Powered by Deep Web Technologies
Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed



NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state

Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)


Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)



Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester


Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab




E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.



E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.


Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan




NLE Websites -- All DOE Office Websites (Extended Search)

François Rémi Carrié [Clear All Filters] François Rémi Carrié [Clear All Filters] 2013 Wargocki, Pawel, Max H. Sherman, Willem de Gids, Peter Wouters, Francis Allard, François Rémi Carrié, Paolo Carrer, and Stylianos Kephalopolous. Proposed Research Agenda for Achieving Indoor Air Quality Supporting Health and Comfort in Highly Energy Efficient Buildings., 2013. 2002 Carrié, François Rémi, Ronnen M. Levinson, Tengfang T. Xu, Darryl J. Dickerhoff, William J. Fisk, Jennifer A. McWilliams, Mark P. Modera, and Duo Wang. "Laboratory and field testing of an aerosol-based duct-sealing technology for large commercial buildings." ASHRAE Transactions (2002). Xu, Tengfang T., François Rémi Carrié, Darryl J. Dickerhoff, William J. Fisk, Jennifer A. McWilliams, Duo Wang, and Mark P. Modera. "Performance of



E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.



NLE Websites -- All DOE Office Websites (Extended Search)

1 results: 1 results: BibTex RIS RTF XML Sort by: Author Title Type [ Year (Desc) ] Filters: Author is Mark P. Modera [Clear All Filters] 2002 Carrié, François Rémi, Ronnen M. Levinson, Tengfang T. Xu, Darryl J. Dickerhoff, William J. Fisk, Jennifer A. McWilliams, Mark P. Modera, and Duo Wang. "Laboratory and field testing of an aerosol-based duct-sealing technology for large commercial buildings." ASHRAE Transactions (2002). Xu, Tengfang T., François Rémi Carrié, Darryl J. Dickerhoff, William J. Fisk, Jennifer A. McWilliams, Duo Wang, and Mark P. Modera. "Performance of thermal distribution systems in large commercial buildings." Energy and Buildings 34 (2002): 215-226. 2001 Carrié, François Rémi, and Mark P. Modera. "Experimental investigation


A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada




SciTech Connect

One of the principal objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, microbial samples were collected from the Trusty Steed prospect area in Grand Traverse County, Michigan. The samples were analyzed using the Microbial Oil Surveying Technique (MOST) technique and revealed only a local (1-point) anomaly. A decision to resample over that point is pending, but drilling has been postponed for the time being. The main news this reporting period is that in the Bear Lake area, northwest Michigan, Federated Oil & Gas Properties' Charlich-Fauble 2-9HD horizontal lateral, has cumulative production of more than 72,000 barrels of oil and is still producing 50 to 75 bopd from a Silurian Niagaran reef reservoir eighteen months after the well was completed. Surface geochemical surveys conducted in the demonstration area were consistent with production results although the ultimate decision to drill was based on interpretation of conventional subsurface and 2D seismic data. The surface geochemical techniques employed were Solid Phase MicroExtraction (SPME) and MOST. The geochemical results have been submitted to World Oil for publication. New geochemical surveys are planned for November in the Springdale quadrangle in Manistee County, Michigan. These surveys will concentrate on sampling over the trace of the proposed horizontal wells rather than a broad grid survey.

James R. Wood; A. Wylie; W. Quinlan



Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997

Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...


Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...


Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...



owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION



Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as



Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake


Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael



Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...

Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...


St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...


ENERGY SURETY MI ROGRID - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment assists in planning and analysis of potential risks


miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha



Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.



NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications Publications Most publications by Environmental Energy Technologies Division authors are searchable from this page, including peer-reviewed publications, book chapters, conference proceedings and LBNL reports. Filter Advanced Search Publications list This publications database is an ongoing project, and not all Division publications are represented here yet. For additional help see the bottom of this page. Show only items where Author Type Term Year Keyword is Abadie, Marc O Abbey, Chad Abdolrazaghi, Mohamad Aberg, Annika Abhyankar, Nikit Abraham, Marvin M Abshire, James B Abushakra, Bass Acevedo-Ruiz, Manuel Aceves, Salvador Ache, Hans J Ackerly, David D Ackerman, Andrew S Adamkiewicz, Gary Adams, Carl Adams, J W Adamson, Bo Addy, Susan E Addy, Nathan Aden, Nathaniel T Adesola, Bunmi Adhikari, Sarina Adilov, Nodir



Energy.gov (U.S. Department of Energy (DOE))

The EERE Publication and Product Library will allow you to find publications and products provided by the DOE's Office of Energy Efficiency and Renewable Energy specifically for our constituents....



Science Conference Proceedings (OSTI)

... Baldrige Stock Studies Performance of the Baldrige Index, a fictitious stock fund including the stock of publicly traded US companies that have ...




NLE Websites -- All DOE Office Websites (Extended Search)

Division authors are searchable from this page, including peer-reviewed publications, book chapters, conference proceedings and LBNL reports. NOTICE Due to the current lapse of...

Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

some of the publications, presentations, posters and other output of the Computational Science and Engineering Petascale Iniative's post-doctoral researchers. Sort by: Default |...



NLE Websites -- All DOE Office Websites (Extended Search)

Thermal Analysis Publications Thermal Analysis Publications Items are listed below in chronological order with the most recent reports first. The Source column lists the journals or conference proceeding where many reports can be found. Please check your local technical or engineering libraries to find these reports. Reports that have links are available on this server in PDF format. Download a free copy of Adobe Acrobat Reader. If you would like to receive a report on this list, please contact our publications coordinator at the address below: Pat Ross Windows and Daylighting Group Lawrence Berkeley National Laboratory Mail Stop 90/3111 Berkeley, CA 94720 (510) 486-6845 Fax: (510) 486-4089 email: plross@lbl.gov Please limit your request to no more than 5 publications. Note: Use the Find function of your browser to search this page if you are



NLE Websites -- All DOE Office Websites (Extended Search)

Lee » Publications Lee » Publications Publications Sort by: Date | Author | Type 2013 Daya Bay Collaboration: F.P. An, A.B. Balantekin, H.R. Band, W. Beriguete, et. al, "Spectral measurement of electron antineutrino oscillation amplitude and frequency at Daya Bay", Phys. Rev. Letter, October 24, 2013, A measurement of the energy dependence of antineutrino disappearance at the Daya Bay Reactor Neutrino Experiment is reported. Electron antineutrinos from six GW reactors were detected with six detectors deployed in two near (effective baselines 512 m and 561 m) and one far (1579 m) underground experimental halls. Using 217 days of data, 41589 (203809 and 92912) antineutrino candidates were detected in the far hall (near halls). An improved measurement of the oscillation amplitude and the first direct



NLE Websites -- All DOE Office Websites (Extended Search)

Recent Publications Recent Publications Ying Xu, Dong Xu, Dongsup Kim, Victor Olman, Jane Razumovskaya, and Tao Jiang Automated Assignment of Backbone NMR Peaks Using Constrained Bipartite Matching. Computing in Science and Engineering. In press. Ying Xu, Victor Olman, and Dong Xu. Clustering Gene Expression Data Using a Graph-Theoretic Approach: An Application of Minimum Spanning Trees. Bioinformatics. In press. Ying Xu, Victor Olman, and Dong Xu. Minimum Spanning Trees for Gene Expression Data Clustering. In Proceedings of the 12th International Conference on Genome Informatics (GIW), edited by S. Miyano, R. Shamir and T. Takagi. Accepted. Dong Xu and Ying Xu. Computational Studies of Protein Structure and Function Using Threading Program PROSPECT. In Protein Structure Prediction: Bioinformatic Approach, edited by Igor Tsigelny. International University Line publishers (IUL), La Jolla, CA. Invited publication.



Annual Energy Outlook 2012 (EIA)

1983(3) is- sue of the PMM). Therefore, there may be some mi- nor discontinuity in price estimates between August 1988 and September 1988 and between December 1983 and...



NLE Websites -- All DOE Office Websites (Extended Search)

PUBLICATIONS PUBLICATIONS A. Refereed International Journal Papers V. Radmilovic, C. Ophus, E.A. Marquis, A. Tolley, M.D. Rossell, A. Gautam, M. Asta and U. Dahmen, "Highly monodisperse core-shell particles created by solid-state reactions", Nature Materials, 2011, in press. Ki-Joon Jeon, Zonghoon Lee, Elad Pollak, Luca Moreschini, Aaron Bostwick, Cheol-Min Park, Rueben Mendelsberg, Velimir Radmilovic, Robert Kostecki, Thomas Richardson, Eli Rotenberg, "Fluorographane: a wide band gap semiconductor with ultraviolet luminescence", ACS Nano, 5 (2011) 1042-1046. J.T. McKewon, V.R. Radmilovic, R. Gronsky, and A.M. Gleaser, "Silicide characterization at alumina-niobium interfaces", Journal of Materials Science, 46 (2011) 3969-3981. B. Jokic, M. Mitric, V. Radmilovic, S. Drmanic, R. Petrovic, and D.



NLE Websites -- All DOE Office Websites (Extended Search)

7 results: 7 results: BibTex RIS RTF XML Sort by: Author Title Type [ Year (Desc) ] Filters: Author is Laura Van Wie McGrory [Clear All Filters] 2006 McGrory, Laura Van Wie, Philip Coleman, David Fridley, Jeffrey P. Harris, and Edgar Villasenor Franco. "Two Paths to Transforming Markets through Public Sector Energy Efficiency: Bottom Up versus Top Down." In 2006 ACEEE Summer Study on Energy Efficiency in Buildings. Pacific Grove, CA, 2006. McGrory, Laura Van Wie, Philip Coleman, David Fridley, Jeffrey P. Harris, and Edgar Villasenor Franco. Two Paths to Transforming Markets through Public Sector Energy Efficiency: Bottom Up versus Top Down In 2006 ACEEE Summer Study on Energy Efficiency in Buildings . Vol. 6., 2006. 2004 Wiel, Stephen, Laura Van Wie McGrory, and Lloyd Harrington. Energy


Michigan Public Service Commission | Open Energy Information  

Open Energy Info (EERE)

Commission Commission Jump to: navigation, search State Michigan Name Michigan Public Service Commission Address 6545 Mercantile Way, Suite 7 City, State Lansing, MI Zip 48911 Website http://www.michigan.gov/mpsc/ Coordinates 42.663692°, -84.535225° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.663692,"lon":-84.535225,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}



NLE Websites -- All DOE Office Websites (Extended Search)

19 results: 19 results: BibTex RIS RTF XML Sort by: Author Title Type [ Year (Desc) ] Filters: Author is Maithili Iyer [Clear All Filters] 2012 Iyer, Maithili, and Jayant A. Sathaye. Market Assessment of Public Sector Energy Efficiency Potential in India. LBNL, 2012. 2011 Sathaye, Jayant A., Stephane Rue de la du Can, Maithili Iyer, Michael A. McNeil, Klaas Jan Kramer, Joyashree Roy, Moumita Roy, and Shreya Roy Chowdhury. Strategies for Low Carbon Growth In India: Industry and Non Residential Sectors. LBNL, 2011. 2010 Harris, Jeffrey P., Richard C. Diamond, Carl Blumstein, Chris Calwell, Maithili Iyer, Christopher T. Payne, and Hans-Paul Siderius. "Towards a Policy of Progressive Efficiency." In People-Centered Initiatives for Increasing Energy Saving. Washington, D.C. : ACEEE, 2010.



NLE Websites -- All DOE Office Websites (Extended Search)

35 results: 35 results: BibTex RIS RTF XML Sort by: Author Title Type [ Year (Desc) ] Filters: Author is Arthur H. Rosenfeld [Clear All Filters] 2009 Akbari, Hashem, and Arthur H. Rosenfeld. Cool roofs could save money, save planet In KGO-TV (abc7news)., 2009. Akbari, Hashem, Surabi Menon, and Arthur H. Rosenfeld. "Global cooling: increasing world-wide urban albedos to offset CO2." Climatic Change 94 (2009): 275-286. Rosenfeld, Arthur H.. Painting the town white: California Energy Commissioner, Art Rosenfeld, explains the benefits of cool roofs In National Public Radio., 2009. 2008 Akbari, Hashem, Surabi Menon, and Arthur H. Rosenfeld. Equivalent CO2 avoided by reflective roofs and pavements in California In Memo to California Air Resources Board., 2008. Akbari, Hashem, and Arthur H. Rosenfeld. White roofs cool the world,



NLE Websites -- All DOE Office Websites (Extended Search)

3 results: 3 results: BibTex RIS RTF XML Sort by: Author Title Type [ Year (Desc) ] Filters: Author is Kayje Booker [Clear All Filters] 2012 Booker, Kayje, Ashok J. Gadgil, and David Winickoff. "Engineering for the Global Poor: The Role of Intellectual Property." Science and Public Policy 39, no. 6 (2012): 775-786. 2011 Booker, Kayje, Tae Won Han, Jessica Granderson, Jennifer L. Jones, Kathleen M. Lask, Nina Yang, and Ashok J. Gadgil. Performance of Charcoal Cookstoves for Haiti, Part 1: Results from the Water Boiling Test. Berkeley: Lawrence Berkeley National Laboratory, 2011. Lask, Kathleen M., Jennifer L. Jones, Kayje Booker, Cristina Ceballos, Nina Yang, and Ashok J. Gadgil. Performance of Charcoal Cookstoves for Haiti, Part 2: Results from the Controlled Cooking



NLE Websites -- All DOE Office Websites (Extended Search)

3 results: 3 results: BibTex RIS RTF XML Sort by: Author Title Type [ Year (Desc) ] Filters: Author is Tiefeng Yu [Clear All Filters] 2012 Bauman, Fred S., Thomas L. Webster, Stefano Schiavon, Hui Zhang, Edward A. Arens, Kwang Ho Lee, Tyler Hoyt, Darryl J. Dickerhoff, Timothy Moore, Wilmer Pasut et al. Advanced Design and Commissioning Tools for Energy-Efficient Building Technologies In Final report to California Energy Commission (CEC) Public Interest Energy Research (PIER) Program. Berkeley: Center for the Built Environment, University of California, 2012. 2011 Bauman, Fred S., Thomas L. Webster, David Lehrer, Edward A. Arens, Hui Zhang, John Goins, Darryl J. Dickerhoff, Stefano Schiavon, Sabine Hoffmann, Tiefeng Yu et al. Advanced Integrated Systems Tools Development and


Publications Alphabetically  

NLE Websites -- All DOE Office Websites (Extended Search)

Alphabetically Alphabetically Recently Posted Overview Report: Project to date through September 2013 Nissan Leaf Vehicle Summary Report: July - September 2013 Chevrolet Volt Vehicle Summary Report: July - September 2013 Electric Vehicle Charging Infrastructure Summary Report: July - September 2013 Blink Charging Units Map - Project to date through September 2013 Nissan Leafs and Chevrolet Volts Map - Project to date through September 2013 DOE U.S. Drive All Tech Teams Meeting (SLIDES) Troy, MI - December 2013 IWC - Testing Results: PLUGLESS Wireless Charging System by Evatran Group Inc. (SLIDES) Franklin, TN - December 2013 2011 Honda CRZ (2982) Fleet Testing Results to Date 2011 Honda CRZ (4466) Fleet Testing Results to Date 2011 Honda CRZ (2982) Fact Sheet 2011 Honda CRZ (4466) Fact Sheet



Gasoline and Diesel Fuel Update (EIA)

1983(3) is- sue of the PMM). Therefore, there may be some mi- nor discontinuity in price estimates between August 1988 and September 1988 and between December 1983 and...


2012 Proceedings of the Performance Metrics for Intelligent ...  

Science Conference Proceedings (OSTI)

Page 1. NIST Special Publication 1136 2012 Proceedings of the Performance Metrics for Intelligent Systems (PerMI '12) Workshop ...



Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

Technical Publications website. The URA tracks the number of theses we produce each year. Power Outage News MI-65 October 25 Power will be off to the MI-65 service building and...



co-fabricated filtration system for enhancement of ... increases functionality and integration of micro ... for the U.S. Department of Energys National Nuclear ...


May All Good Things Gather Here: Life, Religion and Marriage in a Mi nyag Tibetan Village  

E-Print Network (OSTI)

;#15; #29;#31;#3;#14;#12; 3 #11;#5;#12;#6;#3;#20; #8;#20; #31;#6;#7; #29;#7;#5;8#16;#11;#3; #14; #15;#7;#5;#14;#3;#19;#5;#17;.#7;#5; #5;#14; #14;#5;#7;#8; #5;#7;#8;#11;#12; #6;#5;#20;#5;9 : ?@AB@A : >C?DEFGH@AB@A : CIH@AB@A : EKDLMAB@A : N...

Bkra shis bzang po



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

DOE Green Energy (OSTI)

gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



ANRV286-MI60-17 ARI 25 May 2006 23:56 The Bacterial  

E-Print Network (OSTI)

Molecular Genetics and Microbiology, University of Texas, Austin, Texas 78712-0231; email: philipl energy-transducing membranes (133). It is widespread within the microbial world and in plants. Homologs

Georgiou, George

Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


UCRL-MI-224010 ARM-06-012 ARM's Support for GCM Improvement:...  

NLE Websites -- All DOE Office Websites (Extended Search)

updrafts. Because the total mass of water condensed into clouds is controlled by thermodynamics, a greater number of droplets for the same mass of cloud water means that the...


Technical Section: CHuMI viewer: Compressive huge mesh interactive viewer  

Science Conference Proceedings (OSTI)

The preprocessing of large meshes to provide and optimize interactive visualization implies a complete reorganization that often introduces significant data growth. This is detrimental to storage and network transmission, but in the near future could ... Keywords: Interactive visualization, Large meshes, Lossless compression, Out-of-core

Clment Jamin; Pierre-Marie Gandoin; Samir Akkouche



LAT HING MI RO OPTI AL SWIT H - Home - Energy Innovation ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2013-10084P


Classes Are Starting Soon! Prof"..roMI Photography G,aph~ o..,rgn  

E-Print Network (OSTI)

Simone Gori and Val HamburQer, then atthe UnOiersily of FreiburQ in Germany, is a noyel Yariation ofthe .... S~deshows > Mind~Br'" Combiml1iOll of the RO'il1illU_liKed_lilies ""d Enigma Gori and HamburQer


Superfund Record of Decision (EPA Region 5): Wash King Laundry, Baldwin, MI, March 1993  

SciTech Connect

This decision document presents the selected remedial action for the Wash King Laundry Superfund site in Baldwin, Pleasant Plains Township, Michigan. The groundwater remedial action consists of the following: groundwater monitoring; deed restrictions; and groundwater extraction with physical/chemical treatment. The lagoon remedial action consists of the following: excavation of contaminated sediments and soils and off-site disposal.



Characterization of UNUSUAL LATERAL ORGANS : a miRNA regulated F-Box protein  

E-Print Network (OSTI)

between ULO and the HD-ZIP proteins in planta. Anotherof homodomain-leucine zipper (HD-Zip) proteins. Plant SignalKANADI and class III HD-Zip gene families regulate embryo

Smith, Peter Thomas



Integrated modeling within a Hydrologic Information System: An OpenMI based approach  

Science Conference Proceedings (OSTI)

This paper presents a prototype software system for integrated environmental modeling that provides interoperability between the Consortium of Universities for the Advancement of Hydrologic Science, Inc. (CUAHSI) Hydrologic Information System (HIS) and ... Keywords: Data management, Environmental management, Integrated modeling, Systems analysis

Anthony M. Castronova; Jonathan L. Goodall; Mehmet B. Ercan



"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

Puertorriquea. Humacao, Puerto Rico: Editorial Furidi,and Colonization of Puerto Rico, 1493-1599. San Juan: Centroand U.S. Imperialism in Puerto Rico. Berkeley: University of

Rivera, Petra Raquel



"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn.  

E-Print Network (OSTI)

??My dissertation examines entanglements of race, place, gender, and class in Puerto Rican reggaetn. Based on ethnographic and archival research in San Juan, Puerto Rico, (more)

Rivera, Petra Raquel



Ruofan Wu, Hieu Pham Trung Nguyen and Zetian Mi INTRODUCTION TO LEDs  

E-Print Network (OSTI)

-in-a-Wire Light Emitting Diodes and Prevention Method Nano-electronic Devices and Materials, Electrical Computer., Efficiency droop in nitride-based light-emitting diodes. Physica Status Solidi a-Applications and Materials history. Nature Photonics 2007, 1 (4), 189-192. [4] Holonyak, N., Is the light emitting diode (LED

Barthelat, Francois


"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

May ________. A vistas la pornografa. Primera Hora, 22la medida contra la pornografa. El Nuevo Da, 13 Junecomunicacin contra la pornografa. El Nuevo Da, 16 May

Rivera, Petra Raquel



Informa(on and Resources Water Quality and Mi/ga/on: Bifenthrin and Fipronil  

E-Print Network (OSTI)

strategy, Pesticides fluxes, Surface water, Vineyard Introduction The intensive use of pesticides for crop on the mobilisation of pesticides and total fluxes in surface water. Moreover, the effect of the sampling strategy ranged from 1.0 to 60 g. Effect of sampling strategy on the estimation of pesticides fluxes in the river

Hammock, Bruce D.


Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in  

E-Print Network (OSTI)

Universidad Católica de Chile, Santiago 8331010, Chile; b Department of Plant and Soil Sciences, Delaware activated cell sorter (FACS) and extracted total RNA as described previously (9). KNO3 treat- ment induced

Green, Pamela


Preserving research data  

E-Print Network (OSTI)

Consortium for Political and Social Research. Ann Arbor, MI;Access to Publicly Funded Research Data. The Public Domainof the products of scientific research. Meanwhile, research

Jacobs, James A; Humphrey, Charles



Bon Bibliography : An Annotated List of Recent Publications  

E-Print Network (OSTI)

. Bel-gtam Nyan-pai Bskul-ma. Bgres-poi Bel-gtam, issue 1 (2001), pp. 73-74. Poetry. Bon Bibliography 65 CHOS-NGAG Stod Mnga-ris-kyi Dgon-sdei Lo-rgyus Dag-gsal Mthong-bai Me-long, Bod-ljongs Mi-dmangs Dpe-skrun-khang (Lhasa 1999). This book... -bai Bca-yig Pad-dkar Chun Pheng. Contained in: Bca-yig Phyogs-bsgrigs [Bod Sa-gnas-kyi Lo-rgyus Dpe-tshogs Bca-yig Phyogs-bsgrigs], Bod-ljongs Mi-dmangs Dpe-skrun- khang (Lhasa 2001), pp. 504-507. Issued in 1926, this is a charter for the Bon...

Martin, Dan



Integration of Molecular Networks in the Shoot Apical Meristem that Controls Floral Specification in Arabidopsis thaliana  

E-Print Network (OSTI)

lycopersicum_miR156b Solanum_lycopersicum_miR156c Sorghum_bicolor_miR156a Sorghum_bicolor_miR156b Sorghum_bicolor_miR156c Sorghum_

Lal, Shruti



David Chamulak  

NLE Websites -- All DOE Office Websites (Extended Search)

Laboratory, USA 2009: Ph.D., Michigan State University, East Lansing, MI, USA. curriculum vitae Publications Asymmetry and the Nucleosynthetic Signature of Nearly Edge-Lit...


Ivan Brida  

NLE Websites -- All DOE Office Websites (Extended Search)

Laboratory, USA 2009: Ph.D., Michigan State University, East Lansing, MI, USA. curriculum vitae Publications I. Brida and F. M. Nunes, A microscopic hyper-spherical model:...


Advanced composites III: expanding the technology; Proceedings of the Third Annual Conference, Detroit, MI, Sept. 15-17, 1987  

Science Conference Proceedings (OSTI)

The present conference discusses topics in the design features and methods, manufacturing processes, secondary fabrication techniques, and materials science aspects of advanced composites. Attention is given to composite structural armor for ground combat vehicles, composite structures for automotive energy management, CAD/CAM of braided preforms for advanced composites, composite automobile bumper beams, preforming for structural applications, the three-dimensional braiding of thermoplastic composite preforms, and recent advancements in tooling technology. Also discussed are instrument-grade MMCs for imaging IR guidance systems, automated tape layup of a vertical stabilizer fin, the mechanical properties of thermoplastic matrix composites, surface chemistry and adhesion of SMCs, fiber-matrix bonding, and hybrid yarns for high performance thermoplastic composites.

Not Available



1996 Department of Energy pre-freshman enrichment program at GMI Engineering and Management Institute, Flint, MI  

SciTech Connect

This document reports on a summer program to encourage students to pursue scientific or engineering professions. The topics of the report include a description of the recruitment program, selection criteria for participants, workshops, nine follow up activities, research projects and student`s presentation, and field trips. Course descriptions and schedule are included as appendices.


Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Creative Reconstruction in the City: An Analysis of Art, Shrinking, and the Story of the American Dream in Detroit, MI.  

E-Print Network (OSTI)

??A right to the city is a human right that is overlooked in American cities. Cities reflect humanity in collective form, but are manipulated by (more)

Marotta, Stephen J.



Atliekinio fosfogipso panaudojimas sunki?j? metal? immobilizacijai nuotek? dumble ir dumblo-dirvoemio miiniuose.  

