Powered by Deep Web Technologies
Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Ageing and Toughness of a Mn-Ni-Mo PWR Steel  

Science Conference Proceedings (OSTI)

Abstract Scope, Mn-Ni-Mo steels are widely used in the fabrication of pressurisers, steam generators and pressure vessels of pressurised water reactors (PWR).

2

ON THE COMPETITION BETWEEN FERROMAGNETIC AND ANTIFERROMAGNETIC STATES IN Sr2MnMoO6  

E-Print Network (OSTI)

It is argued that the magnetic behavior of Sr2MnMoO6 is determined by the existence of two total energy minima corresponding to the metallic ferromagnetic and insulating antiferromagnetic states, which may be nearly degenerate depending on the magnitude of the breathing distortion. PACS: 71.20.Be; 71.70.Gm; 72.25.Ba; 75.30.Et

I. V. Solovyev

2002-01-01T23:59:59.000Z

3

Electrochemical Studies of Passive Film Stability on Fe49.7Cr17.7Mn1.9Mo7.4W1.6B15.2C3.8Si2.4 Amorphous Metal in Seawater at 90oCElectrochemical Studies of Passive Film Stability on Fe49.7Cr17.7Mn1.9Mo7.4W1.6B15.2C3.8Si2.4 Amorphous Metal in Seawater at 9  

Science Conference Proceedings (OSTI)

An iron-based amorphous metal, Fe{sub 49.7}Cr{sub 17.7}Mn{sub 1.9}Mo{sub 7.4}W{sub 1.6}B{sub 15.2}C{sub 3.8}Si{sub 2.4} (SAM2X5), with very good corrosion resistance was developed. This material was prepared as a melt-spun ribbon, as well as gas atomized powder and a thermal-spray coating. During electrochemical testing in several environments, including seawater at 90 C, the passive film stability was found to be comparable to that of high-performance nickel-based alloys, and superior to that of stainless steels, based on electrochemical measurements of the passive film breakdown potential and general corrosion rates. This material also performed very well in standard salt fog tests. Chromium (Cr), molybdenum (Mo) and tungsten (W) provided corrosion resistance, and boron (B) enabled glass formation. The high boron content of this particular amorphous metal made it an effective neutron absorber, and suitable for criticality control applications. This material and its parent alloy maintained corrosion resistance up to the glass transition temperature, and remained in the amorphous state during exposure to relatively high neutron doses.

Farmer, J C; Haslam, J; Day, S D; Lian, T; Saw, C K; Hailey, P D; Choi, J S; Rebak, R B; Yang, N; Payer, J H; Perepezko, J H; Hildal, K; Lavernia, E J; Ajdelsztajn, L; Branagan, D J; Buffa, E J; Aprigliano, L F

2007-04-25T23:59:59.000Z

4

Quantification of corrosion resistance of a new-class of criticality control materials: thermal-spray coatings of high-boron iron-based amorphous metals - Fe49.7Cr17.7Mn1.9Mo7.4W1.6B15.2C3.8Si2.4  

Science Conference Proceedings (OSTI)

An iron-based amorphous metal, Fe{sub 49.7}Cr{sub 17.7}Mn{sub 1.9}Mo{sub 7.4}W{sub 1.6}B{sub 15.2}C{sub 3.8}Si{sub 2.4} (SAM2X5), with very good corrosion resistance was developed. This material was produced as a melt-spun ribbon, as well as gas atomized powder and a thermal-spray coating. Chromium (Cr), molybdenum (Mo) and tungsten (W) provided corrosion resistance, and boron (B) enabled glass formation. The high boron content of this particular amorphous metal made it an effective neutron absorber, and suitable for criticality control applications. Earlier studies have shown that ingots and melt-spun ribbons of these materials have good passive film stability in these environments. Thermal spray coatings of these materials have now been produced, and have undergone a variety of corrosion testing, including both atmospheric and long-term immersion testing. The modes and rates of corrosion have been determined in the various environments, and are reported here.

Farmer, J C; Choi, J S; Shaw, C K; Rebak, R; Day, S D; Lian, T; Hailey, P; Payer, J H; Branagan, D J; Aprigliano, L F

2007-03-28T23:59:59.000Z

5

Long-Term Corrosion Tests of Prototypical SAM2X5 (Fe49.7Cr17.7Mn1.9Mo7.4W1.6B15.2C3.8Si2.4) Coatings  

Science Conference Proceedings (OSTI)

An iron-based amorphous metal with good corrosion resistance and a high absorption cross-section for thermal neutrons has been developed and is reported here. This amorphous alloy has the approximate formula Fe{sub 49.7}Cr{sub 17.7}Mn{sub 1.9}Mo{sub 7.4}W{sub 1.6}B{sub 15.2}C{sub 3.8}Si{sub 2.4} and is known as SAM2X5. Chromium (Cr), molybdenum (Mo) and tungsten (W) were added to provide corrosion resistance, while boron (B) was added to promote glass formation and the absorption of thermal neutrons. Since this amorphous metal has a higher boron content than conventional borated stainless steels, it provides the nuclear engineer with design advantages for criticality control structures with enhanced safety. While melt-spun ribbons with limited practical applications were initially produced, large quantities (several tons) of gas atomized powder have now been produced on an industrial scale, and applied as thermal-spray coatings on prototypical half-scale spent nuclear fuel containers and neutron-absorbing baskets. These prototypes and other SAM2X5 samples have undergone a variety of corrosion testing, including both salt-fog and long-term immersion testing. The modes and rates of corrosion have been determined in the various environments, and are reported here. While these coatings have less corrosion resistance than melt-spun ribbons and optimized coatings produced in the laboratory, substantial corrosion resistance has been achieved.

Farmer, J C; Choi, J S; Saw, C K; Rebak, R H; Day, S D; Lian, T; Hailey, P D; Payer, J H; Branagan, D J; Aprigliano, L F

2007-05-10T23:59:59.000Z

6

Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...

7

US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

8

US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

9

RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.

10

MoWitt  

NLE Websites -- All DOE Office Websites (Extended Search)

MoWiTT: Mobile Window Thermal Test Facility The window has come a long way since the days when it was a single pane of glass in a wood frame. Low-emissivity windows were designed...

11

DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility

12

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed

13

MI  

NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)

14

DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4

15

DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP

16

Thermodynamic Assessment of Ce-Mo, Mo-La, Mo-Y, Ce-V, La-V ...  

Science Conference Proceedings (OSTI)

In this work, six binary systems, Ce-Mo, Mo-La, Mo-Y, Ce-V, La-V and V-Y were thermodynamically assessed based on available experimental data in the...

17

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...

18

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...

19

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See Block 16C I  

National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)

20

US WNC MO Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

WNC MO WNC MO Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US WNC MO Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 3,000 6,000 9,000 12,000 15,000 US WNC MO Site Consumption kilowatthours $0 $300 $600 $900 $1,200 $1,500 US WNC MO Expenditures dollars ELECTRICITY ONLY average per household * Missouri households consume an average of 100 million Btu per year, 12% more than the U.S. average. * Average household energy costs in Missouri are slightly less than the national average, primarily due to historically lower residential electricity prices in the state. * Missouri homes are typically larger than homes in other states and are more likely to be attached or detached single-family housing units.

Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

MoS2  

NLE Websites -- All DOE Office Websites (Extended Search)

4 4 Myriam Perez De la Rosa1, Gilles Berhault2, Apurva Mehta3, and Russell R. Chianelli1 1University of Texas at El Paso, Materials Research Technology Institute, El Paso, TX 2Institut de Recherches sur la Catalyse, CNRS, Villeurbanne cedex, France 3Stanford Synchrotron Radiation Laboratory, Menlo Park, CA Figure 1: MoS2 layered structure. As the world economy continues to expand the demand for petroleum based fuel increases and the price of these fuels rises. The rising price of fuel has another consequence: refiners tend to purchase cheaper fuels of poorer quality. These poor quality fuels contain increasing amounts of sulfur and other pollutants leading to a decline in air quality worldwide. A recent New York Times article described the major impact a growing Chinese economy

22

DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.

23

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either

24

Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...

25

DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical

26

DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated

27

MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab

2008-10-01T23:59:59.000Z

28

Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)

2012-01-01T23:59:59.000Z

29

DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP

30

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state

31

Compaction and Sintering of Mo Powders  

SciTech Connect

To support the development of Mo-99 production by NorthStar Medical Technologies, LLC, Mo metal powders were evaluated for compaction and sintering characteristics as they relate to Mo-100 accelerator target disk fabrication. Powders having a natural isotope distribution and enriched Mo-100 powder were examined. Various powder characteristics are shown to have an effect on both the compaction and sintering behavior. Natural Mo powders could be cold pressed directly to >90% density. All of the powders, including the Mo-100 samples, could be sintered after cold pressing to >90% density. As an example, a compacted Mo-100 disk reached 89.7% density (9.52 g/cm3) after sintering at 1000 C for 1 hr. in flowing Ar/4%H2. Higher sintering temperatures were required for other powder samples. The relationships between processing conditions and the resulting densities of consolidated Mo disks will be presented.

Nunn, Stephen D [ORNL; Kiggans, Jim [ORNL; Bryan, Chris [ORNL

2013-01-01T23:59:59.000Z

32

Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio

2010-02-01T23:59:59.000Z

33

DOE - Office of Legacy Management -- St Louis Airport - MO 01  

Office of Legacy Management (LM)

Airport - MO 01 Airport - MO 01 FUSRAP Considered Sites St. Louis Airport, MO Alternate Name(s): Airport Site St. Louis Airport Storage Site (SLAPS) Former Robertson Storage Area Robertson Airport MO.01-1 MO.01-2 Location: Brown Road, Robertson, Missouri MO.01-2 Historical Operations: Stored uranium process residues containing uranium, radium, and thorium for the MED and AEC. MO.01-2 MO.01-3 MO.01-4 Eligibility Determination: Eligible MO.01-1 MO.01-7 Radiological Survey(s): Assessment Surveys MO.01-4 MO.01-5 Site Status: Cleanup in progress by U.S. Army Corps of Engineers. MO.01-6 USACE Website Long-term Care Requirements: To be determined upon completion. Also see Documents Related to St. Louis Airport, MO MO.01-1 - DOE Memorandum; Coffman to LaGrone; Subject: Authorization

34

Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png

35

ASHRAE 2000 Annual Meeting, June 24-28, 2000, Minneapolis, MN, and published in ASHRAE Transactions, 106(2) 2000.  

E-Print Network (OSTI)

LBNL-44422 Mo-420 ASHRAE 2000 Annual Meeting, June 24-28, 2000, Minneapolis, MN, and published in ASHRAE Transactions, 106(2) 2000. This work was supported by the Assistant Secretary for Energy-factors of predominantly planar, vertical windows has been made by both ASHRAE and NFRC, and as increasing consensus has

36

Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls

37

DOE - Office of Legacy Management -- Latty Avenue Site - MO 04  

NLE Websites -- All DOE Office Websites (Extended Search)

Latty Avenue Site - MO 04 Latty Avenue Site - MO 04 FUSRAP Considered Sites Latty Avenue Site, MO Alternate Name(s): Futura Coatings Futura Chemical Company Facility Hazelwood Interim Storage Site (HISS) Former Cotter Site, Latty Avenue Properties Contemporary Metals Corp. Continental Mining and Milling MO.04-1 MO.04-2 MO.04-5 MO.04-6 MO.06-8 MO.06-11 Location: 9200 Latty Avenue, Hazelwood, Missouri MO.04-1 Historical Operations: Received, stored, and processed uranium residues for the AEC. Storage and processing were licensed by the AEC and NRC and resulted in contamination of uranium and thorium. MO.04-5 MO.04-6 Eligibility Determination: Eligible MO.04-3 MO.04-4 Radiological Survey(s): Assessment Surveys MO.04-2 MO.04-7 MO.04-8 MO.04-9 MO.04-10 MO.04-11 Site Status: Cleanup in progress by U.S. Army Corps of Engineers. MO.04-12

38

,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

39

,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

40

Li2MnO3-LiMO2 (M=Mn, Co, Ni) Solid Solutions With Surface ...  

Science Conference Proceedings (OSTI)

AISI441 Interconnect-Air Electrode Interfacial Study for Solid Oxide ... Evaluation of a Compliant Silicate-based Sealing Glass for Solid Oxide Fuel Cells.

Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Effect of solution hardening on the shape memory effect of Fe-Mn based alloys  

SciTech Connect

Fe-high Mn-Si alloys, which undergo {gamma} (fcc) to {var_epsilon} (hcp) martensitic transformation, exhibit a pronounced shape memory effect. The origin of shape memory effect of these alloys is the reversion of stress-induced {var_epsilon} martensite. A shape change must hence be accomplish3ed by stress-induced martensitic transformation without permanent slip in austenite ({gamma}) in order to obtain a good shape memory effect. It is clear that the intrusion of permanent slip can be suppressed by increasing the strength of austenite and by decreasing the applied stress required for a shape change due to stress-induced martensitic transformation. It has been reported that the addition of the interstitial elements of C and N as well as the substitutional elements of Mo and V increases the 0.2% proof stress of austenite in Fe-high Mn alloys. However, there have been few studies on the effect of these alloying elements on the shape memory effect of Fe-high Mn based alloys. In the present study, it was aimed to improve the shape memory effect of Fe-high Mn based alloys by the strengthening of austenite through solution hardening due to C and Mo.

Tsuzaki, K.; Natsume, Y.; Maki, T. [Kyoto Univ. (Japan). Dept. of Materials Science and Engineering; Tomota, Y. [Ibaraki Univ., Hitachi (Japan)

1995-10-01T23:59:59.000Z

42

Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.

43

Category:Kansas City, MO | Open Energy Information  

Open Energy Info (EERE)

MO MO Jump to: navigation, search Go Back to PV Economics By Location Media in category "Kansas City, MO" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Kansas City MO Union Electric Co.png SVFullServiceRestauran... 74 KB SVHospital Kansas City MO Union Electric Co.png SVHospital Kansas City... 66 KB SVLargeHotel Kansas City MO Union Electric Co.png SVLargeHotel Kansas Ci... 66 KB SVLargeOffice Kansas City MO Union Electric Co.png SVLargeOffice Kansas C... 65 KB SVMediumOffice Kansas City MO Union Electric Co.png SVMediumOffice Kansas ... 65 KB SVMidriseApartment Kansas City MO Union Electric Co.png SVMidriseApartment Kan... 74 KB SVOutPatient Kansas City MO Union Electric Co.png SVOutPatient Kansas Ci... 66 KB SVPrimarySchool Kansas City MO Union Electric Co.png

44

Thermophysical Properties of U-10MO Alloy  

Science Conference Proceedings (OSTI)

This report provides an overview of thermophysical properties of unirradiated uranium alloyed with ten weight percent molybdenum (U 10Mo), with particular focus on those material properties needed for modeling of new fuels for HPRRs (High Performance Research Reactors). The report contains both historical data available in the literature on U-10Mo, as well as more recent results conducted by the Global Threat Reduction Initiative fuel development program. The main use of the report is intended as a standard U-10Mo alloy properties reference for reactor models and simulations.

A. M. Phillips; G. S. Mickum; D. E. Burkes

2010-11-01T23:59:59.000Z

45

Mn deposition on Ni{sub 2}MnGa(100)  

Science Conference Proceedings (OSTI)

We report the study of Mn adlayers on a Mn deficient Ni{sub 2}MnGa(100) surface by using low energy electron diffraction (LEED). The spot profile analysis indicates that after 0.2 monolayer (ML) deposition, the LEED spots become very sharp. This pattern indicates the removal of Mn vacancies formed on the surface due to Mn deficiency. But with further growth of Mn layers on this surface, the LEED spots become broad.

Nayak, J.; Rai, Abhishek; D'Souza, S. W.; Maniraj, M.; Barman, S. R. [UGC-DAE Consortium for Scientific Research, Khandwa Road, Indore, 452001, M.P. (India)

2012-06-05T23:59:59.000Z

46

Category:Minneapolis, MN | Open Energy Information  

Open Energy Info (EERE)

MN MN Jump to: navigation, search Go Back to PV Economics By Location Media in category "Minneapolis, MN" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Minneapolis MN Northern States Power Co (Minnesota) Excel Energy.png SVFullServiceRestauran... 89 KB SVHospital Minneapolis MN Northern States Power Co (Minnesota) Excel Energy.png SVHospital Minneapolis... 85 KB SVLargeHotel Minneapolis MN Northern States Power Co (Minnesota) Excel Energy.png SVLargeHotel Minneapol... 85 KB SVLargeOffice Minneapolis MN Northern States Power Co (Minnesota) Excel Energy.png SVLargeOffice Minneapo... 82 KB SVMediumOffice Minneapolis MN Northern States Power Co (Minnesota) Excel Energy.png SVMediumOffice Minneap... 83 KB SVMidriseApartment Minneapolis MN Northern States Power Co (Minnesota) Excel Energy.png

47

What is MoWiTT  

NLE Websites -- All DOE Office Websites (Extended Search)

the net energy flow through two window samples in side-by-side tests using ambient weather conditions. MoWiTT characterizes the net energy flow as a function of time and...

48

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:

49

DOE - Office of Legacy Management -- Petrolite Corp - MO 08  

Office of Legacy Management (LM)

Petrolite Corp - MO 08 Petrolite Corp - MO 08 FUSRAP Considered Sites Site: PETROLITE CORP (MO.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: St. Louis , Missouri MO.08-1 Evaluation Year: 1987 MO.08-4 Site Operations: Research involving test quantities of radioactive materials. MO.08-2 Site Disposition: Eliminated - Licensed - Potential for contamination remote MO.08-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Flouride & Thorium Oxide MO.08-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to PETROLITE CORP MO.08-1 - Summary Paper; Title: License History for Petrolite Corporation, St. Louis (MO.8); dated 07/16/93; with three attachments (3

50

The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.

2005-05-01T23:59:59.000Z

51

DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;

52

DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP

53

DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co

54

DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on

55

DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:

56

MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units

57

REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

58

Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper

2012-02-20T23:59:59.000Z

59

Accelerator Production Options for 99MO  

SciTech Connect

Shortages of {sup 99}Mo, the most commonly used diagnostic medical isotope, have caused great concern and have prompted numerous suggestions for alternate production methods. A wide variety of accelerator-based approaches have been suggested. In this paper we survey and compare the various accelerator-based approaches.

Bertsche, Kirk; /SLAC

2010-08-25T23:59:59.000Z

60

Mo Type Phase in Long-Term Aged INCONEL Alloy  

Science Conference Proceedings (OSTI)

FORMATION OF A PtzMo TYPE PHASE IN LONG-TERM AGED lNCONEL@ ALLOY 686. Michael G. ... formation of a low-temperature iutermetallic Pt*Mo type .

Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

MoWiTT: The Mobile Window Thermal Test Facility  

NLE Websites -- All DOE Office Websites (Extended Search)

Airflow schematic MoWiTT: The Mobile Window Thermal Test Facility In the MoWiTT facility, efficient window-and-frame systems are measured to understand the flow of energy through...

62

Role of SrMoO{sub 4} in Sr{sub 2}MgMoO{sub 6} synthesis  

Science Conference Proceedings (OSTI)

Here we investigate the elemental and phase compositions during the solid-state synthesis of the promising SOFC-anode material, Sr{sub 2}MgMoO{sub 6}, and demonstrate that molybdenum does not notably evaporate under the normal synthesis conditions with temperatures up to 1200 {sup o}C due to the formation of SrMoO{sub 4} as an intermediate product at low temperatures, below 600 {sup o}C. However, partial decomposition of the Sr{sub 2}MgMoO{sub 6} phase becomes evident at the higher temperatures ({approx}1500 {sup o}C). The effect of SrMoO{sub 4} on the electrical conductivity of Sr{sub 2}MgMoO{sub 6} is evaluated by preparing a series of Sr{sub 2}MgMoO{sub 6} samples with different amounts of additional SrMoO{sub 4}. Under the reducing operation conditions of an SOFC anode the insulating SrMoO{sub 4} phase is apparently reduced to the highly conductive SrMoO{sub 3} phase. Percolation takes place with 20-30 wt% of SrMoO{sub 4} in a Sr{sub 2}MgMoO{sub 6} matrix, with a notable increase in electrical conductivity after reduction. Conductivity values of 14, 60 and 160 S/cm are determined at 800 {sup o}C in 5% H{sub 2}/Ar for the Sr{sub 2}MgMoO{sub 6} samples with 30, 40 and 50 wt% of added SrMoO{sub 4}, respectively. -- Graphical abstract: SrMoO{sub 4} is formed at low temperatures during the synthesis of Sr{sub 2}MgMoO{sub 6}, which prevents the volatilization of Mo from typical precursor mixtures of this promising SOFC anode material. SrMoO{sub 4} is insulating and it is often found as an impurity in Sr{sub 2}MgMoO{sub 6} samples. It is however readily reduced to highly conducting SrMoO{sub 3}. Composites of Sr{sub 2}MgMoO{sub 6} and SrMoO{sub 3} show increased electrical conductivities compared to pure Sr{sub 2}MgMoO{sub 6} under the reductive operation conditions of an SOFC anode. Display Omitted Highlights: {yields} Sr{sub 2}MgMoO{sub 6} is a promising SOFC anode material. {yields} During the Sr{sub 2}MgMoO{sub 6} synthesis SrMoO{sub 4} is formed at low temperatures. {yields} Formation of SrMoO{sub 4} effectively prevents volatilization of Mo at high temperatures. {yields} Insulating SrMoO{sub 4} reduces to highly conductive SrMoO{sub 3} under SOFC-anode conditions. {yields} Composites of Sr{sub 2}MgMoO{sub 6} and SrMoO{sub 3} show high electrical conductivities.

Vasala, S.; Yamauchi, H. [Laboratory of Inorganic Chemistry, Department of Chemistry, School of Chemical Technology, Aalto University, P.O. Box 16100, FI-00076 Aalto (Finland); Karppinen, M., E-mail: maarit.karppinen@aalto.f [Laboratory of Inorganic Chemistry, Department of Chemistry, School of Chemical Technology, Aalto University, P.O. Box 16100, FI-00076 Aalto (Finland)

2011-05-15T23:59:59.000Z

63

Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-10-01T23:59:59.000Z

64

Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel

2010-01-01T23:59:59.000Z

65

MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-12-01T23:59:59.000Z

66

Microsoft Word - Mn.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

5 5 Structural Determination of Marine Bacteriogenic Manganese Oxides John R. Bargar, Samuel M. Webb (Stanford Synchrotron Radiation Laboratory), and Bradley M. Tebo (Oregon Health and Science University) Bacterial oxidation of Mn(II) impacts the global geochemical cycling of carbon, nitrogen, sulfur, nutrients, and contaminants in the environment. Manganese is abundant in the biosphere (~10 14 Kg of suspended and dissolved manganese in the oceans) and is second only to iron in relative terrestrial abun- dance of transition metals. Manganese is an important nutrient in the marine water column and is fundamentally required for photosynthesis. The acquisition of manganese by organisms and the biogeochemistry of manganese in the oceans is therefore an

67

Missouri Department of National Resources Energy Center Mo DNR | Open  

Open Energy Info (EERE)

Department of National Resources Energy Center Mo DNR Department of National Resources Energy Center Mo DNR Jump to: navigation, search Name Missouri Department of National Resources Energy Center (Mo DNR) Place Jefferson City, Missouri Zip 65102 Product Mo DNR manages the Energy Revolving Fund which assists public organisations in Missouri in financing energy efficient projects for their facilities. References Missouri Department of National Resources Energy Center (Mo DNR)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Missouri Department of National Resources Energy Center (Mo DNR) is a company located in Jefferson City, Missouri . References ↑ "Missouri Department of National Resources Energy Center (Mo

68

Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)

2011-12-01T23:59:59.000Z

69

DOE - Office of Legacy Management -- Elk River Reactor - MN 01  

Office of Legacy Management (LM)

Elk River Reactor - MN 01 FUSRAP Considered Sites Site: Elk River Reactor (MN.01 ) Eliminated from consideration under FUSRAP - Reactor was dismantled and decommissioned by 1974...

70

A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)

2012-07-15T23:59:59.000Z

71

DOE - Office of Legacy Management -- United Nuclear Corp - MO 0-03  

Office of Legacy Management (LM)

United Nuclear Corp - MO 0-03 United Nuclear Corp - MO 0-03 FUSRAP Considered Sites Site: UNITED NUCLEAR CORP. (MO.0-03) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mallinckrodt Chemical Works Mallinckrodt Nuclear Corporation MO.0-03-1 MO.0-03-2 Location: Hematite , Missouri MO.0-03-1 Evaluation Year: Circa 1987 MO.0-03-3 Site Operations: Commercial fuel fabrication operation. Licensed to reclaim unirradiated enriched uranium from scrap generated in fuel fabrication and fuel material preparation. MO.0-03-1 MO.0-03-2 MO.0-03-3 MO.0-03-4 Site Disposition: Eliminated - NRC licensed - Commercial operations MO.0-03-3 MO.0-03-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MO.0-03-3 Radiological Survey(s): None Indicated

72

MoNDian Dark Matter, Entropic Gravity, and Infinite Statistics  

E-Print Network (OSTI)

We propose the concept of MoNDian dark matter which behaves like cold dark matter at cluster and cosmic scales but emulates modified Newtonian dynamics at the galactic scale. The connection between global physics and local galactic dynamics is implemented via entropic gravity. We also give an alternative formulation of MoNDian dark matter by using an effective gravitational Born-Infeld theory. In the latter approach, we show that the quanta of MoNDian dark matter obey infinite statistics.

Y. Jack Ng

2012-12-27T23:59:59.000Z

73

Microstructure Characterization and Processing of U-Mo Alloy Fuels ...  

Science Conference Proceedings (OSTI)

molybdenum (Mo) fuels have been identified as a potential replacement for highly enriched uranium (HEU) dispersion fuels in high performance research...

74

Interdiffusion between Zr Diffusion Barrier and U-Mo Alloy  

Science Conference Proceedings (OSTI)

U-Mo alloys are being developed as low enrichment uranium fuels under the Reduced Enrichment for Research and Test Reactor (RERTR) program. Significant reactions have been observed between U-Mo fuels and Al or Al alloy matrix. Refractory metal Zr has been proposed as barrier material to reduce the interactions. In order to investigate the compatibility and barrier effects between U-Mo alloy and Zr, solid-to-solid U-10wt.%Mo vs. Zr diffusion couples were assembled and annealed at 600, 700, 800, 900 and 1000 C for various times. The microstructures and concentration profiles due to interdiffusion and reactions were examined via scanning electron microscopy and electron probe microanalysis, respectively. Intermetallic phase Mo2Zr was found at the interface and its population increased when annealing temperature decreased. Diffusion paths were also plotted on the U-Mo-Zr ternary phase diagrams with good consistency. The growth rate of interdiffusion zone between U-10wt.%Mo and Zr was also calculated under the assumption of parabolic diffusion, and was determined to be about 103 times lower than the growth rate of diffusional interaction layer found in diffusion couples U-10wt.%Mo vs. Al or Al-Si alloy. Other desirable physical properties of Zr as barrier material, such as neutron adsorption rate, melting point and thermal conductivity are presented as supplementary information to demonstrate the great potential of Zr as the diffusion barrier for U-Mo fuel systems in RERTR.

K. Huang; Y. Park; Y. H. Sohn

2012-12-01T23:59:59.000Z

75

Balancing the Properties of Structural Mo-Borosilicide Alloys for ...  

Science Conference Proceedings (OSTI)

Symposium, Advanced Protective Coatings for Refractory Metals and Alloys. Presentation Title, Balancing the Properties of Structural Mo-Borosilicide Alloys for...

76

IMPROVEMENT OF CdMnTe DETECTOR PERFORMANCE BY MnTe PURIFICATION  

Science Conference Proceedings (OSTI)

Residual impurities in manganese (Mn) are a big obstacle to obtaining high-performance CdMnTe (CMT) X-ray and gamma-ray detectors. Generally, the zone-refining method is an effective way to improve the material's purity. In this work, we purified the MnTe compounds combining the zone-refining method with molten Te, which has a very high solubility for most impurities. We confirmed the improved purity of the material by glow-discharge mass spectrometry (GDMS). We also found that CMT crystals from a multiply-refined MnTe source, grown by the vertical Bridgman method, yielded better performing detectors.

Kim, K.H.; Bolotnikov, A.E.; Camarda, G.S.; Tappero, R.; Hossain, A.; Cui, Y.; Yang, G.; Gul, R.; and James, R.B.

2011-04-25T23:59:59.000Z

77

Observations on the oxidation of Mn-modified Ni-base Haynes 230 alloy under SOFC exposure conditions  

Science Conference Proceedings (OSTI)

The commercial Ni-base Haynes 230 alloy (Ni-Cr-Mo-W-Mn) was modified with two increased levels of Mn (1 and 2 wt per cent) and evaluated for its oxidation resistance under simulated SOFC interconnect exposure conditions. Oxidation rate, oxide morphology, oxide conductivity and thermal expansion were measured and compared with commercial Haynes 230. It was observed that additions of higher levels of Mn to the bulk alloy facilitated the formation of a bi-layered oxide scale that was comprised of an outer M3O4 (M=Mn, Cr, Ni) spinel-rich layer at the oxide gas interface over a Cr2O3-rich sub-layer at the metal oxide interface. The modified alloys showed higher oxidation rates and the formation of thicker oxide scales compared to the base alloy. The formation of a spinel-rich top layer improved the scale conductivity, especially during the early stages of the oxidation, but the higher scale growth rate resulted in an increase in the area-specific electrical resistance over time. Due to their face-centered cubic crystal structure, both commercial and modified alloys demonstrated a coefficient of thermal expansion that was higher than that of typical anode-supported and electrolyte-supported SOFCs.

Yang, Z Gary; Xia, Gordon; Stevenson, Jeffry W.; Singh, Prabhakar

2005-07-01T23:59:59.000Z

78

Solid Solution Phases in Olivine-Type LiMnPO4/MnP4System  

NLE Websites -- All DOE Office Websites (Extended Search)

Solid Solution Phases in Olivine-Type LiMnPO4MnP4System Title Solid Solution Phases in Olivine-Type LiMnPO4MnP4System Publication Type Journal Article Year of Publication 2009...

79

Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.

1997-10-01T23:59:59.000Z

80

Co-Mo Electric Cooperative - Residential Energy Efficiency Rebate Program |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Co-Mo Electric Cooperative - Residential Energy Efficiency Rebate Co-Mo Electric Cooperative - Residential Energy Efficiency Rebate Program Co-Mo Electric Cooperative - Residential Energy Efficiency Rebate Program < Back Eligibility Commercial Residential Savings Category Heating & Cooling Commercial Heating & Cooling Heat Pumps Appliances & Electronics Water Heating Cooling Maximum Rebate Geothermal Heat Pumps: 10 ton maximum for Residential, 50 ton maximum for Commercial Program Info State Missouri Program Type Utility Rebate Program Rebate Amount Room AC: $50 Water Heater: $50 Air Source Heat Pumps: $150 per ton Dual Fuel Air Source Heat Pumps: $300 per ton Geothermal Heat Pumps (Closed Loop): up to $850 per ton Geothermal Heat Pumps (Open Loop or Replacement): $150 per ton Provider Co-Mo Electric Cooperative Co-Mo Electric Cooperative provides rebates to residential and commercial

Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Microsoft Word - Poster Abstract_2010_MO-SCI.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

* * Presenter High-Temperature Viscous Sealing Glasses for Solid Oxide Fuel Cells Cheol-Woon Kim * , Cindy L. Schwartz, Joe Szabo, Kevin S. Barr, and Ted E. Day MO-SCI Corporation, Rolla, MO 65401 * ckim@mo-sci.com; (573) 364-2338 Richard K. Brow ** and Zhongzhi Tang Department of Materials Science and Engineering and the Graduate Center for Materials Research, Missouri University of Science and Technology, Rolla, MO 65409-1170 ** brow@mst.edu; (573) 341-6812 MO-SCI Corporation and the Missouri University of Science and Technology successfully identified and tested several glass compositions that could be used as viscous seals for Solid Oxide Fuel Cells (SOFCs) through a SBIR Phase I project (DE-SC0002491). The glasses possess desirable viscosity characteristics- that is, they have softening points in the temperature range

82

DOE - Office of Legacy Management -- Rogers Iron Works Co - MO 10  

Office of Legacy Management (LM)

Rogers Iron Works Co - MO 10 Rogers Iron Works Co - MO 10 FUSRAP Considered Sites Site: ROGERS IRON WORKS CO. (MO.10 ) Elimination from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Rogers Iron Co. MO.10-1 Location: Joplin , Missouri MO.10-1 Evaluation Year: 1990 MO.10-2 MO.10-3 Site Operations: Tested C-liner crushing methods. MO.10-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantities of material handled MO.10-3 MO.10-4 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium (Trace Amounts) MO.10-2 Radiological Survey(s): None Indicated Site Status: Elimination from consideration under FUSRAP Also see Documents Related to ROGERS IRON WORKS CO. MO.10-1 - National Lead Company of Ohio Analytical Data Sheet 9908;

83

Mo Year Report Period: EIA ID NUMBER:  

U.S. Energy Information Administration (EIA) Indexed Site

Version No: 2013.01 Mo Year Report Period: EIA ID NUMBER: http://www.eia.gov/survey/form/eia_14/instructions.pdf Mailing Address: Secure File Transfer option available at: (e.g., PO Box, RR) https://signon.eia.doe.gov/upload/noticeoog.jsp Electronic Transmission: The PC Electronic Zip Code - Data Reporting Option (PEDRO) is available. If interested in software, call (202) 586-9659. Email form to: OOG.SURVEYS@eia.doe.gov - - - - Fax form to: (202) 586-9772 Mail form to: Oil & Gas Survey Email address: U.S. Department of Energy Ben Franklin Station PO Box 279 Washington, DC 20044-0279 Questions? Call toll free: 1-800-638-8812 PADD 4 Type of Report (Check One ): (Thousands of dollars) (Thousands of barrels) PADD 2 PADD 3 PAD DISTRICT (a) Revision to Report:

84

MattssonMoVacPrague2009.ppt  

National Nuclear Security Administration (NNSA)

Thomas R Mattsson Thomas R Mattsson Sandia National Laboratories Albuquerque, NM, USA Nils Sandberg -- KTH, Stockholm Richard Armiento -- Univ. Bayreuth, Germany Ann Mattsson -- Sandia National Laboratories Self-diffusion in Mo using the AM05 density functional Sandia is a multiprogram laboratory operated by Sandia Corporation, a Lockheed Martin Company, for the United States Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000. Joint U.S. Russia Conference on Advances in Materials Science Prague, Czech Republic Aug 31-Sept 3, 2009 SAND 2009-2197 C, 2009-3883 C, 2009-4713 C, and 2002-1323 P Vacancy mediated diffusion is the main mechanism for mass transport in solids *Vacancies are important for *Self-diffusion *Defect migration *Radiation damage/ swelling

85

MN Office of Energy Security | Open Energy Information  

Open Energy Info (EERE)

MN Office of Energy Security MN Office of Energy Security Jump to: navigation, search Name MN Office of Energy Security Place St. Paul, MN Website http://www.mnofficeofenergysec References MN Office of Energy Security[1] Information About Partnership with NREL Partnership with NREL Yes Partnership Type Test & Evaluation Partner Partnering Center within NREL Electricity Resources & Building Systems Integration LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! MN Office of Energy Security is a company located in St. Paul, MN. References ↑ "MN Office of Energy Security" Retrieved from "http://en.openei.org/w/index.php?title=MN_Office_of_Energy_Security&oldid=379158" Categories: Clean Energy Organizations Companies Organizations

86

Composition-structure-property-performance relationship inMn-substituted LiMn2O4  

DOE Green Energy (OSTI)

The spinel LiMn{sub 2}O{sub 4} has been extensively studied as a positive electrode active material in lithium rechargeable batteries. Partial substitution of Mn by another metal has also been the subject of recent study in an effort to improve the cycling performance. In general, the literature has shown that Mn substitution results in improved cycling stability at the expense of capacity (1,2). Resistance to the formation of tetragonal phase upon lithiation of the starting spinel (via a higher nominal Mn oxidation state in the substituted spinel) has been suggested as a mechanism for the improved performance. The degree of substitution is an important factor to optimize in order to minimize capacity loss and costs. The spectroscopic investigations on LiMn{sub 2}O{sub 4} described in the previous paper (LixMn2O4) confirmed that the cooperative Jahn-Teller effect (CJTE) from the [Mn{sup 3+}O{sub 6}] octahedra is the mechanism for the cubic to tetragonal phase transformation. The driving force for the CJTE is based upon the electronic structure, therefore changes in electronic structure should lead to changes in the phase behavior. The fact that the LiMn{sub 1.5}Ni{sub 0.5}O{sub 4} does not form tetragonal phase upon discharging (FUJI3, MUCK?), unlike the 100% Mn{sup 4+} spinel Li{sub 4}Mn{sub 5}O{sub 12} (THAC5), led to the hypothesis that an increased degree of covalency as a source for the behavior. An increased covalence would remove the driving force for the transformation, the increased electronic stability achieved in tetragonally-distorted [Mn{sup 3+}O{sub 6}] octahedra, due to a change in electron density and widening of the Mn 3d bands. The STH field is dependent upon the amount of unpaired spin density transferred between the magnetic (transition-metal) and diamagnetic ions through an intermittent oxygen ion, attributable to overlap and electron transfer effects. Therefore, the magnitude of the STH coupling constant reflects the degree of covalency (GESC, HUAN). In the case of LiMn{sub 2-y}Me{sub y}O{sub 4}, the STH coupling constant characterizes the amount of unpaired spin density transferred to the Li{sup +} from the Mn, Co, or Ni. Similarly, the La/Lb ratio of the Mn L-XES is sensitive to the amount of electron density at the Mn site as a higher ratio indicates that the Mn 3d{sub 5/2} level is more populated (GRUS1). An investigation into the effects of Mn-substitution on the electronic structure along with the ramifications to the phase behavior upon changing lithium content was carried out. To accomplish this, a set of LiMn{sub 2-y}Me{sub y}O{sub 4} with Me = Li, Co, or Ni over a range of y were synthesized, characterized, and subjected to changes in lithium content by various techniques.

Horne, Craig R.; Richardson, Thomas J.; Gee, B.; Tucker, Mike; Grush, Melissa M.; Bergmann, Uwe; Striebel, Kathryn A.; Cramer, StephenP.; Reimer, Jeffrey A.; Cairns, Elton J.

2001-03-09T23:59:59.000Z

87

DOE - Office of Legacy Management -- Tyson Valley Powder Farm - MO 11  

Office of Legacy Management (LM)

Tyson Valley Powder Farm - MO 11 Tyson Valley Powder Farm - MO 11 FUSRAP Considered Sites Site: TYSON VALLEY POWDER FARM (MO.11) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: St. Louis County , Missouri MO.11-1 Evaluation Year: 1987 MO.11-2 Site Operations: Storage of C-Special material (residue from production of uranium metal). MO.11-1 MO.11-2 MO.11-3 Site Disposition: Eliminated - Referred to Army Corps of Engineers MO.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MO.11-3 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to TYSON VALLEY POWDER FARM MO.11-1 - Letter; Dickenson to Duff; Subject: Granted continued use

88

DOE - Office of Legacy Management -- Spencer Chemical Co - MO 0-01  

Office of Legacy Management (LM)

MO 0-01 MO 0-01 FUSRAP Considered Sites Site: SPENCER CHEMICAL CO. (MO.0-01) Eliminated from further consideration under FUSRAP - an AEC licensed operation Designated Name: Not Designated Alternate Name: Jayhawk Works MO.0-01-1 Location: Joplin , Missouri MO.0-01-1 Evaluation Year: 1985 MO.0-01-2 Site Operations: Processed enriched uranium (UF-6) and scrap to produce primarily uranium dioxide (UO-2) under AEC licenses. MO.0-01-3 MO.0-01-4 Site Disposition: Eliminated - No Authority MO.0-01-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Normal and Enriched Uranium, Thorium MO.0-01-6 Radiological Survey(s): Yes MO.0-01-5 Site Status: Eliminated from further consideration under FUSRAP - an AEC licensed operation Also see Documents Related to SPENCER CHEMICAL CO.

89

OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown

2013-10-01T23:59:59.000Z

90

In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma

2013-06-01T23:59:59.000Z

91

NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk

92

Category:International Falls, MN | Open Energy Information  

Open Energy Info (EERE)

MN MN Jump to: navigation, search Go Back to PV Economics By Location Media in category "International Falls, MN" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant International Falls MN Northern States Power Co (Minnesota) Excel Energy.png SVFullServiceRestauran... 88 KB SVHospital International Falls MN Northern States Power Co (Minnesota) Excel Energy.png SVHospital Internation... 84 KB SVLargeHotel International Falls MN Northern States Power Co (Minnesota) Excel Energy.png SVLargeHotel Internati... 85 KB SVLargeOffice International Falls MN Northern States Power Co (Minnesota) Excel Energy.png SVLargeOffice Internat... 83 KB SVMediumOffice International Falls MN Northern States Power Co (Minnesota) Excel Energy.png

93

A new material, Li2Mn2(MoO4)3 for Li-ion batteries: Synthesis and ...  

Science Conference Proceedings (OSTI)

Abstract Scope, The demand for electrically operated devices has led to a variety of ... Co-Production of Pure Hydrogen and Electricity from Coal Syngas via the...

94

(Mo,Cr) in HASTELLOY C-22HS Alloy, a  

Science Conference Proceedings (OSTI)

debate (with question marks in the phase diagrams) such as ?CrMo4Ni5, ? ... diagram at 500, 620 and 700C show the existence of P phase and. OP6 phase[5

95

9 Cr-- 1 Mo steel material for high temperature application  

DOE Patents (OSTI)

One or more embodiments relates to a high-temperature, titanium alloyed, 9 Cr-1 Mo steel exhibiting improved creep strength and oxidation resistance at service temperatures up to 650.degree. C. The 9 Cr-1 Mo steel has a tempered martensite microstructure and is comprised of both large (0.5-3 .mu.m) primary titanium carbides and small (5-50 nm) secondary titanium carbides in a ratio of. from about 1:1.5 to about 1.5:1. The 9 Cr-1 Mo steel may be fabricated using exemplary austenizing, rapid cooling, and tempering steps without subsequent hot working requirements. The 9 Cr-1 Mo steel exhibits improvements in total mass gain, yield strength, and time-to-rupture over ASTM P91 and ASTM P92 at the temperature and time conditions examined.

Jablonski, Paul D; Alman, David; Dogan, Omer; Holcomb, Gordon; Cowen, Christopher

2012-11-27T23:59:59.000Z

96

Future design mindful of the MoRAS  

Science Conference Proceedings (OSTI)

As human-computer interaction (HCI) expands its scope, the proper context for the design of information technology (IT) is increasingly an interconnected mosaic of responsive adaptive systems (MoRAS) including people's heads, organizations, communities, ...

George W. Furnas

2000-09-01T23:59:59.000Z

97

Magnetoelastic Coupling in NiMnGa Ferromagnetic Shape ...  

Science Conference Proceedings (OSTI)

... Magnetoelastic Coupling in NiMnGa Ferromagnetic Shape Memory Alloys. Peng Zhao (Dept. of Materials Science and ...

98

Developments in realistic design for aperiodic Mo/Si multilayermirrors  

Science Conference Proceedings (OSTI)

Aperiodic multilayers have been designed for various applications, using numeric algorithms and analytical solutions, for many years with varying levels of success. This work developed a more realistic model for simulating aperiodic Mo/Si multilayers to be used in these algorithms by including the formation of MoSi{sub 2}. Using a genetic computer code we were able to optimize a 45{sup o} multilayer for a large bandpass reflection multilayer that gave good agreement with the model.

Aquila, A.L.; Salmassi, F.; Dollar, F.; Liu, Y.; Gullikson, E.M.

2006-04-05T23:59:59.000Z

99

First Principles Calculation for Magnetic Properties of Mn Alloys  

Science Conference Proceedings (OSTI)

The results indicate that the ? of MnAl and MnAlGe are extremely small because of ... Alloy Design and Powder Processing of Mn-Al Based Materials for Rare Earth ... Device Arrays Using Self-limiting Low-energy Glow-discharge Processing.

100

Electrochemical Performances of LiMnPO4 Synthesized from Non-Stoichiometric Li/Mn Ratio  

Science Conference Proceedings (OSTI)

In this paper we report the influences of the initial lithium content on the structural, electrochemical and magnetic properties of nonstoichiometric LixMnPO4 (0.5?x?1.2) nano-particles. It has been revealed Mn2P2O7 is the main impurity when Li1.0. The different functions of Mn2P2O7 and Li3PO4 impurities in the non-stoichiometric compounds have been investigated systematically. At a slow rate of C/50 the reversible capacity of both Li0.5MnPO4 and Li0.8MnPO4 increases with cycling indicating a gradual activation of more sites to accommodate a reversible diffusion of Li+ ions which may be related to the interaction between Mn2P2O7 and LiMnPO4 nanoparticles. Among all the different compositions, Li1.1MnPO4 exhibits the most stable cycling ability probably due to the existence of a trace amount of Li3PO4 impurity which functions as a solid state electrolyte on the surface. The magnetic properties and X-ray absorption spectroscopy (XAS) of MnPO4?H2O precursor, pure and carbon coated LiMnPO4 and all the other non-stoichiometric LixMnPO4 are also investigated to identify the key steps to prepare a high performance LiMnPO4.

Xiao, Jie; Chernova, Natalya; Upreti, Shailesh; Chen, Xilin; Li, Zheng; Deng, Zhiqun; Choi, Daiwon; Xu, Wu; Nie, Zimin; Graff, Gordon L.; Liu, Jun; Whittingham, M. S.; Zhang, Jiguang

2011-09-12T23:59:59.000Z

Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Synthesis, characterization and electrochemmistry of lithium battery electrodes : xLi{sub 2}MnO{sub 3}{center_dot}(1-x)LiMn{sub 0.333}Ni{sub 0.333}Co{sub 0.333}O{sub2} (0{le}x{le}0.7).  

Science Conference Proceedings (OSTI)

Lithium- and manganese-rich layered electrode materials, represented by the general formula xLi{sub 2}MnO{sub 3} {center_dot} (1-x)LiMO{sub 2} in which M is Mn, Ni, and Co, are of interest for both high-power and high-capacity lithium ion cells. In this paper, the synthesis, structural and electrochemical characterization of xLi{sub 2}MnO{sub 3} {center_dot} (1-x)LiMn{sub 0.333}Ni{sub 0.333}Co{sub 0.333}O{sub 2} electrodes over a wide compositional range (0 {le} x {le} 0.7) is explored. Changes that occur to the compositional, structural, and electrochemical properties of the electrodes as a function of x and the importance of using a relatively high manganese content and a high charging potential (>4.4 V) to generate high capacity (>200 mAh/g) electrodes are highlighted. Particular attention is given to the electrode composition 0.3Li{sub 2}MnO{sub 3} {center_dot} 0.7LiMn{sub 0.333}Ni{sub 0.333}Co{sub 0.333}O{sub 2} (x = 0.3) which, if completely delithiated during charge, yields Mn{sub 0.533}Ni{sub 0.233}Co{sub 0.233}O{sub 2}, in which the manganese ions are tetravalent and, when fully discharged, LiMn{sub 0.533}Ni{sub 0.233}Co{sub 0.233}O{sub 2}, in which the average manganese oxidation state (3.44) is marginally below that expected for a potentially damaging Jahn-Teller distortion (3.5). Acid treatment of 0.3Li{sub 2}MnO{sub 3} {center_dot} 0.7LiMn{sub 0.333}Ni{sub 0.333}Co{sub 0.333}O{sub 2} composite electrode structures with 0.1 M HNO{sub 3} chemically activates the Li{sub 2}MnO{sub 3} component and essentially eliminates the first cycle capacity loss but damages electrochemical behavior, consistent with earlier reports for Li{sub 2}MnO{sub 3}-stabilized electrodes. Differences between electrochemical and chemical activation of the Li{sub 2}MnO{sub 3} component are discussed. Electrochemical charge/discharge profiles and cyclic voltammogram data suggest that small spinel-like regions, generated in cycled manganese-rich electrodes, serve to stabilize the electrodes, particularly at low lithium loadings (high potentials). The study emphasizes that, for high values of x, a relatively small LiMO{sub 2} concentration stabilizes a layered Li{sub 2}MnO{sub 3} electrode to reversible lithium insertion and extraction when charged to a high potential.

