oxidation rate, oxide morphology, oxide conductivity and thermal expansion were measured and compared with commercial Haynes 230. It was observed that additions of higher levels of Mn to the bulk alloy facilitated the formation of a bi-layered oxide scale that was comprised of an outer M3O4 (M=Mn, Cr, Ni) spinel-rich layer at the oxide gas interface over a Cr2O3-rich sub-layer at the metal oxide interface. The modified alloys showed higher oxidation rates and the formation of thicker oxide scales compared to the base alloy. The formation of a spinel-rich top layer improved the scale conductivity, especially during the early stages of the oxidation, but the higher scale growth rate resulted in an increase in the area-specific electrical resistance over time. Due to their face-centered cubic crystal structure, both commercial and modified alloys demonstrated a coefficient of thermal expansion that was higher than that of typical anode-supported and electrolyte-supported SOFCs.

Yang, Z Gary; Xia, Gordon; Stevenson, Jeffry W.; Singh, Prabhakar


Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Magnetic properties of MnSb inclusions formed in GaSb matrix directly during molecular beam epitaxial growth  

Science Conference Proceedings (OSTI)

Despite of intensive search for the proper semiconductor base materials for spintronic devices working at room temperature no appropriate material based on ferromagnetic semiconductors has been found so far. We demonstrate that the phase segregated system with MnSb hexagonal inclusions inside the GaSb matrix, formed directly during the molecular beam epitaxial growth reveals the ferromagnetic properties at room temperature and is a good candidate for exploitation in spintronics. Furthermore, the MnSb inclusions with only one crystalline structure were identified in this GaMn:MnSb granular material. The SQUID magnetometry confirmed that this material exhibits ferromagnetic like behavior starting from helium up to room temperature. Moreover, the magnetic anisotropy was found which was present also at room temperature, and it was proved that by choosing a proper substrate it is possible to control the direction of easy axis of inclusions' magnetization moment between in-plane and out-of-plane; the latter is important in view of potential applications in spintronic devices.

Lawniczak-Jablonska, Krystyna; Wolska, Anna; Klepka, Marcin T.; Kret, Slawomir; Kurowska, Boguslawa; Kowalski, Bogdan J. [Institute of Physics PAS, al. Lotnikow 32/46, 02-668 Warsaw (Poland); Gosk, Jacek [Institute of Experimental Physics, University of Warsaw, Hoza 69, 00-681 Warsaw (Poland); Faculty of Physics, Warsaw University of Technology, Koszykowa 75, 00-662 Warsaw (Poland); Twardowski, Andrzej; Wasik, Dariusz; Kwiatkowski, Adam [Institute of Experimental Physics, University of Warsaw, Hoza 69, 00-681 Warsaw (Poland); Sadowski, Janusz [Institute of Physics PAS, al. Lotnikow 32/46, 02-668 Warsaw (Poland); MAX-Lab, Lund University, SE-221 00 Lund (Sweden)



Pyrovanadolysis: a Pyrophosphorolysis-like Reaction Mediated by Pyrovanadate MN2plus and DNA Polymerase of Bacteriophage T7  

Science Conference Proceedings (OSTI)

DNA polymerases catalyze the 3'-5'-pyrophosphorolysis of a DNA primer annealed to a DNA template in the presence of pyrophosphate (PP{sub i}). In this reversal of the polymerization reaction, deoxynucleotides in DNA are converted to deoxynucleoside 5'-triphosphates. Based on the charge, size, and geometry of the oxygen connecting the two phosphorus atoms of PP{sub i}, a variety of compounds was examined for their ability to carry out a reaction similar to pyrophosphorolysis. We describe a manganese-mediated pyrophosphorolysis-like activity using pyrovanadate (VV) catalyzed by the DNA polymerase of bacteriophage T7. We designate this reaction pyrovanadolysis. X-ray absorption spectroscopy reveals a shorter Mn-V distance of the polymerase-VV complex than the Mn-P distance of the polymerase-PP{sub i} complex. This structural arrangement at the active site accounts for the enzymatic activation by Mn-VV. We propose that the Mn{sup 2+}, larger than Mg{sup 2+}, fits the polymerase active site to mediate binding of VV into the active site of the polymerase. Our results may be the first documentation that vanadium can substitute for phosphorus in biological processes.

B Akabayov; A Kulczyk; S Akabayov; C Thiele; L McLaughlin; B Beauchamp; C Richardson



Competition between stripe and checkerboard magnetic instabilities in Mn-doped BaFe2As2  

Science Conference Proceedings (OSTI)

The appearance of unconventional superconductivity often requires the suppression of an antiferromagnetic (AFM) ordered state by tuning the chemical composition. In BaFe2As2, the AFM ordered state is driven by Fermi surface nesting, resulting in stripe magnetic ordering with propagation vector Qstripe = (; 0) (in Fe square lattice notation). Co substitution acts as an electron donor that destabilizes the nesting condition,1 leading to suppression of the stripe AFM ordering2 and the appearance of superconductivity.3,4 Mn is nominally the hole-doping counterpart of Co which should also detune the Fermi surface nesting, but it is not a superconductor.5 Here we report that Mn doping does not act solely as a hole donor, but instead introduces strong spin uctuations at a wavevector (; ) that is unrelated to the Fermi surface topology of BaFe2As2. Spin uctuations at (; ) and (; 0) coexist, suggesting the Mn dopants act as local magnetic impurities that polarize neighbouring Fe/Mn spins, potentially disrupting superconductivity.

Pratt, Daniel [Ames Laboratory and Iowa State University; Kim, M. G. [Ames Laboratory and Iowa State University; Ran, S. [Ames Laboratory and Iowa State University; Thaler, A. [Ames Laboratory and Iowa State University; Granroth, Garrett E [ORNL; Marty, Karol J [ORNL; Tian, W. [University of Tennessee, Knoxville (UTK); Zarestky, J. L. [Ames Laboratory and Iowa State University; Lumsden, Mark D [ORNL; Budko, S L [Ames Laboratory and Iowa State University; Canfield, P. C. [Ames Laboratory; Goldman, A. I. [Ames Laboratory and Iowa State University; Mcqueeney, R J [Ames Laboratory and Iowa State University; Tucker, G. S. [Ames Laboratory and Iowa State University



Structural controlled magnetic anisotropy in Heusler L1{sub 0}-MnGa epitaxial thin films  

Science Conference Proceedings (OSTI)

Ferromagnetic L1{sub 0}-MnGa thin films have been epitaxially grown on GaN, sapphire, and MgO substrates using molecular beam epitaxy. Using diffraction techniques, the epitaxial relationships are determined. It is found that the crystalline orientation of the films differ due to the influence of the substrate. By comparing the magnetic anisotropy to the structural properties, a clear correlation could be established indicating that the in-plane and out-of-plane anisotropy is directly determined by the crystal orientation of the film and could be controlled via selection of the substrates. This result could be helpful in tailoring magnetic anisotropy in thin films for spintronic applications.

Wang Kangkang; Lu Erdong; Smith, Arthur R. [Department of Physics and Astronomy, Nanoscale and Quantum Phenomena Institute, Ohio University, Athens, Ohio 45701 (United States); Knepper, Jacob W.; Yang Fengyuan [Department of Physics, Ohio State University, 191 Woodruff Ave., Columbus, Ohio 43210 (United States)



Synthesis and oxygen content dependent properties of hexagonal DyMnO{sub 3 + sub delta}.  

Science Conference Proceedings (OSTI)

Oxygen deficient polycrystalline samples of hexagonal P6{sub 3}cm (space group No.185) DyMnO{sub 3+{delta}} ({delta} stoichiometric in oxygen content ({delta} = 0). Chemical expansion of the crystal lattice corresponding to these large changes of oxygen was found to be 3.48 x 10{sup -2} mol{sup -1}. Thermal expansion of stoichiometric phases were determined to be 11.6 x 10{sup -6} and 2.1 x 10{sup -6} K{sup -1} for the P6{sub 3}cm and Hex{sub 2} phases, respectively. Our measurements also indicate that the oxygen non-stoichiometry of hexagonal RMnO{sub 3+{delta}} materials may have important influence on their multiferroic properties.

Remsen, S.; Dabrowski, B.; Chmaissem, O.; Mais, J.; Szewczyk, A. (Materials Science Division); (Northern Illinois Univ.); (Polish Acad. Sci.)



Synthesis and oxygen content dependent properties of hexagonal DyMnO[subscript 3+delta  

SciTech Connect

Oxygen deficient polycrystalline samples of hexagonal P6{sub 3}cm (space group No.185) DyMnO{sub 3+{delta}} ({delta} < 0) were synthesized in Ar by intentional decomposition of its perovskite phase obtained in air. The relative stability of these phases is in accord with our previous studies of the temperature and oxygen vacancy dependent tolerance factor. Thermogravimetric measurements have shown that hexagonal samples of DyMnO{sub 3+{delta}} (0 {le} {delta} {le} 0.4) exhibit unusually large excess oxygen content, which readily incorporates on heating near 300 C in various partial-pressures of oxygen atmospheres. Neutron and synchrotron diffraction data show the presence of two new structural phases at {delta} {approx} 0.25 (Hex{sub 2}) and {delta} {approx} 0.40 (Hex{sub 3}). Rietveld refinements of the Hex{sub 2} phase strongly suggest it is well modeled by the R3 space group (No.146). These phases were observed to transform back to P6{sub 3}cm above {approx} 350 C when material becomes stoichiometric in oxygen content ({delta} = 0). Chemical expansion of the crystal lattice corresponding to these large changes of oxygen was found to be 3.48 x 10{sup -2} mol{sup -1}. Thermal expansion of stoichiometric phases were determined to be 11.6 x 10{sup -6} and 2.1 x 10{sup -6} K{sup -1} for the P6{sub 3}cm and Hex{sub 2} phases, respectively. Our measurements also indicate that the oxygen non-stoichiometry of hexagonal RMnO{sub 3+{delta}} materials may have important influence on their multiferroic properties.