E-Print Network (OSTI)

??Nuotek? dumble esan?i? sunki?j? metal? neigiam? poveik? aplinkai bei mogaus sveikatai galima sumainti apribojant metal? judrum? aplinkoje. Magistro darbe tiriamas sunki?j? metal? judrumas ir j? (more)

Puodi?nas,; Marius



I Volume 5, Number 2 Spring 1992 A Ne\\izsletter for the RLE Community at MI'T  

E-Print Network (OSTI)

:l XI:~ri:l Ticchi. Inq~tiriesmay he ;~ddrcsscdto: RLE undercurrents Rescarcli Lahor:ltory of Electrc


Volume 2, Number 2 June 1989 A Nelr-sletter for the KL,t.: Communitv at MI'1'  

E-Print Network (OSTI)

Lahoratory of Electrc~nicsfor the RLE community at MIT. The following individuals contributed their time ancl


LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 2002 Place Time Name Group Group  

E-Print Network (OSTI)

37 192 19:28.7 John Wool 40-49 men 48 193 19:32.4 Jaimin Wan page 7 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS 1st


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 1996 Dummy first body page  

E-Print Network (OSTI)

-59 59 668 34:20.7 Seung-yu Rah 30-39 157 669 34:21.4 John Wool 40-49 120 670 34:25.6 Manny Gonzalez 30:42.8 Pete Valerio HISTORY OF LBL RUNAROUND WINNERS


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 14, 1990 Place Time Name Group Group  

E-Print Network (OSTI)

:56.4 John Wool 30­39 105 483 30:00.0 David O'Neill ) Group Time Name Overall Place Place 1 24:24.3 John Magee 373 2 25:41.9 Edward Lofgren 400 HISTORY OF LBL


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 22, 1995 Dummy first body page  

E-Print Network (OSTI)

198 16:04.7 Alan Meier 40-49 30 199 16:05.7 John Wool 40-49 31 200 16:07.5 Ginny Lackner 50-59F 1 201 Don Krieger Frances Mann Peter Morley Bob Shilling HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 10, 1997 Place Time Name Group  

E-Print Network (OSTI)

Larnon, Frank 50-59 13 156 15:17.4 157 15:18.0 Bartholomew, J 50-59 14 158 15:18.4 Wool, John 40-49 18 159 15 Time Name Group Group Place HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 15, 1989 Envel. Time Name Group Group  

E-Print Network (OSTI)

40-49 8 67 12:51.4 Desiderio Kovar Wool 30-39 20 69 12:56.7 Antoine Mensch Envelope Place Number 1 21:59.8 John L. Magee 354 2 26:14.8 Ed Lofgren 427 HISTORY OF LBL RUNAROUND WINNERS


LBL RUNAROUND RESULTS 2.95 km (1.84 mi) September 16, 1988 Envelope Time Name Group Group  

E-Print Network (OSTI)

120 14:08.2 Z. Mei 30-39 26 121 14:09.5 John Wool 30-39 27 122 14:10.3 Timothy Edberg 30-39 28 123 14 Time Name Envelope Place Number 1 30:14.0 Peter Endt 447 HISTORY OF LBL RUNAROUND WINNERS Year Distance


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 11, 1992 Place Time Name Group Group  

E-Print Network (OSTI)

14:26.2 Barry Freifeld Wool 30-39 39 122 14:28.2 Ken Woolfe 40-49 18 123 14 Williams HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS


I Volume 7, Number 2 Spring 1994 A Newsleccer for the RLE Communitv at MI'I'  

E-Print Network (OSTI)

Robert J. Birgeneau, Dean of the School of Science and a principal investigator in RLE's Surfaces has his blue belt in karate. Seventh grader Amanda's bowl~ngteam competed in the state finals


Corrosion mechanisms of low level vitrified radioactive waste in a loamy soil M.I. Ojovan1  

E-Print Network (OSTI)

Topic: Briefings by environmental groups, industry groups, pub- lic policy groups, and state, is the central authority responsi- ble for evaluating and supervising the nuclear industry's research and 1.95 meters in diameter. It is fabricated from forged steel with a stainless steel coating. The cask

Sheffield, University of


Informa(on and Resources Prac&ces for Mi&ga&ng Urban Pes&cide Runoff  

E-Print Network (OSTI)

. Producers can then use these records to analyze the effectiveness of past pesticide applications a documentation system for determining crop replant, rotation and #12;Pesticide Recordkeeping 2 prePI-20 Pesticide Recordkeeping 1 Michael Aerts, O. Norman Nesheim, and Frederick M. Fishel2 1

Hammock, Bruce D.


Former Worker Program - Defunct Beryllium Vendor Screening Program  

NLE Websites -- All DOE Office Websites (Extended Search)

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Wolverine Tube Division (Detroit, MI); National Beryllia (Haskell, NJ);...


Beryllium Vender Screening Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Speedring Systems, Inc. (Detroit, MI); Wolverine Tube Division...


Microsoft Word - Sample Abstract and Format Instructions.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Dearborn, MI 48128, Wayne State University 2 , Department of Physics and Astronomy, Detroit, MI 48202, Kettering University 3 , Flint, MI 48504, University of Paris-Sud 4 ,...


Language Assimilation Today: Bilingualism Persists More Than in the Past, But English Still Dominates  

E-Print Network (OSTI)

Somerset- Hunterdon, NJ Detroit, MI Table 2 Childrens homeSomerset- Hunterdon, NJ Detroit, MI Bergen-Passaic, NJSomerset- Hunterdon, NJ Detroit, MI Appendix Table 2

Alba, Richard



Publications Portal  

Science Conference Proceedings (OSTI)

Publications Portal. ... a mention of the concept of electronic books, or ebooks. ... http://www.nist.gov/manuscript-publication-search.cfm?pub_id=151477 ...


Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Darshan Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications June 18th, 2013 Publications from the Darshan team: Argonne Leadership Computing Facility, "ALCF IO Data Repository", Technical Memorandum ANLALCFTM-131, Argonne...


NETL: Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications Technology Reference Shelves Oil & Natural Gas Supply Coal & Power Systems Carbon Storage Hydrogen & Clean Fuels Accomplishment Reports Brochures All...


History Publications  

Energy.gov (U.S. Department of Energy (DOE))

List of historical publications available through the Department's History Office, including free PDF versions.


ARM - Publications: Science Team Meeting Documents  

NLE Websites -- All DOE Office Websites (Extended Search)

Parameterization of Hygroscopic Aerosols in a Climate GCM Parameterization of Hygroscopic Aerosols in a Climate GCM Lacis, A.A., Mishchenko, M.I., and Carlson, B.E., Goddard Institute for Space Studies Twelfth Atmospheric Radiation Measurement (ARM) Science Team Meeting Real and imaginary refractive indices are needed over the full range of solar and thermal wavelengths in order to compute the radiative forcing due to atmospheric aerosols. Laboratory measurements are available for dry ammonium sulfate [Toon and Pollack, 1976] over the spectral range 0.3 – 40 ?m, and for dry sea salt [Shettle and Fenn, 1979; Nilsson, 1979; both based on Volz, 1972 measurements] over 0.2 – 40 ?m. Partial spectrum measurements from 0.7 to 2.6 ?m of the imaginary refractive index of ammonium sulfate and ammonium nitrate are also available [Gosse et al.,


--No Title--  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Michigan Total Sum City, County, and SEO Allocations All 76,601,500 MI Michigan State Energy Office 19,599,600 MI Ann Arbor City 1,243,400 MI Battle Creek City 545,100...


Non-traumatic Shoulder Dislocation  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, MI Supervising SectionFord Hospital, 2799 W. Grand Blvd, Detroit, MI 48201. Email

Manteuffel, Jacob



Whither the Keiretsu, Japan's Business Networks? How Were They Structured? What Did They Do? Why Are They Gone?  

E-Print Network (OSTI)

Construction Nippon Flour Mills Kirin Brewery Oji PaperSa Textile NIPPON FLOUR MILLS Mi Food TORAY INDUSTRIES Mi

Lincoln, James R.; Shimotani, Masahiro



Publications Portal  

Science Conference Proceedings (OSTI)

... Many proposed computational platforms are dri ... http://www.nist.gov/ manuscript-publication-search.cfm?pub_id=901100 413. ...



2012 Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

2Publications 2Publications Sign In Launch the Developer Dashboard SLAC National Accelerator Laboratory DOE | Stanford | SLAC | SSRL | LCLS | AD | PPA | Photon Science | PULSE | SIMES LCLS : Linac Coherent Light Source An Office of Science User Facility Search this site... Search Help (new window) Top Link Bar LCLS Lasers Expand Lasers LCLS Quick Launch Home About LCLS Expand About LCLS LCLS News Expand LCLS News User Resources Expand User Resources Instruments Expand Instruments Proposals Publications Expand Publications Schedules Machine Status Machine FAQs Safety Organization Expand Organization Directories Expand Directories Staff Resources Contact Us All Site Content Department of Energy Page Content 2012 Publications 2013 | 2012 | 2011 | 2010 | 2009 | Archive | Citations | Statistics


2010 Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

0Publications 0Publications Sign In Launch the Developer Dashboard SLAC National Accelerator Laboratory DOE | Stanford | SLAC | SSRL | LCLS | AD | PPA | Photon Science | PULSE | SIMES LCLS : Linac Coherent Light Source An Office of Science User Facility Search this site... Search Help (new window) Top Link Bar LCLS Lasers Expand Lasers LCLS Quick Launch Home About LCLS Expand About LCLS LCLS News Expand LCLS News User Resources Expand User Resources Instruments Expand Instruments Proposals Publications Expand Publications Schedules Machine Status Machine FAQs Safety Organization Expand Organization Directories Expand Directories Staff Resources Contact Us All Site Content Department of Energy Page Content 2010 Publications 2013 | 2012 | 2011 | 2010 | 2009 | Archive | Citations | Statistics


Archived Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

ArchivedPublications ArchivedPublications Sign In Launch the Developer Dashboard SLAC National Accelerator Laboratory DOE | Stanford | SLAC | SSRL | LCLS | AD | PPA | Photon Science | PULSE | SIMES LCLS : Linac Coherent Light Source An Office of Science User Facility Search this site... Search Help (new window) Top Link Bar LCLS Lasers Expand Lasers LCLS Quick Launch Home About LCLS Expand About LCLS LCLS News Expand LCLS News User Resources Expand User Resources Instruments Expand Instruments Proposals Publications Expand Publications Schedules Machine Status Machine FAQs Safety Organization Expand Organization Directories Expand Directories Staff Resources Contact Us All Site Content Department of Energy Page Content Archived Publications 2013 | 2012 | 2011 | 2010 | 2009 | Archive | Citations | Statistics


Epigenetic Alterations in High and Low LET Radiation Induced...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the unstable clones. Among these, altered miRNA expression could be validated by qRT-PCR for mmu-miR-466g, hsa-miR-30a and hsa- miR-195. Hsa-miR-30a and hsa-miR-195 were...


Publications Portal  

Science Conference Proceedings (OSTI)

... Growing public concern over air quality has led ... Distillation Curve Analysis of Biodiesel Fuels: Assessment ... Method Part 4: Alcohols, Aldehydes, and ...



Publications Portal  

Science Conference Proceedings (OSTI)

... publication-search.cfm?pub_id=10539 3. 10 Volt Programmable Josephson voltage standard circuits using NbSi-barrier junctions Topic: Quantum ...



Publications Portal  

Science Conference Proceedings (OSTI)

... www.nist.gov/manuscript-publication-search.cfm?pub_id=100199 4. Statistical Correlation of Spectroscopic Analysis of Poplar Samples Published ...



Geothermal: Publications  

Office of Scientific and Technical Information (OSTI)

GEOTHERMAL TECHNOLOGIES LEGACY COLLECTION - Publications Geothermal Technologies Legacy Collection HelpFAQ | Site Map | Contact Us | Admin Log On HomeBasic Search About...


Publications Portal  

Science Conference Proceedings (OSTI)

... http://www.nist.gov/manuscript-publication-search.cfm?pub_id=911090 2. Early LNG Program and LN2 Cryogenic Flow Measurement Facility at ...



MSID Publications  

Science Conference Proceedings (OSTI)

... Publication date: June 1993. Citation: Don Libes: "A Debugger for Tcl Applications," Proceedings of the 1993 Tcl/Tk Conference, June, 1993. ...


Publications Portal  

Science Conference Proceedings (OSTI)

... GLUT/Tk: Open GL with Tcl/Tk Series: Special Publication (NIST SP) Report Number: 500-253 Published: 5/1/2003 Author: Joseph Konczal Abstract ...



Publications Portal  

Science Conference Proceedings (OSTI)

... GLUT/Tk: Open GL with Tcl/Tk Series: Special Publication (NIST SP) Report Number: 500-253 Topic: Information Technology Published: 5/1/2002 ...


Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


WBM Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

CMS Web Based Monitoring Publications CHEP 2012 Presenter: Irakli Chakaberia Title: New Developments in Web Based Monitoring at the CMS Experiment Authors: William Badgett, Irakli...


Publications Portal  

Science Conference Proceedings (OSTI)

... http://www.nist.gov/manuscript-publication-search.cfm?pub_id=912942 72. Fire Tests of Amtrak Passenger Rail Vehicle Interiors. Final Report. ...



MSID Publications  

Science Conference Proceedings (OSTI)

... Publication summary. Author(s): G. Thomas, G. Thompson, C. Chung, Edward Barkmeyer, F. Carter, M. Templeton, S. Fox and B. Hartman. ...


Public Process  

NLE Websites -- All DOE Office Websites (Extended Search)

AGENCY: Department of Energy. 10 CFR Part 903 Procedures for Public Participation in Power and Transmission Rate Adjustments and Extensions 50 FR 37835 September 18, 1985...


Publications Portal  

Science Conference Proceedings (OSTI)

... Answering Track Series: Special Publication (NIST SP) Topic: Information Delivery Systems Published: 11/5/2008 Authors: Hoa Trang Dang, Jimmy ...



Publications Portal  

Science Conference Proceedings (OSTI)

... Olthoff Abstract: This volume deals with the basic knowledge and ... manuscript- publication-search.cfm?pub_id=31439 2. Electricity Division Programs ...



Publications Portal  

Science Conference Proceedings (OSTI)

... gov/manuscript-publication-search.cfm?pub_id=831316 6. Distribution and Retention of ^u137^Cs in Sediments at the Hanford Site, Washington ...



ARM - Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Lidar Technologies, Techniques, and Measurements for Atmospheric Remote Sensing VIII, : SPIE - The International Society for Optical Engineering. Read more Publication Notice: 3...


Publications Portal  

Science Conference Proceedings (OSTI)

... The MOSS project sought to reduce transi ... ... nist.gov/manuscript-publication- search.cfm?pub_id=911880 6. AP210 Edition 2 Concept of Operations ...



Public Outreach  

NLE Websites -- All DOE Office Websites (Extended Search)

58 9 Executive Summary This manual represents a distillation of best practices for public outreach and education to support carbon dioxide (CO 2...


Publications Portal  

Science Conference Proceedings (OSTI)

... The method is based on iter ... http://www.nist.gov/manuscript-publication-search. cfm?pub_id=901466 89. ... The method is based on iter ... ...



Publications Portal  

Science Conference Proceedings (OSTI)

... publication-search.cfm?pub_id=901284 6. Certification of Selected Polynuclear Aromatic Hydrocarbons in SRM l580, "Organics in Shale Oil" Topic ...



PNNL: Publication Details  

NLE Websites -- All DOE Office Websites (Extended Search)

we cannot locate that Publication. Please try the Publications Database for other PNNL Publications. Powered By ERICA, PNNL's publication metadatabase Publications Search...


Public Activities  

NLE Websites -- All DOE Office Websites (Extended Search)

publicactivities_header.jpg publicactivities_header.jpg Public Activities Citizens are encouraged to learn about the Department of Energy's programs through a variety of activities that are open to the public. Our goal is to educate citizens and seek their meaningful involvement. If you are visiting the area, the American Museum of Science and Energy in Oak Ridge is the best starting point for exhibits and information about DOE programs in science, environmental management, nuclear fuel supply, and national security. Tours are conducted of the Oak Ridge National Laboratory, Y-12 National Security Complex and East Tennessee Technology Park during the summer months departing from the Museum. For those with more specific interests in our programs, each month we publish a calendar of public involvement activities, which identifies announcements, comment periods and public meetings of potential interest. Our Environmental Management Program has a Site Specific Advisory Board composed of area citizens who meet the second Wednesday of each month.


TAO: Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Referencing TAO Impact Who We Are Acknowledgements License Contact Us Papers TAO 2.0 Users Manual, T. Munson, J. Sarich, Stefan M. Wild, S. Benson, and L....


USGCRP Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

USGCRP Publications Print E-mail USGCRP Publications Print E-mail The U.S. Global Change Research Program (USGCRP) delivers a variety of publications that highlight scientific advances pertaining to global change. In addition to detailing scientific progress, USGCRP products illustrate the impacts of global change and highlight the Nation's response to these changes. As mandated by Congress, the USGCRP produces regular assessments of global change and annual reports showcasing the Program's progress in achieving its annual goals. Below are some descriptions of recent USGCRP publications. Scientific Assessments According to the scientific assessments are evaluation and consensus building processes for establishing an integrated view of recent scientific breakthroughs and providing policy-relevant information to decision makers.


Publications Search  

NLE Websites -- All DOE Office Websites (Extended Search)

Search Search for publications of the Windows and Daylighting Group by title, author, journal, or keywords: Search for: Start Search Clear If the search doesn't produce the desired...


Old Publication Portal  

Science Conference Proceedings (OSTI)

Publications Portal. This publications database includes many of the most recent publications of the National Institute of ...



Public Meeting  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Summary Minutes of the U.S. Department of Energy (DOE) Secretary of Energy Advisory Board (SEAB) Public Meeting November 14, 2011 Committee Members: William Perry, Chair; Norm Augustine; Ralph Cicerone; John Deutch, Nick Donofrio; Chad Holliday; Michael McQuade; Matt Rogers; Art Rosenfeld; Steven Westly Date and Time: 2:00PM - 2:45PM, November 14, 2011 Location: Teleconference Purpose: Meeting of the Secretary of Energy Advisory Board SEAB Staff: Alyssa Morrissey, Designated Federal Officer for the SEAB Committee Renee Stone, Designated Federal Officer for the Shale Gas Subcommittee Meeting Summary SEAB Members convened by teleconference to discuss the Second 90-Day Report of the Shale Gas Subcommittee. John Deutch gave an overview of the report, which was followed by a public comment


Publications - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications Alternative Power & Energy Conversion Emissions & Emission Controls Engine Combustion & Efficiency Fuels Technology Vehicle Research Miscellaneous Alternative Power & Energy Conversion Z. Gao, The Impact of TXV Heating on the Performance of Air-Source Heat Pumps in Heating Mode, submitted to Energy Conversion and Management (Journal). Emissions & Emission Controls T.J. Toops, N.A. Ottinger, C. Liang, J.A. Pihl, A. Payzant, "Impact of lattice substitution in Ba-based NOx storage reduction catalysts on sulfation, desulfation and NOx reduction performance", Catalysis Today 160:1 (2011) 131. T.J. Toops, M.P. Brady, P.F. Tortorelli, J.A. Pihl, F. Estevez, D. Connors, F. Garzon, T. Rockward, D. Gervasio, W. Mylan and S.H. Kosaraju, "Pre-Oxidized and Nitrided Stainless Steel Alloy Foil for Proton Exchange Membrane Fuel Cell Bipolar Plates: Part 2- Single-Cell Fuel Cell Evaluation of Stamped Plates", Journal of Power Sources 195:17 (2010) 5619.

Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Select Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Dosanjh » Select Dosanjh » Select Publications Select Publications Sort by: Date | Author | Type 2013 Richard A. Barrett, Shekhar Borkar, Sudip S. Dosanjh, Simon D. Hammond, Michael A. Heroux, X. Sharon Hu, Justin Luitjens, Steven G. Parker, John Shalf, Li Tang, "On the Role of Co-design in High Performance Computing", Transition of HPC Towards Exascale Computing, E.H. D'Hollander et. al (Eds.), IOS Press, 2013, ( November 1, 2013) Download File: Codesign-Paper.pdf (pdf: 867 KB) Rolf Riesen, Sudip Dosanjh, Larry Kaplan, "The ExaChallenge Symposium", IBM Research Paper, August 26, 2013, Download File: ExaChallenge2012.pdf (pdf: 1.4 MB) S. Dosanjh, R. Barrett, D. Doerfler, S. Hammond, K. Hemmert, M. Heroux, P. Lin, K. Pedretti, A. Rodrigues, T. Trucano, J.Juitjens, "Exascale Design


NDB Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications Papers from the NDB Project supported in total or in part by the NDB grants (in reverse chronological order) S. Neidle, B. Schneider, H. M. Berman. (2009). Chapter 3 Fundamentals of DNA and RNA structure. In Structural Bioinformatics, Second Edition (P. E. Bourne & J. Gu, eds.). John Wiley & Sons, Inc., Hoboken, NJ. B. Schneider, J. D. L. Cruz, Z. Feng, L. Chen, S. Dutta, I. Persikova, J. D. Westbrook, H. Yang, J. Young, C. Zardecki, H. M. Berman. (2009). Chapter 12 The Nucleic Acid Database. In Structural Bioinformatics, Second Edition (J. Gu & P. E. Bourne, eds.), pp. 305-319. John Wiley & Sons, Inc., Hoboken, NJ. B. Schneider, H. M. Berman. (2006). Basics of Nucleic Acid Structure. Concepts, Tools, and Archives. In Computational approaches to


Public Safety Communications  

Science Conference Proceedings (OSTI)

Public Safety Communication. Summary: ... the development of quantitative requirements for public safety communications. ...



Energy Optimization Savings Standard  

Energy.gov (U.S. Department of Energy (DOE))

Note: The Michigan Public Service Commission (MPSC) created a temporary order ([http://www.dleg.state.mi.us/mpsc/orders/electric/2008/u-15800_12-04-2008... U-15800]) in December of 2008 to address...


1. (P) M.I. Ojovan, W.E. Lee. New Developments in Glassy Nuclear Wasteforms. Nova Science Publishers, New York, 131p. (2007).  

E-Print Network (OSTI)

xxx Keywords: A. Intermetallics, miscellaneous B. Phase diagrams B. Thermodynamic and thermochemical in the Vienna ab-initio simulation package (VASP) [27]. We used the generalized gradient approximation (GGA, Lamoreaux RH. Molybdenum: physicochemical properties of its compounds and alloys. I. thermochemical

Ojovan, Michael


50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links  

E-Print Network (OSTI)

2) and the concentration of 65Cu2+ estimated by the speciation model WHAM (1.0 (28)), we could]e^ equals zero and that [65 Cu2+ ] was constant (i.e., nominal [65 Cu2+ ] ) 5.2-µg L-1). That is, WHAM the speciation model WHAM (28) assuming that the lake water has a pH near 8 (30), a dissolved organic carbon

Allen, Gale


Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

nontritium-bearing drilling fluid during the coring process,nontritium-bearing drilling fluid during the coring process,cores be drilled with drilling fluid spiked with a tracer.



Role of microRNA?155 in dendritic cells and macrophages MiR?155 directly targets PU.1 and IL13R1.  

E-Print Network (OSTI)

??In search of genes differentially expressed between M1 (pro?Th1 or pro?inflammatory) and M2 (pro?Th2 or pro?tolerogenic) macrophages, BIC (microRNA 155 hosting gene) was found up (more)

Martinez?Nunez, Rocio Teresa



Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

converting any H 2 gas produced to water) and measuring thefor the tritium produced in pore water of the fractured rockfor the tritium produced in pore water of the fractured rock



Functional miRNA regulation of metastatic genes promotes tumor cell dissemination in non-small cell and small cell lung carcinomas  

E-Print Network (OSTI)

Tumor progression, from initiation to advanced metastatic disease, requires the orchestration of a diverse group of cell-intrinsic and extrinsic factors. This multifactorial disease is promoted by an accumulation of genetic ...

Blat, Irene Catherine



Summary of the EPRI Early Event Analysis of the Fukushima Daiichi Spent Fuel Pools Following the March 11, 2011 Earthquake and Tsuna mi in Japan  

Science Conference Proceedings (OSTI)

Damage to the Fukushima Daiichi Unit 4 reactor building observed on March 15, 2011, initially generated confusion and concern throughout the nuclear industry. The reactor had been defueled approximately 100 days prior to the March 11 earthquake and tsunami; therefore, any explosion in Unit 4 could not be linked to a recently operating reactor within that unit. With the full core in the spent fuel pool, suspicions immediately turned to hydrogen generated by oxidation of overheating spent fuel cladding fol...



LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 16, 1994 Place Time Name GroupGroup Place Time Name GroupGroup  

E-Print Network (OSTI)

-49 8 30 11:56.7 Dan Gheng Wool 40-49 1 89 13 of the participants. The official number of finishers was 780, including babies in strollers page 7 #12;HISTORY OF LBL



SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, a new field demonstration, Springdale Prospect in Manistee County, Michigan was begun to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path. The main news this reporting period is the confirmed discovery of producing hydrocarbons at the State Springdale & O'Driscoll No.16-16 demonstration well in Manistee County. This well was spudded in late November, tested and put on production in December 2003. To date it is flowing nearly 100 barrels of liquid hydrocarbons per day, which is a good well in Michigan. Reserves have not been established yet. The surface geochemistry sampling at the Springdale demonstration site will be repeated this spring after the well has been on production for several months to see if the anomaly pattern changes. We expect that the anomaly will diminish as the original positive (apical) anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir. This is the behavior that we observed at the Bear lake demonstration well reported last quarter.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

In this reporting period two main accomplishments stand out. The Springdale task is in play in the northern Michigan Basin and the geochemical survey work over the Springdale prospect continued to progress. We still need to characterize the play in terms of the type of trap (basal reef diagenetic (?)) and its relation to the well documented pinnacle reef play. Also, we have become aware that Capac Field in the southern reef trend (Figure 1) is a possible analog to Springdale and so will be looking more closely at the literature on that field, particularly the work by Bowers (1987). Future work is directed toward further defining the Springdale project via more wells and examination and characterization of well cuttings. One to two more geochemical surveys are planned, one this spring and a final one in early fall. Based on current oil prices and Springdale production as of January 2005, an ROI, (defined as Total liquids revenue, $5.45m/DOE support, $1.45m) better than 3.75. This does not include gas revenues, which have not yet been calculated.