Johnson, C. S.; Li, N.; Lefief, C.; Vaughey, J. T.; Thackeray, M. M.; Chemical Sciences and Engineering Division

2008-01-01T23:59:59.000Z

102

The comparison of sulfide CoMo/?-Al2O3 and NiMo/?-Al2O3 catalysts in methyl palmitate and methyl heptanoate hydrodeoxygenation  

Science Conference Proceedings (OSTI)

The hydrodeoxygenation of methyl palmitate and methyl heptanoate as the model compounds of bio-oil in the presence of sulfided CoMo/?-Al2O3 and NiMo/?-Al2O3 catalysts was studied at the temperature ... Keywords: CoMoS/?-Al2O3, NiMoS/?-Al2O3, biofuels, hydrodeoxygenation, methyl heptanoate, methyl palmitate

Irina V. Deliy; Evgenia N. Vlasova; Alexey L. Nuzhdin; Galina A. Bukhtiyarova

2011-12-01T23:59:59.000Z

103

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA

104

miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay

105

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....

106

MoWiTT:Mobile Window Thermal Test Facility  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 MoWiTT: Mobile Window Thermal Test Facility The window has come a long way since the days when it was a single pane of glass in a wood frame. Low-emissivity windows were designed to help buildings retain some of the energy that would have leaked out of less efficient windows. Designing efficient window-and-frame systems requires accurate measurement of the flow of energy through windows in realistic conditions, a capability provided by the Mobile Window Thermal Test facility. Consisting of a pair of outdoor, room-sized calorimeters, MoWiTT measures the net energy flow through two window samples in side-by-side tests using ambient weather conditions. MoWiTT characterizes the net energy flow as a function of time and measures the temperatures, solar fluxes, and

107

Co-Mo Electric Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Mo Electric Coop Inc Mo Electric Coop Inc Jump to: navigation, search Name Co-Mo Electric Coop Inc Place Missouri Utility Id 4063 Utility Location Yes Ownership C NERC Location SERC NERC MRO Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Multi-Phase Commercial Commercial Single-Phase Over 200 Amps Commercial Commercial Single-Phase Up To 200 Amps Commercial Industrial Industrial Outdoor Lighting HPS 100 W Lighting Outdoor Lighting HPS 150 W Lighting Outdoor Lighting HPS 400 W Lighting Residential Multi-Phase Residential Residential Single-Phase Over 200 Amps Residential

108

DOE - Office of Legacy Management -- Medart Co - MO 09  

Office of Legacy Management (LM)

Medart Co - MO 09 Medart Co - MO 09 FUSRAP Considered Sites Site: MEDART CO. (MO.09 ) Eliminated from consideration under FUSRAP - Facility believed to be torn down and the original site built over Designated Name: Not Designated Alternate Name: None Location: 180 Potomoc Street , St. Louis , Missouri MA.09-4 Evaluation Year: Circa 1990 MA.09-3 Site Operations: Conducted test machining operations on uranium bar stock during the early 1950s. MA.09-2 Site Disposition: Eliminated - Potential for contamination considered remote due limited duration of operations and to site reconstruction MA.09-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal (test quantities) MA.09-3 Radiological Survey(s): Health and safety monitoring during operations MA.09-3

109

Low-temperature magnetization of (Ga,Mn) As semiconductors  

E-Print Network (OSTI)

We report on a comprehensive study of the ferromagnetic moment per Mn atom in (Ga,Mn)As ferromagnetic semiconductors. Theoretical discussion is based on microscopic calculations and on an effective model of Mn local moments antiferromagnetically coupled to valence band hole spins. The validity of the effective model over the range of doping studied is assessed by comparing with microscopic tight-binding/coherent-potential approximation calculations. Using the virtual crystal k center dot p model for hole states, we evaluate the zero-temperature mean-field contributions to the magnetization from the hole kinetic and exchange energies, and magnetization suppression due to quantum fluctuations of Mn moment orientations around their mean-field ground state values. Experimental low-temperature ferromagnetic moments per Mn are obtained by superconducting quantum interference device and x-ray magnetic circular dichroism measurements in a series of (Ga,Mn)As semiconductors with nominal Mn doping ranging from similar to 2 to 8%. Hall measurements in as-grown and annealed samples are used to estimate the number of uncompensated substitutional Mn moments. Based on our comparison between experiment and theory we conclude that all these Mn moments in high quality (Ga,Mn)As materials have nearly parallel ground state alignment.

Jungwirth, T.; Masek, J.; Wang, KY; Edmonds, KW; Sawicki, M.; Polini, M.; Sinova, Jairo; MacDonald, AH; Campion, RP; Zhao, LX; Farley, NRS; Johal, TK; van der Laan, G.; Foxon, CT; Gallagher, BL.

2006-01-01T23:59:59.000Z

110

U-Mo Plate Blister Anneal Interim Report  

SciTech Connect

Blister thresholds in fuel elements have been a longstanding performance parameter for fuel elements of all types. This behavior has yet to be fully defined for the RERTR U-Mo fuel types. Blister anneal studies that began in 2007 have been expanded to include plates from more recent RERTR experiments. Preliminary data presented in this report encompasses the early generations of the U-Mo fuel systems and the most recent but still developing fuel system. Included is an overview of relevant dispersion fuel systems for the purposes of comparison.

Francine J. Rice; Daniel M. Wachs; Adam B. Robinson; Dennis D. Keiser Jr.; Jan-Fong Jue; Danielle M. Perez; Ross Finlay

2010-10-01T23:59:59.000Z

111

Microstructural Characterization of Fe-Mn-C Ternary Alloy under ...  

Science Conference Proceedings (OSTI)

Mercury Oxidation and Capture over SCR Catalysts in Simulated Coal Combustion Flue Gas Microstructural Characterization of Fe-Mn-C Ternary Alloy under...

112

Electrochemical Performance of LiFeMnPO4  

Science Conference Proceedings (OSTI)

Symposium, Energy Storage: Materials, Systems, and Applications. Presentation Title, Electrochemical Performance of LiFeMnPO4: A Comparison of Synthesis...

113

Microstructure and Coercivity of Nitrided Mn-Sn Based Alloy  

Science Conference Proceedings (OSTI)

Alloy Design and Powder Processing of Mn-Al Based Materials for Rare Earth ... Enhancement of the Refrigerant Capacity in Partially Crystallized Gd-Fe-Al-B...

114

,"Warroad, MN Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Warroad, MN Natural Gas Pipeline Exports to Canada (Million Cubic Feet)",1,"Annual",2003 ,"Release Date:","172014"...

115

,"Warroad, MN Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Warroad, MN Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

116

,"International Falls, MN Natural Gas Pipeline Imports From Canada...  

U.S. Energy Information Administration (EIA) Indexed Site

International Falls, MN Natural Gas Pipeline Imports From Canada (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of...

117

,"Noyes, MN Natural Gas Pipeline Imports From Canada (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Noyes, MN Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

118

Characterization of Mn-Co Electrodeposition for SOFC Interconnect ...  

Science Conference Proceedings (OSTI)

Presentation Title, Characterization of Mn-Co Electrodeposition for SOFC Interconnect Applications by QCM. Author(s), Junwei Wu, Ayyakkannu Manivannan,...

119

Electrodeposited Mn-Co Alloy Coating For SOFC Interconnects  

Science Conference Proceedings (OSTI)

Presentation Title, Electrodeposited Mn-Co Alloy Coating For SOFC Interconnects. Author(s), Heather McCrabb, Tim Hall, Junwei Wu, Hui Zhang, Xingbo Liu,...

120

¿Cómo funcionan los Híbridos?  

NLE Websites -- All DOE Office Websites (Extended Search)

¿Cómo funcionan los Híbridos? ¿Cómo funcionan los Híbridos? Diagrama de los componentes de un híbrido completo, incluyen (1) un motor de combustión interna (2) un motor eléctrico, (3) un generador, (4) una aparato de cambio de motor, and (5) una batería de gran capacidad. en inglés Flash Animation: ¿Cómo funcionan los Híbridos? (Requiere versión Flash 6.0 o superior) HTML Version: ¿Cómo funcionan los Híbridos? Los vehículos Híbridos-eléctricos (VHEs) combinan las ventajas de los motores de gasolina con los motores eléctricos y se pueden configurar para diferentes objetivos, como mejorar el ahorro de combustible, aumentar su fuerza, o proveer fuerza adicional para el uso del sistema eléctrico o los componentes electrónicos. Algunas de las tecnologías avanzadas que usan los híbridos típicamente

Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

ProMoVer: modular verification of temporal safety properties  

Science Conference Proceedings (OSTI)

This paper describes ProMoVer, a tool for fully automated procedure-modular verification of Java programs equipped with method-local and global assertions that specify safety properties of sequences of method invocations. Modularity at the procedure-level ...

Siavash Soleimanifard; Dilian Gurov; Marieke Huisman

2011-11-01T23:59:59.000Z

122

Domestic production of medical isotope Mo-99 moves a step closer  

NLE Websites -- All DOE Office Websites (Extended Search)

Domestic production of medical isotope Mo-99 Domestic production of medical isotope Mo-99 moves a step closer Irradiated uranium fuel has been recycled and reused for molybdenum-99...

123

Large-Scale Synthesis of MoS2/ Polymer Derived Ceramic ...  

Science Conference Proceedings (OSTI)

Applications of MoS2 as lithium ion battery anode material are also being explored. Here, we demonstrate exfoliation of MoS2 into single and few layers.

124

Elevated Temperature Compression Testing of the U-10 wt% Mo Alloy  

Science Conference Proceedings (OSTI)

Abstract Scope, In order to satisfy non-proliferation treaties the metallic U-10 wt% Mo (U-10Mo) alloy in low enrichments is under development to replace highly...

125

Ni(II) Sorption on Biogenic Mn-Oxides with Varying Mn  

E-Print Network (OSTI)

Lightsource (SSRL), Menlo Park, CA. EXAFS spectra from Ni(II) organic standards were collected in transmission-3 at SSRL. This method is described in detail in Zhu et al. (6). Results Sorption Isotherms and Dissolved Mn,anationaluserfacilityoperatedbyStanfordUniversity on behalf of the U.S. Department of Energy, Office of Basic Energy Sciences. The SSRL Structural Molecular

Sparks, Donald L.

126

miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li

2009-01-01T23:59:59.000Z

127

MN471018, Work Planning and Control Manual  

NLE Websites -- All DOE Office Websites (Extended Search)

18, Work Planning and Control Manual 18, Work Planning and Control Manual Sponsor: Michael W. Hazen, 4000 Issue Date: January 3, 2007 Revision Date: June 1, 2009 This document is no longer a CPR. This document implements the requirements of Corporate procedure ESH100.1.WPC.1, Plan and Control Work. IMPORTANT NOTICE: A printed copy of this document may not be the document currently in effect. The official version is the online version located on the Sandia Restricted Network (SRN) MN471018 - WORK PLANNING AND CONTROL MANUAL Subject Matter Expert: Brad Elkin; CA Counterpart: Aden Jackson MN471018 Revision Date: June 1, 2009; Replaces Document: October 28, 2008 Implementation Notice: The requirements outlined in this document must be incorporated into approved comprehensive organizational procedures on or before June 30, 2009. New work planned and conducted after June 30, 2009 shall be performed in accordance with this document. Ongoing work, conducted under an existing, current, and approved PHS and TWD (if required), is authorized until the expiration of the applicable PHS, TWD, or June 30, 2010.

128

High-Resolution Structure of the Photosynthetic Mn4Ca Catalyst from X-ray Spectroscopy  

E-Print Network (OSTI)

the Photosynthetic Mn 4 Ca Catalyst from X-ray Spectroscopystructure of the Mn 4 Ca catalyst at high-resolution whichthe structure of Mn 4 Ca catalyst as it cycles through the

Yano, Junko

2008-01-01T23:59:59.000Z

129

On the Reaction Mechanism of Acetaldehyde Decomposition on Mo(110)  

Science Conference Proceedings (OSTI)

The strong Mo-O bond strength provides promising reactivity of Mo-based catalysts for the deoxygenation of biomass-derived oxygenates. Combining the novel dimer saddle point searching method with periodic spin-polarized density functional theory calculations, we investigated the reaction pathways of a acetaldehyde decomposition on the clean Mo(110) surface. Two reaction pathways were identified, a selective deoxygenation and a nonselective fragmentation pathways. We found that acetaldehyde preferentially adsorbs at the pseudo 3-fold hollow site in the ?2(C,O) configuration on Mo(110). Among four possible bond (?-C-H, ?-C-H, C-O and C-C) cleavages, the initial decomposition of the adsorbed acetaldehyde produces either ethylidene via the C-O bond scission or acetyl via the ?-C-H bond scission while the C-C and the ?-C-H bond cleavages of acetaldehyde leading to the formation of methyl (and formyl) and formylmethyl are unlikely. Further dehydrogenations of ethylidene into either ethylidyne or vinyl are competing and very facile with low activation barriers of 0.24 and 0.31 eV, respectively. Concurrently, the formed acetyl would deoxygenate into ethylidyne via the C-O cleavage rather than breaking the C-C or the C-H bonds. The selective deoxygenation of acetaldehyde forming ethylene is inhibited by relatively weaker hydrogenation capability of the Mo(110) surface. Instead, the nonselective pathway via vinyl and vinylidene dehydrogenations to ethynyl as the final hydrocarbon fragment is kinetically favorable. On the other hand, the strong interaction between ethylene and the Mo(110) surface also leads to ethylene decomposition instead of desorption into the gas phase. This work was financially supported by the National Advanced Biofuels Consortium (NABC). Computing time was granted by a user project (emsl42292) at the Molecular Science Computing Facility in the William R. Wiley Environmental Molecular Sciences Laboratory (EMSL). This work was financially supported by the National Advanced Biofuels Consortium (NABC). Computing time was granted by a user project (emsl42292) at the Molecular Science Computing Facility in the William R. Wiley Environmental Molecular Sciences Laboratory (EMSL). The EMSL is a U.S. Department of Energy (DOE) national scientific user facility located at Pacific Northwest National Laboratory (PNNL) and supported by the DOE Office of Biological and Environmental Research. Pacific Northwest National Laboratory is operated by Battelle for the U.S. Department of Energy.

Mei, Donghai; Karim, Ayman M.; Wang, Yong

2012-02-16T23:59:59.000Z

130

Graphitization in C and C-Mo Steels  

Science Conference Proceedings (OSTI)

Following the recent carbon (C) and carbon-molybdenum (C-Mo) steel graphitization experience reported by several Electric Power Research Institute (EPRI) members, it became apparent that the industry could benefit from better predictive guidance to prioritize component inspections and examinations for graphitization. This research effort collected and analyzed the additional experience gained since the last EPRI project on the subject and focused on developing suitably conservative time-temperature predi...

2010-12-23T23:59:59.000Z

131

Electronic structure and magnetism in BaMn2As2 and BaMn2Sb2  

Science Conference Proceedings (OSTI)

We study the properties of ThCr{sub 2}Si{sub 2} structure BaMn{sub 2}As{sub 2} and BaMn{sub 2}Sb{sub 2} using density functional calculations of the electronic and magnetic properties as well as experimental measurements on single crystal samples of BaMn{sub 2}As{sub 2}. These materials are local moment magnets with moderate band gap antiferromagnetic semiconducting ground states. The electronic structures show substantial Mn-pnictogen hybridization, which stabilizes an intermediate spin configuration for the nominally d{sup 5} Mn. The results are discussed in the context of possible thermoelectric applications and the relationship with the corresponding iron/cobalt/nickel compounds Ba(Fe,Co,Ni){sub 2}As{sub 2}.

An, Jiming [ORNL; Safa-Sefat, Athena [ORNL; Singh, David J [ORNL; Du, Mao-Hua [ORNL

2009-01-01T23:59:59.000Z

132

50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links  

E-Print Network (OSTI)

2) and the concentration of 65Cu2+ estimated by the speciation model WHAM (1.0 (28)), we could]e^ equals zero and that [65 Cu2+ ] was constant (i.e., nominal [65 Cu2+ ] ) 5.2-µg L-1). That is, WHAM the speciation model WHAM (28) assuming that the lake water has a pH near 8 (30), a dissolved organic carbon

Allen, Gale

133

Single Phase Melt Processed Powellite (Ba,Ca) MoO{sub 4} For The Immobilization Of Mo-Rich Nuclear Waste  

SciTech Connect

Crystalline and glass composite materials are currently being investigated for the immobilization of combined High Level Waste (HLW) streams resulting from potential commercial fuel reprocessing scenarios. Several of these potential waste streams contain elevated levels of transition metal elements such as molybdenum (Mo). Molybdenum has limited solubility in typical silicate glasses used for nuclear waste immobilization. Under certain chemical and controlled cooling conditions, a powellite (Ba,Ca)MoO{sub 4} crystalline structure can be formed by reaction with alkaline earth elements. In this study, single phase BaMoO{sub 4} and CaMoO{sub 4} were formed from carbonate and oxide precursors demonstrating the viability of Mo incorporation into glass, crystalline or glass composite materials by a melt and crystallization process. X-ray diffraction, photoluminescence, and Raman spectroscopy indicated a long range ordered crystalline structure. In-situ electron irradiation studies indicated that both CaMoO{sub 4} and BaMoO{sub 4} powellite phases exhibit radiation stability up to 1000 years at anticipated doses with a crystalline to amorphous transition observed after 1 X 10{sup 13} Gy. Aqueous durability determined from product consistency tests (PCT) showed low normalized release rates for Ba, Ca, and Mo (<0.05 g/m{sup 2}).

Brinkman, Kyle [Savannah River Site (SRS), Aiken, SC (United States); Marra, James [Savannah River Site (SRS), Aiken, SC (United States); Fox, Kevin [Savannah River Site (SRS), Aiken, SC (United States); Reppert, Jason [Savannah River Site (SRS), Aiken, SC (United States); Crum, Jarrod [Paci fic Northwest National Laboratory , Richland, WA (United States); Tang, Ming [Los Alamos National Laboratory , Los Alamos, NM (United States)

2012-09-17T23:59:59.000Z

134

Study of intergranular embrittlement in Fe-12Mn alloys  

Science Conference Proceedings (OSTI)

A high resolution scanning Auger microscopic study has been performed on the intergranular fracture surfaces of Fe-12Mn steels in the as-austenitized condition. Fracture mode below the ductile-brittle transition temperature was intergranular whenever the alloy was quenched from the austenite field. The intergranular fracture surface failed to reveal any consistent segregation of P, S, As, O, or N. The occasional appearance of S or O on the fracture surface was found to be due to a low density precipitation of MnS and MnO/sub 2/ along the prior austenite boundaries. An AES study with Ar/sup +/ ion-sputtering showed no evidence of manganese enrichment along the prior austenite boundaries, but a slight segregation of carbon which does not appear to be implicated in the tendency toward intergranular fracture. Addition of 0.002% B with a 1000/sup 0/C/1h/WQ treatment yielded a high Charpy impact energy at liquid nitrogen temperature, preventing the intergranular fracture. High resolution AES studies showed that 3 at. % B on the prior austenite grain boundaries is most effective in increasing the grain boundary cohesive strength in an Fe-12Mn alloy. Trace additions of Mg, Zr, or V had negligible effects on the intergranular embrittlement. A 450/sup 0/C temper of the boron-modified alloys was found to cause tempered martensite embrittlement, leading to intergranular fracture. The embrittling treatment of the Fe-12Mn alloys with and without boron additions raised the ductile-brittle transition by 150/sup 0/C. This tempered martensite embrittlement was found to be due to the Mn enrichment of the fracture surface to 32 at. % Mn in the boron-modified alloy and 38 at. % Mn in the unmodified alloy. The Mn-enriched region along the prior austenite grain boundaries upon further tempering is believed to cause nucleation of austenite and to change the chemistry of the intergranular fracture surfaces. 61 figures.

Lee, H.J.

1982-06-01T23:59:59.000Z

135

Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)

2010-01-01T23:59:59.000Z

136

Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)

2012-07-01T23:59:59.000Z

137

DEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE  

E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.

138

Fracture and fatigue properties of Mo-Mo{sub 3}Si-Mo{sub 5}SiB{sub 2} refractory intermetallic alloys at ambient to elevated temperatures (25-1300 degrees Centigrade)  

Science Conference Proceedings (OSTI)

The need for structural materials with high-temperature strength and oxidation resistance coupled with adequate lower-temperature toughness for potential use at temperatures above {approx} 1000 degrees C has remained a persistent challenge in materials science. In this work, one promising class of intermetallic alloys is examined, namely boron-containing molybdenum silicides, with compositions in the range Mo (bal), 12-17 at. percentSi, 8.5 at. percentB, processed using both ingot (I/M) and powder (P/M) metallurgy methods. Specifically, the oxidation (''pesting''), fracture toughness and fatigue-crack propagation resistance of four such alloys, which consisted of {approx}21 to 38 vol. percent a-Mo phase in an intermetallic matrix of Mo3Si and Mo5SiB2 (T2), were characterized at temperatures between 25 degrees and 1300 degrees C. The boron additions were found to confer superior ''pest'' resistance (at 400 degrees to 900 degrees C) as compared to unmodified molybdenum silicides, such as Mo5Si3. Moreover , although the fracture and fatigue properties of the finer-scale P/M alloys were only marginally better than those of MoSi2, for the I/M processed microstructures with coarse distributions of the a-Mo phase, fracture toughness properties were far superior, rising from values above 7 MPa sqrt m at ambient temperatures to almost 12 MPa sqrt m at 1300 degrees C.

Choe, Heeman; Schneibel, J.H.; Ritchie, R.O.

2002-08-01T23:59:59.000Z

139

The Role of Manganese Dioxide (MnO2) Deposition in Microbiologically Influenced Corrosion  

Science Conference Proceedings (OSTI)

This report documents the role of manganese dioxide (MnO2) in microbiologically influenced corrosion.

2004-12-20T23:59:59.000Z

140

U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2012 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT...

Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

C:\\ANNUAL\\VENTCHAP.V8\\NGA.VP  

Gasoline and Diesel Fuel Update (EIA)

4 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99...

142

C:\\ANNUAL\\VENTCHAP.V8\\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

0 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy...

143

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA  

Gasoline and Diesel Fuel Update (EIA)

176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY...

144

NGA98fin5.vp  

Annual Energy Outlook 2012 (EIA)

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99...

145

U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)

3 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE...

146

Effects of Mn Doping on the Dielectric Properties of Nnanostructured ...  

Science Conference Proceedings (OSTI)

In order to further improve the insulation resistance, manganese (Mn) was introduced (0.005 at%-1.0 at%) into the TiO2 system by a powder coating process...

147

International Falls, MN Natural Gas Pipeline Imports From Canada...  

U.S. Energy Information Administration (EIA) Indexed Site

per Thousand Cubic Feet) International Falls, MN Natural Gas Pipeline Imports From Canada (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5...

148

International Falls, MN Natural Gas Pipeline Imports From Canada...  

U.S. Energy Information Administration (EIA) Indexed Site

Million Cubic Feet) International Falls, MN Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8...

149

DOE - Office of Legacy Management -- Twin Cities Ammunition - MN 0-01  

NLE Websites -- All DOE Office Websites (Extended Search)

Twin Cities Ammunition - MN 0-01 Twin Cities Ammunition - MN 0-01 FUSRAP Considered Sites Site: TWIN CITIES AMMUNITION (MN.0-01) Eliminated from further consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: None Location: New Brighton , Minnesota MN.0-01-1 Evaluation Year: 1987 MN.0-01-2 Site Operations: Site was formerly licensed under 10CFR 70 by the NRC. MN.0-01-1 MN.0-01-2 Site Disposition: Eliminated - No Authority - Referred to DOD MN.0-01-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DOD MN.0-01-2 Also see Documents Related to TWIN CITIES AMMUNITION MN.0-01-1 - DOE Letter; Mott to Spence; Listings of Military

150

Diluted magnetic semiconductor effects in Mn-implanted silicon carbide  

Science Conference Proceedings (OSTI)

Light transmission and Faraday rotation spectra measured at the temperature of 2 K were compared for silicon carbide single crystals of 4H polytype (4H-SiC), implanted with 3.8 x 10{sup 16} cm{sup -2} of Mn ions at the beam energy of 190 keV, and a control 4H-SiC single crystal sample, which was not implanted. Mn ion implantation led to the creation of a Mn-doped surface layer with the average Mn concentration of 10{sup 21} cm{sup -3} and a thickness of approximately 0.2 {mu}m. Transmission of light through the implanted crystal changed only slightly in comparison with the control sample, which however, corresponded to a relatively strong attenuation in the implanted layer. This was interpreted as a result of scattering, which emerges in the surface layer due to optical nonuniformities, created by the high energy ion irradiation. The presence of a thin Mn-ion-containing surface layer led, despite its small thickness, to noticeable changes in the sample Faraday rotation spectra. The estimated values of the Verdet constant for this layer were about three orders of magnitude larger and of opposite sign compared to the Verdet constant values of the undoped sample. Magnetic field dependencies of the Faraday rotation contribution from the implanted layer were found to be saturating functions, which points to a proportionality of the Faraday rotation to the magnetization of the paramagnetic Mn ion subsystem. Based on these findings we conclude that the Mn-implanted SiC layer exhibits magneto-optical properties typical of a diluted magnetic semiconductor. At the same time, no ferromagnetic ordering was observed in the studied (Si, Mn)C sample.

Komarov, A. V.; Ryabchenko, S. M. [Institute of Physics of the National Academy of Sciences of Ukraine, 46 Nauki Ave., Kiev 03028 (Ukraine); Los, A. V. [ISS Ltd., Semiconductors and Circuits Lab, 15 Bozhenko Street, Kiev 03680 (Ukraine); Freescale Semiconductor Ukraine LLC., 15 Bozhenko Street, Kiev 03680 (Ukraine); Romanenko, S. M. [ISS Ltd., Semiconductors and Circuits Lab, 15 Bozhenko Street, Kiev 03680 (Ukraine)

2011-04-15T23:59:59.000Z

151

Statistical pairing fluctuation and phase transition in $^{94}Mo$  

E-Print Network (OSTI)

In the framework of BCS model, we have applied the isothermal probability distribution to take into account the statistical fluctuations in calculation of thermodynamical properties of nuclei. The energy and the heat capacity are calculated in $^{94}Mo$ nucleus using the mean gap parameter. The results are compared with the values obtained based on the most probable values, experimental data as well as some other theoretical models. We have shown that heat capacity versus temperature behaves smoothly instead of singular behaviour predicted by the standard BCS model. Also a smooth peak in heat capacity is observed which is a signature of transition from normal to super fluid phase.

Z. Kargar; V. Dehghani

2013-07-16T23:59:59.000Z

152

Statistical pairing fluctuation and phase transition in $^{94}Mo$  

E-Print Network (OSTI)

In the framework of BCS model, we have applied the isothermal probability distribution to take into account the statistical fluctuations in calculation of thermodynamical properties of nuclei. The energy and the heat capacity are calculated in $^{94}Mo$ nucleus using the mean gap parameter. The results are compared with the values obtained based on the most probable values, experimental data as well as some other theoretical models. We have shown that heat capacity versus temperature behaves smoothly instead of singular behaviour predicted by the standard BCS model. Also a smooth peak in heat capacity is observed which is a signature of transition from normal to super fluid phase.

Kargar, Z

2013-01-01T23:59:59.000Z

153

Greenfield Alternative Study LEU-Mo Fuel Fabrication Facility  

Science Conference Proceedings (OSTI)

This report provides the initial first look of the design of the Greenfield Alternative of the Fuel Fabrication Capability (FFC); a facility to be built at a Greenfield DOE National Laboratory site. The FFC is designed to fabricate LEU-Mo monolithic fuel for the 5 US High Performance Research Reactors (HPRRs). This report provides a pre-conceptual design of the site, facility, process and equipment systems of the FFC; along with a preliminary hazards evaluation, risk assessment as well as the ROM cost and schedule estimate.

Washington Division of URS

2008-07-01T23:59:59.000Z

154

Upper critical field of Mo-Ni heterostructures  

SciTech Connect

Upper critical field and its anisotropy have been measured on two very short wavelength Mo-Ni heterostructures of different degrees of perfection, lambda = 13.8A (disordered structure) and lambda = 16.6A (layered structure). In both cases the parallel critical field has an unexpected temperature dependence, a large and temperature dependent anisotropy, and over 60% enhancement over the Clogston-Chandrasekhar limit. Data are fit to the Werthamer-Helfand-Hohenberg theory and the spin-orbit scattering times are found to be 1.79 x 10 T s and 2 x 10 T s, respectively.

Uher, C.; Watson, W.J.; Cohn, J.L.; Schuller, I.K.

1985-12-01T23:59:59.000Z

155

Studying the Effect of Carbon on DU-Mo Foil Fabrication for the ...  

Science Conference Proceedings (OSTI)

In support of this program, efforts are ongoing to develop and validate a monolithic depleted uranium molybdenum (DU-Mo) foil fabrication process adaptable for...

156

Surface Structures of Cubo-octahedral Pt-Mo Catalyst Nanoparticles from Monte Carlo Simulations  

E-Print Network (OSTI)

of Cubo-octahedral Pt-Mo Catalyst Nanoparticles from Montefuel cells, new electrode catalysts that have less preciousto designing Pt bimetallic catalysts is knowledge of the

Wang, Guofeng; Van Hove, M.A.; Ross, P.N.; Baskes, M.I.

2005-01-01T23:59:59.000Z

157

Pressure Water Leaching Molybdenum and Nickel from Mo-Ni ore of ...  

Science Conference Proceedings (OSTI)

Presentation Title, Pressure Water Leaching Molybdenum and Nickel from Mo-Ni ore of Black Shale without Reagent. Author(s), Zhigan Deng. On-Site Speaker...

158

Disorder effects in half-metallic Sr 2 FeMoO 6 single crystals  

Science Conference Proceedings (OSTI)

Double perovskites such as Sr 2 FeMoO 6 (SFMO) have been predicted to be half-metallic (100% spin polarized). However

Raghava P. Panguluri; Sheng Xu; Yutaka Moritomo; I. V. Solovyev; B. Nadgorny

2009-01-01T23:59:59.000Z

159

Synthesis of molybdenum disulfide (MoS{sub 2}) for lithium ion battery applications  

Science Conference Proceedings (OSTI)

This paper reports the use of a rheological phase reaction method for preparing MoS{sub 2} nanoflakes. The characterization by powder X-ray diffraction indicated that MoS{sub 2} had been formed. High resolution electron microscopy observation revealed that the as-prepared MoS{sub 2} nanoflakes had started to curve and partly form MoS{sub 2} nanotubes. The lithium intercalation/de-intercalation behavior of as-prepared MoS{sub 2} nanoflake electrode was also investigated. It was found that the MoS{sub 2} nanoflake electrode exhibited higher specific capacity, with very high cycling stability, compared to MoS{sub 2} nanoparticle electrode. The possible reasons for the high electrochemical performance of the nanoflakes electrodes are also discussed. The outstanding electrochemical properties of MoS{sub 2} nanoflakes obtained by this method make it possible for MoS{sub 2} to be used as a promising anode material.

Feng Chuanqi [Key Laboratory for Synthesis and Applications of Organic Functional Molecules, Hubei University, Wuhan 430062 (China); Institute for Superconducting and Electronic Materials, University of Wollongong, NSW 2522 (Australia); Ma Jun; Li Hua [Key Laboratory for Synthesis and Applications of Organic Functional Molecules, Hubei University, Wuhan 430062 (China); Zeng Rong [Institute for Superconducting and Electronic Materials, University of Wollongong, NSW 2522 (Australia); Guo Zaiping, E-mail: zguo@uow.edu.au [School of Mechanical, Materials and Mechatronic Engineering, University of Wollongong, NSW 2522 (Australia); Institute for Superconducting and Electronic Materials, University of Wollongong, NSW 2522 (Australia); ARC Centre of Excellence for Electromaterials Science, University of Wollongong, NSW 2522 (Australia); Liu Huakun [Institute for Superconducting and Electronic Materials, University of Wollongong, NSW 2522 (Australia); ARC Centre of Excellence for Electromaterials Science, University of Wollongong, NSW 2522 (Australia)

2009-09-15T23:59:59.000Z

160

Utilization of Recycled MoO3 and Mill Scale for Synthesis of High ...  

Science Conference Proceedings (OSTI)

... by ammonia gas neutralization method and reduced by hydrogen to produce a high ... Molybdenum and Nickel from Mo-Ni ore of Black Shale without Reagent.

Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

New limit on the neutrinoless double beta decay of /sup 100/Mo  

SciTech Connect

A search for the neutrinoless double beta decay of /sup 100/Mo was conducted using thin Mo films and solid state Si detectors. The experiment has collected 3500 hours of data operating underground in a deep silver mine (3290 M.W.E.). Only one event was found to be consistent with neutrinoless double beta decay. Using this one event, a limit of greater than or equal to 1 x 10/sup 22/ years (1 sigma) is set on the /sup 100/Mo half-life. This is approximately five times larger than the best previous /sup 100/Mo limit.

Krivicich, J.M.

1988-03-01T23:59:59.000Z

162

Experimental activities supporting commercial U.S. accelerator production of 99-Mo  

Science Conference Proceedings (OSTI)

{sup 99m}Tc, the daughter product of {sup 99}Mo, is the most commonly used radioisotope for nuclear medicine in the U.S. Experiments are being performed at Los Alamos National Laboratory and Argonne National Laboratory to demonstrate production of {sup 99}Mo using accelerators. The {sup 100}Mo({gamma},n){sup 99}Mo reaction in an enriched {sup 100}Mo target is currently under investigation. Three scaled low-power production experiments using a 20-MeV electron linac at Argonne have been performed to date. Two of these experiments used natural Mo targets and produced a total of 613 {mu}C of {sup 99}Mo. The third experiment used an enriched {sup 100}Mo target and produced 10.5 mCi of {sup 99}Mo. Following irradiation the targets were dissolved and the low specific activity solution was processed through an ARSII generator from NorthStar Medical Radioisotopes. Yields of {sup 99m}Tc >95% have been observed.

Dale, Gregory E [Los Alamos National Laboratory; Chemerisov, Sergey D [ANL; Vandegrift, George F [ANL

2010-01-01T23:59:59.000Z

163

mo funcionan las Células de Combustible  

NLE Websites -- All DOE Office Websites (Extended Search)

mo funcionan las Células de Combustible Cómo funcionan las Células de Combustible Diagrama: Como funciona un MPE de combustible de célula. 1. El combustible de hidrógeno es canalizado a través de un campo de placas de flujo para el ánodo al otro lado de la pila de combustible, mientras que el oxígeno del aire se canaliza hacia el cátodo del otro lado de la celda. 2. En el ánodo, un catalizador de platino hace que el hidrógeno se divida en iones positivos de hidrógeno (protones) y electrones de carga negativa. 3. La Membrana de Electrolito Polimérico (MPE) sólo permite que los iones de carga positiva pasen a través de ella hacia el cátodo. Los electrones de carga negativa deben viajar a lo largo de un circuito externo hacia el cátodo, creando una corriente eléctrica. 4. En el cátodo, los electrones y los iones positivos de hidrógeno se combinan con el oxígeno para formar agua, que fluye fuera de la célula.

164

Characterization of U-Mo Foils for AFIP-7  

SciTech Connect

Twelve AFIP in-process foil samples, fabricated by either Y-12 or LANL, were shipped from LANL to PNNL for potential characterization using optical and scanning electron microscopy techniques. Of these twelve, nine different conditions were examined to one degree or another using both techniques. For this report a complete description of the results are provided for one archive foil from each source of material, and one unirradiated piece of a foil of each source that was irradiated in the Advanced Test Reactor. Additional data from two other LANL conditions are summarized in very brief form in an appendix. The characterization revealed that all four characterized conditions contained a cold worked microstructure to different degrees. The Y-12 foils exhibited a higher degree of cold working compared to the LANL foils, as evidenced by the highly elongated and obscure U-Mo grain structure present in each foil. The longitudinal orientations for both of the Y-12 foils possesses a highly laminar appearance with such a distorted grain structure that it was very difficult to even offer a range of grain sizes. The U-Mo grain structure of the LANL foils, by comparison, consisted of a more easily discernible grain structure with a mix of equiaxed and elongated grains. Both materials have an inhomogenous grain structure in that all of the characterized foils possess abnormally coarse grains.

Edwards, Danny J.; Ermi, Ruby M.; Schemer-Kohrn, Alan L.; Overman, Nicole R.; Henager, Charles H.; Burkes, Douglas; Senor, David J.

2012-11-07T23:59:59.000Z

165

Development of FeNiMoB thin film materials for microfabricated magnetoelastic sensors  

Science Conference Proceedings (OSTI)

Metglas{sup TM} 2826MB foils of 25-30 {mu}m thickness with the composition of Fe{sub 40}Ni{sub 38}Mo{sub 4}B{sub 18} have been used for magnetoelastic sensors in various applications over many years. This work is directed at the investigation of {approx}3 {mu}m thick iron-nickel-molybdenum-boron (FeNiMoB) thin films that are intended for integrated microsystems. The films are deposited on Si substrate by co-sputtering of iron-nickel (FeNi), molybdenum (Mo), and boron (B) targets. The results show that dopants of Mo and B can significantly change the microstructure and magnetic properties of FeNi materials. When FeNi is doped with only Mo its crystal structure changes from polycrystalline to amorphous with the increase of dopant concentration; the transition point is found at about 10 at. % of Mo content. A significant change in anisotropic magnetic properties of FeNi is also observed as the Mo dopant level increases. The coercivity of FeNi films doped with Mo decreases to a value less than one third of the value without dopant. Doping the FeNi with B together with Mo considerably decreases the value of coercivity and the out-of-plane magnetic anisotropy properties, and it also greatly changes the microstructure of the material. In addition, doping B to FeNiMo remarkably reduces the remanence of the material. The film material that is fabricated using an optimized process is magnetically as soft as amorphous Metglas{sup TM} 2826MB with a coercivity of less than 40 Am{sup -1}. The findings of this study provide us a better understanding of the effects of the compositions and microstructure of FeNiMoB thin film materials on their magnetic properties.

Liang Cai; Gooneratne, Chinthaka; Cha, Dongkyu; Chen Long; Kosel, Jurgen [Computer Electrical and Mathematical Sciences and Engineering, King Abdullah University of Science and Technology, 4700 KAUST, Thuwal 23955 (Saudi Arabia); Gianchandani, Yogesh [Department of Electrical Engineering and Computer Science, 1301 Beal Ave., University of Michigan, Ann Arbor, Michigan 48109 (United States)

2012-12-01T23:59:59.000Z

166

File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload

167

MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.

2011-05-01T23:59:59.000Z

168

Electrodeposition and characterization of nanocrystalline Ni-Mo catalysts for hydrogen production  

Science Conference Proceedings (OSTI)

Ni-Mo nanocrystalline deposits (7-43 nm) with a nodular morphology were prepared by electrodeposition using direct current from citrate-ammonia solutions. They exhibited a single Ni-Mo solid solution phase. The size of the nodules increased as electroplating ...

J. Halim; R. Abdel-Karim; S. El-Raghy; M. Nabil; A. Waheed

2012-01-01T23:59:59.000Z

169

Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab

2007-03-01T23:59:59.000Z

170

Domestic production of medical isotope Mo-99 moves a step closer  

NLE Websites -- All DOE Office Websites (Extended Search)

Domestic production of medical isotope Mo-99 Domestic production of medical isotope Mo-99 Domestic production of medical isotope Mo-99 moves a step closer Irradiated uranium fuel has been recycled and reused for molybdenum-99 (Mo-99) production, with virtually no losses in Mo-99 yields or uranium recovery. May 13, 2013 From left, Los Alamos scientists Roy Copping, Sean Reilly, and Daniel Rios. Copping examines the Buchi Multivapor P-12 Evaporator, and Reilly and Rios are at the Agilent Technologies Cary 60 UV-Vis Spectrometer. From left, Los Alamos scientists Sean Reilly, Roy Copping, and Daniel Rios. Sean is looking at the Buchi Multivapor P-12 Evaporator, and Roy and Daniel are at the Agilent Technologies Cary 60 UV-Vis Spectrometer. Contact Nancy Ambrosiano Communications Office (505) 667-0471

171

Exfoliated MoS2 Nanocomposite as an Anode Material for Lithium Ion Batteries  

DOE Green Energy (OSTI)

Nanocomposites of molybdenum disulfide (MoS2) and poly(ethylene oxide) (PEO) were prepared by the exfoliation/absorption method that involved the hydrolysis of lithiated MoS2 in an aqueous solution of PEO. The absorption and subsequent interaction of PEO on the colloidal MoS2 formed a nanocomposite which restacked into layered secondary particles. X-ray diffraction and high resolution TEM indicated that highly disordered nanocomposites were produced when the Lix(PEO)yMoS2 stoichiometry was limited to y < 1. An improvement of greater than 5x in capacity accompanied by high cycle stability and efficiency was observed for the disordered nanocomposites providing a novel approach to utilize low-cost MoS2 and similar materials for a high capacity energy storage system.

Xiao, Jie; Choi, Daiwon; Cosimbescu, Lelia; Koech, Phillip K.; Liu, Jun; Lemmon, John P.

2010-05-04T23:59:59.000Z

172

Development of LEU targets for {sup 99}Mo production and their chemical processing status 1993  

SciTech Connect

Most of the world`s supply of {sup 99m}{Tc} for medical purposes is currently produced from {sup 99}Mo derived from the fastening of high enriched uranium (HEU). Substitution of low enriched uranium (LEU) silicide fuel for the HEU alloy and aluminide fuels used in current target designs will allow equivalent {sup 99}Mo yields with little change in target geometries. Substitution of uranium metal for uranium oxide films in other target designs will also allow the substitution of LEU for HEU. In 1993, DOE renewed funding that was terminated in 1990 for development of LEU targets for {sup 99}Mo production. During the past year, our efforts were to (1) renew contact with {sup 99}Mo producers, (2) define the means to test our process for recovering {sup 99}Mo from irradiated LEU-silicide targets, and (3) begin to test our process on spent LEU-silicide miniplates stored at ANL from past fuel development studies.

Vandegrift, G.F.; Hutter, J.C.; Srinivasan, B.; Matos, J.E.; Snelgrove, J.L.

1993-10-01T23:59:59.000Z

173

Studies on a novel secondary battery: MH/MnO{sub 2} rechargeable battery. 2: Characteristics of the MnO{sub 2} cathode  

SciTech Connect

The characteristics of the MnO{sub 2} cathode of a MH/MnO{sub 2} battery have been studied by cyclic voltammetry, x-ray diffraction, and potentiostatic techniques. It was found that the addition of Ni(OH){sub 2} to the MnO{sub 2} can prevent overcharge of the MnO{sub 2} and decrease the imbalance of the charge/discharge states of the positive and negative electrodes, raise the working voltage of the MH/MnO{sub 2} cell, and prevent the formation of Mn{sub 3}O{sub 4}, thereby improving the rechargeability of the MnO{sub 2} electrode. The discharge mechanism is also discussed.

Xia, X.; Guo, Z. [Xinjiang Univ., Urumqi, Xinjiang (China). Dept. of Chemistry

1997-08-01T23:59:59.000Z

174

Molecular beam epitaxy growth of exchange-biased PtMn/NiFe bilayers with a spontaneously ordered PtMn layer  

Science Conference Proceedings (OSTI)

We report the direct epitaxial growth of equiatomic ordered antiferromagnetic PtMn layers by molecular beam epitaxy. Such layers are used in giant magnetoresistance spin valve sensors as the antiferromagnetic pinning layer. Structural characterization and phase identification confirmed the spontaneous formation of the chemically ordered face-centered-tetragonal (L1{sub 0}) phase of PtMn with about 87.4% ordering. Based on the antiferromagnetic PtMn layer, we prepared exchange-biased PtMn/NiFe bilayers with various PtMn thicknesses. The exchange anisotropy field of the bilayer with NiFe grown on PtMn stabilizes at about 50 Oe beyond a PtMn thickness of 15 nm. Although the exchange anisotropy field is small compared to that of the polycrystalline system, the antiferromagnetic domain structure is stable over repetitive external magnetic field cycling and no training effect is observed.

Choi, Y. S.; Petford-Long, A. K.; Ward, R. C. C.; Fan, R.; Goff, J. P.; Hase, T. P. A. [Department of Materials, University of Oxford, Parks Road, Oxford OX1 3PH (United Kingdom); Clarendon Laboratory, University of Oxford, Parks Road, Oxford OX1 3PU (United Kingdom); Department of Physics, University of Liverpool, Liverpool L69 7ZE (United Kingdom); Department of Physics, University of Durham, Durham DH1 3LE (United Kingdom)

2006-04-15T23:59:59.000Z

175

Structural evolution in crystalline MoO{sub 3} nanoparticles with tunable size  

SciTech Connect

In this study MoO{sub 3} nanoparticles were prepared in porous Vycor glass by impregnation-decomposition cycles (IDC) with molybdenum(VI) 2-ethylhexanoate. X-ray diffraction data show that the nanoparticles are crystalline and are in the orthorhombic {alpha}-MoO{sub 3} phase. Raman spectroscopy data also indicate the formation of this phase. The profiles in the Raman spectra changed with the number of IDC, indicating a structural evolution of the MoO{sub 3} nanoparticles. The IDC methodology promoted a linear mass increase and allowed tuning the nanoparticle size. Analysis of HRTEM images revealed that for 3, 5 and 7 IDC, the MoO{sub 3} nanoparticle average diameters are 3.2, 3.6 and 4.2 nm. Diffuse reflectance spectroscopy indicates a consistent red shift in the band gap from 3.35 to 3.29 eV as the size increases from 3.2 to 4.2 nm. This observed red shift in the band gap of the MoO{sub 3} nanoparticles is presumably due to quantum confinement effects. - Graphical abstract: Modification of profile Raman spectra for crystalline MoO{sub 3} nanoparticles in function of the particle size. Highlights: Black-Right-Pointing-Pointer Structural evolution of the MoO{sub 3} nanoparticles as a function of the crystallite size. Black-Right-Pointing-Pointer Tunable optical properties by controlling the MoO{sub 3} nanoparticle size. Black-Right-Pointing-Pointer The impregnation-decomposition methodology allowed tuning the nanoparticle size. Black-Right-Pointing-Pointer The red shift in the band gap of the MoO{sub 3} nanoparticles is due to quantum size effect. Black-Right-Pointing-Pointer The short-distance order in MoO{sub 3} nanoparticle is function to area/volume ratio.