Remsen, S.; Dabrowski, B.; Chmaissem, O.; Mais, J.; Szewczyk, A. (NIU); (Polish)



Facile synthesis of {alpha}-MnO{sub 2} one-dimensional (1D) nanostructure and energy storage ability studies  

SciTech Connect

The dense manganese oxide nanorods with an extremely narrow distribution are synthesized at a low temperature using first cathodic electrodeposition subsequently heat treatment. Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) images show that the nanorods have bar shapes, and their average diameter is less than 50 nm. The Fourier transform infrared (FT-IR) study, the selected area electron diffraction (SAED) pattern in TEM images and the X-ray diffraction (XRD) result show that the nanorods are {alpha}-MnO{sub 2} single crystal. The results of N{sub 2} adsorption-desorption analysis indicate that the BET surface area of the {alpha}-MnO{sub 2} nanorods is 93 m{sup 2} g{sup -1}. By recording the potential-time curve during the electrodeposition process, it is revealed that water reduction reaction has a major role in the electrogeneration of base at the cathode surface under the applied electrochemical conditions. Finally, based on the H{sub 2} bubbling on the cathode surface, the mechanism of the formation and the growth of {alpha}-MnO{sub 2} nanorods are proposed and discussed. For the electrochemical supercapacitor application, electrochemically prepared {alpha}-MnO{sub 2} is found to be stable for a large number of cycles with high specific capacitance, 338 F g{sup -1} at a scan rate of 10 mV s{sup -1}. Finally, the charge-discharge mechanism is discussed. - Graphical abstract: Highlights: Black-Right-Pointing-Pointer New nanostructures of MnO{sub 2} is synthesized by simple method of cathodicelectrodeposition. Black-Right-Pointing-Pointer The product has unique one-dimensional morphology with average diameter size of 50 nm. Black-Right-Pointing-Pointer The experiment conditions (temperature, current density) has not been reported. Black-Right-Pointing-Pointer The one-nanostructures obtained without using of hard template or surfactant.

Yousefi, Taher, E-mail: anozadg@yahoo.com [Department of Chemistry, Tarbiat Moallem University, PO Box: 31979-37551, Tehran (Iran, Islamic Republic of); Materials Research School, NSTRI, PO Box: 14395-836, Tehran (Iran, Islamic Republic of); Golikand, Ahmad Nozad, E-mail: taher_yosefy@yahoo.com [Materials Research School, NSTRI, PO Box: 14395-836, Tehran (Iran, Islamic Republic of); Hossein Mashhadizadeh, Mohammad [Department of Chemistry, Tarbiat Moallem University, PO Box: 31979-37551, Tehran (Iran, Islamic Republic of); Aghazadeh, Mustafa [Department of Optic and Spectroscopy, Lasers and Optics Research School, NSTRI, PO Box: 11365-8486, Tehran (Iran, Islamic Republic of)



The role of the (111) texture on the exchange bias and interlayer coupling effects observed in sputtered NiFe/IrMn/Co trilayers  

Science Conference Proceedings (OSTI)

Magnetic properties of sputtered NiFe/IrMn/Co trilayers grown on different seed layers (Cu or Ta) deposited on Si (100) substrates were investigated by magnetometry and ferromagnetic resonance measurements. Exchange bias effect and magnetic spring behavior have been studied by changing the IrMn thickness. As shown by X-ray diffraction, Ta and Cu seed layers provoke different degrees of (111) fcc-texture that directly affect the exchange bias and indirectly modify the exchange spring coupling behavior. Increasing the IrMn thickness, it was observed that the coupling angle between the Co and NiFe ferromagnetic layers increases for the Cu seed system, but it reduces for the Ta case. The results were explained considering (i) different anisotropies of the Co and IrMn layers induced by the different degree of the (111) texture and (ii) the distinct exchange bias set at the NiFe/IrMn and IrMn/Co interfaces in both systems. The NiFe and Co interlayer coupling angle is strongly correlated with both exchange bias and exchange magnetic spring phenomena. It was also shown that the highest exchange bias field occurs when an unstressed L1{sub 2} IrMn structure is stabilized.

Castro, I. L.; Nascimento, V. P.; Passamani, E. C.; Takeuchi, A. Y.; Larica, C. [Universidade Federal do Espirito Santo, Vitoria, ES 29075-910 (Brazil)] [Universidade Federal do Espirito Santo, Vitoria, ES 29075-910 (Brazil); Tafur, M. [Universidade Federal de Itajuba, Campus Itabira, Itabira, MG 37500-903 (Brazil)] [Universidade Federal de Itajuba, Campus Itabira, Itabira, MG 37500-903 (Brazil); Pelegrini, F. [Universidade Federal de Goias, Goiania, GO 74001-970 (Brazil)] [Universidade Federal de Goias, Goiania, GO 74001-970 (Brazil)



Strong room-temperature ferromagnetism of high-quality lightly Mn-doped ZnO grown by molecular beam epitaxy  

Science Conference Proceedings (OSTI)

Strong room-temperature ferromagnetism is demonstrated in single crystalline Mn-doped ZnO grown by molecular beam epitaxy. With a low Mn concentration of 2 Multiplication-Sign 10{sup 19} cm{sup -3}, Mn-doped ZnO films exhibited room-temperature ferromagnetism with a coercivity field larger than 200 Oe, a large saturation moment of 6 {mu}{sub B}/ion, and a large residue moment that is {approx}70% of the saturation magnetization. Isolated ions with long range carrier mediated spin-spin coupling may be responsible for the intrinsic ferromagnetism.

Zuo Zheng; Zhou Huimei; Olmedo, Mario J.; Kong Jieying; Liu Jianlin [Quantum Structures Laboratory, Department of Electrical Engineering, University of California - Riverside, Riverside, California 92521 (United States); Beyermann, Ward P. [Department of Physics and Astronomy, University of California - Riverside, Riverside, California 92521 (United States); Zheng Jianguo [Laboratory for Electron and X-ray Instrumentation, California Institute for Telecommunications and Information Technology, University of California - Irvine, Irvine, California 92697 (United States); Xin Yan [NHMFL, Florida State University, 1800 E. Paul Dirac Dr., Tallahassee, Florida 32310-3706 (United States)



LiMnPO4 Nanoplate Grown via Solid-State Reaction in Molten Hydrocarbon for Li-ion Battery Cathode  

DOE Green Energy (OSTI)

Electrochemically active LiMnPO4 nanoplates have been synthesized via novel single step solid state reaction in molten hydrocarbon. The LiMnPO4 prepared show unique porous nanoplate shape ~50nm in thickness with highly preferred crystallographic orientation. The reversible cycling of carbon coated LiMnPO4 show flat potential at 4.1 V vs. Li with specific capacity reaching up to 168mAh/g and excellent cycling performance using only galvanostatic charging / discharging mode.

Choi, Daiwon; Wang, Donghai; Bae, In-Tae; Xiao, Jie; Nie, Zimin; Wang, Wei; Viswanathan, Vilayanur V.; Lee, Yun Jung; Zhang, Jiguang; Graff, Gordon L.; Yang, Zhenguo; Liu, Jun



Detailed Relationship Between Local Structure Polarons and Magnetization for La1-xCaxMnO3 (0.21 lt x lt 0.45)  

SciTech Connect

We present detailed local structure measurements (using the extended x-ray absorption fine structure technique) for the colossal magnetoresistive material La{sub 1-x}Ca{sub x}MnO{sub 3} (0.21 < x < 0.45) as a function of temperature and magnetic field. The local distortions of the Mn-O bonds are parameterized using {sigma}, the width of the Mn-O pair-distribution function (PDF). After subtracting thermal phonon contributions, we show that the contributions to {sigma}{sup 2} from polaron and Jahn-Teller (JT) distortions, {sigma}{sub JT/polaron}{sup 2}, are a universal function of the magnetization, independent of how the magnetization is achieved via changes in temperature or magnetic field. However this universal behavior is only observed for B fields {ge} 2 T, likely as a result of domain canting in low B fields. The resulting curve is well described by two straight lines with significantly different slopes. These regimes represent two distinctly differ distortions of the oxygen octahedra about the Mn. For low magnetizations up to {approx}65% of the theoretical maximum magnetization, M{sub T}, the slope is low and the distortion removed as the sample becomes magnetized is small - we argue this arises from polarons which have a low distortion around two (or possibly three) Mn sites. At high magnetizations large distortions per Mn site are removed as these sites become magnetized. The data are also analyzed in terms of a two Mn-O peak distribution using experimental standards for Mn-O. The results agree well with recent neutron PDF results but not with some earlier results. We discuss the limitations of assuming a two peak distribution in view of the two distortions needed to describe the Mn-O distortions as a function of T and B for B {ge} 2 T. It is likely that there is a distribution of longer bonds. Finally we show that with increasing B field, the Mn-Mn peak also has a small B-field-induced change - a measure at the unit cell level of magnetostriction but find that there is no observable B-field-induced change in the Mn-La/Ca pair distribution for fields up to {approx}10 T.

F Bridges; L Downward; J Neumeier; T Tyson




Gasoline and Diesel Fuel Update (EIA)

18 18 Energy Information Administration / Natural Gas Annual 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 0 1 2 3 4 5 6 7 T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o A l a b a m a K a n s a s A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 1997 1998 1999 2000 2001 2001 16. Marketed Production of Natural Gas in Selected States, 1997-2001 Figure Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI



Gasoline and Diesel Fuel Update (EIA)

6 6 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 27. Average City Gate Price of Natural Gas in the United States, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Energy Information Administration (EIA), Form EIA-857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Constant dollars: Prices were converted to 2001 dollars using the chain-type


Microsoft Word - Figure_14_15.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 360 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Figure 14. Average Price of Natural Gas Delivered to Residential Consumers, 1980-2004 Figure 15. Average City Gate Price of Natural Gas in the United States, 2004 (Dollars per Thousand Cubic Feet) Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." Constant dollars: Prices were converted to 2004 dollars using the chain-type price indexes for Gross Domestic Product


Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:


Ferromagnetism in Ga1-xMnxP: evidence for inter-Mn exchangemediated bylocalized holes within a detached impurity band  

SciTech Connect

We report an energy gap for hole photoexcitation in ferromagnetic Ga{sub 1-x}Mn{sub x}P that is tunable by Mn concentration (x {le} 0.06) and by compensation with Te donors. For x{approx}0.06, electrical transport is dominated by excitation across this gap above the Curie temperature (T{sub c}) of 60 K and by thermally-activated hopping below T{sub c}. Magnetization measurements reveal a moment of 3.9 {+-} 0.4 {micro}{sub B} per substitutional Mn while the large anomalous Hall signal unambiguously demonstrates that the ferromagnetism is carrier-mediated. In aggregate these data indicate that ferromagnetic exchange is mediated by holes localized in a Mn-derived band that is detached from the valence band.

Scarpulla, M.A.; Cardozo, B.L.; Farshchi, R.; Hlaing Oo, W.M.; McCluskey, M.D.; Yu, K.M.; Dubon, O.D.