James R. Wood; A. Wylie; W. Quinlan




Science Conference Proceedings (OSTI)

Three horizontal wells have been completed (St. Springdale & Trezil 9-15 HD, St. Springdale 13-14 HD, St. Springdale & Stedronsky 10-15 HD) and three more wells were spudded (St. Springdale & CSX 2-22 HD, St. Springdale & Mann 9-21 HD and St. Springdale 7-22 HD) in the Springdale play this past reporting period. All are horizontal wells in the Brown Niagaran. This brings the total wells in the play to 12 with seven wells contributing to a total daily production exceeding 350 bbls/day. Data from these wells has been converted from drillers logs (footage calls) and converted to Michigan GeoRef coordinates and plotted. The Gamma Ray data along the well bore was available since it was used to steer the tool during drilling and this data was superimposed on the well trajectories in an effort to help distinguish pay zones from unproductive rock. One new geochemical survey was conducted over the projected surface path of the State Springdale & Stedronsky 14-15 HD and a final project survey was planned over one of the unsurveyed wells. This will bring the total surveyed wells to five and should provide enough data to determine if the idea of only sampling along the well bore is a sound strategy.

James R. Wood; A. Wylie; W. Quinlan




Science Conference Proceedings (OSTI)

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, plans were finalized for additional surface geochemical sampling in the new Springdale Prospect field demonstration in Manistee County, Michigan. Plans were also developed to acquire additional surface geochemical data in the vicinity of the Bagley Prospect area in Otsego County, Michigan. The main news this reporting period is the continued success in the Springdale demonstration area. The State Springdale & O'Driscoll No.16-16 and the State Springdale & Herban 12-16 horizontal demonstration wells in Manistee County, Michigan are both flowing nearly 100 barrels of liquid hydrocarbons per day plus gas, which are good wells in Michigan. Reserves have not been established yet. A third horizontal well, the State Springdale & Wilburn 1-21 HD has been drilled and is waiting on completion. Two more horizontal wells have been permitted in the Springdale area by our industry partner.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

One of the principal objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, microbial samples were collected from the Springdale prospect area in Manistee County, Michigan. The samples were taken along the trace of the proposed horizontal wells. The samples are presently being analyzed and the results will be reported in the next quarterly report. The main news this reporting period is that the Springdale prospect area in Manistee County, Michigan, continues to see drilling activity. Our industry partner, Jordan Development Company, LLC, is permitting additional horizontal wells following their success in the prospect area.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

Presented in this quarterly report is the Case History and Well Summary for the Vernon Field demonstration project in Isabella County, Michigan. This new case history and well summary format organizes and presents the technical and historical details of the Vernon Field demonstration, as well as the field demonstration results and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and will be used on all subsequent field demonstrations as they near completion. Planning for the annual project meeting in Tampa, Florida has begun. This meeting will be held March 7-9, 2003 at the same site as the last three meetings. The goals of this project were to: (1) test the use of multi-lateral wells to recover bypassed hydrocarbons and (2) to access the potential of using surface geochemistry to reduce drilling risk. Two new demonstration wells, the State-Smock and the Bowers 4-25, were drilled to test the Dundee Formation at Vernon Field for bypassed oil. Neither well was commercial, although both produced hydrocarbon shows. An extensive geochemical survey in the vicinity of Vernon Field, covering much of Isabella County, has produced a base map for interpretation of anomalies in Michigan. Several potential new anomalies were discovered that could be further investigated.

James R. Wood; W. Quinlan




SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, a new field demonstration, Springdale Prospect in Manistee County, Michigan was begun to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path. The surface geochemistry sampling at the original Bear Lake demonstration site was updated several months after the prospect was confirmed and production begun. As expected, the anomaly appears to be diminishing as the positive (apical) anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir.

James R. Wood; W. Quinlan



Energetics of gas-driven limnic and volcanic eruptions Department of Geological Sciences, The University of Michigan, Ann Arbor, MI 48109-1063, USA  

E-Print Network (OSTI)

and when equilibrium is reached between the gas and liquid phases Natural silicate melts often contain two.3. Dynamics of reversible gas-driven eruptions through a fluid medium Because buoyancy plays an important roleEnergetics of gas-driven limnic and volcanic eruptions Y. Zhang* Department of Geological Sciences

Zhang, Youxue

Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

from three different sources (fractured rock, concrete, and+Rock Concentration, no Decay, Rock Source Concentration,Decay, Rock Source Mass Storage, no Decay, Rock Source Mass




Science Conference Proceedings (OSTI)

The principal objective of the study was to test a new analytical technique, Solid-Phase Microextraction (SPME), for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. This involved measuring the effectiveness of SPME to extract hydrocarbons under controlled conditions in the laboratory. As part of the study, a field demonstration was undertaken to assess the validity and usefulness of the laboratory results. Presented in this quarterly report is the condensed version of the Case History and Well Summary for the Bear Lake area in Manistee County, Michigan. The full version will be in the annual report. The condensed case history presents the important technical details regarding the geochemistry and horizontal lateral for Bear Lake, as well as the field demonstration results and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and will be used on all subsequent field demonstrations as they near completion.

James R. Wood; W. Quinlan




SciTech Connect

The geochemical sampling team collected additional 148 samples at Vernon Field along 5 new traverses. Most of the locations were sampled for three types of analyses: microbial, iodine and enzyme leach; no results from the second batch of samples were available in time for this report. In addition to the sampling, a study was begun on the feasibility of collecting and analyzing hydrocarbon gases (C1-C8) directly. Although several companies offer these services, the cost ($200-300/sample w/o sampling fee) is high, on par with the cost of a 3D seismic survey, and may not include the raw data. However direct sampling of reservoir gases collecting in the soil appear to offer the best approach and should be included in this study. It would probably work well at Vernon Field. It may be possible to lower costs considerably; initial estimates of $20/sample for GCMS (Gas Chromatography--mass spectrometry) analysis are attractive and might induce to Michigan producers to include soil surveys in their routine field work-ups. A complete set of digital data was assembled for Vernon Field and nearby locations. The set consists of well locations, formation top picks, lithologies and scanned images of driller's reports and scout tickets. Well logs are still being located. The annual meeting for the Class Revisit work group is tentatively scheduled for the week of March 1-7 in Tampa, Fl. By that time all of the geochemical data will be available and final decisions regarding drilling can be made.

James R. Wood; T.J. Bornhorst; S.D. Chittichk; William B. Harrison; W. Quinlan




SciTech Connect

A principal goal of the Budget Period I was to demonstrate that surface geochemistry could be used to locate bypassed hydrocarbons in old fields. This part of the program was successful. A surface geochemical survey, employing 5 different techniques, was carried out in the Spring and Summer of 2000 and a demonstration well, the State Vernon & Smock 13-23 HD1 (permit number: PN 53945) was drilled in Vernon Township, Isabella County, Michigan in the late fall of 2000. A demonstration well was selected and drilled based on geologic considerations and surface geochemistry. Over 460 soil samples were collected and analyzed over the drill site. A good anomaly was detected near the proposed well site and the demonstration well, the Smock 13-23, was drilled to a depth of 3157 feet by November 17, 2000. Two laterals were drilled, and hydrocarbons were located in a zone approximately 175 feet in length. However, it was determined that the pay zone was too small and difficult reservoir conditions (water production) prevented putting the well in production. The Smock 13-23 was shut in and abandoned January 15, 2001. A post-mortem determined that the main reason the well was not economic was because the zone was nearly completely flushed by earlier recovery operations. The post mortem also revealed the presence of an unmapped shale plug crossing the first lateral. It appears that this shale was detected by the geochemical survey, but its significance was not appreciated at the time. It is possible that sections of the well were faulty, ''porposing'' up and down so as to create water blockages. We are continuing to use the Vernon Field and the demonstration well to calibrate the geochemical data. Eventually, this study may provide a standard site that can be used to test and calibrate geochemical anomalies, something that does not presently exist. A postmortem report on the well, including the geology and geochemistry used to site the well, is presented in Appendix I. Five geochemical techniques have been tested in Phase I. These include surface iodine, microbial, enzyme leaching, soil gas and subsurface iodine. We are most comfortable with the results of the microbial surveys but feel that direct measurement of soil gas is the best method if analytical difficulties can be overcome. The reason the microbial surveys are presently favored is because they provide a logical, consistent picture that is easy to interpret and easy to explain. This in turn is because the microbial anomaly is manifested as an ''apical'' as opposed to an ''edge'' or ''halo'' anomaly. Several lessons were learned during Phase I activities. The main one was that surface geochemistry could locate anomalies over old fields such as Vernon. We also learned that horizontal drilling has advantages and disadvantages in situations such as this. On the plus side, it does provide a means to probe for pockets of bypassed oil, but it is expensive relative to vertical (or slant wells?) and is difficult to control in a narrow pay zone. We tentatively conclude that horizontal wells do not provide a cost-effective solution in this setting and suggest that geochemical anomalies be investigated via a single vertical well or multiple vertical wells.

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan; E. Taylor




Science Conference Proceedings (OSTI)

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. A major part of the remaining project will focus on using surface geochemistry to delineate prospects. A Niagaran reef field geochemical survey, the Bagley Prospect area in Otsego County, Michigan is scheduled to take place this summer. Previous wells drilled in Bagley Prospect area in the early 1970's and in place in late 2002 and early 2003 resulted in discoveries and numerous hydrocarbon shows in the Brown Niagaran reservoir interval. The Bagley region is still considered an area of interest by the industry and appears ripe for a geochemical survey. Our industry partner is interested in a possible test in the Bagley prospect because subsurface geophysical and geological interpretation indicates the presence of structures. Anomalous production and pressure data further suggest the region is not yet well understood and should not be considered mature. The most recent well, the Bagley 1-22A sidetrack, was unsuccessful at locating a new reef culmination to the south of the original vertical well and did not encounter hydrocarbon shows. The sidetrack and well were plugged and abandoned. The proposed geochemical survey will concentrate on areas away from the Bagley 1-22A to the north and west but will include the entire prospect so that the existing data can be used in interpretations. Bagley appears to offer a unique combination of potential and data for a geochemical study that focuses on looking for new oil in an area that has exhausted traditional geologic and geophysical methods. The Bear Lake pinnacle reef trend in Manistee County, Michigan, is also scheduled for further geochemical work this summer. Industry interest, mostly by small companies, is picking up in this area and it is also ripe for targeted geochemical surveys for the same reasons cited above.

James R. Wood; A. Wylie; W. Quinlan




Science Conference Proceedings (OSTI)

One of the main objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. As part of the project, several field demonstrations were undertaken to assess the validity and usefulness of the microbial surface geochemical technique. The important observations from each of these field demonstrations are briefly reviewed in this annual report. These demonstrations have been successful in identifying the presence or lack of hydrocarbons in the subsurface and can be summarized as follows: (1) The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path of the State Springdale & O'Driscoll No.16-16 horizontal demonstration well in Manistee County, Michigan. The well was put on production in December 2003. To date, the well is flowing nearly 100 barrels of liquid hydrocarbons per day plus gas, which is a good well in Michigan. Reserves have not been established yet. Two successful follow-up horizontal wells have also been drilled in the Springdale area. Additional geochemistry data will be collected in the Springdale area in 2004. (2) The surface geochemistry sampling in the Bear Lake demonstration site in Manistee County, Michigan was updated after the prospect was confirmed and production begun; the original subsurface and seismic interpretation used to guide the location of the geochemical survey for the Charlich Fauble re-entry was different than the interpretation used by the operator who ultimately drilled the well. As expected, the anomaly appears to be diminishing as the positive (apical) microbial anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir. (3) The geochemical sampling program over the Vernon Field, Isabella County, Michigan is now interpreted as a large negative anomaly associated with the entire field. The results of the State Smock horizontal well and the Bowers 4-25 well confirmed the lack of additional recoverable hydrocarbons in the Vernon Field. (4) The surface geochemistry data showed a strong anomaly in the Myrtle Beach, Burke County, North Dakota area that would justify drilling by itself and even more so in conjunction with the structural interpretation from the geological and geophysical data; the microbial values here were the highest we have observed. The Myrtle Beach geochemical survey indicated a good to excellent prospect which was confirmed by drilling, however, a pipeline has not yet been completed that would allow the wells to be placed into production. We also present in this annual report the results of recent efforts to map carbonate facies tracts in the middle Devonian Dundee and Rogers City Limestones using gamma ray, bulk density, and photoelectric effect geophysical well log amplitudes. This work was undertaken to identify fairways for exploration in the Dundee and Rogers City where surface geochemical techniques could then be used to screen potential leads.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

Two major accomplishments resulted from Phase I. One is the success of the surface geochemistry program, which collected over 800 samples from the site of the 1st demonstration well in Vernon Field and has pretty well provided us with the tools to delineate favorable ground from unfavorable. The second is the recent detailed mapping of the Central Michigan Basin that for the first time revealed the presence of at least two major faults that control the location of many of the reservoirs in the Michigan Basin. These faults were located from structure maps obtained by contouring the surface of the Dundee Formation using top picks from 9861 wells in 14 counties. Faults were inferred where the contour lines were most dense (''stacked'').

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan




SciTech Connect

The fault study continues to find more faults and develop new techniques to visualize them. Data from the Dundee Formation has been used to document 11 major faults in the Michigan Basin which have now been verified using data from other horizons. These faults control the locations of many of the large anticlinal structures in the Michigan Basin and likely controlled fluid movements as well. The surface geochemistry program is also moving along well with emphasis on measuring samples collected last sampling season. The new GC laboratory is now functional and has been fully staffed as of December. The annual project review was held March 7-9 in Tampa, Florida. Contracts are being prepared for drilling the Bower's prospects in Isabella County, Michigan, this spring or summer. A request was made to extend the scope of the project to include the Willison Basin. A demonstration well has been suggested in Burke County, N. Dakota, following a review of 2D seismic and surface geochem. A 3D seismic survey is scheduled for the prospect.

James R. Wood; T.J. Bornhorst; William B. Harrison; W. Quinlan




SciTech Connect

In this reporting period, we extended the fault study to include more faults and developed new techniques to visualize the faults. We now have used data from the Dundee Formation to document 11 major faults in the Michigan Basin and are in the process of reviewing data from other horizons. These faults appear to control the locations of many of the large anticlinal structures in the Michigan Basin and likely controlled fluid movements as well. The surface geochemistry program is also moving along well with emphasis on measuring samples collected last sampling season. The new laboratory is now functional and has been fully staffed as of December. The annual project review has been set for March 7-9 in Tampa, Florida. Contracts are being prepared for drilling the Bower's prospects in Isabella County, Michigan, this spring or summer.

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan




SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. As part of the project, a field demonstration was undertaken to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a strong anomaly in the Myrtle Beach area that would justify drilling by itself and even more so in conjunction with the structural interpretation from the 3D seismic data. The Myrtle Beach geochemical survey indicated a good to excellent prospect which was confirmed by drilling. Presented in this quarterly report is the Case History and Well Summary for the Myrtle Beach area in Burke County, North Dakota. This case history presents the important technical details regarding the geochemistry and the two vertical wells that are part of this field demonstration, and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and is being used on all subsequent field demonstrations as they near completion.

James R. Wood; W. Quinlan



AND FINANCIAL 2011 Edition | EConoMiC And FinAnCiAL PRoFiLE oF QUBEC  

E-Print Network (OSTI)

ENERGY AGENCY. SOURCE: HYDRO-QU?BEC, COMPARISON OF ELECTRICITY PRICES IN MAJOR NORTH AMERICAN CITIES renewable energy, hydro-electricity in particular. It supports the development of wind power through its Energy Strategy 2006-2015, Hydro-Québec is actively pursuing development of Québec's hydroelectric

Rosei, Federico


Reactor & Nuclear Systems Publications | ORNL  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications and Reports NSED Monthly Reports Reactor and Nuclear Systems Publications 2013 Publications 2012 Publications 2011 Publications 2010 and Older Publications Nuclear...


Find LANL Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Communication Alerts Bibliographic Management Copyright Open Access How to Find LANL Publications Find LANL Publications1354608000000Find LANL PublicationsSome of these...


ARM - Publications: Science Team Meeting Documents: Publication...  

NLE Websites -- All DOE Office Websites (Extended Search)

Publication Trends of ARM Research Troyan, David Brookhaven National Laboratory This study summarizes the publication record of ARM research. Items of all types listed in the ARM...


,"Michigan Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050MI3","N3010MI3","N3020MI3","N3035MI3","N3045MI3" "Date","Natural Gas Citygate Price in Michigan (Dollars per Thousand Cubic Feet)","Michigan Price of...


Epigenetic Alterations in High and Low LET Radiation Induced...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the unstable clones. Among these, altered miRNA expression could be validated by qRT-PCR for mmu-miR-466g, hsa-miR-30a and hsamiR- 195. Hsa-miR-30a and hsa-miR-195 were...


Public Meeting  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Summary Minutes of the Summary Minutes of the U.S. Department of Energy (DOE) Secretary of Energy Advisory Board (SEAB) Public Meeting July 19, 2012 Committee Members: William Perry, Chair; Norm Augustine; Ralph Cicerone; Nick Donofrio; Michael McQuade; Matt Rogers; Art Rosenfeld; Sue Tierney; Steven Westly; Daniel Yergin Date and Time: 3:00PM - 4:30PM, July 19, 2012 Location: Teleconference Purpose: Meeting of the Secretary of Energy Advisory Board SEAB Staff: Amy Bodette, Designated Federal Officer Alyssa Morrissey, Deputy Designated Federal Officer Meeting Summary SEAB Members convened by teleconference to hear updates from the Building Efficiency and Small Modular Reactor (SMR) Subcommittees. After the Subcommittee reports and questions from the full



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

6.html[2/3/2012 12:44:00 PM] 6.html[2/3/2012 12:44:00 PM] PUBLIC SUBMISSION As of: February 03, 2012 Received: January 19, 2012 Status: Pending_Post Tracking No. 80f9b24f Comments Due: January 20, 2012 Submission Type: Web Docket: DOE-HQ-2012-0004 U.S. Department of Energy Audit Guidance: For-Profit Recipients Comment On: DOE-HQ-2012-0004-0001 Audit Guidance: For-Profit Recipients Document: DOE-HQ-2012-0004-DRAFT-0006 Comment on FR Doc # 2011-32622 Submitter Information Name: Eric Russell Address: 836 Thurber Drive West Apt 1 Columbus, Ohio, 43215 Email: ejrussell02@yahoo.com Phone: 615-972-9984 General Comment See attached file(s) Attachments Response to DOE For Profit Audit Federal Register Notice Response to U.S. Department of Energy Request for Information Federal Register Notice 2011-32622


TMS Publications Home  

Science Conference Proceedings (OSTI)

TMS Publications Home. TMS publishes numerous journals, conference proceedings volumes, textbooks, and other print and electronic publications designed...


NIST Publications Policy  

Science Conference Proceedings (OSTI)

... NIST Technical Publication Policy. All technical ... authors. NIST requires all scientific publications to be of high technical quality. In ...

Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2-2012%2010-10-11-600/Document%20List%2003-02-2012%2010-10-11-600_docs/Martin%20WeblerCover_DRAFT-0004.html[2/3/2012 12:40:30 PM] 2-2012%2010-10-11-600/Document%20List%2003-02-2012%2010-10-11-600_docs/Martin%20WeblerCover_DRAFT-0004.html[2/3/2012 12:40:30 PM] PUBLIC SUBMISSION As of: February 03, 2012 Received: January 05, 2012 Status: Pending_Post Tracking No. 80f8e384 Comments Due: January 20, 2012 Submission Type: Web Docket: DOE-HQ-2012-0004 U.S. Department of Energy Audit Guidance: For-Profit Recipients Comment On: DOE-HQ-2012-0004-0001 Audit Guidance: For-Profit Recipients Document: DOE-HQ-2012-0004-DRAFT-0004 Comment on FR Doc # 2011-32622 Submitter Information Name: Martin Webler Address: 866 Macarthur Dr 866 Macarthur Dr Pittsburgh, PA, 15228 General Comment In working with the "316 Audits" over the past year, I noted some general improvements in the guidance that would help clarify things for the auditor, the recipients and DOE personnel. I hope you


Computational Enhancements in Low-Rank Semidefinite ...  

E-Print Network (OSTI)

Jul 12, 2004 ... curvature condition necessary for L-BFGS, to be more efficient than the WP linesearch if the ... The precise condition ..... (Mi D)Mi, Mi := AiR.


Tradeoffs between Costs and Greenhouse Gas Emissions in the Design of Urban Transit Systems  

E-Print Network (OSTI)

mi) Maintenance emissions (g/veh-mi) Total emissions (g/veh-mi) Total emissions (g/veh-km) Comments 15,300 Based onfrom Chester (2008); emissions from EIO-LCA (CMU 2012) 1,841

Griswold, Julia Baird



Applications in the Nuclear Industry for Thermal Spray Amorphous Metal and Ceramic Coatings  

E-Print Network (OSTI)

Science & Technology 2007, Detroit, MI, Sept. 16 20, 2007,2007, Sept. 1620, 2007, Detroit, MI, American CeramicExhib. , Sept. 1620, 2007, Detroit, MI, American Ceramic

Blink, J.; Farmer, J.; Choi, J.; Saw, C.




NLE Websites -- All DOE Office Websites (Extended Search)

Vehicle Usage Number of trips 773,602 Total distance traveled (mi) 5,558,155 Avg trip distance (mi) 7.2 Avg distance traveled per day when the vehicle was driven (mi) 30.2 Avg...


Energy Information Administration/Oil and Gas Field Code ...  

U.S. Energy Information Administration (EIA)

mississippi union 01-26n-9w grand traverse mi 055 003557 n 1969 union 02-26n-9w grand traverse mi 055 006252 n 1973 union 03-26n-9w grand traverse mi ...


