Powered by Deep Web Technologies
Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

CO2 Emissions - Malawi  

NLE Websites -- All DOE Office Websites (Extended Search)

Malawi Graphics CO2 Emissions from Malawi Data graphic Data CO2 Emissions from Malawi image Per capita CO2 Emission Estimates for Malawi...

2

Biomass Briquettes in Malawi.  

E-Print Network (OSTI)

?? In Malawi 2.5 % of the forest disappears each year. The use of firewood and charcoal, deriving from forest resources, accounts for about 99… (more)

Faxälv, Olle

2007-01-01T23:59:59.000Z

3

977.ps  

E-Print Network (OSTI)

Oct 15, 2004 ... model H (such as SeDuMi developed by Jos Sturm [8]). Here the cone C is the. Cartesian product of self-scaled cones: C = Ss1. + × ... × S. sns.

4

Malawi-USAID Climate Activities | Open Energy Information  

Open Energy Info (EERE)

Malawi-USAID Climate Activities Malawi-USAID Climate Activities Jump to: navigation, search Name Malawi-USAID Climate Activities Agency/Company /Organization U.S. Agency for International Development Sector Energy, Land Focus Area Renewable Energy, Forestry Topics Market analysis, Background analysis Website http://www.usaid.gov/our_work/ Country Malawi Eastern Africa References USAID Malawi[1] "USAID's support for natural resources management in Malawi has proved to be indispensable in not only preserving vital carbon sinks, but also in stimulating economic development. Through improved management practices, training, and technical assistance, the people of Malawi have learned the importance of undertaking income creating sustainable development measures." References ↑ "USAID Malawi"

5

Malawi: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Malawi: Energy Resources Malawi: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-13.5,"lon":34,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

6

Business | Embassy of the United States Lilongwe, Malawi  

NLE Websites -- All DOE Office Websites (Extended Search)

Lilongwe, Malawi Enter search terms Enter Search Term(s) Search Home About Us Ambassador Deputy Chief of Mission About the Embassy USAID CDC PCV PEPFAR Millennium Challenge...

7

(RPP_standards.ps)  

NLE Websites -- All DOE Office Websites (Extended Search)

7 7 10 20 30 40 50 70 100 0.001 0.002 0.005 0.010 0.020 0.050 0.100 0.200 0.500 1.000 Confidence level CL for fits α for confidence intervals 3 4 2 6 8 10 15 20 25 30 40 50 n = 1 χ 2 DEG's Macintosh: Adobe Illus Files/RPP_standards.ps Graphics symbols: 4.25 inches (Sports section) 2.60 inches 3.36 inches (m 1 +m 3 ) 2 10 pt captions 10 pt labels set font basic; set mode vector=off set window x 2 6.5 y 2 5.5 set labels size 1.2 set title size 1.29 set tics size 0.05 4.50 inches (Minireviews) TOPDRAWER template: PARTICLE DATA GROUP NOTES PDG-93-05 10 November 1993 Standards for Adobe Illustrator figures in the Review of Particle Properties

8

Acceptance of repeat population-based voluntary counseling and testing for HIV in rural Malawi  

E-Print Network (OSTI)

and testing intervention in rural Uganda. Health Policy andestimates: The case of rural Malawi. Paper presented at theof the AIDS epidemic in a rural area in Tanzania with a

2008-01-01T23:59:59.000Z

9

Malawi-Enhancing Capacity for Low Emission Development Strategies (EC-LEDS)  

Open Energy Info (EERE)

Malawi-Enhancing Capacity for Low Emission Development Strategies (EC-LEDS) Malawi-Enhancing Capacity for Low Emission Development Strategies (EC-LEDS) Jump to: navigation, search Name Malawi-Enhancing Capacity for Low Emission Development Strategies (EC-LEDS) Agency/Company /Organization United States Agency for International Development, United States Environmental Protection Agency, United States Department of Energy, United States Department of Agriculture, United States Department of State Sector Climate, Energy, Land Topics Low emission development planning, -LEDS Program Start 2010 Program End 2016 Country Malawi Eastern Africa References EC-LEDS[1] Contents 1 Overview 2 Framework 3 Lessons Learned and Good Practices 4 Progress and Outcomes 5 Fact Sheet 6 References Overview "Enhancing Capacity for Low Emission Development Strategies (EC-LEDS) is a

10

Employment Patterns among Women: A Comparative Study of Rural Malawi and Rural Pakistan  

E-Print Network (OSTI)

Shahnaz, L. (2002). How do women decide to work in Pakistan?The Pakistan Development Review,41(4), Part II:495-513.is 8 and 14 in rural Pakistan and rural Malawi respectively

Hassan, Amira; Hyder, Asma

2012-01-01T23:59:59.000Z

11

Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...

12

US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

13

US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

14

RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.

15

DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility

16

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed

17

MI  

NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)

18

DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4

19

DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP

20

PS2004 Light-harvesting Systems Workshop  

DOE Green Energy (OSTI)

This special issue of the international scientific research journal Photosynthesis Research consists of 25 original peer-reviewed contributions from participants in the PS 2004 Lisht-Harvesting Systems Workshop. This workshop was held from 26-29, 2004 at Hotel Le Chantecler, Sainte-Adele, Quebec, Canada. The workshop was a satellite meeting of the XIII International Congress on Photosynthesis held August 29-September 3, 2004 in Montreal, Canada. The workshope dealt with all types of photosynthetic antenna systems and types of organisms, including anoxygenic photosynthetic bacteria, cyanobacteria, algae and higher plants, as well as in vitro studies of isolated pigments. This collection of papers is a good representation of the highly interdisciplinary nature of modern research on photosynthetic antenna complexes, utilizing techniques of advanced spectroscopy, biochemistry, molecular biology, synthetic chemistry and structural determination to understand these diverse and elegant molecular complexes.

Robert E. Blankenship

2005-11-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...

22

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...

23

DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.

24

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either

25

Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...

26

DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical

27

DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated

28

MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab

2008-10-01T23:59:59.000Z

29

Paulus, Sokolowski and Sartor (PS&S) & Johnson and Johnson Teaming...  

NLE Websites -- All DOE Office Websites (Extended Search)

(PS&S) & Johnson and Johnson Teaming Profile cover page of document PS&S conducts a Cogeneration Feasibility Study to help Johnson & Johnson improve their facilities' power...

30

Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)

2012-01-01T23:59:59.000Z

31

DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP

32

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state

33

Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mäkinen; Jorma Tarhio

2010-02-01T23:59:59.000Z

34

UNIXUNIXUNIXUNIX((((OpenSSHOpenSSHOpenSSHOpenSSH)))) (gw.ps.nifs.ac.jp) RSA  

E-Print Network (OSTI)

pdf SSH SSH SSH UNIXUNIXUNIXUNIX((((OpenSSHOpenSSHOpenSSHOpenSSH)))) ssh (gw.ps.nifsTerm: New connection TCP/IP gw.ps.nifs.ac.jp %ssh (-i ) (-l ) gw.ps.nifs.ac.jp The authenticity of host 'gw.ps.nifs.ps.nifs.ac.jp,133.75.37.11' (RSA) to the list of known hosts. Enter passphrase for key '/home

Ito, Atsushi

35

Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png

36

Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls

37

,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

38

,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

39

Genetic diversity and performance of maize varieties from Zimbabwe, Zambia and Malawi  

E-Print Network (OSTI)

Large scale and planned introduction of maize (Zea mays) in southern Africa was accomplished during the last 100 years. Since then, smallholder farmers and breeders have been selecting varieties best adapted to their specific growing conditions. Six studies were conducted to generate information on the current levels of genetic diversity and agronomic performance of both farmer-developed and commercially-bred maize varieties in Zimbabwe, Zambia and Malawi to help in the identification of sources of new alleles for improving yield, especially under the main abiotic stresses that prevail in the region. In the first study, 267 maize landraces were collected from smallholder farmers in different agro-ecological zones of the three countries for conservation and further studies. Passport data and information on why smallholder farmers continue to grow landraces despite the advent of modern varieties were also collected along with the landraces. The second study revealed considerable variation for phenological, morphological and agronomic characters, and inter-relationships among the landraces and their commercial counterparts. A core sample representing most of the diversity in the whole collection of landraces was selected for further detailed analyses. The third study revealed high levels of molecular diversity between landraces originating from different growing environments and between landraces and commercially-bred varieties. The Simple Sequence Repeat (SSR) data also showed that the genetic diversity introduced from the original gene pool from the USA about 100 years ago is still found in both the descendant landraces and commercially-bred varieties. The fourth study showed that in general, commercially-bred varieties outyielded landraces under both abiotic stress and nonstress conditions with some notable exceptions. Landraces were more stable across environments than improved varieties. The most promising landraces for pre-breeding and further investigation were also identified. The clustering patterns formed based on agronomic data were different from SSR markers, but in general the genotype groupings were consistent across the two methods of measuring diversity. In the fifth study, the more recently-bred maize varieties in Zimbabwe showed consistent improvement over older cultivars in grain yield. The apparent yearly rate of yield increase due to genetic improvement was positive under optimum growing conditions, low soil nitrogen levels and drought stress. The sixth study revealed that in general, genetic diversity in Zimbabwean maize has neither significantly decreased nor increased over time, and that the temporal changes observed in this study were more qualitative than quantitative. The results from the six studies confirm the origin of maize in southern Africa and reveals that considerable genetic variation exists in the region which could be used to broaden the sources of diversity for maize improvement under the current agro-ecological conditions in southern Africa.

Magorokosho, Cosmos

2006-12-01T23:59:59.000Z

40

Anomalous high ionic conductivity of nanoporous -Li3PS4  

Science Conference Proceedings (OSTI)

Lithium-ion conducting solid electrolytes hold the promise for enabling high-energy battery chemistries and circumventing safety issues of conventional lithium batteries1-3. Achieving the combination of high ionic conductivity and broad electrochemical window in solid electrolytes is a grand challenge for the synthesis of battery materials. Herein we show an enhancement of room-temperature lithium-ion conductivity of 3 orders of magnitude by creating nanostructured Li3PS4. This material has a wide (5V) electrochemical window and superior chemical stability against lithium metal. The nanoporous structure of Li3PS4 reconciles two vital effects that enhance ionic conductivity: (1) The reduced dimension to nanometer-sized framework stabilizes the high conduction beta phase that occurs at elevated temperatures1,4; and (2) The high surface-to-bulk ratio of nanoporous -Li3PS4 promotes surface conduction5,6. Manipulating the ionic conductivity of solid electrolytes has far-reaching implications for materials design and synthesis in a broad range of applications such as batteries, fuel-cells, sensors, photovoltaic systems, and so forth3,7.

Liu, Zengcai [ORNL; Fu, Wujun [ORNL; Payzant, E Andrew [ORNL; Yu, Xiang [ORNL; Wu, Zili [ORNL; Dudney, Nancy J [ORNL; Kiggans, Jim [ORNL; Hong, Kunlun [ORNL; Rondinone, Adam Justin [ORNL; Liang, Chengdu [ORNL

2013-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.

42

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:

43

The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.

2005-05-01T23:59:59.000Z

44

DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;

45

DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP

46

DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co

47

Analysis of PS InSAR Monitoring Result of Beijing Subsidence  

Science Conference Proceedings (OSTI)

Urban subsidence causes more concerns in China recently. PS InSAR technique is a very useful method for surface deformation detection. We selected Beijing as study area. Being the capital of China, Beijing suffered from ground subsidence for a long time. ... Keywords: urban subsidence, PS InSAR, COSMO-SkyMed, high resolution

Dong Jiang; Mario Costantini; Tingwu Chen; Zikuan Zhou; Chunqing Ge; Jiangbing Cao

2012-10-01T23:59:59.000Z

48

DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on

49

DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:

50

MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units

51

REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

52

Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper

2012-02-20T23:59:59.000Z

53

Transgene Excision Has No Impact on In Vivo Integration of Human iPS Derived Neural Precursors  

E-Print Network (OSTI)

The derivation of induced human pluripotent stem cells (hiPS) has generated significant enthusiasm particularly for the prospects of cell-based therapy. But there are concerns about the suitability of iPS cells for in vivo ...

Major, Tamara

54

Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-10-01T23:59:59.000Z

55

Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel

2010-01-01T23:59:59.000Z

56

MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-12-01T23:59:59.000Z

57

Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)

2011-12-01T23:59:59.000Z

58

A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)

2012-07-15T23:59:59.000Z

59

Making organic-inorganic nanocomposites via selective dispersion of PS-tethered SiO2 particles in polystyrene-block-polymethylmethacrylate copolymer  

Science Conference Proceedings (OSTI)

SiO2 nanoparticles have been dispersed selectively in the polystyrene (PS) microdomain of polystyrene-block-polymethylmethacrylate (PS-b-PMMA) block copolymer via the blending of PS-b-PMMA with PS-tethered SiO2. As ...

Chia-Hong Liu; Li-Ko Chiu; Je-Yuan Yeh; Raymond Chien-Chao Tsiang

2012-01-01T23:59:59.000Z

60

Paulus, Sokolowski and Sartor (PS&S) & Johnson and Johnson Teaming Profile  

NLE Websites -- All DOE Office Websites (Extended Search)

Paulus, Sokolowski and Sartor (PS&S) & Johnson and Johnson Paulus, Sokolowski and Sartor (PS&S) & Johnson and Johnson Teaming Profile Secondary menu About us Press room Contact Us Portfolio Manager Login Facility owners and managers Existing buildings Commercial new construction Industrial energy management Small business Service providers Service and product providers Verify applications for ENERGY STAR certification Design commercial buildings Energy efficiency program administrators Commercial and industrial program sponsors Associations State and local governments Federal agencies Tools and resources Training In This Section Campaigns Commercial building design Communications resources Energy management guidance Financial resources Portfolio Manager Products and purchasing Recognition Research and reports Service and product provider (SPP) resources

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Microsoft Word - PS-MST-DRILL-PRESS-2012-05-21.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

51.doc 1 (03/2012) 51.doc 1 (03/2012) BROOKHAVEN NATIONAL LABORATORY MACHINE SHOP SAFE WORK PRACTICES EVALUATION FORM Dept./Div.: PS______ Machine: PhoSci MSJPM Drill Press (PS-MST-DRILLPRESS) Machine Shop Supervisor's Name(s): Employee Name: _________________________________ Life Number: Competencies Date Completed Evaluated By (Initials) Comments 1. State BNL policy for use of eye protection in machine shops. 2. Identify main disconnect for tool and explain the requirement for access to it. 3. Identify all controls and describe their functions. 4. Identify all machine guards and describe their functions. 5. Explain the process when defects are found.