Stability of Jahn-Teller distortion in LaMnO{sub 3} under pressure: An x-ray absorption study  

SciTech Connect

The local environment of manganese atoms in LaMnO{sub 3} under pressure up to 15.3 GPa has been studied by x-ray absorption spectroscopy. For pressures below 8 GPa, no change is detected within the MnO{sub 6} octahedra. Above this pressure a continuous reduction of the long Mn-O distance takes place, however, the octahedral distortion persists over the whole pressure range. At 15.3 GPa the average Jahn-Teller splitting of the distances is reduced by about one-third, indicating that a total removal of the local Jahn-Teller distortion would occur only for pressures around 30 GPa, where metallization is reported to take place. A hysteresis in the long distance reduction is observed down to ambient pressure, suggesting the coexistence of MnO{sub 6} distorted and undistorted units.

Ramos, Aline Y.; Tolentino, Helio C. N.; Souza-Neto, Narcizo M.; Itie, Jean-Paul; Morales, Liliana; Caneiro, Alberto [Institut Neel, UPR 2940-CNRS, 25 av. des Martyrs, Boite Postale 166, 38042 Grenoble, France and Laboratorio Nacional de Luz Sincrotron-LNLS, P.O. Box 6192, 13084-971, Campinas, Sao Paulo (Brazil); Laboratorio Nacional de Luz Sincrotron-LNLS, P.O. Box 6192, 13084-971, Campinas, Sao Paulo, Brazil and Departamento de Fisica dos Materiais e Mecanica, DFMT-IF-USP, Sao Paulo, SP (Brazil); Synchrotron SOLEIL, L'Orme des Merisiers, Saint-Aubin, Boite Postale 48, 91192 Gif-sur-Yvette Cedex (France); Centro Atomico Bariloche and Instituto Balseiro, Comision Nacional de Energia Atomica and Universidad Nacional de Cuyo, 8400 S.C. de Bariloche (Argentina)



Comparison of Small Polaron Migration and Phase Separation in Olivine LiMnPO? and LiFePO? using Hybrid Density Functional Theory  

E-Print Network (OSTI)

Using hybrid density functional theory based on the Heyd-Scuseria-Ernzerhof (HSE06) functional, we compared polaron migration and phase separation in olivine LiMnPO? to LiFePO?. The barriers for free hole and electron ...

Ong, Shyue Ping


Combustion Synthesis of Nanoparticulate LiMgxMn1-xPO4 (x=0, 0.1, 0.2) Carbon Composites  

E-Print Network (OSTI)

G. J. Exarhos: Glycine-nitrate Combustion Synthesis of Oxideby the Nitrate-Citrate Combustion Method. Mat. Res. Bull.Combustion Synthesis of Nanoparticulate LiMg x Mn 1-x PO 4 (

Doeff, Marca M



Effective red compensation of Sr2SiO4: Dy3+ phosphor by codoping Mn2+ ions and its energy transfer  

Science Conference Proceedings (OSTI)

Mn2+ ions codoped Sr2SiO4 : Dy3+ phosphors were prepared by the solid-state reaction method using NH4Cl as the flux. Their phase compositions, photoluminescence properties, and the energy transfer ...

Le Zhang, Zhou Lu, Pengde Han, Lixi Wang, Qitu Zhang


Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Properties of molecular beam epitaxy grown Eu{sub x}(transition metal){sub y} films (transition metals: Mn, Cr)  

Science Conference Proceedings (OSTI)

The electronic and crystallographic structures, as well as the magnetic properties, of Eu{sub x}(transition metal){sub y} (transition metals: Mn, Cr) thin films grown by molecular beam epitaxy were studied. Relative changes of the Eu/Mn and Eu/Cr ratios derived from the XPS lines, as well as x-ray reflectivity, indicate mixing of the Eu/Mn and Eu/Cr layers. Valency transitions from Eu{sup 2+} to Eu{sup 3+} were observed in both systems for most studied stoichiometries. A transition to a magnetically ordered phase was observed at 15 K, 40 K, and 62 K for selected films in the Eu-Mn system, and at 50 K for the film with a Eu/Cr ratio of 0.5.

Balin, K. [A. Chelkowski Institute of Physics, University of Silesia, Katowice, 40-007 (Poland); Center for Magnetism and Magnetic Nanostructures, University of Colorado at Colorado Springs, Colorado Springs, Colorado 80918 (United States); Nowak, A. [A. Chelkowski Institute of Physics, University of Silesia, Katowice, 40-007 (Poland); Laboratoire de Physique de l'Etat Condense, University du Maine, Le Mans Cedex, 72085 (France); Gibaud, A. [Laboratoire de Physique de l'Etat Condense, University du Maine, Le Mans Cedex, 72085 (France); Szade, J. [A. Chelkowski Institute of Physics, University of Silesia, Katowice, 40-007 (Poland); Celinski, Z. [Center for Magnetism and Magnetic Nanostructures, University of Colorado at Colorado Springs, Colorado Springs, Colorado 80918 (United States)



Searching for a link between the presence of chemical spots on the surface of HgMn stars and their weak magnetic fields  

E-Print Network (OSTI)

We present the results of mapping the HgMn star AR Aur using the Doppler Imaging technique for several elements and discuss the obtained distributions in the framework of a magnetic field topology.

Savanov, I S; Gonzlez, J F; Schller, M



Observation of Orbital Ordering and Jahn-Teller Distortions Supporting the Wigner-crystal Model in Highly Dopes Bi{1-x}Ca{x}MnO{3}  

SciTech Connect

We report on the experimental characterization of orbital ordering and the associated lattice distortions in highly doped Bi{sub 1-x}Ca{sub x}MnO{sub 3}. Resonant x-ray diffraction was used at the Mn L-edge for the direct observation of the ordered localized states, and at the Mn K-edge for the sensitivity to the distortions of the manganese-oxygen octahedra. The orbital ordering on Mn atoms was directly observed at x=0.69; the analysis and the numerical simulations of the K-edge spectra allow us to characterize the pattern of the distorted octahedra at x = 4/5. These observations support the Wigner-crystal-type model at both dopings; the bi-stripe model is ruled out at x = 0.69.

Grenier,S.; Kiryukhin, V.; Cheong, S.; Kim, B.; Hill, J.; Thomas, K.; Tonnerre, J.; Joly, Y.; Staub, U.; Scagnoli, V.



A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



Excitons in single and double GaAs/AlGaAs/ZnSe/Zn(Cd)MnSe heterovalent quantum wells  

Science Conference Proceedings (OSTI)

Exciton photoluminescence spectra, photoluminescence excitation spectra, and magnetophotoluminescence spectra of single (GaAs/AlGaAs/ZnMnSe) and double (GaAs/AlGaAs/ZnSe/ZnCdMnSe) heterovalent quantum wells formed by molecular beam epitaxy are studied. It is shown that the exciton absorption spectrum of such quantum wells mainly reproduces the resonant exciton spectrum expected for usual quantum wells with similar parameters, while the radiative exciton recombination have substantial distinctions, in particular the additional localization mechanism determined by defects generated by heterovalent interface exists. The nature of these localization centers is not currently clarified; their presence leads to broadening of photoluminescence lines and to an increase in the Stokes shift between the peaks of luminescence and absorption, as well as determining the variation in the magnetic g factor of bound exciton complexes.

Toropov, A. A., E-mail: toropov@beam.ioffe.ru; Kaibyshev, V. Kh.; Terent'ev, Ya. V.; Ivanov, S. V.; Kop'ev, P. S. [Russian Academy of Sciences, Ioffe Physical Technical Institute (Russian Federation)



Phase Transition of ZnxMn1-xS Dilute Magnetic Semiconductor Nanoparticles under Ultra-high Pressure  

Science Conference Proceedings (OSTI)

The high-pressure behavior of different doping content of ZnS nanocrystals has been investigated using angle-dispersive synchrotron X-ray powder diffraction up to 45.1 GPa. A phase transformation from the zinc-blende(ZB) to the rock-salt (RS) structure is observed at pressures of about 17.7 and 18.3 GPa at room temperature, corresponding to the Mn{sup 2+} ion mole percent content solutions 0.85% and 1.26%, respectively. The obtained results indicate that the Mn{sup 2+} doping could obviously enhance the phase transition pressure of ZnS nanocrystal. The elevation of phase transition pressure could origin from the higher surface energy induced by ion doping.

Z Zong; Y Ma; T Hu; Q Cui; M Zhang; G Zou



Semiconducting Transition-Metal Oxides Based on D5 Cations: Theory for MnO and Fe2O3  

SciTech Connect

Transition-metal oxides with partially filled d shells are typically Mott or charge-transfer insulators with notoriously poor transport properties due to large effective electron/hole masses or due to carrier self-trapping. Employing band-structure calculations and ab initio small-polaron theory for MnO and Fe{sub 2}O{sub 3}, we explore the potential of d{sup 5} oxides for achieving desirable semiconducting properties, e.g., in solar energy applications. The quantification of self-trapping energies and the trends with the coordination symmetry suggest strategies to overcome the main bottlenecks, i.e., the tendency for self-trapping of holes due to Mn(II) and of electrons due to Fe(III).

Peng, H.; Lany, S.



Crystal and magnetic structures and physical properties of a new pyroxene NaMnGe2O6 synthesized under high pressure  

Science Conference Proceedings (OSTI)

A new pyroxene NaMnGe2O6 has been synthesized at 3 GPa and 800 C, and fully characterized by x-ray single-crystal diffraction and neutron powder diffraction, measurements of magnetization and specific heat. Like other majority sodium pyroxenes, NaMnGe2O6 crystallizes into a monoclinic C2/c structure with unit-cell parameters a = 9.859(2) , b = 8.7507(18) , c = 5.5724(11) , and =105.64(3) at room temperature. The crystal structure is featured by quasi-one-dimensional chains of skew edge-sharing MnO6 octahedra running along the crystallographic c axis; these chains are connected by non-magnetic GeO4 tetrahedra, so as to lead to a low-dimensional magnetism. The highly distorted MnO6 octahedron consisting of three Mn-O bond lengths, i.e. 1.918 , 1.991 , and 2.198 , is consistent with the Jahn-Teller effect at Mn3+ in a cubic crystal field. A long-range cooperative Jahn-Teller distortion is formed by ordering longest Mn-O bonds between two neighboring octahedra along the chain direction. No orbital order-disorder transition has been found up to 750 K as checked by magnetic susceptibility. Like other alkali-metal pyroxenes with S > , NaMnGe2O6 (S = 2) was found to undergo a long-range antiferromagnetic ordering at TN = 7 K at low magnetic field due to the exchange interactions along and between chains. Due to the peculiar structural features and the corresponding magnetic coupling, the weak AF spin ordering gives way to a ferromagnetic-like state at a sufficiently high magnetic field. Specific-heat measurements demonstrated that a large portion of the magnetic entropy, i.e. > 60 %, has been removed above TN as a result of strong spin correlations within the quasi-one-dimensional Mn3+-spin chains. Neutron powder diffraction study suggests a commensurate magnetic structure defined by k = [0 0 0.5] with Mn moments aligned along the c axis. The present study on NaMnGe2O6 completed the evolution of magnetic properties as a function of the d-orbital occupancy from d1 to d5 in the magnetic pyroxenes.