ARM - Public Information Materials  

NLE Websites -- All DOE Office Websites (Extended Search)

govPublicationsPublic Information Materials govPublicationsPublic Information Materials Publications Journal Articles Conference Documents Program Documents Technical Reports Publications Database Public Information Materials Image Library Videos Publication Resources Submit a Publication Publishing Procedures ARM Style Guide (PDF, 448KB) Acronyms Glossary Logos Contacts RSS for Publications Public Information Materials The ARM Climate Research Facility develops public information materials to communicate the purpose and objectives of the program to general audiences. These materials are designed to increase awareness of ARM Climate Research Facility goals and to document its scientific results to a lay audience. Public information materials include fact sheets, brochures, CDs, videos, press releases, and information packets. Approved materials are made


Geothermal: Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Sorted By: Relevance, Descending Results: 1-25 of exactly 18776 matches. Sort Results By: Relevance Publication Date System Entry Date Document Type Title Research Org Sponsoring Org OSTI Identifier Report Number DOE Contract Number Ascending Descending Go Show: Make a Selection OSTI ID Report Number DOE Contract No Other Identifier No Document Type Research Org Sponsoring Org Subject Publisher Country Language Availability Entry Date Keywords Go Page 1 of 400 Next » Go to Page: 1 of 400 2 of 400 3 of 400 4 of 400 5 of 400 6 of 400 7 of 400 8 of 400 9 of 400 10 of 400 11 of 400 12 of 400 13 of 400 14 of 400 15 of 400 16 of 400 17 of 400 18 of 400 19 of 400 20 of 400 21 of 400 22 of 400 23 of 400 24 of 400 25 of 400 26 of 400 27 of 400 28 of 400 29 of 400 30 of 400 31 of 400 32 of 400 33 of 400 34 of 400 35 of 400 36 of 400 37 of 400 38 of 400 39 of 400 40 of 400 41 of 400 42 of 400 43 of 400 44 of 400 45 of 400 46 of 400 47 of 400 48 of 400 49 of 400 50 of 400 51 of 400 52 of 400 53 of 400 54 of 400 55 of 400 56 of 400 57 of 400 58 of 400 59 of 400 60 of 400 61 of 400 62 of 400 63 of 400 64 of 400 65 of 400 66 of 400 67 of 400 68 of 400 69 of 400 70 of 400 71 of 400 72 of 400 73 of 400 74 of 400 75 of 400 76 of 400 77 of 400 78 of 400 79 of 400 80 of 400 81 of 400 82 of 400 83 of 400 84 of 400 85 of 400 86 of 400 87 of 400 88 of 400 89 of 400 90 of 400 91 of 400 92 of 400 93 of 400 94 of 400 95 of 400 96 of 400 97 of 400 98 of 400 99 of 400 100 of 400 101 of 400 102 of 400 103 of 400 104 of 400 105 of 400 106 of 400 107 of 400 108 of 400 109 of 400 110 of 400 111 of 400 112 of 400 113 of 400 114 of 400 115 of 400 116 of 400 117 of 400 118 of 400 119 of 400 120 of 400 121 of 400 122 of 400 123 of 400 124 of 400 125 of 400 126 of 400 127 of 400 128 of 400 129 of 400 130 of 400 131 of 400 132 of 400 133 of 400 134 of 400 135 of 400 136 of 400 137 of 400 138 of 400 139 of 400 140 of 400 141 of 400 142 of 400 143 of 400 144 of 400 145 of 400 146 of 400 147 of 400 148 of 400 149 of 400 150 of 400 151 of 400 152 of 400 153 of 400 154 of 400 155 of 400 156 of 400 157 of 400 158 of 400 159 of 400 160 of 400 161 of 400 162 of 400 163 of 400 164 of 400 165 of 400 166 of 400 167 of 400 168 of 400 169 of 400 170 of 400 171 of 400 172 of 400 173 of 400 174 of 400 175 of 400 176 of 400 177 of 400 178 of 400 179 of 400 180 of 400 181 of 400 182 of 400 183 of 400 184 of 400 185 of 400 186 of 400 187 of 400 188 of 400 189 of 400 190 of 400 191 of 400 192 of 400 193 of 400 194 of 400 195 of 400 196 of 400 197 of 400 198 of 400 199 of 400 200 of 400 201 of 400 202 of 400 203 of 400 204 of 400 205 of 400 206 of 400 207 of 400 208 of 400 209 of 400 210 of 400 211 of 400 212 of 400 213 of 400 214 of 400 215 of 400 216 of 400 217 of 400 218 of 400 219 of 400 220 of 400 221 of 400 222 of 400 223 of 400 224 of 400 225 of 400 226 of 400 227 of 400 228 of 400 229 of 400 230 of 400 231 of 400 232 of 400 233 of 400 234 of 400 235 of 400 236 of 400 237 of 400 238 of 400 239 of 400 240 of 400 241 of 400 242 of 400 243 of 400 244 of 400 245 of 400 246 of 400 247 of 400 248 of 400 249 of 400 250 of 400 251 of 400 252 of 400 253 of 400 254 of 400 255 of 400 256 of 400 257 of 400 258 of 400 259 of 400 260 of 400 261 of 400 262 of 400 263 of 400 264 of 400 265 of 400 266 of 400 267 of 400 268 of 400 269 of 400 270 of 400 271 of 400 272 of 400 273 of 400 274 of 400 275 of 400 276 of 400 277 of 400 278 of 400 279 of 400 280 of 400 281 of 400 282 of 400 283 of 400 284 of 400 285 of 400 286 of 400 287 of 400 288 of 400 289 of 400 290 of 400 291 of 400 292 of 400 293 of 400 294 of 400 295 of 400 296 of 400 297 of 400 298 of 400 299 of 400 300 of 400 301 of 400 302 of 400 303 of 400 304 of 400 305 of 400 306 of 400 307 of 400 308 of 400 309 of 400 310 of 400 311 of 400 312 of 400 313 of 400 314 of 400 315 of 400 316 of 400 317 of 400 318 of 400 319 of 400 320 of 400 321 of 400 322 of 400 323 of 400 324 of 400 325 of 400 326 of 400 327 of 400 328 of 400 329 of 400 330 of 400 331 of 400 332 of 400 333 of 400 334 of 400 335 of 400 336 of 400 337 of 400 338 of 400 339 of 400 340 of 400 341 of 400 342 of 400 343 of 400 344 of 400 345 of 400 346 of 400 347 of 400 348 of 400 349 of 400 350 of 400 351 of 400 352 of 400 353 of 400 354 of 400 355 of 400 356 of 400 357 of 400 358 of 400 359 of 400 360 of 400 361 of 400 362 of 400 363 of 400 364 of 400 365 of 400 366 of 400 367 of 400 368 of 400 369 of 400 370 of 400 371 of 400 372 of 400 373 of 400 374 of 400 375 of 400 376 of 400 377 of 400 378 of 400 379 of 400 380 of 400 381 of 400 382 of 400 383 of 400 384 of 400 385 of 400 386 of 400 387 of 400 388 of 400 389 of 400 390 of 400 391 of 400 392 of 400 393 of 400 394 of 400 395 of 400 396 of 400 397 of 400 398 of 400 399 of 400 400 of 400 Go


NETL: Publication Standards Manual  

NLE Websites -- All DOE Office Websites (Extended Search)

Standards Manual Publications Publication Standards Manual Click on the logo to access the NETL Publication Standards Manual 2003 APEX Logo Click on the logo or on the link below...


Record of Decision for the Department of Energy's Waste Management Program: Storage of High-Level Radioactive Waste (08/26/99)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

661 661 Federal Register / Vol. 64, No. 165 / Thursday, August 26, 1999 / Notices Installation State Function(s) Total au- thorizations Public an- nounce- ment date Solicitation issued or scheduled date SELFRIDGE ......................... MI FUELS MANAGEMENT ..................................................... 8 01-Jun-98 27-Apr-99. SELFRIDGE ......................... MI TRANSIENT AIRCRAFT MAINTENANCE ......................... 8 04-Jun-98 28-Apr-99. SEYMOUR JOHNSON ......... NC TRANSIENT AIRCRAFT MAINTENANCE ......................... 8 12-Nov-97 02-Jul-99. SHAW ................................... SC COMMUNICATION FUNCTIONS ....................................... 3 18-May-99 09-May-00. SHAW ................................... SC LIBRARY .............................................................................


LANSCE | Lujan Center | Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publication acknowledgement Lujan Center monitors the number of papers published as a result of the use of our facilities. The Lujan Center's sponsoring agency, US...


NREL: Publications Home Page  

NLE Websites -- All DOE Office Websites (Extended Search)

the database for publications from 1977 to the present on subjects related to renewable energy and energy-efficient technologies. Many publications are available electronically...


Service/Product Provider  

NLE Websites -- All DOE Office Websites (Extended Search)

816 Maple St. 738 E. Gull Lake Dr. Three Rivers, MI 49093 Augusta, MI 49012 Business: Steam, air & hot water systems Business: Pharmaceutical manufacturing Tom Henry, Director of...


Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

experiments with approximately 25 hours and 51 minutes of luminosity - NuMI off due to power supply - MI transformer replaced Monday evening - Store established Tuesday morning...


Subsidized Housing and Neighborhood Change  

E-Print Network (OSTI)

97 Figure 3-6a Detroit, MI PMSA Neighborhood Quintile98 Figure 3-6b Detroit, MI PMSA Neighborhood Quintileinterviewing from the Detroit Area Study. Neighborhood

Wilson, Florence Louise



DOE - Office of Legacy Management -- General Motors Co - Flint...  

Office of Legacy Management (LM)

Motors Co - Flint - MI 07 FUSRAP Considered Sites Site: GENERAL MOTORS CO. (MI.07 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate...


E Pluribus...Separation: Deepening Double Segregation for More Students  

E-Print Network (OSTI)

TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-

Orfield, Gary; Kucsera, John; Siegel-Hawley, Genevieve



NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Clean Energy Coalition - Michigan Green Fleets This CX form is for installing propane refueling infrastructure at one site in MI. This CX is for project selected under...


Petroleum Institute Scholarly Publications  

E-Print Network (OSTI)

Abu Dhabi The Petroleum Institute Scholarly Publications January 1st ­ December 31st 2007 #12;The Petroleum Institute Scholarly Publications January 1st ­ December 31st 2007 v #12;- 2 - Scholarly Publications 2007 | The Petroleum Institute #12;- 3 - Scholarly Publications 2007 | The Petroleum Institute


Building and Fire Publications  

Science Conference Proceedings (OSTI)

... economic analysis; energy conservation; energy economics; life cycle cost analysis; public buildings; renewable energy; water conservation ...

Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


NIST Manuscript Publication Search  

Science Conference Proceedings (OSTI)

... Publication Citation: Radioanalytical Emergency Response Exercise. NIST Authors in Bold. ... Title: Radioanalytical Emergency Response Exercise. ...




E-Print Network (OSTI)

PUBLICATIONS, CONFERENCE PRESENTATIONS AND REPORTS Refereed Publications 29. M.H. Alkhaldi, H. 46, 19-25. 22. Dholkawala, Z. F., Sarma, H.K., and Kam, S.I.: Application of Fractional Flow Theory Pressure When CO2 Is Diluted With Other Gases, SPE Reservoir Evaluation & Engineering, Volume 9, Number 4

Williams, John M.


Public Assembly Buildings  

U.S. Energy Information Administration (EIA) Indexed Site

Assembly Assembly Characteristics by Activity... Public Assembly Public assembly buildings are those in which people gather for social or recreational activities, whether in private or non-private meeting halls. Basic Characteristics [ See also: Equipment | Activity Subcategories | Energy Use ] Public Assembly Buildings... Most public assembly buildings were not large convention centers or entertainment arenas; about two-fifths fell into the smallest size category. About one-fifth of public assembly buildings were government-owned, mostly by local governments; examples of these types of public assembly buildings are libraries and community recreational facilities. Tables: Buildings and Size Data by Basic Characteristics Establishment, Employment, and Age Data by Characteristics


NREL: Buildings Research - Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications NREL publishes a variety of documents related to its research, including technical reports, brochures, and presentations. Read the information below to find out how to find a publication about buildings research at NREL. Accessing Research Papers Buildings Technical Highlights Research Papers - Commercial Research Papers - Residential Accessing Buildings Research Documents Documents produced by NREL related to buildings technologies may be accessed online in several different ways. National Renewable Energy Laboratory Publications Database The NREL Publications Database covers building technology documents written or edited by NREL staff and subcontractors from 1977 to the present. The database includes technical reports as well as outreach publications such


NREL: Wind Research - Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications The NREL wind research program develops publications about its R&D activities in wind energy technologies. Below you'll find links to recently published publications, links to the NREL Avian Literature and Publications Databases, and information about the Technical Library at the National Wind Technology Center (NWTC). The NWTC's quarterly newsletter, @NWTC, contains articles on current wind energy research projects and highlights the latest reports, papers, articles, and events published or sponsored by NREL. Subscribe to @NWTC. Selected Publications Featured Publication Large-scale Offshore Wind Power in the United States: Assessment of Opportunities and Barriers Here are some selected NWTC publications: 2011 Cost of Wind Energy Review Built-Environment Wind Turbine Roadmap


NETL: Major Demonstrations Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Reference Shelf > Publications Reference Shelf Publications Inventory of Power Plants in the U.S. as of January 1, 1997 PDF-31MB (Dec 1997) Sustainable Development with Clean...


NETL Publication Standards Manual  

NLE Websites -- All DOE Office Websites (Extended Search)

Standards NETL Publication Standards Manual Publication Standards Manual Click on topic below to view Click "Contents" in the bookmarks panel at the left of your screen to return to this page Introduction * Overview * About This Manual - Point of Contact - Download Files - Permission - Signage - Special Applications Publication Standards * Design Elements * Fact Sheets * Font (Typeface) * Full-Size Brochures * Logo * Presentations * Report Covers NETL Publication Standards Manual Overview For over 60 years, we have been at the forefront


Building and Fire Publications  

Science Conference Proceedings (OSTI)

... Ramsey prices. Optimal Pricing of Publicly Supplied Private Goods: A Case Study of NIST Standard Reference Materials. ...


Conference Proceedings Publication Proposal  

Science Conference Proceedings (OSTI)

AVAILABILITY. ? Concurrent with conference ? Non-concurrent (publication recommended within 3 months of meeting). Date papers are due to editors:...


NIST Manuscript Publication Search  

Science Conference Proceedings (OSTI)

... Publication Citation: ITL Updates Glossary of Key Information Security Terms. ... Title: ITL Updates Glossary of Key Information Security Terms. ...



NIST Manuscript Publication Search  

Science Conference Proceedings (OSTI)

... Publication Citation: Glossary of Key Information Security Terms. NIST Authors in Bold. ... Title: Glossary of Key Information Security Terms. ...



EIA publications directory, 1992  

DOE Green Energy (OSTI)

This directory contains abstracts and ordering information for EIA publications. The abstracts are arranged by broad subject category such as coal, petroleum, natural gas, and electric power. A comprehensive subject index, a title index, and a report number index are included. Each entry gives the title, report number, publication frequency, date, number of pages, and ordering information. Publication began with the 1979 edition.

Not Available



Publications | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Publications Publications Publications November 1, 2013 - 11:40am Addthis Thumbnail image of the cover for the Combined Heat and Power (CHP): A Decade of Progress, A Vision for the Future, October 2009 Numerous publications are available to help educate end users, product developers, project managers, and policymakers on the many potential benefits of distributed generation (DG) and combined heat and power (CHP) and the barriers to widespread deployment of these technologies. Among these resources are market analyses, databases, fact sheets, guidebooks, technical reports, technical white papers, technology reviews, webcasts, and vision and roadmap documents. Recent Publications Market Analyses Commercial District Energy/Institutional Federal Industrial Multifamily Housing


Publications | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Publications Publications Publications November 1, 2013 - 11:40am Addthis Thumbnail image of the cover for the Combined Heat and Power (CHP): A Decade of Progress, A Vision for the Future, October 2009 Numerous publications are available to help educate end users, product developers, project managers, and policymakers on the many potential benefits of distributed generation (DG) and combined heat and power (CHP) and the barriers to widespread deployment of these technologies. Among these resources are market analyses, databases, fact sheets, guidebooks, technical reports, technical white papers, technology reviews, webcasts, and vision and roadmap documents. Recent Publications Market Analyses Commercial District Energy/Institutional Federal Industrial Multifamily Housing


Emergency Information for the Public  

NLE Websites -- All DOE Office Websites (Extended Search)

the Public Emergency Information for the Public Ensuring release of accurate information to the public. Contact Communications Office (505) 667-7000 Email LANL Update (505)...


Publications 2000 - Nuclear Data Program - Nuclear Engineering...  

NLE Websites -- All DOE Office Websites (Extended Search)

0 Nuclear Data Program Overview Current Projects & Recent Activities Collaborating Organizations Publications Publications 2011 Publications 2010 Publications 2009...


LCLS Publications: Statistics  

NLE Websites -- All DOE Office Websites (Extended Search)

LCLS Publications: Statistics LCLS Publications: Statistics Sign In Launch the Developer Dashboard SLAC National Accelerator Laboratory DOE | Stanford | SLAC | SSRL | LCLS | AD | PPA | Photon Science | PULSE | SIMES LCLS : LCLS Publications: Statistics Linac Coherent Light Source An Office of Science User Facility Search this site... Search Help (new window) Top Link Bar LCLS Lasers Expand Lasers LCLS Quick Launch Home About LCLS Expand About LCLS LCLS News Expand LCLS News User Resources Expand User Resources Instruments Expand Instruments Proposals Publications Expand Publications Schedules Machine Status Machine FAQs Safety Organization Expand Organization Directories Expand Directories Staff Resources Contact Us All Site Content Department of Energy Page Content LCLS Publications: Statistics 2013 | 2012 | 2011 | 2010 | 2009 | Archive | Citations | Statistics


130517 - Public Meeting - Notepad  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site



Alternative Fuels Data Center: Publications  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Publications Publications Printable Version Share this resource Send a link to Alternative Fuels Data Center: Publications to someone by E-mail Share Alternative Fuels Data Center: Publications on Facebook Tweet about Alternative Fuels Data Center: Publications on Twitter Bookmark Alternative Fuels Data Center: Publications on Google Bookmark Alternative Fuels Data Center: Publications on Delicious Rank Alternative Fuels Data Center: Publications on Digg Find More places to share Alternative Fuels Data Center: Publications on AddThis.com... Publications Find publications about alternative transportation, including alternative fuels, advanced vehicles, and regulated fleets. Keyword Category Search more search options close × Filter by Document Category Books & Chapters Brochures & Fact Sheets Conference Papers & Proceedings


Alternative Fuels Data Center: Publications  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Publications Publications Printable Version Share this resource Send a link to Alternative Fuels Data Center: Publications to someone by E-mail Share Alternative Fuels Data Center: Publications on Facebook Tweet about Alternative Fuels Data Center: Publications on Twitter Bookmark Alternative Fuels Data Center: Publications on Google Bookmark Alternative Fuels Data Center: Publications on Delicious Rank Alternative Fuels Data Center: Publications on Digg Find More places to share Alternative Fuels Data Center: Publications on AddThis.com... Publications Find publications about alternative transportation, including alternative fuels, advanced vehicles, and regulated fleets. Keyword Category alternative fuel price report Search more search options close × Filter by Document Category

Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


ORISE: Public Health Communication  

NLE Websites -- All DOE Office Websites (Extended Search)

Communication Communication Public Health Communication The Oak Ridge Institute for Science and Education (ORISE) assists government agencies and organizations in addressing public health challenges by developing evidence-based communication programs and social marketing initiatives that resonate with target populations. Because approximately half of American adults do not understand basic health information, ORISE develops the types of messages that will attract attention and motivate people to address their personal and family health. ORISE also develops and executes evidence-based and culturally-competent public health communication programs that help change behaviors and result in healthier lifestyles. Communication Planning and Products Public health organizations are faced with increasing demands for


Sririam Recent Publication  

Science Conference Proceedings (OSTI)

... 4, 2009, pp. 25-38. Presentation slides: http://www.cyber.st.dhs.gov/ public/CATCH/Sriram.pdf. Kotikalapudi Sriram, Doug ...



NREL: Geothermal Technologies - Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications NREL's geothermal team develops publications, including technical reports and conference papers, about geothermal resource assessments, market and policy analysis, and geothermal research and development (R&D) activities. In addition to the selected documents available below, you can find resources on the U.S. Department of Energy (DOE) Geothermal Technologies Program Web site or search the NREL Publications Database. For additional geothermal documents, including those published since 1970, please visit the Office of Science and Technology Information Geothermal Legacy Collection. Policymakers' Guidebooks Five steps to effective policy. Geothermal Applications Market and Policy Analysis Program Activities R&D Activities Geothermal Applications


Public Reading Room  

Office of Legacy Management (LM)

has established a Public Reading Room at 955 has established a Public Reading Room at 955 Mound Road, Miamisburg, Ohio, which contains documents and information related to Mound as required under Section 117(d) of SARA. Copies of key Mound records, including the CERCLA Administrative Record and Information Repository, are kept in the Public Reading Room. The Administrative Record and Information Repository for Mound are updated as new documents are created and an index of documents in the complete collections accompanies each update. The Public Reading Room also contains reference items consisting of technical documents, news clippings, videotapes, journal articles, annual reports, and environmental restoration and decontamination and decommissioning decisional documents. Stakeholders are


About - Glass Publications Portal  

Office of Scientific and Technical Information (OSTI)

from the repository at OSTI. The Glass Publications Portal is sponsored by the DOE Energy Efficiency and Renewable Energy (EERE) Industrial Technologies Program. In...


Public Assembly Buildings  

U.S. Energy Information Administration (EIA) Indexed Site

buildings. Since they comprised 7 percent of commercial floorspace, this means that their energy intensity was just slightly below the commercial average. Public assembly buildings...


Building and Fire Publications  

Science Conference Proceedings (OSTI)

... to cover costs, prices therefore need to deviate from marginal cost. A public-sector pricing model in the Boiteux tradition computes price and output ...


Building and Fire Publications  

Science Conference Proceedings (OSTI)

... A public-sector pricing model in the Boiteux tradition computes price and output combinations that minimize the loss from charging prices that do ...


Advanced Energy Storage Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Advanced Energy Storage Publications Reports: Advanced Technology Development Program For Lithium-Ion Batteries: Gen 2 Performance Evaluation Final Report Advanced Technology...


NERSC Publications and Reports  

NLE Websites -- All DOE Office Websites (Extended Search)

Reports Publications & Reports Download the NERSC Strategic Plan (PDF | 3.2 MB) NERSC Annual Reports NERSC's annual reports highlight the scientific accomplishments of its users...


Public Safety Network Requirements  

Science Conference Proceedings (OSTI)

... Usage scenario. ... imposed by public safety applications and usage scenarios is key in ... requirements as shown in Figure 2. This analysis was used as ...



Electric Vehicle Public Charging -  

NLE Websites -- All DOE Office Websites (Extended Search)

Electric Vehicle Public Charging - Time vs. Energy March, 2013 A critical factor for successful PEV adoption is the deployment and use of charging infrastructure in non-...


NIST Manuscript Publication Search  

Science Conference Proceedings (OSTI)

NIST Home > NIST Manuscript Publication Search. ... In general, comb generators apply high power to a non-linear element (NLE) such as a step ...



ORNL Neutron Sciences Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

at other facilties by Neutron Sciences Directorate staff. We strongly encourage SNS and HFIR users to submit citation information, including URLs, for all publications regarding...


Making waste public.  

E-Print Network (OSTI)

??This thesis questions the boundaries that define waste as a public or private dilemma, investigating these boundaries as productive sites for the imagination of social (more)

Gambetta, Curt



Making Waste Public.  

E-Print Network (OSTI)

??This thesis questions the boundaries that define waste as a public or private dilemma, investigating these boundaries as productive sites for the imagination of social (more)

Gambetta, Curt



Nathalie Prevost - Publications - CECM  

E-Print Network (OSTI)

Publications. Ph.D. Thesis The Physics of Language: Towards a Phase Transition of Language Change. Canadian Artificial Intelligence(CAI) magazine


Montgomery County Public Schools  

Science Conference Proceedings (OSTI)

... Montgomery County Public Schools (MCPS) is the largest school district in the state of Maryland and the 16th-largest school district in the nation. ...



NIST Manuscript Publication Search  

Science Conference Proceedings (OSTI)

NIST Home > NIST Manuscript Publication Search. Author(s): Kristen L. Wood; RJ B. Stone; DRJ Mcadams; J Hirtz; Simon Szykman; ...




Science Conference Proceedings (OSTI)

...Tim Webber, IPG Photonics, Oxford, MA Frank Brennan, Trumpf, Plymouth, MI Rainer Uhlig, ABB, Fort Collins, CO Jim Cann, Rofin Sinar, Plymouth, MI Urban Widén, Permanova, Mölndal, Sweden Robert Borgstrom, Precitec, New Hudson, MI Scott Green, LT Ultra, New Hudson, MI Mike...

Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Supporting Information Evolution of Dendritic Platinum Nanosheets  

E-Print Network (OSTI)

87131. 3 Toyota Technical Center, Toyota Motor Engineering & Manufacturing North America, Ann Arbor, MI

Shelnutt, John A.


Civil Works Fact Sheets  

E-Print Network (OSTI)

HAMILTON DAM, FLINT RIVER, FLINT, MI ............................................ LRD-19 HOLES CREEK, WEST

US Army Corps of Engineers


MicroRNA expression in canine mammary cancer  

E-Print Network (OSTI)

MicroRNAs (miRNAs) play a vital role in differentiation, proliferation and tumorigenesis by binding to messenger RNAs (mRNA) and inhibiting translation. To initiate an investigation into the identification of miRNAs in the domestic dog, an emerging model for human disease, a comparison of the human and canine genetic databases was conducted. The bioinformatics work revealed significant conservation of miRNA genes between the two species. Proof of principle experiments, including serial dilutions and sequencing, were performed to verify that primers made to amplify human mature miRNAs can be used to amplify canine miRNAs, providing that the mature sequences are conserved. TaqMan Real-time RT-PCR, a sensitive and specific method, was used to isolate the first miRNA mature products from canine tissues. The expression levels of miR-17-3p, miR-17-5p, miR-18, miR-19a, miR-19b, miR-20, and miR-92 were evaluated in five canine tissues (heart, lung, brain, kidney, and liver). Because miRNAs have been found to act as both tumor suppressors and oncogenes in several different cancers, expression patterns of ten miRNAs (miR-15a, miR-16, miR-17-5p, miR-21, miR-29b, miR-125b, miR-145, miR-155, miR-181b, let-7f) known to be associated with human breast cancer were compared between malignant canine mammary tumors (n=6) and normal canine mammary tissue (n=10). Resulting data revealed miR-29b and miR-21 to have a statistically significant (p<0.05) up-regulation in cancerous samples. Overall expression patterns showed nine of the ten miRNAs follow the same pattern of expression in the domestic dog as the human, while the miR-145 expression does not show a difference between the normal and cancerous samples.

Boggs, Rene' Michelle



EIA Publications Directory 1993  

SciTech Connect

This directory contains abstracts and ordering information for EIA publications released in the above time period. The abstracts are arranged by broad subject category such as coal, petroleum, natural gas, and electric power. A comprehensive subject index, a title index, and a report number index are included. Each entry gives the title, report number, publication frequency, date, number of pages, and ordering information.

Not Available



2007 NSLS Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

07 NSLS Publications 07 NSLS Publications Brookhaven National Laboratory * National Synchrotron Light Source * P.O. Box 5000, Upton, NY 11973 * http://www.nsls.bnl.gov/ VUV-IR Beamlines ................................................................................................................................................................................................. 2 X-Ray Beamlines .................................................................................................................................................................................................. 8 NSLS Users NSLS Staff ............................................................................................................................................................................................................