62

Microsoft Word - PS-MST-MILLING-2012-05-22.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

71.doc 1 (03/2012) 71.doc 1 (03/2012) BROOKHAVEN NATIONAL LABORATORY MACHINE SHOP SAFE WORK PRACTICES EVALUATION FORM Dept./Div.: PS______ Machine: PhoSci MSJPM Milling Machine (PS-MST-MILLING) Machine Shop Supervisor's Name(s): Employee Name: _________________________________ Life Number: Competencies Date Completed Evaluated By (Initials) Comments 1. State BNL policy for use of eye protection in machine shops. 2. Identify main disconnect for tool and explain the requirement for access to it. 3. Identify all controls and describe their functions. 4. Identify all machine guards and describe their functions. 5. Explain the process when defects are found. 6. Demonstrate safe work practices while performing

63

Microsoft Word - PS-MST-LATHE-2012-05-22.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

61.doc 1 (03/2012) 61.doc 1 (03/2012) BROOKHAVEN NATIONAL LABORATORY MACHINE SHOP SAFE WORK PRACTICES EVALUATION FORM Dept./Div.: PS______ Machine: PhoSci MSJPM Lathe (PS-MST-LATHE) Machine Shop Supervisor's Name(s): Employee Name: _________________________________ Life Number: Competencies Date Completed Evaluated By (Initials) Comments 1. State BNL policy for use of eye protection in machine shops. 2. Identify main disconnect for tool and explain the requirement for access to it. 3. Identify all machine controls and explain their functions. 4. Identify all machine guards and describe their functions. 5. Explain the process when defects are found. 6. Describe the proper methods for supporting oversized

64

Microsoft Word - PS-MST-BELTSANDER-2012-05-21.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

21.doc 1 (03/2012) 21.doc 1 (03/2012) BROOKHAVEN NATIONAL LABORATORY MACHINE SHOP SAFE WORK PRACTICES EVALUATION FORM Dept./Div.: PS______ Machine: PhoSci MSJPM Belt/Disc Sander (PS-MST-BELTSANDER) Machine Shop Supervisor's Name(s): Employee Name: _________________________________ Life Number: Competencies Date Completed Evaluated By (Initials) Comments 1. State BNL policy for use of eye protection in machine shops. 2. Identify main disconnect for tool, and explain the requirement for access to it. 3. Identify all controls and describe their functions. 4. Identify all machine guards and describe their functions. 5. State the proper clearance between the belt/disc and the tool rest.

65

Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.

1997-10-01T23:59:59.000Z

66

Orbit, optics and chromaticity correction for PS2 negative momentum compaction lattices  

SciTech Connect

The effect of magnet misalignments in the beam orbit and linear optics functions are reviewed and correction schemes are applied to the negative momentum compaction lattice of PS2. Chromaticity correction schemes are also proposed and tested with respect to off-momentum optics properties. The impact of the correction schemes in the dynamic aperture of the lattice is finally evaluated.

Papaphilippou,Y.; Barranco, J.; Bartmann, W.; Benedikt, M.; Carli, C.; de Maria, R.; Peggs, S.; Trbojevic, D.

2009-05-04T23:59:59.000Z

67

The Ps and Qs of Parallel ALCF Leap to Petascale Workshop  

E-Print Network (OSTI)

The Ps and Qs of Parallel Debugging ALCF Leap to Petascale Workshop May 23, 2012 Ray Loy ApplicaALCF #12;Outline § bgp ­ hSp://www.alcf.anl.gov/resource-guides/debugging ("Core file seRngs") 4 #12;Lightweight

Kemner, Ken

68

IMPEDANCE CONSIDERATIONS FOR THE DESIGN OF THE VACUUM SYSTEM OF THE CERN PS2  

SciTech Connect

In order for the LHC to reach an ultimate luminosity goal of 10{sup 35}/cm{sup 2}/s, CERN is considering upgrade options for the LHC injector chain, including a new 50 GeV synchrotron of about 1.3 km length for protons and heavy ions, to be called the PS2 [1]. The proton energy will be ramped from 4 GeV to 50 GeV in 1.2 s, and the design proton current for LHC operation is 2.7 A. In the LARP framework, we are studying the instability thresholds and the impedance requirements of the vacuum system for the PS2. Goal of this study is to develop an impedance budget for the machine. We consider the standard single and multi-bunch collective effects that may be an issue in the PS2. For single bunch, we study the microwave instability and the transverse mode coupling instability (TMCI); for multi-bunch, the transverse coupled bunch instability. While the impedance budget will include many components in the machine, at present, we only have sufficient information to include the resistance of the beam pipe, the vacuum flanges that connect the various pieces of the vacuum chamber, and space charge impedance in our estimate. Note that earlier estimates of the impedance and its effects in the PS2 can be found in Ref. [2]. Table 1 presents selected PS2 parameters that will be used in the calculations. The equations used, unless indicated otherwise, can be found in Ref. [3].

Bane, K.L.F.; Stupakov, G.; Wienands, U.; Benedikt, M.; Grudiev, A.; Mahner, E.; /SLAC /CERN

2010-08-26T23:59:59.000Z

69

Direct optoelectronic generation and detection of sub-ps-electrical pulses on sub-mm-coaxial transmission lines  

E-Print Network (OSTI)

-mm-coaxial transmission lines Tae-In Jeona) and D. Grischkowskyb) School of Electrical and Computer Engineering, OklahomaDirect optoelectronic generation and detection of sub-ps-electrical pulses on sub efficient direct optoelectronic generation of sub-ps-THz pulses on 50 coaxial transmission lines with a 330

Oklahoma State University

70

OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown

2013-10-01T23:59:59.000Z

71

In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma

2013-06-01T23:59:59.000Z

72

NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk

73

737.ps  

E-Print Network (OSTI)

It follows from (2.16)-(2.19) that. ?xf? + C ?? + A µ? + N ?? =0,. (2.21). ?yf? + D ?? + B µ? + M ?? = ??,. (2.22). ??. i (Cix? + Diy? ? ci)=0, i = 1,...,l,. (2.23). ??.

74

274.ps  

E-Print Network (OSTI)

Swedish Natural Science Research Council (NFR). ... potentially save large amounts of network resources by avoiding unnecessary trans-. portation of ...... All computations have been performed on a SUN SPARC Ultra-Enterprise ma-.

75

1089.ps  

E-Print Network (OSTI)

Feb 25, 2005 ... ?Department of Electrical and Computer Engineering, Northwestern ... 0422132, and Department of Energy grant DE-FG02-87ER25047-A004. ... effective in practice and that are supported by a global convergence analysis.

76

2389.ps  

E-Print Network (OSTI)

The tremendous research activity in this area was spurred ... [2]), combinatorial optimization (e.g. [6]), among others areas, as well as the ...... 51 (2002), pp.

77

856.ps  

E-Print Network (OSTI)

Note that ?D is the area bounded by the feasible region of Problem (1),. a set of ...... An explicit form of dT cannot be obtained from (51) and therefore com-.

78

597.ps  

E-Print Network (OSTI)

tion areas. This is followed ... In various areas of mathematical programming, the max function plays an impor- ...... Mathematical Programming, 71:51–69, 1995.

79

418.ps  

E-Print Network (OSTI)

Dec 10, 2001 ... We partition A into row blocks, precisely as done at ..... The general case can be proved along similar lines to the following argument. ..... linear equations, arising from a fully discretized model of transmission computerized.

80

615.ps  

E-Print Network (OSTI)

of Ax 6 b, such that A0has full row-rank and the affine hull of P is the set fx 2 R. n j . A0x = b0g. ..... A Framework for the Acquisition, Processing, Transmission, and. Interactive ... Infimaximal Frames: A Technique for Making Lines Look Like.

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

2645.ps  

E-Print Network (OSTI)

procure electric energy on the spot market to meet their customers' electricity demand. To. hedge against this exposure, ... points, in each case based on the information available up to that particular time point. For a ...... 5.2 Sensitivity Analysis.

82

1507.ps  

E-Print Network (OSTI)

Oct 26, 2006 ... The second author was supported by the Netherlands Organization for Scientific Research under ...... 2 hQ(x);Q(y)i~F(x; y)d! n(x)d! n(y) 0:.

83

524.ps  

E-Print Network (OSTI)

Let G(V;E) be a simple undirected graph, V = f1;2;:::;ng. The adjacency matrix of G is a. matrix A G = (a ij )n n , where aij = 1 if (i; j) 2 E, and a ij = 0 if (i; j) =2 E. A ...

84

780.ps  

E-Print Network (OSTI)

In our conclusion, we will discuss some implications of the relation. between neighborhoods and complexity estimates of the algorithm. Let. NG(?G) := {(x, y, ...

85

231.ps  

E-Print Network (OSTI)

Vn := f1;:::;ng, En := fij j 1 ing, and dn := jEnj = n. 2 . Let Sn denote the. set of n n symmetric matrices. For X 2Sn, X 0 means that X is positive semide nite.

86

656.ps  

E-Print Network (OSTI)

May 15, 2003 ... only if AIR. n = IR. n , i.e., if and only if (A; ... b 2FA;C (x): Therefore we can rephrase the condition \\(A;C) is well-posed" as \\F. A;C is. surjective.".

87

413.ps  

E-Print Network (OSTI)

Dec 7, 2001 ... 1280 Main Street West, Hamilton. Ontario, Canada ..... xT ?s + sT ?x = nµh ? xT s. ..... In light of this relation, we know that after at most O(n. 2.

88

1450.ps  

E-Print Network (OSTI)

(a) Z(x; y) does not depend on the choice of the orthonormal basis of R 0. ...... CENTRUM VOOR WISKUNDE EN INFORMATICA (CWI), KRUISLAAN 413,.

89

1800.ps  

E-Print Network (OSTI)

it does not easily reach the same level of accuracy as our method. We have. set a time limit of ..... matical Programming, 109:413–444, 2007. [LNM07] Z. Lu, A.

90

1162.ps  

E-Print Network (OSTI)

... M. Laurent: Centrum voor Wiskunde en Informatica, Kruislaan 413, 1098 SJ ...... Our proof technique for Theorem 2 does not apply to the case when (G) 9.

91

3024.ps  

E-Print Network (OSTI)

We note that (38) does not hold when ? > ? ?c,y?? ..... 413-424. [2] Z.M. Li, A theorem of the alternative and its Application to the optimization of set-valued. maps ...

92

1543.ps  

E-Print Network (OSTI)

proof uses inductive and combinatorial arguments and does not easily generalize .... CENTRUM VOOR WISKUNDE EN INFORMATICA (CWI), KRUISLAAN 413,.

93

354.ps  

E-Print Network (OSTI)

Jun 29, 2001 ... CWI, Kruislaan 413, 1098 SJ Amsterdam, The Netherlands ...... The Sherali- Adams hierarchy does not seem to yield a signi cant improvement ...

94

3153.ps  

E-Print Network (OSTI)

with a fixed number of agents and for combinatorial optimization problems in which the ...... Let ?i denote the fraction of the customers in class i, where ?i?C.

95

1003.ps  

E-Print Network (OSTI)

Nov 17, 2004 ... a vehicle type to serve each trip so that the total demand on the trip does not exceed the ... In both papers, no computation is reported with the.

96

579.ps  

E-Print Network (OSTI)

ables themselves might be the entries of a symmetric positive semidefinite matrix, and. the objective .... variational characterization of the maximum eigenvalue of Z that every component .... This set, visualized in a risk/return plot,. is called the ...

97

1277.ps  

E-Print Network (OSTI)

Dec 20, 2005 ... where Q ? IRn×n is symmetric positive semidefinite, A ? IRm×n ..... Their union, A1 ? A2, can be visualized as the bold line segments in Figures 1 and 2. ... the components of the subproblems and evaluate the merit function ...

98

595.ps  

E-Print Network (OSTI)

real symmetric matrices; T denotes the transpose operation for a matrix. We denote ei ... In particular,. for a ? n, we write a2 to denote the n-dimensional vector which is component-wise square of a. ..... To visualize the picture, see Figure 1. 10 ...

99

821.ps  

E-Print Network (OSTI)

instability is often the decisive point when designing a “real-world” struc-. ture, like a ...... at http://www.is.titech.ac.jp/˜yamashi9/sdpa/index.html, De-. partment of  ...

100

851.ps  

E-Print Network (OSTI)

Professional sports leagues are a major economic activity around the world. ... and Tonga are considering to boycott the next world cup. ..... Solution S is ac-.

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

3190.ps  

E-Print Network (OSTI)

?F. W. Kong(fk07@doc.ic.ac.uk), B. Rustem(br@doc.ic.ac.uk). Department ... subscribes to the subjectivist Bayesian view of the world that assumes every player.

102

453.ps  

E-Print Network (OSTI)

Mt. Carmel, Haifa 31905, Israel (yair@math.haifa.ac.il). Gabor T. Herman ... rithms to real-world problems is demonstrated on a problem of image. reconstruction ...

103

860.ps  

E-Print Network (OSTI)

e-mail: is.kanno@archi.kyoto-u.ac.jp. ‡. Instituto Superior ...... Proc. of the Fifth World Congress of Structural and Multidisciplinary Optimization (WCSMO5).

104

3395.ps  

E-Print Network (OSTI)

Mar 19, 2012 ... closer to limits: liberalization of the markets, and the subsequent increased. commercial .... it is assumed that limited information is available about the network and its. exact state is ...... Available: https://reports.energy.gov/.

105

239.ps  

E-Print Network (OSTI)

Department of Energy grant DE-FG02-87ER25047-A004, and by Sandia National Labo-. ratories LDRD .... Based on this information, the server computes a new trial point (op-. timization ..... the market, and most of them are CORBA-

106

285.ps  

E-Print Network (OSTI)

Feb 23, 2001 ... ing strategy makes extensive use of dual information associated ...... The total potential energy, expressed in terms of the coe cients of the approximating ...... population and have di erential costs of production and marketing.

107

2924.ps  

E-Print Network (OSTI)

this greater accuracy comes at the cost of increased computational time; so it ... ‡ National Renewable Energy Laboratory, Computational Science Center (Peter.

108

746.ps  

E-Print Network (OSTI)

A phylogenetic tree s for the operational taxons under analysis belongs to. the set S of unrooted trees .... sor with 512 Mbytes of RAM memory. Heuristic AG+PR ...

109

1115.ps  

E-Print Network (OSTI)

versus design cost trade-off analysis. In particular, our robust ...... All tests reported below are done on a 1.1 GHz 1256 MB RAM Pentium III. using the MIP solver ...

110

2314.ps  

E-Print Network (OSTI)

found in (Tansel et al., 1983a) and cluster analysis are shown in (Hansen and Jaumard, 1997;. Rao, 1971). ..... Gb of RAM memory. Cplex 11 is used to close the ...

111

625.ps  

E-Print Network (OSTI)

Applications of the p-Median problem arise in the Cluster Analysis (Vinod [47], Rao ...... Personal Computer with Pentium IV-1.8 Ghz processor and 1 Gb RAM.

112

1360.ps  

E-Print Network (OSTI)

a Service d'architecture BSC (PC 12A7), Nortel GSM Access R&D, Parc d' activités ... †Nortel GSM Access R&D Technical Report PE/BSC/INF/016550 V01/ EN, ...

113

1365.ps  

E-Print Network (OSTI)

a Service d'architecture BSC (PC 12A7), Nortel GSM Access R&D, Parc ... † Technical report Nortel GSM Access R&D PE/BSC/INF/017912 V01/EN, to appear.

114

472.ps  

E-Print Network (OSTI)

May 29, 2002 ... It is well-known that, under assumptions ˆA1 and ˆA2, both ( ˆP) and ...... One can think of Ij as the injection of Mj into its regular position in SF .

115

1044.ps  

E-Print Network (OSTI)

Jan 18, 2005 ... Bregman's technique of designing iterative algorithms consists of ensuring that the sequences. {xk}k?N .... by Fan and Glicksberg [44].

116

666.ps  

E-Print Network (OSTI)

plicitly calculated,in general, it is important to understand what is the right way. to approximate ... Here ?, ? is the standard scalar product in Rn+1. Hence, the ...

117

1012.ps  

E-Print Network (OSTI)

We define the energy functional by. J(u) = 1 ... unique minimizer of the energy functional: J(u) = min .... A straightforward result using Green's formula states that.

118

1108.ps  

E-Print Network (OSTI)

brands, most customers do not have enough demand to justify full pallet shipments. ... As the Just-in-Time (JIT) or Efficient Consumer Response (ECR) strategies ...