Barros Santos, Elias de; Aparecido Sigoli, Fernando [Functional Materials Laboratory, Institute of Chemistry, University of Campinas, UNICAMP, PO Box 6154, Zip Code 13083-970 Campinas, SP (Brazil); Odone Mazali, Italo, E-mail: mazali@iqm.unicamp.br [Functional Materials Laboratory, Institute of Chemistry, University of Campinas, UNICAMP, PO Box 6154, Zip Code 13083-970 Campinas, SP (Brazil)

2012-06-15T23:59:59.000Z

176

Mo-99/Tc-99m Separation: An Assessment of Technical Options  

Science Conference Proceedings (OSTI)

Several strategies for the effective separation of 99mTc from 99Mo have been developed and validated. Due to the success of column chromatographic separation using acidic alumina coupled with high specific activity fission 99Mo (F 99Mo) for production of 99Mo/99mTc generators, however, most technologies until recently have generated little interest. The reduced availability of F 99Mo and consequently the shortage of 99Mo/99mTc column generators in the recent past have resurrected interest in the production of 99Mo as well as 99mTc by alternate routes. Most of these alternative production processes require separation techniques capable of providing clinical grade 99mTc from low specific activity 99Mo or irradiated Mo targets. For this reason there has been renewed interest in alternate separation routes. This paper reviews the reported separation technologies which include column chromatography, solvent extraction, sublimation and gel systems that have been traditionally used for the fabrication of 99Mo/99mTc generator systems. The comparative advantage, disadvantage, and technical challenges toward adapting the emerging requirements are discussed. New developments such as solid-phase column extraction, electrochemical separation, extraction chromatography, supported liquid membrane (SLM) and thermochromatographic techniques are also being evaluated for their potential application in the changed scenario of providing 99mTc from alternate routes. Based on the analysis provided in this review, it appears that some proven separation technologies can be quickly resurrected for the separation of clinical grade 99mTc from macroscopic levels of reactor or cyclotron irradiated molybdenum targets. Furthermore, emerging technologies can be developed further to respond to the expected changing modes of 99mTc production.

Dash, A [Bhabha Atomic Research Centre, Mumbai, India; Pillai, M R A [Bhabha Atomic Research Centre, Mumbai, India; Knapp Jr, Russ F [ORNL

2013-01-01T23:59:59.000Z

177

Mo-containing tetrahedral amorphous carbon deposited by dual filtered cathodic vacuum arc with selective pulsed bias voltage  

E-Print Network (OSTI)

only. Fig.2 (a) Electrical resistivity of ta-C:Mo films as aC plasma pulses; (b) Electrical resistivity of the ta-C:MoIt found that the electrical resistivity decreases with an

Pasaja, Nitisak; Sansongsiri, Sakon; Anders, Andre; Vilaithong, Thiraphat; Intasiri, Sawate

2006-01-01T23:59:59.000Z

178

MN471004, Electrical Safety Manual Sponsor: Michael W. Hazen, 4000  

NLE Websites -- All DOE Office Websites (Extended Search)

MN471004, Electrical Safety Manual MN471004, Electrical Safety Manual Sponsor: Michael W. Hazen, 4000 Revision Date: June 9, 2011 Replaces Document Dated: September 4, 2007 This document is no longer a CPR. This document implements the requirements of Corporate Procedure ESH100.2.ELC.1, Manage Electrical Hazards. IMPORTANT NOTICE: A printed copy of this document may not be the document currently in effect. The official version is the online version located on the Sandia Restricted Network (SRN). Subject Matter Experts: Marc Williams and David Paoletta MN471004, Issue S Revision Date: June 9, 2011; Replaces Document Dated: April 29, 2008 Review Date: August 29, 2007 Administrative Changes: February 5, 2008, June 28, 2010, July 28, 2010, May 26, 2011, June 9, 2011, November 28, 2011, February 1, 2012

179

The oxidation of Ba dosed Mo(100) surfaces with O/sub 2/ at moderately high temperatures  

DOE Green Energy (OSTI)

The oxidation of Mo(100) and Ba-covered Mo(100) by O/sub 2/ have been examined at moderately high temperature (700 to 1400/sup 0/K) using x-ray photoelectron spectroscopy. Results indicate that the Ba or BaO overlayer retards but does not prevent oxidation of the underlying Mo surface. The high temperature surface chemistry of the O/Ba/Mo surface is described. 11 refs., 3 figs.

Rogers, J.W. Jr.; Blair, D.S.; Paffett, M.T.

1987-01-01T23:59:59.000Z

180

Rechargeable Zn-MnO sub 2 alkaline batteries  

SciTech Connect

In this paper progress in the development of rechargeable alkaline zinc-manganese dioxide cells is described. The advantages and limitations of the system are evaluated. Laboratory tests run on commercial primary alkaline cells as well as model simulations of a bipolar MnO{sub 2} electrode show that the rechargeable alkaline battery may be able to compete with lead-acid, nickel-cadmium, and secondary lithium cells for low- to moderate-rate applications. However, because of this poor performance at high rates and low temperatures, the alkaline MnO{sub 2} battery is not suitable for present automotive starting applications.

Wruck, W.J.; Reichman, B.; Bullock, K.R.; Kao, W.H. (Corporate Applied Research, Johnson Controls, Inc., Milwaukee, WI (US))

1991-12-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Magnetic properties of a metal-organic antiferromagnet Mn,,hfipbb...py,,H2O...0.5  

E-Print Network (OSTI)

crystallographically independent Mn atoms Mn1 and Mn2 exist in this structure, and an alternate connection ­MnMnMn are discovered. Here we report the synthesis, structure, and magnetic properties of a metal-organic coordination 0.195, 0.5 mmol , py 2 ml , and H2O 5 ml was sealed in a Teflon-lined acid digestion bomb and heated

Li, Jing

182

Disentangling the Mn moments on different sublattices in the half-metallic ferrimagnet Mn3?xCoxGa  

SciTech Connect

Ferrimagnetic Mn{sub 3-x}Co{sub x}Ga compounds have been investigated by magnetic circular dichroism in x-ray absorption (XMCD). Compounds with x > 0.5 crystallize in the CuHg{sub 2}Ti structure. A tetragonal distortion of the cubic structure occurs for x {le} 0.5. For the cubic phase, magnetometry reveals a linearly increasing magnetization of 2x Bohr magnetons per formula unit obeying the generalized Slater-Pauling rule. XMCD confirms the ferrimagnetic character with Mn atoms occupying two different sublattices with antiparallel spin orientation and different degrees of spin localization and identifies the region 0.6 < x {le} 0.8 as most promising for a high spin polarization at the Fermi level. Individual Mn moments on inequivalent sites are compared to theoretical predictions.

Klaer, P.; Jenkins, C.A.; Alijani, V.; Winterlik, J.; Balke, B.; Felser, C.; Elmers, H.J.

2011-05-03T23:59:59.000Z

183

Thermal Instability of Olivine-type LiMnPO4 Cathodes  

NLE Websites -- All DOE Office Websites (Extended Search)

Thermal Instability of Olivine-type LiMnPO4 Cathodes Title Thermal Instability of Olivine-type LiMnPO4 Cathodes Publication Type Journal Article Year of Publication 2010 Authors...

184

Electrodeposited Al-Mn Alloys with Microcrystalline, Nanocrystalline, Amorphous and Nano-quasicrystalline Structures  

E-Print Network (OSTI)

AlMn alloys with Mn content ranging from 0 to 15.8 at.% are prepared by electrodeposition from an ionic liquid at room temperature, and exhibit a remarkably broad range of structures. The alloys are characterized through ...

Ruan, Shiyun

185

Assessment of the Diffusive Gradients in Thin-films (DGT) technique to assess the plant availability of Mn in soils.  

E-Print Network (OSTI)

predicts copper availability to plants. EnvironmentalAttempts to assess Mn availability have been impeded due towill influence the Mn availability. Often flooding of soils

Mundus, Simon; Husted, Sren; Lombi, Enzo

2009-01-01T23:59:59.000Z

186

Control of magnetic properties of MnBi and MnBiCu thin films by Kr{sup +} ion irradiation  

SciTech Connect

Mn{sub 52}Bi{sub 48} (15 nm) and Mn{sub 54}Bi{sub 24}Cu{sub 21} (15 nm) thin films were prepared by the magnetron sputtering and vacuum annealing at 350 deg. C, and the variations of their structures and magnetic properties with 30 keV Kr{sup +} ion irradiation were studied. The MnBi and MnBiCu films exhibited saturation magnetizations M{sub s} of 180 emu/cc and 210 emu/cc, the coercivities H{sub c} of 10 kOe and 3.4 kOe, respectively. The M{sub s} and H{sub c} of the MnBi abruptly vanished by the irradiation of ion dose at 3 x 10{sup 14} ions/cm{sup 2}, while those of the MnBiCu film gradually decreased with increasing the ion dose and became zero at 5 x 10{sup 13} ions/cm{sup 2}. The different trend on the ion irradiation between MnBi and MnBiCu films is understood by the surface structure of the film, i.e., the MnBi has convex islands on its surface, which protect the underneath NiAs-type MnBi from the irradiation, while the MnBiCu has rather flat surface, and its crystal structure was uniformly modified by the irradiation. From the surface flatness and the uniformity of the MnBiCu film, as well as the low annealing temperature of 350 deg. C, it was concluded that the MnBiCu film is one of the attractive materials for high-density ion irradiation bit patterned media.

Xu Qianqian; Kanbara, Ryutarou; Kato, Takeshi; Iwata, Satoshi [Department of Quantum Engineering, Nagoya University Furo-cho, Chikusa-ku, Nagoya, 464-8603 (Japan); Tsunashima, Shigeru [Department of Research, Nagoya Industrial Science Research Institute, 1-13 Yotsuya-dori, Chikusa-ku, Nagoya 460-0819 (Japan)

2012-04-01T23:59:59.000Z

187

Electrochemically Induced High Capacity Displacement Reaction of PEO/MoS2/Graphene Nanocomposites with Lithium  

SciTech Connect

MoS2/PEO/graphene composite is successfully prepared and the discharge mechanism of MoS2 as an anode material for Li-ion batteries has been investigated systematically in this work. The simultaneous formation of Li2S and Mo at deep discharge depth has been shown for the first time. The deposition of Mo metal with Li residing on the defects after the first discharge increases the intrinsic electronic conductivity of the electrode leading to a superior cycling stability for over 185 cycles. After the first discharge the amorphous Mo matrix allows a large amount of Li+ ions to repeatedly deposit and being oxidized during cycling while the transition between Li2S and S contribute to the capacity above 2.0 V. The interactions between as-formed Mo and S prevents the dissolution of the intermediate polysulfide thus providing clues to immobilize the soluble species in a Li-S battery. Excellent rate performances are achieved in this MoS2/PEO/graphene composite indicating a fast diffusion path of Li+ ions existing not only in the bulk material but also in the interface between the electrode and the electrolyte.

Xiao, Jie; Wang, Xaojian; Yang, Xiao-Qing; Xun, Shidi; Liu, Gao; Koech, Phillip K.; Liu, Jun; Lemmon, John P.

2011-08-09T23:59:59.000Z

188

Surface Structures of Cubo-octahedral Pt-Mo Catalyst Nanoparticles from Monte Carlo Simulations  

DOE Green Energy (OSTI)

The surface structures of cubo-octahedral Pt-Mo nanoparticles have been investigated using the Monte Carlo method and modified embedded atom method potentials that we developed for Pt-Mo alloys. The cubo-octahedral Pt-Mo nanoparticles are constructed with disordered fcc configurations, with sizes from 2.5 to 5.0 nm, and with Pt concentrations from 60 to 90 at. percent. The equilibrium Pt-Mo nanoparticle configurations were generated through Monte Carlo simulations allowing both atomic displacements and element exchanges at 600 K. We predict that the Pt atoms weakly segregate to the surfaces of such nanoparticles. The Pt concentrations in the surface are calculated to be 5 to 14 at. percent higher than the Pt concentrations of the nanoparticles. Moreover, the Pt atoms preferentially segregate to the facet sites of the surface, while the Pt and Mo atoms tend to alternate along the edges and vertices of these nanoparticles. We found that decreasing the size or increasing the Pt concentration leads to higher Pt concentrations but fewer Pt-Mo pairs in the Pt-Mo nanoparticle surfaces.

Wang, Guofeng; Van Hove, M.A.; Ross, P.N.; Baskes, M.I.

2005-03-31T23:59:59.000Z

189

Systematics of magnetic dipole strength in the stable even-mass Mo isotopes  

SciTech Connect

The nuclides {sup 92}Mo, {sup 98}Mo, and {sup 100}Mo have been studied in photon-scattering experiments by using bremsstrahlung produced at an electron energy of 6 MeV at the ELBE accelerator of the Forschungszentrum Rossendorf and at electron energies from 3.2 to 3.8 MeV at the Dynamitron accelerator at the University of Stuttgart. Six dipole transitions in {sup 98}Mo and 19 in {sup 100}Mo were observed for the first time in the energy range from 2 to 4 MeV. The experimental results are compared with predictions of the shell model and with predictions of the quasiparticle random-phase approximation (QRPA) in a deformed basis. The latter show significant contributions of isovector-orbital and isovector-spin vibrations. The change of the magnetic dipole strength in the isotopic chain of the even-mass isotopes from {sup 92}Mo to {sup 100}Mo is discussed. The calculations within the QRPA are extrapolated to the particle-separation energies to estimate the possible influence of M1 strength on the stability of the nuclides against photodissociation in cosmic scenarios.

Rusev, G. [Institut fuer Kern- und Hadronenphysik, Forschungszentrum Rossendorf, D-01314 Dresden (Germany); Institute for Nuclear Research and Nuclear Energy, BAS, BG-1784 Sofia (Bulgaria); Schwengner, R.; Doenau, F.; Erhard, M.; Grosse, E.; Junghans, A.R.; Kaeubler, L.; Kosev, K.; Mallion, S.; Schilling, K.D.; Wagner, A. [Institut fuer Kern- und Hadronenphysik, Forschungszentrum Rossendorf, D-01314 Dresden (Germany); Frauendorf, S. [Institut fuer Kern- und Hadronenphysik, Forschungszentrum Rossendorf, D-01314 Dresden (Germany); Department of Physics, University of Notre Dame, Notre Dame, Indiana 46556 (United States); Kostov, L.K. [Institute for Nuclear Research and Nuclear Energy, BAS, BG-1784 Sofia (Bulgaria); Garrel, H. von; Kneissl, U.; Kohstall, C.; Kreutz, M.; Pitz, H.H.; Scheck, M.; Stedile, F. [Institut fuer Strahlenphysik, Universitaet Stuttgart, D-70569 Stuttgart (Germany)] (and others)

2006-04-15T23:59:59.000Z

190

Thermoelectric figure of merit of LSCoO-Mn perovskites  

Science Conference Proceedings (OSTI)

Oxide ceramics with nominal composition of La"0"."8Sr"0"."2Co"1"-"xMn"xO"3(0= Keywords: 72.20.Pa, 84.60.Bk, 84.60.Rb, 85.80.Fi, LSCoO compounds, Thermoelectric figure of merit, Thermoelectric materials

J. E. Rodrguez; D. Cadavid; L. C. Moreno

2008-11-01T23:59:59.000Z

191

Reactor physics calculations for {sup 99}Mo production at the Annular Core Research Reactor  

SciTech Connect

The isotope {sup 99}Mo would be produced at Sandia using ACRR and the collocated Hot Cell Facility. {sup 99}Mo would be produced by irradiating targets coated with {sup 235}U in the form of highly enriched U{sub 3}O{sub 8}; after 7 days, the target would be removed and the isotope extracted using the Cintichem process. The Monte Carlo neutronics computer code MCNP was used to determine the optimum configuration for production, using various fractions of the US demand. Although ACRR operates at a low power level, the US demand for {sup 99}Mo can be easily met using a reasonable number of targets.

Parma, E.J.

1995-07-01T23:59:59.000Z

192

Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A

2008-01-01T23:59:59.000Z

193

Distribution of water extractable heavy metals (Cd, Co, Mn and Mo) in the topsoil of Osijek-Baranja County (Eastern Croatia)  

E-Print Network (OSTI)

Agronomy no. 9, Madison, Wisconsin, USA: p 199-224 Nelson,Agronomy no. 9, Madison, Wisconsin, USA: p 539- APPENDIX 1.

Ivezic, Vladimir; Alms, sgeir R.; Loncaric, Zdenko; Singh, Bal Ram

2009-01-01T23:59:59.000Z

194

Clarification of enhanced ferromagnetism in Be-codoped InMnP fabricated using Mn/InP:Be bilayers grown by molecular beam epitaxy  

Science Conference Proceedings (OSTI)

The p-type InMnP:Be epilayers were prepared by the sequential growth of Mn/InP:Be bilayers using molecular-beam-epitaxy and the subsequent in-situ annealing at 200-300 deg. C. In triple-axis x-ray diffraction patterns, the samples revealed a shoulder peak indicative of intrinsic InMnP. The ferromagnetic transition in InMnP:Be was observed to occur at the elevated temperature of {approx}140 K, and the ferromagnetic spin-domains clearly appeared in magnetic force microscopy images. The improved ferromagnetic properties are attributed to the increased p-d hybridation due to high p-type conductivity of InMnP:Be (p {approx} 10{sup 20 }cm{sup -3}). The results suggest that enhanced ferromagnetism can be effectively obtained from Be-codoped InMnP.

Shon, Yoon; Lee, Sejoon; Taek Yoon, Im; Jeon, H. C.; Lee, D. J.; Kang, T. W. [Quantum-functional Semiconductor Research Center, Dongguk University-Seoul, Seoul 100-715 (Korea, Republic of); Song, J. D. [Center for Spintronics Research, Korea Institute of Science and Technology, Seoul 136-791 (Korea, Republic of); Yoon, Chong S. [Department of Materials Science and Engineering, Hanyang University, Seoul 133-791 (Korea, Republic of); Kim, D. Y. [Department of Semiconductor Science, Dongguk University-Seoul, Seoul 100-715 (Korea, Republic of); Park, C. S. [School of Electrical Engineering, Korea University, Anam-dong, Seongbuk-gu, Seoul 136-713 (Korea, Republic of)

2011-11-07T23:59:59.000Z

195

The Mn effect on magnetic structure of FeMn-B amorphous metals , D.M.C. Nicholson2  

E-Print Network (OSTI)

usually less than 1mm in thickness, because fast cooling rate is (~ 106 °K/sec) required for retaining] for a historical summary on the discovery of bulk amorphous metals.) They have been proposed for a range in transformers and electrical motors. Lately, high Mn content, Fe-based bulk amorphous metals have been

Widom, Michael

196

SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012" Coal Consumers in the Manufacturing and Coke Sectors, 2012" "Company Name","Plant Location" "Top Ten Manufacturers" "American Crystal Sugar Co","MN, ND" "Archer Daniels Midland","IA, IL, MN, ND, NE" "Carmeuse Lime Stone Inc","AL, IL, IN, KY, MI, OH, PA, TN, VA, WI" "Cemex Inc","AL, CA, CO, FL, GA, KY, OH, TN, TX" "Dakota Gasification Company","ND" "Eastman Chemical Company","TN" "Georgia-Pacific LLC","AL, GA, OK, VA, WI" "Holcim (US) Inc","AL, CO, MD, MO, MT, OK, SC, TX, UT" "NewPage Corporation","MD, MI, WI" "U S Steel Corporation","AL, IN, MI, MN"

197

U.S. Energy Information Administration | Annual Coal Report 2012  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012 Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Table 25. Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Company Name Plant Location Top Ten Manufacturers American Crystal Sugar Co MN, ND Archer Daniels Midland IA, IL, MN, ND, NE Carmeuse Lime Stone Inc AL, IL, IN, KY, MI, OH, PA, TN, VA, WI Cemex Inc AL, CA, CO, FL, GA, KY, OH, TN, TX Dakota Gasification Company ND Eastman Chemical Company TN Georgia-Pacific LLC AL, GA, OK, VA, WI Holcim (US) Inc AL, CO, MD, MO, MT, OK, SC, TX, UT NewPage Corporation MD, MI, WI U S Steel Corporation AL, IN, MI, MN Other Major Manufacturers Ash Grove Cement Co

198

Forming 6061 Al HIP-Clad DU10Mo Monolithic Fuel Plates  

Science Conference Proceedings (OSTI)

Small scale trials with multi-layer 6061 Al HIP-clad DU10Mo (depleted uranium), co-rolled with Zr, have been performed. Important results include springback...

199

NTT DoCoMo's competition strategy (before and) after the introduction of the flat rate  

E-Print Network (OSTI)

NTT DoCoMo, which was spun off from NTT in 1992, grew rapidly by increasing the number of subscribers and successfully implementing a new data communication, i-mode. However, when a competitor introduced a flat rate for ...

Yajima, Masaaki

2008-01-01T23:59:59.000Z

200

Solution-reactor-produced Mo-99 using activated carbon to remore I-131  

SciTech Connect

The production of {sup 99}Mo in a solution reactor was explored. Activated charcoal was used to filter the {sup 131}I contaminant from an irradiated fuel solution. Gamma spectroscopy confirmed that the activated carbon trapped a significant amount of {sup 131}I, as well as notable amounts of {sup 133}Xe, {sup 105}Rb, and {sup 140}Ba; the carbon trapped a diminutive amount of {sup 99}Mo. The results promote the idea of solution-reactor-produced {sup 99}Mo. Solution reactors are favorable both energetically and environmentally. A solution reactor could provide enough {sup 99}Mo/{sup 99m}Te to support both the current and future radiopharmaceutical needs of the U.S.

Kitten, S.; Cappiello, C.

1998-06-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

The Thermodynamics of Titanium Formation in 95CrMo Steel  

Science Conference Proceedings (OSTI)

... on the fatigue life of 95CrMo steel which was applied in producing drilling rod. ... Analysis of Residence Time Distribution (RTD) of Fluid Flows in a Four Strand ...

202

Production of Mixed Alcohols from Bio-syngas over Mo-based Catalyst  

Science Conference Proceedings (OSTI)

A series of Mo-based catalysts prepared by sol-gel method using citric acid as complexant were successfully applied in the high efficient production of mixed alcohols from bio-syngas

Song-bai Qiu; Wei-wei Huang; Yong Xu; Lu Liu; Quan-xin Li

2011-01-01T23:59:59.000Z

203

Electrochemical properties of sputter-deposited MoO{sub 3} films in lithium microbatteries  

Science Conference Proceedings (OSTI)

Molybdenum oxide (MoO{sub 3}) films were prepared by magnetron sputtering using an Mo target. The films were sputtered in the reactive atmosphere of an argon-oxygen gas mixture under various substrate temperatures, T{sub s}, and oxygen partial pressures, p(O{sub 2}). The effects of the growth conditions on the microstructure were examined using reflection high-energy electron diffraction and x-ray photoelectron spectroscopy. The analyses indicate that stoichiometric and polycrystalline MoO{sub 3} films were obtained at T{sub s} = 445 Degree-Sign C and p(O{sub 2}) = 61%. The applicability of the sputtered MoO{sub 3} films for lithium microbattery application has been demonstrated. The discharge-charge profiles, the kinetics of lithium intercalation process in the film, and the cycling behavior have been investigated in detail to understand the effect of microstructure on the electrochemical performance.

Ramana, C. V.; Atuchin, V. V.; Groult, H.; Julien, C. M. [Department of Mechanical Engineering, University of Texas at El Paso, El Paso, Texas 79968 (United States); Institute of Semiconductor Physics, SB RAS, Novosibirsk, 630090 (Russian Federation); Physicochimie des Electrolytes, Colloiedes et Systemes Analytiques (PECSA), Universite Pierre et Marie Curie-Paris 6, UMR 7195, 4 place Jussieu, 75005 Paris (France)

2012-07-15T23:59:59.000Z

204

Plutonium Oxidation and Subsequent Reduction by Mn (IV) Minerals  

Science Conference Proceedings (OSTI)

Plutonium sorbed to rock tuff was preferentially associated with manganese oxides. On tuff and synthetic pyrolusite (Mn{sup IV}O{sub 2}), Pu(IV) or Pu(V) was initially oxidized, but over time Pu(IV) became the predominant oxidation state of sorbed Pu. Reduction of Pu(V/VI), even on non-oxidizing surfaces, is proposed to result from a lower Gibbs free energy of the hydrolyzed Pu(IV) surface species versus that of the Pu(V) or Pu(VI) surface species. This work suggests that despite initial oxidation of sorbed Pu by oxidizing surfaces to more soluble forms, the less mobile form of Pu, Pu(IV), will dominate Pu solid phase speciation during long term geologic storage. The safe design of a radioactive waste or spent nuclear fuel geologic repository requires a risk assessment of radionuclides that may potentially be released into the surrounding environment. Geochemical knowledge of the radionuclide and the surrounding environment is required for predicting subsurface fate and transport. Although difficult even in simple systems, this task grows increasingly complicated for constituents, like Pu, that exhibit complex environmental chemistries. The environmental behavior of Pu can be influenced by complexation, precipitation, adsorption, colloid formation, and oxidation/reduction (redox) reactions (1-3). To predict the environmental mobility of Pu, the most important of these factors is Pu oxidation state. This is because Pu(IV) is generally 2 to 3 orders of magnitude less mobile than Pu(V) in most environments (4). Further complicating matters, Pu commonly exists simultaneously in several oxidation states (5, 6). Choppin (7) reported Pu may exist as Pu(IV), Pu(V), or Pu(VI) oxic natural groundwaters. It is generally accepted that plutonium associated with suspended particulate matter is predominantly Pu(IV) (8-10), whereas Pu in the aqueous phase is predominantly Pu(V) (2, 11-13). The influence of the character of Mn-containing minerals expected to be found in subsurface repository environments on Pu oxidation state distributions has been the subject of much recent research. Kenney-Kennicutt and Morse (14), Duff et al. (15), and Morgenstern and Choppin (16) observed oxidation of Pu facilitated by Mn(IV)-bearing minerals. Conversely, Shaughnessy et al. (17) used X-ray Absorption near-edge spectroscopy (XANES) to show reduction of Pu(VI) by hausmannite (Mn{sup II}Mn{sub 2}{sup III}O{sub 4}) and manganite ({gamma}-Mn{sup III}OOH) and Kersting et al., (18) observed reduction of Pu(VI) by pyrolusite (Mn{sup IV}O{sub 2}). In this paper, we attempt to reconcile the apparently conflicting datasets by showing that Mn-bearing minerals can indeed oxidize Pu, however, if the oxidized species remains on the solid phase, the oxidation step competes with the formation of Pu(IV) that becomes the predominant solid phase Pu species with time. The experimental approach we took was to conduct longer term (approximately two years later) oxidation state analyses on the Pu sorbed to Yucca Mountain tuff (initial analysis reported by Duff et al., (15)) and measure the time-dependant changes in the oxidation state distribution of Pu in the presence of the Mn mineral pyrolusite.

KAPLAN, DANIEL

2005-09-13T23:59:59.000Z

205

U-EXTRACTION--IMPROVEMENTS IN ELIMINATION OF Mo BY USE OF FERRIC ION  

DOE Patents (OSTI)

An improved solvent extraction process is described whereby U may be extracted by a water immiscible organic solvent from an aqueous solution of uranyl nitrate. It has been found that Mo in the presence of phosphate ions appears to form a complex with the phosphate which extracts along with the U. This extraction of Mo may be suppressed by providing ferric ion in the solution prior to the extraction step. The ferric ion is preferably provided in the form of ferric nitrate.

Clark, H.M.; Duffey, D.

1958-06-10T23:59:59.000Z

206

Photoluminescent BaMoO{sub 4} nanopowders prepared by complex polymerization method (CPM)  

SciTech Connect

The BaMoO{sub 4} nanopowders were prepared by the Complex Polymerization Method (CPM). The structure properties of the BaMoO{sub 4} powders were characterized by FTIR transmittance spectra, X-ray diffraction (XRD), Raman spectra, photoluminescence spectra (PL) and high-resolution scanning electron microscopy (HR-SEM). The XRD, FTIR and Raman data showed that BaMoO{sub 4} at 300 deg. C was disordered. At 400 deg. C and higher temperature, BaMoO{sub 4} crystalline scheelite-type phases could be identified, without the presence of additional phases, according to the XRD, FTIR and Raman data. The calculated average crystallite sizes, calculated by XRD, around 40 nm, showed the tendency to increase with the temperature. The crystallite sizes, obtained by HR-SEM, were around of 40-50 nm. The sample that presented the highest intensity of the red emission band was the one heat treated at 400 deg. C for 2 h, and the sample that displayed the highest intensity of the green emission band was the one heat treated at 700 deg. C for 2 h. The CPM was shown to be a low cost route for the production of BaMoO{sub 4} nanopowders, with the advantages of lower temperature, smaller time and reduced cost. The optical properties observed for BaMoO{sub 4} nanopowders suggested that this material is a highly promising candidate for photoluminescent applications.

Azevedo Marques, Ana Paula de [Laboratorio de Analise Termica e Materiais, Departamento de Quimica, Universidade Federal do Rio Grande do Norte, 59072-970 Natal, RN (Brazil)]. E-mail: apamarques@liec.ufscar.br; Melo, Dulce M.A. de [Laboratorio de Analise Termica e Materiais, Departamento de Quimica, Universidade Federal do Rio Grande do Norte, 59072-970 Natal, RN (Brazil); Paskocimas, Carlos A. [Departamento de Engenharia Mecanica, Universidade Federal do Rio Grande do Norte, 59072-970 Natal, RN (Brazil); Pizani, Paulo S. [Laboratorio de Semicondutores, Departamento de Fisica, Universidade Federal de Sao Carlos, 13565-905 Sao Carlos, SP (Brazil); Joya, Miryam R. [Laboratorio de Semicondutores, Departamento de Fisica, Universidade Federal de Sao Carlos, 13565-905 Sao Carlos, SP (Brazil); Leite, Edson R. [Laboratorio Interdisciplinar de Eletroquimica e Ceramica, CMDMC, Departamento de Quimica, Universidade Federal de Sao Carlos 13565-905, Sao Carlos, SP (Brazil); Longo, Elson [CMDMC, LIEC, Instituto de Quimica, Universidade Estadual Paulista, 14801-907 Araraquara, SP (Brazil)

2006-03-15T23:59:59.000Z

207

Solution-reactor-produced-{sup 99}Mo using activated carbon to remove {sup 131}I  

SciTech Connect

This research explores the idea of producing {sup 99}Mo in a solution reactor. The Solution High Energy Burst Assembly (SHEBA), located at the Los Alamos Critical Assembly Facility, was used to facilitate this study. The goal of this study was to build on work previously completed and to investigate a possible mode of radioactive contaminant removal prior to a {sup 99}Mo extraction process. Prior experiments, performed using SHEBA and a single-step sorption process, showed a significant amount of {sup 131}I present along with the {sup 99}Mo on the alumina that was used to isolate the {sup 99}Mo. A high concentration of {sup 131}I and/or other contaminants present in a sample prohibits the Food and Drug Administration from approving an extraction of that nature for radiopharmaceutical use. However, if it were possible to remove the {sup 131}I and other contaminants prior to a {sup 99}Mo extraction, a simple column extraction process might be feasible. Activated charcoal was used to try to filter the {sup 131}I contaminant from an irradiated fuel solution. Gamma spectroscopy confirmed that the activated carbon trapped a significant amount of the {sup 131}I, as well as notable amounts of {sup 133}Xe, {sup 105}Rb, and {sup 140}Ba. Most importantly, the carbon traps a diminutive amount of {sup 99}Mo.

Kitten, S.; Cappiello, C. [Los Alamos National Lab., NM (United States)

1998-09-01T23:59:59.000Z

208

Substrate recovery of Mo-Si multilayer coated optics  

Science Conference Proceedings (OSTI)

Imaging optics in a soft x-ray projection lithography (SXPL) system must meet stringent requirements to achieve high throughput and diffraction limited performance. Errors in the surface figure must be kept to less than {approximately}1 nm and the rms surface roughness must be less than 0.1 nm. The ML coatings must provide high reflectivity (> 60%) at wavelengths in the vicinity of 13 nm. The reflectivity bandpasses of the optics must be aligned within 0.05 nm. Each coating must be uniform across the surface of the optic to within 0.5%. These specifications challenge the limits of the current capabilities in optics fabrication and ML deposition. Consequently a set of qualified SXPL imaging optics is expected to be expensive, costing in the range of 100--250 k$. If the lifetime of the imaging optics is short, the replacement cost could significantly impact the economic competitiveness of the technology. The most likely failure modes for the imaging optics are mechanisms that degrade the ML coatings, but which leave the substrates intact. A potentially low cost solution for salvaging the imaging optics could be to strip the damaged ML coating to recover the substrate and then deposit a new coating. In this paper the authors report on the use of reactive ion etching (RIE) to remove Mo-Si ML coatings from precision optical substrates. The goal of this work was to characterize the etching process both in the ML film and at the substrate, and to determine the effects of the etching on the surface figure and finish of the substrate.

Stearns, D.G.; Baker, S.L.

1993-06-01T23:59:59.000Z

209

Electrodeposited Mn-Co Alloy Coating For SOFC Interconnects  

NLE Websites -- All DOE Office Websites (Extended Search)

Electrodeposited Electrodeposited Mn-Co Alloy Coating For SOFC Interconnects H. McCrabb * , T. Hall * , J. Wu # , H. Zhang # , X. Liu # , E.J. Taylor * * Faraday Technology Inc., 315 Huls Dr., Clayton, OH 45315, USA # West Virginia University, Dept. of Mechanical and Aerospace Eng.ESB, Morgantown, WV, 26506, USA Overall Objective Overall Objective Principal Investigator: Heather McCrabb, Company Name: Faraday Technology, Inc., Address: 315 Huls Drive, Clayton, OH 45315, Phone: 937-836-7749, E-mail: heathermccrabb@faradaytechnology.com, Company website: faradaytechnology.com Previous Work at WVU Results Develop an inexpensive manufacturing process for depositing (Mn,Co) 3 O 4 spinel coatings onto SOFC interconnects. Introduction The decrease in the SOFC operating temperatures from 1000°C to between 650 and 850°C has enabled the use of chromia-forming ferritic stainless steels as interconnects

210

Charge transport properties of CdMnTe radiation detectors  

Science Conference Proceedings (OSTI)

Growth, fabrication and characterization of indium-doped cadmium manganese telluride (CdMnTe)radiation detectors have been described. Alpha-particle spectroscopy measurements and time resolved current transient measurements have yielded an average charge collection efficiency approaching 100 %. Spatially resolved charge collection efficiency maps have been produced for a range of detector bias voltages. Inhomogeneities in the charge transport of the CdMnTe crystals have been associated with chains of tellurium inclusions within the detector bulk. Further, it has been shown that the role of tellurium inclusions in degrading chargecollection is reduced with increasing values of bias voltage. The electron transit time was determined from time of flight measurements. From the dependence of drift velocity on applied electric field the electron mobility was found to be n = (718 55) cm2/Vs at room temperature.

Kim K.; Rafiel, R.; Boardman, M.; Reinhard, I.; Sarbutt, A.; Watt, G.; Watt, C.; Uxa, S.; Prokopovich, D.A.; Belas, E.; Bolotnikov, A.E.; James, R.B.

2012-04-11T23:59:59.000Z

211

G3: Tribological Properties of MoS2-Ti Coated Steel in Vacuum and ...  

Science Conference Proceedings (OSTI)

B7: Synthesis and Electrical Properties of K2NiF4-Type (Ca2-xLnx)MnO4 (Ln=Nd and Sm) B8: Monitoring Oxygen Diffusion in Gd-Doped Ceria by Null...

212

High-Resolution Mn EXAFS of the Oxygen-Evolving Complex inPhotosystem II: Structural Implications for the Mn4Ca Cluster  

DOE Green Energy (OSTI)

The biological generation of oxygen by the oxygen-evolving complex in photosystem II (PS II) is one of natures most important reactions. The recent X-ray crystal structures, while limited by resolutions of 3.2 to 3.5 A, have located the electron density associated with the Mn4Ca complex within the multi-protein PS II complex. Detailed structures critically depend on input from spectroscopic techniques such as EXAFS and EPR/ENDOR, as the XRD resolution does not allow for accurate determination of the position of Mn/Ca or the bridging and terminal ligand atoms. The number and distances of Mn-Mn/Ca/ligand interactions determined from EXAFS provide important constraints for the structure of the Mn cluster. Here we present data from a high-resolution EXAFS method using a novel multi-crystal monochromator that show three short Mn-Mn distances between 2.7 and 2.8 A and hence the presence of three di-mu-oxobridged units in the Mn4Ca cluster. This result imposes clear limitations on the proposed structures based on spectroscopic and diffraction data and provides input for refining such structures.

Yano, Junko; Pushkar, Yulia; Glatzel, Pieter; Lewis, Azul; Sauer,Kenneth; Messinger, Johannes; Bergmann, Uwe; Yachandra, Vittal

2005-09-06T23:59:59.000Z

213

MCNPX-CINDER'90 Simulation of Photonuclear Mo-99 Production Experiments  

SciTech Connect

The MCNPX and CINDER'90 codes were used to support design of experiments investigating Mo-99 production with a 20-MeV electron beam. Bremsstrahlung photons produced by the electron beam interacting with the target drive the desired Mo-100({gamma},n)Mo-99 reaction, as well as many undesired reactions important to accurate prediction of radiation hazards. MCNPX is a radiation transport code and CINDER'90 is a transmutation code. They are routinely used together for accelerator activation calculations. Low energy neutron fluxes and production rates for nonneutron and high energy neutron induced reactions computed using MCNPX are inputs to CINDER'90. CINDER'90 presently has only a neutron reaction cross section library up to 25 MeV and normally the other reaction rates come from MCNPX physics models. For this work MCNPX photon flux tallies modified by energy response functions prepared from evaluated photonuclear cross section data were used to tally the reaction rates for CINDER'90 input. The cross section evaluations do not provide isomer to ground state yield ratios so a spin based approximation was used. Post irradiation dose rates were calculated using MCNPX with CINDER'90 produced decay photon spectra. The sensitivity of radionuclide activities and dose rates to beam parameters including energy, position, and profile, as well as underlying isomer assumptions, was investigated. Three experimental production targets were irradiated, two natural Mo and one Mo-100 enriched. Natural Mo foils upstream of the targets were used to analyze beam position and profile by exposing Gafchromic film to the foils after each irradiation. Activation and dose rate calculations were rerun after the experiments using measured beam parameters for comparison with measured Mo-99 activities and dose rates.

Kelsey, Charles T. IV [Los Alamos National Laboratory; Chemerizov, Sergey D. [Argonne National Laboratory; Dale, Gregory E. [Los Alamos National Laboratory; Harvey, James T. [NorthStar Medical Radioisotopes; Tkac, Peter [Argonne National Laboratory; Vandegrift, George R III [Argonne National Laboratory

2011-01-01T23:59:59.000Z

214

Structural and magnetic properties of MnAs nanoclusters formed by Mn ion implantation in GaAs  

SciTech Connect

Ferromagnetic (FM) nanostructures embedded in semiconductors are of fundamental interest since their physical properties could be used in new devices such as memories, sensors or spintronics. In this work, we present results obtained on the synthesis and characterization of nanosized MnAs ferromagnets buried in GaAs. These nanocrystals are formed either by single Mn implantation or Mn + As co-implantation at room temperature into GaAs wafers at 141 and 180 keV respectively. Two doses, 1 x 10{sup 16} and 2 x 10{sup 16} ions {center_dot} cm{sup -2} for each impurity, are tested. Pieces of the wafers are then annealed by RTA or classical furnace annealing at various temperatures under N{sub 2} atmosphere for increasing times. HRTEM and diffraction analysis show that under such conditions MnAs precipitates form with a regular hexagonal structure, the 3m orientation-relationship of precipitates with respect to the matrix offers the most energetically stable configuration. Size distributions are systematically extracted from statistical analysis of ''2 beam'' TEM images. The precipitate mean diameters of nanocrystals populations range from 9 to 13 nm depending on the annealing conditions. Magnetization measurements by SQUID magnetometry on the same samples reveal a progressive transition from a superparamagnetic behavior at room temperature to an FM one at 2K, reflecting a distribution of blocking temperature, due to distribution of size and to dipolar interactions. Curie temperatures in the range of 360K were measured.

Serres, A.; Benassayag, G.; Respaud, M.; Armand, C.; Pesant, J.C.; Mari, A.; Liliental-Weber, Z.; Claverie, A.

2002-08-01T23:59:59.000Z

215

Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester

2012-07-01T23:59:59.000Z

216

T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab

2012-02-11T23:59:59.000Z

217

PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos

2008-06-27T23:59:59.000Z

218

LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance

219

Effect of a high electric field on the conductivity of MnGa{sub 2}S{sub 4}, MnIn{sub 2}S{sub 4}, and MnGaInS{sub 4} single crystals  

Science Conference Proceedings (OSTI)

The results of studying the effect of a high electric field on the conductivity of MnGa{sub 2}S{sub 4}, MnIn{sub 2}S{sub 4}, and MnGaInS{sub 4} single crystals are reported. The activation energy is determined in high and low electric fields. It is established that the decrease in the activation energy with increasing the external voltage is associated with decreasing the depth of the potential well, in which the electron is located.

Niftiev, N. N. [Azerbaijan State Pedagogical University (Azerbaijan); Tagiev, O. B. [National Academy of Sciences of Azerbaijan, Institute of Physics (Azerbaijan)

2009-09-15T23:59:59.000Z

220

Elementary Steps of Syngas Reactions on Mo2C(001): Adsorption Thermochemistry and Bond Dissociation  

SciTech Connect

Density functional theory (DFT) and ab initio thermodynamics are applied in order to investigate the most stable surface and subsurface terminations of Mo{sub 2}C(001) as a function of chemical potential and in the presence of syngas. The Mo-terminated (001) surface is then used as a model surface to evaluate the thermochemistry and energetic barriers for key elementary steps in syngas reactions. Adsorption energy scaling relations and Broensted-Evans-Polanyi relationships are established and used to place Mo{sub 2}C into the context of transition metal surfaces. The results indicate that the surface termination is a complex function of reaction conditions and kinetics. It is predicted that the surface will be covered by either C{sub 2}H{sub 2} or O depending on conditions. Comparisons to transition metals indicate that the Mo-terminated Mo{sub 2}C(001) surface exhibits carbon reactivity similar to transition metals such as Ru and Ir, but is significantly more reactive towards oxygen.

Medford, Andrew

2012-02-16T23:59:59.000Z

Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

FeAl and Mo-Si-B Intermetallic Coatings Prepared by Thermal Spraying  

SciTech Connect

FeAl and Mo-Si-B intermetallic coatings for elevated temperature environmental resistance were prepared using high-velocity oxy-fuel (HVOF) and air plasma spray (APS) techniques. For both coating types, the effect of coating parameters (spray particle velocity and temperature) on the microstructure and physical properties of the coatings was assessed. Fe-24Al (wt.%) coatings were prepared using HVOF thermal spraying at spray particle velocities varying from 540 m/s to 700 m/s. Mo-13.4Si-2.6B coatings were prepared using APS at particle velocities of 180 and 350 m/s. Residual stresses in the HVOF FeAl coatings were compressive, while stresses in the APS Mo-Si-B coatings were tensile. In both cases, residual stresses became more compressive with increasing spray particle velocity due to increased peening imparted by the spray particles. The hardness and elastic moduli of FeAl coatings also increased with increasing particle velocity, again due to an increased peening effect. For Mo-Si-B coatings, plasma spraying at 180 m/s resulted in significant oxidation of the spray particles and conversion of the T1 phase into amorphous silica and {alpha}-Mo. The T1 phase was retained after spraying at 350 m/s.

Totemeier, T.C.; Wright, R.N.; Swank, W.D.

2003-04-22T23:59:59.000Z

222

van der Waals Epitaxy of MoS2 Layers Using Graphene As Growth Templates  

SciTech Connect

We present a method for synthesizing MoS{sub 2}/Graphene hybrid heterostructures with a growth template of graphene-covered Cu foil. Compared to other recent reports, a much lower growth temperature of 400 C is required for this procedure. The chemical vapor deposition of MoS{sub 2} on the graphene surface gives rise to single crystalline hexagonal flakes with a typical lateral size ranging from several hundred nanometers to several micrometers. The precursor (ammonium thiomolybdate) together with solvent was transported to graphene surface by a carrier gas at room temperature, which was then followed by post annealing. At an elevated temperature, the precursor self-assembles to form MoS{sub 2} flakes epitaxially on the graphene surface via thermal decomposition. With higher amount of precursor delivered onto the graphene surface, a continuous MoS{sub 2} film on graphene can be obtained. This simple chemical vapor deposition method provides a unique approach for the synthesis of graphene heterostructures and surface functionalization of graphene. The synthesized two-dimensional MoS{sub 2}/Graphene hybrids possess great potential toward the development of new optical and electronic devices as well as a wide variety of newly synthesizable compounds for catalysts.

Shi, Yumeng [Massachusetts Institute of Technology (MIT); Zhou, Wu [Vanderbilt University; Lu, Ang-Yu [Academia Sinica, Hefei, China; Fang, Wenjing [Massachusetts Institute of Technology (MIT); Lee, Yi-Hsien [Massachusetts Institute of Technology (MIT); Hsu, Allen Long [Massachusetts Institute of Technology (MIT); Kim, Soo Min [Massachusetts Institute of Technology (MIT); Kim, Ki Kang [Massachusetts Institute of Technology (MIT); Yang, Hui Ying [Singapore University of Technology and Design; Liang, Lain-Jong [Academia Sinica, Hefei, China; Idrobo Tapia, Juan C [ORNL; Kong, Jing [Massachusetts Institute of Technology (MIT)

2012-01-01T23:59:59.000Z

223

Method for the production of {sup 99m}Tc compositions from {sup 99}Mo-containing materials  

DOE Patents (OSTI)

An improved method is described for producing {sup 99m}Tc compositions from {sup 99}Mo compounds. {sup 100}Mo metal or {sup 100}MoO{sub 3} is irradiated with photons in a particle (electron) accelerator to ultimately produce {sup 99}MoO{sub 3}. This composition is then heated in a reaction chamber to form a pool of molten {sup 99}MoO{sub 3} with an optimum depth of 0.5--5 mm. A gaseous mixture thereafter evolves from the molten {sup 99}MoO{sub 3} which contains vaporized {sup 99}MoO{sub 3}, vaporized {sup 99m}TcO{sub 3}, and vaporized {sup 99m}TcO{sub 2}. This mixture is then combined with an oxidizing gas (O{sub 2(g)}) to generate a gaseous stream containing vaporized {sup 99m}Tc{sub 2}O{sub 7} and vaporized {sup 99}MoO{sub 3}. Next, the gaseous stream is cooled in a primary condensation stage in the reaction chamber to remove vaporized {sup 99}MoO{sub 3}. Cooling is undertaken at a specially-controlled rate to achieve maximum separation efficiency. The gaseous stream is then cooled in a sequential secondary condensation stage to convert vaporized {sup 99m}Tc{sub 2}O{sub 7} into a condensed {sup 99m}Tc-containing reaction product which is collected. 1 fig.