Environmental Public Health at  

E-Print Network (OSTI)

requiring special laboratory expertise · The Division of Emergency and Environmental Health Services, which, environmental sanitation, and laboratory sciences----to protect public health · Responding and sharing solutions to environmental public health problems worldwide "We" are---- · The Division of Laboratory Sciences, which


Public affairs plan  

SciTech Connect

The purpose of the Uranium Mill Tailings Remedial Action (UMTRA) Project Public Affairs Plan is to establish goals for the Fiscal Year 1995 UMTRA public affairs program and identify specific activities to be conducted during the year. It also describes the roles of various agencies involved in the conduct of the public affairs program and defines the functions of the Technical Assistance Contractor (TAC) Public Affairs Department. It integrates and replaces the Public Participation Plan (DOE/AL/62350-47D) and Public Information Plan (DOE/AL/623590-71). The plan describes the US Department of Energy`s (DOE) plans to keep stakeholders and other members of the public informed about project policies, plans, and activities, and provide opportunities for stakeholders and interested segments of the public to participate in project decision-making processes. The plan applies to the UMTRA Project Office; the DOE Albuquerque Operations Office, Office of Intergovernmental and External Affairs (OIEA); the UMTRA TAC; the UMTRA Remedial Action Contractor (RAC); and other cooperating agencies.

Not Available



Publications and Presentations  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications and Presentations Publications and Presentations News & Publications ESnet in the News ESnet News Publications and Presentations Galleries ESnet Awards and Honors Contact Us Technical Assistance: 1 800-33-ESnet (Inside the US) 1 800-333-7638 (Inside the US) 1 510-486-7600 (Globally) 1 510-486-7607 (Globally) Report Network Problems: trouble@es.net Provide Web Site Feedback: info@es.net Publications and Presentations Sort by: Date | Author | Type 2013 Dart E., Rotman L., Tierney B., Hester M., and Zurawski J., "The Science DMZ: A Network Design Pattern for Data-Intensive Science", IEEE/ACM Annual SuperComputing Conference (SC13), Denver CO, USA, November 19, 2013, LBNL LBNL-6366E Download File: sc13sciDMZ-final.pdf (pdf: 952 KB) Ezra Kissel, Martin Swany, Brian Tierney and Eric Pouyoul, "Efficient


WIPP - Public Reading Facilities  

NLE Websites -- All DOE Office Websites (Extended Search)

Public Reading Facilities/Electronic Reading Facilities The Freedom of Information Act (FOIA) and Electronic FOIA (E-FOIA) require that various specific types of records, as well as various other records, be maintained in public reading facilities. Before you submit a FOIA request, we recommend you contact or visit the appropriate public reading facility to determine if the records you are seeking have already been released. The U.S. Department of Energy (DOE), as well as other related DOE sites, have established home pages on the Internet with links to other web sites. If you determine a specific facility might have records in which you are interested, requests for those records can be made directly to the public reading rooms identified below. Copying of records located in the public reading rooms must be made by the staff of those facilities.


Publication Submission Form  

NLE Websites -- All DOE Office Websites (Extended Search)

Pages Pages publicationsubmission Sign In Launch the Developer Dashboard SLAC National Accelerator Laboratory DOE | Stanford | SLAC | SSRL | LCLS | AD | PPA | Photon Science | PULSE | SIMES LCLS : Linac Coherent Light Source An Office of Science User Facility Search this site... Search Help (new window) Top Link Bar LCLS Lasers Expand Lasers LCLS Quick Launch Home About LCLS Expand About LCLS LCLS News Expand LCLS News User Resources Expand User Resources Instruments Expand Instruments Proposals Publications Expand Publications Schedules Machine Status Machine FAQs Safety Organization Expand Organization Directories Expand Directories Staff Resources Contact Us All Site Content Department of Energy Page Content Publication Submission Form Th Tell LCLS about new publications Please submit this form to notify LCLS about new publications relating to


Public Scoping Meeting Materials  

NLE Websites -- All DOE Office Websites (Extended Search)

Public Scoping Meeting Materials Public Scoping Meeting Materials Public Scoping Meeting Materials Fact sheets, presentations, and other information from the Conversion EIS Public Scoping Meetings. The following materials were made available during the DUF6 Conversion EIS public scoping meetings held near Portsmouth, Ohio, Oak Ridge, Tennessee, and Paducah, Kentucky, November - December, 2001. Notice of Intent PDF Icon Notice of Intent to Prepare an Environmental Impact Statement for Depleted Uranium Hexafluoride Conversion Facilities 60 KB details Presentation PDF Icon Overview: Depleted Uranium Hexafluoride (DUF6) Management Program 5.97 MB details DUF6 Fact Sheets PDF Icon Overview of Depleted Uranium Hexafluoride Management Program 174 KB details PDF Icon NEPA Activities for the Depleted Uranium Hexafluoride Management Program


Department of Energy - Public Participation  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site



Public Sector Energy Efficiency  

NLE Websites -- All DOE Office Websites (Extended Search)

Capitol dome Capitol dome Public Sector Energy Efficiency Research on sustainable federal operations supports the implementation of sustainable policies and practices in the public sector. This work serves as a bridge between the technology development of Department of Energy's National Laboratories and the operational needs of public sector. Research activities involve many aspects of integrating sustainability into buildings and government practices, including technical assistance for sustainable building design, operations, and maintenance; project financing for sustainable facilities; institutional change in support of sustainability policy goals; and procurement of sustainable products. All of those activities are supported by our work on program and project evaluation, which analyzes overall program effectiveness while ensuring



NLE Websites -- All DOE Office Websites (Extended Search)

4 4 Overall AC electrical energy consumption (AC Wh/mi)¹ 64 Overall DC electrical energy consumption (DC Wh/mi)² 31 Total number of trips 831 Total distance traveled (mi) 7,559 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 35 DC electrical energy consumption (DC Wh/mi) 54 Number of trips 541 Percent of trips city | highway 79% | 21% Distance traveled (mi) 3,402 Percent of total distance traveled 45%



NLE Websites -- All DOE Office Websites (Extended Search)

2 2 Overall AC electrical energy consumption (AC Wh/mi)¹ 45 Overall DC electrical energy consumption (DC Wh/mi)² 22 Total number of trips 1,585 Total distance traveled (mi) 14,910 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 34 DC electrical energy consumption (DC Wh/mi) 49 Number of trips 883 Percent of trips city | highway 81% | 19% Distance traveled (mi) 4,778 Percent of total distance traveled 32%


DOE Emergency Public Affairs Plan  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Headquarters Headquarters Office of Public Affairs Emergency Public Affairs Plan The DOE HQ Office of Public Affairs Emergency Public Affairs Plan has been approved for implementation by: __________________________________________________________ Dan Leistikow, Director, HQ Office of Public Affairs Date: ______________ __________________________________________________________ Joseph Krol, Director, HQ Office of Emergency Management Date: ______________ DOE Office of Public Affairs Emergency Public Affairs Plan 1 Purpose The Department of Energy (DOE) HQ Office of Public Affairs (PA) is committed to communicating information about the Department's work in a timely, accurate and accessible way to the news media, general public and employees.


CBECS - public use data  

U.S. Energy Information Administration (EIA) Indexed Site

Public Use Microdata Files Public Use Microdata Files CBECS Public Use Microdata Files Released: November 2008 Next CBECS will cover calendar year 2007 The 2003 CBECS Public Use Files are comma separated value (.csv) files that each contain 5,215 records. They represent commercial buildings from the 50 States and the District of Columbia. Each record corresponds to a single responding, in-scope sampled building. These files contain data for all buildings, including malls. There are 395 mall building records. For the mall buildings, a limited amount of information was collected, so there are many blank fields in the data for these cases. For all buildings, these files contain information such as the building size, year constructed, types of energy used, energy consumption and expenditures. For non-mall buildings, additional data items such as types of energy-using equipment and conservation features are also included in the files.


Risks to the public  

Science Conference Proceedings (OSTI)

Edited by Peter G. Neumann (Risks Forum Moderator and Chairman of the ACM Committee on Computers and Public Policy), plus personal contributions by others, as indicated. Opinions expressed are individual rather than organizational, and all of the usual ...

Peter G. Neumann



Risks to the public  

Science Conference Proceedings (OSTI)

Edited by Peter G. Neumann (Risks Forum Moderator and Chairman of the ACM Committee on Computers and Public Policy), plus personal contributions by others, as indicated. Opinions expressed are individual rather than organizational, and all of the usual ...

Peter G. Neumann



Risks to the public  

Science Conference Proceedings (OSTI)

Edited by Peter G. Neumann (Risks Forum Moderator and Chairman of the ACM Committee on Computers and Public Policy), plus personal contributions by others, as indicated. Opinions expressed are individual rather than organizational, and all of the usual ...

Peter G. Neumann


Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

'EXEC-2009-002897 'EXEC-2009-002897 PUBLIC SERV COM 1 2/25/2009 5:00 PM February 25,2009 The Honorable Steven Chu Secretary, U. S. Department of Energy 1000 Independence Avenue, S .W. Washingon, D.C. 20585 Re: State Energy Program Assurances Dear Secretary Chu: As a condition of receiving our State's share o f the $3.1, billion funding for the S t a t e Energy Program (SEP) under the American Recovery and Renewal Act of 2009 (H.R. l)(ARRA), I am providing the following assurances. I have written to our public u t i l i t y commission and requested that it consider additional actions to promote energy efficiency, consistent with the Federal statutory language contained in H.R. 1 and its obligations to maintain just and reasonable rates, while protecting the public. As set forth in the attached letter, the Chairperson of the Public Service


PNNL: EDO - Useful Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Useful Publications Useful Publications EDO produces an assortment of publications designed to inform, support and educate local technology businesses and service providers as well as communicate about our own efforts. We invite you to make use of these publications in supporting your efforts to start or grow a tech business or to help one succeed. Report - Hanford and the Tri-Cities Economy: Historical Trends 1970-2008 Tri-Cities Tech Business Update - Monthly news and events of interest to tech businesses in the Mid-Columbia area of Southeastern Washington State Companies with Roots in PNNL - Color flyer listing companies that received foundational technology and/or executives from PNNL since 1965. SBIR Alerting Service Targeted Support Program Technology Assistance Program


BNL | Public Events  

NLE Websites -- All DOE Office Websites (Extended Search)

Public Events Public Events Public event photos > About Visiting Brookhaven National Laboratory hosts concerts, lectures, and other events throughout the year which are free and open to the public. U.S. citizens age 16 and over must bring government-issued photo-identification for admission. Lectures JAN 17 Friday East Coast Conference for Undergraduate Women in Physics - Lecture "The Nation's Nuclear Physics Program and the Role of the Government" Presented by Dr. Jehanne Gillo, U.S. Department of Energy, Nuclear Physics 9:30 am, Berkner Hall Auditorium Friday, January 17, 2014, 9:30 am Hosted by: Director's Office JAN 22 Wednesday Brookhaven Lecture "491st Brookhaven Lecture: Juergen Thieme of Photon Sciences Directorate" Presented by Juergen Thieme, Brookhaven Lab's Photon Sciences Directorate


Publications | Argonne National Laboratory  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications Documents Publications Publication Type - Any - Book Book Chapter Conference Paper Conference Proceedings Journal Journal Article Miscellaneous Report Year - Any - 1985 1988 1990 1992 1993 1994 1995 1996 1997 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 Author - Any - Abarzhi, S. I. Abate, J. Abdel-khalik, H. S. Abeysuriya, R. Abhishek, K. Abhyankar, Shrirang Abla, G. Abraham, J. A. Adams, B. Adams, M. L. Addis, B. Adhikari, A. N. Adve, S. V. Afsahi, A. Ahmadia, A. Ahsant, M. Aiken, R. J. Aithal, Shashi M. Akella, S. Akerley, J. Aksenova, A. E. Aktulga, H. M. Al-Ali, R. Alam, S. Albee, P. B. Albrecht, A. Alderman, I. Aldermhini, I. Alessandri, A. Alexe, M. Alexeev, Y. Ali, N. Alimohideen, J. Allain, J. P. Allan, Benjamin A. Allcock, William E. Allen, B. Allen, G.


Risks to the public  

Science Conference Proceedings (OSTI)

Edited by Peter G. Neumann (Risks Forum Moderator and Chairman of the ACM Committee on Computers and Public Policy), plus personal contributions by others, as indicated. Opinions expressed are individual rather than organizational, and all of the usual ...

Peter G. Neumann



BNL Biology Department - Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

2003 2002 2001 File Format .pdf 2011 2010 2009 2008 2007 2006 2005 2004 2003 2002 2001 Biology Department 2012 Publications Agarwal R., Burley S.K., and Swaminathan S. Structural...


Risks to the public  

Science Conference Proceedings (OSTI)

Edited by Peter G. Neumann (Risks Forum Moderator and Chairman of the ACM Committee on Computers and Public Policy), plus personal contributions by others, as indicated. Opinions expressed are individual rather than organizational, and all of the usual ...

Peter G. Neumann



Risks to the public  

Science Conference Proceedings (OSTI)

Edited by Peter G. Neumann (Risks Forum Moderator and Chairman of the ACM Committee on Computers and Public Policy), plus personal contributions by others, as indicated. Opinions expressed are individual rather than organizational, and all of the usual ...

Peter G. Neumann



Risks to the public  

Science Conference Proceedings (OSTI)

Edited by Peter G. Neumann (Risks Forum Moderator and Chairman of the ACM Committee on Computers and Public Policy), plus personal contributions by others, as indicated. Opinions expressed are individual rather than organizational, and all of the usual ...

Peter G. Neumann



EMSL: Publications Search  

NLE Websites -- All DOE Office Websites (Extended Search)

Search for publications related to an EMSL user proposal by author, title, keyword, Science Theme, and more. Full text is available in PDF for download as copyright allows. You may...


ZeptoOS // Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications K. Yoshii, H. Naik, C. Yu, and P. Beckman, Extending and Benchmarking the Big Memory Implementation on Blue GeneP Linux, In "Proceedings of the 1st Int. Workshop on...



E-Print Network (OSTI)

This Public Health Statement is the summary chapter from the Toxicological Profile for Mercury. It is one in a series of Public Health Statements about hazardous substances and their health effects. A shorter version, the ToxFAQs, is also available. This information is important because this substance may harm you. The effects of exposure to any hazardous substance depend on the dose, the duration, how you are exposed, personal traits and habits, and whether other chemicals are

unknown authors



Publication Number: Special Publication 800-56A Revision 2 ...  

Science Conference Proceedings (OSTI)

... Final Publication: http://nvlpubs.nist.gov/nistpubs/SpecialPublications/NIST. SP.800- 56Ar2.pdf Related Information on CSRC: ...



Can Public Research Universities Compete?  

E-Print Network (OSTI)

shifted to a 60-40 public- private split by 1960, shiftedagain to a 75-25 public-private split by 1970, andto an 80-20 public-private split by 1980, before moving back

Brint, Steven



Public Works Transportation Infrastructure Study  

E-Print Network (OSTI)

Public Works Transportation Infrastructure Study Minneapolis City of Lakes Minneapolis Public Works Transportation Infrastructure Study #12;Public Works Transportation Infrastructure Study Minneapolis City Works Transportation Infrastructure Study Minneapolis City of Lakes Background: · Currently, funding

Minnesota, University of


NREL: Transmission Grid Integration - Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications Want updates about future transmission grid integration webinars and publications? Join our mailing list. NREL has an extensive collection of publications related to transmission integration research. Explore the resources below to learn more. Selected Project Publications Read selected publications related to these transmission integration projects: Western Wind and Solar Integration Study Eastern Renewable Generation Integration Study Oahu Wind Integration and Transmission Study Flexible Energy Scheduling Tool for Integration of Variable generation (FESTIV) Active power controls Forecasting Grid Simulation. NREL Publications Database NREL's publications database offers a variety of documents related to transmission integration that were written by NREL staff and


EERE Publication and Product Library  

NLE Websites -- All DOE Office Websites (Extended Search)

& Energy at Home Details Bookmark & Share View Related Request by Mail Welcome to the EERE Publication and Product Library. This library will allow you to find publications and...


Sandia National Laboratories: News: Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Research Magazine Search Sandia Publications News Publications Reports authored by Sandia National Laboratories can be obtained through the following sources: Office of Scientific...


Search Publications | Superconducting Magnet Division  

NLE Websites -- All DOE Office Websites (Extended Search)

Rapid Cycling Magnets Helical Magnets HERA upgrade LHC IR Dipoles RHIC Publications Search Publications Selected Cryogenic Data Notebook Proceedings of the 1968 Summer Study on...


Solid-State Lighting: Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications to someone by Publications to someone by E-mail Share Solid-State Lighting: Publications on Facebook Tweet about Solid-State Lighting: Publications on Twitter Bookmark Solid-State Lighting: Publications on Google Bookmark Solid-State Lighting: Publications on Delicious Rank Solid-State Lighting: Publications on Digg Find More places to share Solid-State Lighting: Publications on AddThis.com... Conferences & Meetings Presentations Publications Postings Articles Program Fact Sheets Technology Fact Sheets CALiPER Reports GATEWAY Reports LED Lighting Facts Reports Project Reports Studies and Reports Technology Roadmaps Product Performance Guides Webcasts Videos Tools Publications The Solid-State Lighting (SSL) program produces a comprehensive portfolio of publications, ranging from overviews of the program's research

Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


ARM News &#187; Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publication Notice: Publication Notice: New Journal Reference Available Mon, 25 Nov 2013 15:51:51 +0000 Publication Notice: New Journal Reference Available Wed, 20 Nov 2013 22:43:20 +0000 Publication Notice: 2 New References Available Thu, 14 Nov 2013 23:20:39 +0000 Publication Notice: New Journal Reference Available Wed, 13 Nov 2013 17:18:42 +0000 Publication Notice: 2 New References Available Mon, 11 Nov 2013 19:48:04 +0000 Publication Notice: New Journal Reference Available Mon, 04 Nov 2013 14:40:22 +0000 Publication Notice: New Journal Reference Available Thu, 31 Oct 2013 21:00:57 +0000 Publication Notice: 3 New References Available Wed, 30 Oct 2013 22:13:53 +0000 Publication Notice: 2 New References Available Mon, 28 Oct 2013 21:39:05 +0000 Publication Notice: New Journal Reference Available Wed, 23 Oct 2013 23:24:48 +0000


Publications | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Publications Publications Publications Energy Savers Guide This guide shows you how easy it is to cut your energy use at home and also on the road. The easy, practical solutions for saving energy include tips you can use today -- from your roof and landscaping to appliances and lights. They are good for your wallet and for the environment -- and actions that you take help reduce our national needs to produce or import more energy, thereby improving our energy security. Ahorre Energía Esta guía le muestra lo fácil que es reducir el uso de energía en su casa, y también en los caminos. Estas soluciones fáciles y prácticas para ahorrar energía incluyen consejos que usted puede usar hoy mismo, en el techo, en el paisaje que rodea su casa, en sus electrodomésticos y en


Notice of Public Meeting  

NLE Websites -- All DOE Office Websites (Extended Search)

[6450-01-P] [6450-01-P] DEPARTMENT OF ENERGY 10 CFR Parts 429 and 430 (Docket No. EERE-2012-BT-TP-00xx) Test Procedure Guidance for Room Air Conditioners, Residential Dishwashers, and Residential Clothes Washers: Public Meeting AGENCY: Office of Energy Efficiency and Renewable Energy, Department of Energy. ACTION: Notice of public meeting. SUMMARY: The U.S. Department of Energy (DOE) is holding a public meeting to provide a forum for manufacturers and test laboratories to discuss their respective interpretations of existing DOE test procedures, where they believe that the test procedures lack clarity, and to provide information for DOE to consider prior to publishing any proposed guidance to clarify the current test procedures for room air conditioners, residential dishwashers, and residential clothes


Green Power Network: Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

News News TVA Seeks 126 MW of Renewables in 2014 December 2013 More News More News Subscribe to E-Mail Update Subscribe to e-mail update Events EPA Webinar - The Power of Aggregated Purchasing: How to Green Your Electricity Supply & Save Money January 15, 2014 1:00-2:00 p.m. ET Previous Webinars More News Features Green Power Market Status Report (2011 Data) Featured Green Power Reports Publications Alphabetical Listing Categorical Listing Chronological Listing Featured Reports The Green Power Network library contains articles and reports on green power, green pricing, and related topics. Whenever possible, we provide a link to publications available online. The publications are grouped by the following topics to help you in your search. If you are aware of other documents that should be added to this list, please notify our Webmaster.


Theory and Software Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications Coming up A probability-conserving dissipative Schrodinger equation M. van Veenendaal, J. Chang, and A. J. Fedro preprint Publications 2011 Electronic structure and orbital polarization of LaNiO3 with a reduced coordination and under strain: A first-principles study M. J. Han and M. van Veenendaal Phys. Rev. B 84, 125137 (2011). Stability of ferromagnetic ground state against large compressive stress in magnetodielectric oxide La2MnNiO6 D. Haskel, G. Fabbris, N. M. Souza-Neto, M. van Veenendaal, G. Shen, A. E. Smith, and M. A. Subramanian Phys. Rev. B 84, 100403(R) (2011). Addressing the amorphous content issue in quantitative phase analysis: the certification of NIST standard reference material 676a J. P. Cline, R. B. Von Dreele, R. Winburn, P. W. Stephens, and J. J.


Argonne CNM: Publications 2004  

NLE Websites -- All DOE Office Websites (Extended Search)

4 Publications 4 Publications A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z Publications for 2004 B Barber R., Ghantasala M., Divan R., Mancini D. and Harvey E., "An Investigation of SU-8 Resist Layer Adhesion in Deep X-Ray Lithography of High-Aspect-Ratio Structures," Proc. SPIE, 5276, pp85-91, 2004 Barnard A., "Shape and energetics of TiN nanoparticles," Journal of Computational and Theoretical Nanoscience, 1, pp334-339, 2004 Bhattacharjee S., Booske J., Kory C., Van Der Weide D., Limbach S., Gallagher S., Welter J., Lopez M., Gilgenbach R., Ives R., Read M., Divan R. and Mancini D., "Folded Waveguide Traveling Wave Tube Sources for THz Radiation," IEEE Transaction of Plasma Science, Special Issue on High Power Microwaves, 32, pp1002-1014, 2004


American Public Power Association  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Public Power Association Public Power Association 2301 M SJ Issue Brief 2301M ! NWV Issue aie I I*Wasnimgon. D., 2. 0037-I48-a 202/467-2900 FAX 202/45-7-2910 www. APPAnet.org National Energy Policy Legislation - A Comprehensive Approach to Ensuring Energy Security March 2001 Summary: A confluence of even s involving rising prices and supply shortages in several energy sectors has focused public and political attention on the need to update the nation's energy policy and to provide for increased production of domestic energy sources. President George W. Bush made this central point in his campaign platform on energy issues and has designated an Administration team under the leadership of Vice President Cheney to develop specific recommendations in this regard. House and Senate leaders have similarly indicated


EIA publications directory, 1991  

SciTech Connect

Enacted in 1977, the Department of Energy (DOE) Organization Act established the Energy Information Administration (EIA) as the Department`s independent statistical and analytical agency, with a mandate to collect and publish data and prepare analyses on energy production, consumption, prices, and resources, and projections of energy supply and demand. This edition of the EIA Publications Directory contains titles and abstracts of periodicals and one-time reports produced by the EIA from January through December 1991. This edition supplements EIA Publications Directory 1977--1989 and EIA Publications Directory 1990. The body of the Directory contains citations and abstracts arranged by broad subject categories, such as coal, petroleum, and natural gas and subcategories such as reserves, produces and byproducts, and marketing and economics. All reports are indexed alphabetically by subject and title and numerically by report number.

Not Available



EIA publications directory, 1991  

SciTech Connect

Enacted in 1977, the Department of Energy (DOE) Organization Act established the Energy Information Administration (EIA) as the Department's independent statistical and analytical agency, with a mandate to collect and publish data and prepare analyses on energy production, consumption, prices, and resources, and projections of energy supply and demand. This edition of the EIA Publications Directory contains titles and abstracts of periodicals and one-time reports produced by the EIA from January through December 1991. This edition supplements EIA Publications Directory 1977--1989 and EIA Publications Directory 1990. The body of the Directory contains citations and abstracts arranged by broad subject categories, such as coal, petroleum, and natural gas and subcategories such as reserves, produces and byproducts, and marketing and economics. All reports are indexed alphabetically by subject and title and numerically by report number.