119

1669.ps  

E-Print Network (OSTI)

demand is not available, but the decision-maker receives advance information on ... due to their limited understanding of the market response at such an early.

120

756.ps  

E-Print Network (OSTI)

The SPG is defined as follows: given a graph G = (V,E), positive edge costs c ..... and D. Werthimer, The seti@home Project, http://stiahome.ssl.berkeley.edu/.

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

1712.ps  

E-Print Network (OSTI)

Jun 20, 2007 ... 1540. 1582. 1582. 2003. 2030. 2030. 1367. 1403. 1403. 11. 114. 138. 138. 157. 175. 175. 174. 213. 213. 12. 248. 267. 267. 337. 350. 350. 278.

122

1552.ps  

E-Print Network (OSTI)

Dec 25, 2006 ... 2030. 22. 9. 2. 9. 66. ok. 56.23. PILOT-JA. 1988. 940. 80. 88. 18. 0. 57. ok. 1.30. PILOTNOV. 2172. 975. 73. 0. 26. 0. 45. ok. 2.10. PILOT. 3652.

123

2428.ps  

E-Print Network (OSTI)

Oct 14, 2009 ... 2030. 1.71 4257.80. 318. 1.66 3,600 19.08 304,331. gt2. 76.50. 99 96.61. 0.29. 256 98.38 2,618 98.37. 599. harp2. 22.43. 1136 67.31 240.81.

124

983.ps  

E-Print Network (OSTI)

Oct 15, 2004 ... ?Department of Computer Science, University of Colorado, Boulder, CO 80309. ... by Department of Energy grant DE-FG02-87ER25047-A004. 1 ...... We have not considered the ultimate convergence rate of the algorithm, nor ...

125

416.ps  

E-Print Network (OSTI)

In general, convergence and convergence rate analyses are. keys to the ... examples, thus illustrating the practical utility of the su cient conditions. Although.

126

263.ps  

E-Print Network (OSTI)

consolidation where applicable. The rate of increase of direct (origin-to- destination). complete block train service is taken to be a linear function of distance, ...

127

640.ps  

E-Print Network (OSTI)

dients: the fact that any norm g is its own bidual g , and the fundamental. inequality. hX; Y i h (X); (Y )i: (2) ...... Handbook of Semide nite Pro-. gramming: Theory ...

128

740.ps  

E-Print Network (OSTI)

Sep 29, 2003 ... The next lemma is a fundamental observation about the local minima of ...... L. Vandenberghe, editors, Handbook of Semidefinite Programming: ...

129

337.ps  

E-Print Network (OSTI)

This object has become fundamental in modern. variational analysis. ...... of Handbooks in Operations Research and Management Science, pages. 529{572.

130

296.ps  

E-Print Network (OSTI)

Mar 9, 2001 ... The following fundamental proposition (whose proof can be found for ...... In R. Saigal, L. Vandenberghe, and H. Wolkowicz, editors, Handbook ...

131

1861.ps  

E-Print Network (OSTI)

[6] Friedrich Eisenbrand and Sören Laue. A linear algorithm for integer programming in the plane. Mathematical Programming, 102(2):249–259, 2005. [7

132

509.ps  

E-Print Network (OSTI)

Jul 19, 2002 ... Often, however, it is not proved that the line search. eventually .... ? is “large”, then (1) the computational overhead may become significant and,.

133

1361.ps  

E-Print Network (OSTI)

a Service d'architecture BSC (PC 12A7), Nortel GSM Access R&D, Parc d' activités. de Magny-Châteaufort, 78928 ... results demonstrating its practical relevance. The paper is ...... Lecture Notes in Computer Science, page 145. Springer, 2001.

134

251.ps  

E-Print Network (OSTI)

have radio transmission and reception equipment, including antennas and all ..... aspect that plays a ma j or role in frequency planning is the (un)availability of.

135

425.ps  

E-Print Network (OSTI)

The general availability of parallel computers and in particular of distributed ...... algorithms, ASME Journal of Mechanics, Transmissions, and Automation in.

136

583.ps  

E-Print Network (OSTI)

and Chin and Fletcher [8] so that stronger statements about convergence to a ...... ORFE-00-06, Operations Research and Financial Engineering, Princeton ...

137

806.ps  

E-Print Network (OSTI)

Note that in this paper we are not interested in making a global statement ...... ORFE-00-06, Operations Research and Financial Engineering, Princeton Univer-

138

693.ps  

E-Print Network (OSTI)

Domination analysis for minimum multiprocessor scheduling. Gregory ..... Proof: Let B i be the event that jA i j < b: Mallows [14] proved that the probability that all.

139

1349.ps  

E-Print Network (OSTI)

Mar 14, 2006... complementary graph of G). *France Telecom R&D, 38-40, rue du Gal Leclerc, 92794 Issy-les-Moulineaux Cedex 9, ..... We state now the main result of this paper. 8 ..... flows, Management Science 17 (1970) pp. 200-207.

140

1150.ps  

E-Print Network (OSTI)

Jun 17, 2005 ... problems can be made safe, even if ill-posed relaxations are used. ...... the process. .... increases safety but in addition overestimation).

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

836.ps  

E-Print Network (OSTI)

Mar 19, 2004 ... with a “safety factor” ?? ? (0,1]. ..... in the optimization process, the current implementation of the algorithm terminates with an error. message ...

142

3955.ps  

E-Print Network (OSTI)

coD??C(z)(u) = {A?u??? A ? J ?C(z)}. between the coderivative and ( Clarke's) generalized Jacobian of any single-valued locally Lips-. chitzian mapping ...

143

718.ps  

E-Print Network (OSTI)

An important measure of conditioning of a conic linear system is. the size of .... We typically denote the norm on a normed space X by k k (or by k kX. if we wish to ...

144

338.ps  

E-Print Network (OSTI)

matrices, a convex cone in Sn, the space of real symmetric matrices. Let. P 0 denote the condition that P 2Sn is positive de nite. Then, for any. square matrix X  ...

145

116.ps  

E-Print Network (OSTI)

the reduced space is large, the algorithm automatically switches to a limited .... can make use of \

146

650.ps  

E-Print Network (OSTI)

In this paper we consider yet another condition on the interpolation set,. which we ... Typically, p is the dimension of the space of polynomials of degree less than.

147

1212.ps  

E-Print Network (OSTI)

The problem MCLSSP is to find a production planning that minimizes the demand shortage, the. setup, the inventory and the production costs. Originally, the ...

148

206.ps  

E-Print Network (OSTI)

periodically varying demand, capacity, inventory holding and production costs. We. show that with concave revenue curves and a polymatroid constraint set, ...

149

830.ps  

E-Print Network (OSTI)

The objective pursued by the supply chain is to construct a deterministic and sustainable inventory-. production-distribution plan enabling it to minimize its costs ...

150

755.ps  

E-Print Network (OSTI)

de ned by a cost function f and a set of feasible solutions X, where we seek an optimal solution. x 2 X such that f(x ) ..... rigs for onshore oil production. Technical  ...

151

1031.ps  

E-Print Network (OSTI)

Dec 22, 2004 ... deal with the energy or the Boltzmann-Shannon entropy (which are .... and the right Bregman distance to C is defined by. (29). ??. DC = ??.

152

1904.ps  

E-Print Network (OSTI)

2] is the average energy of the signal and ... function with respect to Uc and Dc. Define ?H = UH ... Proof: Suppose the optimal solution ¯Dc lies in the region.

153

316.ps  

E-Print Network (OSTI)

(ALENEX 01), Washington DC, 2001. [7] V.G. Deineko and G.J. Woeginger, A study of exponential neighbourhoods. for the traveling salesman problem and the  ...

154

352.ps  

E-Print Network (OSTI)

Jun 19, 2001 ... straint Programming Compared, Report 95.8, University of Leeds, School. of Computer Studies, March 1995. (Also appeared in Proceedings of.

155

332.ps  

E-Print Network (OSTI)

The University of Electro-Communications. 1-5-1 Chofugaoka, ..... Dept. of Mathematical and Computing Sciences, Tokyo Institute of Technology. [6] Goemans ...

156

289.ps  

E-Print Network (OSTI)

Bears, Detroit Lions, Green Bay Packers, and Minnesota Vikings are great rivals. ... to keep Minnesota, Detroit, Green Bay, and Chicago together, and to keep ...

157

658.ps  

E-Print Network (OSTI)

May 3, 2003... order infeasible-interior-point methods for solving. sufficient linear complementarity problems. In system modeling and optimization (Detroit,.

158

1024.ps  

E-Print Network (OSTI)

Dec 18, 2004 ... Exploiting Structure in IPMs. 4. where S = diagfs 1;s2;:::;sng and e = (1;1;:::;1)T , the first order optimality conditions (for the barrier. problem) are:.

159

233.ps  

E-Print Network (OSTI)

Kurt Anstreicher: Department of Management Sciences, University of Iowa, ... nug20 problem was first solved on a 16-processor MEIKO computing system in ...... of the resource management software and three times to perform maintenance.

160

252.ps  

E-Print Network (OSTI)

Switching Centers (MSCs), Service Management System Centers (SMSCs), Home Location ... In addition, maintenance requests and other service requests can.

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

610.ps  

E-Print Network (OSTI)

plies that it will be used for high performance computing and Java is already. introduced as the programming language in introductory courses in scienti c.

162

852.ps  

E-Print Network (OSTI)

pears in a large number of applications such as video-conferences, high performance computing,. and grids, among others. The information is transmitted along ...

163

353.ps  

E-Print Network (OSTI)

Jun 13, 2001 ... The central path in linear optimization always converges to the analytic center of the optimal set. .... Without loss of generality (applying an orthonormal transformation of problem. data, if necessary) we can assume that. X = 2.

164

902.ps  

E-Print Network (OSTI)

its flexibility for handling various types of traveltime. data simultaneously ...... For forcing convergence from a remote starting model,. we follow the standard ...

165

1761.ps  

E-Print Network (OSTI)

Aug 29, 2007 ... Menlo Park, California, 1984. [5] E. Bannai ... Experimental study of energy- minimizing point configurations on spheres, preprint,. arXiv:math.

166

323.ps  

E-Print Network (OSTI)

Mathematical Programming, State of the Art 1994, pages 93{101, Ann Arbor, 1994. University. of Michigan. [10] C. Helmberg, F. Rendl, R.J. Vanderbei, and H.

167

1376.ps  

E-Print Network (OSTI)

Eng., University of Michigan. [29] Sakai, T. (1996), Riemannian Geometry, American Mathematical Society, Providence, RI. [30] Souza, S., de Oliveira, G. L.,  ...

168

687.ps  

E-Print Network (OSTI)

Jul 14, 2003 ... Department of Mathematics and Statistics, Oakland University, Rochester, Michigan, 48309 USA (e-mail: liptak@oakland.edu). Research of this ...

169

1201.ps  

E-Print Network (OSTI)

Report 93-21, Dep. Ind. and Oper. Eng., University of Michigan. [22] Sakai, T. ( 1996), Riemannian Geometry, American Mathematical Society, Providence, RI. 20 ...

170

232.ps  

E-Print Network (OSTI)

Warren, Michigan 48090. and. ‡ mehrotra@iems.nwu.edu. Department of Industrial Engineering and Management Sciences. Robert R. McCormick School of ...

171

339.ps  

E-Print Network (OSTI)

Sciences Division subprogram of the Office of Advanced Scientific Computing Research, U.S.. Department of Energy, under Contract W-31-109-Eng-38 and by  ...

172

2034.ps  

E-Print Network (OSTI)

Department of Electrical Engineering, Mathematics and Computer Science,. Delft University of Technology,. P.O. Box 5031, 2600 GA Delft, The Netherlands.

173

1226.ps  

E-Print Network (OSTI)

set ˜S = {˜s1, ˜s2, ··· , ˜sK} with an average energy of. ˜. Esav . ...... convergence and a saving in the computation time and memory requirements. It is.

174

761.ps  

E-Print Network (OSTI)

Oct 19, 2003 ... facilities F. Each client j ? D has a demand dj that must be served by one ... capacity ui, which is the maximum demand that facility i can serve.

175

2705.ps  

E-Print Network (OSTI)

1 Centrum voor Wiskunde en Informatica, Science Park 123, 1098 XG. Amsterdam ... Computing all points x ? Kn (K = R or C) at which a given system of. polynomials in ..... Throughout the article we illustrate the results with various examples.

176

3531.ps  

E-Print Network (OSTI)

Jul 13, 2012 ... Abstract In this paper we are interested in the convergence analysis of the Stochastic ... continuous policies and converges pointwise to the optimal policy of the problem. ...... Multi-stage stochastic optimization applied to energy planning. ... Dual dynamic programming for linear production/inventory systems.

177

1690.ps  

E-Print Network (OSTI)

Jun 15, 2007 ... relationship with another NP-hard problem designated the dominating set problem. [6, 9, 10] ... European Community Fund FEDER/POCI 2010.

178

394.ps  

E-Print Network (OSTI)

Dec 3, 2001 ... CT98-0202 of the European Community and within the framework of the Belgian Program on ... these relations, consider the following problem.

179

452.ps  

E-Print Network (OSTI)

C.C. RIBEIRO, E. UCHOA, AND R.F. WERNECK, “A hybrid GRASP with ... P.M. THOMPSON AND H.N. PSARAFTIS, “Cyclic transfer algorithms for multi-vehicle.

180

483.ps  

E-Print Network (OSTI)

unzip -U SOSTOOLS.nnn.zip -d your_dir. where nnn is the version number, and your_dir should be replaced by the directory of your choice. In Windows ...

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

1413.ps  

E-Print Network (OSTI)

approach and numerical results. 2. Gomory mixed-integer cut. Let. zIP = {min ex + fv : (x, v) ? P}. be a mixed-integer program where. P = {(x, v) ? Rm : Ax + Cv ...

182

1569.ps  

E-Print Network (OSTI)

Aside from determining the value zIP , the goal of solving (2) is to find. such an ... a problem is called a dual problem and is a strong dual problem if zD = zIP .

183

484.ps  

E-Print Network (OSTI)

Zlp and ZIP correspond to number of variables (n), number of constraints (m), optimal. value of the objective function for the LP relaxation, and the optimal value ...

184

551.ps  

E-Print Network (OSTI)

csdp50.zip” to expand the zip archive. 2. First, determine whether you'll find the BLAS and LAPACK library rou-. tines needed by CSDP. Many manufacturers ...

185

517.ps  

E-Print Network (OSTI)

to the paper by Alizadeh and Goldfarb [1]. ?High Performance Computing for Engineered Systems (HPCES), Singapore-MIT Alliance, 4 Engineering. Drive 3 ...

186

849.ps  

E-Print Network (OSTI)

Apr 2, 2004 ... [8] J. Gondzio and R. Kouwenberg, High performance computing for asset liability man-. agement, Operations Research, 49 (2001), pp.

187

431.ps  

E-Print Network (OSTI)

The research was partly carried out during a visit of Utrecht Univer-. sity. *Institute ... Much research has been carried ...... staging of oesophageal cancer. 42. 57.

188

1055.ps  

E-Print Network (OSTI)

Theorem 1. The mapping D k 7! Lk is a .... for a set A V , s A is the permutation of P mapping any I 2 P to sA(I) := A I. Two ...... On the Shannon capacity of a graph.

189

998.ps  

E-Print Network (OSTI)

Nov 11, 2004 ... Some numerical implementations for large-scale Lovasz capacity and ..... I = fi 1 mapping i ...