Bennett, R.G.; Christian, J.D.; Grover, S.B.; Petti, D.A.; Terry, W.K.; Yoon, W.Y.

1998-09-01T23:59:59.000Z

224

Ga{sub 1-x}Mn{sub x}N epitaxial films with high magnetization  

Science Conference Proceedings (OSTI)

We report on the fabrication of pseudomorphic wurtzite Ga{sub 1-x}Mn{sub x}N grown on GaN with Mn concentrations up to 10% using molecular beam epitaxy. According to Rutherford backscattering, the Mn ions are mainly at the Ga-substitutional positions, and they are homogeneously distributed according to depth-resolved Auger-electron spectroscopy and secondary-ion mass-spectroscopy measurements. A random Mn distribution is indicated by transmission electron microscopy, and no Mn-rich clusters are present for optimized growth conditions. A linear increase of the c-lattice parameter with increasing Mn concentration is found using x-ray diffraction. The ferromagnetic behavior is confirmed by superconducting quantum-interference measurements showing saturation magnetizations of up to 150 emu/cm{sup 3}.

Kunert, G.; Kruse, C.; Figge, S.; Hommel, D. [Semiconductor Epitaxy, Institute of Solid State Physics, University of Bremen, D-28359 Bremen (Germany); Dobkowska, S.; Jakiela, R.; Stefanowicz, W.; Sawicki, M. [Institute of Physics, Polish Academy of Science, PL-02-668 Warszawa (Poland); Li, Tian; Bonanni, A. [Institute for Semiconductor and Solid State Physics, Johannes Kepler University Linz, A 4040 Linz (Austria); Reuther, H.; Grenzer, J.; Borany, J. von [Helmholtz-Zentrum Dresden-Rossendorf, Institute of Ion Beam Physics and Materials Research, Bautzner Landstrasse 400, 01328 Dresden (Germany); Dietl, T. [Institute of Physics, Polish Academy of Science, PL-02-668 Warszawa (Poland); Institute of Theoretical Physics, Faculty of Physics, University of Warsaw, PL-00-681 Warszawa (Poland)

2012-07-09T23:59:59.000Z

225

Time resolved magneto-optical studies of ferromagnetic InMnSb films  

SciTech Connect

We report time resolved magneto-optical measurements in InMnSb ferromagnetic films with 2% and 2.8% Mn contents grown by low temperature molecular beam epitaxy. In order to probe a possible interaction between the spins of photoexcited carriers and the Mn ions, we measured spin dynamics before and after aligning the Mn ions by applying an external magnetic field at temperatures above and below the samples' Curie temperatures. We observed no significant temperature or magnetic field dependence in the relaxation times and attribute the observed dynamics entirely to the relaxation of photoexcited electrons in the conduction band where the s-d coupling with the localized Mn ions is significantly weaker compared to the p-d exchange coupling. We observed several differences in the optical response of our InMnSb samples which could have been influenced mainly by the samples' growth conditions.

Frazier, M.; Kini, R. N.; Nontapot, K.; Khodaparast, G. A. [Department of Physics, Virginia Tech, Blacksburg, Virginia 24061 (United States); Wojtowicz, T. [Institute of Physics, Polish Academy of Sciences 02-668 Warsaw (Poland); Liu, X.; Furdyna, J. K. [Department of Physics, University of Notre Dame, Notre Dame, Indiana 46556 (United States)

2008-02-11T23:59:59.000Z

226

Investigation of structure, magnetic, and transport properties of Mn-doped SiC films  

SciTech Connect

Mn-doped SiC films were fabricated by radio frequency magnetron sputtering technique. The structure, composition, and magnetic and transport properties of the films were investigated. The results show the films have the 3C-SiC crystal structure and the doped Mn atoms in the form of Mn{sup 2+} ions substitute for C sites in SiC lattice. All the films are ferromagnetic at 300 K, and the ferromagnetism in films arises from the doped Mn atoms and some extended defects. In addition, the saturation magnetization increases with the Mn-doped concentration increasing. The Mn doping does not change the semiconductor characteristics of the SiC films.

Sun Xianke [School of Material Science and Engineering, Tianjin University, Tianjin 300172 (China); Tianjin Key Laboratory for Photoelectric Materials and Devices, Tianjin University of Technology, Tianjin 300384 (China); Guo Ruisong [School of Material Science and Engineering, Tianjin University, Tianjin 300172 (China); An Yukai [Tianjin Key Laboratory for Photoelectric Materials and Devices, Tianjin University of Technology, Tianjin 300384 (China); School of Material Science and Engineering, Tianjin University of Technology, Tianjin 300384 (China); Liu Jiwen [School of Material Science and Engineering, Tianjin University, Tianjin 300172 (China); Tianjin Key Laboratory for Photoelectric Materials and Devices, Tianjin University of Technology, Tianjin 300384 (China); School of Material Science and Engineering, Tianjin University of Technology, Tianjin 300384 (China)

2013-07-15T23:59:59.000Z

227

Electronic Structure and Oxidation State Changes in the Mn (4) Ca Cluster of Photosystem II  

Science Conference Proceedings (OSTI)

Oxygen-evolving complex (Mn{sub 4}Ca cluster) of Photosystem II cycles through five intermediate states (S{sub i}-states, i = 0-4) before a molecule of dioxygen is released. During the S-state transitions, electrons are extracted from the OEC, either from Mn or alternatively from a Mn ligand. The oxidation state of Mn is widely accepted as Mn{sub 4}(III{sub 2},IV{sub 2}) and Mn{sub 4}(III,IV{sub 3}) for S{sub 1} and S{sub 2} states, while it is still controversial for the S{sub 0} and S{sub 3} states. We used resonant inelastic X-ray scattering (RIXS) to study the electronic structure of Mn{sub 4}Ca complex in the OEC. The RIXS data yield two-dimensional plots that provide a significant advantage by obtaining both K-edge pre-edge and L-edge-like spectra (metal spin state) simultaneously. We have collected data from PSII samples in the each of the S-states and compared them with data from various inorganic Mn complexes. The spectral changes in the Mn 1s2p{sub 3/2} RIXS spectra between the S-states were compared to those of the oxides of Mn and coordination complexes. The results indicate strong covalency for the electronic configuration in the OEC, and we conclude that the electron is transferred from a strongly delocalized orbital, compared to those in Mn oxides or coordination complexes. The magnitude for the S{sub 0} to S{sub 1}, and S{sub 1} to S{sub 2} transitions is twice as large as that during the S{sub 2} to S{sub 3} transition, indicating that the electron for this transition is extracted from a highly delocalized orbital with little change in charge density at the Mn atoms.

Yano, J.; Pushkar, Y.; Messinger, J.; Bergmann, U.; Glatzel, P.; Yachandra, V.K.; /SLAC

2012-08-17T23:59:59.000Z

228

Distinct local electronic structure and magnetism for Mn in amorphous Si and Ge  

SciTech Connect

Transition metals such as Mn generally have large local moments in covalent semiconductors due to their partially filled d shells. However, Mn magnetization in group-IV semiconductors is more complicated than often recognized. Here we report a striking crossover from a quenched Mn moment (<0.1 {mu}{sub B}) in amorphous Si (a-Si) to a large distinct local Mn moment ({ge}3{mu}{sub B}) in amorphous Ge (a-Ge) over a wide range of Mn concentrations (0.005-0.20). Corresponding differences are observed in d-shell electronic structure and the sign of the Hall effect. Density-functional-theory calculations show distinct local structures, consistent with different atomic density measured for a-Si and a-Ge, respectively, and the Mn coordination number N{sub c} is found to be the key factor. Despite the amorphous structure, Mn in a-Si is in a relatively well-defined high coordination interstitial type site with broadened d bands, low moment, and electron (n-type) carriers, while Mn in a-Ge is in a low coordination substitutional type site with large local moment and holes (p-type) carriers. Moreover, the correlation between N{sub c} and the magnitude of the local moment is essentially independent of the matrix; the local Mn moments approach zero when N{sub c} > 7 for both a-Si and a-Ge.

Zeng, Li; Cao, J. X.; Helgren, E.; Karel, J.; Arenholz, E.; Ouyang, Lu; Smith, David J.; Wu, R. Q.; Hellman, F.

2010-06-01T23:59:59.000Z

229

Investigation of Structural Stability of Monolayer MnO 2 Sheet under ...  

Science Conference Proceedings (OSTI)

Presentation Title, Investigation of Structural Stability of Monolayer MnO2 Sheet under Electron Beam Irradiation. Author(s), Yong Wang, Chenghua Sun, Jin Zou ...

230

Ion-exchanged MnO2 nanoparticles as cathodes of lithium ion ...  

Science Conference Proceedings (OSTI)

Presentation Title, Ion-exchanged MnO2 nanoparticles as cathodes of lithium ion batteries at elevated temperatures. Author(s), Dawei Liu, Jasper Wright, Wei...

231

F-8: Modeling of Mn-Ni-Si-Cu Precipitation in Reactor Pressure ...  

Science Conference Proceedings (OSTI)

Presentation Title, F-8: Modeling of Mn-Ni-Si-Cu Precipitation in Reactor .... Steels 316 and Comparison with the Rate Theory Model of a Multicomponent System.

232

Optimization of Na 0.44 MnO 2 Cathode Material - Programmaster.org  

Science Conference Proceedings (OSTI)

Symposium, Energy Storage: Materials, Systems, and Applications. Presentation Title, Optimization of Na0.44MnO2 Cathode Material for Use in Aqueous...

233

Low-energy structure of 61Mn populated following $\\beta$ decay of 61Cr  

E-Print Network (OSTI)

$\\beta$ decay of the $^{61}$Cr$_{37}$ ground state has been studied. A new half-life of 233 +/- 11 ms has been deduced, and seven delayed $\\gamma$ rays have been assigned to the daughter, $^{61}$Mn$_{36}$. The low-energy level structure of $^{61}$Mn$_{36}$ is similar to that of the less neutron-rich $^{57,59}$Mn nuclei. The odd-A $_{25}$Mn isotopes follow the systematic trend in the yrast states of the even-even, Z + 1 $_{26}$Fe isotopes, and not that of the Z - 1 $_{24}$Cr isotopes, where a possible onset of collectivity has been suggested to occur already at N = 36.

Crawford, H L; Berryman, J S; Broda, R; Fornal, B; Hoffman, C R; Hoteling, N; Janssens, R V F; Lenzi, S M; Pereira, J; Stoker, J B; Tabor, S L; Walters, W B; Wang, X; Zhu, S

2009-01-01T23:59:59.000Z

234

Low-energy structure of 61Mn populated following $?$ decay of 61Cr  

E-Print Network (OSTI)

$\\beta$ decay of the $^{61}$Cr$_{37}$ ground state has been studied. A new half-life of 233 +/- 11 ms has been deduced, and seven delayed $\\gamma$ rays have been assigned to the daughter, $^{61}$Mn$_{36}$. The low-energy level structure of $^{61}$Mn$_{36}$ is similar to that of the less neutron-rich $^{57,59}$Mn nuclei. The odd-A $_{25}$Mn isotopes follow the systematic trend in the yrast states of the even-even, Z + 1 $_{26}$Fe isotopes, and not that of the Z - 1 $_{24}$Cr isotopes, where a possible onset of collectivity has been suggested to occur already at N = 36.

H. L. Crawford; P. F. Mantica; J. S. Berryman; R. Broda; B. Fornal; C. R. Hoffman; N. Hoteling; R. V. F. Janssens; S. M. Lenzi; J. Pereira; J. B. Stoker; S. L. Tabor; W. B. Walters; X. Wang; S. Zhu

2009-04-29T23:59:59.000Z

235

EA-1947: Transfer of the Kansas City Plant, Kansas City, MO | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EA-1947: Transfer of the Kansas City Plant, Kansas City, MO EA-1947: Transfer of the Kansas City Plant, Kansas City, MO EA-1947: Transfer of the Kansas City Plant, Kansas City, MO SUMMARY This EA evaluates potential environmental impacts of a proposal to transfer the NNSA's KCP property either in whole or in part. This includes considering the No Action Alternative, where NNSA relocates operations from the KCP and maintains ownership of its property; and the Proposed Action Alternative, where NNSA transfers the KCP property for mixed use (industrial, warehouse, commercial, office). Under the proposed action, the EA addresses the potential direct, indirect, and cumulative impacts of using the KCP property for uses consistent with current zoning. NNSA also analyzes the potential environmental impacts of partial and/or complete

236

EA-1947: Transfer of the Kansas City Plant, Kansas City, MO | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EA-1947: Transfer of the Kansas City Plant, Kansas City, MO EA-1947: Transfer of the Kansas City Plant, Kansas City, MO EA-1947: Transfer of the Kansas City Plant, Kansas City, MO SUMMARY This EA evaluates potential environmental impacts of a proposal to transfer the NNSA's KCP property either in whole or in part. This includes considering the No Action Alternative, where NNSA relocates operations from the KCP and maintains ownership of its property; and the Proposed Action Alternative, where NNSA transfers the KCP property for mixed use (industrial, warehouse, commercial, office). Under the proposed action, the EA addresses the potential direct, indirect, and cumulative impacts of using the KCP property for uses consistent with current zoning. NNSA also analyzes the potential environmental impacts of partial and/or complete

237

EIS-0475: Disposition of the Bannister Federal Complex, Kansas City, MO |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EIS-0475: Disposition of the Bannister Federal Complex, Kansas EIS-0475: Disposition of the Bannister Federal Complex, Kansas City, MO EIS-0475: Disposition of the Bannister Federal Complex, Kansas City, MO Summary NNSA/DOE announces its intent to prepare an EIS for the disposition of the Bannister Federal Complex, Kansas City, MO. NNSA previously decided in a separate NEPA review (EA-1592) to relocate its operations from the Bannister Federal Complex to a newly constructed industrial campus eight miles from the current location. NOTE: On November 30, 2012, DOE announced the cancellation of this EIS and its intent to prepare an Environmental Assessment (EA-1947). Public Comment Opportunities None available at this time. Documents Available for Download November 30, 2012 EA-1947: Notice of Intent to Prepare an Environmental Assessment and

238

DOE - Office of Legacy Management -- Weldon Spring Chemical Co - MO 03  

NLE Websites -- All DOE Office Websites (Extended Search)

Weldon Spring Chemical Co - MO 03 Weldon Spring Chemical Co - MO 03 FUSRAP Considered Sites Site: Weldon Spring Chemical Co. (MO.03) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: Also see Weldon Spring, Missouri, Site Documents Related to Weldon Spring Chemical Co. Summary of Work Session - Focus Area: Monitoring and Maintenance. Summary of Weldon Spring Long-Term Stewardship Plan Public Workshop. Summary of Work Session - Focus Area: Communication and Public Involvement. Land Use and Institutional Controls and Homeland SecurityFocus Area Work SessionWeldon Spring SiteInterpretive CenterDecember 5, 20022 Agenda7:00 p.m.Welcome, Pam Thompson, Manager, Weldon SpringObjective of

239

The development of uranium foil farication technology utilizing twin roll method for Mo-99 irradiation target  

E-Print Network (OSTI)

MDS Nordion in Canada, occupying about 75% of global supply of Mo-99 isotope, has provided the irradiation target of Mo-99 using the rod-type UAl sub x alloys with HEU(High Enrichment Uranium). ANL (Argonne National Laboratory) through co-operation with BATAN in Indonesia, leading RERTR (Reduced Enrichment for Research and Test Reactors) program substantially for nuclear non-proliferation, has designed and fabricated the annular cylinder of uranium targets, and successfully performed irradiation test, in order to develop the fabrication technology of fission Mo-99 using LEU(Low Enrichment Uranium). As the uranium foils could be fabricated in laboratory scale, not in commercialized scale by hot rolling method due to significant problems in foil quality, productivity and economic efficiency, attention has shifted to the development of new technology. Under these circumstances, the invention of uranium foil fabrication technology utilizing twin-roll casting method in KAERI is found to be able to fabricate LEU or...

Kim, C K; Park, H D

2002-01-01T23:59:59.000Z

240

Progress in chemical processing of LEU targets for {sup 99}Mo production -- 1997  

SciTech Connect

Presented here are recent experimental results of the continuing development activities associated with converting current processes for producing fission-product {sup 99}Mo from targets using high-enriched uranium (HEU) to low-enriched uranium (LEU). Studies were focused in four areas: (1) measuring the chemical behavior of iodine, rhodium, and silver in the LEU-modified Cintichem process, (2) performing experiments and calculations to assess the suitability of zinc fission barriers for LEU metal foil targets, (3) developing an actinide separations method for measuring alpha contamination of the purified {sup 99}Mo product, and (4) developing a cooperation with Sandia National Laboratories and Los Alamos National Laboratory that will lead to approval by the US Federal Drug Administration for production of {sup 99}Mo from LEU targets. Experimental results continue to show the technical feasibility of converting current HEU processes to LEU.

Vandegrift, G.F.; Conner, C.; Sedlet, J.; Wygmans, D.G. [Argonne National Lab., IL (United States); Wu, D. [Univ. of Illinois, Urbana, IL (United States); Iskander, F.; Landsberger, S. [Univ. of Texas, Austin, TX (United States)

1997-10-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

An experimental investigation of double beta decay of /sup 100/Mo  

SciTech Connect

New limits on half-lives for several double beta decay modes of /sup 100/Mo were obtained with a novel experimental system which included thin source films interleaved with a coaxial array of windowless silicon detectors. Segmentation and timing information allowed backgrounds originating in the films to be studied in some detail. Dummy films containing /sup 96/Mo were used to assess remaining backgrounds. With 0.1 mole years of /sup 100/Mo data collected, the lower half-life limits at 90% confidence were 2.7 /times/ 10/sup 18/ years for decay via the two-neutrino mode, 5.2 /times/10/sup 19/ years for decay with the emission of a Majoron, and 1.6 /times/ 10/sup 20/ years and 2.2 /times/ 10/sup 21/ years for neutrinoless 0/sup +/ ..-->.. 2/sup +/ and 0/sup +/ ..-->.. 0/sup +/ transitions, respectively. 50 refs., 38 figs., 11 tabs.

Dougherty, B.L.

1988-11-17T23:59:59.000Z

242

Large energy absorption in Ni-Mn-Ga/polymer composites  

SciTech Connect

Ferromagnetic shape memory alloys can respond to a magnetic field or applied stress by the motion of twin boundaries and hence they show large hysteresis or energy loss. Ni-Mn-Ga particles made by spark erosion have been dispersed and oriented in a polymer matrix to form pseudo 3:1 composites which are studied under applied stress. Loss ratios have been determined from the stress-strain data. The loss ratios of the composites range from 63% to 67% compared to only about 17% for the pure, unfilled polymer samples.

Feuchtwanger, Jorge; Richard, Marc L.; Tang, Yun J.; Berkowitz, Ami E.; O'Handley, Robert C.; Allen, Samuel M. [Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States); University of California, San Diego, La Joya, California 92093 (United States); Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States)

2005-05-15T23:59:59.000Z

243

Giant tunneling magnetoresistance in Co{sub 2}MnSi/Al-O/Co{sub 2}MnSi magnetic tunnel junctions  

SciTech Connect

Magnetic tunnel junctions (MTJs) with a stacking structure of Co{sub 2}MnSi/Al-O/Co{sub 2}MnSi were fabricated using magnetron sputtering system. Fabricated MTJ exhibited an extremely large tunneling magnetoresistance (TMR) ratio of 570% at low temperature, which is the highest TMR ratio reported to date for an amorphous Al-O tunneling barrier. The observed dependence of tunneling conductance on bias voltage clearly reveals the half-metallic energy gap of Co{sub 2}MnSi. The origins of large temperature dependence of TMR ratio were discussed on the basis of the present results.

Sakuraba, Y.; Hattori, M.; Oogane, M.; Ando, Y.; Kato, H.; Sakuma, A.; Miyazaki, T.; Kubota, H. [Department of Applied Physics, Graduate School of Engineering, Tohoku University, Aoba-yama 6-6-05, Aramaki, Aoba-ku, Sendai 980-8579 (Japan); Nanoelectronics Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), 1-1-1 Umezono, Tsukuba 305-8568 (Japan)

2006-05-08T23:59:59.000Z

244

Substitution of modified 9 Cr-1 Mo steel for austentic stainless steels  

SciTech Connect

This report describes the current program to develop a high-strength ferritic-martensitic steel. The alloy is essentially Fe-9% Cr-1% Mo with small additions of V and Nb and is known as modifed 9 Cr-1 Mo steel. Its elevated-temperature properties and design allowable stresses match those of type 304 stainless steel for temperatures up to 600/sup 0/C and exceed those of other ferritic steels by factors of 2 to 3. The improved strength of this alloy permits its use in place of stainless steels for many applications.

Sikka, V. K.

1982-04-01T23:59:59.000Z

245

Effect of Mo Back Contact on Na Out-Diffusion and Device Performance of Mo/Cu(In,Ga)Se2/CdS/ZnO Solar Cells: Preprint  

DOE Green Energy (OSTI)

This conference paper describes the molybdenum thin films that were deposited on soda lime glass (SLG) substrates using direct-current planar magnetron sputtering, with a sputtering power density of 1.2 W/cm2. The working gas (Ar) pressure was varied from 0.6 to 16 mtorr to induce changes in the Mo films' morphology and microstructure. Thin films of Cu(In,Ga)Se2 (CIGS) were deposited on the Mo-coated glass using the 3-stage co-evaporation process. The morphology of both the Mo-coated SLG and the CIGS thin films grown on it was examined using high-resolution scanning electron microscopy. Na was depth profiled in the Mo and CIGS films by secondary ion mass spectrometry. The device performance was evaluated under standard conditions of 1000 W/m2 and 25 C. Optimum device performance is found for an intermediate Mo sputtering pressure.

Al-Thani, H. A.; Hasoon, F. S.; Young, M.; Asher, S.; Alleman, J. L.; Al-Jassim, M. M.; Williamson, D. L.

2002-05-01T23:59:59.000Z

246

Soft X-ray Spectroscopy of C60/Copper Phthalocyanine/MoO3 Interfaces: Role of Reduced MoO3 on Energetic Band Alignment and Improved Performance  

Science Conference Proceedings (OSTI)

The interfacial electronic structure of C{sub 60}/copper phthalocyanine (CuPc)/molybdenum trioxide (MoO{sub 3}) thin films grown in situ on indium tin oxide (ITO) substrates has been studied using synchrotron radiation-excited photoelectron spectroscopy in an attempt to understand the influence of oxide interlayers on the performance of small molecule organic photovoltaic devices. The MoO{sub 3} layer on ITO is found to significantly increase the work function of the substrate and induces large interface dipoles and band bending at the CuPc/MoO{sub 3} interface. The large band bending confirms the formation of an internal potential that assists hole extraction from the CuPc layer to the electrode. The electronic structure of the MoO{sub 3} layer on ITO was also examined using various soft X-ray spectroscopies to probe the conductive nature of the MoO{sub 3} thin film.

S Cho; L Piper; A DeMasi; A Preston; K Smith; K Chauhan; R Hatton; T Jones

2011-12-31T23:59:59.000Z

247

Semesterplan WS 2012/13 Chemie (VL) fr Zahnmediziner (1. FS) Stand. 02.10.2012 Mo 22. Okt.  

E-Print Network (OSTI)

Semesterplan WS 2012/13 Chemie (VL) für Zahnmediziner (1. FS) Stand. 02.10.2012 Mo 22. Okt;Semesterplan WS 2012/13 Chemie (VL) für Zahnmediziner (1. FS) Stand. 02.10.2012 Mo 17. Dez. 10.15 11

Gollisch, Tim

248

Specific DNA cleavage mediated by [SalenMn(III)][sup +  

Science Conference Proceedings (OSTI)

The combination of [SalenMn(III)][sup +] and a terminal oxidant affords efficient and specific cleavage of right-handed double-helical DNA in regions rich in A:T base pairs. Metal complexes of the tetradentate chelating ligands Salen (Salen = N,N[prime]-ethylenebis(salicylideneaminato)) have been part of the inorganic chemistry literature for several decades. The cationic manganese(III) complex [SalenMn(III)][sup +] (1) is an efficient catalyst for the epoxidation of olefins with terminal oxidants such as iodosylbenzene. 1 also catalyzes oxidative C-H bond activation. The flat, crescent shape of 1, its aromatic and cationic nature, and its ability to catalyze hydrocarbon oxidation are features shared in whole or in part by metal complexes which bind to DNA and cleave it via oxidative processes. These similarities prompted the authors to evaluate the DNA-cleaving properties of 1, and they now report that 1 mediates specific cleavage of right-handed double-helical DNA in a reaction requiring a terminal oxidant. 20 refs., 3 figs., 1 tab.

Gravert, D.J.; Griffin, J.H. (Stanford Univ., CA (United States))

1993-02-12T23:59:59.000Z

249

Small non-polar complexes exhibiting significant piezoelectric properties: Solvothermal synthesis and crystal structures of MO{sub 5}V(tren){center_dot}H{sub 2}O (M=Mo and W; tren=tris(2-aminoethyl)amine)  

SciTech Connect

The two isostructural complexes MO{sub 5}V(tren){center_dot}H{sub 2}O (M=Mo (1) and W (2)) were synthesized under solvothermal conditions at pH Almost-Equal-To 12 crystallizing in the non-centrosymmetric space group P2{sub 1}2{sub 1}2{sub 1}. The structures are constructed by a distorted tetrahedral [MO{sub 4}]{sup 2-} anion bound via one shared oxygen atom to a severely distorted [V{sup IV}N{sub 4}O]{sup 2+} complex completing the octahedral coordination around the V centre. The two O atoms in the VN{sub 4}O{sub 2} octahedron are in cis position. The two compounds represent rare examples where the [MO{sub 4}]{sup 2-} anion is acting as a ligand. Both compounds exhibit a piezoelectric effect which is more pronounced for M=Mo. The samples are further characterized with IR and UV/Vis spectroscopy and thermal analysis. - Graphical abstract: The complexes [(V(tren)O)(MO4)]{center_dot}H2O (M = Mo, W; tren = tris(2-aminoethyl)amine)) composed of vertex-linked [MO4]{sup 2-} tetrahedron and [VN4O6]{sup 2+}octahedron. Highlights: Black-Right-Pointing-Pointer [MO{sub 4}]{sup 2-} tetrahedron (M=Mo, W) acting as ligand. Black-Right-Pointing-Pointer Jahn-Teller and steric distortion of the [VN{sub 4}O{sub 2}]{sup 2+} octahedron. Black-Right-Pointing-Pointer Non-centrosymmetric complexes exhibiting pronounced piezoelectric effect.

Rasmussen, M.; Naether, C. [Institut fuer Anorganische Chemie, Christian-Albrechts-Universitaet Kiel, Max-Eyth-Str. 2, D-24118 Kiel (Germany)] [Institut fuer Anorganische Chemie, Christian-Albrechts-Universitaet Kiel, Max-Eyth-Str. 2, D-24118 Kiel (Germany); Bismayer, U. [Mineralogisch-Petrographisches Institut, Universitaet Hamburg, Grindelallee 48 20146 Hamburg (Germany)] [Mineralogisch-Petrographisches Institut, Universitaet Hamburg, Grindelallee 48 20146 Hamburg (Germany); Bensch, W., E-mail: wbensch@ac.uni-kiel.de [Institut fuer Anorganische Chemie, Christian-Albrechts-Universitaet Kiel, Max-Eyth-Str. 2, D-24118 Kiel (Germany)

2012-11-15T23:59:59.000Z

250

Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.

2003-12-01T23:59:59.000Z

251

Electric-Field Modulation of Curie Temperature in (Ga, Mn)As Field-Effect Transistor Structures with Varying Channel Thickness and Mn Compositions  

SciTech Connect

We have investigated the change of T{sub C} of ferromagnetic semiconductor (Ga, Mn)As by changing hole concentration p. The field effect transistor structure was utilized to change p. The relation T{sub C}propor top{sup 0.2} is obtained for three samples, despite the difference of their Mn composition and thickness, indicating that the relation holds over 2 decades of p.

Nishitani, Y.; Endo, M. [Laboratory for Nanoelectronics and Spintronics, Research Institute of Electrical Communication, Tohoku University, Katahira 2-1-1, Aoba-ku, Sendai 980-8577 (Japan); Chiba, D. [Semiconductor Spintronics Project, Exploratory Research for Advanced Technology, Japan Science and Technology Agency, Sanban-cho 5, Chiyoda-ku, Tokyo 102-0075 (Japan); Laboratory for Nanoelectronics and Spintronics, Research Institute of Electrical Communication, Tohoku University, Katahira 2-1-1, Aoba-ku, Sendai 980-8577 (Japan); Matsukura, F.; Ohno, H. [Laboratory for Nanoelectronics and Spintronics, Research Institute of Electrical Communication, Tohoku University, Katahira 2-1-1, Aoba-ku, Sendai 980-8577 (Japan); Semiconductor Spintronics Project, Exploratory Research for Advanced Technology, Japan Science and Technology Agency, Sanban-cho 5, Chiyoda-ku, Tokyo 102-0075 (Japan)

2010-01-04T23:59:59.000Z

252

Element-specific study of the temperature dependent magnetization of Co-Mn-Sb thin films  

SciTech Connect

Magnetron sputtered thin Co-Mn-Sb films were investigated with respect to their element-specific magnetic properties. Stoichiometric Co{sub 1}Mn{sub 1}Sb{sub 1} crystallized in the C1{sub b} structure has been predicted to be half-metallic and is therefore of interest for spintronics applications. It should show a characteristic antiferromagnetic coupling of the Mn and Co magnetic moments and a transition temperature T{sub C} of about 480K. Although the observed transition temperature of our 20nm thick Co{sub 32.4}Mn{sub 33.7}Sb{sub 33.8}, Co{sub 37.7}Mn{sub 34.1}Sb{sub 28.2} and Co{sub 43.2}Mn{sub 32.6}Sb{sub 24.2} films is in quite good agreement with the expected value, we found a ferromagnetic coupling of the Mn and Co magnetic moments which indicates that the films do not crystallize in the C1{sub b} structure and are probably not fully spin-polarized. The ratio of the Co and Mn moments does not change up to the transition temperature and the temperature dependence of the magnetic moments can be well described by the mean field theory.

Schmalhorst, J.; Ebke, D.; Meinert, M.; Thomas, A.; Reiss, G.; Arenholz, E.

2008-09-30T23:59:59.000Z

253

Synthesis and Characterization of MnO2-Based Mixed Oxides as Supercapacitors  

E-Print Network (OSTI)

Synthesis and Characterization of MnO2-Based Mixed Oxides as Supercapacitors Hansung Kim. Available electronically January 28, 2003. The development of a high-power-density supercapacitor made to develop supercapacitors based on non-noble oxides.13 Hydrous manganese oxide (a-MnO2 · nH2O

Popov, Branko N.

254

Cation Effects on the Layer Structure of Biogenic Mn-Oxides  

E-Print Network (OSTI)

Radiation Lightsource (SSRL). Wet sample slurries were placed in an aluminum sample cell with Lexan windows-bs (Samuel Webb, SSRL). Two Mn-oxide references, triclinic birnessite (TcBir) and -MnO2 were synthesized and Environmental and Quality (ISEQ) Graduate Fellowship. M.Z. also thanks Dr. Samuel Webb at SSRL for his help

Sparks, Donald L.

255

[Characterization of lignin and Mn peroxidases from Phanerochaete chrysosporium]. Progress report  

DOE Green Energy (OSTI)

Lignin peroxidases were investigated with respect to enzyme kinetics and NMR spectroscopy of the heme domain. MN peroxidases were studied with respect to the role of oxalate in enzyme activity, the NMR spectroscopy of the heme domain. Gene expression of both lignin and MN peroxidases were examined as well as expression of site-directed mutants aimed at scale up production of these enzymes.

Not Available

1992-12-31T23:59:59.000Z

256

Dietary resveratrol administration increases MnSOD expression and activity in mouse brain  

E-Print Network (OSTI)

SOD protein level (140%) and activity (75%). The increase in MnSOD was not due to a substantial proliferationDietary resveratrol administration increases MnSOD expression and activity in mouse brain Ellen L oxidative stress. In vitro studies have shown an increase in antioxidant enzyme activities following

Stuart, Jeffrey A.

257

MoSi2 and Other Silicides as High Temperature Structural Materials  

Science Conference Proceedings (OSTI)

... R.W. Stusrud, R.A. MacKay,. D.L. Anton, T. Khan, R.D. Kissinger, D.L. Klarstmm ..... 'I. 3 10-S d. 5. Q. H. 3 10= g. 5. E a. E m-7. 'E 5, .- z. 10-8 '. 5 c:3si MoSi2. //II.

258

MoCha-pi, an exogenous coordination calculus based on mobile channels  

Science Conference Proceedings (OSTI)

In this paper we present MoCha-?, an exogenous coordination calculus that is based on mobile channels. A mobile channel is a coordination primitive that allows anonymous point-to-point communication between processes. Our calculus is an extension ... Keywords: calculus, coordination, distributed mobile channels

Juan Guillen-Scholten; Farhad Arbab; Frank de Boer; Marcello Bonsangue

2005-03-01T23:59:59.000Z

259

The MoLE project: an international experiment about mobile learning environment  

Science Conference Proceedings (OSTI)

This paper aims to present an international project, called the MoLE Project, which provided learning resources and tools for personnel in disaster or emergency situations. Thus, it illustrates the interpenetration of e-Learning and field workers with ... Keywords: education, mobile technologies, system evaluation

Marie-Hlne Ferrer, Jacob Hodges, Nathalie Bonnardel

2013-08-01T23:59:59.000Z

260

High-field superconductivity in some bcc Ti-Mo and Nb-Zr alloys  

Science Conference Proceedings (OSTI)

Zero electrical resistance at unusually high magnetic field strengths has been observed in the bcc alloys Ti-16 a/o (atomic percent) Mo, Nb-12 a/o Zr, and Nb-25 a/o Zr. The maximum highfield zero-resistance current density, Jc, in these ...

R. R. Hake; T. G. Berlincourt; D. H. Leslie

1962-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Spectroscopy of low energy solar neutrinos by MOON -Mo Observatory Of Neutrinos-  

E-Print Network (OSTI)

Spectroscopy of low energy solar neutrinos by MOON -Mo Observatory Of Neutrinos- R. Hazamaa , P Be solar 's. The present status of MOON for the low energy solar experiment is briefly discussed the pp solar flux with good accuracy. 1. INTRODUCTION Realtime studies of the high-energy component of 8

Washington at Seattle, University of

262

To appear in the ACM SIGGRAPH conference proceedings Jeong-Mo Hong  

E-Print Network (OSTI)

To appear in the ACM SIGGRAPH conference proceedings ? ??? ????? Ð? ? Jeong-Mo Hong£ Korea of viscosity influences the shape of air bubbles in water. In this paper, we extend previous fluid simulation

Frey, Pascal

263

Aqueous Phase Glycerol Reforming by PtMo Bimetallic Nano-Particle Catalyst: Product Selectivity and Structural Characterization  

Science Conference Proceedings (OSTI)

A carbon supported PtMo aqueous phase reforming catalyst for producing hydrogen from glycerol was characterized by analysis of the reaction products and pathway, TEM, XPS and XAS spectroscopy. Operando X-ray absorption spectroscopy (XAS) indicates the catalyst consists of bimetallic nano-particles with a Pt rich core and a Mo rich surface. XAS of adsorbed CO indicates that approximately 25% of the surface atoms are Pt. X-ray photoelectron spectroscopy indicates that there is unreduced and partially reduced Mo oxide (MoO{sub 3} and MoO{sub 2}), and Pt-rich PtMo bimetallic nano-particles. The average size measured by transmission electron microscopy of the fresh PtMo nano-particles is about 2 nm, which increases in size to 5 nm after 30 days of glycerol reforming at 31 bar and 503 K. The catalyst structure differs from the most energetically stable structure predicted by density functional theory (DFT) calculations for metallic Pt and Mo atoms. However, DFT indicates that for nano-particles composed of metallic Pt and Mo oxide, the Mo oxide is at the particle surface. Subsequent reduction would lead to the experimentally observed structure. The aqueous phase reforming reaction products and intermediates are consistent with both C-C and C-OH bond cleavage to generate H{sub 2}/CO{sub 2} or the side product CH{sub 4}. While the H{sub 2} selectivity at low conversion is about 75%, cleavage of C-OH bonds leads to liquid products with saturated carbon atoms. At high conversions (to gas), these will produced additional CH{sub 4} reducing the H{sub 2} yield and selectivity.

Stach E. A.; Dietrich, P.J.; Lobo-Lapidus, R.J.; Wu, T.; Sumer, A.; Akatay, M.C.; Fingland, B.R.; Guo, N.; Dumesic, J.A.; Marshall, C.L.; Jellinek, J.; Delgass, W.N.; Ribeiro, F.H.; Miller, J.T.

2012-03-01T23:59:59.000Z

264

Estudo das propriedades termomecnicas da liga cu 78,3% - al 9,8% mn 11,9%.  

E-Print Network (OSTI)

??The alloys Cu 78,3% - Al 9,8% - Mn 11,9 and 77.5% Cu - Al 9.8% - Mn 11,9% -% Nb 0.5 - 0.3% Ni (more)

Rafael Evaristo Calute

2012-01-01T23:59:59.000Z

265

Scanning tunneling microscopy reveals LiMnAs is a room temperature anti-ferromagnetic semiconductor  

SciTech Connect

We performed scanning tunneling microscopy and spectroscopy on a LiMnAs(001) thin film epitaxially grown on an InAs(001) substrate by molecular beam epitaxy. While the in situ cleavage exposed only the InAs(110) non-polar planes, the cleavage continued into the LiMnAs thin layer across several facets. We combined both topography and current mappings to confirm that the facets correspond to LiMnAs. By spectroscopy we show that LiMnAs has a band gap. The band gap evidenced in this study, combined with the known Neel temperature well above room temperature, confirms that LiMnAs is a promising candidate for exploring the concepts of high temperature semiconductor spintronics based on antiferromagnets.

Wijnheijmer, A. P.; Koenraad, P. M. [COBRA Inter-University Research Institute, Department of Applied Physics, Eindhoven University of Technology, P. O. Box 513, NL-5600 MB Eindhoven (Netherlands); Marti, X. [Faculty of Mathematics and Physics, Charles University in Prague, Ke Karlovu 3, 121 16 Prague 2 (Czech Republic); Institute of Physics ASCR, v.v.i., Cukrovarnicka 10, 162 53 Prague 6 (Czech Republic); Holy, V. [Faculty of Mathematics and Physics, Charles University in Prague, Ke Karlovu 3, 121 16 Prague 2 (Czech Republic); Cukr, M.; Novak, V. [Institute of Physics ASCR, v.v.i., Cukrovarnicka 10, 162 53 Prague 6 (Czech Republic); Jungwirth, T. [Institute of Physics ASCR, v.v.i., Cukrovarnicka 10, 162 53 Prague 6 (Czech Republic); School of Physics and Astronomy, University of Nottingham, Nottingham NG7 2RD (United Kingdom)

2012-03-12T23:59:59.000Z

266

Microstructural Analysis of Irradiated U-Mo Fuel Plates: Recent Results  

Science Conference Proceedings (OSTI)

Microstructural characterization of irradiated dispersion and monolithic RERTR fuel plates using scanning electron microscopy (SEM) is being performed in the Electron Microscopy Laboratory at the Idaho National Laboratory. The SEM analysis of samples from U-Mo dispersion fuel plates focuses primarily on the behavior of the Si that has been added to the Al matrix to improve the irradiation performance of the fuel plate and on the overall behavior of fission gases (e.g., Xe and Kr) that develop as bubbles in the fuel microstructure. For monolithic fuel plates, microstructural features of interest, include those found in the U-Mo foil and at the U-Mo/Zr and Zr/6061 Al cladding interfaces. For both dispersion and monolithic fuel plates, samples have been produced using an SEM equipped with a Focused Ion Beam (FIB). These samples are of very high quality and can be used to uncover some very unique microstructural features that are typically not observed when characterizing samples produced using more conventional techniques. Overall, for the dispersion fuel plates with matrices that contained Si, narrower fuel/matrix interaction layers are typically observed compared to the fuel plates with pure Al matrix, and for the monolithic fuel plates microstructural features have been observed in the U-10Mo foil that are similar to what have been observed in the fuel particles found in U-Mo dispersion fuels. Most recently, more prototypic monolithic fuel samples have been characterized and this paper describes the microstructures that have been observed in these samples.

D. D. Keiser, Jr.; J. Jue; B. D. Miller; J. Gan; A. B. Robinson; P. V. Medvedev

2012-03-01T23:59:59.000Z

267

Improvement of Thermal Stability of Li-Ion Batteries by Polymer Coating of LiMn2O4  

E-Print Network (OSTI)

lithium-ion battery by arresting the Mn + dissolution, thereby increasing the battery stability. Key Words: Lithium Battery, Cathode,

Stroeve, Pieter; Vidu, Ruxandra

2004-01-01T23:59:59.000Z

268

Microsoft Word - figure_8.doc  

Gasoline and Diesel Fuel Update (EIA)

T I D O R W Y ND SD C A N V U T CO NE KS A Z NM OK TX MN WI MI IA I L IN OH MO AR M S AL GA T N KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI A K J a p a n Mexico M e x...

269

Manganese trends in a sample of thin and thick disk stars. The origin of Mn  

E-Print Network (OSTI)

CONTEXT: Manganese is an iron-peak element and although the nucleosynthesis path that leads to its formation is fairly well understood, it remains unclear which objects, SN II and/or SN Ia, that contribute the majority of Mn to the interstellar medium. It also remains unclear to which extent the supernovae Mn yields depend on the metallicity of the progenitor star or not. AIMS: By using a well studied and well defined sample of 95 dwarf stars we aim at further constraining the formation site(s) of Mn. METHODS: We derive Mn abundances through spectral synthesis of four Mn I lines at 539.4, 549.2, 601.3, and 601.6 nm. Stellar parameters and data for oxygen are taken from Bensby et al. (2003, 2004, 2005). RESULTS: When comparing our Mn abundances with O abundances for the same stars we find that the abundance trends in the stars with kinematics of the thick disk can be explained by metallicity dependent yields from SN II. We go on and combine our data for dwarf stars in the disks with data for dwarf and giant stars in the metal-poor thick disk and halo from the literature. We find that dwarf and giant stars show the same trends, which indicates that neither non-LTE nor evolutionary effects are a major concern for Mn. Furthermore, the [Mn/O] vs [O/H] trend in the halo is flat. CONCLUSIONS: We conclude that the simplest interpretation of our data is that Mn is most likely produced in SN II and that the Mn yields for such SNae must be metallicity dependent. Contribution from SN Ia in the metal-rich thin disk can not, however, be excluded.

S. Feltzing; M. Fohlman; T. Bensby

2007-03-19T23:59:59.000Z

270

Category:Utility Rate Impacts on PV Economics By Location | Open Energy  

Open Energy Info (EERE)

Utility Rate Impacts on PV Economics By Location Utility Rate Impacts on PV Economics By Location Jump to: navigation, search Impact of Utility Rates on PV Economics Montgomery, AL Little Rock, AR Flagstaff, AZ Phoenix, AZ Tucson, AZ Arcata, CA LA, CA San Francisco, CA Boulder, CO Eagle County, CO Pueblo, CO Bridgeport, CT Wilmington, DE Miami, FL Tampa, FL Atlanta, GA Savannah, GA Des Moines, IA Mason, IA Boise, ID Chicago, IL Springfield, IL Indianapolis, IN Goodland, KS Wichita, KS Lexington, KY New Orleans, LA Shreveport, LA Boston, MA Baltimore, MD Caribou, ME Portland, ME Detroit, MI Houghton-Lake, MI Traverse City, MI International Falls, MN Minneapolis, MN Kansas City, MO Jackson, MS Billings, MT Greensboro, NC Wilmington, NC Bismarck, ND Minot, ND Omaha, NE Concord, NH Atlantic City, NJ Albuquerque, NM Las Vegas, NV Reno, NV New York, NY

271

Low temperature hydrothermally synthesized nanocrystalline orthorhombic LiMnO2 cathode material for lithium-ion cells  

Science Conference Proceedings (OSTI)

Nanocrystalline orthorhombic LiMnO2 particles with an average particle size of about 35 nm in diameter were successfully synthesized by a hydrothermal process at 160-180 C from trimanganese tetroxide (Mn3O4) prepared ... Keywords: hydrothermal process, lithium ion battery, nanocrystalline, orthorhombic LiMnO2, solvothermal process

Mengqiang Wu; Ai Chen; Rongqing Xu; Yue Li

2003-05-01T23:59:59.000Z

272

A rational self-sacrificing template route to LiMn2O4nanotubes and nanowires  

Science Conference Proceedings (OSTI)

Single-crystalline LiMn2O4 nanotubes and nanowires have been synthesized via a low-temperature molten salt synthesis method, using the prepared ?-MnO2 nanotubes and ?-MnO2 nanowires as the precursors ...

Baojun Yang; Xinsong Yuan; Duoli Chai

2011-01-01T23:59:59.000Z

273

Recrystallization behavior of a supersaturated Al Mn alloy  

SciTech Connect

The effect of concurrent precipitation on recrystallization behavior during the isothermal annealing of a supersaturated and deformed Al-Mn alloy was investigated. It is found that concurrent precipitation strongly affects the recrystallization behavior of this alloy. At low temperatures, concurrent precipitation retards recrystallization and results in large flat grains. The size of recrystallized grains decreases significantly with increasing temperature. The kinetics of recrystallization was determined by measurements of hardness. The JMAK exponent decreases from 3.0 to 0.8 as the annealing temperature increases from 371 C to 427 C. The activation energy for recrystallization of the alloy is about 456 kJ/mol. Concurrent precipitation enhances the activation energy for recrystallization of aluminum alloys.

Radhakrishnan, Balasubramaniam [ORNL; Liu, W C [Yanshan University

2010-01-01T23:59:59.000Z

274

Metalloantibiotic Mn(II)-bacitracin complex mimicking manganese superoxide dismutase  

SciTech Connect

Superoxide dismutase (SOD) activities of various metallobacitracin complexes were evaluated using the riboflavin-methionine-nitro blue tetrazolium assay. The radical scavenging activity of various metallobacitracin complexes was shown to be higher than those of the negative controls, e.g., free transition metal ions and metal-free bacitracin. The SOD activity of the complex was found to be in the order of Mn(II) > Cu(II) > Co(II) > Ni(II). Furthermore, the effect of bacitracin and their complexation to metals on various microorganisms was assessed by antibiotic susceptibility testing. Moreover, molecular modeling and quantum chemical calculation of the metallobacitracin complex was performed to evaluate the correlation of electrostatic charge of transition metal ions on the SOD activity.