Yan, Jiaqiang [ORNL; Tian, Wei [ORNL; May, Andrew F [ORNL; Cheng, J G [University of Texas, Austin; Zhou, J.-S. [University of Texas, Austin; Garlea, Vasile O [ORNL; Neuefeind, Joerg C [ORNL; Steinfink, Hugo [University of Texas, Austin; Lynch, V [University of Texas, Austin



Structural, morphological, and magnetic characterization of In{sub 1-x}Mn{sub x}As quantum dots grown by molecular beam epitaxy  

SciTech Connect

In this paper, we present a method to order low temperature (LT) self-assembled ferromagnetic In{sub 1-x}Mn{sub x}As quantum dots (QDs) grown by molecular beam epitaxy (MBE). The ordered In{sub 1-x}Mn{sub x}As QDs were grown on top of a non-magnetic In{sub 0.4}Ga{sub 0.6}As/GaAs(100) QDs multi-layered structure. The modulation of the chemical potential, due to the stacking, provides a nucleation center for the LT In{sub 1-x}Mn{sub x}As QDs. For particular conditions, such as surface morphology and growth conditions, the In{sub 1-x}Mn{sub x}As QDs align along lines like chains. This work also reports the characterization of QDs grown on plain GaAs(100) substrates, as well as of the ordered structures, as function of Mn content and growth temperature. The substitutional Mn incorporation in the InAs lattice and the conditions for obtaining coherent and incoherent structures are discussed from comparison between Raman spectroscopy and x-ray analysis. Ferromagnetic behavior was observed for all structures at 2 K. We found that the magnetic moment axis changes from [110] in In{sub 1-x}Mn{sub x}As over GaAs to [1-10] for the ordered In{sub 1-x}Mn{sub x}As grown over GaAs template.

Ferri, F. A.; Marega, E. Jr. [Instituto de Fisica de Sao Carlos, Universidade de Sao Paulo, Sao Carlos 13560-970, SP (Brazil); Coelho, L. N. [Instituto de Fisica, Universidade de Brasilia, Brasilia 70919-970, DF (Brazil); Kunets, V. P.; Salamo, G. J. [Department of Physics, University of Arkansas, Fayetteville, Arkansas 72701 (United States)



Characterization of precipitation behaviors in a non-stoichiometric Cu-24.5at.%Al-19.4at.%Mn alloy  

SciTech Connect

Scanning and transmission electron microscopy examinations of Cu-24.5at.% Al-19.4at.%Mn (similar to Cu{sub 2.2}Mn{sub 0.8}Al) alloy were performed after aging at temperatures ranging from 350 deg. C to 700 deg. C for various durations. It was observed that only {gamma}-brass type and L-J phases were formed after aging at or below 400 deg. C. On the other hand, the {beta}-Mn phase was formed after aging at temperatures ranging from 500 deg. C to 650 deg. C. It is noteworthy that the precipitation behaviors of the {gamma}-brass type and {beta}-Mn phases are different at different aging temperatures. This remarkable result differs from those reported in previous studies on the Cu{sub 3-X}Mn{sub X}Al alloys with X {<=} 1. - Research Highlights: {yields}Precipitation behaviors in a Cu{sub 2.2}Mn{sub 0.8}Al alloy shows different results from those reported in previous studies on the Cu-A-lMn alloys. {yields}The {gamma}-brass type precipitate occurs at temperatures ranging from 350 deg. C to 500 deg. C revealing different precipitation characteristics. {yields}The {beta}-Mn phase formed after aging at 500 deg. C to 650 deg. C shows different precipitation behaviors as well. {yields}L-J phase having an orthorhombic structure could be always observed in the as-quenched and aged conditions.

Jeng, S.C., E-mail: sccheng@tsint.edu.tw



Solvothermal synthesis of Zn{sub 2}GeO{sub 4}:Mn{sup 2+} nanophosphor in water/diethylene glycol system  

SciTech Connect

The influence of aging of the suspension containing the amorphous precusors on structural, compositional and photoluminescent properties is studied to understand the mechanism on the formation of Zn{sub 2}GeO{sub 4}:Mn{sup 2+} nanoparticles during the solvothermal reaction in the water/diethylene glycol mixed solvent. Aging at 200 Degree-Sign C for 20 min forms the crystalline Zn{sub 2}GeO{sub 4} nanorods and then they grow up to {approx} 50 nm in mean length after aging for 240 min. Their interplanar spacing of (410) increases with increasing the aging time. The photoluminescence intensity corresponding to the d-d transition of Mn{sup 2+} increases with increasing the aging time up to 120 min, and then decreases after aging for 240 min. The photoluminescence lifetime decreases with increasing the aging time, indicating the locally concentrated Mn{sup 2+} ions. These results reveal that Mn{sup 2+} ions gradually replace Zn{sup 2+} ions near surface through repeating dissolusion and precipitation processes during prolonged aging after the complete crystallization of Zn{sub 2}GeO{sub 4}. - Graphical abstract: TEM images of Zn{sub 2}GeO{sub 4}:Mn{sup 2+} nanoparticles aged at 200 Degree-Sign C for different aging times in the mixed solvent of water and diethylene glycol. Highlights: Black-Right-Pointing-Pointer Mechanism on formation of Zn{sub 2}GeO{sub 4}:Mn{sup 2+} nanophosphor under solvothermal condition. Black-Right-Pointing-Pointer Zn{sub 2}GeO{sub 4} nanorods crystallize via amorphous precursors. Black-Right-Pointing-Pointer Gradual substitution of Mn{sup 2+} during prolonged aging. Black-Right-Pointing-Pointer Such an inhomogeneous Mn{sup 2+} doping process results in concentration quenching.

Takeshita, Satoru; Honda, Joji [Department of Applied Chemistry, Faculty of Science and Technology, Keio University, 3-14-1 Hiyoshi, Kohoku-ku, Yokohama 223-8522 (Japan); Isobe, Tetsuhiko, E-mail: isobe@applc.keio.ac.jp [Department of Applied Chemistry, Faculty of Science and Technology, Keio University, 3-14-1 Hiyoshi, Kohoku-ku, Yokohama 223-8522 (Japan); Sawayama, Tomohiro; Niikura, Seiji [SINLOIHI Company, Limited, 2-19-12 Dai, Kamakura 247-8550 (Japan)



Electron cyclotron emission reconstruction image and m/n=3/2 mode in HT-7 tokamak  

SciTech Connect

Electron cyclotron emission reconstruction image has been used for flux surface reconstruction. The reconstruction image is based on plasma rigid rotation which is obtained from Mirnov diagnostic. From the reconstructed two-dimensional flux surface, the classical m/n=3/2 mode is visualized, which is of similar spatial structure as neoclassical 3/2 mode observed in some other tokamaks [B. Esposito et al., Phys. Rev. Lett. 100, 045006 (2008)].

Li Erzhong; Hu Liqun; Ling Bili; Liu Yong; Ti Ang; Chen Kaiyun; Shen Biao; Gao Xiang [Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China)



Synthesis of Mn{sub 2}O{sub 3} homogeneous core/hollow-shell structures with excellent adsorption performance  

Science Conference Proceedings (OSTI)

Large-scale Mn{sub 2}O{sub 3} homogeneous core/hollow-shell structures with cube-shaped and dumbbell-shaped morphologies have been synthesized trough a facile and low-cost method. The microscopy analyses indicate that the core-shell microcubes have an average edge length of 2.5 {mu}m with a shell thickness of about 150 nm, and the core-shell microdumbbells were formed with a length of about 3 {mu}m and shell thickness of about 160 nm. The possible formation mechanism was discussed on the basis of transmission electron microscopy observations. The novel homogeneous core/hollow-shell structures were found to exhibit excellent performance in wastewater treatment. - Graphical abstract: A simple method is described for fabrication of Mn{sub 2}O{sub 3} homogeneous core/hollow-shell structures and the as-prepared materials showed a good ability to remove an organic pollutant in waste water. Highlights: Black-Right-Pointing-Pointer The Mn{sub 2}O{sub 3} homogeneous core/hollow-shell structures were successfully prepared. Black-Right-Pointing-Pointer A simple and high yield method was employed to fabricate such novel structure. Black-Right-Pointing-Pointer The products showed a good ability to remove an organic pollutant in waste water.

Cao Jie, E-mail: candj@mail.ustc.edu.cn [Anhui Provincial Key Lab of Photonics Devices and Materials, Anhui Institute of Optics and Fine Mechanics, Chinese Academy of Sciences, Hefei 230031 (China); Hefei National Laboratory for Physical Science at Microscale and Department of Chemistry, University of Science and Technology of China, Hefei, Anhui 230026 (China); Mao Qinghe [Anhui Provincial Key Lab of Photonics Devices and Materials, Anhui Institute of Optics and Fine Mechanics, Chinese Academy of Sciences, Hefei 230031 (China); Qian Yitai [Hefei National Laboratory for Physical Science at Microscale and Department of Chemistry, University of Science and Technology of China, Hefei, Anhui 230026 (China)



Electrode Materials with the Na0.44MnO2 Structure: Effect ofTitanium Substitution on Physical and Electrochemical Properties  

Science Conference Proceedings (OSTI)

The physical and electrochemical properties of LixMnO2 and LixTi0.11Mn0.89O2 synthesized from precursors made by glycine-nitrate combustion (GNC) and solid-state synthesis methods (SS) are examined in this paper. The highest specific capacities in lithium cells are obtained for SS-LixMnO2 electrodes at low current densities, but GNC-LixTi0.11Mn0.89O2 electrodes show the best high rate performance. These results can be explained by changes in the voltage characteristics and differences in the particle morphologies induced by the Ti-substitution and synthesis method. Ti-substitution also results in a decrease in the electronic conductivity, but greatly improves the thermal properties and imparts dissolution resistance to the electrode. For these reasons, it is preferable to use LixTi0.11MnO0.89O2 in lithium battery configurations rather than LixMnO2. Suggestions for improving the electrochemical performance of the Ti-substituted variant are given based on the results described herein.