190

1839.ps  

E-Print Network (OSTI)

This work was partially supported by the Marie Curie Research Training Network. 504438 (ADONET) ... In any integer program for linear ordering, we have to.

191

1372.ps  

E-Print Network (OSTI)

the Smith+ algorithm begins fathoming nodes on level 3 of the B&B tree, compared to level 6. for the Smith algorithm. In addition, the subtree bounds computed ...

192

1114.ps  

E-Print Network (OSTI)

May 4, 2005 ... NG1. alt.atheism. NG11 rec.sport.hockey. NG2. comp.graphics. NG12 sci.crypt. NG3. comp.os.ms-windows.misc. NG13 sci.electronics. NG4.

193

3110.ps  

E-Print Network (OSTI)

Jul 26, 2011 ... In this paper, we consider deriving tight upper and lower bounds for the ... developed to estimate the prices of options directly, one main ad- ... that the dynamics of (Xt) are influenced by two types of noise: the usual white noise.

194

649.ps  

E-Print Network (OSTI)

Abstract: In this paper we study the relationship between bilevel optimization ... and White [14], and Marcotte [15]). Wen and ... This paper is divided as follows. ...... ever, since there is a hierarchical structure involved, it would be wrong to ad-.

195

1112.ps  

E-Print Network (OSTI)

distinct Paddington stations: one served by the Hammersmith & City line, and the other served by the remaining three lines that go to Paddington. In that sense ...

196

647.ps  

E-Print Network (OSTI)

V = fx ijk : (' ij = 0)&(8p : ' pj 6= k)&(8q : 'iq 6= k)g: (4). As earlier, put an edge ... E = f(x ijk ;xpqr): (i = p)&(j = q)&(k 6= r) _(i = p)&(j 6= q)&(k = r)_. (i 6= p)&(j = q)&(k ...

197

571.ps  

E-Print Network (OSTI)

papers by Todd [36] and Vandenberghe & Boyd [38], the SDP handbook edited by .... Good surveys of such methods appear in Goffin & Vial [4] and Mitchell [27].

198

234.ps  

E-Print Network (OSTI)

Oct 8, 2002 ... CHUZC: Scan cN for a good candidate q to enter the basis. .... Note that the term RHS is used to refer, not just to the vector on the right hand ..... (which is always available without a search for the nonzeros), the hyper-sparse.

199

676.ps  

E-Print Network (OSTI)

path flow is a nonnegative vector / = ( /p ) peç that meets the demand, i.e., ?peçu / p = dk ..... The demand rate ...... The law of peak-hour e x pressway congestion.

200

553.ps  

E-Print Network (OSTI)

with penalty term. .... global convergence, filter methods evaluate the quality of a search direction ... below, and (hk;fk) is entered to the filter, it follows that hk ! 0. ... Enter restoration phase to find a point xk acceptable to the filter Fk such that.

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

888.ps  

E-Print Network (OSTI)

this paper is not self-regular due to its growth term increasing linearly. ..... otherwise we enter an inner iteration by computing the search directions at the.

202

1455.ps  

E-Print Network (OSTI)

Aug 14, 2006 ... cost of reassigning group t (e.g., a function of its criticality, as for the first .... gives rise to a min-max problem: as each cabinet has its own battery,.

203

1147.ps  

E-Print Network (OSTI)

Yamashita, Imai and Fukushima [27] pro-. posed a proximal regularization, defined as follows: given xk, let Fk(x) := F(x)+ck(x?xk), where ck is a positive ...

204

2076.ps  

E-Print Network (OSTI)

convexity assumption on the objective function, Li and Fukushima [15, 16] made a slight ... Fukushima (see [15]) advised a new quasi-Newton equation with the ...

205

326.ps  

E-Print Network (OSTI)

survey articles for SDP include Vandenberghe and Boyd [42], the SDP handbook . edited by Wolkowicz et al [44], Helmberg [15] and Todd [40]. Since the seminal ...

206

2506.ps  

E-Print Network (OSTI)

Dec 29, 2009 ... (c) Optimizing with L1. Figure 2: Three different solutions to the GBACP instance of Figure 1. The load. profile is depicted for each curriculum Q1 ...

207

1929.ps  

E-Print Network (OSTI)

Mar 13, 2008 ... Consider a piecewise linear concave utility function u(·) : ? defined. as follows: u

208

1056.ps  

E-Print Network (OSTI)

lem of determining the minimum energy conformation of a cluster of particles. which interact through ..... PBH turns out to be a waste. This is confirmed by the ...

209

712.ps  

E-Print Network (OSTI)

Aug 27, 2003 ... the cost of placing a new facility on a certain site as well as the interaction with ..... where t > 0 is a parameter that has to be chosen by the user.

210

306.ps  

E-Print Network (OSTI)

the bin-packing problem and the capacitated facility location problem with ...... A.W. Neebe and M.R. Rao, \\ an algorithm for the xed-charge assigning users to ...

211

361.ps  

E-Print Network (OSTI)

information on the link delays, it faces the a priori choice of a robust route where the total delay ..... shortest for some realizations of arc lengths (weak paths).

212

291.ps  

E-Print Network (OSTI)

working with someone else who already has climbed this learning curve and whose experience might. offer quick help. 4. Availability of ASA Code. 4.1. ingber.

213

2359.ps  

E-Print Network (OSTI)

Jul 31, 2009 ... In many practical applications of statistical learning the objective is not ...... We can see that the ROC curve of the regularization path for the ...

214

573.ps  

E-Print Network (OSTI)

Nov 28, 2002 ... [4] A. B. Berkelaar, C. Dert, B. Oldenkamp, and S. Zhang. A primal-dual. decomposition-based interior point approach to two-stage stochastic ...

215

265.ps  

E-Print Network (OSTI)

Programming 4, O. L. Mangasarian, R. R. Meyer, and S. M. Robinson, eds., New York,. 1981 ... Rep. STAN-CS-TR-97-1600, Stanford University, 1997.

216

2704.ps  

E-Print Network (OSTI)

Aug 2, 2010 ... problem under equilibrium constraints in electricity spot market modeling, Applica -. tions of Mathematics, Vol. 52, pp.473-494, 2007.

217

995.ps  

E-Print Network (OSTI)

reactive strategies for resource-constrained project scheduling with uncertain resource. availability. ... Solving a robust maintenance scheduling. problem at the  ...

218

887.ps  

E-Print Network (OSTI)

Q-rates in terms of the di erential properties of v and in terms of the asymptotic dynamical behaviour. of the associated ... ever enters the ball B (x ), then it ..... tion of a descent method for unconstrained minimisation with a line-search procedure.

219

2050.ps  

E-Print Network (OSTI)

The third identity is far from trivial; it is known as the fundamental formula for Jordan algebras. .... It is worth pointing out that the fact that (ii) does not always hold with equality is related to ...... Handbook of semidefinite programming. In-.

220

1061.ps  

E-Print Network (OSTI)

computational scheme in terms of serial efficiency and numerical robustness. ... a nonbasic variable xq with negative reduced cost is chosen to enter the. basis. ...... potential for parallelising the search for singletons in the triangularisation.

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

322.ps  

E-Print Network (OSTI)

MAX SOLUTIONS have been accepted to enter into the CSM, ATC stops the ..... broad terms, our sequential short-term-memory-based tabu search algorithm ...

222

3219.ps  

E-Print Network (OSTI)

extracted and used in a guided local search metaheuristic approach to ..... The offline problem is defined in terms of n bins B and each bin b ? B has a capacity ..... munication Technologies in Tourism 2005, Proceedings of ENTER, 149–159.

223

992.ps  

E-Print Network (OSTI)

Ui(x, t)2/2 + ghi(x, t)] = 0. In terms of the functions Ui and hi, the quasilinear system can be written as ..... characteristic curves that enter the nodes. To obtain these ...... search (that is an approximate one–dimensional minimization) is performed.

224

212.ps  

E-Print Network (OSTI)

performed on one processor, while the remaining processors search for a .... Therefore, before we enter the second phase of our procedure, if we have found .... on a characterization of perfect matrices in terms of forbidden submatrices by.

225

667.ps  

E-Print Network (OSTI)

conditions of the MPCC in terms of stationary conditions of the relaxed NLP for which. constraint ...... we enter a neighborhood, N?(?) of a solution (z?,??) satisfying strict ..... Perform backtracking line search to obtain ?k ? (0,?max] such that,.

226

495.ps  

E-Print Network (OSTI)

May 17, 2002 ... A line search is then used to refine the solution of each ..... the solution operator of the PDE and its discretization enter the calculation of the. Hessian. .... In terms of the operators of Section 3.2, the Hessian has the form S?.

227

272.ps  

E-Print Network (OSTI)

... of Princeton University for. making o ce facilities available to me during my sabbatical. .... The essential objective F 0 : R. n ! ( 1;+1] of (1) is. F0(x) def. = F(x;0) =.

228

388.ps  

E-Print Network (OSTI)

An essential element of the polyhedral. approach is the .... facilities. In our implementation we use polytomic row and column branching. We consider two ...

229

491.ps  

E-Print Network (OSTI)

Jun 13, 2002 ... lengths of the clauses in the formula, its potential to yield truth assignments satisfying the ...... The results are summarized in Tables 3, 4, and 5.

230

604.ps  

E-Print Network (OSTI)

price is, however, also high: instead of the original state variable y, we now have to work. with the ...... the potential energy subject to possible unilateral contact constraints: min. u?IRn. 1. 2 ..... Theory of the Market Economy, Oxford Univ. Press ...

231

143.ps  

E-Print Network (OSTI)

Mathematics a nd Computer Science Division, Argonne National Laboratory, 9700 ... Avenue, Argonne, Illinois 60439, U.S.A. This work was supported by the ...

232

700.ps  

E-Print Network (OSTI)

Germany. Konrad-Zuse-Zentrum. f¨ur Informationstechnik Berlin. ARIE M.C.A. KOSTER. ADRIAN ZYMOLKA. Polyhedral investigations on stable multi-sets.

233

1318.ps  

E-Print Network (OSTI)

... corresponds to a group of customers with similar needs. and purchasing power . This is a reasonable model as marketing departments of these companies. 1 ...

234

2241.ps  

E-Print Network (OSTI)

was implemented in the interactive system for universal functional optimization UFO. Results. of extensive numerical experiments are reported. Keywords:.

235

569.ps  

E-Print Network (OSTI)

This Algorithm was im-. plemented in the interactive system for universal functional optimization UFO. Results. of numerical experiments are reported. Keywords.

236

1468.ps  

E-Print Network (OSTI)

Sep 19, 2006 ... by two-sided bounding inequalities. Technical report, University of Colorado, 2005. [12] Z. Gu, G. Nemhauser, and M. Savelsbergh. Lifted cover ...

237

393.ps  

E-Print Network (OSTI)

ity Constraints, PhD thesis, Dept. of Computer Science, University of Colorado, 1991. [16] M. J. D. Powell, Convergence properties of a class of minimization ...

238

1913.ps  

E-Print Network (OSTI)

Feb 26, 2008 ... Technical report, University of Colorado at Boulder, 2007. 562. [12] L. Liu and S. Liu. Dynamic and static job allocation for multi-server systems.

239

1768.ps  

E-Print Network (OSTI)

Sep 2, 2007 ... ?Department of Computer Science, University of Colorado, Boulder, CO 80309, USA;. richard.byrd@colorado.edu. This author was supported ...

240

542.ps  

E-Print Network (OSTI)

Oct 1, 2002 ... Denver, Colorado,. September 8-12, 1996. 1015-1026. [6] Ceria, S., Cordier, C., Marchand, H., Wolsey, L. A. (1998): Cutting planes for.

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

748.ps  

E-Print Network (OSTI)

structure (tumor) does not appear in the atlas (c) nor in the normal brain (a). ...... procedures”. Handbook of Metaheuristics (F. Glover and G. Kochenberger,. eds.)

242

3152.ps  

E-Print Network (OSTI)

Sep 7, 2011 ... results in the literature, our approximation scheme does not require the assumption of ...... Handbook of Global Optimization, Volume 1.

243

850.ps  

E-Print Network (OSTI)

The white hyper-signal structure (tumor) does not appear in the atlas. (c) nor in ...... Handbook of Metaheuristics (F. Glover and G. Kochenberger, eds.), pages.

244

321.ps  

E-Print Network (OSTI)

May 3, 2001 ... trends and fundamental issues in parallel computing, which interfere in the ...... chemistry to determine the best energy minimum for oligopeptides is reported in [ 143]. ...... handbook of genetic algorithms (L.D. Chambers, ed.) ...

245

3416.ps  

E-Print Network (OSTI)

School of Mathematics & Statistics, Zhejiang University of Finance & Economics, ... problem is one of the elementary and fundamental models in inventory ..... Handbook in Operations Research and Management Science, Volume on Supply ...

246

2248.ps  

E-Print Network (OSTI)

topic of research rather recently and noticeably beyond mathematics, which explains ...... Kutateladze S. S., Fundamentals of Heat Transfer, Academic Press Inc., New York ... Gruber P. M. and Wills J. M. (Eds.), Handbook on Convex Geometry.

247

673.ps  

E-Print Network (OSTI)

Abstract The satisfiability (SAT) problem is a central problem in mathematical. logic, computing theory, and artificial intelligence. An instance of SAT is specified  ...

248

1619.ps  

E-Print Network (OSTI)

RUTCOR - Rutgers University Center for Operations Research, Piscataway, NJ, USA ...... Logical Analysis of Data: From Combinatorial Optimization to Medical.

249

1232.ps  

E-Print Network (OSTI)

Observe that SH,? (?) is a trigonometric polynomial taking values in the space of ... stock at warehouse # 1; the stock at warehouse # i is replenished from ...

250

303.ps  

E-Print Network (OSTI)

Feb 11, 1999 ... We use a design problem for a thermal insulation system to il- .... from a hot to a cold surface by inserting some shields (heat intercepts) ...

251

1227.ps  

E-Print Network (OSTI)

Oct 5, 2005 ... log-linear algorithm named the Fast Legendre Transform (FLT for short, ..... Bec, Burgulence, in Les Houches 2000: New Trends in Turbulence,.

252

340.ps  

E-Print Network (OSTI)

Energy, under Contract W-31-109-Eng-38, and by the the National Science ... on the computation of the gradient and Hessian matrix for partially separable ...

253

618.ps  

E-Print Network (OSTI)

symmetric positive definite matrices, we develop a new polynomial-time primal- ...... III.2.2, we see that the set {P(a) : a ? K(J)} is the connected component of the.

254

249.ps  

E-Print Network (OSTI)

By R E we represent a matrix. whose ijth element is Eij =Rij , where Rij 6= 0: The set of feasible choices satisfying fd1;::: ;dn j. Pn. k=1 dk = l; d k 2Z+;k = 1;::: ;ng is ...

255

1286.ps  

E-Print Network (OSTI)

Jan 12, 2006 ... Though the case of k = 3 was proved by M. Voorhoeve in 1979 [36] ,. this conjecture was ...... We get by a direct inspection that. lim !1. P (t) = ((n ...

256

639.ps  

E-Print Network (OSTI)

Apr 11, 2003 ... We develop Quasi-Newton methods for distributed parameter es-. timation problems ... where bobs is some observed data and mref is a reference model. The func- ..... We use a rather coarse grid of 17 3 cells to approximate the PDE which. leads to 4913 .... [2] L. Borcea. Electrical impedance tomography.

257

1964.ps  

E-Print Network (OSTI)

quadratic penalty function, which combines f with a term of order ? that ...... pre- determined search direction is typically given as the solution of a quadratic ... entered, the penalty parameter will no longer need to be decreased and the algorithm.