Piacham, Theeraphon [Department of Clinical Microbiology, Faculty of Medical Technology, Mahidol University, Bangkok 10700 (Thailand); Pure and Applied Biochemistry, Chemical Center, Lund University, P.O. Box 124, 22100 Lund (Sweden); Isarankura-Na-Ayudhya, Chartchalerm [Department of Clinical Microbiology, Faculty of Medical Technology, Mahidol University, Bangkok 10700 (Thailand); Nantasenamat, Chanin [Department of Clinical Microbiology, Faculty of Medical Technology, Mahidol University, Bangkok 10700 (Thailand); Yainoy, Sakda [Department of Clinical Microbiology, Faculty of Medical Technology, Mahidol University, Bangkok 10700 (Thailand); Ye Lei [Pure and Applied Biochemistry, Chemical Center, Lund University, P.O. Box 124, 22100 Lund (Sweden); Buelow, Leif [Pure and Applied Biochemistry, Chemical Center, Lund University, P.O. Box 124, 22100 Lund (Sweden); Prachayasittikul, Virapong [Department of Clinical Microbiology, Faculty of Medical Technology, Mahidol University, Bangkok 10700 (Thailand)]. E-mail: mtvpr@mucc.mahidol.ac.th

2006-03-24T23:59:59.000Z

275

Unprecedented {sup 1}/{sub {infinity}}[{beta}-Mo{sub 8}O{sub 26}]{sup 4-} polymeric chains and four novel organic-inorganic hybrids based on Mo-POMs and azaheterocycles templates  

Science Conference Proceedings (OSTI)

Abstrct: Four novel organic-inorganic hybrid materials based on Mo-POMs and organic templates, namely [DEB] [{beta}-Mo{sub 8}O{sub 26}] [NH{sub 4}]{sub 2} (1), [BMIM] [{beta}-Mo{sub 8}O{sub 26}]{sub 0.5}{center_dot}H{sub 2}O (2), [BMIM] [1D-Mo{sub 8}O{sub 26}]{sub 0.5} (3) and {l_brace}3D-[Cu(DIE){sub 2}] [1D-Mo{sub 8}O{sub 26}]{sub 0.5}{r_brace}{sub {infinity}} (4) [DEB= 1,1 Prime -diethyl-4,4 Prime -bipyridinium, BMIM=1,1 Prime -bis(1-methylimidazolium)methylene, DIE=1,2-diimidazoloethane] have been hydrothermally synthesized and characterized by elemental analyses, IR spectroscopy, thermal gravimetric analysis(TGA) and single-crystal X-ray diffraction. Both compounds 1 and 2 are POMs-based supramolecular compounds consisted of independent [{beta}-Mo{sub 8}O{sub 26}]{sup 4-} anions and [DEB]{sup 2+} or [BMIM]{sup 2+} organic cations. Compound 3 is the first external template example of Mo-POMs-based supramolecular network incorporated with novel {sup 1}/{sub {infinity}}[{beta}-Mo{sub 8}O{sub 26}]{sup 4-} polymeric chains. Compound 4 is a rare supramolecular structure that contains octamolybdate {sup 1}/{sub {infinity}}[{beta}-Mo{sub 8}O{sub 26}]{sup 4-} polymeric chains interconnected via DIE ligands to form a 3D net. Moreover, it was indicated that these polyacid compounds had definite catalytic activities on the probe reaction of acetaldehyde oxidation to acetic acid with H{sub 2}O{sub 2}. - Graphical abstract: Four novel organic templated polyoxometalates comprising of 0D, 1D and 3D supramolecular frameworks together with the catalytic activities on the acetaldehyde oxidation to acetic acid were reported. Highlights: Using cation templated self-assembly four novel polyoxometalates were prepared. Compounds 1 and 2 consisted of independent [{beta}-Mo{sub 8}O{sub 26}]{sup 4-} anions and organic cations. Compound 3 is the first external template-assisted POMs with {sup 1}/{sub {infinity}}[{beta}-Mo{sub 8}O{sub 26}]{sup 4-} chain. Compound 4 is a rare 3D net containing {sup 1}/{sub {infinity}}[{beta}-Mo{sub 8}O{sub 26}]{sup 4-} 1D chain and DIE ligands. These compounds had definite catalytic activities on the acetaldehyde oxidation.

Du Haijuan; Zunzhe Shu [College of Chemistry and Molecular Engineering, Zhengzhou University, Zhengzhou 450001 (China); Niu Yunyin, E-mail: niuyy@zzu.edu.cn [College of Chemistry and Molecular Engineering, Zhengzhou University, Zhengzhou 450001 (China); Song Lisha; Zhu Yu [College of Chemistry and Molecular Engineering, Zhengzhou University, Zhengzhou 450001 (China)

2012-06-15T23:59:59.000Z

276

Microstructural Characterization of U-7Mo/Al-Si Alloy Matrix Dispersion Fuel Plates Fabricated at 500C  

Science Conference Proceedings (OSTI)

The starting microstructure of a dispersion fuel plate will impact the overall performance of the plate during irradiation. To improve the understanding of the as-fabricated microstructures of UMo dispersion fuel plates, particularly the interaction layers that can form between the fuel particles and the matrix, scanning electron microscopy (SEM) and transmission electron microscopy (TEM) analyses have been performed on samples from depleted U7Mo (U7Mo) dispersion fuel plates with either Al2 wt.% Si(Al2Si) or AA4043 alloy matrix. It was observed that in the thick interaction layers, U(Al, Si)3 and U6Mo4Al43 were present, and in the thin interaction layers, (U, Mo) (Al, Si)3, U(Al, Si)4, U3Si3Al2, U3Si5, and possibly USi-type phases were observed. The U3Si3Al2 phase contained some Mo. Based on the results of this investigation, the time that a dispersion fuel plate is exposed to a relatively high temperature during fabrication will impact the nature of the interaction layers around the fuel particles. Uniformly thin, Si-rich layers will develop around the U7Mo particles for shorter exposure times, and thicker, Si-depleted layers will develop for the longer exposure times.

Dennis D. Keiser, Jr.; Jan-Fong Jue; Bo Yao; Emmanuel Perez; Yongho Sohn; Curtis R. Clark

2011-05-01T23:59:59.000Z

277

Interfacial studies of a thin-film Li2Mn4O9 electrode  

NLE Websites -- All DOE Office Websites (Extended Search)

Interfacial studies of a thin-film Li2Mn4O9 electrode Interfacial studies of a thin-film Li2Mn4O9 electrode Title Interfacial studies of a thin-film Li2Mn4O9 electrode Publication Type Journal Article Year of Publication 1999 Authors Kostecki, Robert, Fanping Kong, Yoshiaki Matsuo, and Frank R. McLarnon Journal Electrochimica Acta Volume 45 Pagination 225-233 Keywords interfacial films, manganese oxide electrode Abstract A thin-film spinel Li2Mn4O9 electrode was prepared by spin coating onto a Pt substrate. Spectroscopic ellipsometry, X-ray diffraction and current-sensing atomic force microscopy (CSAFM) were used to characterize interfacial processes and film formation at this electrode in the presence of 1.0 M LiPF6, EC:DMC (1:1 by volume) electrolyte. Prolonged exposure of the film to the electrolyte at ambient temperature resulted in spontaneous decomposition of the spinel to λ-MnO2 without disruption of the original structure. The surface of the resulting λ-MnO2 film exhibited no significant change in morphology, however a thin passive electrode surface layer was detected by the CSAFM probe. This electrode surface layer exhibited insulating properties and most likely contained Li2O, a by-product of Li2Mn4O9 decomposition.

278

Ferromagnetism in Mn-Implanted Epitaxially Grown Ge on Si(100)  

SciTech Connect

We have studied ferromagnetism of Mn-implanted epitaxial Ge films on silicon. The Ge films were grown by ultrahigh vacuum chemical vapor deposition using a mixture of germane (GeH{sub 4}) and methylgermane (CH{sub 3}GeH{sub 3}) gases with a carbon concentration of less than 1 at. %, and observed surface rms roughness of 0.5 nm, as measured by atomic force microscopy. Manganese ions were implanted in epitaxial Ge films grown on Si (100) wafers to an effective concentration of 16, 12, 6, and 2 at. %. Superconducting quantum interference device measurements showed that only the three highest Mn concentration samples are ferromagnetic, while the fourth sample, with [Mn] = 2 at. %, is paramagnetic. X-ray absorption spectroscopy and x-ray magnetic circular dichroism measurements indicate that localized Mn moments are ferromagnetically coupled below the Curie temperature. Isothermal annealing of Mn-implanted Ge films with [Mn] = 16 at. % at 300 C for up to 1200 s decreases the magnetization but does not change the Curie temperature, suggesting that the amount of the magnetic phase slowly decreases with time at this anneal temperature. Furthermore, transmission electron microscopy and synchrotron grazing incidence x-ray diffraction experiments show that the Mn-implanted region is amorphous, and we believe that it is this phase that is responsible for the ferromagnetism. This is supported by our observation that high-temperature annealing leads to recrystallization and transformation of the material into a paramagnetic phase.

Guchhait, S.; Jamil, M.; Ohldag, H.; Mehta, A.; Arenholz, E.; Lian, G.; Li Fatou, A.; Ferrer, D. A.; Markert, J. T.; Colombo, L.; Banerjee, S. K.

2011-01-05T23:59:59.000Z

279

Energy Transfer Dynamics and Dopant Luminescence in Mn-Doped CdS/ZnS Core/Shell Nanocrystals  

E-Print Network (OSTI)

Mn-doped II-VI semiconductor nanocrystals exhibit bright dopant photoluminescence that has potential usefulness for light emitting devices, temperature sensing, and biological imaging. The bright luminescence comes from the 4T1?6A1 transition of the Mn2+ d electrons after the exciton-dopant energy transfer, which reroutes the exciton relaxation through trapping processes. The driving force of the energy transfer is the strong exchange coupling between the exciton and Mn2+ due to the confinement of exciton in the nanocrystal. The exciton-Mn spatial overlap affecting the exchange coupling strength is an important parameter that varies the energy transfer rate and the quantum yield of Mn luminescence. In this dissertation, this correlation is studied in radial doping location-controlled Mn-doped CdS/ZnS nanocrystals. Energy transfer rate was found decreasing when increasing the doping radius in the nanocrystals at the same core size and shell thickness and when increasing the size of the nanocrystals at a fixed doping radius. In addition to the exciton-Mn energy transfer discussed above, two consecutive exciton-Mn energy transfers can also occur if multiple excitons are generated before the relaxation of Mn (lifetime ~10^-4 - 10^-2 s). The consecutive exciton-Mn energy transfer can further excite the Mn2+ d electrons high in conduction band and results in the quenching of Mn luminescence. The highly excited electrons show higher photocatalytic efficiency than the electrons in undoped nanocrystals. Finally, the effect of local lattice strain on the local vibrational frequency and local thermal expansion was observed via the temperature-dependent Mn luminescence spectral linewidth and peak position in Mn-doped CdS/ZnS nanocrystals. The local lattice strain on the Mn2+ ions is varied using the large core/shell lattice mismatch (~7%) that creates a gradient of lattice strain at various radial locations. When doping the Mn2+ closer to the core/shell interface, the stronger lattice strain softens the vibrational frequency coupled to the 4T1?6A1 transition of Mn2+ (Mn luminescence) by ~50%. In addition, the lattice strain also increases the anharmonicity, resulting in larger local thermal expansion observed from the nearly an order larger thermal shift of the Mn luminescence compared to the Mn-doped ZnS nanocrystals without the core/shell lattice mismatch.

Chen, Hsiang-Yun

2012-12-01T23:59:59.000Z

280

Ni spin switching induced by magnetic frustration in FeMn/Ni/Cu(001)  

SciTech Connect

Epitaxially grown FeMn/Ni/Cu(001) films are investigated by Photoemission Electron Microscopy and Magneto-Optic Kerr Effect. We find that as the FeMn overlayer changes from paramagnetic to antiferromagnetic state, it could switch the ferromagnetic Ni spin direction from out-of-plane to in-plane direction of the film. This phenomenon reveals a new mechanism of creating magnetic anisotropy and is attributed to the out-of-plane spin frustration at the FeMn-Ni interface.

Wu, J.; Choi, J.; Scholl, A.; Doran, A.; Arenholz, E.; Hwang, Chanyong; Qiu, Z. Q.

2009-03-08T23:59:59.000Z

Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Quantum Anomalous Hall Effect in Hg_1-yMn_yTe Quantum Wells  

SciTech Connect

The quantum Hall effect is usually observed when the two-dimensional electron gas is subjected to an external magnetic field, so that their quantum states form Landau levels. In this work we predict that a new phenomenon, the quantum anomalous Hall effect, can be realized in Hg{sub 1-y}Mn{sub y}Te quantum wells, without the external magnetic field and the associated Landau levels. This effect arises purely from the spin polarization of the Mn atoms, and the quantized Hall conductance is predicted for a range of quantum well thickness and the concentration of the Mn atoms. This effect enables dissipationless charge current in spintronics devices.

Liu, Chao-Xing; /Tsinghua U., Beijing /Stanford U., Phys. Dept.; Qi, Xiao-Liang; /Stanford U., Phys. Dept.; Dai, Xi; Fang, Zhong; /Beijing, Inst. Phys.; Zhang, Shou-Cheng; /Stanford U., Phys. Dept.

2010-03-19T23:59:59.000Z

282

Demonstration of molecular beam epitaxy and a semiconducting band structure for I-Mn-V compounds  

SciTech Connect

Our ab initio theory calculations predict a semiconducting band structure of I-Mn-V compounds. We demonstrate on LiMnAs that high-quality materials with group-I alkali metals in the crystal structure can be grown by molecular beam epitaxy. Optical measurements on the LiMnAs epilayers are consistent with the theoretical electronic structure. Our calculations also reproduce earlier reports of high antiferromagnetic ordering temperature and predict large, spin-orbit-coupling-induced magnetic anisotropy effects. We propose a strategy for employing antiferromagnetic semiconductors in high-temperature semiconductor spintronics.

Jungwirth, T. [Institute of Physics ASCR, v.v.i., Cukrovarnicka 10, 162 53 Praha 6 (Czech Republic); School of Physics and Astronomy, University of Nottingham, Nottingham NG7 2RD (United Kingdom); Novak, V.; Cukr, M.; Zemek, J. [Institute of Physics ASCR, v.v.i., Cukrovarnicka 10, 162 53 Praha 6 (Czech Republic); Marti, X.; Horodyska, P.; Nemec, P.; Holy, V. [Faculty of Mathematics and Physics, Charles University in Prague, Ke Karlovu 3, 121 16 Prague 2 (Czech Republic); Maca, F.; Shick, A. B.; Masek, J.; Kuzel, P. [Institute of Physics ASCR, v.v.i., Na Slovance 2, 182 21 Praha 8 (Czech Republic); Nemec, I. [Faculty of Science, Charles University in Prague, Hlavova 2030, 128 40 Prague 2 (Czech Republic); Gallagher, B. L.; Campion, R. P.; Foxon, C. T. [School of Physics and Astronomy, University of Nottingham, Nottingham NG7 2RD (United Kingdom); Wunderlich, J. [Institute of Physics ASCR, v.v.i., Cukrovarnicka 10, 162 53 Praha 6 (Czech Republic); Hitachi Cambridge Laboratory, Cambridge CB3 0HE (United Kingdom)

2011-01-15T23:59:59.000Z

283

File:USDA-CE-Production-GIFmaps-MO.pdf | Open Energy Information  

Open Energy Info (EERE)

MO.pdf MO.pdf Jump to: navigation, search File File history File usage Missouri Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 377 KB, MIME type: application/pdf) Description Missouri Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Missouri External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,650 × 1,275 (377 KB) MapBot (Talk | contribs) Automated bot upload

284

Laser Welding and Post Weld Treatment of Modified 9Cr-1MoVNb Steel [Laser  

NLE Websites -- All DOE Office Websites (Extended Search)

Laser Welding of Metals > Laser Welding of Metals > Laser Welding and Post Weld Treatment of Modified 9Cr-1MoVNb Steel Capabilities Engineering Experimentation Reactor Safety Experimentation Aerosol Experiments System Components Laser Applications Overview Laser Oil & Gas Well Drilling Laser Heat Treatment Laser Welding of Metals On-line Monitoring Laser Beam Delivery Laser Glazing of Railroad Rails High Power Laser Beam Delivery Decontamination and Decommissioning Refractory Alloy Welding Robots Applications Other Facilities Other Capabilities Work with Argonne Contact us For Employees Site Map Help Join us on Facebook Follow us on Twitter NE on Flickr Laser Applications Laboratory Laser Welding of Metals Laser Welding and Post Weld Treatment of Modified 9Cr-1MoVNb Steel Zhiyue Xu Nuclear Engineering Division of Argonne National Laboratory

285

Improved performance of U-Mo dispersion fuel by Si addition in Al matrix.  

SciTech Connect

The purpose of this report is to collect in one publication and fit together work fragments presented in many conferences in the multi-year time span starting 2002 to the present dealing with the problem of large pore formation in U-Mo/Al dispersion fuel plates first observed in 2002. Hence, this report summarizes the excerpts from papers and reports on how we interpreted the relevant results from out-of-pile and in-pile tests and how this problem was dealt with. This report also provides a refined view to explain in detail and in a quantitative manner the underlying mechanism of the role of silicon in improving the irradiation performance of U-Mo/Al.

Kim, Y S; Hofman, G L [Nuclear Engineering Division

2011-06-01T23:59:59.000Z

286

Mo-6%Nb single crystal alloy creep strength demonstration for long life thermionic power systems  

DOE Green Energy (OSTI)

Experimental results of one- and two-dimensional creep testing for single crystal Mo-6%Nb alloy are presented. Three 1-D specimens were creep-tested for up to 3000 hours at 1873 to 1973 K and 5 to 15 MPa. One 2-D specimen tube was creep-tested for 2000 hours at 1873 K/15MPa. Results confirm the high creep strength of Mo-6%Nb for long life (10 to 15 year) TFE emitter application in thermionic space nuclear power systems. After the initial transition stage (about 1000 hours), quasi-steady state 1-D and 2-D creep rates were within 20% of each other suggesting little significant effect of anisotropy. More data points will be needed to define the Sherby-Dom parameters with statistical accuracy. {copyright} 1995 {ital American} {ital Institute} {ital of} {ital Physics}

Rhee, H.S.; Zheng, C.; Kent Koester, J. [Space Power, Inc., 621 River Oaks Parkway, San Jose, California 95134 (United States); Yastrebkov, A.; Nikolaev, Y.; Gontar, A. [Scientific Industrial Association Lutch, Podolsk, Moscow Region (Russian Federation)

1995-01-20T23:59:59.000Z

287

Continuing investigations for technology assessment of /sup 99/Mo production from LEU (low enriched Uranium) targets  

SciTech Connect

Currently much of the world's supply of /sup 99m/Tc for medical purposes is produced from /sup 99/Mo derived from the fissioning of high enriched uranium (HEU). The need for /sup 99m/Tc is continuing to grow, especially in developing countries, where needs and national priorities call for internal production of /sup 99/Mo. This paper presents the results of our continuing studies on the effects of substituting low enriched Uranium (LEU) for HEU in targets for the production of fission product /sup 99/Mo. Improvements in the electrodeposition of thin films of uranium metal are reported. These improvements continue to increase the appeal for the substitution of LEU metal for HEU oxide films in cylindrical targets. The process is effective for targets fabricated from stainless steel or hastaloy. A cost estimate for setting up the necessary equipment to electrodeposit uranium metal on cylindrical targets is reported. Further investigations on the effect of LEU substitution on processing of these targets are also reported. Substitution of uranium silicides for the uranium-aluminum alloy or uranium aluminide dispersed fuel used in other current target designs will allow the substitution of LEU for HEU in these targets with equivalent /sup 99/Mo-yield per target and no change in target geometries. However, this substitution will require modifications in current processing steps due to (1) the insolubility of uranium silicides in alkaline solutions and (2) the presence of significant quantities of silicate in solution. Results to date suggest that both concerns can be handled and that substitution of LEU for HEU can be achieved.

Vandergrift, G.F.; Kwok, J.D.; Marshall, S.L.; Vissers, D.R.; Matos, J.E.

1987-01-01T23:59:59.000Z

288

Production and Characterization of Atomized U-Mo Powder by the Rotating Electrode Process  

SciTech Connect

In order to produce feedstock fuel powder for irradiation testing, the Idaho National Laboratory has produced a rotating electrode type atomizer to fabricate uranium-molybdenum alloy fuel. Operating with the appropriate parameters, this laboratory-scale atomizer produces fuel in the desired size range for the RERTR dispersion experiments. Analysis of the powder shows a homogenous, rapidly solidified microstructure with fine equiaxed grains. This powder has been used to produce irradiation experiments to further test adjusted matrix U-Mo dispersion fuel.

C.R. Clark; B.R. Muntifering; J.F. Jue

2007-09-01T23:59:59.000Z

289

High strength Sn-Mo-Nb-Zr alloy tubes and method of making same  

DOE Patents (OSTI)

Tubes for use in nuclear reactors fabricated from a quaternary alloy comprising 2.5-4.0 wt% Sn, 0.5-1.5 wt% Mo, 0.5-1.5 wt% Nb, balance essentially Zr. The tubes are fabricated by a process of hot extrusion, heat treatment, cold working to size and age hardening, so as to produce a microstructure comprising elongated .alpha. grains with an acicular transformed .beta. grain boundary phase.

Cheadle, Brian A. (Deep River, CA)

1977-01-01T23:59:59.000Z

290

Anomalous Stoichiometry Layered Structure and Magnetic Ordering of the Prussian Blue Analog [NEt4]2MnII3(CN)8  

Science Conference Proceedings (OSTI)

Atypical of Prussian blue structured materials, Mn{sup II} and [NEt{sub 4}]CN react to form [NEt{sub 4}]{sub 2}Mn{sub 3}(CN){sub 8} possessing layers of octahedral [Mn{sup II}(CN){sub 6}]{sup 4-} bonded to two high-spin tetrahedral Mn{sup II} sites.

J Her; P Stephens; C Kareis; J Moore; J Miller

2011-12-31T23:59:59.000Z

291

Electrical tuning of valley magnetic moment through symmetry control in bilayer MoS2  

SciTech Connect

Crystal symmetry governs the nature of electronic Bloch states. For example, in the presence of time-reversal symmetry, the orbital magnetic moment and Berry curvature of the Bloch states must vanish unless inversion symmetry is broken1. In certain two-dimensional electron systems such as bilayer graphene, the intrinsic inversion symmetry can be broken simply by applying a perpendicular electric field2,3. In principle, this offers the possibility of switching on/off and continuously tuning the magnetic moment and Berry curvature near the Dirac valleys by reversible electrical control4,5. Here we investigate this possibility using polarization-resolved photoluminescence of bilayer MoS2, which has the same symmetry as bilayer graphene but has a bandgap in the visible spectrum6,7 allowing direct optical probing5,8 12. We find that in bilayer MoS2 the circularly polarized photoluminescence can be continuously tuned from 15% to 15% as a function of gate voltage, whereas in structurally non-centrosymmetric monolayer MoS2 the photoluminescence polarization is gate independent. The observations are well explained as resulting from the continuous variation of orbital magnetic moments between positive and negative values through symmetry control.

Wu, Sanfeng [University of Washington, Seattle; Ross, Jason [University of Washington, Seattle; Liu, G. B. [University of Hong Kong, The; Aivazian, Grant [University of Washington, Seattle; Jones, Aaron [University of Washington, Seattle; Fei, Zaiyao [University of Washington, Dept Phys, Seattle, WA; Zhu, Wenguang [University of Tennessee, Knoxville (UTK); Xiao, Di [ORNL; Yao, Wang [University of Hong Kong, The; Cobden, David [University of Washington, Dept Phys, Seattle, WA; Xu, Xiaodong [University of Washington

2013-01-01T23:59:59.000Z

292

Ni6Cr5MoO18: A compensated half metal predicted from first-principles  

Science Conference Proceedings (OSTI)

NiCrO3 is semiconducting. It contains six molecular units in the conventional cell. By substituting one of the six Cr atoms with Mo in the conventional cell

Jing Wang; Ningning Zu; Zhijian Wu

2013-01-01T23:59:59.000Z

293

Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available

2011-10-01T23:59:59.000Z

294

Electrical properties of a-C:Mo films produced by dual-cathode filtered cathodic arc plasma deposition  

SciTech Connect

Molybdenum-containing amorphous carbon (a-C:Mo) thin films were prepared using a dual-cathode filtered cathodic arc plasma source with a molybdenum and a carbon (graphite) cathode. The Mo content in the films was controlled by varying the deposition pulse ratio of Mo and C. Film sheet resistance was measured in situ at process temperature, which was close to room temperature, as well as ex situ as a function of temperature (300-515 K) in ambient air. Film resistivity and electrical activation energy were derived for different Mo and C ratios and substrate bias. Film thickness was in the range 8-28 nm. Film resistivity varied from 3.55x10-4 Omega m to 2.27x10-6 Omega m when the Mo/C pulse ratio was increased from 0.05 to 0.4, with no substrate bias applied. With carbon-selective bias, the film resistivity was in the range of 4.59x10-2 and 4.05 Omega m at a Mo/C pulse ratio of 0.05. The electrical activation energy decreased from 3.80x10-2 to 3.36x10-4 eV when the Mo/C pulse ratio was increased in the absence of bias, and from 0.19 to 0.14 eV for carbon-selective bias conditions. The resistivity of the film shifts systematically with the amounts of Mo and upon application of substrate bias voltage. The intensity ratio of the Raman D-peak and G-peak (ID/IG) correlated with the pre-exponential factor (sigma 0) which included charge carrier density and density of states.

Sansongsiri, Sakon; Anders, Andre; Yodsombat, Banchob

2008-01-20T23:59:59.000Z

295

Characterization of LiNi?.?Mn?.?O? Thin Film Cathode Prepared by Pulsed Laser Deposition  

E-Print Network (OSTI)

LiNi?.?Mn?.?O? thin films have been grown by pulsed laser deposition (PLD) on stainless steel (SS) substrates. The crystallinity and structure of thin films were investigated by X-ray diffraction (XRD). Microstructure and ...

Xia, Hui

296

D11: Thermodynamic and Electrochemical Properties of the Mg-Mn ...  

Science Conference Proceedings (OSTI)

B7: Synthesis and Electrical Properties of K2NiF4-Type (Ca2-xLnx)MnO4 (Ln=Nd and Sm) B8: Monitoring Oxygen Diffusion in Gd-Doped Ceria by Null...

297

100- The Effect of Mn and Pr Co-Doping on Electrical Properties of ...  

Science Conference Proceedings (OSTI)

144- The Role of Mn Content on Microstructure and Phases of High Alloyed White Cast Irons 145- The Synergy of XRD and XRF in a Shale and Slate Analysis.

298

Southwest MN IPM STUFF All the pestilence that's fit to print  

E-Print Network (OSTI)

and soybeans during hot dry weather. Twospotted spider mites are favored by high temperatures and drought Southwest Research and Outreach Center 23669 130th Street Lamberton, MN 56152 Phone: 507.752.5066 Cell: 507

Amin, S. Massoud

299

Southwest MN IPM STUFF All the pestilence that's fit to print  

E-Print Network (OSTI)

started to show up. This could be a bad year for this disease. Cool wet spring and hot, dry late seasons Research and Outreach Center 23669 130th Street Lamberton, MN 56152 Phone: 507.752.5066 Cell: 507

Amin, S. Massoud

300

Formation of nano-crystalline todorokite from biogenic Mn Xiong Han Feng a,1  

E-Print Network (OSTI)

Formation of nano-crystalline todorokite from biogenic Mn oxides Xiong Han Feng a,1 , Mengqiang Zhu oxides in the environment. Additionally this method may be a viable biosynthesis route for porous, nano

Sparks, Donald L.

Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Mn solid solutions in self-assembled Ge/Si (001) quantum dot heterostructures  

SciTech Connect

Heteroepitaxial Ge{sub 0.98}Mn{sub 0.02} quantum dots (QDs) on Si (001) were grown by molecular beam epitaxy. The standard Ge wetting layer-hut-dome-superdome sequence was observed, with no indicators of second phase formation in the surface morphology. We show that Mn forms a dilute solid solution in the Ge quantum dot layer, and a significant fraction of the Mn partitions into a sparse array of buried, Mn-enriched silicide precipitates directly underneath a fraction of the Ge superdomes. The magnetic response from the ultra-thin film indicates the absence of robust room temperature ferromagnetism, perhaps due to anomalous intermixing of Si into the Ge quantum dots.

Kassim, J.; Nolph, C.; Reinke, P.; Floro, J. [Department of Materials Science and Engineering, University of Virginia, Charlottesville, Virginia 22904 (United States); Jamet, M. [Institut Nanosciences et Cryogenie/SP2M, CEA-UJF, F-38054 Grenoble (France)

2012-12-10T23:59:59.000Z

302

Synthesis, characterization, and microwave-absorbing properties of polypyrrole/MnFe2O4 nanocomposite  

Science Conference Proceedings (OSTI)

Conductive polypyrrole (PPy)-manganese ferrite (MnFe2O4) nanocomposites with core-shell structure were synthesized by in situ polymerization in the presence of dodecyl benzene sulfonic acid (DBSA) as the surfactant and dopant and ...

Seyed Hossein Hosseini; Ahmad Asadnia

2012-01-01T23:59:59.000Z

303

Aliovalent titanium substitution in layered mixed Li Ni-Mn-Co oxides for lithium battery applications  

Science Conference Proceedings (OSTI)

Improved electrochemical characteristics are observed for Li[Ni1/3Co1/3-yMyMn1/3]O2 cathode materials when M=Ti and ycapacity.

Kam, Kinson; Doeff, Marca M.

2010-12-01T23:59:59.000Z

304

Electrophysical properties of semimagnetic solid solutions Hg 1?x Mn x Te  

Science Conference Proceedings (OSTI)

A comprehensive study of the electrophysical properties of the semimagnetic ternary solid solution Hg 1?x Mn x Te an alternative material to Hg 1?x Cd x Te is reported. The charge-carrier scattering

I. M. Nesmelova; V. N. Ryzhkov; M. I. Ibragimova; V. Yu. PetukhovKazan Physicotechnical Institute, Kazan Research Center of the Russian Academy of Sciences, Kazan?420029, Russia

2004-01-01T23:59:59.000Z

305

Spin current switching and spin-filtering effects in Mn-doped boron nitride nanoribbons  

Science Conference Proceedings (OSTI)

The spin transport properties are investigated by means of the first principle approach for boron nitride nanoribbons with one or two substitutional Mn impurities, connected to graphene electrodes. The spin current polarization is evaluated using the ...

G. A. Nemnes

2012-01-01T23:59:59.000Z

306

Mn Monolayer Modified Rh for Syngas-to-Ethanol Conversion: A First-Principles Study  

SciTech Connect

Rh is unique in its ability to convert syngas to ethanol with the help of promoters. We performed systematic first-principles computations to examine the catalytic performance of pure and Mn modified Rh(100) surfaces for ethanol formation from syngas. CO dissociation on the surface as well as CO insertion between the chemisorbed CH{sub 3} and the surface are the two key steps. The CO dissociation barrier on the Mn monolayer modified Rh(100) surface is remarkably lowered by {approx}1.5 eV compared to that on Rh(100). Moreover, the reaction barrier of CO insertion into the chemisorbed CH{sub 3} group on the Mn monolayer modified Rh(100) surface is 0.34 eV lower than that of methane formation. Thus the present work provides new mechanistic insight into the role of Mn promoters in improving Rh's selectivity to convert syngas to ethanol.

Li, Fengyu [University of Puerto Rico; Jiang, Deen [ORNL; Zeng, X.C. [University of Nebraska, Lincoln; Chen, Zhongfang [University of Puerto Rico

2012-01-01T23:59:59.000Z

307

TEM Characterization of U-7Mo/Al-2Si Dispersion Fuel Irradiated to Intermediate and High Fission Densities  

SciTech Connect

This paper will discuss the results of TEM analysis that was performed on two samples taken from the low flux and high flux sides of the fuel plate with U-7Mo fuel particles dispersed in U-2Si matrix. The corresponding local fission density of the fuel particles and the peak fuel plate centerline temperature between the low flux and high flux samples are 3.32 x 10{sup 27} f/m{sup 3} and 90 C, and 6.31 x 10{sup 27} f/m{sup 3} and 120 C, respectively. The results of this work showed the presence of a bubble superlattice within the U-7Mo grains that accommodated fission gases (e.g., Xe). The presence of this structure helps the U-7Mo exhibit a stable swelling behavior during irradiation. The Si-rich interaction layers that develop around the fuel particles at the U-7Mo/matrix interface during fuel plate fabrication and irradiation become amorphous during irradiation. The change in bubble distribution at the high fission density suggests that the bubble superlattice is stable as the U-7Mo matrix remains crystalline. It appears that there is a threshold Si content in the fuel particle above which the U-Mo turns to amorphous under irradiation. The threshold Si content is approximately 8 at.% and 4 at.% for low flux and high flux condition, respectively.

J. Gan; D.D. Keiser, Jr.; B.D. Miller; A.B. Robinson; J-F. Jue; P.G. Medvedev; D.M. Wachs

2012-05-01T23:59:59.000Z

308

Building of a Novel Mn12 Single Molecule Magnet by Assembly of Anisotropic  

NLE Websites -- All DOE Office Websites (Extended Search)

Building of a Novel Mn12 Single Building of a Novel Mn12 Single Molecule Magnet by Assembly of Anisotropic Triangles Building of a Novel Mn12 Single Molecule Magnet by Assembly of Anisotropic Triangles Print Wednesday, 06 July 2011 12:58 Assembly of triangular {MnIII3(O)(salox)3}+ fragments mediated by azido ligands, results in the dodecanuclear [Mn12O4(salox)12(N3)4(MeOH)4(H2O)2] complex with S = 8 ground state and SMM response. After the discovery of the Single-Molecule-Magnet (SMM) behaviour of [Mn6(O)2(salox)6(R-COO)2] (salox = salicylaldoxime, R = Me, Ph) complexes in 2004,1 the chemistry of this family of [Mn6] clusters has been studied in depth: the systematic change of the carboxylato ligands, the study of substitutedR-saloxH2 related ligands,2 the effect of variation of the oxidation state,3 the response under pressure4 or the one-dimensional assembly of [Mn6] units into chains of clusters5 with Single-Chain-Magnet behaviour in some cases,5c,d turn this system into one of the best known in the SMM field. One of the main goals of this work, developed by Brechin et al. has been to modulate the value of the ground spin level, reaching the maximum possible spin S = 12 by means of the adequate choice of methyl or ethyl substituted salicylaldoximes and the understanding of the structural features that control the coupling inside the triangles. Article Link (PDF)

309

NEUTRON DIFFRACTION STUDY OF A NON-STOICHIOMETRIC Ni-Mn-Ga MSM ALLOY  

SciTech Connect

The structure and chemical order of a Heusler alloy of non-stoichiometric composition Ni-Mn-Ga were studied using constant-wavelength (1.538 ) neutron diffraction at 363K and the diffraction pattern was refined using the FullProf software. At this temperature the structure is austenite (cubic) with Fm-3m space group and lattice constant of a = 5.83913(4) [ ]. The chemical order is of critical importance in these alloys, as Mn becomes antiferromagnetic when the atoms are closer than the radius of the 3d shell. In the studied alloy the refinement of the site occupancy showed that the 4b (Ga site) contained as much as 22% Mn; that significantly alters the distances between the Mn atoms in the crystal and, as a result, also the exchange energy between some of the Mn atoms. Based on the refinement, the composition was determined to be Ni1.91Mn1.29Ga0.8

Ari-Gur, Pnina [Western Michigan University; Garlea, Vasile O [ORNL

2013-01-01T23:59:59.000Z

310

Mkha' 'gro dbang mo'i rnam that, the biography of the gter ston ma bde chen chos kyi dbang mo (1868-1927?)  

E-Print Network (OSTI)

, for example, A 'dzom 'Brug pa 'Gro 'dul dPa' bo rDo rje (1842-1924), a famous rdzogs chen master and treasure revealer (see Namkhai 1986, p. 153), who bestowed upon her a long life empowerment when she was 26 (1893); see dBang mo'i rnam thar, p. 824, passim... , Kvrne and Nagano eds., 2003, p. 323), gCod, A khrid (see Kvrne and Rikey, 1996), Phur pa (see Bon Kanjur, op.cit., pp. 295-297), rDzogs chen Yang rtse Klong chen (Sherab Wangyal, TBMC, New Delhi, 1973), Khro bo rGyud drug gSang ba bSen thub (see Bon...

Rossi, Donatella

2008-01-01T23:59:59.000Z

311

A practical grinding-assisted dry synthesis of nanocrystalline NiMoO{sub 4} polymorphs for oxidative dehydrogenation of propane  

Science Conference Proceedings (OSTI)

A practical two-stage reactive grinding-assisted pathway waste-free and cost-effective for the synthesis of NiMoO{sub 4} has been successfully developed. It was demonstrated that proper design in synthetic strategy for grinding plays a crucial role in determining the ultimate polymorph of NiMoO{sub 4}. Specifically, direct grinding (DG) of MoO{sub 3} and NiO rendered {alpha}-NiMoO{sub 4} after annealing, whereas sequential grinding (SG) of the two independently pre-ground oxides followed by annealing generated {beta}-NiMoO{sub 4} solid solution. Characterizations in terms of Raman and X-ray diffraction suggest the creation of {beta}-NiMoO{sub 4} precursor in the latter alternative is the key aspect for the formation of {beta}-NiMoO{sub 4}. The DG-derived {alpha}-NiMoO{sub 4} tested by oxidative dehydrogenation of propane exhibited superior activity in contrast to its analog synthesized via conventional coprecipitation. It is suggested that the favorable chemical composition facilely obtained via grinding in contrast to that by coprecipitation was essential for achieving a more selective production of propylene. - Graphical Abstract: Grinding-assisted synthesis of NiMoO{sub 4} offers higher and more reproducible activities in contrast to coprecipitation for oxidative dehydrogenation of propane, and both {alpha}- and {beta}-NiMoO{sub 4} can be synthesized. Highlights: Black-Right-Pointing-Pointer NiMoO{sub 4} was prepared through grinding-assisted pathway. Black-Right-Pointing-Pointer Direct/sequential grinding rendered {alpha}-, {beta}-NiMoO{sub 4}, respectively. Black-Right-Pointing-Pointer Grinding-derived {alpha}-NiMoO{sub 4} showed high and reproducible activity for oxidative dehydrogenation of propane.

Chen Miao, E-mail: chenmiao@sinochem.com [Shanghai Key Laboratory of Molecular Catalysis and Innovative Materials, Department of Chemistry, Fudan University, Shanghai 200433 (China); Zhejiang Chemical Industry Research Institute, Hangzhou 310023 (China); Wu Jialing; Liu Yongmei [Shanghai Key Laboratory of Molecular Catalysis and Innovative Materials, Department of Chemistry, Fudan University, Shanghai 200433 (China); Cao Yong, E-mail: yongcao@fudan.edu.cn [Shanghai Key Laboratory of Molecular Catalysis and Innovative Materials, Department of Chemistry, Fudan University, Shanghai 200433 (China); Guo Li [Zhejiang Chemical Industry Research Institute, Hangzhou 310023 (China); He Heyong; Fan Kangnian [Shanghai Key Laboratory of Molecular Catalysis and Innovative Materials, Department of Chemistry, Fudan University, Shanghai 200433 (China)

2011-12-15T23:59:59.000Z

312

Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.

2006-08-29T23:59:59.000Z

313

Magnetic field-induced phase transformation and variant reorientation in Ni2MnGa and NiMnCoIn magnetic shape memory alloys  

E-Print Network (OSTI)

The purpose of this work is to reveal the governing mechanisms responsible for the magnetic field-induced i) martensite reorientation in Ni2MnGa single crystals, ii) stress-assisted phase transformation in Ni2MnGa single crystals and iii) phase transformation in NiMnCoIn alloys. The ultimate goal of utilizing these mechanisms is to increase the actuation stress levels in magnetic shape memory alloys (MSMAs). Extensive experimental work on magneto-thermo-mechanical (MTM) characterization of these materials enabled us to i) better understand the ways to increase the actuation stress and strain and decrease the required magnetic field for actuation in MSMAs, ii) determine the effects of main MTM parameters on reversible magnetic field induced phase transformation, such as magnetocrystalline anisotropy energy (MAE), Zeeman energy (ZE), stress hysteresis, thermal hysteresis, critical stress for the stress induced phase transformation and crystal orientation, iii) find out the feasibility of employing polycrystal MSMAs, and iv) formulate a thermodynamical framework to capture the energetics of magnetic field-induced phase transformations in MSMAs. Magnetic shape memory properties of Ni2MnGa single crystals were characterized by monitoring magnetic field-induced strain (MFIS) as a function of compressive stress and stress-induced strain as a function of magnetic field. It is revealed that the selection of the operating temperature with respect to martensite start and Curie temperatures is critical in optimizing actuator performance. The actuation stress of 5 MPa and work output of 157 kJm?3 are obtained by the field-induced variant reorientation in NiMnGa alloys. Reversible and one-way stress-assisted field-induced phase transformations are observed in Ni2MnGa single crystals under low field magnitudes (transformation and shape memory characteristics of NiMnCoIn single crystals are also studied. Reversible field-induced phase transformation is observed only under high magnetic fields (>4T). Necessary magnetic and mechanical conditions, and materials design and selection guidelines are proposed to search for field-induced phase transformation in other ferromagnetic materials that undergo thermoelastic martensitic phase transformation.

Karaca, Haluk Ersin

2007-08-01T23:59:59.000Z

314

Effects of laser irradiation on the self-assembly of MnAs nanoparticles in a GaAs matrix  

SciTech Connect

We investigate the effects of laser irradiation on the self-assembly of MnAs nanoparticles during solid-phase decomposition in a GaAs matrix. It is found that laser irradiation suppresses the growth of MnAs nanoparticles from small to large size, and that the median diameter D{sub 1} in the size distribution of small MnAs nanoparticles depends on the incident photon energy E following D{sub 1} {approx} E{sup -1/5}. We explain this behavior by the desorption of Mn atoms on the MnAs nanoparticle surface due to resonant optical absorption, in which incident photons excite intersubband electronic transitions between the quantized energy levels in the MnAs nanoparticles.

Hai, Pham Nam; Nomura, Wataru [Department of Electrical Engineering and Information Systems, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan); Yatsui, Takashi; Ohtsu, Motoichi; Tanaka, Masaaki [Department of Electrical Engineering and Information Systems, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan); Nanophotonics Research Center, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan)

2012-11-05T23:59:59.000Z

315

Mo Zhou  

NLE Websites -- All DOE Office Websites (Extended Search)

and regional government on appliance standard achievement; evaluate the social impact of appliance labeling program; and analysis of appliance price trend and learning rate to...

316

MO: ZL  

Office of Legacy Management (LM)

Tonawanda, New York," May 1978 (DOEEV-00056). 2. "Radiological Survey of the Ashland Oil Co. (Former Waist Property), Tonewanda, Kew York," May 1978 (DOEEV-00054). 3....

317

Stability and Lifetime of K-CoMoSx Mixed Alcohol Catalysts  

SciTech Connect

Researchers have studied sulfide-type catalysts for the production of mixed alcohols from synthesis gas for several decades. Despite many advances in the art, these processes are not yet commercial, due in large part to mediocre economics and the added risk associated with uncertainty in catalyst lifetime. This talk will outline some recent studies in the lifetime and stability of K-CoMoSx-type mixed alcohol catalysts. Specifically, studies of long term operation (> 3000h), sulfiding agents, simulated methanol recycle, and morphology (probed via XRD and XPS) will be discussed, with the conclusion that these materials are likely to exhibit acceptable lifetimes in continuous operation.

Hensley, J. E.; Ruddy, D.; Schaidle, J.; Ferrell, J.; Thibodeaux, J.

2013-01-01T23:59:59.000Z

318

FULL SIZE U-10MO MONOLITHIC FUEL FOIL AND FUEL PLATE FABRICATION-TECHNOLOGY DEVELOPMENT  

Science Conference Proceedings (OSTI)

Full-size U10Mo foils are being developed for use in high density LEU monolithic fuel plates. The application of a zirconium barrier layer too the foil is applied using a hot co-rolling process. Aluminum clad fuel plates are fabricated using Hot Isostatic Pressing (HIP) or a Friction Bonding (FB) process. An overview is provided of ongoing technology development activities, including: the co-rolling process, foil shearing/slitting and polishing, cladding bonding processes, plate forming, plate-assembly swaging, and fuel plate characterization. Characterization techniques being employed include, Ultrasonic Testing (UT), radiography, and microscopy.

G. A. Moore; J-F Jue; B. H. Rabin; M. J. Nilles

2010-03-01T23:59:59.000Z

319

Beta-decay properties of Zr and Mo neutron-rich isotopes  

E-Print Network (OSTI)

Gamow-Teller strength distributions, beta-decay half-lives, and beta-delayed neutron emission are investigated in neutron-rich Zr and Mo isotopes within a deformed quasiparticle random-phase approximation. The approach is based on a self-consistent Skyrme Hartree-Fock mean field with pairing correlations and residual separable particle-hole and particle-particle forces. Comparison with recent measurements of half-lives stresses the important role that nuclear deformation plays in the description of beta-decay properties in this mass region.

Sarriguren, P

2010-01-01T23:59:59.000Z

320

Properties of Ga{sub 1-x}Mn{sub x}As with high x (>0.1)  

SciTech Connect

We have investigated the magnetic and the crystalline properties of a set of Ga{sub 1-x}Mn{sub x}As layers with high nominal Mn compositions (x=0.101-0.198). Magnetization measurements and combined channeling Rutherford backscattering (c-RBS) and particle induced x-ray emission (c-PIXE) measurements have been performed to determine the effective Mn composition x{sub eff} and the fraction of Mn atoms at various lattice sites. Here, x{sub eff} determined from magnetization measurements, which increases with increasing x, is consistent with the results determined from c-RBS-PIXE measurements.

Chiba, D. [Semiconductor Spintronics Project, Exploratory Research for Advanced Technology, Japan Science and Technology Agency, Sendai 980-0023 (Japan); Laboratory for Nanoelectronics and Spintronics, Research Institute of Electrical Communication, Tohoku University, Katahira 2-1-1, Aoba-ku, Sendai 980-8577 (Japan); Yu, K. M.; Walukiewicz, W. [Electronic Materials Program, Materials Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94549 (United States); Nishitani, Y. [Laboratory for Nanoelectronics and Spintronics, Research Institute of Electrical Communication, Tohoku University, Katahira 2-1-1, Aoba-ku, Sendai 980-8577 (Japan); Matsukura, F.; Ohno, H. [Laboratory for Nanoelectronics and Spintronics, Research Institute of Electrical Communication, Tohoku University, Katahira 2-1-1, Aoba-ku, Sendai 980-8577 (Japan); Semiconductor Spintronics Project, Exploratory Research for Advanced Technology, Japan Science and Technology Agency, Sendai 980-0023 (Japan)

2008-04-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Mn-Stabilized Zirconia: From Imitation Diamonds to a New Potential High-T{sub C} Ferromagnetic Spintronics Material  

SciTech Connect

From the basis of ab initio electronic structure calculations which include the effects of thermally excited magnetic fluctuations, we predict Mn-stabilized cubic zirconia to be ferromagnetic above 500 K. We find this material, which is well known both as an imitation diamond and as a catalyst, to be half-metallic with the majority and minority spin Mn impurity states lying in zirconia's wide gap. The Mn concentration can exceed 40%. The high-T{sub C} ferromagnetism is robust to oxygen vacancy defects and to how the Mn impurities are distributed on the Zr fcc sublattice. We propose this ceramic as a promising future spintronics material.