Doeff, Marca M; Saint, Juliette A.; Doeff, Marca M; Wilcox, James D.



Isothermal calorimetry investigation of Li{sub 1+x}Mn{sub 2-y}Al{sub z}O{sub 4} spinel.  

DOE Green Energy (OSTI)

The heat generation of LiMn{sub 2}O{sub 4}, Li{sub 1.156}Mn{sub 1.844}O{sub 4}, and Li{sub 1.06}Mn{sub 1.89}Al{sub 0.05}O{sub 4} spinel cathode materials in a half-cell system was investigated by isothermal micro-calorimetry (IMC). The heat variations of the Li/LiMn{sub 2}O{sub 4} cell during charging were attributed to the LiMn{sub 2}O{sub 4} phase transition and order/disorder changes. This heat variation was largely suppressed when the stoichiometric spinel was doped with excess lithium or lithium and aluminum. The calculated entropy change (dE/dT) from the IMC confirmed that the order/disorder change of LiMn{sub 2}O{sub 4}, which occurs in the middle of the charge, was largely suppressed with lithium or lithium and aluminum doping. The dE/dT values obtained did not agree between the charge and the discharge at room temperature (25 C), which was attributed to cell self-discharge. This discrepancy was not observed at low temperature (10 C). Differential scanning calorimeter (DSC) results showed that the fully charged spinel with lithium doping has better thermal stability.

Lu, W.; Belharouak, I.; Park, S. H.; Sun, Y. K; Amine, K.; Chemical Engineering; Hanyang Univ.



Epitaxial growth on silicon and characterization of MnF{sub 2} and ZnF{sub 2} layers with metastable orthorhombic structure  

SciTech Connect

The growth of MnF{sub 2} and ZnF{sub 2} layers on Si(001) and Si(111) substrates was studied by molecular-beam epitaxy. Calcium fluoride buffer layers with (001) (110), and (111) orientations were used to prevent chemical interaction of MnF{sub 2} and ZnF{sub 2} molecules with the Si substrate. The analysis of x-ray and reflection high-energy electron-diffraction (RHEED) patterns showed that MnF{sub 2} layers grow on all of these planes in the orthorhombic {alpha}-PbO{sub 2}-type crystal phase observed earlier only at high pressures and temperatures. Atomic force microscopy revealed a strong dependence of the surface morphology on the buffer orientation and growth temperature. The best-ordered MnF{sub 2} growth occurred at 500 deg. C on a CaF{sub 2} (110) buffer layer. The diffraction analysis enabled us to find the epitaxial relations at the MnF{sub 2}/CaF{sub 2} interface. A careful analysis of the RHEED patterns of the films grown on CaF{sub 2}(001) showed a similarity in the structure and growth modes between MnF{sub 2} and ZnF{sub 2} layers, with ZnF{sub 2} tending to form multiphase layers. These findings are in agreement with the x-ray diffraction measurements.

Kaveev, A.K.; Anisimov, O.V.; Banshchikov, A.G.; Kartenko, N.F.; Ulin, V.P.; Sokolov, N.S. [Ioffe Physico-Technical Institute Russian Academy of Sciences, St. Petersburg 194021 (Russian Federation)



Factors Affecting the Hydrogen Embrittlement Resistance of Ni-Cr-Mn-Nb Welds  

DOE Green Energy (OSTI)

Nickel based alloys are often welded with argon/hydrogen shielding gas mixtures to minimize oxidation and improve weld quality. However, shielding gas mixtures with {ge} 1% hydrogen additions can result in hydrogen concentrations greater than 5 wt. ppm in the weld metal and reduce ductility via hydrogen embrittlement. For the conditions investigated, the degree of hydrogen embrittlement is highly variable between 5 and 14 wt. ppm. investigation of hydrogen embrittlement of EN82H GTAW welds via tensile testing, light microscopy, transmission electron microscopy, orientation imaging microscopy, and thermal desorption spectroscopy shows that this variability is due to the inhomogeneous microstructure of the welds, the presence of recrystallized grains, and complex residual plastic strains. Specifically, research indicates that high residual strains and hydrogen trapping lower the ductility of Ni-Cr-Mn-Nb weld metal when dissolved hydrogen concentrations are greater than 5 wt. ppm. The inhomogeneous microstructure contains columnar dendritic, cellular dendritic, and recrystallized grains. The decreased tensile ductility observed in embrittled samples is recovered by post weld heat treatments that decrease the bulk hydrogen concentration below 5 wt. ppm.

G.A. Young; C.K. Battige; N. Liwis; M.A. Penik; J. Kikel; A.J. Silvia; C.K. McDonald




U.S. Energy Information Administration (EIA)

Pilgrim Nuclear Power Station Massachusetts Total MD Calvert Cliffs Nuclear Power Plant Maryland Total MI Fermi Donald C Cook Michigan Total MN Prairie Island ...


A Continuous Measure of Gross Primary Production for the Conterminous U.S. Derived from MODIS and AmeriFlux Data  

E-Print Network (OSTI)

Oklahoma (ARM) Metolius intermediate aged ponderosa pine (MI) Metolius new young pine (MN) Brookings (Bro) Freeman Ranch Mesquite Juniper (FRM) Wind

Xia, Jingfeng




U.S. Energy Information Administration (EIA) Indexed Site


Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Enhanced Li+ ion transport in LiNi0.5Mn1.5O4 through Control of Site Disorder  

SciTech Connect

High voltage spinel LiNi0.5Mn1.5O4 is a very promising cathode material for lithium ion batteries that can be used to power hybrid electrical vehicles (HEVs). In an effort to maximize the performances of high voltage spinel, it is found that the presence of an appropriate amount of oxygen deficiency and/or Mn3+ is critical to accelerate the transport of Li+ ions within the crystalline structure. Through careful control of the cooling rates after high temperature calcination, LiNi0.5Mn1.5O4 spinels with different disordered phase and/or Mn3+ contents have been synthesized. It is revealed that during slow cooling process (<3oC/min), oxygen deficiency is reduced by the oxygen intake, thus residual Mn3+ amount is also decreased in spinels due to charge neutrality. The relative ratio of ordered/disordered phases in high voltage spinels are systematically investigated and finally correlated with Li+ transport phenomena in the lattice through electrochemical evaluation and in-situ XRD technique. LiNi0.5Mn1.5O4 with an appropriate amount of disordered phase or Mn3+ ions offers high rate capability (96 mAh g-1 at 10 C) and excellent cycling performance with 94.8% capacity retention after 300 cycles. The fundamental findings in this work can be widely used to guide the synthesis of other mixed oxides or spinels as high performance electrode materials for lithium ion batteries.

Zheng, Jianming; Xiao, Jie; Yu, Xiqian; Kovarik, Libor; Gu, Meng; Omenya, Fredrick; Chen, Xilin; Yang, Xiao-Qing; Liu, Jun; Graff, Gordon L.; Whittingham, M. S.; Zhang, Jiguang



Aurivillius phases of PbBi{sub 4}Ti{sub 4}O{sub 15} doped with Mn{sup 3+} synthesized by molten salt technique: Structure, dielectric, and magnetic properties  

Science Conference Proceedings (OSTI)

Doping of manganese (Mn{sup 3+}/Mn{sup 4+}) into the Aurivillius phase Pb{sub 1-x}Bi{sub 4+x}Ti{sub 4-x}Mn{sub x}O{sub 15} was carried out using the molten salt technique for various Mn concentrations (x=0, 0.2, 0.4, 0.6, 0.8, and 1). Single phase samples could be obtained in the composition range with x up to 0.6 as confirmed by X-ray and neutron diffraction analysis. Dielectric measurements show a peak at 801, 803, 813 and 850 K for samples with x=0, 0.2, 0.4, and 0.6, respectively, related to the ferroelectric transition temperature (T{sub c}). The main contribution of the in-plane polarization for x{=}0.4 the polarization originates from the dipole moment in the Ti(2)O{sub 6} layer. Mn doping in the Pb{sub 1-x}Bi{sub 4+x}Ti{sub 4-x}Mn{sub x}O{sub 15} does not show any long range magnetic ordering. -- Graphical abstract: The dipole moment of TiO{sub 6} dependence of x in Pb{sub 1-x}Bi{sub 4+x}Ti{sub 4-x}Mn{sub x}O{sub 15} (0{0.2. {yields} Ferromagnetic interactions show the contribution of mixed valence of Mn{sup 3+}/Mn{sup 4+}.

Zulhadjri; Prijamboedi, B. [Inorganic and Physical Chemistry Group, Faculty of Mathematics and Natural Sciences, Institut Teknologi Bandung, Jl. Ganesha No. 10, Bandung (Indonesia); Nugroho, A.A. [Magnetic and Photonic Physics Research-Group, Faculty of Mathematics and Natural Sciences, Institut Teknologi Bandung, Jl. Ganesha No. 10, Bandung (Indonesia); Mufti, N. [Physics Department, Universitas Negeri Malang, Jl. Surabaya 6, Malang 65145 (Indonesia); Fajar, A. [Centre for Technology of Nuclear Industry Materials - BATAN Puspiptek Serpong, Tangerang (Indonesia); Palstra, T.T.M. [Solid State Materials Laboratory, Zernike Institute for Advanced Materials, Rijksuniversiteit Groningen, Nijenborgh 4, 9747AG Groningen (Netherlands); Ismunandar, E-mail: ismu@chem.itb.ac.i [Inorganic and Physical Chemistry Group, Faculty of Mathematics and Natural Sciences, Institut Teknologi Bandung, Jl. Ganesha No. 10, Bandung (Indonesia)




Gasoline and Diesel Fuel Update (EIA)

Specific LNG Terminals Specific LNG Terminals Generic LNG Terminals Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Specific LNG Terminals Generic LNG Terminals Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana



Gasoline and Diesel Fuel Update (EIA)

LNG Imports LNG Imports Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming


Electrochemical Kinetics and Performance of Layered Composite Cathode Material Li[Li0.2Ni0.2Mn0.6]O2  

SciTech Connect

Lithium-rich, manganese-rich (LMR) layered composite cathode material Li[Li0.2Ni0.2Mn0.6]O2 has been successfully prepared by a co-precipitation method and its structure is confirmed by XRD characterization. The material delivers a high discharge capacity of 281 mAh g-1, when charged and discharged at a low current density of 10 mA g-1. However, significant increase of cell polarization and decrease of discharge capacity are observed at voltages below 3.5 V with increasing current densities. Galvanostatic intermittent titration technique (GITT) analysis demonstrates that lithium ion intercalation/de-intercalation reactions in this material are kinetically controlled by Li2MnO3 and its activated MnO2 component. The relationship between the electrochemical kinetics and rate performance as well as cycling stability has been systematically investigated. High discharge capacity of 149 mAh g-1 can be achieved at 10 C charge rate and C/10 discharge rate. The result demonstrates that the Li2MnO3 based material could withstand high charge rate (except initial activation process), which is very promising for practical applications. A lower discharge current density is preferred to overcome the kinetic barrier of lithium ion intercalation into MnO2 component, in order to achieve higher discharge capacity even at high charge rates.