258

1545.ps  

E-Print Network (OSTI)

We study ad hoc wireless sensor networks and the sensor network ...... the first r coordinates by Pr, then the resulting operation on the locations in the. rows of ˆP

259

2843.ps  

E-Print Network (OSTI)

Dec 9, 2010 ... 2Supported by the Slovenian Research Agency (project no. 1000-08-210518). 1 ...... BP cones with Manhattan norm. In the following we ...

260

600.ps  

E-Print Network (OSTI)

?Department of Statistics, University of Oxford, 1 South Parks Road, Oxford OX1 3TG, ..... Hence if the restoration phase does terminate then. the point ...... merical Analysis Proceedings Dundee 1981, edited by G.A. Watson, Lecture Notes ... tors

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

2334.ps  

E-Print Network (OSTI)

Apr 8, 2008 ... ?Presented at the conference NAO2008 on “Numerical Analysis and Optimization ... †Department of Mathematics and Statistics, Sultan Qaboos University ..... If this condition does not hold for some ?yk, we set ?yk = yk. ..... Hillstrom (1981) and Conn, Gould and Toint (1988). .... SIAM-AMS Proceedings, Vol.

262

889.ps  

E-Print Network (OSTI)

Oct 15, 2004 ... In this paper we consider a mathematical program with equilibrium ... y Department of Mathematics and Statistics, University of Victoria, ... quali cations such as Mangasarian-Fromovitz constriant quali cation (MFCQ) does ..... Although in some special cases an MPEC may become a convex ..... York, 1983.

263

2400.ps  

E-Print Network (OSTI)

Sep 18, 2009 ... program with equilibrium constraints (SMPEC) whose second stage problem has ... finally we analyze special cases when the variational inequality ... †

264

Supervision Application for the New Power Supply of the CERN PS (POPS)  

E-Print Network (OSTI)

The power supply system for the magnets of the CERN PS has been recently upgraded to a new system called POPS (POwer for PS). The old mechanical machine has been replaced by a system based on capacitors. The equipments as well as the low level controls have been provided by an external company (CONVERTEAM). The supervision application has been developed at CERN reusing the technologies and tools used for the LHC Accelerator and Experiments (UNICOS and JCOP frameworks, SIMATIC WinCC Open Architecture SCADA tool). The paper describes the full architecture of the control application, and the challenges faced for the integration with an outsourced system. The benefits of reusing the CERN industrial control frameworks and the required adaptations will be discussed. Finally, the initial operational experience will be presented.

Milcent, H; Gonzalez-Berges, M; Voitier, A

2011-01-01T23:59:59.000Z

265

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA

266

miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay

267

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....

268

1170-MW(t) HTGR-PS/C plant application-study report: alumina-plant application  

SciTech Connect

This report considers the HTGR-PS/C application to producing alumina from bauxite. For the size alumina plant considered, the 1170-MW(t) HTGR-PS/C supplies 100% of the process steam and electrical power requirements and produces surplus electrical power and/or process steam, which can be used for other process users or electrical power production. Presently, the bauxite ore is reduced to alumina in plants geographically separated from the electrolysis plant. The electrolysis plants are located near economical electric power sources. However, with the integration of an 1170-MW(t) HTGR-PS/C unit in a commercial alumina plant, the excess electric power available (approx. 233 MW(e)) could be used for alumina electrolysis.

Rao, R.; McMain, A.T. Jr.; Stanley, J.D.

1981-05-01T23:59:59.000Z

269

miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li

2009-01-01T23:59:59.000Z

270

1170-MW(t) HTGR-PS/C plant application study report: shale oil recovery application  

SciTech Connect

The US has large shale oil energy resources, and many companies have undertaken considerable effort to develop economical means to extract this oil within environmental constraints. The recoverable shale oil reserves in the US amount to 160 x 10/sup 9/ m/sup 3/ (1000 x 10/sup 9/ bbl) and are second in quantity only to coal. This report summarizes a study to apply an 1170-MW(t) high-temperature gas-cooled reactor - process steam/cogeneration (HTGR-PS/C) to a shale oil recovery process. Since the highest potential shale oil reserves lie in th Piceance Basin of Western Colorado, the study centers on exploiting shale oil in this region.

Rao, R.; McMain, A.T. Jr.

1981-05-01T23:59:59.000Z

271

Proposal for the award of a contract for the design, supply, installation and commissioning of Heating, Ventilation and Air-Conditioning (HVAC) systems for the PS accelerator infrastructure  

E-Print Network (OSTI)

Proposal for the award of a contract for the design, supply, installation and commissioning of Heating, Ventilation and Air-Conditioning (HVAC) systems for the PS accelerator infrastructure

2012-01-01T23:59:59.000Z

272

Proposal for the award of a contract for dismantling, removal and packaging of the existing Heating, Ventilation and Air-Conditioning (HVAC) systems in the PS tunnel  

E-Print Network (OSTI)

Proposal for the award of a contract for dismantling, removal and packaging of the existing Heating, Ventilation and Air-Conditioning (HVAC) systems in the PS tunnel

2012-01-01T23:59:59.000Z

273

Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)

2010-01-01T23:59:59.000Z

274

Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)

2012-07-01T23:59:59.000Z

275

DEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE  

E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.

276

Observation of excited state charge transfer with fs/ps-CARS  

Science Conference Proceedings (OSTI)

Excited state charge transfer processes are studied using the fs/ps-CARS probe technique. This probe allows for multiplexed detection of Raman active vibrational modes. Systems studied include Michler's Ketone, Coumarin 120, 4-dimethylamino-4{prime}-nitrostilbene, and several others. The vibrational spectrum of the para di-substituted benzophenone Michler's Ketone in the first excited singlet state is studied for the first time. It is found that there are several vibrational modes indicative of structural changes of the excited molecule. A combined experimental and theoretical approach is used to study the simplest 7-amino-4-methylcoumarin, Coumarin 120. Vibrations observed in FTIR and spontaneous Raman spectra are assigned using density functional calculations and a continuum solvation model is used to predict how observed modes are affected upon inclusion of a solvent. The low frequency modes of the excited state charge transfer species 4-dimethylamino-4{prime}-nitrostilbene are studied in acetonitrile. Results are compared to previous work on this molecule in the fingerprint region. Finally, several partially completed projects and their implications are discussed. These include the two photon absorption of Coumarin 120, nanoconfinement in cyclodextrin cavities and sensitization of titania nanoparticles.

Blom, Alex Jason

2009-08-01T23:59:59.000Z

277

Pulse-dilation enhanced gated optical imager with 5 ps resolution (invited)  

Science Conference Proceedings (OSTI)

A 5 ps gated framing camera was demonstrated using the pulse-dilation of a drifting electron signal. The pulse-dilation is achieved by accelerating a photoelectron derived information pulse with a time varying potential [R. D. Prosser, J. Phys. E 9, 57 (1976)]. The temporal dependence of the accelerating potential causes a birth time dependent axial velocity dispersion that spreads the pulse as it transits a drift region. The expanded pulse is then imaged with a conventional gated microchannel plate based framing camera and the effective gating time of the combined instrument is reduced over that of the framing camera alone. In the drift region, electron image defocusing in the transverse or image plane is prevented with a large axial magnetic field. Details of the unique issues associated with rf excited photocathodes were investigated numerically and a prototype instrument based on this principle was recently constructed. Temporal resolution of the instrument was measured with a frequency tripled femtosecond laser operating at 266 nm. The system demonstrated 20x temporal magnification and the results are presented here. X-ray image formation strategies and photometric calculations for inertial confinement fusion implosion experiments are also examined.

Hilsabeck, T. J.; Kilkenny, J. D. [General Atomics, P.O. Box 85608, San Diego, California 92186-5608 (United States); Hares, J. D.; Dymoke-Bradshaw, A. K. L. [Kentech Instruments Ltd., Wallingford, Oxfordshire OX10 (United Kingdom); Bell, P. M.; Koch, J. A.; Celliers, P. M.; Bradley, D. K.; McCarville, T.; Pivovaroff, M.; Soufli, R.; Bionta, R. [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States)

2010-10-15T23:59:59.000Z

278

Lightweight and Statistical Techniques for Petascale Debugging: Correctness on Petascale Systems (CoPS) Preliminry Report  

SciTech Connect

Petascale platforms with O(10{sup 5}) and O(10{sup 6}) processing cores are driving advancements in a wide range of scientific disciplines. These large systems create unprecedented application development challenges. Scalable correctness tools are critical to shorten the time-to-solution on these systems. Currently, many DOE application developers use primitive manual debugging based on printf or traditional debuggers such as TotalView or DDT. This paradigm breaks down beyond a few thousand cores, yet bugs often arise above that scale. Programmers must reproduce problems in smaller runs to analyze them with traditional tools, or else perform repeated runs at scale using only primitive techniques. Even when traditional tools run at scale, the approach wastes substantial effort and computation cycles. Continued scientific progress demands new paradigms for debugging large-scale applications. The Correctness on Petascale Systems (CoPS) project is developing a revolutionary debugging scheme that will reduce the debugging problem to a scale that human developers can comprehend. The scheme can provide precise diagnoses of the root causes of failure, including suggestions of the location and the type of errors down to the level of code regions or even a single execution point. Our fundamentally new strategy combines and expands three relatively new complementary debugging approaches. The Stack Trace Analysis Tool (STAT), a 2011 R&D 100 Award Winner, identifies behavior equivalence classes in MPI jobs and highlights behavior when elements of the class demonstrate divergent behavior, often the first indicator of an error. The Cooperative Bug Isolation (CBI) project has developed statistical techniques for isolating programming errors in widely deployed code that we will adapt to large-scale parallel applications. Finally, we are developing a new approach to parallelizing expensive correctness analyses, such as analysis of memory usage in the Memgrind tool. In the first two years of the project, we have successfully extended STAT to determine the relative progress of different MPI processes. We have shown that the STAT, which is now included in the debugging tools distributed by Cray with their large-scale systems, substantially reduces the scale at which traditional debugging techniques are applied. We have extended CBI to large-scale systems and developed new compiler based analyses that reduce its instrumentation overhead. Our results demonstrate that CBI can identify the source of errors in large-scale applications. Finally, we have developed MPIecho, a new technique that will reduce the time required to perform key correctness analyses, such as the detection of writes to unallocated memory. Overall, our research results are the foundations for new debugging paradigms that will improve application scientist productivity by reducing the time to determine which package or module contains the root cause of a problem that arises at all scales of our high end systems. While we have made substantial progress in the first two years of CoPS research, significant work remains. While STAT provides scalable debugging assistance for incorrect application runs, we could apply its techniques to assertions in order to observe deviations from expected behavior. Further, we must continue to refine STAT's techniques to represent behavioral equivalence classes efficiently as we expect systems with millions of threads in the next year. We are exploring new CBI techniques that can assess the likelihood that execution deviations from past behavior are the source of erroneous execution. Finally, we must develop usable correctness analyses that apply the MPIecho parallelization strategy in order to locate coding errors. We expect to make substantial progress on these directions in the next year but anticipate that significant work will remain to provide usable, scalable debugging paradigms.

de Supinski, B R; Miller, B P; Liblit, B

2011-09-13T23:59:59.000Z

279

1170-MW(t) HTGR-PS/C plant application study report: Geismar, Louisiana refinery/chemical complex application  

SciTech Connect

This report summarizes a study to apply an 1170-MW(t) high-temperature gas-cooled reactor - process steam/cogeneration (HTGR-PS/C) to an industrial complex at Geismar, Louisiana. This study compares the HTGR with coal and oil as process plant fuels. This study uses a previous broad energy alternative study by the Stone and Webster Corporation on refinery and chemical plant needs in the Gulf States Utilities service area. The HTGR-PS/C was developed by General Atomic (GA) specifically for industries which require both steam and electric energy. The GA 1170-MW(t) HTGR-PC/C design is particularly well suited to industrial applications and is expected to have excellent cost benefits over other energy sources.

McMain, Jr., A. T.; Stanley, J. D.

1981-05-01T23:59:59.000Z

280

High-Intensity and High-Density Charge-Exchange Injection Studies into the CERN PS Booster at Intermediate Energies  

E-Print Network (OSTI)

For the high brilliance LHC ultimate beam and the high intensity CNGS beam, single batch injections into the CERN Proton Synchrotron (PS) will be used to increase the overall machine intensity compared with the present double batch injections. Charge-exchange injection into the PS Booster with a new linac at intermediate energies is thus examined. A key parameter to consider is the energy dependence of beam incoherent tune shifts at injection. Increasing the linac energy from the present 50 MeV to 160 MeV should yield a safer tune shift. For each PS Booster ring, a charge-exchange injection scheme is envisaged inside a proper straight section, redesigned with new bends to make a local bump and using the existing fast bump magnets for horizontal phase-space painting. ACCSIM simulations for charge-exchange injection at 160 MeV have been investigated for both LHC and CNGS beams. After optimizing the parameters that are used for the space charge tracking routines, the results of the simulations agree well with ex...

Martini, M

2004-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See Block 16C I  

National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)

282

File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload

283

MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.

2011-05-01T23:59:59.000Z

284

Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab

2007-03-01T23:59:59.000Z

285

On Sojourn Times in the $M/M/1$-PS Model, Conditioned on the Number of Other Users  

E-Print Network (OSTI)

We consider the $M/M/1$-PS queue with processor sharing. We study the conditional sojourn time distribution of an arriving customer, conditioned on the number of other customers present. A new formula is obtained for the conditional sojourn time distribution, using a discrete Green's function. This is shown to be equivalent to some classic results of Pollaczeck and Vaulot from 1946. Then various asymptotic limits are studied, including large time and/or large number of customers present, and heavy traffic, where the arrival rate is only slightly less than the service rate.

Zhen, Qiang

2009-01-01T23:59:59.000Z

286

Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A

2008-01-01T23:59:59.000Z

287

www.eia.gov  

U.S. Energy Information Administration (EIA)

PU Kenya KE Lesotho LT Liberia LI Libya LY Madagascar MA Malawi MI Mali ML Mauritania MR Mauritius MP Morocco MO Mozambique MZ Namibia WA Niger NG Nigeria NI Reunion ...

288

Ecloud in PS2, PS+, SPS+  

E-Print Network (OSTI)

We present a preliminary but broad assessment of the ecloud build-up for the various proposed upgrades of the LHC and its injectors. The study pertains only to the ecloud in bending dipole magnets, and does not shed any light on the effects of the electrons on the beam. We focus on the ecloud heat load, although we have computed many other quantities of interest. The basic variable used to classify our results is the bunch spacing tb, whose values are 12.5, 25, 50 and 75 ns. The ecloud heat load follows an inverse relation to tb both for the LHC and for the injectors, with tb = 12.5 ns being by far the least favorable case. Although tb = 75 ns is the most favorable case, the 50-ns option comes closely behind. A simulated comparison of copper vs. stainless steel shows a clear advantage of the former over the latter. Somewhat surprisingly, a comparison of gaussian vs. flat longitudinal bunch profile does not show a clear winner, at least for the LHC at tb = 50 ns. We describe the strengths and limitations of ou...