Ostanin, S. [Max-Planck-Institut fuer Mikrostrukturphysik, Weinberg 2, D-06120 Halle (Saale) (Germany); Department of Physics, University of Warwick, Coventry CV4 7AL (United Kingdom); Ernst, A.; Sandratskii, L. M.; Bruno, P. [Max-Planck-Institut fuer Mikrostrukturphysik, Weinberg 2, D-06120 Halle (Saale) (Germany); Daene, M.; Hergert, W.; Mertig, I. [Martin-Luther-Universitaet Halle-Wittenberg, Fachbereich Physik, D-06099 Halle (Germany); Hughes, I. D.; Staunton, J. B. [Department of Physics, University of Warwick, Coventry CV4 7AL (United Kingdom); Kudrnovsky, J. [Max-Planck-Institut fuer Mikrostrukturphysik, Weinberg 2, D-06120 Halle (Saale) (Germany); Institute of Physics, Academy of Sciences of the Czech Republic, Na Slovance 2, CZ-18221 Prague 8 (Czech Republic)

2007-01-05T23:59:59.000Z

322

Flexible Zn2SnO4/MnO2 Core/Shell Nanocable-Carbon Microfiber ...  

Science Conference Proceedings (OSTI)

Presentation Title, Flexible Zn2SnO4/MnO2 Core/Shell Nanocable-Carbon Microfiber Hybrid Composites for High-Performance Supercapacitor Electrodes.

323

Magnetic order near 270 K in mineral and synthetic Mn 2 FeSbO 6 ilmenite  

Science Conference Proceedings (OSTI)

The structural and magnetic properties of Mn 2 FeSbO 6 single-crystalline mineral and ceramic samples synthesized under thermobaric treatment have been investigated

R. Mathieu; S. A. Ivanov; G. V. Bazuev; M. Hudl; P. Lazor; I. V. Solovyev; P. Nordblad

2011-01-01T23:59:59.000Z

324

Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan

2008-01-01T23:59:59.000Z

325

Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-

2009-01-01T23:59:59.000Z

326

Novel Solar Energy Conversion Materials by Design of Mn(II) Oxides  

Science Conference Proceedings (OSTI)

Solar energy conversion materials need to fulfill simultaneously a number of requirements in regard of their band-structure, optical properties, carrier transport, and doping. Despite their desirable chemical properties, e.g., for photo-electrocatalysis, transition-metal oxides usually do not have desirable semiconducting properties. Instead, oxides with open cation d-shells are typically Mott or charge-transfer insulators with notoriously poor transport properties, resulting from large effective electron/hole masses or from carrier self-trapping. Based on the notion that the electronic structure features (p-d interaction) supporting the p-type conductivity in d10 oxides like Cu2O and CuAlO2 occurs in a similar fashion also in the d5 (high-spin) oxides, we recently studied theoretically the band-structure and transport properties of the prototypical binary d5 oxides MnO and Fe2O3 [PRB 85, 201202(R)]. We found that MnO tends to self-trap holes by forming Mn+III, whereas Fe2O3 self-traps electrons by forming Fe+II. However, the self-trapping of holes is suppressed by when Mn is tetrahedrally coordinated, which suggests specific routes to design novel solar conversion materials by considering ternary Mn(II) oxides or oxide alloys. We are presenting theory, synthesis, and initial characterization for these novel energy materials.

Lany, S.; Peng, H.; Ndione, P.; Zakutayev, A.; Ginley, D. S.

2013-01-01T23:59:59.000Z

327

High-Resolution Structure of the Photosynthetic Mn4Ca Catalyst from X-ray Spectroscopy  

Science Conference Proceedings (OSTI)

The application of high-resolution X-ray spectroscopy methods to study the photosynthetic water oxidizing complex, which contains a unique hetero-nuclear catalytic Mn4Ca cluster, are described. Issues of X-ray damage especially at the metal sites in the Mn4Ca cluster are discussed. The structure of the Mn4Ca catalyst at high-resolution which has so far eluded attempts of determination by X-ray diffraction, EXAFS and other spectroscopic techniques has been addressed using polarized EXAFS techniques applied to oriented PS II membrane preparations and PS II single crystals. A review of how the resolution of traditional EXAFS techniques can be improved, using methods such as range-extended EXAFS is presented, and the changes that occur in the structure of the cluster as it advances through the catalytic cycle are described. X-ray absorption and emission techniques (XANES and K? emission) have been used earlier to determine the oxidation states of the Mn4Ca cluster, and in this report we review the use of X-ray resonant Raman spectroscopy to understand the electronic structure of the Mn4Ca cluster as it cycles through the intermediate S-states.

Yachandra, Vittal; Yano, Junko; Kern, Jan; Pushkar, Yulia; Sauer, Kenneth; Glatzel, Pieter; Bergmann, Uwe; Messinger, Johannes; Zouni, Athina; Yachandra, Vittal K.

2007-08-01T23:59:59.000Z

328

Carbon/lambda-MnO{sub 2} composites for supercapacitor electrodes  

Science Conference Proceedings (OSTI)

In the present work a composite of carbon with lambda-MnO{sub 2} have been synthesized by a simple two-step route. In the first step, to obtain LiMn{sub 2}O{sub 4}/carbon material, mesoporous activated carbon was impregnated with the solution of precursor metal salts and heated subsequently. As-prepared materials were acid treated which resulted in the formation of lambda-MnO{sub 2}/carbon. Physical properties, structure and specific surface area of electrode materials were studied by TEM, X-ray diffraction and nitrogen sorption measurements. Voltammetry cycling, galvanostatic charge/discharge and impedance spectroscopy measurements performed in two- and three-electrode cells have been applied in order to measure electrochemical parameters. TEM images confirmed well dispersed lambda-MnO{sub 2} particles on the surface of carbon material. The carbon in the composite plays an important role as the surface area enhancing component and a support of pseudocapacitive material. Furthermore, the through-connected porosity serves as a continuous pathway for electrolyte transport. A synergetic effect of the porous carbon framework and of the redox properties of the lambda-MnO{sub 2} is at the origin of improvement of specific capacitance values which has been observed for composites after delithiation. - Comparison of capacitance characteristics for initial carbon and synthesised composites for CB in 1 mol L{sup -1} Na{sub 2}SO{sub 4} solution.

Malak-Polaczyk, A., E-mail: agnieszka-malak@wp.p [Institute of Chemistry and Technical Electrochemistry, Poznan University of Technology, Piotrowo 3, 60-695 Poznan (Poland); Institut de Sciences des Materiaux de Mulhouse, CNRS LRC 7228, 15 Rue Starcky, 68057 Mulhouse (France); Matei-Ghimbeu, C.; Vix-Guterl, C. [Institut de Sciences des Materiaux de Mulhouse, CNRS LRC 7228, 15 Rue Starcky, 68057 Mulhouse (France); Frackowiak, E. [Institute of Chemistry and Technical Electrochemistry, Poznan University of Technology, Piotrowo 3, 60-695 Poznan (Poland)

2010-04-15T23:59:59.000Z

329

Investigation of Modified Ni-Cr-Mn Base Alloys for SOFC Interconnect Applications  

Science Conference Proceedings (OSTI)

Two Ni-Cr-W-Mn base alloys based on Haynes 230 were developed and evaluated against criteria relevant to SOFC interconnect applications, which included oxidation behavior under SOFC operating conditions, scale electrical conductivity, and thermal expansion. It was found that, similar to the ferritic stainless steel Crofer22 APU, additions of Mn led to the formation of a unique scale that was comprised of a M3O4 (M=Mn, Cr, Ni, ) spinel-rich top layer and Cr2O3-rich sub-layer. The modified alloys demonstrated reasonable oxidation resistance under SOFC operating conditions, though the Mn additions increased the scale growth rate and thus sacrificed to some extent the oxidation resistance of the base alloy (Haynes 230). The formation of a spinel-rich top layer improved the scale conductivity, especially during the early stages of oxidation, but the higher scale growth rate resulted in a higher rate of increase in the area-specific electrical resistance. Due to their FCC crystal structure, the Ni-Cr-W-Mn base alloys demonstrated a CTE that was higher than that of anode-supported cells and candidate ferritic stainless steels such as Crofer22 APU.

Yang, Z Gary; Singh, Prabhakar; Stevenson, Jeffry W.; Xia, Gordon

2006-09-01T23:59:59.000Z

330

Properties of DU-10wt%Mo Alloys Subjected to Various Post-Rolling Heat Treatments  

Science Conference Proceedings (OSTI)

Mechanical properties of depleted uranium-molybdenum (U-Mo) alloys subjected to different post-processing treatments have been obtained using microhardness, quasi-static tensile tests, and scanning electron microscopy failure analysis. U-Mo alloy foils are currently under investigation for potential fuel conversion of high power research reactors to low enriched uranium fuel. Although mechanical properties take on a secondary effect during irradiation, an understanding of the alloy behavior during fabrication and the effects of irradiation on the integrity of the fuel is essential. In general, the microhardness was insensitive to annealing temperature but decreased with annealing duration. Yield strength, Youngs modulus and ultimate tensile strength improved with both increasing annealing temperature and duration. The failure mode was also insensitive to annealing conditions, but was significantly controlled by the impurity concentration of the alloy, especially carbon. Values obtained from literature are also provided with reasonable agreement based on extrapolation of annealing duration, even though processing conditions and applications were quite different in some instances.

Douglas E. Burkes; Ramprashad Prabhakaran; Thomas Hartmann; Jan-Fong Jue; Francine J. Rice

2010-06-01T23:59:59.000Z

331

Development and processing of LEU targets for {sup 99}Mo production  

SciTech Connect

Most of the world`s supply of {sup 99m}Tc for medical purposes is currently produced from the decay of {sup 99}Mo derived from the fissioning of high-enriched uranium (HEU). Substantial progress has been made in developing targets and chemical processes for producing {sup 99}Mo using low-enriched uranium (LEU). Target development has been focused on a uranium-metal foil target as a replacement for the coated-UO{sub 2} Cintichem-type target. Although the first designs were not successful because of ion mixing-induced bonding of the uranium foil to the target tubes, recent irradiations of modified targets have proven successful. Only minor modifications of the Cintichem chemical process are required for the uranium-metal foil targets. A demonstration using prototypically irradiated targets is anticipated in February 1997. Progress has also been made in basic dissolution of both uranium-metal foil and aluminum-clad U{sub 3}Si{sub 2} dispersion fuel targets.

Snelgrove, J.L.; Vandegrift, G.F.; Hofman, G.L.

1997-04-01T23:59:59.000Z

332

Thermal shock behavior of alumina/MoSi2 plasma sprayed laminated composites  

Science Conference Proceedings (OSTI)

Alumina (Al{sub 2}O{sub 3}) is very susceptible to thermal shock, which leads to strength degradation. By reinforcing Al{sub 2}O{sub 3} with molybdenum disilicide (MoSi{sub 2}) layers, the tolerance to damage caused by thermal shock can be improved. The thermal shock resistance of plasma sprayed Al{sub 2}O{sub 3}/MoSi{sub 2} laminated composites were investigated. Three laminate microstructures having different layer thickness were fabricated by atmospheric plasma spraying while maintaining a 50/50-volume fraction. Quenching experiments done on 4-point bend bars showed a gradual decrease in the strength as the change in temperature ({Delta}T) increased. Thermal shock resistant parameters (R{prime} and R-quadruple prime) provided a representative numerical value of the thermal shock resistance for the laminated composites. The corresponding material properties for the different microstructures were determined experimentally in order to calculate the R{prime} and R quadruple prime values. The intermediate layered composite showed the highest R-quadruple prime va1ue at 1061 {micro}m, while the thin layered composite had the highest R{prime} value at 474 W/m.

Castro, R. G. (Richard G.); Petrovic, J. J.; Vaidya, R. U. (Rajendra U.); Mendoza, D. (Daniel)

2001-01-01T23:59:59.000Z

333

Experimental study of the electric dipole strength in the even Mo nuclei and its deformation dependence  

E-Print Network (OSTI)

Two methods based on bremsstrahlung were applied to the stable even Mo isotopes for the experimental determination of the photon strength function covering the high excitation energy range above 4 MeV with its increasing level density. Photon scattering was used up to the neutron separation energies Sn and data up to the maximum of the isovector giant resonance(GDR) were obtained by photo-activation. After a proper correction for multi-step processes the observed quasi-continuous spectra of scattered photons show a remarkably good match to the photon strengths derived from nuclear photo effect data obtained previously by neutron detection and corrected in absolute scale using the new activation results. The combined data form an excellent basis to derive a shape dependence of the E1 strength in the even Mo isotopes with increasing deviation from the N = 50 neutron shell, i.e. with the impact of quadrupole deformation and triaxiality. The wide energy coverage of the data allows for a stringent assessment of the dipole sum-rule, and a test of a novel parameterization developed previously which is based upon. This parameterization for the electric dipole strength function in nuclei with A>80 deviates significantly from prescriptions generally used previously. In astrophysical network calculations it may help to quantify the role the p-process plays in the cosmic nucleosynthesis. It also has impact on the accurate analysis of neutron capture data of importance for future nuclear energy systems and waste transmutation.

M. Erhard; A. R. Junghans; C. Nair; R. Schwengner; R. Beyer; J. Klug; K. Kosev; A. Wagner; E. Grosse

2010-01-21T23:59:59.000Z

334

Relationships between processing, microstructure, and properties of a Co-Cr-Mo alloy  

SciTech Connect

STELLITE alloy No. 21 was produced via rapid solidification processing (RSP) in a variety of particulate morphologies (coarse and fine powder, flakes, fibers, and ribbons). The various RSP forms showed similar, fine microstructures with only a slight difference in the scale of the microstructural features. These RSP particulates were consolidated by extrusion, dynamic compaction, and rapid omnidirectional compaction (ROC) at two processing temperatures (1077/sup 0/C and 1121/sup 0/C). Dynamic compaction proved to be unacceptable for this alloy because of non-uniform porosity and the inability to develop a metallurgical bond between particulates. A plot of elongation versus yield strength depicted two yield strength/ductility relationships for the Co-Cr-Mo type alloys. As-ROC'd samples had a low yield strength/ductility relationship. Atomized powder size also affected the strength/ductility relationships of the extruded products. Decreasing powder size increased ductility without effecting yield strength. Processing temperature did not affect the yield strength/ductility relationship. Electrochemical polarization tests were not successful in delineating fine differences between the various types of Co-Cr-Mo alloy while immersion-pitting temperature tests were capable of distinguishing between samples processed from fine and coarse powders. These materials proved susceptible to stress corrosion cracking (SCC) in boiling 30% MgCl/sub 2/.

Anand, V.; Hickl, A.J.; Kumar, P.; Boeck, B.A.; Sanders, T.H. Jr.

1984-01-01T23:59:59.000Z

335

Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI

2012-06-01T23:59:59.000Z

336

Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah

2011-04-21T23:59:59.000Z

337

/sup 238/PuO/sub 2//Mo-50 wt% Re compatibility at 800 and 1000/sup 0/C  

DOE Green Energy (OSTI)

The compatibility of Mo-50 wt % Re with /sup 238/PuO/sub 2/ was investigated after heat treatments of up to 720 days at 800/sup 0/C and 180 days at 1000/sup 0/C. At 800/sup 0/C, a 1-..mu..m thick, continuous layer of molybdenum oxide resulted. At 1000/sup 0/C, the oxide reaction product contained some plutonium and did not appear continuous. At 1000/sup 0/C, a layer of intermetallic formed at the Mo-Re edge, beneath the oxide layer, creating a barrier between the Mo-50 wt % Re and the /sup 238/PuO/sub 2/. The intermetallic layer was promoted by the iron impurity in the /sup 238/PuO/sub 2/.

Schaeffer, D.R.; Teaney, P.E.

1980-07-18T23:59:59.000Z

338

Xcel Energy - Solar*Rewards Program and MN Made PV Rebate Program |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Xcel Energy - Solar*Rewards Program and MN Made PV Rebate Program Xcel Energy - Solar*Rewards Program and MN Made PV Rebate Program Xcel Energy - Solar*Rewards Program and MN Made PV Rebate Program < Back Eligibility Commercial Local Government Nonprofit Residential Savings Category Solar Buying & Making Electricity Maximum Rebate $90,000 (as determined by the incentive level and maximum system size) Program Info Start Date 03/01/2010 State Minnesota Program Type Utility Rebate Program Rebate Amount REC Rebate Program 2010-2012:$2.25/W DC REC Rebate Program 2013:$1.50/W DC Minnesota Made Bonus 2010-2012:Up to an additional $2.75/W DC (paired with REC Rebate) Provider Xcel Energy '''''Note: All 2012 funding for the Solar*Rewards program and Minnesota Made Bonus has been reserved as of July 11, 2012. On October 1, 2012, the

339

Magnetism, chemical spots, and stratification in the HgMn star phi Phoenicis  

E-Print Network (OSTI)

Mercury-manganese (HgMn) stars have been considered as non-magnetic and non-variable chemically peculiar (CP) stars for a long time. However, recent discoveries of the variability in spectral line profiles suggested an inhomogeneous surface distribution of chemical elements in some HgMn stars. From the studies of other CP stars it is known that magnetic field plays a key role in the formation of surface spots. All attempts to find magnetic fields in HgMn stars yielded negative results. In this study, we investigate a possible presence of the magnetic field in phi Phe (HD 11753) and reconstruct surface distribution of chemical elements that show variability in spectral lines. We also test a hypothesis that magnetic field is concentrated in chemical spots and look into the possibility that some chemical elements are stratified with depth in the stellar atmosphere.

Makaganiuk, V; Piskunov, N; Jeffers, S V; Johns-Krull, C M; Keller, C U; Rodenhuis, M; Snik, F; Stempels, H C; Valenti, J A

2011-01-01T23:59:59.000Z

340

In-situ spectro-microscopy on organic films: Mn-Phthalocyanine on Ag(100)  

SciTech Connect

Metal phthalocyanines are attracting significant attention, owing to their potential for applications in chemical sensors, solar cells and organic magnets. As the electronic properties of molecular films are determined by their crystallinity and molecular packing, the optimization of film quality is important for improving the performance of organic devices. Here, we present the results of in situ low-energy electron microscopy / photoemission electron microscopy (LEEM/PEEM) studies of incorporation-limited growth [1] of manganese-phthalocyanine (MnPc) on Ag(100) surfaces. MnPc thin films were grown on both, bulk Ag(100) surface and thin Ag(100)/Fe(100) films, where substrate spin-polarized electronic states can be modified through tuning the thickness of the Ag film [2]. We also discuss the electronic structure and magnetic ordering in MnPc thin films, investigated by angle- and spin-resolved photoemission spectroscopy.

Al-Mahboob A.; Vescovo, E.; Sadowski, J.T.

2013-08-18T23:59:59.000Z

Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Growth and Magnetic Properties of Mn-doped Germanium near the Kinetic Solubility Limit  

Science Conference Proceedings (OSTI)

Growth of high-quality dilute magnetic semiconductor (DMS) material is often compromised by the low solubility of magnetic dopants, leading to formation of precipitates. Here, we explore the feasibility of growing precipitate-free Mn-doped Ge at doping levels near the kinetic solubility limit. Ge:Mn DMS films were grown at low temperature so as to minimize precipitate formation. Meanwhile, epitaxial quality was maintained by employing a very low growth rate. The magnetic properties of these lightly doped films exhibit both interesting contrasts and similarities with those of heavily-doped DMS reported in the literature, indicating that the substitutional Mn contents are very similar. Films grown at 95 degree C are free of intermetallic precipitates, offering useful opportunities for studying the fundamentals of carrier mediated exchange and metal insulator transitions without complications arising from precipitate formation.

Ozer, Mustafa M [University of Tennessee, Knoxville (UTK); Thompson, James R [ORNL; Weitering, Harm H [ORNL

2012-01-01T23:59:59.000Z

342

Microwave-assisted fast vapor-phase transport synthesis of MnAPO-5 molecular sieves  

Science Conference Proceedings (OSTI)

MnAPO-5 was prepared by a microwave-assisted vapor-phase transport method at 180 deg. C in short times. The products were characterized by X-ray diffraction, scanning electron microscopy, Fourier transform infrared spectra, UV-vis spectroscopic measurement, NH{sub 3}-temperature-programmed desorption and esterification reaction. It was found that dry gels prepared with aluminum isopropoxide, phosphoric acid and manganese acetate could be transferred to MnAPO-5 in the vapors of triethylamine and water by the microwave-assisted vapor-phase transport method at 180 deg. C for less than 30 min. The crystallization time was greatly reduced by the microwave heating compared with the conventional heating. The resulting MnAPO-5 exhibited much smaller particle sizes, higher surface areas and slightly higher catalytic activity in the esterification of acetic acid and butyl alcohol than those prepared by the conventional vapor-phase transport method and hydrothermal synthesis.

Shao Hui [State Key Laboratory of Materials-Oriented Chemical Engineering, College of Chemistry and Chemical Engineering, Nanjing University of Technology, Nanjing 210009 (China); Department of Chemical Engineering, Jiangsu Polytechnic University, Changzhou 213016 (China); Yao Jianfeng; Ke Xuebin [State Key Laboratory of Materials-Oriented Chemical Engineering, College of Chemistry and Chemical Engineering, Nanjing University of Technology, Nanjing 210009 (China); Zhang Lixiong [State Key Laboratory of Materials-Oriented Chemical Engineering, College of Chemistry and Chemical Engineering, Nanjing University of Technology, Nanjing 210009 (China)], E-mail: lixiongzhang@yahoo.com; Xu Nanping [State Key Laboratory of Materials-Oriented Chemical Engineering, College of Chemistry and Chemical Engineering, Nanjing University of Technology, Nanjing 210009 (China)

2009-04-02T23:59:59.000Z

343

MoO3 as combined hole injection layer and tapered spacer in combinatorial multicolor microcavity organic light emitting diodes  

SciTech Connect

Multicolor microcavity ({mu}C) organic light-emitting diode (OLED) arrays were fabricated simply by controlling the hole injection and spacer MoO{sub 3} layer thickness. The normal emission was tunable from {approx}490 to 640 nm and can be further expanded. A compact, integrated spectrometer with two-dimensional combinatorial arrays of {mu}C OLEDs was realized. The MoO{sub 3} yields more efficient and stable devices, revealing a new breakdown mechanism. The pixel current density reaches {approx}4 A/cm{sup 2} and a maximal normal brightness {approx}140 000 Cd/m{sup 2}, which improves photoluminescence-based sensing and absorption measurements.

Liu, R.; Xu, Chun; Biswas, Rana; Shinar, Joseph; Shinar, Ruth

2011-09-01T23:59:59.000Z

344

Low-spin structure of {sup 96}Mo studied with the (n,n{sup '}{gamma}) reaction  

Science Conference Proceedings (OSTI)

Extensive studies of the low-spin excited states in {sub 42}{sup 96}Mo{sub 54} with the (n,n{sup '}{gamma}) reaction have clarified the level scheme below 3.7 MeV excitation energy and determined detailed information about {sup 96}Mo, including lifetimes from the Doppler-shift attenuation method, branching ratios, and multipole mixing ratios. Also, B(E2) and B(M1) values were determined for many transitions, multiphonon states were identified, and several low-spin states were characterized in terms of collective, mixed-symmetry states.

Lesher, S. R.; Yates, S. W. [Department of Physics and Astronomy, University of Kentucky, Lexington, Kentucky 40506-0055 (United States); Department of Physics, University of Richmond, Richmond, Virginia 23173 (United States); McKay, C. J.; Bandyopadhyay, D.; Boukharouba, N.; Fransen, C.; Orce, J. N.; McEllistrem, M. T. [Department of Physics and Astronomy, University of Kentucky, Lexington, Kentucky 40506-0055 (United States); Mynk, M. [Department of Chemistry, University of Kentucky, Lexington, Kentucky 40506-0055 (United States)

2007-03-15T23:59:59.000Z

345

Stoichiometric growth of high Curie temperature heavily alloyed GaMnAs  

SciTech Connect

Heavily alloyed, 100 nm Ga{sub 1-x}Mn{sub x}As (x>0.1) films are obtained via low-temperature molecular beam epitaxy by utilizing a combinatorial technique which allows systematic control of excess arsenic during growth. Reproducible electronic, magnetic, and structural properties are optimized in a narrow range of stoichiometric growth conditions. In contrast to a prediction of the Zener model of hole-mediated ferromagnetism, the Curie temperature of the stoichiometric material is independent of x (for x>0.1), while substitutional Mn content is proportional to x within a large window of growth conditions.

Mack, S.; Myers, R. C.; Heron, J. T.; Gossard, A. C.; Awschalom, D. D. [Center for Spintronics and Quantum Computation, University of California, Santa Barbara, California 93106 (United States)

2008-05-12T23:59:59.000Z

346

Ultrafast Enhancement of Ferromagnetism via Photoexcited Holes inGaMnAs  

SciTech Connect

We report on the observation of ultrafast photo-enhanced ferromagnetism in GaMnAs. It is manifested as a transient magnetization increase on a 100-ps time scale, after an initial sub-ps demagnetization. The dynamic magnetization enhancement exhibits a maximum below the Curie temperature {Tc} and dominates the demagnetization component when approaching {Tc}. We attribute the observed ultrafast collective ordering to the p-d exchange interaction between photoexcited holes and Mn spins, leading to a correlation-induced peak around 20K and a transient increase in {Tc}.

Wang, J.; Cotoros, I.; Dani, K.M.; Liu, X.; Furdyna, J.K.; Chemla, D.S.

2007-02-17T23:59:59.000Z

347

Relaxation of photoinduced spins and carriers in ferromagnetic InMnSb films  

SciTech Connect

The authors report time resolved measurements and control of photoinduced spin and carrier relaxations in InMnSb ferromagnetic films with 2% Mn content (grown by low-temperature molecular beam epitaxy) using femtosecond laser pulses, and compare them to analogous measurements on InBeSb and InSb films. In this work, magneto-optical Kerr effect and standard pump-probe techniques provided a direct measure of the photoexcited spin and carrier lifetimes, respectively. They observe decrease in relaxations times in the high laser fluence regime and an absence of temperature dependence of the relaxation times.

Nontapot, K.; Kini, R. N.; Gifford, A.; Merritt, T. R.; Khodaparast, G. A.; Wojtowicz, T.; Liu, X.; Furdyna, J. K. [Department of Physics, Virginia Tech, Blacksburg, Virginia 24061 (United States); Institute of Physics, Polish Academy of Sciences, 02-668 Warsaw (Poland); Department of Physics, University of Notre Dame, Notre Dame, Indiana 46556 (United States)

2007-04-02T23:59:59.000Z

348

Fabrication of (Mn,Co)3O4 Surface Coatings onto Alloy Substrates  

DOE Green Energy (OSTI)

Ferritic stainless steels are promising candidates for IT-SOFC interconnect applications due to their low cost and resistance to oxidation at SOFC operating temperatures. However, several challenges remain, including long term electrical conductivity and surface stability under interconnect exposure conditions and chromia scale evaporation. One means of extending interconnect lifetime and improving performance is to apply a protective coating, such as (Mn,Co)3O4 spinel, to the cathode side of the interconnect. These coatings have proven effective in reducing scale growth kinetics and Cr volatility. This report describes several procedures developed at PNNL for fabricating (Mn,Co)3O4 spinel coatings onto ferritic stainless steels.

Yang, Zhenguo; Xia, Guanguang; Li, Xiaohong S.; Singh, Prabhakar; Stevenson, Jeffry W.

2007-04-30T23:59:59.000Z

349

Neutron and X-ray diffraction studies on the high temperature phase of Mn{sub 3}(VO{sub 4}){sub 2}, the new isostructural compound NaMn{sub 4}(VO{sub 4}){sub 3} and their mixed crystals Na{sub x}Mn{sub 4.5-x/2}(VO{sub 4}){sub 3} (0{<=}x{<=}1)  

SciTech Connect

This paper presents a detailed structure analysis (combined Rietveld analysis of X-ray and neutron powder diffraction data as well as quantum mechanical calculations) of the high temperature phase of Mn{sub 3}(VO{sub 4}){sub 2} (space group I4 Macron 2d). Special attention is directed to the analysis of the local coordination around Mn{sup 2+} ions or vacancies within a stella quadrangula configuration of anions. Furthermore, the new compound NaMn{sub 4}(VO{sub 4}){sub 3} is described as well as a range of mixed crystals between NaMn{sub 4}(VO{sub 4}){sub 3} and Mn{sub 3}(VO{sub 4}){sub 2} (described by the formula Na{sub x}Mn{sub 4.5-x/2}(VO{sub 4}){sub 3}, 0{<=}x{<=}1) which were synthesized by a solid state route. All compounds were shown to be isostructural to the high temperature phase Mn{sub 3}(VO{sub 4}){sub 2}. - Graphical abstract: The crystal structure of the new compound NaMn{sub 4}(VO{sub 4}){sub 3}. Highlights: Black-Right-Pointing-Pointer We present neutron and X-ray diffraction studies on high temperature-Mn{sub 3}(VO{sub 4}){sub 2}. Black-Right-Pointing-Pointer Structural details of partly filled stellae quadrangulae positions are discussed. Black-Right-Pointing-Pointer Refined structural parameters and theoretical calculations are compared. Black-Right-Pointing-Pointer We investigate the mixed crystal system Mn{sub 3}(VO{sub 4}){sub 2}-NaMn{sub 4}(VO{sub 4}){sub 3}.

Clemens, Oliver [Universitaet des Saarlandes, Institut fuer Anorganische und Analytische Chemie und Radiochemie, Am Markt, Zeile 5, 66125 Saarbruecken (Germany)] [Universitaet des Saarlandes, Institut fuer Anorganische und Analytische Chemie und Radiochemie, Am Markt, Zeile 5, 66125 Saarbruecken (Germany); Haberkorn, Robert [Universitaet des Saarlandes, Anorganische Festkoerperchemie, Am Markt, Zeile 3, 66125 Saarbruecken (Germany)] [Universitaet des Saarlandes, Anorganische Festkoerperchemie, Am Markt, Zeile 3, 66125 Saarbruecken (Germany); Springborg, Michael [Universitaet des Saarlandes, Physikalische und Theoretische Chemie, Campus B2 2, 66123 Saarbruecken (Germany)] [Universitaet des Saarlandes, Physikalische und Theoretische Chemie, Campus B2 2, 66123 Saarbruecken (Germany); Beck, Horst Philipp, E-mail: hp.beck@mx.uni-saarland.de [Universitaet des Saarlandes, Institut fuer Anorganische und Analytische Chemie und Radiochemie, Am Markt, Zeile 5, 66125 Saarbruecken (Germany)

2012-10-15T23:59:59.000Z

350

Multisegmented Au-MnO2/Carbon Nanotube Hybrid Coaxial Arrays for High-Power Supercapacitor Applications  

E-Print Network (OSTI)

Multisegmented Au-MnO2/Carbon Nanotube Hybrid Coaxial Arrays for High-Power SupercapacitorVised Manuscript ReceiVed: NoVember 4, 2009 The present work reports on synthesis and supercapacitor applications hybrid coaxial arrays are efficient electrodes for supercapacitor applications. Au-segmented MnO2/CNT

Ajayan, Pulickel M.

351

Growth of single-crystal {alpha}-MnO{sub 2} nanorods on multi-walled carbon nanotubes  

Science Conference Proceedings (OSTI)

Single-crystal {alpha}-MnO{sub 2} nanorods were grown on multi-walled carbon nanotubes (MWNTs) in H{sub 2}SO{sub 4} aqueous solution. The morphology and microstructure of the composites were examined by transmission electron microscopy, high-resolution transmission electron microscopy (HRTEM), X-ray diffractometry and energy dispersive spectroscopy (EDS). The results show that {alpha}-MnO{sub 2} single-crystal nanorods with a mean diameter of 15 nm were densely grown on the surface of MWNTs. Those MWNTs/MnO{sub 2} composites were used as an electrode material for supercapacitors, and it was found that the supercapacitor performance using MWNTs/MnO{sub 2} composites was improved largely compared to that using pure MWNTs and {alpha}-MnO{sub 2} nanorod mechanically mixed with MWNTs.

Chen Yong [Shenyang National Laboratory for Materials Science, Institute of Metal Research, Chinese Academy of Sciences, 72 Wenhua Road, Shenyang 110016 (China); Key Laboratory of Tropic Biological Resources, MOE, Hainan University, 58 Renmin Road, Haikou 570228 (China); Liu Chenguang; Liu Chang [Shenyang National Laboratory for Materials Science, Institute of Metal Research, Chinese Academy of Sciences, 72 Wenhua Road, Shenyang 110016 (China); Lu Gaoqing [ARC Centre for Functional Nanomaterials, Australian Institute of Bioengineering and Nanotechnology, University of Queensland, QLD 4072 (Australia); Cheng Huiming [Shenyang National Laboratory for Materials Science, Institute of Metal Research, Chinese Academy of Sciences, 72 Wenhua Road, Shenyang 110016 (China)], E-mail: cheng@imr.ac.cn

2007-11-06T23:59:59.000Z

352

The eects of CO2, CO and H2 co-reactants on methane reactions catalyzed by Mo/H-ZSM-5  

E-Print Network (OSTI)

partial oxidation and autothermal or steam reforming is currently practiced [1±4]. Catalytic pyrolysisThe eects of CO2, CO and H2 co-reactants on methane reactions catalyzed by Mo/H-ZSM-5 Zheng Liu-reactants; methane reactions; Mo/H-ZSM-5 catalyst. 1. Introduction The direct conversion of natural gas

Iglesia, Enrique

353

Effects of Cr-Mo Infiltration Source Structure on the Thickness of Alloy Layer by Double Glow Plasma Surface Metallurgy Technology  

Science Conference Proceedings (OSTI)

To strengthen the growth characteristics of layer on Q235 steel, a new source structure of Cr-Mo infiltration was proposed by plasma surface metallurgy technology. Comparative experiments were carried out on source polar of scrubbing brush structure ... Keywords: Surface alloying, Cr-Mo infiltrated, Plasma surface metallurgy technology, Thickness of layer

Jinyong Xu; Jingchun Zhang; Yajuan Liu; Cheng Gao

2010-03-01T23:59:59.000Z

354

Preparation and structural study from neutron diffraction data of Pr{sub 5}Mo{sub 3}O{sub 16}  

SciTech Connect

The title compound has been prepared as polycrystalline powder by thermal treatments of mixtures of Pr{sub 6}O{sub 11} and MoO{sub 2} in air. In the literature, an oxide with a composition Pr{sub 2}MoO{sub 6} has been formerly described to present interesting catalytic properties, but its true stoichiometry and crystal structure are reported here for the first time. It is cubic, isostructural with CdTm{sub 4}Mo{sub 3}O{sub 16} (space group Pn-3n, Z=8), with a=11.0897(1) A. The structure contains MoO{sub 4} tetrahedral units, with Mo-O distances of 1.788(2) A, fully long-range ordered with PrO{sub 8} polyhedra; in fact it can be considered as a superstructure of fluorite (M{sub 8}O{sub 16}), containing 32 MO{sub 2} fluorite formulae per unit cell, with a lattice parameter related to that of cubic fluorite (a{sub f}=5.5 A) as a{approx}2a{sub f}. A bond valence study indicates that Mo exhibits a mixed oxidation state between 5+ and 6+ (perhaps accounting for the excellent catalytic properties). One kind of Pr atoms is trivalent whereas the second presents a mixed Pr{sup 3+}-Pr{sup 4+} oxidation state. The similarity of the XRD pattern with that published for Ce{sub 2}MoO{sub 6} suggests that this compound also belongs to the same structural type, with an actual stoichiometry Ce{sub 5}Mo{sub 3}O{sub 16}. -- Graphical Abstract: Formerly formulated as Pr{sub 2}MoO{sub 6}, the title compound is a cubic superstructure of fluorite (a=11.0897(1) A, space group Pn-3n) due to the long-range ordering of PrO{sub 8} scalenohedra and MoO{sub 4} tetrahedral units, showing noticeable shifts of the oxygen positions in order to provide a tetrahedral coordination for Mo ions. A mixed valence Mo{sup 5+}-Mo{sup 6+} is identified, which could account for the excellent catalytic properties of this material. Display Omitted

Martinez-Lope, M.J. [Instituto de Ciencia de Materiales de Madrid, C.S.I.C., Cantoblanco, E-28049 Madrid, Spain. (Spain); Alonso, J.A., E-mail: ja.alonso@icmm.csic.e [Instituto de Ciencia de Materiales de Madrid, C.S.I.C., Cantoblanco, E-28049 Madrid, Spain. (Spain); Sheptyakov, D.; Pomjakushin, V. [Laboratory for Neutron Scattering, Paul Scherrer Institut, CH-5232 Villigen PSI (Switzerland)

2010-12-15T23:59:59.000Z

355

Toluene 4-Monooxygenase and its Complex with Effector Protein T4moD  

Science Conference Proceedings (OSTI)

Toluene 4-monooxygenase (T4MO) is a multiprotein diiron enzyme complex that catalyzes the regiospecific oxidation of toluene to p-cresol. Catalytic function requires the presence of a small protein, called the effector protein. Effector protein exerts substantial control on the diiron hydroxylase catalytic cycle through protein-protein interactions. High-resolution crystal structures of the stoichometric hydroxylase and effector protein complex described here reveal how protein-protein interactions and reduction of the diiron center produce an active site configuration poised for reaction with O{sub 2}. Further information from crystal structures of mutated isoforms of the hydroxylase and a peroxo adduct is combined with catalytic results to give a fuller picture of the geometry of the enzyme-substrate complex used for the high fidelity oxidation of hydrocarbon substrates.

Bailey, Lucas J.; Fox, Brian G. (UW)

2012-10-16T23:59:59.000Z

356

Structure and composition of clean and hydrogen covered MoRe surfaces  

DOE Green Energy (OSTI)

The clean and hydrogen covered (100) and (110) faces of Mo{sub 0.75}Re{sub 0.23} alloy single crystals show 1x1 structures. By means of LEED structure analyses we have determined the interlayer distances as well as the layer concentrations down to the sixth layer. While the clean (110) surface turns out to be nearly bulklike terminated, the clean (100) face is found to exhibit both an extended oscillatory layer relaxation and composition profile. Hydrogen adsorption at low temperatures does not alter the composition profile and removes the small remaining relaxation for the (110) surface. In case of the (100) face a substancial reduction of the relaxation is observed for the outermost layer distances as well, while deeper layer relaxations are preserved indicating a strong coupling off relaxation and composition profiles. Hydrogen is found to adsorb in quasi-threefold coordinated sites for the (110) and bridge sites for the (100) face.

Hammer, L.; Meyer, S.; Rath, C. [and others

1995-04-01T23:59:59.000Z

357

Small-scale Specimen Testing of Monolithic U-Mo Fuel Foils  

SciTech Connect

The objective of this investigation is to develop a shear punch testing (SPT) procedure and standardize it to evaluate the mechanical properties of irradiated fuels in a hot-cell so that the tensile behavior can be predicted using small volumes of material and at greatly reduced irradiation costs. This is highly important in the development of low-enriched uranium fuels for nuclear research and test reactors. The load-displacement data obtained using SPT can be interpreted in terms of and correlated with uniaxial mechanical properties. In order to establish a correlation between SPT and tensile data, sub-size tensile and microhardness testing were performed on U-Mo alloys. In addition, efforts are ongoing to understand the effect of test parameters (such as specimen thickness, surface finish, punch-die clearance, crosshead velocity and carbon content) on the measured mechanical properties, in order to rationalize the technique, prior to employing it on a material of unknown strength.

Ramprashad Prabhakaran; Douglas E. Burkes; James I. Cole; Indrajit Charit; Daniel M. Wachs

2008-10-01T23:59:59.000Z

358

Synthesis and optical properties of MoS{sub 2} nanoclusters  

DOE Green Energy (OSTI)

Highly crystalline nanoclusters of MoS{sub 2} were synthesized and their optical absorption and photoluminescence spectra were investigated. Key results include: (1) strong quantum confinement effects with decreasing size; (2) preservation of the quasiparticle (or excitonic) nature of the optical response for clusters down to {approximately} 2.5 nm in size which are only two unit cells thick; (3) demonstration that 3-D confinement produces energy shifts which are over an order of magnitude larger than those due to 1-D confinement; (4) observation of large increases in the spin-orbit splittings at the top of the valence band at the K and M points of the Brillouin zone with decreasing cluster size; and (5) observation of photoluminescence due to both direct and surface recombination. Application is to photocatalysts for solar fuel production and detoxification of chemical waste.

Wilcoxon, J.P.; Newcomer, P.P.; Samara, G.A.

1996-12-01T23:59:59.000Z

359

Nuclear Sturcture Along the Neutron Dripline: MoNa-LISA and the dinueutron system  

Science Conference Proceedings (OSTI)

Nuclei with extreme neutron-to-proton ratios were found to present different structures from what was known for the stable ones. With the current facilities we can now study nuclei that lie even beyond the neutron drip line. At the National Superconducting Cyclotron Laboratory at Michigan State University we use the MoNA/Sweeper setup to perform such studies of neutron unbound nuclei. In a typical experiment, a radioactive beam is employed to produce the nucleus of interest. This unbound nucleus immediately decays into a neutron and a remaining charged fragment, both of which are detected and used to reconstruct the original nucleus and study its properties. In this Colloquium, new exciting findings from recent experiments will be presented. These include the first observation of a dineutron decay from 16Be, the exploration of the south shore of the Island of Inversion and the first evidence of the decay of the troubling nucleus 26O.

Spyou, Artemis [Michigan State Univeristy

2012-09-05T23:59:59.000Z

360

Thermodynamic modeling and experimental validation of the Fe-Al-Ni-Cr-Mo alloy system  

SciTech Connect

NiAl-type precipitate-strengthened ferritic steels have been known as potential materials for the steam turbine applications. In this study, thermodynamic descriptions of the B2-NiAl type nano-scaled precipitates and body-centered-cubic (BCC) Fe matrix phase for four alloys based on the Fe-Al-Ni-Cr-Mo system were developed as a function of the alloy composition at the aging temperature. The calculated phase structure, composition, and volume fraction were validated by the experimental investigations using synchrotron X-ray diffraction and atom probe tomography. With the ability to accurately predict the key microstructural features related to the mechanical properties in a given alloy system, the established thermodynamic model in the current study may significantly accelerate the alloy design process of the NiAl-strengthened ferritic steels.

Teng, Zhenke [ORNL; Zhang, F [CompuTherm LLC, Madison, WI; Miller, Michael K [ORNL; Liu, Chain T [Hong Kong Polytechnic University; Huang, Shenyan [ORNL; Chou, Y.T. [Multi-Phase Services Inc., Knoxville; Tien, R [Multi-Phase Services Inc., Knoxville; Chang, Y A [ORNL; Liaw, Peter K [University of Tennessee, Knoxville (UTK)

2012-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Development and processing of LEU targets for {sup 99}Mo production  

SciTech Connect

Substituting LEU for HEU in targets for producing fission-product {sup 99}Mo requires changes in target design and chemical processing. We have made significant progress in developing targets and chemical processes for this purpose. Target development was concentrated on a U- metal foil target as a replacement for the coated-UO{sub 2} Cintichem- type target. Although the first designs were not successful because of ion mixing-induced bonding of the U foil to the target tubes, recent irradiations of modified targets have proven successful. It was shown that only minor modifications of the Cintichem chemical process are required for the U-metal foil targets. A demonstration using prototypically irradiated targets is anticipated by the end of 1996. Progress was also made in basic dissolution of both U-metal foil and Al-clad U{sub 3}Si{sub 2} dispersion fuel targets, and work in this area is also continuing.

Snelgrove, J.L.; Vandergrift, G.F.; Hofman, G.L.

1997-02-01T23:59:59.000Z

362

Microstructural characterization of as-cast biocompatible Co-Cr-Mo alloys  

SciTech Connect

The microstructure of a cobalt-base alloy (Co-Cr-Mo) obtained by the investment casting process was studied. This alloy complies with the ASTM F75 standard and is widely used in the manufacturing of orthopedic implants because of its high strength, good corrosion resistance and excellent biocompatibility properties. This work focuses on the resulting microstructures arising from samples poured under industrial environment conditions, of three different Co-Cr-Mo alloys. For this purpose, we used: 1) an alloy built up from commercial purity constituents, 2) a remelted alloy and 3) a certified alloy for comparison. The characterization of the samples was achieved by using optical microscopy (OM) with a colorant etchant to identify the present phases and scanning electron microscopy (SE-SEM) and energy dispersion spectrometry (EDS) techniques for a better identification. In general the as-cast microstructure is a Co-fcc dendritic matrix with the presence of a secondary phase, such as the M{sub 23}C{sub 6} carbides precipitated at grain boundaries and interdendritic zones. These precipitates are the main strengthening mechanism in this type of alloys. Other minority phases were also reported and their presence could be linked to the cooling rate and the manufacturing process variables and environment. - Research Highlights: {yields}The solidification microstructure of an ASTM-F75 type alloy were studied. {yields}The alloys were poured under an industrial environment. {yields}Carbides and sigma phase identified by color metallography and scanning microscopy (SEM and EDS). {yields}Two carbide morphologies were detected 'blocky type' and 'pearlite type'. {yields}Minority phases were also detected.

Giacchi, J.V., E-mail: jgiacchi@exa.unicen.edu.ar [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Av. Rivadavia 1917, C1033AAJ Buenos Aires (Argentina); Instituto de Fisica de Materiales Tandil (IFIMAT-FCE-CICPBA) Facultad de Ciencias Exactas, Universidad Nacional del Centro de la Provincia de Buenos Aires, Pinto 399 B7000GHG Tandil (Argentina); Morando, C.N.; Fornaro, O. [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Av. Rivadavia 1917, C1033AAJ Buenos Aires (Argentina); Instituto de Fisica de Materiales Tandil (IFIMAT-FCE-CICPBA) Facultad de Ciencias Exactas, Universidad Nacional del Centro de la Provincia de Buenos Aires, Pinto 399 B7000GHG Tandil (Argentina); Palacio, H.A. [Comision de Investigaciones Cientificas de la Provincia de Buenos Aires (CICPBA), Calle 526 e/10 y 11 B1096APP La Plata (Argentina); Instituto de Fisica de Materiales Tandil (IFIMAT-FCE-CICPBA) Facultad de Ciencias Exactas, Universidad Nacional del Centro de la Provincia de Buenos Aires, Pinto 399 B7000GHG Tandil (Argentina)

2011-01-15T23:59:59.000Z

363

NUMERICAL SIMULATION FOR MECHANICAL BEHAVIOR OF U10MO MONOLITHIC MINIPLATES FOR RESEARCH AND TEST REACTORS  

Science Conference Proceedings (OSTI)

This article presents assessment of the mechanical behavior of U-10wt% Mo (U10Mo) alloy based monolithic fuel plates subject to irradiation. Monolithic, plate-type fuel is a new fuel form being developed for research and test reactors to achieve higher uranium densities within the reactor core to allow the use of low-enriched uranium fuel in high-performance reactors. Identification of the stress/strain characteristics is important for understanding the in-reactor performance of these plate-type fuels. For this work, three distinct cases were considered: (1) fabrication induced residual stresses (2) thermal cycling of fabricated plates; and finally (3) transient mechanical behavior under actual operating conditions. Because the temperatures approach the melting temperature of the cladding during the fabrication and thermal cycling, high temperature material properties were incorporated to improve the accuracy. Once residual stress fields due to fabrication process were identified, solution was used as initial state for the subsequent simulations. For thermal cycling simulation, elasto-plastic material model with thermal creep was constructed and residual stresses caused by the fabrication process were included. For in-service simulation, coupled fluid-thermal-structural interaction was considered. First, temperature field on the plates was calculated and this field was used to compute the thermal stresses. For time dependent mechanical behavior, thermal creep of cladding, volumetric swelling and fission induced creep of the fuel foil were considered. The analysis showed that the stresses evolve very rapidly in the reactor. While swelling of the foil increases the stress of the foil, irradiation induced creep causes stress relaxation.