Not Available



LEAF List of Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

LEAF Logo LEAF Logo Laser-Electron Accelerator Facility Publications Concerning LEAF and Work Done at LEAF The Brookhaven Laser-Electron Accelerator Facility (LEAF) J. F. Wishart Houshasenkagaku (Biannual Journal of the Japanese Society of Radiation Chemistry) 66, 63-64 (1998) Electron Attachment to CO2 in Supercritical Ethane M. Nishikawa, K. Itoh, and R. Holroyd J. Phys. Chem. A 103, 550-556 (1999) Abstract [Find paper at ACS Publications] Thermodynamics of Electron Attachment to Pyrimidine and Styrene in Supercritical Ethane R. A. Holroyd, M. Nishikawa, and K. Itoh J. Phys. Chem. B 103, 9205-9210 (1999) Abstract [Find paper at ACS Publications] Solvent Clustering around Pyrazine Ions in the High-Compressibility Region of Supercritical Ethane R. A. Holroyd, M. Nishikawa, and K. Itoh


NERSC Staff Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Staff Staff Publications & Presentations NERSC Staff Publications & Presentations Sort by: Date | Author | Type 2013 Massimo Di Pierro, James Hetrick, Shreyas Cholia, James Simone, and Carleton DeTar., "The new "Gauge Connection" at NERSC", 21st International Lattice Data Grid Workshop, December 2013, Richard Gerber (Berkeley Lab), Ken Bloom (U. Nebraska-Lincoln), "Report of the Snowmass 2013 Computing Frontier Working Group on Distributed Computing and Facility Infrastructures", to be included in proceedings of Community Summer Study ("Snowmass") 2013, November 11, 2013, Download File: 1311.2208v1.pdf (pdf: 551 KB) Richard Gerber and Harvey Wasserman, eds., "Large Scale Computing and Storage Requirements for High Energy Physics - Target 2017", November 8,


Terrestrial Trading Recent Publications  

E-Print Network (OSTI)

In t ro du ct i o n This Newsletter is created by the National Energy Technology Laboratory and represents a summary of carbon sequestration news covering the past month. Readers are referred to the actual article(s) for complete information. It is produced by the National Energy Technology Laboratory to provide information on recent activities and publications related to carbon sequestration. It covers domestic, international, public sector, and private sector news. Hi g h l i g h t s Wh at s In s i d e? Sequestration in the News

unknown authors



Argonne Transportation - Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Transportation Publications All downloadable documents on this site are in PDF format. You will need Adobe Reader to view these files (download Adobe Reader). Please note that some of these files are very large and may take some time to download. transforum TransForum The Center's quarterly newsletter featuring articles and photographs about current transportation research and breakthroughs. A 2011 STC Excellence Award winner. Subscribe to TransForum » factsheet icon Fact Sheets One sheet summaries on transportation topics and research argonne logo Recent Papers & Presentations Search for Papers, Presentations & More Find publications highlighting researcher work presented at conferences and other venues. Search by WORD or PHRASE Enter word or phrase


Carbon Sequestration - Public Meeting  

NLE Websites -- All DOE Office Websites (Extended Search)

Public Meeting Programmatic Environmental Impact Statement Public Meeting May 18, 2004 National Energy Technology Laboratory Office of Fossil Energy Scott Klara Carbon Sequestration Technology Manager Carbon Sequestration Program Overview * What is Carbon Sequestration * The Fossil Energy Situation * Greenhouse Gas Implications * Pathways to Greenhouse Gas Stabilization * Sequestration Program Overview * Program Requirements & Structure * Regional Partnerships * FutureGen * Sources of Information What is Carbon Sequestration? Capture can occur: * at the point of emission * when absorbed from air Storage locations include: * underground reservoirs * dissolved in deep oceans * converted to solid materials * trees, grasses, soils, or algae Capture and storage of CO 2 and other Greenhouse Gases that


BFRL: HVAC&R - Publications  

Science Conference Proceedings (OSTI)

HVAC&R Equipment Performance Group. Publications. Repeatability of Energy Consumption Test Results for Compact Refrigerators ...


IL-1 beta and TNF-alpha upregulate angiotensin II type 1 (AT(1)) receptors on cardiac fibroblasts and are associated with increased AT(1) density in the post-MI heart  

E-Print Network (OSTI)

broblasts and the infarcted heart. Am J Physiol 1998;274:matrix remodeling in heart failure: a role for de novoin right and left heart after myocardial infarction. Mol

Gurantz, D; Cowling, R T; Varki, N; Frikovsky, E; Moore, C D; Greenberg, Barry H




E-Print Network (OSTI)

doxycycline make a difference? Maybe, but here was the catch: To slow IMHA's destruction of red blood cells- tion. How to get out of this catch-22? Start the doxycycline but "contin- ue to treat the IMHA because

Tufts University


Publications Salmonid Broodstock, Black  

E-Print Network (OSTI)

Publications Salmonid Broodstock, Black Cod, and Successful Fishing Piers "Salmon Broodstock Avenue. N.E.. Seattle, WA 98105. "Black Cod, Boom or Bust?", also published by Washington Sea Grant- page paper- bound booklet addresses the location and status of black cod stocks. harvest methods


Science and Public Policy  

SciTech Connect

The United States faces many issues that involve science. Issues ranging from climate change to nano-technology, from human genomics to modified food crops. What is the role that science plays in determining what the public policy for these issues should be? How as scientists should we respond to requests for advice?

Handler, Thomas [University of Tennessee



Clean Cities: Clean Cities Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Information Resources Information Resources Printable Version Share this resource Send a link to Clean Cities: Clean Cities Publications to someone by E-mail Share Clean Cities: Clean Cities Publications on Facebook Tweet about Clean Cities: Clean Cities Publications on Twitter Bookmark Clean Cities: Clean Cities Publications on Google Bookmark Clean Cities: Clean Cities Publications on Delicious Rank Clean Cities: Clean Cities Publications on Digg Find More places to share Clean Cities: Clean Cities Publications on AddThis.com... Publications Technical Assistance Clean Cities Publications Learn about alternative fuels and vehicles, infrastructure development, emissions, idle reduction, and more in the following Clean Cities-branded publications. Program Clean Cities Overview Clean Cities Now - Fall 2013 issue

Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


ARM - Publications Article  

NLE Websites -- All DOE Office Websites (Extended Search)

September 27, 2013 [Publications] September 27, 2013 [Publications] New Radar Brochure Available Bookmark and Share A new brochure describing ARM's global network of 32 research radars is now available. ARM radars are divided into three main groups: Scanning ARM Cloud Radars; Scanning ARM Precipitation Radars; and ARM Cloud Profiling Radars. A map is included, showing where specific radars are located throughout the ARM sites: North Slope of Alaska, Southern Great Plains, Tropical Western Pacific, and Eastern North Atlantic. It also indicates which type of radars are available with each of ARM's three mobile facilities. In addition, the brochure includes a high-level flowchart detailing how ARM radar data is stored, processed, and output into advanced data products and tools. All ARM data can be found using the ARM Data


Sector 6 Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 2009 2008 2007 2006 2005 2004 2003 2002 2001 APS Pubs. Database Sector 6 Publications Publications 2013:(45) "Classical and quantum phase transitions revealed using transport and x-ray measurements," Arnab Banerjee, Ph.D.-Thesis, University of Chicago, 2013. "Charge transfer and multiple density waves in the rare earth tellurides," A. Banerjee, Yejun Feng, D.M. Silevitch, Jiyang Wang, J.C. Lang, H.-H. Kuo, I.R. Fisher, T.F. Rosenbaum, Phys. Rev. B 87, 155131 (2013). "Controlling Size-Induced Phase Transformations Using Chemically Designed Nanolaminates," Matt Beekman, Sabrina Disch, Sergei Rouvimov, Deepa Kasinathan, Klaus Koepernik, Helge Rosner, Paul Zschack, Wolfgang S. Neumann, David C. Johnson, Angew. Chem. Int. Ed. 52, 13211 (2013).


Argonne CNM: Publications 2006  

NLE Websites -- All DOE Office Websites (Extended Search)

6 Publications 6 Publications A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z A Alvine K., Pontoni D., Shpyrko O., Pershan P., Cookson D., Shin K., Russell T., Brunnbauer M., Stellacci F. and Gang O., "Solvent Mediated Assembly of Nanoparticles Confined in Mesoporous Alumina," Phys. Rev. B, 73, p 125412, 2006 Alvine K., Shpyrko O., Pershan P., Shin K. and Russell T., "Capillary Filing of Anodized Alumina Nanopore Arrays," Phys. Rev. Lett., 97, p 175503, 2006 Angadi M., Watanabe T., Bodapati A., Xiao X., Auciello O., Carlisle J., Eastman J., Schelling P. and Phillpot S., "Thermal Transport and Grain Boundary Conductance in Ultrananocry Stalline Diamond Thin Films," J. Appl. Phys., 99, p 114301, 2006


JGI - Notable Scientific Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Notable Scientific Publications Notable Scientific Publications May 5, 2013 Nonhybrid, finished microbial genome assemblies from long-read SMRT sequencing data. (Nature Methods.) We present a hierarchical genome-assembly process (HGAP) for high-quality de novo microbial genome assemblies using only a single, long-insert shotgun DNA library in conjunction with Single Molecule, Real-Time (SMRT) DNA sequencing. Our method uses the longest reads as seeds to recruit all other reads for construction of highly accurate preassembled reads through a directed acyclic graph–based consensus procedure, which we follow with assembly using off-the-shelf long-read assemblers. March 24, 2013 The high-quality draft genome of peach (Prunus persica) identifies unique patterns of genetic diversity, domestication and genome evolution. (Nature


Argonne CNM: Publications 2009  

NLE Websites -- All DOE Office Websites (Extended Search)

9 Publications 9 Publications A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z A Adiga S. P., Jin C., Curtiss L. A., Monteiro-riviere N. A. and Narayan R. J., "Nanoporous Membranes for Medical and Biological Applications," Wiley Interdisciplinary Reviews: Nanomedicine and Nanobiotechnology, 1, pp568-581, 2009 ( Link) Adiga V. P., Sumant A. V., Suresh S., Gudeman C., Auciello O., Carlisle J. A. and Carpick R. W."Temperature dependence of mechanical stiffness and dissipation in ultrananocrystalline diamond," Micro- and Nanotechnology Sensors, Systems, and Applications, [7318], (SPIE - The International Society for Optical Engineering, USA), 2009 ( Link) Adiga V. P., Sumant A. V., Suresh S., Gudeman C., Auciello O., Carlisle J. A. and Carpick R. W., "Mechanical Stiffness and Dissipation in Ultrananocrystalline Diamond Microresonators," Phys. Rev. B, 79, p 245403, 2009 ( Link)


BNL | Biosciences Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Past Publications 2013 2012 2011 2010 File Format .pdf 2013 2012 2011 2010 Biosciences Department 2013 Publications Andre C., Kim S.-W., Yu X.-H., and Shanklin J. Fusing catalase to an alkane-producing enzyme maintains enzymatic activity by converting the inhibitory byproduct H2O2 to the cosubstrate O2. Proceedings of the National Academy of Sciences USA, 110(8):3191-3196 (February, 2013). PubMed Babst B., Karve A., and Tatjana J. Radio-metabolite analysis of carbon-11 biochemical partitioning to nonstructural carbohydrates for integrated metabolism and transport studies. Plant & Cell Physiology, 54(6):1016-1025 (June 2013). PubMed Baniecki M.L., McGrath W.J., and Mangel W.F. Regulation of a viral proteinase by a peptide and DNA in one-dimensional space. III. Atomic resolution structure of a nascent form of the adenovirus


Argonne CNM: Publications 2013  

NLE Websites -- All DOE Office Websites (Extended Search)

3 Publications 3 Publications A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z A An C., Wang J., Liu J., Wang S. and Sun Y., "Hollow AgI:Ag Nanoframes as Solar Photocatalysts for Hydrogen Generation from Water Reduction," Chem Sus Chem, 6, 1931-1937 (2013) (Link) (Back to top B Bairu S. G., Mghanga E., Hasan J., Kola S., Rao V. J., Bhanuprakash K., Giribabu L., Wiederrecht G. P., Da Silva R., Rego L. G. and Ramakrishna G., "Ultrafast Interfacial Charge-Transfer Dynamics in a Donor-?-Acceptor Chromophore Sensitized TiO2 Nanocomposite," J. Phys. Chem. C, 117, 4824-4835 (2013) (Link) Balasubramanian S., Wang P., Schaller R. D., Rajh T. and Rozhkova E. A., "High-Performance Bioassisted Nanophotocatalyst for Hydrogen Production," Nano Letters, 13, 3365-3371 (2013) (Link)


Fuel Cells publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Materials Science » Materials Science » Fuel Cells » Fuel Cells Publications Fuel Cells publications Research into alternative forms of energy, especially energy security, is one of the major national security imperatives of this century. Get Expertise Melissa Fox Applied Energy Email Catherine Padro Sensors & Electorchemical Devices Email Fernando Garzon Sensors & Electorchemical Devices Email Piotr Zelenay Sensors & Electorchemical Devices Email Rod Borup Sensors & Electorchemical Devices Email Karen E. Kippen Chemistry Communications Email Like a battery, a fuel cell consists of two electrodes separated by an electrolyte-in polymer electrolyte fuel cells, the separator is made of a thin polymeric membrane. Unlike a battery, a fuel cell does not need recharging-it continues to produce electricity as long as fuel flows


Argonne CNM: Publications 2005  

NLE Websites -- All DOE Office Websites (Extended Search)

5 Publications 5 Publications A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z B Barber R., Ghantasala M., Divan R., Vora K., Harvey E. and Mancini D., "Optimisation of SU-8 Processing Parameters for Deep X-Ray Lithography," Microsystem Technologies, 11, pp303-310, 2005 Barnard A., Lin X. and Curtiss L., "Equilibrium Morphology of FCC Gold Nanoparticles >3nm and Shape Changes Induced by Temperature," J. Phys. Chem. B, 109, pp24465-24472, 2005 Barnard A., Russo S. and Snook I., "Visualization of Hybridization in Nanocarbon Systems," Journal of Computer Theory and Nanoscience, 2, pp68-74, 2005 Barnard A., Saponjic Z., Tiede D., Rajh T. and Curtiss L., "Multiscale modeling of titanium dioxide: Controlling shape with surface chemistry," Review of Advanced Materials Science, 10, pp21-27, 2005


Argonne CNM: Publications 2012  

NLE Websites -- All DOE Office Websites (Extended Search)

2 Publications 2 Publications A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z A Ade P., Datesman A. M., Novosad V. and Yefremenko V. G."Performance and on-sky optical characterization of the SPTpol instrument," Proc. SPIE: Millimeter, Submillimeter, and Far-Infrared Detectors and Instrumentation for Astronomy VI, 8452 (84521F-1) (2012) (Link) Ade P., Datesman A. M., Novosad V. and Yefremenko V. G., "An Overview of the SPTpol Experiment," J. Low Temp. Phys., 167, 859-864 (2012) (Link) Ade P., Novosad V. and Yefremenko V. G."Detectors for the South Pole Telescope," Proc. 2nd Int. Conf. Technology and Instrumentation in Particle Physics,37 (1381-1388) (2012) (Link) Antonio D., Zanette D. and Lopez O., "Frequency Stabilization in Nonlinear Micromechanical Oscillators," Nature, 3, 806 (2012) (Link)


EIA publications directory, 1990  

Science Conference Proceedings (OSTI)

Enacted in 1977, the Department of Energy (DOE) Organization Act established the Energy Information Administration (EIA) as the Department's independent statistical and analytical agency, with a mandate to collect and publish data and prepare analyses on energy production, consumption, prices, and resources, and projections of energy supply and demand. This edition of the EIA Publications Directory contains titles and abstracts of periodicals and one-time reports produced by the EIA from January through December 1990. This edition supplements EIA Publications Directory 1977--1989. The body of the Directory contains citations and abstracts arranged by broad subject categories, such as coal, petroleum, and natural gas and subcategories such as reserves, products and byproducts, and marketing and economics. All reports are indexed alphabetically by subject and title and numerically by report number.

Not Available



Modeling & Simulation publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Modeling & Simulation » Modeling & Simulation » Modeling & Simulation Publications Modeling & Simulation publications Research into alternative forms of energy, especially energy security, is one of the major national security imperatives of this century. Get Expertise David Harradine Physical Chemistry and Applied Spectroscopy Email Josh Smith Chemistry Email The inherent knowledge of transformation has beguiled sorcerers and scientists alike. D.A. Horner, F. Lambert, J.D. Kress, and L.A. Collins, "Transport properties of lithium hydride from quantum molecular dynamics and orbital-free molecular dynamics," Physical Review B - Condensed Matter and Materials Physics 80(2) (2009). J.D. Kress, D.A. Horner, and L.A. Collins, "Mixing rules for optical and transport properties of warm, dense matter," AIP Conference Proceedings 1195, 931-934 (2009).


EIA publications directory 1997  

SciTech Connect

This edition of the EIA Publications Directory contains 68 titles and abstracts of periodicals and one time reports produced by EIA from January through December 1997. The body of the Directory contains citations and abstracts arranged by broad subject categories; (1) MetaData, (2) Coal, (3) Oil (4) Natural gas, (5) Nuclear, (6) Electricity, (7) Renewable energy and Alternative fuels, (8) Multifuel, (9) End use consumption, (10) Models, and (11) Forecasts.




Public Facilities Guidebook  

Science Conference Proceedings (OSTI)

This "Guidebook" provides a basic guide to electric solutions for typical problems encountered in public facilities. The "Guidebook" introduces technologies that can improve energy service quality, reduce energy costs, improve building occupant satisfaction, increase building occupant productivity, and enhance environmental protection. The "Guidebook" suggests practical measures for applying state-of-the-art electric technology to existing buildings as well as to modern and new buildings. The document al...



EIA publications directory 1996  

DOE Green Energy (OSTI)

This edition of the EIA Publications Directory contains titles and abstracts of periodicals and one-time reports produced by the Energy Information Administration (EIA) from January through December 1996. The body of the Directory contains citations and abstracts arranged by broad subject categories; metadata, coal, oil and gas, nuclear, electricity, renewable and energy/alternative fuels, multifuel, end-use consumption, models, and forecasts.




LBA Data and Publication Policy  

NLE Websites -- All DOE Office Websites (Extended Search)

LBA Data and Publication Policy The LBA Data and Publication Policy was amended by the Science Steering Committee in May 2006: For LBA data archived at the Oak Ridge National...


The FIFE Data Publication Experiment  

Science Conference Proceedings (OSTI)

The First ISLSCP Field Experiment (FIFE) provided an opportunity to test the concept of data publication for long-term access to valuable scientific data. In analogy with the procedures used in research publication, the FIFE Information System ...

Donald E. Strebel; David R. Landis; K. Fred Huemmrich; Jeffrey A. Newcomer; Blanche W. Meeson



EERE Publication and Product Library  

NLE Websites -- All DOE Office Websites (Extended Search)

Mail Requests You have not requested any products. You can request that products and publications be mailed to you by clicking on the "Request by Mail" link in the publication...


Publications inventory control and distribution  

Science Conference Proceedings (OSTI)

Most publications stocked by STSC, Inc. are produced at headquarters. A small number of other publications, however, are ordered from outside vendors and then stocked at headquarters for distribution. Past procedures for inventory control and distribution ...

Deborah R. Richardson




Science Conference Proceedings (OSTI)

Page 1. NBS SPECIAL PUBLICATION 445- 1 Page 2. NATJONAL BUREAU OF STANDARDS The National Bureau of Standards ...


Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


BFRL: HVAC&R - Publications  

Science Conference Proceedings (OSTI)

HVAC&R Equipment Performance Group. Publications. Fundamental Aspects of the Application of Carbon Dioxide in Comfort Cooling. ...


EIA publications directory 1994  

Science Conference Proceedings (OSTI)

Enacted in 1977, the Department of Energy (DOE) Organization Act established the Energy Information Administration (EIA) as the Department`s independent statistical and analytical agency, with a mandate to collect and publish data and prepare analyses on energy production, consumption, prices, resources, and projections of energy supply and demand. This edition of the EIA Publications Directory contains titles and abstracts of periodicals and one-time reports produced by EIA from January through December 1994. The body of the Directory contains citations and abstracts arranged by broad subject categories: metadata, coal, oil and gas, nuclear, electricity, renewable energy/alternative fuels, multifuel, end-use consumption, models, and forecasts.




A Kallikrein 15 (KLK15) single nucleotide polymorphism located close to a novel exon shows evidence of association with poor ovarian cancer survival  

E-Print Network (OSTI)

of the UTR and splice site SNPs. Analysis for putative microRNA (miRNA) sites was performed using miRBase Targets V4, Target scan, miRanda, PicTar and Patrocles. Cell culture, RT PCR and sequencing of KLK15 putative promoter region The normal ovarian cell... intronic SNPs located within 30 bp of exon- intron boundaries. We also predicted miRNA binding sites using three different software programs; Target Scan, miRanda and Patrocles. A maximum of 32 miRNA bind- ing sites scattered throughout the gene were...

Batra, Jyotsna; Nagle, Christina M; O'Mara, Tracy; Higgins, Melanie; Dong, Ying; Tan, Olivia L; Lose, Felicity; Skeie, Lene Marie; Srinivasan, Srilakshmi; Bolton, Kelly L; Song, Honglin; Ramus, Susan J; Gayther, Simon A; Pharoah, Paul D P; Kedda, Mary-Anne; Spurdle, Amanda B; Clements, Judith A



Argonne CNM: Publications 2008  

NLE Websites -- All DOE Office Websites (Extended Search)

8 Publications 8 Publications A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z A Adiga S. P., Curtiss L., Elam J. W., Pellin M. J., Shih C. C., Shih C. M., Lin S. J., Su Y. Y., Gittard S. A., Zhang J. and Narayan R., "Nanoporous Materials for Biomedical Devices," JOM, 60, pp26-32, 2008 ( Link) B Baca A. J., Ahn J., Sun Y., Meitl M. A., Menard E., Kim H., Choi W., Kim D., Huang Y. and Rogers J. A., "Semiconductor wires and ribbons for high-performance flexible electronics," Angew. Chem. Int. Ed., 47, pp5524-5542, 2008 ( Link) Barnard A. and Sternberg M. G., "Vacancy Induced Structural Changes in Diamond Nanoparticles," J. Comput. Theor. Nanosci., 5, pp2089-2095, 2008 ( Link) Belkin A. V., Novosad V., Iavarone M., Pearson J. and Karapetrov G., "Superconductor/Ferromagnet Bilayers: Influence of Magnetic Domain Structure on Vortex Dynamics," Phys. Rev. B, 77, pp180506-180509, 2008 ( Link)


Sector 9 | Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications Acknowledgement: Work at the CMC Beamlines is supported in part by the Office of Basic Energy Sciences of the U.S. Dept. of Energy and by the National Science Foundation Division of Materials Research. Use of the Advanced Photon Source is supported by the Office of Basic Energy Sciences of the U.S. Department of Energy under Contract No. W-31-109-Eng-38. 2007: T. Gog, D.M. Casa, I. Kuzmenko, R.J. Krakora, T.B. Bolin, "Windowless transition between atmospheric pressure and high vacuum via differential pumping for synchrotron radiation applications," J. Synchrotron Rad. 14 (4), July, 339-344 (2007). DOI: 10.1107/S0909049507016317 J.P. Hill, D.S. Coburn, Y.-J. Kim, T. Gog, D.M. Casa, C.N. Kodituwakku, H. Sinn, "A 2m inelastic X-ray scattering spectrometer at CMC-XOR, Advanced Photon Source," J. Synchrotron Rad. 14 (4), July, 361-365 (2007). DOI: 10.1107/S0909049507018006


Argonne CNM: Publications 2011  

NLE Websites -- All DOE Office Websites (Extended Search)

1 Publications 1 Publications A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z A Antonio D. and Lopez O."Micromechanical Magnetometers Based on Clamped-clamped High-Q Nonlinear Resonators ,"IEEE Conf. Proc. Solid-State Sensors, Actuators and Microsystems (2011) (Link) Aschauer U. J. and Selloni A., "Structure of the Rutile TiO2(011) Surface in Aqueous Environment," Phys. Rev. Lett., 106, 166102-166105 (2011) (Link) Awuah S. G., Polreis J., Biradar V. and You Y., "Singlet Oxygen Generation by Novel NIR BODIPY Dyes," Org. Lett., 13, 3884-3887 (2011) (Link) Aytug T., Chen Z., Maroni V. A., Miller D. J., Cantoni C., Specht E. D., Kropf A. J., Zaluzec N., Zhang Y., Zuev Y. and Paranthaman M., "Nano-engineered Defect Structures in Ce- and Ho-doped Metal-organic Chemical Vapor Deposited YBa2Cu3O6+x Films: Correlation of Structure and Chemistry with Flux Pinning Performance," J. Appl. Phys., 109, 113923-113934 (2011) (Link)


AP Group Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

List of Publications since 2006 List of Publications since 2006 E. Fujita, C. Creutz, D. C. Grills, J. T. Muckerman, D. E. Polyansky D. Cabelli, P. Khalifah, J. A. Rodriguez, and K. Sasaki 2013 Matsubara, Y.; Hightower, S. H.; Chen, J.; Grills, D. C.; Polyansky, D. E.; Muckerman, J. T.; Tanaka, K.; Fujita, E. Reactivity of a fac-ReCl(α-diimine)(CO)3 complex with an NAD+ model ligand toward CO2 reduction, Chem. Commun. ASAP, DOI:10.1039/C3CC47699E. Manaka, Y.; Wang, W.-H.; Suna, Y.; Kambayashi, H.; Muckerman, J. T.; Fujita. E.; Himeda, Y. Efficient H2 generation from formic acid using azole complexes in water, Catal. Sci. Technol. ASAP, DOI: 10.1039/c3cy00830d. Lewandowska-Andralojc, A.; Polyansky, D. E. "Mechanism of the Quenching of the Tris(bipyridine)ruthenium(II) Emission by Persulfate: Implications for Photo-Induced Oxidation Reactions" J. Phys Chem. A, 2013, 117, 10311-10319, DOI: 10.1021/jp407573d.