Zheng, Jianming; Shi, Wei; Gu, Meng; Xiao, Jie; Zuo, Pengjian; Wang, Chong M.; Zhang, Jiguang



Pr{sub 0.67}Ba{sub 0.33}MnO{sub 3} in Bulk and Thin Film Ceramic  

Science Conference Proceedings (OSTI)

Bulk polycrystalline of Pr{sub 0.67}Ba{sub 0.33}MnO{sub 3}(PBMO) ceramic prepared via solid-state reaction and converted into thin films on corning glass, fused silica and MgO (100) by pulsed laser deposition (PLD) technique. As compared to bulk PBMO, the unit cell in thin film PBMO experienced positive misfit due to lattice strain induced by substrate used resulting MnO{sub 6} to deform (change in Mn-O-Mn bond angle and Mn-O bond length). Bulk PBMO had large grains ({approx}1.5{mu}m) as compared to thin film which are nano-sized (<100 nm). Two metal-insulator transition temperatures, T{sub P}(156 K and 190 K) were observed in bulk due to core-shell effect as proposed by Zhang et al.. In summary, variation of electrical behaviour was observed between bulk and thin film samples which believed to be due to the difference of ordering in core (body) and grain surface.

Wong, J. K.; Lim, K. P.; Halim, S. A.; Chen, S. K.; Ng, S. W.; Gan, H. M. Albert [Department of Physics, Faculty of Science, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor (Malaysia)



Preparation and physical properties of the solid solutions Cu{sub 1+x}Mn{sub 1-x}O{sub 2} (0=  

SciTech Connect

Solid solutions of formula Cu{sub 1+x}Mn{sub 1-x}O{sub 2} (0=Mn{sup 3+} ions and revealed that the predominant interactions are antiferromagnetic. Their strength decreases with x, which can be ascribed to a dilution effect, and long-range 3D magnetic ordering observed for CuMnO{sub 2}, disappears for x> 0.05. The crednerite solid solutions are p-type semiconductors. Modeling the thermoelectric power behavior suggests that charge carriers are Cu{sup 2+} holes diffusing in Cu layers for small x values and Mn{sup 4+} holes diffusing in Mn layers for x>0.05. For larger x values a saturation effect limits the charge carrier concentration.

Trari, M. [Laboratoire de Stockage et de Valorisation des Energies Renouvelables, USTHB BP 32, El-Alia Algiers 16111 Algeria (Algeria); Toepfer, J. [Fachhochschule Jena, FB SciTec Carl-Zeiss-Promenade 2, 07745 Jena (Germany); Dordor, P. [Institut de la Matiere Condensee de Bordeaux, ICMCB-CNRS, 87, avenue du Dr. Schweitzer, 33608 Pessac, Cedex (France); Grenier, J.C. [Institut de la Matiere Condensee de Bordeaux, ICMCB-CNRS, 87, avenue du Dr. Schweitzer, 33608 Pessac, Cedex (France); Pouchard, M. [Institut de la Matiere Condensee de Bordeaux, ICMCB-CNRS, 87, avenue du Dr. Schweitzer, 33608 Pessac, Cedex (France); Doumerc, J.P. [Institut de la Matiere Condensee de Bordeaux, ICMCB-CNRS, 87, avenue du Dr. Schweitzer, 33608 Pessac, Cedex (France)]. E-mail: doumerc@icmcb-bordeaux.cnrs.fr



LaMnO3 thin films grown by using pulsed laser deposition and their simple recovery to a stoichiometric phase by annealing  

Science Conference Proceedings (OSTI)

We systematically investigated various physical properties of epitaxial LaMnO{sub 3} thin films fabricated on SrTiO{sub 3} substrate by using pulsed laser deposition. In particular, we observed drastic changes in their properties when the as-grown films were annealed in a reduced-oxygen atmosphere. Whereas the as-grown LaMnO{sub 3} film showed ferromagnetic and semiconducting properties with a small optical band gap, the LaMnO{sub 3} films annealed at temperature higher than 700 C showed antiferromagnetic and insulating properties with an enlarged band gap. The optical features also changed drastically, in that the optical transition peak shifted to a higher energy with additional fine structures. Such changes were made in a direction such that the LaMnO{sub 3} films were more stoichiometric, indicating that the stoichiometric phase could be recovered by simple annealing of the pulsed-laser-deposited films. Finally, possibilities of the polar catastrophe scenario at the interface between LaMnO{sub 3} and SrTiO{sub 3} are briefly discussed.

Choi, W. S. [Seoul National University; Jeong, D. W. [Seoul National University; Jang, S. Y. [Seoul National University; Marton, Zsolt [ORNL; Seo, Sung Seok A [ORNL; Lee, Ho Nyung [ORNL; Lee, Y. S. [Soongsil University, Korea



Growth and structure of epitaxial Pb{sub 1-x}Mn{sub x}Se(Ga) films  

Science Conference Proceedings (OSTI)

The growth and structure of Pb{sub 1-x}Mn{sub x}Se (Ga) (N{sub Ga} = 0.8 at %) films with thicknesses of 0.3-0.5 {mu}m, grown on single-crystal PbSe{sub 1-x}S{sub x} (100) substrates by molecular-beam epitaxy, have been studied. It is established that films grow in a face-centered cubic lattice with the (100) orientation, reproducing the substrate orientation. The optimal conditions for obtaining photosensitive epitaxial films with perfect crystal structure are determined (W{sub 1/2} = 70-80'').

Nuriyev, I. R., E-mail: mhagiyev@yahoo.com; Gadzhiyev, M. B.; Sadigov, R. M. [National Academy of Sciences of Azerbaijan, Institute of Physics (Azerbaijan)



Detector Performance of Ammonium-Sulfide-Passivated CdZnTe and CdMnTe Materials  

Science Conference Proceedings (OSTI)

Dark currents, including those in the surface and bulk, are the leading source of electronic noise in X-ray and gamma detectors, and are responsible for degrading a detector's energy resolution. The detector material itself determines the bulk leakage current; however, the surface leakage current is controllable by depositing appropriate passivation layers. In previous research, we demonstrated the effectiveness of surface passivation in CZT (CdZnTe) and CMT (CdMnTe) materials using ammonium sulfide and ammonium fluoride. In this research, we measured the effect of such passivation on the surface states of these materials, and on the performances of detectors made from them.

Kim, K.H.; Bolotnikov, A.E.; Camarda, G.S.; Marchini, L.; Yang, G.; Hossain, A.; Cui, Y.; Xu, L.; and James, R.B.



Oxygen reduction at a YSZ interface with cathode materials La{sub 1-x}(Ca or Sr){sub x}MnO{sub 3} or Y{sub 1-x}CaMnO{sub 3}  

Science Conference Proceedings (OSTI)

Impedance spectroscopy combined with an unbonded interface cell (UIC) design, was used to assess oxygen reduction at an yttria-stabilized zirconia electrolyte interface with several substituted yttrium and lanthanum manganite cathode compositions. By analyzing impedance spectra taken using the UIC, effective length of reaction zone at the solid-gas triple phase boundary can be estimated and used to normalize the oxygen reduction reaction rate for each cell, thus effectively removing effect of interface morphology. Intrinsic reaction rates (specific oxygen activities) were determined from spectra as function of temperature and oxygen partial pressure for cathodes La{sub 1-x}(Ca or Sr){sub x}MnO{sub 3} and Y{sub 1-x}Ca{sub x}MnO{sub 3} (LCM, LSM and YCM, respectively) and for Pt. Specific activities in the temperature and P(O{sub 2}) ranges of an operating solid oxide fuel cell (SOFC) cathode, 1173--1273K and 10{sup 5}-10{sup 3} Pa, were highest for LCM intermediate for YCM and lowest for LSM. For LCM and YCM, compositions with x=0.5 gave highest specific activities. Specific activities for all of the tested manganite compositions exceeded the platinum specific activities by at least an order of magnitude. Shapes of impedance spectra for all the manganite systems were similar. Examination of spectra shapes revealed that the overall cathodic polarization process was rather complex and made up of at least two or more fundamental steps.

Youngblood, G.E.; Windisch, C.F. Jr.; Bates, J.L.



Charge transport and magnetization profile at the interface between the correlated metal CaRuO{sub3} and the antiferromagnetic insulator CaMnO{sub3}.;  

Science Conference Proceedings (OSTI)

A combination of spectroscopic probes was used to develop a detailed experimental description of the transport and magnetic properties of superlattices composed of the paramagnetic metal CaRuO{sub 3} and the antiferromagnetic insulator CaMnO{sub 3}. The charge-carrier density and Ru valence state in the superlattices are not significantly different from those of bulk CaRuO{sub 3}. The small charge transfer across the interface implied by these observations confirms predictions derived from density-functional calculations. However, a ferromagnetic polarization due to canted Mn spins penetrates 3-4 unit cells into CaMnO{sub 3}, far exceeding the corresponding predictions. The discrepancy may indicate the formation of magnetic polarons at the interface.