Hakan Ozaltun & Herman Shen

2011-11-01T23:59:59.000Z

364

Development of an energy-use estimation methodology for the revised Navy Manual MO-303  

SciTech Connect

The U.S. Navy commissioned Pacific Northwest Laboratory (PNL) to revise and/or update the Navy Utilities Targets Manual, NAVFAC MO-303 (U.S. Navy 1972b). The purpose of the project was to produce a current, applicable, and easy-to-use version of the manual for use by energy and facility engineers and staff at all Navy Public Works Centers (PWCs), Public Works Departments (PWDs), Engineering Field Divisions (EFDs), and other related organizations. The revision of the MO-303 manual involved developing a methodology for estimating energy consumption in buildings and ships. This methodology can account for, and equitably allocate, energy consumption within Navy installations. The analyses used to develop this methodology included developing end-use intensities (EUIs) from a vast collection of Navy base metering and billing data. A statistical analysis of the metering data, weather data, and building energy-use characteristics was used to develop appropriate EUI values for use at all Navy bases. A complete Navy base energy reconciliation process was also created for use in allocating all known energy consumption. Initial attempts to use total Navy base consumption values did not produce usable results. A parallel effort using individual building consumption data provided an estimating method that incorporated weather effects. This method produced a set of building EUI values and weather adjustments for use in estimating building energy use. A method of reconciling total site energy consumption was developed based on a {open_quotes}zero-sum{close_quotes} principle. This method provides a way to account for all energy use and apportion part or all of it to buildings and other energy uses when actual consumption is not known. The entire text of the manual was also revised to present a more easily read understood and usable document.

Richman, E.E.; Keller, J.M.; Wood, A.G.; Dittmer, A.L.

1995-01-01T23:59:59.000Z

365

Characterization of the Microstructure of Irradiated U-Mo Dispersion Fuel with a Matrix that Contains Si  

SciTech Connect

RERTR U-Mo dispersion fuel plates are being developed for application in research reactors throughout the world. Of particular interest is the irradiation performance of U-Mo dispersion fuels with Si added to the Al matrix. Si is added to improve the performance of U-Mo dispersion fuels. Microstructural examinations have been performed on fuel plates with Al-2Si matrix after irradiation to around 50% LEU burnup. Si-rich layers were observed in many areas around the various U-7Mo fuel particles. In one local area of one of the samples, where the Si-rich layer had developed into a layer devoid of Si, relatively large fission gas bubbles were observed in the interaction phase. There may be a connection between the growth of these bubbles and the amount of Si present in the interaction layer. Overall, it was found that having Si-rich layers around the fuel particles after fuel plate fabrication positively impacted the overall performance of the fuel plate.

D. D. Keiser, Jr.; A. B. Robinson; J. F. Jue; P. Medvedev; M. R. Finlay

2009-03-01T23:59:59.000Z

366

Characterization and Hydrodesulfurization Activity of CoMo Catalysts Supported on Boron-Doped Sol-Gel Alumina  

E-Print Network (OSTI)

desulfurization character of the CoMo catalysts supported on the B- Al2O3 supports, because high hydrogenation, the catalysts were kept in a closed vessel during two hours for aging, and then dried overnight in an oven.29 in the HDS of Kuwait gas oil [14], heavy Kuwait residue oil [15], and Kuwait crude oil [25]. They correlated

Paris-Sud XI, Université de

367

Determining the Specificity of Terms based on Information Theoretic Pum-Mo Ryu and Key-Sun Choi  

E-Print Network (OSTI)

Determining the Specificity of Terms based on Information Theoretic Measures Pum-Mo Ryu and Key@world.kaist.ac.kr, kschoi@world.kaist.ac.kr Abstract This paper introduces new specificity determining methods for terms based on information theoretic measures. The specificity of terms represents the quantity of domain

368

Gd/sub 2/ (MoO/sub 4/)/sub 3/ longitudinal electrooptic modulator at 6328 A  

SciTech Connect

A Gd/sub 2/(MoO/sub 4/)/sub 3/ light modulator operating at low frequencies, from 100 Hz up to 1 MHz, is examined. Experimental results concerning the thermal behavior and stability, frequency response, and linearity performance characteristics of the system are presented. Advantages and disadvantages of the modulator are discussed.

Theophanous, N.G.

1976-08-01T23:59:59.000Z

369

Magnetic characterizations of sol-gel-produced mn-doped ZnO  

Science Conference Proceedings (OSTI)

Nanoparticles of ZnO doped with 6 at.% Mn were produced by a sol-gel method. X-ray diffraction confirms the hexagonal structure as that of the parent compound ZnO, and high-resolution electron transmission microscopy reveals a single-crystallite lattice. ...

R. Asmatulu; H. Haynes; M. Shinde; Y. H. Lin; Y. Y. Chen; J. C. Ho

2010-01-01T23:59:59.000Z

370

Cycling performance of nanocrystalline LiMn2O4 thin films via electrophoresis  

Science Conference Proceedings (OSTI)

The present study demonstrates a novel approach by which titanium foils coated with LiMn2O4 nanocrystals can be processed into a high-surface-area electrode for rechargeable batteries. A detailed study has been performed to elucidate ...

S. Parvathy; R. Ranjusha; K. Sujith; K. R. V. Subramanian; N. Sivakumar; Shantikumar V. Nair; Avinash Balakrishnan

2012-01-01T23:59:59.000Z

371

Electrodeposition of Mn-Co Alloys on Stainless Steels for SOFC Interconnect Application  

Science Conference Proceedings (OSTI)

Chromium-containing ferritic stainless steels are the most popular materials for solid oxide fuel cell (SOFC) interconnect applications because of its oxidation resistance and easy fabrication process. However, excessive scale growth and chromium evaporation will degrade the cell performance. Highly conductive coatings that resist oxide scale growth and chromium evaporation may prevent both of these problems. Mn1.5Co1.5O4 spinel is one of the most promising coatings for interconnect application because of its high conducitivy, good chromium retention capability, as well as good CTE match. Electroplating of alloys or thin film multilayers followed by controlled oxidation to the desired spinel phase offers an additional deposition option. In the present study binary Mn/Co alloys was fabricated by electrodeposition, and polarization curves were used to characterize the cathodic reactions on substrate surface. By controlling the current density precisely, coatings with Mn/Co around 1:1 has been successfully deposited in Mn/Co =10 solutions, SEM and EDX was used to characterize the surface morphology and composition.

Wu, J. (West Virginia University); Jiang, Y. (West Virginia University); Johnson, C.; Gong, M. (West Virginia University); Liu, X. (West Virginia University)

2007-09-01T23:59:59.000Z

372

Modulation on Ni{sub 2}MnGa(001) surface  

SciTech Connect

We report periodic modulation on (001) surface of Ni2MnGa ferromagnetic shape memory alloy. For the stoichiometric surface, analysis of the low energy electron diffraction (LEED) spot profiles shows that the modulation is incommensurate. The modulation appears at 200 K, concomitant with the first order structural transition to the martensitic phase.

D'Souza, S. W.; Rai, Abhishek; Nayak, J.; Maniraj, M.; Dhaka, R. S.; Barman, S. R.; Schlagel, D. L.; Lograsso, T. A. [UGC-DAE Consortium for Scientific Research, Khandwa Road, Indore, 452001, Madhya Pradesh (India); Ames Laboratory U. S. DOE, Iowa State University, Ames, Iowa 50011-3020 (United States)

2011-07-15T23:59:59.000Z

373

Southwest MN IPM STUFF All the pestilence that's fit to print  

E-Print Network (OSTI)

in heavily infested fields in the near future. Hatch will continue for some time,. After a hot, humid day and Outreach Center 23669 130th Street Lamberton, MN 56152 Phone: 507.752.5066 Cell: 507.276.1184 Fax: 507

Amin, S. Massoud

374

Southwest MN IPM STUFF All the pestilence that's fit to print  

E-Print Network (OSTI)

of fields (hot spots) or field edges. Alate aphids depositing nymphs can rapidly increase the percentage for larva in square foot areas on the ground. During hot weather armyworms may hide under litter. In small 130th Street Lamberton, MN 56152 Phone: 507.752.5066 Cell: 507.276.1184 Fax: 507.752.5097 E

Amin, S. Massoud

375

Southwest MN IPM STUFF All the pestilence that's fit to print  

E-Print Network (OSTI)

indeed treated and the infestation was not a localized hot spot, this may signal the beginning of the end 23669 130th Street Lamberton, MN 56152 Phone: 507.752.5066 Cell: 507.276.1184 Fax: 507.752.5097 E

Amin, S. Massoud

376

Frustration and multiferroic behavior in Ca3CoMnO6  

Science Conference Proceedings (OSTI)

Lu{sub 2}MnCoO{sub 6} and Ca{sub 3}MnCoO{sub 6} satisfy one of the primary goals of multiferroics research, namely ferromagnetic-like magnetization coupled to ferroelectric-like polarization. Thus the mechanism for magnetoelectric coupling in these materials deserves careful study. New data shows that the physics of these compound may be related to the classic 'ANNNI' model. Frustration between ferromagnetic nearest-neighbor and antiferromagnetic next-nearest-neighbor interactions between Ising spins creates an 'up up down down' magnetic structure in zero magnetic field, along c-axis chains that consist of alternating Co and Mn ions. In applied magnetic fields 'up up down,' 'up up up down' and other metastable variations can evolve, yielding hysteretic ferromagnetic-like magnetization. The key is that the phase slips between regions of 'up' and 'down' carries an electric polarization due to broken spatial inversion symmetry. Thus these phase slips can be manipulated with both electric and magnetic fields. The result is a profusion of magnetic and electric states that are closely-spaced in temperature, electric, and magnetic field. We present experimental studies of the magnetic, electric, and structural properties of these two compounds. We include very new data up to 100 Ton Ca{sub 3}CoMnO{sub 6} that resolves a key controversy of over the magnetic structure and the size of the moments.

Zapf, Vivien [Los Alamos National Laboratory

2012-06-01T23:59:59.000Z

377

Hydrogen Storage in a Microporous Metal-Organic Framework with Exposed Mn2+ Coordination Sites  

E-Print Network (OSTI)

Hydrogen Storage in a Microporous Metal-Organic Framework with Exposed Mn2+ Coordination Sites and 90 bar, which at 60 g H2/L provides a storage density 85% of that of liquid hydrogen. The material-358. (2) EERE: Hydrogen, Fuel Cells, & Infrastructure Technologies Program Homepage, www.eere.energy

378

Aliovalent titanium substitution in layered mixed Li Ni-Mn-Co oxides for lithium battery applications  

SciTech Connect

Improved electrochemical characteristics are observed for Li[Ni1/3Co1/3-yMyMn1/3]O2 cathode materials when M=Ti and y<0.07, compared to the baseline material, with up to 15percent increased discharge capacity.

Kam, Kinson; Doeff, Marca M.

2010-12-01T23:59:59.000Z

379

Role of Si on the Diffusional Interactions between U-Mo and Al-Si Alloys at 823 K (550 degrees C)  

Science Conference Proceedings (OSTI)

U-Mo dispersions in Al-alloy matrix and monolithic fuels encased in Al-alloy are under development to fulfill the requirements for research and test reactors to use low-enriched molybdenum stabilized uranium alloys fuels. Significant interaction takes place between the U-Mo fuel and Al during manufacturing and in-reactor irradiation. The interactions products are Al-rich phases with physical and thermal characteristics that adversely affect fuel performance and lead to premature failure. Detailed analysis of the interdiffusion and microstructural development of this system was carried through diffusion couples consisting of U-7wt.%Mo, U-10wt.%Mo and U-12wt.%Mo in contact with pure Al, Al-2wt.%Si, and Al-5wt.%Si, annealed at 823K for 1, 5 and 20 hours. Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) were employed for the analysis. Diffusion couples consisting of U-Mo vs. pure Al contained UAl3, UAl4, U6Mo4Al43, and UMo2Al20 phases. The addition of Si to the Al significantly reduced the thickness of the interdiffusion zone. The interdiffusion zones developed Al and Si enriched regions, whose locations and size depended on the Si and Mo concentrations in the terminal alloys. In the couples, the (U,Mo)(Al,Si)3 phase was observed throughout interdiffusion zone, and the U6Mo4Al43 and UMo2Al20 phases were observed only where the Si concentrations were low.

E. Perez; Y.H. Sohn; D.D. Keiser, Jr.

2013-01-01T23:59:59.000Z

380

A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.

2008-06-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

M5Si3(M=Ti, Nb, Mo) Based Transition-Metal Silicides for High Temperature Applications  

Science Conference Proceedings (OSTI)

Transition metal silicides are being considered for future engine turbine components at temperatures up to 1600 C. Although significant improvement in high temperature strength, room temperature fracture toughness has been realized in the past decade, further improvement in oxidation resistance is needed. Oxidation mechanism of Ti{sub 5}Si{sub 3}-based alloys was investigated. Oxidation behavior of Ti{sub 5}Si{sub 3}-based alloy strongly depends on the atmosphere. Presence of Nitrogen alters the oxidation behavior of Ti{sub 5}Si{sub 3} by nucleation and growth of nitride subscale. Ti{sub 5}Si{sub 3.2} and Ti{sub 5}Si{sub 3}C{sub 0.5} alloys exhibited an excellent oxidation resistance in nitrogen bearing atmosphere due to limited dissolution of nitrogen and increased Si/Ti activity ratio. MoSi{sub 2} coating developed by pack cementation to protect Mo-based Mo-Si-B composites was found to be effective up to 1500 C. Shifting coating composition to T1+T2+Mo{sub 3}Si region showed the possibility to extend the coating lifetime above 1500 C by more than ten times via formation of slow growing Mo{sub 3}Si or T2 interlayer without sacrificing the oxidation resistance of the coating. The phase equilibria in the Nb-rich portion of Nb-B system has been evaluated experimentally using metallographic analysis and differential thermal analyzer (DTA). It was shown that Nb{sub ss} (solid solution) and NbB are the only two primary phases in the 0-40 at.% B composition range, and the eutectic reaction L {leftrightarrow} Nb{sub SS} + NbB was determined to occur at 2104 {+-} 5 C by DTA.

Zhihong Tang

2007-12-01T23:59:59.000Z

382

Local atomic and electronic structure in LaMnO{sub 3} across the orbital ordering transition  

SciTech Connect

The local atomic disorder and electronic structure in the environment of manganese atoms in LaMnO{sub 3} has been studied by x-ray absorption spectroscopy over a temperature range (300-870 K) covering the orbital ordering transition ({approx}710 K). The Mn-O distance splitting into short and long bonds (1.95 and 2.15 A) is kept across the transition temperature, so that the MnO{sub 6} octahedra remain locally Jahn-Teller distorted. Discontinuities in the Mn local structure are identified in the extended x-ray fine structure spectra at this temperature, associated with a reduction of the disorder in the superexchange angle and to the removal of the anisotropy in the radial disorder within the coordination shell. Subtle changes in the electronic local structure also take place at the Mn site at the transition temperature. The near-edge spectra show a small drop of the Mn 4p hole count and a small enhancement in the pre-edge structures at the transition temperature. These features are associated with an increase of the covalence of the Mn-O bonds. Our results shed light on the local electronic and structural phenomena in a model of order-disorder transition, where the cooperative distortion is overcome by the thermal disorder.

Souza, Raquel A.; Souza-Neto, Narcizo M.; Ramos, Aline Y.; Tolentino, Helio C.N.; Granado, Eduardo [Laboratorio Nacional de Luz Sincrotron (LNLS), P.O. Box 6192, 13084-971, Campinas, Sao Paulo, Brazil and (Brazil); Instituto de Fisica Gleb Wataghin, IFGW-UNICAMP, Campinas, SP (Brazil); Laboratorio Nacional de Luz Sincrotron (LNLS), P.O. Box 6192, 13084-971, Campinas, Sao Paulo, Brazil and (Brazil); Departamento de Fisica dos Materiais e Mecanica, DFMT-IF-USP, Sao Paulo, SP (Brazil); Laboratorio Nacional de Luz Sincrotron (LNLS), P.O. Box 6192, 13084-971, Campinas, Sao Paulo, Brazil and (Brazil); Laboratoire de Mineralogie-Cristallographie de Paris, LMCP-UMR 7590-CNRS, Paris (France); Laboratorio Nacional de Luz Sincrotron (LNLS), P.O. Box 6192, 13084-971, Campinas, Sao Paulo (Brazil); Laboratorio Nacional de Luz Sincrotron (LNLS), P.O. Box 6192, 13084-971, Campinas, Sao Paulo, Brazil and (Brazil); Instituto de Fisica Gleb Wataghin, IFGW-UNICAMP, Campinas, SP (Brazil)

2004-12-01T23:59:59.000Z

383

In situ synchrotron x-ray studies of LiMn{sub 2}O{sub 4} cathodes  

DOE Green Energy (OSTI)

LiCoO{sub 2} cathodes are now used in most commercial lithium ion batteries. LiMn{sub 2}O{sub 4} is an attractive low cost alternative. However, it is difficult to make reproducibly. At Brookhaven National Laboratory two in situ synchrotron x-ray techniques, that are available at the National Synchrotron Light Source (NSLS), have been used to investigate LiMn{sub 2}O{sub 4}. The techniques are x-ray absorption and high resolution x-ray diffraction. With x-ray absorption it is possible to follow the changes in the Mn oxidation state and the changes in the Mn-O and Mn-Mn bond lengths on cycling. Also it is possible to detect amorphous phases. The high energy x-rays at the diffraction Beam Lines at the NSLS (up to 24 KeV) permit in situ x-ray diffraction, in the transmission mode, in thin lithium and lithium ion cells. The evolution of the structural chances that occur on cycling can be followed. These in situ measurements were done on Li/LiMn{sub 2}O{sub 4} cells with a liquid electrolyte (1 M LiPF{sub 6} in a 1:1:3 PC:EC:DMC solvent).

McBreen, J.; Mukerjee, S.; Yang, X.Q. [and others

1997-05-01T23:59:59.000Z

384

Electrochemical and structural characterization of titanium-substituted manganese oxides based on Na0.44MnO2  

DOE Green Energy (OSTI)

A series of titanium-substituted manganese oxides, Li{sub x}Ti{sub y}Mn{sub 1-y}O{sub 2} (y = 0.11, 0.22, 0.33, 0.44, and 0.55) with the Na{sub 0.44}MnO{sub 2} structure were prepared from Na{sub x}Ti{sub y}Mn{sub 1-y}O{sub 2} (x {approx} 0.44) precursors. The electrochemical characteristics of these compounds, which retain the unique double-tunnel structure during ion exchange, were examined in lithium/polymer electrolyte cells operating at 85 C. All of the substituted cathode materials intercalated lithium reversibly, with Li{sub x}Ti{sub 0.22}Mn{sub 0.78}O{sub 2} exhibiting the highest capacity in polymer cells, about 10-20% greater than that of unsubstituted Li{sub x}MnO{sub 2} made from Na{sub 0.44}MnO{sub 2}. In common with Li{sub x}MnO{sub 2}, the Ti-substituted materials exhibited good capacity retention over one hundred or more cycles, with some compositions exhibiting a fade rate of less than 0.03% per cycle.

Doeff, Marca M.; Richardson, Thomas J.; Hwang, Kwang-Taek

2004-03-01T23:59:59.000Z

385

Method for generating a crystalline {sup 99}MoO{sub 3} product and the isolation {sup 99m}Tc compositions therefrom  

DOE Patents (OSTI)

An improved method is described for producing {sup 99m}Tc compositions. {sup 100}Mo metal is irradiated with photons in a particle (electron) accelerator to produce {sup 99}Mo metal which is dissolved in a solvent. A solvated {sup 99}Mo product is then dried to generate a supply of {sup 99}MoO{sub 3} crystals. The crystals are thereafter heated at a temperature which will sublimate the crystals and form a gaseous mixture containing vaporized {sup 99m}TcO{sub 3} and vaporized {sup 99m}TcO{sub 2} but will not cause the production of vaporized {sup 99}MoO{sub 3}. The mixture is then combined with an oxidizing gas to generate a gaseous stream containing vaporized {sup 99m}Tc{sub 2}O{sub 7}. Next, the gaseous stream is cooled to a temperature sufficient to convert the vaporized {sup 99m}Tc{sub 2}O{sub 7} into a condensed {sup 99m}Tc-containing product. The product has high purity levels resulting from the use of reduced temperature conditions and ultrafine crystalline {sup 99}MoO{sub 3} starting materials with segregated {sup 99m}Tc compositions therein which avoid the production of vaporized {sup 99}MoO{sub 3} contaminants. 1 fig.

Bennett, R.G.; Christian, J.D.; Kirkham, R.J.; Tranter, T.J.

1998-09-01T23:59:59.000Z

386

Magnetic order near 270 K in mineral and synthetic Mn{sub 2}FeSbO{sub 6} ilmenite  

SciTech Connect

The structural and magnetic properties of Mn{sub 2}FeSbO{sub 6} single-crystalline mineral and ceramic samples synthesized under thermobaric treatment have been investigated, and compared to theoretical predictions based on first-principles electronic structure calculations. This ilmenite system displays a sharp magnetic transition just below the room temperature related to a ferrimagnetic ordering of the Mn{sup 2+} and Fe{sup 3+} cations, which makes Mn{sub 2}FeSbO{sub 6} a promising candidate for designing functional magnetic materials.

Mathieu, R.; Hudl, M.; Nordblad, P. [Department of Engineering Sciences, Uppsala University, Box 534, SE-75121 Uppsala (Sweden); Ivanov, S. A. [Department of Engineering Sciences, Uppsala University, Box 534, SE-75121 Uppsala (Sweden); Department of Inorganic Materials, Karpov' Institute of Physical Chemistry, Vorontsovo pole, 10 105064, Moscow K-64 (Russian Federation); Bazuev, G. V. [Institute of Solid-State Chemistry, Ural Branch of the Russian Academy of Science, 620999, Ekaterinburg GSP-145 (Russian Federation); Lazor, P. [Department of Earth Sciences, Uppsala University, Villavaegen 16, SE-75236 Uppsala (Sweden); Solovyev, I. V. [National Institute for Materials Science, 1-2-1 Sengen, Tsukuba, Ibaraki 305-0047 (Japan)

2011-05-16T23:59:59.000Z

387

In situ X-ray absorption fine structure studies of a manganese dioxide electrode in a rechargeable MnO{sub 2}/Zn alkaline battery environment  

DOE Green Energy (OSTI)

Electronic and structural aspects of a MnO{sub 2} electrode in a rechargeable MnO{sub 2}/Zn battery environment have been investigated by in situ Mn K-edge X-ray absorption fine structure (XAFS). The relative amplitudes of the three major Fourier transform shells of the EXAFS (extended XAFS) function of the rechargeable MnO{sub 2} electrode in the undischarged state were found to be similar to those found for ramsdellite, a MnO{sub 2} polymorph with substantial corner-sharing linkages among the basic MnO{sub 6} octahedral units. The analyses of the background-subtracted pre-edge peaks and absorption edge regions for the nominally 1-e{sup {minus}} discharged electrode were consistent with Mn{sup 3+} as being the predominant constituent species, rather than a mixture of Mn{sup 4+} and Mn{sup 2+} sites. Furthermore, careful inspection of both the XANES (X-ray absorption near edge structure) and EXAFS indicated that the full recharge of MnO, which had been previously discharged either by a 1- or 2-equivalent corner-sharing linkages compared to the original undischarged MnO{sub 2}.

Mo, Y.; Hu, Y.; Bae, I.T.; Miller, B.; Scherson, D.A. [Case Western Reserve Univ., Cleveland, OH (United States). Dept. of Chemistry; Antonio, M.R. [Argonne National Lab., IL (United States). Chemistry Div.

1996-12-31T23:59:59.000Z

388

X-ray spectroscopic study of the charge state and local orderingof room-temperature ferromagnetic Mn oped ZnO  

Science Conference Proceedings (OSTI)

The charge state and local ordering of Mn doped into a pulsed laser deposited single-phase thin film of ZnO are investigated by using X-ray absorption spectroscopy at the O K-, Mn K- and L-edges, and X-ray emission spectroscopy at the O K- and Mn L-edge. This film is found to be ferromagnetic at room temperature. EXAFS measurement shows that Mn{sup 2+} replaces Zn site in tetrahedral symmetry, and there is no evidence for either metallic Mn or MnO in the film. Upon Mn doping, the top of O 2p valence band extends into the bandgap indicating additional charge carries being created.

Guo, J.-H.; Gupta, Amita; Sharma, Parmanand; Rao, K.V.; Marcus,M.A.; Dong, C.L.; Guillen, J.M.O.; Butorin, S.M.; Mattesini, M.; Glans,P.A.; Smith, K.E.; Chang, C.L.; Ahuja, R.

2007-08-07T23:59:59.000Z

389

Adsorption of Potassium on the MoS2(100) Surface: A First-Principles Investigation  

DOE Green Energy (OSTI)

Periodic density functional theory calculations were performed to investigate the interaction that potassium with the Mo and S edges of the MoS2(100) surface. Both neutral and cationic (+1) charged potassium-promoted systems at different sulfur coverages were considered. Our calculations indicate that the potassium atom readily donates its single 4s valence electron to the MoS2 structure for the neutral potassium-promoted system, and the neutral and cationic potassium-promoted systems demonstrate a similar adsorption behavior. Moreover, potassium changes the magnetic properties known to occur at the metallic edge surface, which have implications for electron spin dependent surface characterization methods (i.e., electron spin/paramagnetic spectroscopy). Potassium in both the neutral and cationic systems tends to maximize its interactions with the available sulfur atoms at the edge surface, preferring sites over four-fold S hollows on fully sulfided Mo and S edges and over the interstitial gap where two to four edge surface S atoms are available for coordination. As the potassium coverage increases, the adsorption energy per potassium atom, surface work function, and transfer of the K 4s electron to the MoS2(100) surface decreases, which is in line with an increased metallization of the potassium adlayer. The potassium adlayer tends to form chains along the interstitial with K-K distances ~1 , which is notably less than those of bulk bcc K metal (4.61 ). Density of states for the potassium-saturated surface suggests enhanced involvement of broad K 3d states beginning just above the Fermi level. Potassium-promotion of MoS2(100) has implications for alcohol catalysis: increasing the surface basicity by increasing the electron charge of the surface, providing hydrogenation-promoting CO site, blocking edge surface that dissociate CO and lead to methanation, and limiting H2 dissociative adsorption to the edge surface and possibly inhibiting the H2 dissociative adsorption via s character electron repulsion. This research was performed in part using the Molecular Science Computing Facility in the William R. Wiley Environmental Molecular Sciences Laboratory, a U.S. Department of Energy (DOE) national scientific user facility located at the Pacific Northwest National Laboratory (PNNL). PNNL is operated by Battelle for DOE.

Andersen, Amity; Kathmann, Shawn M.; Lilga, Michael A.; Albrecht, Karl O.; Hallen, Richard T.; Mei, Donghai

2011-04-15T23:59:59.000Z

390

Microstructural evolution during solution treatment of Co-Cr-Mo-C biocompatible alloys  

SciTech Connect

Three different Co-Cr-Mo-C alloys conforming to ASTM F75 standard were poured in an industrial environment and subjected to a conventional solution treatment at 1225 Degree-Sign C for several time intervals. The microstructural changes and transformations were studied in each case in order to evaluate the way in which treatment time influences the secondary phase fraction and clarify the microstructural changes that could occur. To assess how treatment time affects microstructure, optical microscopy and image analyzer software, scanning electron microscopy and energy dispersion spectrometry analysis were employed. The main phases detected in the as-cast state were: {sigma}-phase, M{sub 6}C, and M{sub 23}C{sub 6} carbides. The latter presented two different morphologies, blocky type and lamellar type. Despite being considered the most detrimental feature to mechanical properties, {sigma}-phase and lamellar carbides dissolution took place in the early stages of solution treatment. M{sub 23}C{sub 6} carbides featured two different behaviors. In the alloy obtained by melting an appropriate quantity of alloyed commercial materials, a decrease in size, spheroidization and transformation into M{sub 6}C carbides were simultaneously observed. In the commercial ASTM F75 alloy, in turn, despite being the same phase, only a marked decrease in precipitates size was noticed. These different behaviors could be ascribed to the initial presence of other phases in the alloy obtained from alloyed materials, such as {sigma}-phase and 'pearlitic' carbides, or to the initial precipitate size which was much larger in the first than in the commercial ASTM F75 alloy studied. M{sub 6}C carbides dissolved directly in the matrix as they could not be detected in samples solution-treated for 15 min. - Highlights: Black-Right-Pointing-Pointer Three different Co-Cr-Mo alloys were poured under an industrial environment. Black-Right-Pointing-Pointer Transformation of existing phases followed during conventional solution treatment. Black-Right-Pointing-Pointer In as-cast/treated samples, phases were identified by color metallography, SEM and EDS. Black-Right-Pointing-Pointer M{sub 23}C{sub 6} {yields} M{sub 6}C transformation was corroborated by SEM and EDS analysis. Black-Right-Pointing-Pointer Carbide spheroidization was also detected prior a noticeably carbide size decreasing.

Giacchi, J.V., E-mail: jgiacchi@exa.unicen.edu.ar [IFIMAT, Instituto de Fisica de Materiales Tandil, Facultad de Ciencias Exactas, Universidad Nacional del Centro de la Provincia de Buenos Aires, Pinto 399, B7000GHG Tandil (Argentina); Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Av. Rivadavia 1917, C1033AA, Buenos Aires (Argentina); Fornaro, O. [IFIMAT, Instituto de Fisica de Materiales Tandil, Facultad de Ciencias Exactas, Universidad Nacional del Centro de la Provincia de Buenos Aires, Pinto 399, B7000GHG Tandil (Argentina); Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Av. Rivadavia 1917, C1033AA, Buenos Aires (Argentina); Palacio, H. [IFIMAT, Instituto de Fisica de Materiales Tandil, Facultad de Ciencias Exactas, Universidad Nacional del Centro de la Provincia de Buenos Aires, Pinto 399, B7000GHG Tandil (Argentina); Comision de Investigaciones Cientificas de la Provincia de Buenos Aires (CICPBA), Calle 526 e/10 y 11, B1096APP, La Plata (Argentina)

2012-06-15T23:59:59.000Z

391

The preparation of carbon nanotube/MnO2 composite fiber and its application to flexible micro-supercapacitor  

Science Conference Proceedings (OSTI)

In recent years, flexible electronic devices pursued for potential applications. The design and the fabrication of a novel flexible nanoarchitecture by coating electrical conductive MWCNT fiber with ultrathin films of MnO2 to achieve high ...

Li Li, Chen Chen, Jing Xie, Zehuai Shao, Fuxin Yang

2013-01-01T23:59:59.000Z

392

Synthesis and Electrochemical Properties of Monoclinic LiMnBO[subscript 3] as a Li Intercalation Material  

E-Print Network (OSTI)

We investigated the structural stability and electrochemical properties of LiMnBO3 in the hexagonal and monoclinic form with ab initio computations and, for the first time, report electrochemical data on monoclinic ...

Kim, Jae Chul

393

Synthesis and Electrochemical Properties of Monoclinic LiMnBO[subscript 3] as a Li Intercalation Material  

E-Print Network (OSTI)

We investigated the structural stability and electrochemical properties of LiMnBO[subscript 3] in the hexagonal and monoclinic form with ab initio computations and, for the first time, report electrochemical data on ...

Kim, Jae Chul

394

Thermal Stabilities of Delithiated Olivine MPO[subscript 4] (M=Fe,Mn) Cathodes investigated using First Principles Calculations  

E-Print Network (OSTI)

We present an analysis of the thermal reduction of delithiated LiMnPO[subscript 4] and LiFePO[subscript 4] based on the quarternary phase diagrams as calculated from first principles. Our results confirm the recent ...

Ong, Shyue Ping

395

Preparation of Mn{sub 2}SnO{sub 4} nanoparticles as the anode material for lithium secondary battery  

Science Conference Proceedings (OSTI)

The ultrafine Mn{sub 2}SnO{sub 4} nanoparticles with diameters of 5-10 nm have been prepared by thermal decomposition of precursor MnSn(OH){sub 6}. The MnSn(OH){sub 6} nanoparticles precursor was synthesized by a hydrothermal microemulsion method. X-ray diffraction, transmission electron microscopy, high-resolution transmission electron microscopy and electron diffraction have been employed to characterize the crystal structures and morphologies of the as-prepared samples. High-resolution transmission electron microscopy observations revealed that the as-synthesized nanoparticles were single crystals. The thermal characterization was studied by differential thermal analysis and thermogravimetry analysis measurements. Electrochemical test showed that the Mn{sub 2}SnO{sub 4} nanoparticles exhibited a high initial charge-discharge capacity of 1320 mAh/g.

Lei Shuijin [School of Materials Science and Engineering, Nanchang University, No. 999, Xuefu Avenue Honggutan New District, Nanchang, Jiangxi 330031 (China)], E-mail: shjlei@ncu.edu.cn; Tang Kaibin [Nanomaterial and Nanochemistry, Hefei National Laboratory for Physical Sciences at Micro-scale, University of Science and Technology of China, Hefei, Anhui 230026 (China)], E-mail: kbtang@ustc.edu.cn; Chen Chunhua; Jin Yi [Department of Materials Science and Engineering, University of Science and Technology of China, Hefei, Anhui 230026 (China); Zhou Lang [School of Materials Science and Engineering, Nanchang University, No. 999, Xuefu Avenue Honggutan New District, Nanchang, Jiangxi 330031 (China)

2009-02-04T23:59:59.000Z

396

Electrode properties of Mn2O3 nanospheres synthesized by combined sonochemical/solvothermal method for use in electrochemical capacitors  

Science Conference Proceedings (OSTI)

We report here an efficient single step combined sonochemical and solvothermal synthesis process to obtain bulk quantities of nanospherical particles of cubic Mn2O3 and characterized its pseudocapacitive characteristics in relevance ...

Teressa Nathan; Michael Cloke; S. R. S. Prabaharan

2008-01-01T23:59:59.000Z

397

Electrochemical and structural characterization of titanium-substituted manganese oxides based on Na0.44MnO2  

E-Print Network (OSTI)

by heating them in a molten salt- mixture of 68-mol% LiNOtakes place during the molten salt exchange. Because the850 C. c) prepared by molten salt exchange of Na x Ti y Mn

Doeff, Marca M.; Richardson, Thomas J.; Hwang, Kwang-Taek

2004-01-01T23:59:59.000Z

398

Synthesis and Electrochemical Characterization of M2Mn3O8 (M=Ca, Cu) Compounds and Derivatives  

E-Print Network (OSTI)

surprising, because the molten salt environment at elevatedthe product of the molten salt reaction can be considered tothat is formed during the molten salt reaction with Ca 2 Mn

Park, Yong Joon; Doeff, Marca M.

2005-01-01T23:59:59.000Z

399

DEPARTMENT OF ENERGY EERE PROJECT MN-IAGEMENT CENTER NEPA DETERMINATION  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MN-IAGEMENT CENTER MN-IAGEMENT CENTER NEPA DETERMINATION Page 1 of4 RECIPIENT:A1aska Energy Authority STATE: AK PROJECT TITLE: Alaska Wind Energy PrOject Funding Opportunity Announcement Number PnK:urcmcntlnstrumcnl Numbcr NEPA Control Number CID Number DE-FG-36-05GOO85038 DE-FG-36-05GOO85038 GFO-G085038-002 G085038 Bastd on my review orthe information concuning the proposed adion, as NEPA Compliance Officer (authorized under DOE Order 45 1.IA), I have made the following determination: ex, EA. [IS APPENDIX AND NUMBER: Description: 61 .19 Microwave, Siting, construction, modification. operation, and removal of microwave, radio communication, and meteorological , meteorological towers and assOCIated facilities, prOVided that the towers and associated facilitJes would

400

Optical transitions in MnGa{sub 2}Se{sub 4}  

Science Conference Proceedings (OSTI)

The dependence of the absorption coefficient on incident photon energy in a MnGa{sub 2}Se{sub 4} single crystal has been investigated in the temperature range 110-295 K. Using group-theory analysis of the electron state symmetry and comparison of the symmetry of the energy spectrum of MnGa{sub 2}Se{sub 4} and its isoelectronic analogs, a conclusion about the character of optical transitions has been drawn. It is shown that the features observed at 2.31 and 2.45 eV are related to the intracenter transitions {sup 6}A{sub 1}{sup 1} {yields} {sup 4}T{sub 2}({sup 4}G) and {sup 6}A{sub 1}{sup 2} {yields} {sup 4}T{sub 2}({sup 4}G). The {sup 6}A{sub 1} state is split by the crystal field.

Tagiev, B. G.; Kerimova, T. G., E-mail: ktaira@physics.ab.az; Tagiev, O. B.; Asadullayeva, S. G.; Mamedova, I. A. [National Academy of Sciences of Azerbaijan, Institute of Physics (Azerbaijan)

2012-06-15T23:59:59.000Z

Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

RECIPIENT:Minnesota Department of Commerce, Office of Energy Security SEP ARRA STATE: MN  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Minnesota Department of Commerce, Office of Energy Security SEP ARRA STATE: MN Minnesota Department of Commerce, Office of Energy Security SEP ARRA STATE: MN PROJECT TITLE: SEP - Residential Ground Source Heat Pump Installation - Schmitz, Mary C. Funding Opportunity Announcement Number DE FOA 0000052 Procurement Instrument Number EE0000164 NEPA Control Number cm Number GFO-0000164-018 0 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical

402

File:USDA-CE-Production-GIFmaps-MN.pdf | Open Energy Information  

Open Energy Info (EERE)

MN.pdf MN.pdf Jump to: navigation, search File File history File usage Minnesota Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 311 KB, MIME type: application/pdf) Description Minnesota Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Minnesota External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,650 × 1,275 (311 KB) MapBot (Talk | contribs) Automated bot upload

403

Charge Melting & Polaron Collapse in LA1.2SR1.8MN207  

NLE Websites -- All DOE Office Websites (Extended Search)

Charge Melting & Polaron Collapse in LA1.2SR1.8MN207 Charge Melting & Polaron Collapse in LA1.2SR1.8MN207 Recent studies carried out on the Synchrotron Radiation Instrumentation Collaborative Access Team's beamline I-ID-C at the Advanced Photon Source provide new insights into charge melting and polaron collapse. X-ray and neutron scattering measurements directly demonstrate the existence of polarons in the paramagnetic phase of optimally doped colossal magnetoresistive oxides. The polarons exhibit short-range correlations that grow with decreasing temperature, but disappear abruptly at the ferromagnetic transition because of the sudden charge delocalization. The "melting" of the charge ordering as we cool through TC occurs with the collapse of the quasistatic polaron scattering, and provides important new

404

High capacitive performance of nanostructured Mn-Ni-Co oxide composites for supercapacitor  

SciTech Connect

Nanostructured Mn-Ni-Co oxide composites (MNCO) were prepared by thermal decomposition of the precursor obtained by chemical co-precipitation of Mn, Ni and Co salts. The chemical composition and morphology were characterized by X-ray diffraction (XRD), energy dispersive spectroscopy (EDS) and scanning electron microscopy (SEM). The electrochemical capacitance of MNCO electrode was examined by cyclic voltammetry, impedance and galvanostatic charge-discharge measurements. The results showed that MNCO electrode exhibited the good electrochemical characteristics. A maximum capacitance value of 1260 F g{sup -1} could be obtained within the potential range of -0.1 to 0.4 V versus saturated calomel electrode (SCE) in 6 mol L{sup -1} KOH electrolyte.

Luo Jianmin [Institute of Applied Chemistry, Xinjiang University, Urumqi 830046 (China); Gao Bo [College of Material Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 210016 (China); Zhang Xiaogang [College of Material Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 210016 (China)], E-mail: azhangxg@163.com

2008-05-06T23:59:59.000Z

405

Structural and magnetic properties of MBE grown GeMnN2 thin films  

Science Conference Proceedings (OSTI)

Epitaxial GeMnN{sub 2} thin films are synthesized by plasma-assisted molecular beam epitaxy. Transmission electron microscopy and x-ray diffraction measurements confirm that it is the orthorhombic variant, consistent with the predictions of first-principles calculations. The magnetic properties of the films are related to defects, with samples grown under Ge-rich conditions exhibiting a net magnetic moment above room temperature. These results are explained by first-principles calculations, indicating that the preferential substitution of one magnetic sublattice of GeMnN{sub 2} by impurities and/or intrinsic defects such as Ge antisites produces a net magnetic moment in an antiferromagnetic background, and also introduces spin-polarized carriers near the Fermi level.

Liu, Y [University of Wisconsin, Milwaukee; Lazarov, V. K. [University of Wisconsin, Milwaukee; Cheung, S.H. [University of Wisconsin, Milwaukee; Keavney, D.J. [Argonne National Laboratory (ANL); Gai, Zheng [ORNL; Gajdardziska-Josifovska, M [University of Wisconsin, Milwaukee; Weinert, M [University of Wisconsin, Milwaukee; Li, Lian [University of Wisconsin, Milwaukee

2012-01-01T23:59:59.000Z

406

Irradiation-controlled giant magnetoresistance of PtMn-based spin valve  

Science Conference Proceedings (OSTI)

He{sup +}-ion irradiation resulted in the direct ordering of PtMn without postannealing. Samples were irradiated with 2 MeV He{sup +} ions and a beam current of 1.08 {mu}A/cm{sup 2} such that the corresponding surface temperature was 190 deg. C. The exchange bias direction was set in situ during irradiation in a field of 900 Oe. A high giant magnetoresistance (GMR) ratio of 11% was obtained in PtMn-based spin valves after He{sup +} irradiation. The GMR is completely eliminated after it is irradiated with oxygen ions at 42 keV. Combining He{sup +} with oxygen-ion irradiation can provide magnetic patterning for GMR sensors.

Huang, S.-H.; Lai, C.-H.; Chiang, C. C.; Yang, C.-H. [Department of Materials Science and Engineering, National Tsing Huang University, 101, Section 2, Kuang Fu Road, Hsinchu, Taiwan 30013 (China)

2006-04-15T23:59:59.000Z

407

FTIR and Raman Study of LixTiyMn1-y2(y=0,0.11) Cathodes in  

NLE Websites -- All DOE Office Websites (Extended Search)

FTIR and Raman Study of LixTiyMn1-y2(y=0,0.11) Cathodes in FTIR and Raman Study of LixTiyMn1-y2(y=0,0.11) Cathodes in Pyrrolidinium-based Ionic Liquid Electrolyte Systems Title FTIR and Raman Study of LixTiyMn1-y2(y=0,0.11) Cathodes in Pyrrolidinium-based Ionic Liquid Electrolyte Systems Publication Type Journal Article Year of Publication 2009 Authors Hardwick, Laurence J., Juliette A. Saint, Ivan T. Lucas, Marca M. Doeff, and Robert Kostecki Journal J. Electrochemical Society Volume 156 Issue 2 Pagination A120-A127 Keywords electrochemical electrodes, Fourier transform spectra, infrared spectra, lithium compounds, manganese compounds, Raman spectra, titanium compounds Abstract This work demonstrates the protective effect of partial titanium substitution in LixTi0.11Mn0.89O2 against surface decomposition in room-temperature ionic liquid (RTILs) cells. Raman microscopy and reflectance Fourier transform IR (FTIR) spectroscopy were used to analyze electrodes recovered from cycled Li/LixTiyMn1-yO2 (y=0,0.11) cells containing the 0.5mol/kg LiTFSI in P13FSI RTIL electrolyte. [TFSI=bis(trifluoromethanesulfonyl)imide .] Raman and FTIR spectra of cycled LixMnO2 cathodes showed many distinct bands that can be attributed to both the electrolyte and electrode decomposition products. The thickness of the amorphous porous layer on the LixMnO2 cathode increased during cycling. The surface degradation of LixMnO2 and precipitation of electrolyte decomposition products contributed to the film growth. Improved cycling behavior was observed in cells containing LixTi0.11Mn0.89O2 , yet Raman spectroscopy also showed possible surface degradation. The FTIR spectra of cycled LixMnO2 and LixTi0.11Mn0.89O2 cathodes displayed bands characteristic for LiSO3CF3 and Li2NSO2CF3 , which originate from the reaction of the TFSI anion with traces of water present in the cell.

408

Overview of a Welding Development Program for a Ni-Cr-Mo-Gd Alloy  

Science Conference Proceedings (OSTI)

The National Spent Nuclear Fuel Program (NSNFP), located at the Idaho National Laboratory, coordinates and integrates management and disposal of U.S. Department of Energy-owned spent nuclear fuel. These management functions include using the DOE standardized canister for packaging, storage, treatment, transport, and long-term disposal in the Yucca Mountain Repository. Nuclear criticality must be prevented in the postulated event where a waste package is breached and water (neutron moderator) is introduced into the waste package. Criticality control will be implemented by using a new, weldable, corrosion-resistant, neutron-absorbing material to fabricate the welded structural inserts (fuel baskets) that will be placed in the standardized canister. The new alloy is based on the Ni-Cr-Mo alloy system with a gadolinium addition. Gadolinium was chosen as the neutron absorption alloying element because of its high thermal neutron absorption cross section. This paper describes a weld development program to qualify this new material for American Society of Mechanical Engineers (ASME) welding procedures, develop data to extend the present ASME Code Case (unwelded) for welded construction, and understand the weldability and microstructural factors inherent to this alloy.

W. L. Hurt; R. E. Mizia; D. E. Clark

2007-06-01T23:59:59.000Z

409

Coupled spin and valley physics in monolayer MoS2 and group-VI dichalcogenides  

SciTech Connect

We show that inversion symmetry breaking together with spin-orbit coupling leads to coupled spin and valley physics in monolayer MoS2 and group-VI dichalcogenides, making possible controls of spin and valley in these 2D materials. The spin-valley coupling at the valence band edges suppresses spin and valley relaxation, as flip of each index alone is forbidden by the 0.1 eV valley contrasting spin splitting. Valley Hall and spin Hall effects coexist in both electron-doped and hole-doped systems. Optical interband transitions have frequency-dependent polarization selection rules which allow selective photoexcitation of carriers with various combination of valley and spin indices. Photo-induced spin Hall and valley Hall effects can generate long lived spin and valley accumulations on sample boundaries. The physics discussed here provides a route towards the integration of valleytronics and spintronics in multi-valley materials with strong spin-orbit coupling and inversion symmetry breaking.