From networked publics to issue publics: reconsidering the public/private distinction in web science  

Science Conference Proceedings (OSTI)

As an increasing part of everyday life becomes connected with the web in many areas of the globe, the question of how the web mediates political processes becomes still more urgent. Several scholars have started to address this question by thinking about ... Keywords: Dewey, Facebook, democracy, issue publics, networked publics, public/private, social media

Andreas Birkbak



Energy Efficiency and Conservation Block Grant Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-Sterling Heights MI-City-Sterling Heights Location: City Sterling Heights MI American Recovery and Reinvestment Act: Proposed Action or Project Description 1) Energy Efficiency and Conservation Strategy administrative costs; 2) completion of an energy audit of city-owned Nature Center to identify energy-consuming items; 3) energy efficiency retrofits to replace lighting in the Department of Public Works (DPW) Office Building (1971); 4) energy efficiency retrofits to replace windows at Fire Station #5 (1991); 5) energy efficiency retrofits to include replacing boilers, chillers, electric furnaces, and/or hot water tank at the Parks & Recreation Building (1974), Police Department (1977), Library (1978), City Hall (1968), DPW (1971), Nature Center (1980); integrated control systems,


U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-Novi MI-City-Novi Location: City Novi MI American Recovery and Reinvestment Act: Proposed Action or Project Description: 1) Technical consultant to prepare Energy Efficiency and Conservation Strategy, 2) establish an Energy Office, 3) energy efficiency retrofits at the Civic Center 4) energy efficiency retrofits at the Ice Arena, 5) energy efficiency retrofits at Fire Stations 1 and 4, 6) energy efficiency retrofits at Meadowbrook Senior Center, 7) energy efficient retrofits at the Public Service Building, and 8) engineering analysis of Civic Center duct work, and expanding the existing city non-motorized plan Conditions: None Categorical Exclusion(s) Applied: A1, A9, A11, B1.32, B2.5, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21


Energy Efficiency and Conservation Block Grant Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-Taylor MI-City-Taylor Location: City Taylor MI American Recovery and Reinvestment Act: Proposed Action or Project Description 1) Replace boilers with energy efficient boilers in apartment communities owned by the city of Taylor; 2) replace lighting fixtures and roof at the Department of Public Works Building; 3) replace parking lot lights around the city of Taylor; and 4) lighting retrofits at the Taylor Sportsplex recreational facility. Conditions: None Categorical Exclusion(s) Applied: B1.32, B2.5, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21 This action would not: threaten a violation of applicable statutory, regulatory, or permit requirements for environment, safety, and health,


U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-County-Macomb MI-County-Macomb Location: County Macomb MI American Recovery and Reinvestment Act: Proposed Action or Project Description: 1) Develop plan for retrofitting county buildings, provide reports/website to inform public about activities and energy savings, and conduct energy audits and 2) retrofit County Court Building and Robert A. Ver Kuilen Building with energy efficiency upgrades: conduct interior lighting retrofits (lights and sensors), installation of air-cooled air conditioning units, and installation of new reflective ceiling tiles. Conditions: None - applicant must comply with Programmatic Agreement Categorical Exclusion(s) Applied: A9, A11, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21


Public Order and Safety Buildings  

U.S. Energy Information Administration (EIA) Indexed Site

Order and Safety Order and Safety Characteristics by Activity... Public Order and Safety Public order buildings are those used for the preservation of law and order or public safety. Basic Characteristics [ See also: Equipment | Activity Subcategories | Energy Use ] Public Order and Safety Buildings... Volunteer fire stations tend not to be government owned, which probably explains why 33 percent of public order and safety buildings were not owned by Federal, state, or local governments. Only 7 percent of all public order and safety buildings were constructed in the 1990's. The Northeast Census region had a high concentration of public order and safety buildings—43 percent of these buildings are in the Northeast (while the Northeast region contained only 9 percent of all commercial buildings).


PSERC Public Webinar  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Transmission Design at the National Level: Transmission Design at the National Level: Benefits, Risks and Possible Paths Forward James D. McCalley Professor, Electrical and Computer Engineering Iowa State University PSERC Public Webinar Tuesday, January 24, 2012 2:00-3:00 p.m. Eastern Time (11:00-12:00 p.m. Pacific) [Note: a poster on this work is available on the PSERC website: Dec. 7 Workshop Poster, PDF 583KB. The white paper associated with this webinar will be available on the PSERC website in advance of the webinar.] Description Today, the ability to move electric energy interregionally is limited to the capacity of the existing transmission system, a system designed largely to serve intraregional needs from fossil- and nuclear- based generation for which production costs are relatively flat from one region to another. In contrast, the


Energy Analysis Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Analysis > Product List Analysis > Product List HeaderLine Energy Analysis Publications Products BRIEFS: Showing Results 1 to 5 of 23 Role of Alternative Energy Sources: Nuclear Technology Assessment Brief (Aug 2012) Role of Alternative Energy Sources: Hydropower Technology Assessment Brief (Aug 2012) Role of Alternative Energy Sources: Geothermal Technology Assessment Brief (Aug 2012) Role of Alternative Energy Sources: Solar Thermal Technology Assessment Brief (Aug 2012) Role of Alternative Energy Sources: Wind Technology Assessment Brief (Aug 2012) View All MODELS/TOOLS: Showing Results 1 to 5 of 23 Power Plant Flexible Model (Nov 2013) NETL Upstream Dashboard Tool (Aug 2012) Power Systems Life Cycle Analysis Tool (Power LCAT) (Jun 2012) Life Cycle Greenhouse Gas Analysis of Advanced Jet Propulsion Fuels: Fischer-Tropsch Based SPK-1 Case Study - Model (Dec 2011)


PSERC Public Webinar  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Cyber-Physical Systems Security for the Smart Grid Cyber-Physical Systems Security for the Smart Grid Manimaran Govindarasu Professor, Electrical and Computer Engineering Iowa State University PSERC Public Webinar Tuesday, February 7, 2012 2:00-3:00 p.m. Eastern Time (11:00-12:00 p.m. Pacific) [Note: a poster on this work is available on the PSERC website: Dec. 7 Workshop Poster, PDF 763KB. The white paper associated with this webinar will be available on the PSERC website in advance of the webinar.] Description One thing that virtually all of the information hierarchy components must deal with is cyber and physical security. This webinar (and the associated white paper) focuses on identifying a comprehensive set of cyber security challenges and the need for security at multiple levels of the cyber-physical power system,


Marshall D. Newton Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Marshall D. Newton Marshall D. Newton Recent Publications 138. Modeling Donor/Acceptor Interactions: Combined Roles of Theory and Computation M. D. Newton Int. J. Quant. Chem. 77, 255-263 (2000) 139. Estimation of Electron Transfer Distances from AM1 Calculations S. F. Nelson and M. D. Newton J. Phys. Chem. A104, 10023-31 (2000) 140. An Informative Subtlety of Temperature-Jump or Coulostatic Responses for Surface-Attached Species J. F. Smalley, M. D. Newton and S. W. Fledberg Electrochem. Commun. 2, 832-38 (2000) 141. Electron Transfer: Theoretical Models and Computational Implementation M. D. Newton In Electron Transfer in Chemistry, Vol I, Ed., V. Balzani .; Wiley-VCH Verlag GmbH: Weinhein, Germany, 2001, p3 142. Adiabatic Interfacial Electron Transfer over 26 Å through


Energy Analysis Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Analysis Analysis Life Cycle Analysis Energy Analysis Publications NEW RELEASES Perspective on the U.S. Coal Industry Perspective on the U.S. Coal Industry [PPSX - 3.09MB] (Dec 2013) Novel CO2 Utilization Concepts: Working Paper Novel CO2 Utilization Concepts: Working Paper [ZIP - 4MB] (Nov 2013) Contact: Gavin Pickenpaugh Contact: Robert James This presentation provides an overview of the coal industry, focusing on the United States, but within a global context.... Read More Working Report on CO2 Utilization Concepts, detailing screening and detailed studies of concepts using CO2 for product g... Read More Power Plant Flexible Model Power Plant Flexible Model [2.04 - PDF] (Nov 2013) LCA XIII: The Carbon Footprint of Carbon Dioxide LCA XIII: The Carbon Footprint of Carbon Dioxide


NETL Publications: Conference Proceedings  

NLE Websites -- All DOE Office Websites (Extended Search)

Conference Proceedings Conference Proceedings Publications Conference Proceedings 2013 Aug 20-22 Carbon Storage R&D Project Review Meeting Aug 6-7 2013 NETL Workshop on Multiphase Flow Science July 23 14th Annual SECA Workshop July 8-11 NETL CO2 Capture Technology Meeting June 11-13 University Coal Research/Historically Black Colleges and Universities and other Minority Institutions Contractors Review Meeting 2012 Oct 2-4 2012 University Turbine Systems Research Workshop Aug 21-23 Carbon Storage R&D Project Review Meeting July 24-27 13th Annual SECA Workshop July 9-12 2012 NETL CO2 Capture Technology Meeting May 30-31 2012 University Coal Research/ Historically Black Colleges and Universities and Other Minority Institutions Contractors Review Conference April 17-19 The 26th Annual Conference on Fossil Energy Materials


EIS-0431: Extension of public comment period; Notice of public...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Notice of public hearing; Correction Hydrogen Energy California's Integrated Gasification Combined Cycle and Carbon Capture and Sequestration Project, CA On Monday, August 26,...

Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Publications - Center for Transportation Analysis  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications Publications are by year in alphabetical order by lead author. If you need additional assistance, please contact Debbie Bain. Note: Many publications prior to 1999 are not available electronically and can be obtained by contacting the author. CTA Publications are listed by Year [2013] [2012] [2011] [2010] [2009] [2008] [2007] [2006] [2005] [2004] [2003] [2002] [2001] [2000] [1999] [1998] [1997] [1996] [1995] 2013 Publications Malikopoulos, A.A., "Impact of Component Sizing in Plug-In Hybrid Electric Vehicles for Energy Resource and Greenhouse Emissions Reduction,"ASME Journal of Energy Resources Technology, Vol. 135, No. 4, 2013, pp. 041201-041209. Malikopoulos, A.A. and Aguilar, J.P., "An Optimization Framework for Driver Feedback Systems,"IEEE Transactions on Intelligent Transportation Systems, Vol. 14, No. 2, 2013, pp. 955-964.


Recent Publications | Advanced Photon Source  

NLE Websites -- All DOE Office Websites (Extended Search)

Entries in the APS Publications Database for the week ending 01.05.2014 Entries in the APS Publications Database for the week ending 01.05.2014 This list of entries in the APS Publications Database includes Journal Articles (9,003), Conference Proceedings (7), Books (4), and Book Chapters (76), and Dissertations (0). This list of entries in the APS Publications Database does not include abstracts, invited talks, awards, magazine articles, or patents. For the complete list, search the APS Publications Database. Inquiries about or submissions to the publications database should be directed to apspubs@aps.anl.gov. Journal Article Z. Aabdin, N. Peranio, O. Eibl, Tö W. llner, K. Nielsch, D. Bessas, R.P. Hermann, M. Winkler, Kö J. nig, Bö H. ttner, V. Pacheco, J. Schmidt, A. Hashibon, Elsä C. sser, Nanostructure, Excitations, and Thermoelectric


Public Involvment Plan - Rifle, Colorado  

Office of Legacy Management (LM)

4-TAR 4-TAR MAC-GWRIF 7.1 UMTRA Ground Water Project Public Involvement Plan for the Environmental Assessment of Ground Water Compliance at the New and Old Rifle, Colorado, Uranium Mill Tailings Sites May 1999 Prepared by U.S. Department of Energy Grand Junction Office Grand Junction, Colorado Work performed under DOE Contract No. DE-AC13-96GJ87335 Public Involvement Plan for the Rifle UMTRA Sites Page 2 Introduction This Public Involvement Plan is tiered to the Uranium Mill Tailings Remedial Action (UMTRA) Ground Water Project Public Participation Plan dated October 1997. This Public Involvement Plan applies to both the Old and New Rifle, Colorado, UMTRA Project sites and details the activities that have been or will be carried out to meet the public participation requirements of the


Recent Publications | Advanced Photon Source  

NLE Websites -- All DOE Office Websites (Extended Search)

Entries in the APS Publications Database for the week ending 12.29.2013 Entries in the APS Publications Database for the week ending 12.29.2013 This list of entries in the APS Publications Database includes Journal Articles (9,007), Conference Proceedings (7), Books (4), and Book Chapters (76), and Dissertations (0). This list of entries in the APS Publications Database does not include abstracts, invited talks, awards, magazine articles, or patents. For the complete list, search the APS Publications Database. Inquiries about or submissions to the publications database should be directed to apspubs@aps.anl.gov. Journal Article Z. Aabdin, N. Peranio, O. Eibl, Tö W. llner, K. Nielsch, D. Bessas, R.P. Hermann, M. Winkler, Kö J. nig, Bö H. ttner, V. Pacheco, J. Schmidt, A. Hashibon, Elsä C. sser, Nanostructure, Excitations, and Thermoelectric


DUF6 EIS Public Comment Form  

NLE Websites -- All DOE Office Websites (Extended Search)

Public Comment Form Public Comment Form The public comment period for the Depleted UF6 Supplemental Analysis is closed. The public comment form is no longer available. Sorry The...


Fuel Cell Technologies Office: Educational Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Educational Educational Publications to someone by E-mail Share Fuel Cell Technologies Office: Educational Publications on Facebook Tweet about Fuel Cell Technologies Office: Educational Publications on Twitter Bookmark Fuel Cell Technologies Office: Educational Publications on Google Bookmark Fuel Cell Technologies Office: Educational Publications on Delicious Rank Fuel Cell Technologies Office: Educational Publications on Digg Find More places to share Fuel Cell Technologies Office: Educational Publications on AddThis.com... Publications Program Publications Technical Publications Educational Publications Newsletter Program Presentations Multimedia Conferences & Meetings Webinars Data Records Databases Glossary Quick Links Hydrogen Production Hydrogen Delivery Hydrogen Storage


Synthetic and Mechanistic Chemistry publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Synthetic and Mechanistic Synthetic and Mechanistic publications Research into alternative forms of energy, especially energy security, is one of the major national...


2007 Solar Decathlon Technical Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

2007 Solar Decathlon Citations from Select Technical Publications Changing Behaviors: Market Transformation Web Sites as Online Narrative Hicks, D. Panel 6 - Market Transformation:...


Prior NIST Work in Public Safety Communications  

Science Conference Proceedings (OSTI)

... Prior NIST Work in Public Safety Communications. ... Distributed Testbed for First Responders; Guide to Public Safety Communication Technologies.



Developer American Public Transportation Association | Open Energy...  

Open Energy Info (EERE)

value "American Public Transportation Association" 2011 APTA Public Transportation Fact Book + Quantifying Greenhouse Gas Emissions from Transit + Property: Developer Value:...


American Municipal Power (Public Electric Utilities) - Residential...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

American Municipal Power (Public Electric Utilities) - Residential Efficiency Smart Program (Ohio) American Municipal Power (Public Electric Utilities) - Residential Efficiency...


Environmental Justice and Public Participation Through Technology...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Environmental Justice and Public Participation Through Technology- Building Community Capacity Environmental Justice and Public Participation Through Technology- Building Community...


Public Scoping Meeting Public Scoping Meeting David Levenstein  

Office of Legacy Management (LM)

Public Scoping Public Scoping Meeting Public Scoping Meeting David Levenstein EIS Document Manager David Levenstein EIS Document Manager 2 About Tonight's Scoping Meeting * Scoping is a required step in the National Environmental Policy Act (NEPA) process for preparing an environmental impact statement (EIS). * Scoping is the process of determining the subjects that will be considered and evaluated in an EIS. * Public comments - both oral and written - received during the scoping period are taken into account when decisions are made about the issues and alternatives to be analyzed in an EIS. * The scoping period for the Mercury Storage EIS began with publication in the Federal Register of DOE's Notice of Intent to prepare the Mercury Storage EIS on July 2, 2009; ends on August 17, 2009.


Publications on maglev technologies  

Science Conference Proceedings (OSTI)

Magnetically levitated passenger-transportation vehicles, using attractive and repulsive magnetic forces, are currently in the development or prototype-revenue stages in Japan and Germany. The basic principles of these technologies have been understood for several decades, but their practical applications awaited advances in high-power electronic devices, modern controls, superconducting magnets, and improvements in our transportation infrastructures. A considerable amount of work was devoted to magnetic-levitation (maglev) transportation system in the late 1960s and the 1970s. Detailed development was sustained primarily in Germany and Japan. This listing of publications was begun as the initial phase of a design study for a maglev development facility sponsored by the State of Illinois. The listing has been continually updated under programs sponsored by the Federal Railroad Administration and the US Army Corps of Engineers. In 1991, the National Maglev Initiative issued 27 contracts for the study of technical issues related to maglev and four contracts for the definition of maglev systems. In December 1991, the Intermodal Surface Transportation Efficiency Act was enacted, mandating the development of a US-designed maglev system in a six-year period. This listing is offered as an aid to those working on these projects, to help them locate technical papers on relevant technologies. The design and installation of a maglev transportation system will require the efforts of workers in many disciplines, from electronics to economics to safety. Accordingly, the references have been grouped in 14 different sections to expedite review of the listing. In many case, the references are annotated to indicate the general content of the papers. Abstracts are not available. A list of information services from which the listed documents might be obtained and an author index are provided.

He, J.L.; Coffey, H.T.; Rote, D.M.; Wang, Z.



Index of Publications by the Nuclear Data Program - Nuclear Engineering  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications Nuclear Data Program Overview Current Projects & Recent Activities Collaborating Organizations Publications [Publications 2011] [Publications 2010] [Publications 2009] [Publications 2008] [Publications 2007] [Publications 2006] [Publications 2005] [Publications 2004] [Publications 2003] [Publications 2002] [Publications 2001] [Publications 2000] [Publications 1999] [Publications 1998] [Publications 1997] [Other Publications] Nuclear Data Measurements (NDM) Reports Experimental Nuclear Data Resources Contact ND Program Related Resources Other Major Programs Work with Argonne Contact us For Employees Site Map Help Join us on Facebook Follow us on Twitter NE Division on Flickr Nuclear Data Program Publications Bookmark and Share The ND staff has contributed to a number of scientific journals, conference


Appendix V Public Involvement Plan  

NLE Websites -- All DOE Office Websites (Extended Search)

V V Public Involvement Plan Revision No.: 6 February 2008 Federal Facility Agreement and Consent Order (FFACO) FFACO, Appendix V February 2008 i FFACO Public Involvement Plan U.S. Department of Energy National Nuclear Security Administration Nevada Site Office Las Vegas, Nevada U.S. Department of Defense Defense Threat Reduction Agency Detachment 1, Nevada Operations Mercury, Nevada U.S. Department of Energy Office of Legacy Management Grand Junction, Colorado FFACO, Appendix V February 2008 ii Preface The Public Involvement Plan serves two purposes: it provides a broad public involvement strategy, and fulfills requirements contained in the Federal Facility Agreement and Consent Order (FFACO) relating to public awareness and participation. Under the FFACO, agreed to by


Publications of LASL research, 1978  

DOE Green Energy (OSTI)

This bibliography is a compilation of unclassified publications of work done at the Los Alamos Scientific Laboratory for 1978. Papers published in 1978 are included regardless of when they were actually written. Publications received too late for inclusion in earlier compilations are also listed. Declassification of previously classified reports is considered to constitute publication. All classified issuances are omitted. If a paper was published more than once, all places of publication are included. The bibliography includes Los Alamos Scientific Laboratory reports, papers released as non-LASL reports, journal articles, books, chapters of books, conference papers (whether published separately or as part of conference proceedings issued as books or reports), papers published in congressional hearings, theses, and US patents. Publications by LASL authors that are not records of Laboratory-sponsored work are also included.

Willis, J.K.; Salazar, C.A. (comps.)



Public Affairs | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

The National Nuclear Security Administration The National Nuclear Security Administration Public Affairs Home > Field Offices > Welcome to the Sandia Field Office > Public Affairs Public Affairs The SFO Public Affairs Director is responsible for all public affairs matters connected with the functions of SFO. In this capacity the Public Affairs Director is responsible for the development and management of the SFO public affairs programs including media relations, community relations, tribal relations, public participation, government/congressional relations, protocol, emergency public information, and internal employee communications and contractor oversight of these same programs. For public affairs assistance, please call (505) 845-5264. Printer-friendly version Printer-friendly version


NREL: Concentrating Solar Power Research - Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications NREL develops publications, including technical reports and papers, about its R&D activities in concentrating solar power, as well as related information. Below you'll find a list of selected NREL publications concerning these activities. Also see TroughNet's publications on parabolic trough technology, and market and economic assessment. For other NREL concentrating solar power publications, you can search NREL's Publications Database. Selected Publications These publications are available as Adobe Acrobat PDFs. Utility-Scale Power Tower Solar Systems: Performance Acceptance Test Guidelines NREL Subcontract Report Author: David Kearney - Kearney & Associates Publication Date: March 2013 Simulating the Value of Concentrating Solar Power with Thermal Energy


Fuel Cell Technologies Office: Hydrogen Technical Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Information Resources Information Resources Printable Version Share this resource Send a link to Fuel Cell Technologies Office: Hydrogen Technical Publications to someone by E-mail Share Fuel Cell Technologies Office: Hydrogen Technical Publications on Facebook Tweet about Fuel Cell Technologies Office: Hydrogen Technical Publications on Twitter Bookmark Fuel Cell Technologies Office: Hydrogen Technical Publications on Google Bookmark Fuel Cell Technologies Office: Hydrogen Technical Publications on Delicious Rank Fuel Cell Technologies Office: Hydrogen Technical Publications on Digg Find More places to share Fuel Cell Technologies Office: Hydrogen Technical Publications on AddThis.com... Publications Program Publications Technical Publications Hydrogen Fuel Cells Safety, Codes & Standards

Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Number of trips 1,610 Distance traveled (mi) 372 Percent of total distance traveled (%) 72% Average Trip Distance (mi) 0.2 Average Driving Speed (mph) 5.2 Average Stops per mile 32.1 Percent of Regen Braking Energy Recovery (%) 13% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 383 Number of trips 114 Distance traveled (mi) 144 Percent of total distance traveled (%) 28% Average Trip Distance (mi) 1.3 Average Driving Speed (mph) 18.3 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 16% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 549 Number of trips 5 Distance traveled (mi) 2 Percent of total distance traveled (%) 0% Average Trip Distance (mi) 0.4 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

530 530 Number of trips 1,308 Distance traveled (mi) 495 Percent of total distance traveled (%) 69% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 5.6 Average Stops per mile 31.4 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 471 Number of trips 91 Distance traveled (mi) 175 Percent of total distance traveled (%) 24% Average Trip Distance (mi) 1.9 Average Driving Speed (mph) 16.6 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 357 Number of trips 2 Distance traveled (mi) 49 Percent of total distance traveled (%) 7% Average Trip Distance (mi) 24.7 Average Driving Speed (mph)


Computational and experimental analysis of plant microRNAs  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are small, endogenous, non-coding RNAs that mediate gene regulation in plants and animals. We demonstrated that Arabidopsis thaliana miRNAs are highly complementary (0-3 mispairs in an ungapped alignment) ...

Jones-Rhoades, Matthew W. (Matthew William)



Service/Product Provider  

NLE Websites -- All DOE Office Websites (Extended Search)

Johnson Controls, Inc. Ford Motor Company 2875 High Meadow Cir. 550 Town Center Dr., Ste 200 Auburn Hills, MI 48326-2773 Dearborn, MI 48126 Business: Building Automation, Facility...



NLE Websites -- All DOE Office Websites (Extended Search)

74 74 Number of trips 399 Distance traveled (mi) 148 Percent of total distance traveled (%) 73% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 6.3 Average Stops per mile 35.5 Percent of Regen Braking Energy Recovery (%) 11% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 423 Number of trips 27 Distance traveled (mi) 54 Percent of total distance traveled (%) 27% Average Trip Distance (mi) 2.0 Average Driving Speed (mph) 20.7 Average Stops per mile 3.5 Percent of Regen Braking Energy Recovery (%) 15% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 0 Number of trips 0 Distance traveled (mi) 0 Percent of total distance traveled (%) 0% Average Trip Distance (mi) 0.0 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

5 5 Overall AC electrical energy consumption (AC Wh/mi)¹ 111 Overall DC electrical energy consumption (DC Wh/mi)² 71 Overall DC electrical energy captured from regenerative braking (DC Wh/mi) 61 Total number of trips 1,135 Total distance traveled (mi) 4,408 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 22 DC electrical energy consumption (DC Wh/mi) 296 Number of trips 264 Percent of trips city | highway 100% | 0% Distance traveled (mi) 781 Percent of total distance traveled 18% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 19 DC electrical energy consumption (DC Wh/mi) 141 Number of trips 44 Percent of trips city | highway 96% | 4% Distance traveled CD | CS (mi) 333 | 389 Percent of total distance traveled CD | CS



NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Number of trips 493 Distance traveled (mi) 189 Percent of total distance traveled (%) 38% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 4.9 Average Stops per mile 28.7 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 377 Number of trips 67 Distance traveled (mi) 275 Percent of total distance traveled (%) 56% Average Trip Distance (mi) 4.1 Average Driving Speed (mph) 17.9 Average Stops per mile 3.7 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 438 Number of trips 1 Distance traveled (mi) 29 Percent of total distance traveled (%) 6% Average Trip Distance (mi) 28.7 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

505 505 Number of trips 601 Distance traveled (mi) 245 Percent of total distance traveled (%) 62% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 5.4 Average Stops per mile 34.8 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 373 Number of trips 35 Distance traveled (mi) 124 Percent of total distance traveled (%) 31% Average Trip Distance (mi) 3.5 Average Driving Speed (mph) 23.0 Average Stops per mile 3.7 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 319 Number of trips 3 Distance traveled (mi) 25 Percent of total distance traveled (%) 6% Average Trip Distance (mi) 8.5 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

1 1 Overall AC electrical energy consumption (AC Wh/mi)¹ 93 Overall DC electrical energy consumption (DC Wh/mi)² 71 Overall DC electrical energy captured from regenerative braking (DC Wh/mi) 40 Total number of trips 11,047 Total distance traveled (mi) 119,879 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 25 DC electrical energy consumption (DC Wh/mi) 208 Number of trips 4,491 Percent of trips city | highway 92% | 8% Distance traveled (mi) 30,376 Percent of total distance traveled 25% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 22 DC electrical energy consumption (DC Wh/mi) 71 Number of trips 1,352 Percent of trips city | highway 69% | 31% Distance traveled CD | CS (mi) 12,772 | 20,001 Percent of total distance traveled CD | CS



NLE Websites -- All DOE Office Websites (Extended Search)

613 613 Number of trips 89 Distance traveled (mi) 9 Percent of total distance traveled (%) 30% Average Trip Distance (mi) 0.1 Average Driving Speed (mph) 7.0 Average Stops per mile 44.5 Percent of Regen Braking Energy Recovery (%) 9% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 487 Number of trips 8 Distance traveled (mi) 5 Percent of total distance traveled (%) 16% Average Trip Distance (mi) 0.6 Average Driving Speed (mph) 25.0 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 6% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 487 Number of trips 7 Distance traveled (mi) 16 Percent of total distance traveled (%) 54% Average Trip Distance (mi) 2.3 Average Driving Speed (mph)


Many families of Caenorhabditis elegans microRNAs are not essential for development or viability  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are approximately 23 nt regulatory RNAs that posttranscriptionally inhibit the functions of protein-coding mRNAs. We previously found that most C. elegans miRNAs are individually not essential for ...