Freeland, J. W.; Chakhalian, J.; Boris, A. V.; Tonnerre, J-M.; Kavich, JJ.; Yordanov, P.; Grenier,S.; Zschack, P.; Karapetrova, E.; Popovich, P.; Lee, H. N.; Keimer, B. (X-Ray Science Division); ( PSC-USR); (Univ. of Arkansas); (Max Planck Inst. for Solid State Research); (Loughborough Univ.); (CNRS and Univ. Joseph Fourier); (Univ. of Illinois); (ORNL)



Alanine-assisted low-temperature combustion synthesis of nanocrystalline LiMn{sub 2}O{sub 4} for lithium-ion batteries  

SciTech Connect

Nanocrystalline LiMn{sub 2}O{sub 4} powders have been synthesized by combustion process in a single step using a novel fuel, L-alanine. Thermogravimetric analysis and differential thermal analysis of the gel indicate a sharp combustion at a temperature as low as 149 deg. C. Quantitative phase analysis of X-ray diffraction data shows about 97% of phase purity in the as-synthesized powder, which on further calcination at 700 deg. C becomes single phase LiMn{sub 2}O{sub 4}. High Brunauer, Emmett, and Teller surface area values obtained for ash (53 m{sup 2}/g) and calcined powder (23 m{sup 2}/g) indicate the ultrafine nature of the powder. Average crystallite size is found to be {approx}60-70 nm from X-ray diffraction analysis and transmission electron microscopy. Fourier transformed infra-red spectrum shows two strong bands at 615 and 511 cm{sup -1} originating from asymmetrical stretching of MnO{sub 6} octahedra. A nominal composition of Li{sub 0.88} Mn{sub 2}O{sub 4} is calculated from the inductive coupled plasma analysis. From UV-vis spectroscopy, an optical band gap of 1.43 eV is estimated which is assigned to a transition between t{sub 2g} and e{sub g} bands of Mn 3d. Electrochemical charge-discharge profiles show typical LiMn{sub 2}O{sub 4} behavior with a specific capacity of 76 mAh/g.

Raja, M.W. [Fuel Cell and Battery Section, Electroceramics Division, Central Glass and Ceramic Research Institute, Kolkata 700 032 (India); Mahanty, S. [Fuel Cell and Battery Section, Electroceramics Division, Central Glass and Ceramic Research Institute, Kolkata 700 032 (India); Ghosh, Paromita [Fuel Cell and Battery Section, Electroceramics Division, Central Glass and Ceramic Research Institute, Kolkata 700 032 (India); Basu, R.N. [Fuel Cell and Battery Section, Electroceramics Division, Central Glass and Ceramic Research Institute, Kolkata 700 032 (India)]. E-mail: rnbasu@cgcri.res.in; Maiti, H.S. [Fuel Cell and Battery Section, Electroceramics Division, Central Glass and Ceramic Research Institute, Kolkata 700 032 (India)



LaL2SrL8Mn207BelowTc : Exchange StricthR ECEI VED  

NLE Websites -- All DOE Office Websites (Extended Search)

088-00-105 088-00-105 58916-00-105 9714E3 co C--q 03/64 - 1 Sign Reversal of the MN-0 bond Compressibility r in LaL2SrL8Mn207BelowTc : Exchange StricthR ECEI VED in the Ferromagnetic State JUL Q 7 1997 O S T I D. N. Argyriout§ J. F. Mitchell, J. B. Goodenough * , 0. Chmaissemt S. Short, and J. D. Jorgensen t Science and Technology Center for Superconductivity and Materials Science Division Argonne National Laboratory Argonne, IL 60439 * Center for Materials Science and Engineering, ECT 9.102 University of Texas at Austin Austin, TX 78712-1063 the submitted manuscript has been created by the University of Chicago as Operator of Argonne National ( Argonne") under Contract No. W-31-109-ENG-38 with the U. S. Department of Energy. The U.S. Government retains for itself, and others acting on its behalf, a paid-up, non


Neutron contribution to CaF2:Mn thermoluminescent dosimeter response in mixed (n/y) field environments.  

SciTech Connect

Thermoluminescent dosimeters (TLDs), particularly CaF{sub 2}:Mn, are often used as photon dosimeters in mixed (n/{gamma}) field environments. In these mixed field environments, it is desirable to separate the photon response of a dosimeter from the neutron response. For passive dosimeters that measure an integral response, such as TLDs, the separation of the two components must be performed by postexperiment analysis because the TLD reading system cannot distinguish between photon- and neutron-produced response. Using a model of an aluminum-equilibrated TLD-400 (CaF{sub 2}:Mn) chip, a systematic effort has been made to analytically determine the various components that contribute to the neutron response of a TLD reading. The calculations were performed for five measured reactor neutron spectra and one theoretical thermal neutron spectrum. The five measured reactor spectra all have experimental values for aluminum-equilibrated TLD-400 chips. Calculations were used to determine the percentage of the total TLD response produced by neutron interactions in the TLD and aluminum equilibrator. These calculations will aid the Sandia National Laboratories-Radiation Metrology Laboratory (SNL-RML) in the interpretation of the uncertainty for TLD dosimetry measurements in the mixed field environments produced by SNL reactor facilities.

DePriest, Kendall Russell; Griffin, Patrick Joseph



Effect of Pt and H{sub 2} on n-butane isomerization over Fe and Mn promoted sulfated zirconia  

Science Conference Proceedings (OSTI)

The activity of a 0.4 wt% Pt-containing Fe and Mn promoted sulfated zirconia (PtSFMZ) catalyst in n-butane isomerization at 35{degrees}C was compared to that of a Pt-free catalyst (SFMZ). The maximum rate of n-butane conversion observed in helium over PtSFMZ was found to be 2.5 times higher than that over the SFMZ catalyst under the same conditions. It is believed that n-butane isomerization proceeds via a bimolecular mechanism in which the formation of hydrogen-deficient intermediates (carbenium ions and butenes), is necessary and the presence of transition metals such as Pt, Fe, and Mn on sulfated zirconia facilitates the formation/accumulation of these intermediates and increases their stability on the catalyst surface. The presence of H{sub 2} had a strong negative effect on n-butane conversion over PtSFMZ, but had no effect over SFMZ. The negative effect of H{sub 2} on PtSFMZ catalyst in n-butane isomerization reaction was attributed to the decreased concentration of butenes in the presence of hydrogen atoms which are formed by the dissociation of H{sub 2} on Pt. The ability of calcined Pt-containing catalysts to activate hydrogen at 35{degrees}C was demonstrated. Reduced SFMZ with or without Pt was not active at 35{degrees}C regardless of the nature of the carrier gas. 42 refs., 5 figs.

Song, Xuemin; Reddy, K.R.; Sayari, A. [Universite Laval, Quebec (Canada)] [Universite Laval, Quebec (Canada)



First-principles calculation of the effect of atomic disorder on the electronic structure of the half-metallic ferromagnet NiMnSb  

Science Conference Proceedings (OSTI)

The electronic structure of the half-metallic ferromagnet NiMnSb with three different types of atomic disorder is calculated using the layer Korringa-Kohn-Rostoker method in conjunction with the coherent potential approximation. Results indicate the presence of minority-spin states at the Fermi energy for degrees of disorder as low as a few percent. The resulting spin polarization below 100{percent} is discussed in the light of experimental difficulties confirming the half-metallic property of NiMnSb thin films directly. {copyright} {ital 1999} {ital The American Physical Society}

Orgassa, D.; Fujiwara, H. [Center for Materials for Information Technolgy (MINT), The University of Alabama, Tuscaloosa, Alabama 35487-0209 (United States); Schulthess, T.C.; Butler, W.H. [Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831-6114 (United States)



Magnetic properties of the chemically delithiated Li{sub x}Mn{sub 2}O{sub 4} with 0.07{<=}x{<=}1  

Science Conference Proceedings (OSTI)

Magnetism for the Li{sub x}Mn{sub 2}O{sub 4} samples with 0.07{<=}x{<=}1, which are prepared by a chemical reaction in HNO{sub 3} solution, is investigated by direct current susceptibility ({chi}) and muon-spin rotation/relaxation ({mu}SR) measurements. The effective magnetic moment ({mu}{sub eff}) of Mn ions decreases monotonically with decreasing x, indicating that Mn{sup 3+} ions with S=2 (t{sub 2g}{sup 3}e{sub g}{sup 1}) are oxidized to Mn{sup 4+} ions with S=3/2 (t{sub 2g}{sup 3}) with decreasing x. On the other hand, as x decreases from 1 to 0.6, the Curie-Weiss temperature ({Theta}{sub p}) increases monotonically from {approx}-260 to -100 K, and then levels off to -100 K with further decreasing x. This indicates that the antiferromagnetic interaction is dominant in the whole x range. For the x=0.48 sample, the temperature dependence of {chi} in field-cooling mode clearly deviates from that in zero-field-cooling mode below {approx}63 K (=T{sub m}). Furthermore, the hysteresis loop is observed in the magnetization vs. field curve at 5 K. Since the zero-field {mu}SR spectrum is well fitted by a strongly damped oscillation function, the Mn moments for the x=0.48 sample are in a highly disordered fashion down to the lowest temperature measured. -- Graphical abstract: Magnetic phase diagram of the chemically delithiated spinel Li{sub x}Mn{sub 2}O{sub 4} determined by magnetic susceptibility ({chi}) and muon spin rotation/relaxation ({mu}SR) measurements. Display Omitted Highlights: {yields} Magnetic properties of the chemically delithiated Li{sub x}Mn{sub 2}O{sub 4} samples are investigated. {yields} The antiferromagnetic interaction is dominant in the whole x range. {yields} All the Li{sub x}Mn{sub 2}O{sub 4} samples show a magnetic transition below T{sub m}. {yields} The remanent magnetization vs. x curve exhibits a maximum at x=0.48. {yields} The x=0.48 sample is in a highly disordered magnetic state even at 1.8 K.

Mukai, Kazuhiko, E-mail: e1089@mosk.tytlabs.co.j [Toyota Central Research and Development Laboratories, Inc., 41-1 Yokomichi, Nagakute, Aichi 480-1192 (Japan); Sugiyama, Jun; Kamazawa, Kazuya; Ikedo, Yutaka [Toyota Central Research and Development Laboratories, Inc., 41-1 Yokomichi, Nagakute, Aichi 480-1192 (Japan); Andreica, Daniel [Laboratory for Muon-Spin Spectroscopy, Paul Scherrer Institut, PSI Villigen CH-5232 (Switzerland); Faculty of Physics, Babes-Bolyai University, 400084 Cluj-Napoca (Romania); Amato, Alex [Laboratory for Muon-Spin Spectroscopy, Paul Scherrer Institut, PSI Villigen CH-5232 (Switzerland)



Exchange bias of spin valve structure with a top-pinned Co{sub 40}Fe{sub 40}B{sub 20}/IrMn  

SciTech Connect

We have investigated the exchange bias of a directly top-pinned Co{sub 40}Fe{sub 40}B{sub 20}/IrMn structure. An exchange bias was realized on the as-deposited samples, in which Co{sub 40}Fe{sub 40}B{sub 20} exhibits a fully amorphous structure. A current-in-plane giant magnetoresistance effect was demonstrated on simple Ru/CoFeB/Cu/CoFeB/IrMn/Ru stacks prior to and after annealing. The amorphous CoFeB layer partially crystallized from the interface with a Cu spacer layer after annealed at 280 deg. C.