Furman, M A

2007-01-01T23:59:59.000Z

289

Summary of Input to DOE Request for Information DE-PS36-08GO38002 (Presentation)  

NLE Websites -- All DOE Office Websites (Extended Search)

Input to Input to DOE Request for Information DE-PS36-08GO38002 David Peterson Golden Field Office Department of Energy Fuel Cell Pre-Solicitation Workshop January 23, 2008 2 Purpose * Release date: 11/20/07; Close date: 1/14/08 * Obtain feedback from the fuel cell community. * Planned Funding Opportunity Announcement for RD&D of fuel cell technologies for automotive, stationary, portable power and early market applications * Tentative Release: Spring '08 * Tentative Awards Made: FY09 3 Response Areas * Technical topic areas * Catalysts (durability and reduced loading) and supports. * Catalyst layer. * Water management. * Membrane electrode assembly (MEA) optimization. * Accelerated durability testing. * Balance of plant component development. * Impurity effects.

290

Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester

2012-07-01T23:59:59.000Z

291

T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab

2012-02-11T23:59:59.000Z

292

PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos

2008-06-27T23:59:59.000Z

293

LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance

294

Available at URL ftp://ftp.cs.dartmouth.edu/TR/TR97-306.ps.Z AGDB: A Debugger for Agent Tcl  

E-Print Network (OSTI)

Available at URL ftp://ftp.cs.dartmouth.edu/TR/TR97-306.ps.Z AGDB: A Debugger for Agent Tcl Melissa, dfkg@dartmouth.edu Technical Report PCS-TR97-306 February 4, 1997 Abstract The Agent Tcl language is an extension of Tcl/Tk that supports distributed programming in the form of transportable agents. AGDB

295

Available at URL ftp://ftp.cs.dartmouth.edu/TR/TR97306.ps.Z AGDB: A Debugger for Agent Tcl  

E-Print Network (OSTI)

Available at URL ftp://ftp.cs.dartmouth.edu/TR/TR97­306.ps.Z AGDB: A Debugger for Agent Tcl Melissa, dfkg@dartmouth.edu Technical Report PCS­TR97­306 February 4, 1997 Abstract The Agent Tcl language is an extension of Tcl/Tk that supports distributed programming in the form of transportable agents. AGDB

296

Proposal for the award of a contract for the supply of pole-face windings for the Ps main magnets  

E-Print Network (OSTI)

This document concerns the award of a contract for the supply of 244 pole-face windings for the PS main magnets. Following a market survey carried out among 58 firms in twelve Member States, a call for tenders (IT-3277/AT) was sent on 25 March 2004 to eight firms in seven Member States. By the closing date, CERN had received three tenders from three firms in three Member States. The Finance Committee is invited to agree to the negotiation of a contract with SIGMAPHI (FR), the lowest bidder, for the supply of 244 pole-face windings for a total amount of 1 122 268 euros (1 753 544 Swiss francs), not subject to revision, with an option for up to 240 additional pole-face windings for an amount not exceeding 1 101 299 euros (1 720 780 Swiss francs), not subject to revision, bringing the total amount to 2 223 567 euros (3 474 324 Swiss francs), not subject to revision. The firm has indicated the following distribution by country of the contract value covered by this adjudication proposal: FR - 98%; IT - 2%.

2004-01-01T23:59:59.000Z

297

Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.

2003-12-01T23:59:59.000Z

298

PUBL072.PS  

NLE Websites -- All DOE Office Websites (Extended Search)

5 STAT. 777 PUBLIC LAW 112-72-DEC. 20, 2011 5 STAT. 777 PUBLIC LAW 112-72-DEC. 20, 2011 Public Law 112-72 112th Congress An Act To further allocate and expand the availability of hydroelectric power generated at Hoover Dam, and for other purposes. Be it enacted by the Senate and House of Representatives of the United States of America in Congress assembled, SECTION 1. SHORT TITLE. This Act may be cited as the ''Hoover Power Allocation Act of 2011''. SEC. 2. ALLOCATION OF CONTRACTS FOR POWER. (a) SCHEDULE A POWER.-Section 105(a)(1)(A) of the Hoover Power Plant Act of 1984 (43 U.S.C. 619a(a)(1)(A)) is amended- (1) by striking ''renewal''; (2) by striking ''June 1, 1987'' and inserting ''October 1, 2017''; and (3) by striking Schedule A and inserting the following: ''Schedule A Long-term Schedule A contingent capacity and associated firm energy for offers of contracts to

299

141.ps - Optimization Online  

E-Print Network (OSTI)

[19] M. W. Trosset, The krigi er: A procedure for generating pseudorandom non- ... [1] M. Avriel, Nonlinear Programming: Analysis and Methods, Prentice-Hall, En-

300

311.ps.gz  

E-Print Network (OSTI)

To describe this combined approach, let be a simple domain, preferably a cube like ...... terminates after 1 cycle, that is, system (4.4) is solved in Step 2 up to the ...

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

390.ps.gz  

E-Print Network (OSTI)

Oct 10, 2001 ... number of separable odd-cycle inequalities) by adding edges with weight 0 does not improve. the relaxation [3]. This is not true in combination ...

302

801.ps.gz  

E-Print Network (OSTI)

Dec 18, 2003 ... energy loss = 9.9 eV, convergence cone = 0.2 mrad, longitudinal .... Parallel Optimization: Theory, Algorithms, and ... Nuclear Science 42,.

303

1858.ps.gz  

E-Print Network (OSTI)

digraphs with two stripes. Discrete Mathematics, 176(1-3), 233–254, 1997. [27] Q. Zhao, S.E. Karisch, F. Rendl, and H. Wolkowicz. Semidefinite Programming ...

304

936.ps - Optimization Online  

E-Print Network (OSTI)

Aug 16, 2004 ... Analysis of the computed solution for the Pennsylvania - New Jersey ... R82873101-0, and by the Mathematical, Information, and Computational Sciences .... day-ahead, hourly-ahead, and spot energy markets with an hourly ...

305

427872_PS3054.indd  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

31, 2010 31, 2010 U.S. Department of Energy Office of Electricity Delivery and Energy Reliability 1000 Independence Avenue, SW., Room 8H033 Washington, DC 20585 smartgridpolicy@hq.doe.gov Reference: "Smart Grid RFI: Addressing Policy and Logistical Challenges" Thank you for the opportunity to submit information to help with Smart Grid implementation in the United States. We strongly support the DOE effort to encourage the development of an interoperable Smart Grid. We see significant benefits for consumers, the economy and the environment. The request for information indicates "The Department of Energy is seeking comments on policy and logistical challenges that confront smart grid implementation, as well as recommendations on how to best overcome those challenges".

306

562.ps.gz  

E-Print Network (OSTI)

Following common usage in the interior-point literature, if a vector is denoted ...... T.P. 515, Atomic Energy Research Establishment, Harwell, England, 1973. 37.

307

275.ps.gz  

E-Print Network (OSTI)

de ections in the search directions which ensure that the total step points towards ... based, however, on infeasible algorithms [5, 10, 19, 22] which may enter and .... term. P. i2I. ln(si ) in the merit function (2:4). In section 6 we show that a trust ...

308

399.ps - Optimization Online  

E-Print Network (OSTI)

Nov 2, 2001 ... Wright-Patterson Air Force Base, Ohio, 1965), pages. 205{224. Academic Press, New York, 1967. [11] P. A. Parrilo. Semide nite programming ...

309

1129.ps - Optimization Online  

E-Print Network (OSTI)

integrate ACCPM with branch-and-price algorithm and implement it for ..... pV z). or. dz = Qz1=2 (pQz1=2 V Qz1=2 + I) 1 (e pQ z1=2 V z). An advantage of using ...

310

933.ps - Optimization Online  

E-Print Network (OSTI)

Aug 30, 2004 ... optimization problem on a ner grid (see Griewank and Toint, 1982, Banks, Gill and .... clear that n is typically large, since it usually grows as some power of the ...... extensions to be possible and the resulting algorithms to be of ...

311

305.ps.gz  

E-Print Network (OSTI)

An extension of the re nement concept to the. sequential ..... The computational cost for a xed error reduction should remain propor-. tional to the ..... powers of two [8]. .... Binder T., Blank L., Dahmen W., Marquardt W.: Grid Re nement in Multi -.

312

PS-Prep  

Science Conference Proceedings (OSTI)

... improve their emergency preparedness for disasters. ... in bolstering our disaster preparedness and response capabilities,” Napolitano ...

2010-12-01T23:59:59.000Z

313

329.ps - Optimization Online  

E-Print Network (OSTI)

In [4] it is shown that we can reformulate problem (1) as the copositive programming problem. p := min fhQ; Xi : hEn;Xi = 1; X 2 Cng : (3). Problem (3) is called a ...

314

661.ps.gz  

E-Print Network (OSTI)

negativity requirement s; > 0 and produces negligible progress toward the ... system (2.3) reveals that if H1 does not depend on z1, then neither does the step.

315

540.ps.gz  

E-Print Network (OSTI)

Rn+1 ? R and the injection from R n to Rn+1 which sends every vector p to .... as well as on its integration into modern algorithms for global optimization like [5].

316

1571.ps - Optimization Online  

E-Print Network (OSTI)

Jan 29, 2007 ... Shapiro and Fan. [39] and Shapiro [37] ..... authors [8, 9, 18, 44] to design smoothing Newton methods for solving SDP problems (1). and (2).

317

640.ps - Optimization Online  

E-Print Network (OSTI)

one nonzero entry of 1 in each row and column, and Z is the subgroup of ... Von Neumann's characterization follows by considering the standard Cartan.

318

1193.ps.gz  

E-Print Network (OSTI)

As a consequence of the increasing demand for cars that are more comfortable and. safer ..... a topology design which has its vibratory response (the measured ...

319

334.ps - Optimization Online  

E-Print Network (OSTI)

hydro power, cogeneration, fossil fuels, urban waste incineration, and im- ..... CAR. 0:5. 0:7. (80 : 80). 40. 2:0. 0:5. 1:5. household propane. HLP. 0:4. 0:6. (5 : 5)

320

837.ps.gz  

E-Print Network (OSTI)

253.4. 1536. 277,277,242. 107.9 (7.0). 1263. 396,339,296. 62.0 (13.5). gpp20× 50. 262.4. 2030. 512,491,39. 179.7 (9.4). 1379. 566,461. 112.3 (10.9). gpp25×40.

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

401.ps.gz  

E-Print Network (OSTI)

Aug 23, 2001 ... 2030. 57. 1485. 2125. 40. 1579. 2219. 44. 1673. 2313. 46. 1769. 2409. 45. 1865. 2505. 51. 1960. 2600. 50. 2052. 2692. 52. 2145. 2785. 47.

322

804.ps - Optimization Online  

E-Print Network (OSTI)

Dec 22, 2003... Science, U.S. Department of Energy, under Contract W-31-109-ENG-38. ... denotes a con dence threshold of sustainable loss, the CVaR and ...

323

PUBL072.PS  

NLE Websites -- All DOE Office Websites (Extended Search)

20, 2011 Public Law 112-72 112th Congress An Act To further allocate and expand the availability of hydroelectric power generated at Hoover Dam, and for other purposes. Be it...

324

1039.ps.gz  

E-Print Network (OSTI)

Transmission capacity at a link is provided by the installation of fibers and Wavelength. Division ... out due to the unlimited availability of wavelength converters.

325

1096.ps.gz  

E-Print Network (OSTI)

colors used, in an optical network the number and availability of wavelengths (= colors). *Zuse Institute ... provided by the switching and transmission equipment.

326

987.ps.gz  

E-Print Network (OSTI)

If Cj > dj, the job is said to be tardy and the tardiness is penalized by the cost. ?jTj where Tj = max{0,Cj ... This computational analysis was particularly motivated ...

327

581.ps.gz  

E-Print Network (OSTI)

models are estimated from noisy data and as such subject to statistical and ...... the indices is low, 25%, making the benchmark tracking a real challenge. Table 1

328

1143.ps.gz  

E-Print Network (OSTI)

3. Even with an appropriate criteria function, there is another inherent challenge in clustering { the. problem of allocating the data points to optimize the objective ...

329

262.ps - Optimization Online  

E-Print Network (OSTI)

communications, and we describe applications in filter design and system identification. Autocorrelation ... more efficient interior-point methods for handling autocorrelation sequences. F or a ...... e?? resentine? s ? ectral ¿ ash? constraints.

330

653.ps - Optimization Online  

E-Print Network (OSTI)

Let X be a complete metric space, f : X ! R [f+1g be a lower semicontinuous function, ... su cient condition for the existence of such global error bounds, in terms of ...

331

1018.ps.gz  

E-Print Network (OSTI)

real world applications like stochastic forestry problems, oil refinery. problems, flap settings of aircraft, pilot ... The computational costs. increase with decreasing  ...

332

596.ps - Optimization Online  

E-Print Network (OSTI)

Department of Mathematics, National University of Singapore, 2 Science ...... [6] B . Borchers, SDPLIB 1.2, a library of semide nite programming test problems,.

333

368.ps.Z  

E-Print Network (OSTI)

Aug 22, 2001 ... Department of Mathematics, National University of Singapore, 10 Kent Ridge Crescent, .... problems from the SDPLIB and DIMACS libraries.

334

237.ps.gz  

E-Print Network (OSTI)

Energy, under Contract W-31-109-Eng-38, and by the National Science ...... where Dc and hc are constants, and g0 is the gravitational force at the earth's ...

335

451.ps - Optimization Online  

E-Print Network (OSTI)

E-mail address, C.C. Ribeiro: celso@inf.puc-rio.br. (F. Glover) Leeds School of Business, University of Colorado at Boulder, Boulder,. CO 80309-0419, United ...

336

395.ps.gz  

E-Print Network (OSTI)

zResearch up to version 1.02 performed at Communications Research ...... Institute of Technology, 2-12-1 Oh-Okayama, Meguro-ku, Tokyo 152, Japan, 1998.

337

1110.ps - Optimization Online  

E-Print Network (OSTI)

In this paper, we use semi-definite and second-order cone programming to propose an ... To see why, we simulate the project performance under normally distributed ... It helps the project manager identify and monitor activities that ...... path from the start node s to end node t measures the time to complete the project

338

552.ps.Z  

E-Print Network (OSTI)

techniques are available to us in this framework and therefore, they are not intrinsically .... One can immediately compute the Legendre transformation of : ..... These data de ne .... Clearly, the last expression is always nonnegative. ...... A. \\

339

346.ps.gz  

E-Print Network (OSTI)

center requires an amount of operations independent on the particular data set. ... dent of the particular data set. ..... the solution x? of this problem always exists. ..... techniques previously devised, we choose a point x ? intK, and we transform.

340

713.ps - Optimization Online  

E-Print Network (OSTI)

Aug 5, 2003 ... Research supported in part by CDCHT-UCLA, Venezuela; also supported. in part by a Discovery Grant from NSERC and a PREA of the third ...

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

482.ps - Optimization Online  

E-Print Network (OSTI)

May 26, 2002 ... gradient techniques is the method of Car and Parrinello [6] that also shares ...... subject to electric elds produced by atomic nuclei, like atoms, ...

342

1093.ps.gz  

E-Print Network (OSTI)

technique is very effective in saving the computation time and the memory space ...... Since Coleman [7], we know that a lower bound of the ground-state energy.

343

1028.ps.gz  

E-Print Network (OSTI)

Dec 23, 2004 ... zIP = min x?PI. c x,. (2) where c ? Qn is a vector defining the objective function. The case in which all variables are continuous (p = 0) is called ...

344

1354.ps.gz  

E-Print Network (OSTI)

Proof. Let P be the polyhedron on the right-hand side of the statement. above. From Propositions 7 and 9 we know already that. P ? ZIp,q = O= p,q(Sq) ? ZIp,q.

345

397.ps - Optimization Online  

E-Print Network (OSTI)

I ?(x) = {RQ G IR nTS n s.t.UQ = VW1YX (x),`V GaG ÿ£) (21 (x))} ...... to t h e end o f testing, in t h e b ac k trac k ing strateg y , a merit f unction wh ic h e xh i b its.