Alvarez-Saavedra, Ezequiel


C:\\DS\\08-2225 - Final with Errata Page.wpd  

NLE Websites -- All DOE Office Websites (Extended Search)

per liter MgO magnesium oxide mi milemiles mi 2 square miles mL millilitermilliliters MOU memorandum of understanding mph miles per hour mrem milliremmillirem MRL method...


Screening SNPs residing in the microRNA-binding sites of Hepatocellular Carcinoma related genes  

Science Conference Proceedings (OSTI)

Single nucleotide polymorphisms located at miRNA-binding sites are likely to affect the expression of the miRNA targets and may contribute to the susceptibility of humans to common diseases. Here we selected 289 candidate Hepatocellular Carcinoma ...

Jun Ding; Yuzhen Gao; Yan He; Yifeng Zhou; Moli Huang; Haiyan Liu



Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

,"Next Release Date:","11292013" ,"Excel File Name:","n9050mi2a.xls" ,"Available from Web Page:","http:tonto.eia.govdnavnghistn9050mi2a.htm" ,"Source:","Energy Information...


Species Revision and Generic Systematics of World Rileyinae (Hymenoptera: Eurytomidae)  

E-Print Network (OSTI)

Woolley (9F TAMU); 23 mi. S. Trona, 13.v.1980, J. Woolley,Gates (2m UCR); 23 mi. S. Trona, 13.v.1980, J. Woolley (1m

Gates, Michael William



PowerPoint Presentation  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

law * Tech transfer and licensing Why do GIV and V2G make sense? Basic GIVV2G Math * US car used 1 hour day, parked 23 h d * Battery 100 mi, daily travel 30 mi, thus * Drive...



NLE Websites -- All DOE Office Websites (Extended Search)

with battery state of charge below 90% (for charging events with SOC reported) Vehicle Usage Number of trips 3,364 Total distance traveled (mi) 21,706 Avg trip distance (mi) 5.8...


GTdemo (.mw) - CECM  

E-Print Network (OSTI)

Algorithm: Backtracking (Branch & Bound) MaximumIndependentSet(G); NygiIiMiIiQiIiYiIiciIigiIzc= MaximumClique(G); NyUiIiMiIikiIio= ChromaticNumber( G...


PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Chow, T. Edwin  

E-Print Network (OSTI)

a ; Michael E. Hodgson b a Department of Earth and Resource Science, University of Michigan--Flint, Flint, MI*{ and MICHAEL E. HODGSON{ {Department of Earth and Resource Science, University of Michigan--Flint, Flint, MI

Chow, Tzeekiu Edwin


Bang smad Villages New Year in 2011  

E-Print Network (OSTI)

and Mi Nyag Tibetan ??????? ??????????????????? Performer(s)'s first / native language Khams Tibetan and Mi Nyag Tibetan ??????? last updated by World Oral Literature Project staff on Wednesday, Tuesday, June 8, 2010 ??????????????????? Performer...

Bkar shis bzang po

Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network (OSTI)

Public-private partnerships (PPPs) cannot be justified because they free public funds. When PPPs are justified on efficiency grounds, the contract that optimally balances demand risk, user-fee distortions and the opportunity cost of public funds, features a minimum revenue guarantee and a revenue cap. However, observed revenue guarantees and revenue sharing arrangements differ from those suggested by the optimal contract. Also, this contract can be implemented via a competitive auction with realistic informational requirements. Finally, the allocation of risk under the optimal contract suggests that PPPs

Eduardo Engel; Ronald Fischer; Alexander Galetovic



Modulation of Intestinal Micrornas by a Chemoprotective Diet  

E-Print Network (OSTI)

We have hypothesized that dietary modulation of intestinal miRNA expression may contribute to the chemoprotective effects of nutritional bioactives (fish oil and pectin). Using a rat colon carcinogen model, we determined miRNAs-let-7d, miR-15b, miR-107, miR-191 and miR-324-5p were modulated by fish oil + pectin. We also demonstrated that BACE1 and PTEN are targets of miR-107 and miR-21, respectively. To further elucidate the biological effects of diet and carcinogen on miRNAs, we integrated global miRNAs, total and polysomal gene expression datasets obtained from the above mentioned study and used four computational approaches. We demonstrated that polysomal profiling is tightly related to microRNA changes when compared with total mRNA profiling. In addition, diet and carcinogen exposure modulated a number of microRNAs and complementary gene expression analyses showed that oncogenic PTK2B, PDE4B, and TCF4 were suppressed by the chemoprotective diet at both the mRNA and protein levels. To determine the function of select diet and colon carcinogen modulated miRNAs and to validate their targets, we carried out a series of loss and gain of function experiments along with luciferase reporter assays. We verified that PDE4B and TCF4 are direct targets of miR-26b and miR-203, respectively. PTK2B was determined to be an indirect target of miR-19b. In addition, microRNA physiological function was assessed by examining effects on apoptosis and cell proliferation. To better understand how the colonic stem cell population responds to environmental factors such as diet and carcinogen, we investigated the chemoprotective effects of dietary agents on miRNAs in colonic stem cells obtained from Lgr5-EGFP-IRES-creERT2 knock in mice injected with AOM. We demonstrated that based on relative expression of miR-125a-5p, miR-190b and miR-191 in stem cells vs. daughter cells and differentiated cells, these miRNAs may be stem cell specific miRNAs. We also identified miR-21 to be significantly reduced in stem cells compared to differentiated cells and selectively modulated by these dietary agents in stem cells. In summary, our results indicate for the first time that fish oil plus pectin protect against colon tumorigenesis in part by modulating a subset of miRNAs and their target genes (mRNAs) implicated in the regulation of the colon stem cell niche and tumor development.

Shah, Manasvi 1984-



Publications 2010 - Nuclear Data Program - Nuclear Engineering Division  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Nuclear Data Program Overview Current Projects & Recent Activities Collaborating Organizations Publications [Publications 2011] [Publications 2010] [Publications 2009] [Publications 2008] [Publications 2007] [Publications 2006] [Publications 2005] [Publications 2004] [Publications 2003] [Publications 2002] [Publications 2001] [Publications 2000] [Publications 1999] [Publications 1998] [Publications 1997] [Other Publications] Nuclear Data Measurements (NDM) Reports Experimental Nuclear Data Resources Contact ND Program Related Resources Other Major Programs Work with Argonne Contact us For Employees Site Map Help Join us on Facebook Follow us on Twitter NE Division on Flickr Nuclear Data Program Publications: 2010 References Bookmark and Share 1. Refereed Publications in Peer-reviewed Scientific Journals


Publications 2006 - Nuclear Data Program - Nuclear Engineering Division  

NLE Websites -- All DOE Office Websites (Extended Search)

6 6 Nuclear Data Program Overview Current Projects & Recent Activities Collaborating Organizations Publications [Publications 2011] [Publications 2010] [Publications 2009] [Publications 2008] [Publications 2007] [Publications 2006] [Publications 2005] [Publications 2004] [Publications 2003] [Publications 2002] [Publications 2001] [Publications 2000] [Publications 1999] [Publications 1998] [Publications 1997] [Other Publications] Nuclear Data Measurements (NDM) Reports Experimental Nuclear Data Resources Contact ND Program Related Resources Other Major Programs Work with Argonne Contact us For Employees Site Map Help Join us on Facebook Follow us on Twitter NE Division on Flickr Nuclear Data Program Publications: 2006 References Bookmark and Share Refereed Publications in Peer-reviewed Scientific Journals


Publications 2007 - Nuclear Data Program - Nuclear Engineering Division  

NLE Websites -- All DOE Office Websites (Extended Search)

7 7 Nuclear Data Program Overview Current Projects & Recent Activities Collaborating Organizations Publications [Publications 2011] [Publications 2010] [Publications 2009] [Publications 2008] [Publications 2007] [Publications 2006] [Publications 2005] [Publications 2004] [Publications 2003] [Publications 2002] [Publications 2001] [Publications 2000] [Publications 1999] [Publications 1998] [Publications 1997] [Other Publications] Nuclear Data Measurements (NDM) Reports Experimental Nuclear Data Resources Contact ND Program Related Resources Other Major Programs Work with Argonne Contact us For Employees Site Map Help Join us on Facebook Follow us on Twitter NE Division on Flickr Nuclear Data Program Publications: 2007 References Bookmark and Share Refereed Publications in Peer-reviewed Scientific Journals


Semiconductor Landing  

Science Conference Proceedings (OSTI)

Title Goes Here. Lorem ipsum dolor sit amet, consectetur adipiscing elit. Sed malesuada accumsan mi, et adipiscing nunc varius quis. ...




E-Print Network (OSTI)

: Gole Mi" Myrtle Williomson. Deye Muey. Chris Moderl. led Row: Dr. Gron· yille Price. Deen Judd. Ed

O'Laughlin, Jay


Particulate matter chemistry and dynamics in the Twilight Zone at VERTIGO ALOHA and K2 Sites  

E-Print Network (OSTI)

Marine Chemistry 105, 208 Volk, T. , Hoffert, M.I. , 1985.Broecker and Peng, 1982; Volk and Hoffert, 1985; Armstrong

Bishop, James K.B.



The export of carbon mediated by mesopelagic fishes in the northeast Pacific Ocean  

E-Print Network (OSTI)

Chapman and Hall, New York. Volk, T. , Hoffert, M.I. , 1985.the biological pump (Volk and Hoffert, 1985). The

Davison, Peter Charles



I Cant Walk! Acute Thrombosis of Descending Aorta Causing Paraplegia  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, Michigan Supervising SectionWest Grand Boulevard, CFP-258, Detroit, MI 48202. Email:

Mitchell, Matthew Lee; Yucebey, Elif; Weaver, Mitchell R; Jaehne, A Kathrin; Rivers, Emanuel P



Project Brief: Michigan Aerospace Corporation  

Science Conference Proceedings (OSTI)

... RECIPIENT: Michigan Aerospace Corporation, Ann Arbor, MI. Project duration: 3 Years; Total NIST Funding: $1,499,463. ...



Mark Iadicola  

Science Conference Proceedings (OSTI)

... 2002-2003 Postdoctoral Research Fellow University of Michigan, Ann Arbor, MI. 1996-2002 University of Michigan, Ann ...



California Cuckoo Wasps in the Family Chrysididae (Hymenoptera)  

E-Print Network (OSTI)

Panamint Springs; 13 mi. n Trona; Lone Pine; Death Valley;San Bernardino Co. : Trona. Map 89. California distribution

Kimsey, Lynn S.



Available Technologies: Long-term Growth of Finite Life ...  

APPLICATIONS OF TECHNOLOGY: Examine carcinogenesis, aging, expression of genes, proteins and miRNA, signaling pathways, epigenetics, and genomic ...


The FASEB Journal Research Communication Structure-function analysis of human l-prostaglandin D  

E-Print Network (OSTI)

the commercially available PGD2-MOX ELISA kit (Cay- man Chemicals, Ann Arbor, MI, USA). One unit of enzyme activity

Zhijie, Liu



NLE Websites -- All DOE Office Websites (Extended Search)

Sciences STATE: MI PROJECT TITLE : Manufacturing Industrial Development for the Alternative Energy Systems Funding Opportunity Announcement Number Procurement Instrument...



Science Conference Proceedings (OSTI)

... the permission of GJ Ackland and MI Mendelev. These potentials are not designed for simulations of radiation damage. ...



Observation of a Narrow Charm-Strange Meson D A.V. Evdokimov,8  

E-Print Network (OSTI)

University of Iowa, Iowa City, IA 52242, USA 17 University of Michigan-Flint, Flint, MI 48502, USA 18

Akgun, Ugur


Preserving the U.S. Underground and Alternative Press of the 1960s and '70s: History, Prospects, and Microform Sources  

E-Print Network (OSTI)

Reporter, Washington, DC, 1985- , UMI Navajo Times, WindowWashington, DC Native Sun, Detroit, MI Navajo Times, Window

Tsang, Daniel C



Materials Technology @ TMS  

Science Conference Proceedings (OSTI)

... MI; Elizabeth Holm, Carnegie Mellon University, Pittsburgh, PA; Peter Gumbsch, Fraunhofer Institute for Mechanics of Materials IWM, Freiburg, Germany.

Note: This page contains sample records for the topic "mi mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Thermal Insulation Materials  

Science Conference Proceedings (OSTI)

... IN. Knauf Insulation Product Testing Laboratory, Shelbyville, IN [200883- 0] MI. Dow Chemical Building Solutions Product Perf. ...



Argonne National Laboratory 1985 publications  

Science Conference Proceedings (OSTI)

This report is a bibliography of scientific and technical 1985 publications of Argonne National Laboratory. Some are ANL contributions to outside organizations' reports published in 1985. This compilation, prepared by the Technical Information Services Technical Publications Section (TPB), lists all nonrestricted 1985 publications submitted to TPS by Laboratory's Divisions. The report is divided into seven parts: Journal Articles - Listed by first author, ANL Reports - Listed by report number, ANL and non-ANL Unnumbered Reports - Listed by report number, Non-ANL Numbered Reports - Listed by report number, Books and Book Chapters - Listed by first author, Conference Papers - Listed by first author, Complete Author Index.

Kopta, J.A. (ED.); Hale, M.R. (comp.)



Mississippi Public Utility Act | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mississippi Public Utility Act Mississippi Public Utility Act Mississippi Public Utility Act < Back Eligibility Commercial Construction Developer General Public/Consumer Industrial Investor-Owned Utility Municipal/Public Utility Rural Electric Cooperative Utility Savings Category Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making Electricity Water Home Weatherization Solar Wind Program Info State Mississippi Program Type Industry Recruitment/Support Siting and Permitting Provider Public Service Commission The Mississippi Public Utility Act is relevant to any project that plans to generate energy. It requires that a utility must first obtain a Certificate of Public Convenience and Necessity (CPCN) from the Mississippi Public Service Commission (PSC) before commencing construction of a new electric


Recent Publications | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Recent Publications Recent Publications Recent Publications November 1, 2013 - 11:40am Addthis Learn more about DOE's Combined Heat and Power (CHP) Program and CHP's potential benefits to the nation by downloading these recent publications. Guide to Using Combined Heat and Power for Enhancing Reliability and Resiliency in Buildings, 20 pp*, September 2013 Capturing Waste Gas: Saves Energy, Lowers Costs - Case Study, 2 pp*, July 2013 Combined Heat and Power System Achieves Millions in Cost Savings at Large University - Case Study, 4 pp*, May 2013 Tapping Landfill Gas to Provide Significant Energy Savings and Greenhouse Gas Reductions - Case Study, 4 pp*, Apr. 2013 Combined Heat and Power System Enables 100% Reliability at Leading Medical Campus - Case Study, 4 pp*, Mar. 2013 CHP: Enabling Resilient Energy Infrastructure for Critical


Recent Publications | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Recent Publications Recent Publications Recent Publications November 1, 2013 - 11:40am Addthis Learn more about DOE's Combined Heat and Power (CHP) Program and CHP's potential benefits to the nation by downloading these recent publications. Guide to Using Combined Heat and Power for Enhancing Reliability and Resiliency in Buildings, 20 pp*, September 2013 Capturing Waste Gas: Saves Energy, Lowers Costs - Case Study, 2 pp*, July 2013 Combined Heat and Power System Achieves Millions in Cost Savings at Large University - Case Study, 4 pp*, May 2013 Tapping Landfill Gas to Provide Significant Energy Savings and Greenhouse Gas Reductions - Case Study, 4 pp*, Apr. 2013 Combined Heat and Power System Enables 100% Reliability at Leading Medical Campus - Case Study, 4 pp*, Mar. 2013 CHP: Enabling Resilient Energy Infrastructure for Critical


Federal Energy Management Program: Publications  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Advanced Search Browse by Topic Mail Requests Help Software FAQs Feature featured product thumbnail Federal Energy Management Program Overview - Facilitating Sound, Cost-Effective Energy Management Details Bookmark & Share View Related Welcome to the Federal Energy Management Program's (FEMP) publication and product library. Use this database to: Search for FEMP publications and products View or download publications Request hard copies of select publications and products. Search the Library Search (Searches Title, Description, Filename and Keywords) Advanced Search Browse by Topic Most Popular Energy Savings Performance Contract (ESPC) ENABLE Program The Energy Savings Performance Contract (ESPC) ENABLE program, a new project funding approach, allows small Federal facilities to realize energy and water savings in six months or less. ESPC ENABLE pr Details Bookmark & Share


Publications | Building Energy Codes Program  

NLE Websites -- All DOE Office Websites (Extended Search)

Center » [all items] Center » [all items] Site Map Printable Version Development Adoption Compliance Regulations Resource Center FAQs Publications Resource Guides eLearning Model Policies Glossary Related Links ACE Learning Series Utility Savings Estimators Publications To receive updates about BECP publications subscribe to the BECP Mailing List. Additional resources are also available from the Building America Solution Center. 189.1 Progress Indicator Report Energy Use Comparison between 189.1-2009 and 90.1-2010 Document type: Presentation Publication Date: June 2011 Focus: Code Development, Green and Advanced Codes Presentation given at the ASHRAE Annual Meeting, ASHRAE Standard 189.1 Committee; June 29, 2011; Montreal Canada.Main topics included: Progress Indicator and Prototype Models developed by Pacific


Publications 1997 - Nuclear Data Program - Nuclear Engineering Division  

NLE Websites -- All DOE Office Websites (Extended Search)

7 7 Nuclear Data Program Overview Current Projects & Recent Activities Collaborating Organizations Publications [Publications 2011] [Publications 2010] [Publications 2009] [Publications 2008] [Publications 2007] [Publications 2006] [Publications 2005] [Publications 2004] [Publications 2003] [Publications 2002] [Publications 2001] [Publications 2000] [Publications 1999] [Publications 1998] [Publications 1997] [Other Publications] Nuclear Data Measurements (NDM) Reports Experimental Nuclear Data Resources Contact ND Program Related Resources Other Major Programs Work with Argonne Contact us For Employees Site Map Help Join us on Facebook Follow us on Twitter NE Division on Flickr Nuclear Data Program Publications: 1997 References Bookmark and Share Donald L. Smith and Andreas Fessler


Publications 2002 - Nuclear Data Program - Nuclear Engineering Division  

NLE Websites -- All DOE Office Websites (Extended Search)

2 2 Nuclear Data Program Overview Current Projects & Recent Activities Collaborating Organizations Publications [Publications 2011] [Publications 2010] [Publications 2009] [Publications 2008] [Publications 2007] [Publications 2006] [Publications 2005] [Publications 2004] [Publications 2003] [Publications 2002] [Publications 2001] [Publications 2000] [Publications 1999] [Publications 1998] [Publications 1997] [Other Publications] Nuclear Data Measurements (NDM) Reports Experimental Nuclear Data Resources Contact ND Program Related Resources Other Major Programs Work with Argonne Contact us For Employees Site Map Help Join us on Facebook Follow us on Twitter NE Division on Flickr Nuclear Data Program Publications: 2002 References Bookmark and Share M. Danchev, D.J. Hartley, F.G. Kondev, M.P. Carpenter, R.V.F.


Publications 2008 - Nuclear Data Program - Nuclear Engineering Division  

NLE Websites -- All DOE Office Websites (Extended Search)

8 8 Nuclear Data Program Overview Current Projects & Recent Activities Collaborating Organizations Publications [Publications 2011] [Publications 2010] [Publications 2009] [Publications 2008] [Publications 2007] [Publications 2006] [Publications 2005] [Publications 2004] [Publications 2003] [Publications 2002] [Publications 2001] [Publications 2000] [Publications 1999] [Publications 1998] [Publications 1997] [Other Publications] Nuclear Data Measurements (NDM) Reports Experimental Nuclear Data Resources Contact ND Program Related Resources Other Major Programs Work with Argonne Contact us For Employees Site Map Help Join us on Facebook Follow us on Twitter NE Division on Flickr Nuclear Data Program Publications: 2008 References Bookmark and Share F.G. Kondev Nuclear Data Sheets for A=206


Brief communication: Genome-wide computational identification of microRNAs and their targets in the deep-branching eukaryote Giardialamblia  

Science Conference Proceedings (OSTI)

Using a combined computational program, we identified 50 potential microRNAs (miRNAs) in Giardia lamblia, one of the most primitive unicellular eukaryotes. These miRNAs are unique to G. lamblia and no homologues have been found in other organisms; miRNAs, ... Keywords: CDS, Computational, EST, Gene regulation, Giardia lamblia, MicroRNA, UTR, VSPs

Yan-Qiong Zhang; Dong-Liang Chen; Hai-Feng Tian; Bao-Hong Zhang; Jian-Fan Wen



U.S. Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI : 140 : 2011-2013: Marysville, MI: 176 : 1,080: 14 : 2011-2013: St. Clair, MI: 1,562: 1,422: 2 : 26 : 2011-2013: Noyes, MN: 13,380: 14,460: 20,624: 33,889 ...


U.S. Price of Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI: 3.80 : 4.50 : 2011-2013: Marysville, MI: 3.63: 3.65 : 4.57: 4.70 : 2011-2013: St. Clair, MI: 3.75: 3.67: 4.09: 4.41 : 4.35: 2011-2013: Noyes, MN: 3.74: 3 ...


U.S. Natural Gas Pipeline Exports by Point of Exit  

U.S. Energy Information Administration (EIA)

Detroit, MI: 22,904: 27,220: 43,980: 44,275: 43,690: 50,347: 1996-2011: Marysville, MI: 9,158: 8,756: 14,925: 22,198: 41,964: 42,866: 1996-2011: Sault Ste. Marie, MI ...


U.S. Price of Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI: 8.28: 6.58: 4.53: 8.37: 5.17 : 1996-2011: Marysville, MI: 7.59: 8.59: 3.80: 4.44: 4.42: 2.99: 1996-2012: St. Clair, MI: 6.97: 10.03: 5.10: 4.97: 4.29: 2 ...


U.S. Price of Natural Gas Pipeline Exports by Point of Exit  

U.S. Energy Information Administration (EIA)

Detroit, MI: 6.88: 8.37: 4.01: 4.69: 4.26: 3.10: 1996-2012: Marysville, MI: 7.77: 7.48: 4.85: 4.87: 4.48: 3.18: 1996-2012: Sault Ste. Marie, MI: 7.13: 8.75: 5.04: 5 ...


July 2009 NW Michigan Regional Fruit Grower Newsletter CALENDER OF EVENTS  

E-Print Network (OSTI)

Basket Sparta, MI 7/10 Grape IPM Update L. Mawby's Tasting Room 7/13 Canola Research 2009 Plot Days Central Lake, MI 7/14 Canola Research 2009 Plot Days Marion, MI 7/16 Backyard Chicken Production Workshop


Publications on Energy Policy | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Publications on Energy Policy Publications on Energy Policy Get information on clean energy policy in publications produced by the U.S. Department of Energy (DOE) and the National...


Public School Transportation National and Regional  

E-Print Network (OSTI)

..............................................................................1 II. West Virginia's Public School Transportation Funding SystemPublic School Transportation National and Regional Perspectives: An Update Presented to Education Subcommittee C ­ Public School Finance January 2009 Amy Higginbotham Jared Pincin Dr. Tami Gurley-Calvez Dr

Mohaghegh, Shahab


Clean Cities: Tips for Public Outreach  

NLE Websites -- All DOE Office Websites (Extended Search)

Tips for Public Outreach to someone by E-mail Share Clean Cities: Tips for Public Outreach on Facebook Tweet about Clean Cities: Tips for Public Outreach on Twitter Bookmark Clean...