You, C. Y.; Furubayashi, T.; Takahashi, Y. K. [National Institute for Materials Science, 1-2-1 Sengen, Tsukuba 305-0047 (Japan); Goripati, H. S. [Graduate School of Pure and Applied Sciences, University of Tsukuba, Tsukuba 305-8571 Japan (Japan); Hono, K. [National Institute for Materials Science, 1-2-1 Sengen, Tsukuba 305-0047 (Japan); Graduate School of Pure and Applied Sciences, University of Tsukuba, Tsukuba 305-8571 (Japan)



The Influence of Surface Chemistry on the Rate Capability of LiNi[subscript 0.5]Mn[subscript 0.5]O[subscript 2] for Lithium Rechargeable Batteries  

E-Print Network (OSTI)

Subsequent annealing at Formula enhances the rate capability of LiNi[subscript 0.5]Mn[subscript 0.5]O[subscript 2], delivering 180 mAh/g at 55[degrees]C and 8C rate compared to 50 mAh/g of LiNi[subscript 0.5]Mn[subscript ...

Yabuuchi, Naoaki

Note: This page contains sample records for the topic "mi mn wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Synthesis, characterization and electrochemmistry of lithium battery electrodes : xLi{sub 2}MnO{sub 3}{center_dot}(1-x)LiMn{sub 0.333}Ni{sub 0.333}Co{sub 0.333}O{sub2} (0{le}x{le}0.7).  

Science Conference Proceedings (OSTI)

Lithium- and manganese-rich layered electrode materials, represented by the general formula xLi{sub 2}MnO{sub 3} {center_dot} (1-x)LiMO{sub 2} in which M is Mn, Ni, and Co, are of interest for both high-power and high-capacity lithium ion cells. In this paper, the synthesis, structural and electrochemical characterization of xLi{sub 2}MnO{sub 3} {center_dot} (1-x)LiMn{sub 0.333}Ni{sub 0.333}Co{sub 0.333}O{sub 2} electrodes over a wide compositional range (0 {le} x {le} 0.7) is explored. Changes that occur to the compositional, structural, and electrochemical properties of the electrodes as a function of x and the importance of using a relatively high manganese content and a high charging potential (>4.4 V) to generate high capacity (>200 mAh/g) electrodes are highlighted. Particular attention is given to the electrode composition 0.3Li{sub 2}MnO{sub 3} {center_dot} 0.7LiMn{sub 0.333}Ni{sub 0.333}Co{sub 0.333}O{sub 2} (x = 0.3) which, if completely delithiated during charge, yields Mn{sub 0.533}Ni{sub 0.233}Co{sub 0.233}O{sub 2}, in which the manganese ions are tetravalent and, when fully discharged, LiMn{sub 0.533}Ni{sub 0.233}Co{sub 0.233}O{sub 2}, in which the average manganese oxidation state (3.44) is marginally below that expected for a potentially damaging Jahn-Teller distortion (3.5). Acid treatment of 0.3Li{sub 2}MnO{sub 3} {center_dot} 0.7LiMn{sub 0.333}Ni{sub 0.333}Co{sub 0.333}O{sub 2} composite electrode structures with 0.1 M HNO{sub 3} chemically activates the Li{sub 2}MnO{sub 3} component and essentially eliminates the first cycle capacity loss but damages electrochemical behavior, consistent with earlier reports for Li{sub 2}MnO{sub 3}-stabilized electrodes. Differences between electrochemical and chemical activation of the Li{sub 2}MnO{sub 3} component are discussed. Electrochemical charge/discharge profiles and cyclic voltammogram data suggest that small spinel-like regions, generated in cycled manganese-rich electrodes, serve to stabilize the electrodes, particularly at low lithium loadings (high potentials). The study emphasizes that, for high values of x, a relatively small LiMO{sub 2} concentration stabilizes a layered Li{sub 2}MnO{sub 3} electrode to reversible lithium insertion and extraction when charged to a high potential.

Johnson, C. S.; Li, N.; Lefief, C.; Vaughey, J. T.; Thackeray, M. M.; Chemical Sciences and Engineering Division



Demonstration Assessment of Light-Emitting Diode (LED) Roadway Lighting at the I-35W Bridge, Minneapolis, MN  

SciTech Connect

This report describes the process and results of a demonstration of solid-state lighting (SSL) technology conducted in 2009 at the recently reconstructed I-35W bridge in Minneapolis, MN. The project was supported under the U.S. Department of Energy (DOE) Solid-State Lighting GATEWAY Technology Demonstration Program. Other participants in the demonstration project included the Minnesota Department of Transportation (Mn/DOT), Federal Highways Administration (FHWA), and BetaLED (a division of Ruud Lighting). Pacific Northwest National Laboratory (PNNL) conducted the measurements and analysis of the results. DOE has implemented a three-year evaluation of the LED luminaires in this installation in order to develop new longitudinal field data on LED performance in a challenging, real-world environment. This document provides information through the initial phase of the I-35W bridge project, up to and including the opening of the bridge to the public and the initial feedback received on the LED lighting installation from bridge users. Initial findings of the evaluation are favorable, with minimum energy savings level of 13% for the LED installation relative to the simulated base case using 250W high-pressure sodium (HPS) fixtures. The LEDs had an average illuminance level of 0.91 foot candles compared to 1.29 fc for the HPS lamps. The LED luminaires cost $38,000 more than HPS lamps, yielding a lengthy payback period, however the bridge contractor had offered to include the LED luminaires as part of the construction package at no additional cost. One potentially significant benefit of the LEDs in this installation is avoiding rolling lane closures on the heavily-traveled interstate bridge for the purpose of relamping the HPS fixtures. Rolling lane closures involve multiple crew members and various maintenance and safety vehicles, diversion of traffic, as well as related administrative tasks (e.g., approvals, scheduling, etc.). Mn/DOT records show an average cost of relamping fixtures along interstate roadways of between $130-150 per pole. The previous bridge saw a lamp mortality rate of approximately 50% every two years, though the new bridge was designed to minimize many of the vibration issues. A voluntary Web-based feedback survey of nearly 500 self-described bridge users showed strong preference for the LED lighting - positive comments outnumbered negative ones by about five-to-one.

Kinzey, Bruce R.; Myer, Michael



Influence of defect formation as a result of incorporation of a Mn {delta} layer on the photosensitiviy spectrum of InGaAs/GaAs quantum wells  

Science Conference Proceedings (OSTI)

The influence of defect formation upon the deposition of a Mn {delta} layer and a GaAs coating layer (with the use of laser evaporation) on the photosensitivity spectra of heterostructures with InGaAs/GaAs quantum wells located in the near-surface region has been studied.

Gorshkov, A. P., E-mail: gorskovap@phys.unn.ru; Karpovich, I. A.; Pavlova, E. D.; Kalenteva, I. L. [Lobachevsky State University of Nizhny Novgorod (Russian Federation)



Study of the Mn-binding sites in photosystem II using antibodies raised against lumenal regions of the D1 and D2 reaction center proteins  

DOE Green Energy (OSTI)

The experiments discussed in this thesis focus on identifying the protein segments or specific amino acids which provide ligands to the Mn cluster of photosystem II (PS II). This Mn cluster plays a central role in the oxygen-evolving complex (OEC) of PS II. The Mn cluster is thought to be bound by lumenal regions of the PS II reaction center proteins known as D1 and D2. First, several peptides were synthesized which correspond to specific lumenal segments of the D1 and D2 proteins. Next, polyclonal antibodies were successfully elicited using three of these peptides. The peptides recognized by these antibodies correspond to protein segments of the spinach reaction center proteins: Ile-321 to Ala-344 of D1 (D1-a), Asp-319 to Arg-334 of D1 (D1-b), and Val-300 to Asn-319 of D2 (D2-a). These antibodies were then used in assays which were developed to structurally or functionally probe the potential Mn-binding regions of the D1 and D2 proteins.

Dalmasso, E.A.



In-situ x-ray characterization of LiMn{sub 2}O{sub 4}: A comparison of structural and electrochemical behavior  

DOE Green Energy (OSTI)

Li{sub x}Mn{sub 2}O{sub 4} materials are of considerable interest in battery research and development. The crystal structure of this material can significantly affect electrochemical performance. The ability to monitor changes of crystal structure during use, that is during electrochemical cycling, would prove useful to verify and control such structural changes. The authors report in-situ XRD measurements of LiMn{sub 2}O{sub 4} cathodes with the use of an electrochemical cell designed for in-situ X-ray analysis. Cells prepared using this cell design allow investigation of the changes in the LiMn{sub 2}O{sub 4} structure during charge and discharge. They describe the variation in lattice parameters along the voltage plateaus and consider the structural changes in terms of the electrochemical results on each cell. Kinetic effects of LiMn{sub 2}O{sub 4} phase changes are also addressed. Applications of the in-situ cell to other compounds such as LiCoO{sub 2} cathodes and carbon anodes are presented as well.

Rodriguez, M.A.; Ingersoll, D.; Doughty, D.H.



U.S. Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI : 140 : 2011-2013: Marysville, MI: 176 : 1,080: 14 : 2011-2013: St. Clair, MI: 1,562: 1,422: 2 : 26 : 2011-2013: Noyes, MN: 13,380: 14,460: 20,624: 33,889 ...


U.S. Price of Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI: 3.80 : 4.50 : 2011-2013: Marysville, MI: 3.63: 3.65 : 4.57: 4.70 : 2011-2013: St. Clair, MI: 3.75: 3.67: 4.09: 4.41 : 4.35: 2011-2013: Noyes, MN: 3.74: 3 ...


Structural and magnetic characterization of BiFe{sub x}Mn{sub 2-x}O{sub 5} oxides (x=0.5, 1.0)  

SciTech Connect

The title compounds have been synthesized by a citrate technique followed by thermal treatments in air (BiFe{sub 0.5}Mn{sub 1.5}O{sub 5}) or under high oxygen pressure conditions (BiFeMnO{sub 5}), and characterized by X-ray diffraction (XRD), neutron powder diffraction (NPD) and magnetization measurements. The crystal structures have been refined from NPD data in the space group Pbam at 295 K. These phases are isostructural with RMn{sub 2}O{sub 5} oxides (R=rare earths) and contain infinite chains of Mn{sup 4+}O{sub 6} octahedra sharing edges, linked together by (Fe,Mn){sup 3+}O{sub 5} pyramids and BiO{sub 8} units. These units are strongly distorted with respect to those observed in other RFeMnO{sub 5} compounds, due to the presence of the electro