346

427.ps.gz  

E-Print Network (OSTI)

High Performance Computing for Engineered Systems, Singapore-MIT Alliance, 4 Engineering Drive. 3, Singapore 117576. E-mail: smazgl@nus.edu.sg.

347

1459.ps - Optimization Online  

E-Print Network (OSTI)

tion problem, the goals are to compute the modification without much. additional cost and to keep A + E well-conditioned and close to A. Gill, Murray and Wright introduced a ... ment of Energy Grant DEFG0204ER25655. 1 ...... matrices with. an application to condition estimation. SIAM J. Numer. Anal., 17:403–409,. 1980. 42.

348

448.ps.gz  

E-Print Network (OSTI)

Feb 22, 2002 ... Definition 2.8 The ice cream cone with parameter ? > 0, denoted ice(?), ...... since the method may then be used as a preliminary phase for ...

349

981.ps - Optimization Online  

E-Print Network (OSTI)

Oct 17, 2004 ... Let Qn+1 indicate a second-order cone (Lor?tz cone, ice-cream ...... On Anstreicher's combined phase i–phase ii projective algorithm for linear.

350

480.ps.gz  

E-Print Network (OSTI)

m n such that rank(A) = m (this will be assumed throughout the paper) be given. Consider the ..... The system of equations Ad = 0 can be written as A ...... [3] A. Bj orner, M. Las Vergnas, B. Sturmfels, N. White and G. Ziegler, Oriented matroids,.

351

1061.ps.gz  

E-Print Network (OSTI)

computational scheme in terms of serial efficiency and numerical robustness. ... a nonbasic variable xq with negative reduced cost is chosen to enter the. basis. ...... potential for parallelising the search for singletons in the triangularisation.

352

439.ps - Optimization Online  

E-Print Network (OSTI)

Feb 6, 2002 ... tarity problem (SDCP) and showed some properties under suitable. assumptions. Yamashita and Fukushima also presented other proper-. ties.

353

243.ps - Optimization Online  

E-Print Network (OSTI)

The lifting order is the following. Let r 2 M. C. i. 0. be such that a rn r = minfa sns : s 6= i. 0g (in. case of a tie, break it arbitrarily). We then pick, in any order, all the ...

354

1052.ps - Optimization Online  

E-Print Network (OSTI)

a natural approach of formulating problems where it is necessary to simultaneously. optimize the system ... deign of gas or water transmission networks. ..... region of the linear programming relaxation is compressed because of the decrease.

355

724.ps - Optimization Online  

E-Print Network (OSTI)

Sep 9, 2003 ... distance between a client and the facility to which it is assigned (capacitated ...... It was a multi-user system and cpu time that the server is.

356

469.ps - Optimization Online  

E-Print Network (OSTI)

Apr 21, 2002 ... weaker properties, and the weak convergence for Eggermont method. was obtained ..... The link between that class and some known. methods ...

357

1007.ps.gz  

E-Print Network (OSTI)

Dec 1, 2004 ... tive function to guide its search strategy. .... strategy exploiting the surrogate to determine S0 is presented in §4.4). Set p0 ...... maintenance.

358

420.ps - Optimization Online  

E-Print Network (OSTI)

Dec 14, 2001... uses BCP, a state of the art Branch-Cut-Price framework designed ...... Lagrangian relaxation and cutting-planes, COAL Bull, 21 (1992),. pp.

359

1223.ps - Optimization Online  

E-Print Network (OSTI)

marine. 15. 16. 15. 16. 15. 16. 15. 16. 29. 30. methanol. 15. 19. 19. 23. 19. 23 .... updating rule, the power of Newton's method applied to an augmented primal- ...

360

tel-00007388.ps - HAL  

E-Print Network (OSTI)

Nous donnons deux preuves de ce r esultat : une preuve formelle bas ee sur la ... car bas ee sur la notion de d eriv ee d'un vecteur de s eries formelles multivari ...

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

477.ps - Optimization Online  

E-Print Network (OSTI)

lems can be solved efficiently by commercial software. However, this .... etc. as building. blocks in their ...... Finding a feasible point of a max-min system is a non-

362

1005.ps.gz  

E-Print Network (OSTI)

assignment, while dimensioning was considered less frequently. To incorporate all three. 1Zuse Institute Berlin (ZIB), Takustraße 7, D–14195 Berlin, Germany.

363

1256.ps.gz  

E-Print Network (OSTI)

Takustraße 7. D-14195 Berlin-Dahlem. Germany. Konrad-Zuse-Zentrum. f¨ur Informationstechnik Berlin. ARIE M.C.A. KOSTER. ANNEGRET K. WAGLER.

364

568.ps - Optimization Online  

E-Print Network (OSTI)

was implemented in the interactive system for universal functional optimization UFO. Results of extensive numerical experiments are reported. Keywords.

365

643.ps - Optimization Online  

E-Print Network (OSTI)

Apr 23, 2003 ... richard@cs.colorado.edu. This author was supported by Air Force O ce of Scienti c Research. grant F49620-00-1-0162, and Army Research O ...

366

1093.ps - Optimization Online  

E-Print Network (OSTI)

The Semidefinite Program (SDP) is a fundamental problem in mathematical .... SDPs arising from quantum chemistry [11, 24] and polynomial optimization [17, 19], ...... R. Saigal and L. Vandenberghe, Handbook of Semidefinite Programming ,.

367

382.ps - Optimization Online  

E-Print Network (OSTI)

... Houston, Texas 77005, USA. e-mail: yzhang@caam.rice.edu. This author was supported in part by DOE Grant DE-FG03-97ER25331, DOE/LANL Con-.

368

341.ps.gz  

E-Print Network (OSTI)

Jun 1, 2001 ... This author was supported in part by DOE Grant DE-FG03-97ER25331, DOE/ LANL Contract 03891-99-23. and NSF Grant DMS-9973339.

369

304.ps - Optimization Online  

E-Print Network (OSTI)

Thermal insulation systems use heat intercepts to minimize the heat ow from a hot to. a cold surface. In Figure 1, the cooling temperature T i is a control imposed  ...

370

438.ps.gz  

E-Print Network (OSTI)

the trigonometric functions, the functions exp, log are basic functions. ..... straint Programming: basics and trends, volume 910 of Lecture Notes in Computer.

371

921.ps - Optimization Online  

E-Print Network (OSTI)

one problem that can be solved by inspection and another that reduces to the .... 1979. 38. Lawrence V. Snyder. A note on the robust international sourcing ...

372

797.ps - Optimization Online  

E-Print Network (OSTI)

2 by inspection of Figure 2.2. The set C is bounded, ...... 1979.). [11] M.L. Minsky and S.A. Papert. Perceptrons. MIT Press, 1969. [12] T. Motzkin and I.Y. Sch ...

373

1736.ps.gz  

E-Print Network (OSTI)

neered by Lovász (1979) in 1979 in order to compute the Shannon capacity of a ..... We note that for the grid_2D instances we can find a solution by inspection.

374

1545.ps.gz  

E-Print Network (OSTI)

We study ad hoc wireless sensor networks and the sensor network ...... the first r coordinates by Pr, then the resulting operation on the locations in the. rows of ˆP

375

459.ps - Optimization Online  

E-Print Network (OSTI)

Mar 19, 2002 ... partment of Energy, under Contract W-31-109-Eng-38. References ... nology, New Mexico Tech, Socorro, NM, USA, July 1998. [7] S. Burer and ...

376

330.ps - Optimization Online  

E-Print Network (OSTI)

May 24, 2001 ... or performance of a nuclear reactor core after the re-loading ...... and Corliss, G.F.

377

Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available

2011-10-01T23:59:59.000Z

378

PROCEEDINGS OF THE LAKE MALAWI FISHERIES  

E-Print Network (OSTI)

standards. The nature of the various environmental considerations will have to depend on the nature and circumstances under which the certificates can be withdrawn, and oblige researchers to follow a set standard

379

Observation of coupled vortex gyrations by 70-ps-time and 20-nm-space- resolved full-field magnetic transmission soft x-ray microscopy  

SciTech Connect

We employed time-and space-resolved full-field magnetic transmission soft x-ray microscopy to observe vortex-core gyrations in a pair of dipolar-coupled vortex-state Permalloy (Ni{sub 80}Fe{sub 20}) disks. The 70 ps temporal and 20 nm spatial resolution of the microscope enabled us to simultaneously measure vortex gyrations in both disks and to resolve the phases and amplitudes of both vortex-core positions. We observed their correlation for a specific vortex-state configuration. This work provides a robust and direct method of studying vortex gyrations in dipolar-coupled vortex oscillators.

Jung, Hyunsung; Yu, Young-Sang; Lee, Ki-Suk; Im, Mi-Young; Fischer, Peter; Bocklage, Lars; Vogel, Andreas; Bolte, Markus; Meier, Guido; Kim, Sang-Koog

2010-09-01T23:59:59.000Z

380

Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 – 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.

2006-08-29T23:59:59.000Z

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: © 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan

2008-01-01T23:59:59.000Z

382

Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-

2009-01-01T23:59:59.000Z

383

Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI

2012-06-01T23:59:59.000Z

384

Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah

2011-04-21T23:59:59.000Z

385

A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.

2008-06-01T23:59:59.000Z

386

Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan

2008-09-30T23:59:59.000Z

387

ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

linear system of equations (1) has a unique solution c, i.e., there is. a unique polynomial P(x) which interpolates the data set S. The same argument applies to  ...

388

ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

Area: 1.875000000. ?0.2. 0. 0.2. 0.4 ... Area: 1.425000000. ?0.2. 0. 0.2. 0.4 ..... j= 1. f(xj)?? ?. b ? a. 12. h. 2. f (?),. a51 ...

389

MOSAIC_PI.ps - CECM  

E-Print Network (OSTI)

that the circular area is to. the quadrant of the circum-. ference, as the area of an equi- ..... for error checking. For algebraic log( ) has the. same complexity. 51 ...

390

ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

The reduction is done via elementary row operations; ... Type 3: replacing a row by the same row plus a constant ..... standard agreement on this terminology.

391

anno_bib.ps - CECM  

E-Print Network (OSTI)

n(a) becomes relatively close tos n, in the weak sense. that there is an ..... In particular the ergodic sets link together to give nitely many projective systems, each.

392

ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

with various rates of convergence (those authors found the N = 3 case especially. di cult, with ...... (2 l) for any l 2 and B(p j ) = p Nj (p j ) for any j 1 and. odd prime ...

393

NONPROFIT ORG DETROIT, MI  

E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor

394

Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use

395

Bragg diffraction using a 100ps 17.5 keV x-ray backlighter and the Bragg Diffraction Imager  

Science Conference Proceedings (OSTI)

A new diagnostic for measuring Bragg diffraction from a laser-driven crystal using a 100ps 17.5 kV x-ray backlighter source is designed and tested successfully at the Omega EP laser facility on static Mo and Ta single crystal samples using a Mo Ka backlighter. The Bragg Diffraction Imager (BDI) consists of a heavily shielded enclosure and a precisely positioned beam block, attached to the main enclosure by an Aluminum arm. Image plate is used as the x-ray detector. The diffraction lines from Mo and Ta planes are clearly detected with a high signal-to-noise using the 17.5 keV and 19.6 keV characteristic lines generated by a petawatt-driven Mo foil. This technique will be applied to shock and ramp-loaded single crystals on the Omega EP laser. Pulsed x-ray diffraction of shock- and ramp-compressed materials is an exciting new technique that can give insight into the dynamic behavior of materials at ultra-high pressure not achievable by any other means to date. X-ray diffraction can be used to determine not only the phase and compression of the lattice at high pressure, but by probing the lattice compression on a timescale equal to the 3D relaxation time of the material, information about dislocation mechanics, including dislocation multiplication rate and velocity, can also be derived. Both Bragg, or reflection, and Laue, or transmission, diffraction have been developed for shock-loaded low-Z crystalline structures such as Cu, Fe, and Si using nano-second scale low-energy implosion and He-{alpha} x-ray backlighters. However, higher-Z materials require higher x-ray probe energies to penetrate the samples, such as in Laue, or probe deep enough into the target, as in the case of Bragg diffraction. Petawatt laser-generated K{alpha} x-ray backlighters have been developed for use in high-energy radiography of dense targets and other HED applications requiring picosecond-scale burst of hard x-rays. While short pulse lasers are very efficient at producing high-energy x-rays, the characteristic x-rays produced in these thin foil targets are superimposed on a broad bremsstrahlung background and can easily saturate a detector if careful diagnostic shielding and experimental geometry are not implemented. A new diagnostic has been designed to measure Bragg diffraction from laser-driven crystal targets using characteristic x-rays from a short-pulse laser backlighter on the Omega EP laser. The Bragg Diffraction Imager, or BDI, is a TIM-mounted instrument consisting of a heavily shielded enclosure made from 3/8-inch thick Heavymet (W-Fe-Ni alloy) and a precisely positioned beam bock, attached to the main enclosure by an Aluminum arm. The beam block is made of 1-inch thick, Al-coated Heavymet and serves to block the x-rays directly from the petawatt backlight, while allowing the diffraction x-rays from the crystal to pass to the enclosure. A schematic of the BDI is shown in Fig. 1a. Image plates are used as the x-ray detector and are loaded through the top of the diagnostic in an Aluminum, light-tight cartridge. The front of the enclosure can be fitted with various filters to maximize the diffraction signal-to-noise.

Maddox, B R; Park, H; Hawreliak, J; Comley, A; Elsholz, A; Van Maren, R; Remington, B A; Wark, J

2010-05-13T23:59:59.000Z

396

Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.

397

The Yao Muslims : religion and social change in southern Malawi  

E-Print Network (OSTI)

the pax Britannica, as the British Central Africa Gazette reported: "The Yao seem to be taking heartily now to service in the Armed Forces of the Protectorate -a change as sudden and remarkable as may be seen amongst the border tribes of India, where... the road to Mangochi passes through Zomba and then winds steeply down from the Shire...

Thorold, Alan Peter Hereward

1995-01-01T23:59:59.000Z

398

Malawi-Enhancing Capacity for Low Emission Development Strategies...  

Open Energy Info (EERE)

of November 2012, the U.S is working with more than 20 countries as part of the EC-LEDS program. The U.S. has established joint EC-LEDS work programs with 13 countries, including...

399

A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada

2005-09-01T23:59:59.000Z

400

ERDOS.ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

1. 4. Z. S. v( ; x)dx. where dx is area measure on S. .... Erd}os, P., & P. Tur an, On the distribution of. roots of polynomials, Ann. of Math. 51. (1950), 105{119.

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

833.ps.gz - Optimization Online  

E-Print Network (OSTI)

sphong@cau.ac.kr). Research of this author was performed while visiting ...... SIAM J. Discrete Mathematics. 3 (1990) 411{430. [28] H. D. Sherali and W. P. ...

402

541.ps.gz - Optimization Online  

E-Print Network (OSTI)

semide nite programming formulation for the relaxation of (37): min. hQ; Xi. subject to Diag(X) ...... We proceed with the organization of this section. In Subsection ...

403

Voluntary Product Standard PS 1-07  

Science Conference Proceedings (OSTI)

... plies. 2.26 Jointed inner plies Crossband and center veneers with edges machine-squared to permit tightest possible layup. ...