Xiao, Di [ORNL; Liu, G. B. [University of Hong Kong, The; Feng, wanxiang [Chinese Academy of Sciences; Xu, Xiaodong [University of Washington; Yao, Wang [University of Hong Kong, The

2012-01-01T23:59:59.000Z

410

Window nighttime U-values: A comparison between computer calculations and MoWiTT measurements  

SciTech Connect

The proper specification of window U-values has been a controversial area for many years, and current attempts to incorporate more careful treatment of windows into building standards and utility conservation programs and to define window energy labels has heightened the controversy. In a previous paper (Klems 1979) it was argued that current calculation techniques, as embodied in the computer program WINDOW, accurately represented field-measured window U-values, provided frame corrections and surface heat transfer coefficients were correctly estimated, and that in most cases the calculations were also consistent with test laboratory measurements on the same windows. This means that the calculation could serve both as a standard for deriving calculated U-values and as a method of comparing measurements made under different conditions to determine their consistency. This work has now been extended to form a joint US/Canadian collaborative effort to test current computer programs. For six windows the U-values measured with the MoWiTT under field conditions are compared with detailed U-value calculations for the same conditions using the programs WINDOW and ANSYS. There is good agreement between measurements and calculations. 7 refs., 3 figs., 4 tabs.

Klems, J.H.; Reilly, S.

1989-11-01T23:59:59.000Z

411

Progress in converting {sup 99}Mo production from high- to low-enriched uranium--1999.  

SciTech Connect

Over this past year, extraordinary progress has been made in executing our charter to assist in converting Mo-99 production worldwide from HEU to LEU. Building on the successful development of the experimental LEU-foil target, we have designed a new, economical irradiation target. We have also successfully demonstrated, in collaboration with BATAN in Indonesia, that LEU can be substituted for HEU in the Cintichem target without loss of product yield or purity; in fact, conversion may make economic sense. We are interacting with a number of commercial producers--we have begun active collaborations with the CNEA and ANSTO; we are working to define the scope of collaborations with MDS Nordion and Mallinckrodt; and IRE has offered its services to irradiate and test a target at the appropriate time. Conversion of the CNEA process is on schedule. Other papers presented at this meeting will present specific results on the demonstration of the LEU-modified Cintichem process, the development of the new target, and progress in converting the CNEA process.

Snelgrove, J. L.; Vandegrift, G. F.; Conner, C.; Wiencek, T. C.; Hofman, G. L.

1999-09-29T23:59:59.000Z

412

Glass forming ability of the Mo-Pd system studied by thermodynamic modeling and ion beam mixing  

SciTech Connect

Glass forming ability/range of the Mo-Pd binary metal system was studied by thermodynamic calculations employing Miedema's model and ion beam mixing of multiple metal layers. The thermodynamic calculations predict a narrow composition range of 8-26 at% Pd, within which metallic glass formation is energetically favored, whereas the experimental results showed that ion beam mixing was able to synthesize metallic glasses within a composition range 13-30 at% Pd, which was well in accordance with the prediction. Besides, in the Mo{sub 70}Pd{sub 30} multilayered films, with varying the irradiation dose, a dual-phase metallic glass was formed, and it could be considered as an intermediate state. The possible mechanism for the formation of the metallic glasses was also discussed in terms of the atomic collision theory.

Ding, N.; Li, J. H.; Liu, B. X.

2011-07-01T23:59:59.000Z

413

Feasibility study Part I - Thermal hydraulic analysis of LEU target for {sup 99}Mo production in Tajoura reactor  

SciTech Connect

The Renewable Energies and Water Desalination Research Center (REWDRC), Libya, will implement the technology for {sup 99}Mo isotope production using LEU foil target, to obtain new revenue streams for the Tajoura nuclear research reactor and desiring to serve the Libyan hospitals by providing the medical radioisotopes. Design information is presented for LEU target with irradiation device and irradiation Beryllium (Be) unit in the Tajoura reactor core. Calculated results for the reactor core with LEU target at different level of power are presented for steady state and several reactivity induced accident situations. This paper will present the steady state thermal hydraulic design and transient analysis of Tajoura reactor was loaded with LEU foil target for {sup 99}Mo production. The results of these calculations show that the reactor with LEU target during the several cases of transient are in safe and no problems will occur. (author)

Bsebsu, F.M.; Abotweirat, F. [Reactor Department, Renewable Energies and Water Desalination Research Cente, P.O. Box 30878 Tajoura, Tripoli (Libyan Arab Jamahiriya)], E-mail: Bsebso@yahoo.com, E-mail: abutweirat@yahoo.com; Elwaer, S. [Radiochemistry Department, Renewable Energies and Water Desalination Research Cente, P.O. Box 30878 Tajoura, Tripoli (Libyan Arab Jamahiriya)], E-mail: samiwer@yahoo.com

2008-07-15T23:59:59.000Z

414

Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan

2008-09-30T23:59:59.000Z

415

Modeling, synthesis and characterization of LiMn{sub 2}O{sub 4} spinels  

DOE Green Energy (OSTI)

The authors report on an integrated program to understand the fundamentals of LiMn{sub 2}O{sub 4} performance as a cathode for lithium ion rechargeable batteries. Specifically, this program is designed to address the effects of doping on the crystal chemistry, lattice constants, and electrochemical performance. The work is being expanded to include studies on LiCoO{sub 2} and LiNiO{sub 2}.

Doughty, D.H.; Ingersoll, D.; Cygan, R.T.; Westrich, H.R.; Rodriguez, M.A.; Boyle, T.J.; Voigt, J.A. [Sandia National Labs., Albuquerque, NM (United States); Johnson, B.J. [3M Co., St. Paul, MN (United States). Specialty Chemicals Div.

1997-11-01T23:59:59.000Z

416

Annealing effect on the giant magnetoresistance of La-Ca-Mn-O thin films  

SciTech Connect

Thin films of perovskite-like (La,Ca)MnO{sub {delta}} with (001) orientation were grown epitaxially on (100) MgO substrates by a simple facing-target sputtering technique. The as-deposited films already possess a significant low field giant magnetoresistance. Further post-annealing experiments on these samples indicate that the high electrical resistivity is not a prerequisite of the giant magnetoresistance effect.

Zeng, X.T.; Wong, H.K. [Chinese Univ. of Hong Kong, Chatin (Hong Kong). Physics Dept.

1995-11-01T23:59:59.000Z

417

Elastic Properties of the Zintl Ferromagnet Yb14MnSb11  

SciTech Connect

We report measurements of the elastic moduli as a function of temperature (5-300) K and magnetic field (0-2 T) for the Zintl ferromagnet Yb{sub 14}MnSb{sub 11}, which is believed to be a rare example of an underscreened Kondo lattice. The elastic moduli measured below the Curie temperature in this complex ferromagnet exhibit unusual lattice stiffening that is independent of the magnetic field and can be adequately modeled using the Landau theory.

Bhattacharya, Sriparna [University of Tennessee, Knoxville (UTK); Marinescu, D. C. [Clemson University; Morris, James R [ORNL; Sergienko, Ivan A [ORNL; Sales, Brian C [ORNL; Mandrus, D. [University of Tennessee, Knoxville (UTK) & Oak Ridge National Laboratory (ORNL); Keppens, V. [University of Tennessee, Knoxville (UTK)

2012-01-01T23:59:59.000Z

418

LiFe(x)Mn(1-x)PO(4): A Cathode for Lithium-ion Batteries  

DOE Green Energy (OSTI)

The high redox potential of LiMnPO{sub 4}, {approx}4.0 vs. (Li{sup +}/Li), and its high theoretical capacity of 170 mAh g{sup -1} makes it a promising candidate to replace LiCoO{sub 2} as the cathode in Li-ion batteries. However, it has attracted little attention because of its severe kinetic problems during cycling. Introducing iron into crystalline LiMnPO{sub 4} generates a solid solution of LiFe{sub x}Mn{sub 1-x}PO{sub 4} and increases kinetics; hence, there is much interest in determining the Fe-to-Mn ratio that will optimize electrochemical performance. To this end, we synthesized a series of nanoporous LiFe{sub x}Mn{sub 1-x}PO{sub 4} compounds (with x = 0, 0.05, 0.1, 0.15, and 0.2), using an inexpensive solid-state reaction. The electrodes were characterized using X-ray diffraction and energy-dispersive spectroscopy to examine their crystal structure and elemental distribution. Scanning-, tunneling-, and transmission-electron microscopy (viz., SEM, STEM, and TEM) were employed to characterize the micromorphology of these materials; the carbon content was analyzed by thermogravimetric analyses (TGAs). We demonstrate that the electrochemical performance of LiFe{sub x}Mn{sub 1-x}PO{sub 4} rises continuously with increasing iron content. In situ synchrotron studies during cycling revealed a reversible structural change when lithium is inserted and extracted from the crystal structure. Further, introducing 20% iron (e.g., LiFe{sub 0.2}Mn{sub 0.8}PO{sub 4}) resulted in a promising capacity (138 mAh g{sup -1} at C/10), comparable to that previously reported for nano-LiMnPO{sub 4}.

J Hong; F Wang; X Wang; J Graetz

2011-12-31T23:59:59.000Z

419

Inhomogeneous distribution of mercury on the surfaces of rapidly rotating HgMn stars  

E-Print Network (OSTI)

Starspots are usually associated with the action of magnetic fields at the stellar surfaces. However, recently an inhomogeneous chemical distribution of mercury was found for the mercury-manganese (HgMn) star alpha And -- a well-established member of a non-magnetic subclass of the chemically peculiar stars of the upper main sequence. In this study we present first results of the high-resolution survey of the HgII 3984 resonance line in the spectra of rapidly rotating HgMn stars with atmospheric parameters similar to those of alpha And. We use spectrum synthesis modelling and take advantage of the Doppler resolution of the stellar surfaces to probe horizontal structure of mercury distribution. Clear signatures of spots are found in the HgII 3984 line profiles of HR 1185 and HR 8723. Two observations of the latter star separated by two days give evidence for the line profile variability. We conclude that inhomogeneous distribution of Hg is a common phenomenon for the rapidly rotating HgMn stars in the 13000--13800 K effective temperature range independently of the stellar evolutionary stage. These results establish existence of a new class of spectrum variable spotted B-type stars. It is suggested that the observed Hg inhomogeneities arise from dynamical instabilities in the chemical diffusion processes and are unrelated to magnetic phenomena.

O. Kochukhov; N. Piskunov; M. Sachkov; D. Kudryavtsev

2005-05-06T23:59:59.000Z

420

Thin-film Li-LiMn{sub 2}O{sub 4} batteries  

DOE Green Energy (OSTI)

Thin-film rechargeable Li-LiMn{sub 2}O{sub 4} batteries have been fabricated and characterized. Following deposition by electron beam evaporation of LiMn{sub 2}O{sub 4}, the amorphous as-deposited cathode films 1 cm{sup 2} in area by 0.3 to 4 {mu}m thick were annealed at 700{degree}C to 800{degree}C in oxygen in order to form the crystalline spinel phase. The capacity of the cells between 4.5 V to 3.8 V depended on the annealing conditions and ranged from 50 {mu}Ah/mg to 120 {mu}Ah/mg. When cycled over this range, the batteries exhibited excellent secondary performance with capacity losses as low as 0.001% per cycle. On charging to 5.3 V, a plateau with a median voltage of 5.1 V was observed. The total charge extracted between 3.8 V to 5.3 V corresponded to about 1Li/Mn{sub 2}O{sub 4}.

Bates, J.B.; Lubben, D.; Dudney, N.J.

1994-11-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Redox Active Layer-by-Layer Structures containing MnO2 Nanoparticles  

Science Conference Proceedings (OSTI)

Nanoscale materials provide unique properties that will enable new technologies and enhance older ones. One area of intense activity in which nanoscale materials are being used is in the development of new functional materials for battery applications. This effort promises superior materials with properties that circumvent many of the problems associated with traditional battery materials. Previously we have worked on several approaches for using nanoscale materials for application as cathode materials in rechargeable Li batteries. Our recent work has focused on synthesizing MnO2 nanoparticles and using these in layer-by-layer (LbL) structures to probe the redox properties of the nanoparticles. We show that the aqueous colloidal nanoparticles produced by butanol reduction of tetramethylammonium permanganate can be trapped in thin films using a layer-by-layer deposition approach, and that these films are both redox active and exhibit kinetically facile electrochemical responses. We show cyclic voltammetry of MnO2 colloidal nanoparticles entrapped in a LbL thin film at an ITO electrode surface using poly(diallyldimethylammonium chloride) (PDDA). CV experiments demonstrate that Li+ insertion accompanies Mn(IV) reduction in LiClO4 supporting electrolytes, and that reduction is hindered in supporting electrolytes containing only tetrabutylammonium cations. We also show that electron propagation through multilayer films is facile, suggesting that electrons percolate through the films via electron exchange between nanoparticles.

Bazito, Fernanda; O'Brien, Robert; Buttry, Daniel A.

2005-02-01T23:59:59.000Z

422

Development of (Mn,Co)3O4 Protection Layers for Ferritic Stainless Steel Interconnects  

DOE Green Energy (OSTI)

A spinel-based surface protection layer has been developed for alloy SOFC current collectors and bi-polar gas separators. The (Mn,Co)3O4 spinel with a nominal composition of Mn1.5Co1.5O4 demonstrates an excellent electrical conductivity and thermal expansion match to ferritic stainless steel interconnects. A slurry-coating technique provides a viable approach for fabricating protective layers of the spinel onto the steel interconnects. Thermally grown protection layers of Mn1.5Co1.5O4 have been found not only to significantly decrease the contact resistance between a LSF cathode and stainless steel interconnect, but also inhibits the sub-scale growth on the stainless steel. The combination of the inhibited sub-scale growth, good thermal expansion matching between the spinel and the stainless steel, and the closed-pore structure contribute to the excellent structural and thermomechanical stability of these spinel protection layers, which was verified by a long-term thermal-cycling test. The spinel protection layers can also act effectively to prevent outward diffusion of chromium from the interconnect alloy, preventing subsequent chromium migration into the cathode and contact materials. PNNL is currently engaged in studies intended to optimize the composition, microstructure, and fabrication procedure for the spinel protection layers.

Yang, Zhenguo; Simner, Steven P.; Singh, Prabhakar; Xia, Guanguang; Stevenson, Jeffry W.

2005-07-05T23:59:59.000Z

423

Investigation of the Charge Collection Efficiency of CdMnTe Radiation Detectors  

SciTech Connect

This paper presents the growth, fabrication and characterization of indium-doped cadmium manganese telluride (CdMnTe) crystals grown by the vertical Bridgman technique. The 10 x 10 x 1.9 mm{sup 3} samples have been fabricated, and the charge collection properties of the CdMnTe detectors have been measured. Alpha-particle spectroscopy measurements have yielded an average charge collection efficiency approaching 100%. Ion beam induced charge (IBIC) measurements have been performed by raster scanning focused 5.5 MeV {sup 4}He beams onto the detectors. Spatially resolved charge collection efficiency maps have been produced for a range of detector bias voltages. Inhomogeneities in the charge transport of the CdMnTe crystals have been associated with chains of Te inclusions within the detector bulk, and the reduction in charge collection efficiency in their locality has been quantified. It has been shown that the role of Te inclusions in degrading charge collection is reduced with increasing values of bias voltage. IBIC measurements for a range of low biases have highlighted the evolution of the charge collection uniformity across the detectors.

Bolotnikov A.; Rafiei, R.; Boardman, D.; Sarbutt, A.; Prokopovich, A.; Kim, K.; Reinhard, M.I.; James, R.B.

2012-06-01T23:59:59.000Z

424

Carriers-mediated ferromagnetic enhancement in Al-doped ZnMnO dilute magnetic semiconductors  

SciTech Connect

Nano-crystalline Zn{sub 0.95-x}Mn{sub 0.05}Al{sub x}O (x = 0, 0.05, 0.10) dilute magnetic semiconductors (DMS) were synthesized by sol-gel derived auto-combustion. X-ray diffraction (XRD) analysis shows that the samples have pure wurtzite structure typical of ZnO without the formation of secondary phases or impurity. Crystallite sizes were approximated by Scherrer formula while surface morphology and grain sizes were measured by field emission scanning electron microscopy. Incorporation of Mn and Al into the ZnO structure was confirmed by energy-dispersive X-ray analysis. Temperature dependent electrical resistivity measurements showed a decreasing trend with the doping of Al in ZnMnO, which is attributable to the enhancement of free carriers. Vibrating sample magnetometer studies confirmed the presence of ferromagnetic behavior at room temperature. The results indicate that Al doping results in significant variation in the concentration of free carriers and correspondingly the carrier-mediated magnetization and room temperature ferromagnetic behavior, showing promise for practical applications. We attribute the enhanced saturation magnetization and electrical conductivity to the exchange interaction mediated by free electrons.

Saleem, Murtaza [Centre of Excellence in Solid State Physics, University of the Punjab, Lahore-54590 (Pakistan); Siddiqi, Saadat A. [Centre of Excellence in Solid State Physics, University of the Punjab, Lahore-54590 (Pakistan); Interdisciplinary Research Centre in Biomedical Materials (IRCBM), COMSATS Institute of Information Technology, Defence Road, Off Raiwind Road, Lahore (Pakistan); Atiq, Shahid, E-mail: shahidatiqpasrur@yahoo.com [Centre of Excellence in Solid State Physics, University of the Punjab, Lahore-54590 (Pakistan); Anwar, M. Sabieh; Hussain, Irshad [School of Science and Engineering (SSE), Lahore University of Management Sciences (LUMS), Opposite Sector U, D.H.A. Lahore Cantt-54792 (Pakistan); Alam, Shahzad [Pakistan Council for Scientific and Industrial Research (PCSIR) Laboratories Complex, Lahore (Pakistan)

2011-11-15T23:59:59.000Z

425

Mn-doped Ga(As,P) and (Al,Ga)As ferromagnetic semiconductors: Electronic structure calculations  

E-Print Network (OSTI)

A remarkable progress towards functional ferromagnetic semiconductor materials for spintronics has been achieved in p-type (Ga,Mn)As. Robust hole-mediated ferromagnetism has, however, been observed also in other III-V hosts such as antimonides, GaP, or (Al,Ga)As, which opens a wide area of possibilities for optimizing the host composition towards higher ferromagnetic Curie temperatures. Here we explore theoretically hole-mediated ferromagnetism and Mn incorporation in Ga(As,P) and (Al,Ga)As ternary hosts. While alloying (Ga,Mn)As with Al has only a small effect on the Curie temperature we predict a sizable enhancement of Curie temperatures in the smaller lattice constant Ga(As,P) hosts. Mn-doped Ga(As,P) is also favorable, as compared to (Al,Ga)As, with respect to the formation of carrier and moment compensating interstitial Mn impurities. In (Ga,Mn) (As,P) we find a marked decrease of the partial concentration of these detrimental impurities with increasing P content.

Masek, J.; Kudrnovsky, J.; Maca, F.; Sinova, Jairo; MacDonald, A. H.; Campion, R. P.; Gallagher, B. L.; Jungwirth, T.

2007-01-01T23:59:59.000Z

426

1: Mass asymmetric fission barriers for {sup 98}Mo; 2: Synthesis and characterization of actinide-specific chelating agents  

SciTech Connect

Excitation functions have been measured for complex fragment emission from the compound nucleus {sup 98}Mo, produced by the reaction of {sup 86}Kr with {sup 12}C. Mass asymmetric fission barriers have been obtained by fitting the excitation functions with a transition state formalism. The extracted barriers are {approximately} 5.7 MeV higher, on average, than the calculations of the Rotating Finite Range Model (RFRM). These data clearly show an isospin dependence of the conditional barriers when compared with the extracted barriers from {sup 90}Mo and {sup 94}Mo. Eleven different liquid/liquid extractants were synthesized based upon the chelating moieties 3,2-HOPO and 3,4-HOPO; additionally, two liquid/liquid extractants based upon the 1,2-HOPO chelating moiety were obtained for extraction studies. The Pu(IV) extractions, quite surprisingly, yielded results that were very different from the Fe(III) extractions. The first trend remained the same: the 1,2-HOPOs were the best extractants, followed closely by the 3,2-HOPOs, followed by the 3,4-HOPOs; but in these Pu(IV) extractions the 3,4-HOPOs performed much better than in the Fe(III) extractions. 129 refs.

Veeck, A.C. [Univ. of California, Berkeley, CA (United States). Dept. of Chemistry]|[Lawrence Livermore National Lab., CA (United States). Glenn T. Seaborg Inst. for Transactinium Science]|[Lawrence Berkeley National Lab., CA (United States). Nuclear Science Div.

1996-08-01T23:59:59.000Z

427

11/11/2002 1AVS 49th Int'l Symp. MS-MoA7 (Oct. 29, 2002) -Cho Dynamic Simulation and Optimization  

E-Print Network (OSTI)

'l Symp. MS-MoA7 (Oct. 29, 2002) - Cho Scope & Strategy Multilevel modeling & simulation incorporating dynamics &Multilevel modeling & simulation incorporating dynamics & stochasticsstochastics ESH fluctuations Incorporate capability in models for dynamics & stochastics Process & tool Fundamental science Si

Rubloff, Gary W.

428

Presented at the ASHRAE 2003 Annual Meeting, June 28 July 2, 2003, in Kansas City, MO, and published in ASHRAE Transactions 109, part 2: 733-739  

E-Print Network (OSTI)

LBNL-50219 Presented at the ASHRAE 2003 Annual Meeting, June 28 ­ July 2, 2003, in Kansas City, MO, and published in ASHRAE Transactions 109, part 2: 733-739 The research reported here was funded, in part

429

Fischer Tropsch synthesis : influence of Mn on the carburization rates and activities of Fe-based catalysts by TPR-EXAFS/XANES and catalyst testing.  

Science Conference Proceedings (OSTI)

Fe-based catalysts containing different amounts of Mn were tested for Fischer-Tropsch synthesis using a stirred tank reactor at 270 C, 1.21 MPa, and H{sub 2}:CO = 0.7. Catalyst activation by carburization with 10% CO/He was followed by Temperature Programmed Reduction/X-ray Absorption Spectroscopy (TPR-EXAFS/XANES) from room temperature to 300 C. {gamma}-Fe{sub 2}O{sub 3} was converted into iron carbides, whereas MnO{sub x} was reduced to oxygen deficient MnO. Mn hindered Fe carburization, such that the carburized catalyst displayed higher Fe{sub 3}O{sub 4} content than the catalyst without Mn. EXAFS fitting indicates that the carburized catalyst contained a mixture of Hgg carbide, Fe{sub 3}O{sub 4}, and Mn oxides. Increasing Mn content led to higher CH{sub 4} and light product selectivities, and lower light olefin selectivities. Higher and stable conversions were obtained with a catalyst containing an almost equimolar Fe/Mn ratio relative to the catalyst without Mn. Selectivity trends are attributed to the higher WGS rates observed on the FeMn catalysts, consistent with the structural differences observed.

Ribeiro, M. C.; Jacobs, G.; Pendyala, R.; Davis, B. H.; Cronauer, D. C.; Kropf, A. J.; Marshall, C. L. (Chemical Sciences and Engineering Division); (Univ. of Kentucky)

2011-03-24T23:59:59.000Z

430

Ab initio calculations and synthesis of the off-stoichiometric half-Heusler phase Ni{sub 1-x}Mn{sub 1+x}Sb  

SciTech Connect

We perform a combined theoretical and experimental study of the phase stability and magnetism of the off-stoichiometric Ni{sub 1-x}Mn{sub 1+x}Sb in the half-Heusler crystal phase. Our work is motivated by the need for strategies to engineer the magnetism of potentially half-metallic materials, such as NiMnSb, for improved performance at elevated temperatures. By means of ab initio calculations we investigate Ni{sub 1-x}Mn{sub 1+x}Sb over the whole composition range 0{<=}x{<=}1 of Ni replacing Mn and show that at relevant temperatures, the half-Heusler phase should be thermodynamically stable up to at least x=0.20 with respect to the competing C38 structure of Mn{sub 2}Sb. Furthermore we find that half-Heusler Ni{sub 1-x}Mn{sub 1+x}Sb retains half-metallic band structure over the whole concentration range and that the magnetic moments of substitutional Mn{sub Ni} atoms display magnetic exchange interactions an order of magnitude larger than the Ni-Mn interaction in NiMnSb. We also demonstrate experimentally that the alloys indeed can be created by synthesizing off-stoichiometric Ni{sub 1-x}Mn{sub 1+x}Sb films on MgO substrates by means of magnetron sputtering.

Ekholm, M.; Larsson, P.; Alling, B.; Helmersson, U.; Abrikosov, I. A. [Department of Physics, Chemistry and Biology (IFM), Linkoeping University, SE-58183 Linkoeping (Sweden)

2010-11-15T23:59:59.000Z

431

Why MnIn{sub 2}O{sub 4} spinel is not a transparent conducting oxide?  

SciTech Connect

The title compound has been synthesized by a citrate technique. The crystal structure has been investigated at room temperature from high-resolution neutron powder diffraction (NPD) data. It crystallizes in a cubic spinel structure, space group Fd3-bar m, Z=8, with a=9.0008(1) A at 295 K. It exhibits a crystallographic formula (Mn{sub 0.924(2)}In{sub 0.076(2)}){sub 8a}(In{sub 1.804(2)}Mn{sub 0.196(2)}){sub 16d}O{sub 4}, where 8a and 16d stand for the tetrahedral and octahedral sites of the spinel structure, respectively, with a slight degree of inversion, {lambda}=0.08. MnIn{sub 2}O{sub 4} shows antiferromagnetic interactions below T{sub N} Almost-Equal-To 40 K, due to the statistical distribution of Mn ions over the two available sites. Unlike the related MgIn{sub 2}O{sub 4} and CdIn{sub 2}O{sub 4} spinels, well known as transparent conducting oxides, MnIn{sub 2}O{sub 4} is not transparent and shows a poor conductivity ({sigma}=0.38 S cm{sup -1} at 1123 K): the presence of Mn ions, able to adopt mixed valence states, localizes the charges that, otherwise, would be delocalized in the spinel conduction band. - Graphical Abstract: From NPD data the crystallographic formula (Mn{sub 0.924(2)}In{sub 0.076(2)}){sub 8a}(In{sub 1.804(2)}Mn{sub 0.196(2)}){sub 16d}O{sub 4}, shows a slight degree of inversion, {lambda}=0.08 and a certain In deficiency. The presence of Mn ions, able to adopt mixed oxidation states, localize the charges that, otherwise, would be delocalized in the spinel conduction band; the presence of localized Mn{sup 2+} and Mn{sup 3+} ions provides the characteristic brown color. Highlights: Black-Right-Pointing-Pointer Accurate structural determination from NPD data: inversion degree (8%), and In deficiency. Black-Right-Pointing-Pointer Bond-valence indicates Mn{sup 2+}-Mn{sup 3+} ions; edge-sharing octahedra contain 90% In{sup 3+}+10% Mn{sup 3+} cations. Black-Right-Pointing-Pointer Conductivity several orders of magnitude lower than those of MgIn{sub 2}O{sub 4} or CdIn{sub 2}O{sub 4}. Black-Right-Pointing-Pointer Variability of Mn oxidation states cancels any electron-doping effect, emptying conduction band of mobile charge carriers. Black-Right-Pointing-Pointer Curie-Weiss behavior confirming the determined charge distribution.

Martinez-Lope, M.J. [Instituto de Ciencia de Materiales de Madrid, C.S.I.C., Cantoblanco E-28049 Madrid (Spain); Retuerto, M. [Instituto de Ciencia de Materiales de Madrid, C.S.I.C., Cantoblanco E-28049 Madrid (Spain); Department of Chemistry, Rutgers State University of New Jersey, Piscataway, NJ 08854-8087 (United States); Calle, C. de la [Instituto de Ciencia de Materiales de Madrid, C.S.I.C., Cantoblanco E-28049 Madrid (Spain); Porcher, Florence [Laboratoire Leon Brillouin, CEA/Saclay, 91191 Gif Sur Ivette Cedex, France. (France); Alonso, J.A., E-mail: ja.alonso@icmm.csic.es [Instituto de Ciencia de Materiales de Madrid, C.S.I.C., Cantoblanco E-28049 Madrid (Spain)

2012-03-15T23:59:59.000Z

432

Field Evaluation of the Comanagement of Utility Low-Volume Wastes with High-Volume Coal Combustion By-Products: MO Site  

Science Conference Proceedings (OSTI)

This report documents an investigation into the effects of comanagement of low-volume wastes with high-volume coal combustion by-products at the MO site. The MO site is one of 14 investigated by EPRI to provide background information to the United States Environmental Protection Agency (EPA) for the 2000 Regulatory Determination on comanagement under the Resource Conservation and Recovery Act (RCRA).

2003-09-29T23:59:59.000Z

433

A high temperature neutron diffraction study of the double perovskite Ba{sub 2}{sup 154}SmMoO{sub 6}  

SciTech Connect

Ba{sub 2}LnMoO{sub 6} double perovskites have been recently shown to display a wide range of interesting magnetic and structural properties; Ba{sub 2}{sup 154}SmMoO{sub 6} exhibits simultaneous antiferromagnetic order and a Jahn-Teller distortion. Here we report a high temperature neutron diffraction study of Ba{sub 2}{sup 154}SmMoO{sub 6} from 353 to 877 K. The results evidence a tetragonal to cubic phase transition at 423 K. Above this temperature the thermal displacement parameters of the oxygen atoms are modelled anisotropically as a result of a transverse vibration of the bridging oxygen. A smooth increase in the cell parameter a is observed with temperature for Ba{sub 2}{sup 154}SmMoO{sub 6}. - Graphical abstract: The high temperature crystal structure of Ba{sub 2}{sup 154}SmMoO{sub 6} evidencing a transverse oxygen vibration. Highlights: Black-Right-Pointing-Pointer A high temperature neutron diffraction study has been performed on an isotopically enriched sample of Ba{sub 2}{sup 154}SmMoO{sub 6}. Black-Right-Pointing-Pointer A cubic-tetragonal phase transition occurs below 423 K. Black-Right-Pointing-Pointer The thermal displacement parameters of the bridging oxygens are modelled anisotropically. Black-Right-Pointing-Pointer There is a transverse vibration of the bridging oxygen.

Wallace, Thomas K. [Department of Chemistry, University of Aberdeen, Meston Walk, Aberdeen AB24 3UE (United Kingdom)] [Department of Chemistry, University of Aberdeen, Meston Walk, Aberdeen AB24 3UE (United Kingdom); Ritter, Clemens [Institut Laue Langevin, 6 rue Jules Horowitz, BP 156, F-38042 Grenoble Cedex 9 (France)] [Institut Laue Langevin, 6 rue Jules Horowitz, BP 156, F-38042 Grenoble Cedex 9 (France); Mclaughlin, Abbie C., E-mail: a.c.mclaughlin@abdn.ac.uk [Department of Chemistry, University of Aberdeen, Meston Walk, Aberdeen AB24 3UE (United Kingdom)

2012-12-15T23:59:59.000Z

434

Preparation of anisotropic Nd(Fe,Mo){sub 12}N{sub 1.0} magnetic materials by strip casting technique and direct nitrogenation for the strips  

SciTech Connect

The Nd(Fe,Mo){sub 12}-type alloys are prepared by strip casting technique, and direct nitrogenation of the strips without precrushing is executed in this paper. It is found that 6 h annealing treatment at 1050 deg. C for the strips is enough to obtain the single-phase Nd(Fe,Mo){sub 12} compounds. The strips can be directly nitrogenated at 620 deg. C to obtain interstitial Nd(Fe,Mo){sub 12}N{sub 1.0} materials, and a spontaneous pulverization phenomenon in the strips induced by nitrogenation is found. The results indicate that the nitrogenation process of the strips can be used to prepare Nd(Fe,Mo){sub 12}N{sub 1.0} interstitial nitrides and pulverize the casted strips into fine particles simultaneously. Base on this, we propose a new technical route of preparing Nd(Fe,Mo){sub 12}N{sub X} magnetic powders without precrushing and obtain anisotropic NdFe{sub 10.5}Mo{sub 1.5}N{sub 1.0} powders with a remanence of B{sub r} = 1.08 T, a coercivity of {sub i}H{sub c} = 400 kA/m, and a maximum energy product of (BH){sub max} = 144 kJ/m{sup 3}.

Han Jingzhi; Liu Shunquan; Xing Meiying; Lin Zhong; Kong Xiangpeng; Wang Changsheng; Du Honglin; Yang Yingchang [School of Physics, Peking University, Beijing 100871 (China); Yang Jinbo [School of Physics, Peking University, Beijing 100871 (China); State Key Laboratory for Artificial Microstructure and Mesoscopic Physics, School of Physics, Peking University, Beijing 100871 (China)

2011-04-01T23:59:59.000Z

435

A low-temperature extraction-solvothermal route to the fabrication of micro-sized MoS{sub 2} spheres modified by Cyanex 301  

Science Conference Proceedings (OSTI)

Mono-dispersed molybdenum disulfide micro-spheres with the diameter of 1-3 {mu}m have been successfully synthesized via extraction-solvothermal method at 150 deg. C. The extractant Cyanex 301 (di-(2,4,4-trimethylpentyl) dithiophosphinic acid) acted as phase transferring agent, reductant, sulfur source and morphology-controlling agent in the whole procedure. The obtained MoS{sub 2} micro-spheres were characterized by XRD, EDS, SEM, TEM, HRTEM, IR, UV-Vis and TG, respectively. The influences of reaction conditions were discussed while a mechanism was proposed to explain the formation of the micro-spheres. Moreover, the tribological properties of liquid paraffin (LP) containing Cyanex 301-modified MoS{sub 2} micro-spheres were also evaluated on a four-ball machine, showing that the obtained MoS{sub 2} product was an excellent oil additive in LP and such lubricant had good anti-wear and friction-reducing properties. - Graphical abstract: Mono-dispersed MoS{sub 2} micro-spheres with the diameter of 1-3 {mu}m were synthesized in gasoline via extraction-solvothermal method at 150 deg. C. The MoS{sub 2} product could be well dispersed into organic solvents again and the tribological properties of liquid paraffin (LP) containing MoS{sub 2} micro-spheres were improved.

Shi Huaqiang [Qingdao University of Science and Technology, Qingdao, Shandong 266042 (China); Fu Xun [Qingdao University of Science and Technology, Qingdao, Shandong 266042 (China)]. E-mail: fuxun4483@163.com; Zhou Xiaodong [Qingdao University of Science and Technology, Qingdao, Shandong 266042 (China); Wang Debao [Qingdao University of Science and Technology, Qingdao, Shandong 266042 (China); Hu Zhengshui [Qingdao University of Science and Technology, Qingdao, Shandong 266042 (China)

2006-06-15T23:59:59.000Z

436

Hydrothermal synthesis and luminescent properties of NaLa(MoO{sub 4}){sub 2}:Dy{sup 3+} phosphor  

SciTech Connect

Pompon-like NaLa(MoO{sub 4}){sub 2}:Dy{sup 3+} phosphors have been successfully prepared via a hydrothermal method using ammonia as pH value regulator. The hydrothermal process was carried out under aqueous condition without the use of any organic solvent, surfactant, and catalyst. The experimental results demonstrate that the obtained NaLa(MoO{sub 4}){sub 2}:Dy{sup 3+} phosphor powders are single-phase scheelite structure with tetragonal symmetry. Moreover, the phosphor under the excitation of 390 and 456 nm exhibited blue emission (486 nm) and yellow emission (574 nm), corresponding to the {sup 4}F{sub 9/2}{yields}{sup 6}H{sub 15/2} transition and {sup 4}F{sub 9/2}{yields}{sup 6}H{sub 13/2} transition of Dy{sup 3+} ions, respectively. In addition, the yellow-to-blue emission intensity ratio (Y/B) can be changed with the doped concentration of Dy{sup 3+} ions. All chromaticity coordinates of the obtained NaLa(MoO{sub 4}){sub 2}:Dy{sup 3+} phosphors are located in the white-light region. The results indicate that this kind of phosphor may has potential applications in the fields of near UV-excited and blue-excited white LEDs. - Graphical abstract: It can be seen from the SEM images that a pompon-like shape was obtained with an average diameter of about 1 {mu}m, and it is composed of many nanoflakes. Highlights: Black-Right-Pointing-Pointer Pompon-like NaLa(MoO{sub 4}){sub 2}:Dy{sup 3+} phosphors have been successfully prepared via a hydrothermal method. Black-Right-Pointing-Pointer Blue emission at 486 nm and yellow emission at 574 nm were obtained from the samples. Black-Right-Pointing-Pointer The yellow-to-blue emission intensity ratio (Y/B) can be changed with the doped concentration of Dy{sup 3+} ions. Black-Right-Pointing-Pointer NaLa(MoO{sub 4}){sub 2}:Dy{sup 3+} can be efficiently excited by the blue light and the near ultraviolet light.

Li Linlin; Zi Wenwen; Li Guanghuan; Lan Shi; Ji Guijuan [College of Chemistry, Jilin University, Changchun 130026 (China); Gan Shucai, E-mail: gansc@jlu.edu.cn [College of Chemistry, Jilin University, Changchun 130026 (China); Zou Haifeng [College of Chemistry, Jilin University, Changchun 130026 (China); Xu Xuechun [College of Earth Sciences, Jilin University, Changchun 130026 (China)

2012-07-15T23:59:59.000Z

437

Conformal growth of Mo/Si multilayers on grating substrates using collimated ion beam sputtering  

SciTech Connect

Deposition of multilayers on saw-tooth substrates is a key step in the fabrication of multilayer blazed gratings (MBG) for extreme ultraviolet and soft x-rays. Growth of the multilayers can be perturbed by shadowing effects caused by the highly corrugated surface of the substrates, which results in distortion of the multilayer stack structure and degradation of performance of MBGs. To minimize the shadowing effects we used an ionbeam sputtering machine with a highly collimated atomic flux to deposit Mo/Si multilayers on saw-tooth substrates. The sputtering conditions were optimized by finding a balance between smoothening and roughening processes in order to minimize degradation of the groove profile in the course of deposition and at the same time to keep the interfaces of a multilayer stack smooth enough for high efficiency. An optimal value of energy of 200 eV for sputtering Kr{sup +} ions was found by deposition of test multilayers on flat substrates at a range of ion energies. Two saw-tooth substrates were deposited at energies of 200 eV and 700 eV for the sputtering ions. It was found that reduction of the ion energy improved the blazing performance of the MBG and resulted in a 40% gain in the diffraction efficiency due to better replication of the groove profile by the multilayer. As a result of the optimization performed, an absolute diffraction efficiency of 28.8% was achieved for the 2nd blaze order of the MBG with a groove density of 7350 lines/mm at a wavelength of 13.5 nm. Details of the growth behavior of the multilayers on flat and saw-tooth substrates are discussed in terms of the Linear Continuous Model of film growth.

Gawlitza, Peter; Cambie, Rossana; Dhuey, Scott; Gullikson, Eric; Warwick, Tony; Braun, Stefan; Yashchuk, Valeriy; Padmore, Howard

2012-01-23T23:59:59.000Z

438

Laser welding and post weld treatment of modified 9Cr-1MoVNb steel.  

SciTech Connect

Laser welding and post weld laser treatment of modified 9Cr-1MoVNb steels (Grade P91) were performed in this preliminary study to investigate the feasibility of using laser welding process as a potential alternative to arc welding methods for solving the Type IV cracking problem in P91 steel welds. The mechanical and metallurgical testing of the pulsed Nd:YAG laser-welded samples shows the following conclusions: (1) both bead-on-plate and circumferential butt welds made by a pulsed Nd:YAG laser show good welds that are free of microcracks and porosity. The narrow heat affected zone has a homogeneous grain structure without conventional soft hardness zone where the Type IV cracking occurs in conventional arc welds. (2) The laser weld tests also show that the same laser welder has the potential to be used as a multi-function tool for weld surface remelting, glazing or post weld tempering to reduce the weld surface defects and to increase the cracking resistance and toughness of the welds. (3) The Vicker hardness of laser welds in the weld and heat affected zone was 420-500 HV with peak hardness in the HAZ compared to 240 HV of base metal. Post weld laser treatment was able to slightly reduce the peak hardness and smooth the hardness profile, but failed to bring the hardness down to below 300 HV due to insufficient time at temperature and too fast cooling rate after the time. Though optimal hardness of weld made by laser is to be determined for best weld strength, methods to achieve the post weld laser treatment temperature, time at the temperature and slow cooling rate need to be developed. (4) Mechanical testing of the laser weld and post weld laser treated samples need to be performed to evaluate the effects of laser post treatments such as surface remelting, glazing, re-hardening, or tempering on the strength of the welds.

Xu, Z. (Nuclear Engineering Division)

2012-04-03T23:59:59.000Z

439

Conformal growth of Mo/Si multilayers on grating substrates using collimated ion beam sputtering  

SciTech Connect

Deposition of multilayers on saw-tooth substrates is a key step in the fabrication of multilayer blazed gratings (MBG) for extreme ultraviolet and soft x-rays. Growth of the multilayers can be perturbed by shadowing effects caused by the highly corrugated surface of the substrates, which results in distortion of the multilayer stack structure and degradation of performance of MBGs. To minimize the shadowing effects, we used an ion-beam sputtering machine with a highly collimated atomic flux to deposit Mo/Si multilayers on saw-tooth substrates. The sputtering conditions were optimized by finding a balance between smoothening and roughening processes in order to minimize degradation of the groove profile in the course of deposition and at the same time to keep the interfaces of a multilayer stack smooth enough for high efficiency. An optimal value of energy of 200 eV for sputtering Kr{sup +} ions was found by deposition of test multilayers on flat substrates at a range of ion energies. Two saw-tooth substrates were deposited at energies of 200 eV and 700 eV for the sputtering ions. It was found that reduction of the ion energy improved the blazing performance of the MBG and resulted in a 40% gain in the diffraction efficiency due to better replication of the groove profile by the multilayer. As a result of the optimization performed, an absolute diffraction efficiency of 28.8% was achieved for the 2nd blaze order of the MBG with a groove density of 7350 lines/mm at a wavelength of 13.5 nm. Details of the growth behavior of the multilayers on flat and saw-tooth substrates are discussed in terms of the linear continuous model of film growth.

Voronov, D. L.; Cambie, R.; Dhuey, S.; Gullikson, E. M.; Warwick, T.; Yashchuk, V. V.; Padmore, H. A. [Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, California 94720 (United States); Gawlitza, P.; Braun, S. [Fraunhofer Institute for Material and Beam Technology, Winterbergstrasse 28, 01277 Dresden (Germany)

2012-05-01T23:59:59.000Z

440

NONPROFIT ORG DETROIT, MI  

E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor

Note: This page contains sample records for the topic "mi mn mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

In situ XRD Studies of Li-ion Cells with Mixed LiMn2O4 and LiCo1/3Ni1/3Mn1/3O2 Composite Cathode  

Science Conference Proceedings (OSTI)

The structural changes of the composite cathode made by mixing spinel LiMn2O4 and layered LiNi1/3Co1/3Mn1/3O2 in 1:1 wt% in both Li-half and Li-ion cells during charge/discharge are studied by in situ XRD. During the first charge up to {approx}5.2 V vs. Li/Li+, the in situ XRD spectra for the composite cathode in the Li-half cell track the structural changes of each component. At the early stage of charge, the lithium extraction takes place in the LiNi1/3Co1/3Mn1/3O2 component only. When the cell voltage reaches at {approx}4.0 V vs. Li/Li+, lithium extraction from the spinel LiMn2O4 component starts and becomes the major contributor for the cell capacity due to the higher rate capability of LiMn2O4. When the voltage passed 4.3 V, the major structural changes are from the LiNi1/3Co1/3Mn1/3O2 component, while the LiMn2O4 component is almost unchanged. In the Li-ion cell using a MCMB anode and a composite cathode cycled between 2.5 V and 4.2 V, the structural changes are dominated by the spinel LiMn2O4 component, with much less changes in the layered LiNi1/3Co1/3Mn1/3O2 component, comparing with the Li-half cell results. These results give us valuable information about the structural changes relating to the contributions of each individual component to the cell capacity at certain charge/discharge state, which are helpful in designing and optimizing the composite cathode using spinel- and layered-type materials for Li-ion battery research.

Nam, K.; Yoon, W; Shin, H; Chung, K; Choi, S; Yang, X

2009-01-01T23:59:59.000Z

442

Growth kinetics and micromorphology of NH{sub 4}Cl:Mn{sup 2+} crystals formed in the NH{sub 4}Cl-MnCl{sub 2}-H{sub 2}O-CONH{sub 3} system  

Science Conference Proceedings (OSTI)

The growth kinetics and elementary growth processes on the surface of NH{sub 4}Cl:Mn{sup 2+} heterogeneous crystals formed in the NH{sub 4}Cl-MnCl{sub 2}-H{sub 2}O-CONH{sub 3} system are experimentally studied. It is found that a change in the composition of complexes in an NH{sub 4}Cl crystal from Mn(NH{sub 4}){sub 2}Cl{sub 4} {center_dot} 2H{sub 2}O to MnCl{sub 2} {center_dot} 2CONH{sub 3} leads to the occurrence of a local maximum in the kinetic curve and a change in the shape of dislocation growth centers from flat to conical. The growth kinetics of {l_brace}100{r_brace} faces of heterogeneous NH{sub 4}Cl:Mn{sup 2+} crystals is described within the Bliznakov model using the Fowler-Guggenheim adsorption isotherm, which takes into account the lateral interaction of adsorbed particles.

Pyankova, L. A., E-mail: lyuba_pyan@mail.ru; Punin, Yu. O.; Bocharov, S. N.; Shtukenberg, A. G. [Petersburg State University (Russian Federation)

2012-03-15T23:59:59.000Z

443

Probing The Electrode/Electrolyte Interface in The Lithium Excess Layered Oxide Li1.2Ni0.2Mn0.6O2  

Science Conference Proceedings (OSTI)

A detailed surface investigation of the lithium-excess nickel manganese layered oxide Li1.2Ni0.2Mn0.6O2 structure was carried out using x-ray photoelectron spectroscopy (XPS), total electron yield and transmission x-ray absorption spectroscopy (XAS), and electron energy loss spectroscopy (EELS) during the first two electrochemical cycles. All spectroscopy techniques consistently showed the presence of Mn4+ in the pristine material and a surprising reduction of Mn at the voltage plateau during the first charge. The Mn reduction is accompanied by the oxygen loss revealed by EELS. Upon the first discharge, the Mn at the surface never fully returns back to Mn4+. The electrode/electrolyte interface of this compound consists of the reduced Mn at the crystalline defect-spinel inner layer and an oxidized Mn species simultaneously with the presence of a superoxide species in amorphous outer layer. This proposed model signifies that oxygen vacancy formation and lithium removal result in electrolyte decomposition and superoxide formation, leading to Mn activation/dissolution and surface layer-spinel phase transformation. The results also indicate that the role of oxygen is complex and significant in contributing to the extra capacity of this class of high energy density cathode materials.

Carroll, Kyler J [University of California, San Diego; Qian, Danna [University of California, San Diego; Fell, Chris [University of Florida, Gainesville; Calvin, Scott [Sarah Lawrence College; Veith, Gabriel M [ORNL; Chi, Miaofang [ORNL; Dudney, Nancy J [ORNL; Meng, Ying Shirley [University of California, San Diego