2011-07-27T23:59:59.000Z

404

C4PS: colors for privacy settings  

Science Conference Proceedings (OSTI)

The ever increasing popularity of Facebook and other Online Social Networks has left a wealth of personal and private data on the web, aggregated and readily accessible for broad and automatic retrieval. Protection from both undesired recipients and ... Keywords: access control, online social networks, privacy

Thomas Paul; Martin Stopczynski; Daniel Puscher; Melanie Volkamer; Thorsten Strufe

2012-04-01T23:59:59.000Z

405

309.ps.gz - Optimization Online  

E-Print Network (OSTI)

by an electric utility. ... package), includes additional features to the above list. ... The di erent functions of the model (e.g., covering of the load demand as a ...

406

626.ps.gz - Optimization Online  

E-Print Network (OSTI)

the set AC is not closed ß there is a point in outer(AC) which can be strictly separated by a ...... The world of M*K* and its related sets is depicted in ¥ igure1in the ...

407

BOG.ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

nologically, in a mathematical world. More. so than most of ... \\I think there is a world market for about ... 9C381872D27596F81D0E48B95A6C46 (ac-. tually 100  ...

408

COGNOS.ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

nologically, in a mathematical world. More. so than most of ... \\I think there is a world market for about .... 9C381872D27596F81D0E48B95A6C46 (ac-. tually 100 ...

409

ps file - CECM - Simon Fraser University  

E-Print Network (OSTI)

The Joint Institute of Nuclear Research, Dubna, Russia,. September 1998. ? Communication-oriented representation of mathematical objects. Monthly seminar ...

410

330.ps.Z - Optimization Online  

E-Print Network (OSTI)

May 24, 2001 ... tion of ow through a pipe is modeled by a disjunction. ...... ing, S.T., Klepeis, J.L., Meyer, C.A. and Schweiger, C.A. Handbook of Test Problems.

411

OFC Commercial Analysis 20140402 v3 PS  

• Landfill"biogas18" • Glass"industry19" • Steel"industry20" • NonUferrous"furnaces21" • Refineries22" • Vegetable"oil/biodiesel23" • BiogasUfuelled ...

412

236.ps.gz - Optimization Online  

E-Print Network (OSTI)

subprogram of the O ce of Advanced Scienti c Computing, U.S. Department of Energy, under Contract ..... As noted in Table 6.1, the op rate for the linear solve component of GPCG is 26 .... library, Report, Colorado School of Mines, 1994.

413

P156.ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

A spectrum is discrete if for any nite interval [a;b] of the real line \\[a; b] ..... was decided that the overhead needed to implement this technique was not justi ed. 4 .

414

486.ps.gz - Optimization Online  

E-Print Network (OSTI)

solver administrators such as maintaining security, providing usage ..... After deciding on the userid and home directory for the Server, installation begins with

415

444.ps.gz - Optimization Online  

E-Print Network (OSTI)

Feb 5, 2002... unveiling of the human genome marked the transition in the bio- ...... analysis of protein folding potentials. To appear in J. Comp. Chem. 16.

416

476.ps.gz - Optimization Online  

E-Print Network (OSTI)

May 9, 2002 ... the Hessian of the Lagrangian leeds to a similar conclusion. This example shows that it. is not su cient to trigger the elastic mode only when QP ...

417

CP2006.ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

The cost. of the Hessenberg approach is O(n3) arithmetic operations in Zp for ..... Berkowitz algorithm (an extremely rough estimate based on the performance of ...

418

Li S CA EERE 20130405 ps  

weakest!link!in!the!vehicle’s!performance,!durability,!and!cost.!Even!after!decades!of!progress,!lithium9 ... manufacturers! (see!Error!! Reference!

419

3473.ps.gz - Optimization Online  

E-Print Network (OSTI)

May 22, 2012 ... Let Z ? Rn and X ? R be nonempty compact convex sets. Consider the composite function ...... A global minlp optimization algorithm for the synthesis of heat exchanger networks with no stream splits. Computers & Chemical ...

420

Bacteriophage Commercial Analysis EERE 20130521 ps  

electricity"to"rechargea"cell=phone"battery."Or"a"pacemaker"powered,"literally,"by ... Manufacturing"costs ...

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

P162.ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

play a large number of equations by curves;. each curve would have to be drawn by its. points, and ... and teaching and learning. Lately though, forces in.

422

677.ps.gz - Optimization Online  

E-Print Network (OSTI)

˜Cwiƒ‚„€tj˜h{b |S one for each commod£ ity pairs BAS EDS ! an6£ we are as¡¦ e¥£ to satisfy the mahy imX m fraction~} of allj£ eman6£ si i.e. mahyf} s¡ bGt ect ...

423

1857.ps.gz - Optimization Online  

E-Print Network (OSTI)

Key-words: benchmarking – collection of problems – CUTEr – Libopt – Modulopt – ...... Duxbury Press, Brooks/Cole-Thomson Publishing Com-. pany, Pacific ...

424

CPpaper.ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

For a machine prime p, in order to improve the running time of our algorithm, we' ve implemented ... We allow both positive and negative integers of magnitude.

425

lomon05.ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

In order to improve the running time of our algorithm, we've implemented the ... suppose that the entries of A are bounded by Bm in magnitude, that is, they are m  ...

426

REAL.ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

be the most original creation of the human spirit". Whitehead, Alfred North. \\[ Mathematics] is an independent world created. out of pure intelligence." Wordsworth ...

427

P166.ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

Abstract. This paper gives exact rates of quadratic approximations to an .... nj) + : Here is an irrational angled complex number with modulus 1. Thus for any > 0,.

428

285.ps.gz - Optimization Online  

E-Print Network (OSTI)

Feb 27, 2001 ... Working paper, Department of Management Science, University of Iowa, ...... style analysis which estimates an implied asset allocation for an investment fund). ...... such as demand-supply response and enterprise selection.

429

P164.ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

Feb 19, 2001 ... matically increased processor power, almost limitless storage ... to see a line in a proof that begins \\by a large calculation in Maple we see ...".

430

3757.ps.gz - Optimization Online  

E-Print Network (OSTI)

Sep 22, 2013 ... W. H. Freeman, 1979. [32] L. El Ghaoui, M. Oks, ...... infinite constraint (15). An inspection of Theorems 6 and 7 reveals that this implies A = B = 0.

431

705.ps.gz - Optimization Online  

E-Print Network (OSTI)

Aug 8, 2003 ... 0086579 and CCR-0219438 and Department of Energy grant ... yDepartamento de Matem aticas, ITAM, Mexico City. This author was ...

432

593.ps.gz - Optimization Online  

E-Print Network (OSTI)

form of an semide nite program. ... in the area of statistics, and in engineering elds such as structural design [6, 8] and control theory .... SDP problem, and even if they are, strong duality does not necessarily have to hold. ..... We now describe a scaling procedure which allows us to view the MZ ...... puting, 2:257{267, 1981.

433

Laser damage by ns and sub-ps pulses on hafnia/silica anti-reflection coatings on fused silica double-sided polished using zirconia or ceria and washed with or without an alumina wash step.  

SciTech Connect

Sandia's Large Optics Coating Operation has extensive results of laser induced damage threshold (LIDT) testing of its anti-reflection (AR) and high reflection coatings on substrates pitch polished using ceria and washed in a process that includes an alumina wash step. The purpose of the alumina wash step is to remove residual polishing compound to minimize its role in laser damage. These LIDT tests are for multi longitudinal mode, ns class pulses at 1064 nm and 532 nm (NIF-MEL protocol) and mode locked, sub-ps class pulses at 1054 nm (Sandia measurements), and show reasonably high and adequate laser damage resistance for coatings in the beam trains of Sandia's Z-Backlighter terawatt and petawatt lasers. An AR coating in addition to coatings of our previous reports confirms this with LIDTs of 33.0 J/cm{sup 2} for 3.5 ns pulses and 1.8 J/cm{sup 2} for 350 fs pulses. In this paper, we investigate both ceria and zirconia in doublesided polishing (common for large flat Z-Backlighter laser optics) as they affect LIDTs of an AR coating on fused silica substrates washed with or without the alumina wash step. For these AR coated, double-sided polished surfaces, ceria polishing in general affords better resistance to laser damage than zirconia polishing and laser damage is less likely with the alumina wash step than without it. This is supported by specific results of laser damage tests with 3.5 ns, multi longitudinal mode, single shot pulses at 1064 nm and 532 nm, with 7.0 ns, single and multi longitudinal mode, single and multi shot pulses at 532 nm, and with 350 fs, mode-locked, single shot pulses at 1054 nm.

Bellum, John Curtis; Rambo, Patrick K.; Schwarz, Jens; Kletecka, Damon; Atherton, Briggs W.; Kimmel, Mark W.; Smith, Ian Craig; Smith, Douglas (Plymouth Grating Laboratory, Carver, MA); Hobbs, Zachary (Sydor Optics, Inc., Rochester, NY)

2010-10-01T23:59:59.000Z

434

Pre-Application to PROGRAM SOLICITATION (PS) DE-PS26-02NT15377  

NLE Websites -- All DOE Office Websites (Extended Search)

Production Improvement from Increased Permeability Using Engineered Biochemical Production Improvement from Increased Permeability Using Engineered Biochemical Secondary Recovery Methodology in Marginal Wells of the East Texas Field Final Report Reporting Period Start Date: July 1, 2003 Reporting Period End Date: December 31, 2004 By Dr. R.L. Bassett, President TENECO Energy, LLC and William S. Botto, President MICRO-TES, Inc. Issue Date: April 29, 2005 USDOE Award No. DE-FG26-03NT15440 Submitted by: TENECO Energy, LLC, 3760 Vance St. Suite 200, Wheat Ridge, CO 80033-6275, and MICRO-TES, Inc., 12500 Network, Suite 201, San Antonio, TX 78249-3307 1 DISCLAIMER This report was prepared as an account of work sponsored by an agency of the United State Government. Neither the United States Government nor any agency thereof, nor any of their

435

Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997

436

MI ROPYROLIZER FOR RAPID IOIDENTIFI ATION  

POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...

437

MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The�¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2

438

Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...

439

Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...

440

Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...

442

Kanthu Kali Munye: A Lesson in Listening and Learning in Rural Malawi  

E-Print Network (OSTI)

actor led to my acquisition of data on funding of community-led to the collection of a great deal of data on the funding

Dionne, Kim Yi

2006-01-01T23:59:59.000Z

443

Money, Morals, and Modernity: Making Sense of Same-Sex Sexualities in Malawi  

E-Print Network (OSTI)

Money, Morals, and Modernity: Making Sense of Same-Sexhomosexuality is fundamentally Money, Morals, and Modernity:positions on the trial. Money, Morals, and Modernity: Making

McKay, Tara

2012-01-01T23:59:59.000Z

444

Template:Abengoa Solar PS10 | Open Energy Information  

Open Energy Info (EERE)

the sun's rays on a 40-story tower that houses a receiver where water is heated to steam which is stored and then can be used to drive turbines that then generate...

445

edgardoEJAM04.ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

[2] A.D. Polyanin, V.F. Zaitsev, \\Handbook of Exact Solutions for Ordinary Di ... [12 ] M. Abramowitz and I. A. Stegun, \\Handbook of mathematical functions", Dover ...

446

Microsoft Word - PS-ESH-0088 740 SLM Rev 2  

NLE Websites -- All DOE Office Websites (Extended Search)

8 8 002 Effective: Page 1 of 12 07/29/13 Subject: Laser Safety Program Documentation - 740 C30 SLM 3.1/2g03e011.doc 1 (02/2010) BROOKHAVEN NATIONAL LABORATORY LASER CONTROLLED AREA STANDARD OPERATING PROCEDURE (SOP) This document defines the safety management program for the laser system(s) listed below. All American National Standard Institute (ANSI) Hazard Class 3B and 4 laser systems must be documented, reviewed, and approved through use of this form. Each system must be reviewed annually. Modify the template for this document to fit your particular circumstance. System description: Pico second pulsed laser Location: Building 740, C30 SLM hutch LINE MANAGEMENT RESPONSIBILITIES The Owner/Operator(s) for this laser is/are listed below. The Owner/Operator is the Line Manager of the

447

C4PS - helping facebookers manage their privacy settings  

Science Conference Proceedings (OSTI)

The ever increasing popularity of Online Social Networks has left a wealth of personal data on the web, accessible for broad and automatic retrieval. Protection from undesired recipients and harvesting by crawlers is implemented by access control, manually ...

Thomas Paul; Martin Stopczynski; Daniel Puscher; Melanie Volkamer; Thorsten Strufe

2012-12-01T23:59:59.000Z

448

Injection Phenomena in the PS Converter - The Teachings of J ...  

Science Conference Proceedings (OSTI)

blockage and punching); the concept of “high pressure” or sonic injection including a review of the ... to the representatives of the technology suppliers as well as.

449

hare1MSW02.ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

algorithm does not work. If this is the case, simply add the semi-inner product to a standard ..... userinfo(2, 'LLLPoly', "Using Gram-Schmitd on row "||i||" of "||dim);.

450

Employment of PS Template in the Surface Modification  

Science Conference Proceedings (OSTI)

Abstract Scope, In order to improve the performance of wide bandgap semiconductor such as TiO2 or ZnO, a variety of micro-grids were deposited ...

451

edgardoHeun.ps.old - CECM - Simon Fraser University  

E-Print Network (OSTI)

[17] A.D. Polyanin, V.F. Zaitsev, \\Handbook of Exact Solutions for Ordinary Di ... [ 24] M. Abramowitz and I. A. Stegun, \\Handbook of mathematical functions", ...

452

roche.ps.old - CECM - Simon Fraser University  

E-Print Network (OSTI)

invariant polynomials required a fundamental assumption: Assumption 1. .... [13] Polyanin, A. D. & Zaitsev, V. F. 1995 Handbook of Exact Solutions for Ordinary.

453

hare2MSW02.ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

This research is part of the MITACS Symbolic Analysis Project and is based ... in the event that the decimal expansion of a number is known to greater accuracy.

454

gregMSW02.ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

We can always increase the precision to overcome the ill-conditioning, but a ..... The memory space complexity of the standard methods is O(Nn). oating point ...

455

edgardo2MSW02.ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

Regarding what "type" of information request is targeted by this project, our idea is to ... Move away from the concept of a help facility and implement the function ...

456

GenericLA.ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

In contrast,. Maple's facilities for linear algebra in its LinearAlgebra package only ... fields in Maple, we have designed a simple to use facility that permits the.

457

CURSO DE PS-GRADUAO EM SENSORIAMENTO REMOTO Coordenador Acadmico  

E-Print Network (OSTI)

actividades de minería ilegal en la cuenca media del río Caroní, Venezuela. Julio Lezama, Igor Narvaes #12

458

PS Tech Spaces: Electro-Mechanical Assembly Only  

NLE Websites -- All DOE Office Websites (Extended Search)

recycled. Solder areas should be cleaned periodically (lead wipes area available in the stock room). When using knivesrazor blades: * Be aware of hand positioning * Use safety...

459

ogilvieMSW02.ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

classical mechanical system, a lagrangian is the di erence of kinetic energy and ... The algebraic manipulations to simplify the kinetic energy and to employ the ...

460

C ED PS: Getting Your Data Downtown Enabling PETASCALE  

E-Print Network (OSTI)

(ALCF) has based its data management system on the Globus GridFTP software, using it to manage the movement of data to and from the HPSS mass store, the ALCF's high-performance file servers, and external W . O R G Figure 6. The Argonne Leadership Computing Facility (ALCF) has based its data management

Kettimuthu, Rajkumar

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Solar Commercial Analysis EERE 20130410 v2 PS AES  

technology"is"overcoming"the"problem"ofgate"screening.As"a"light"emitting"diode"is"essentially"a" solar"cell"in"reverse" ...

462

3b2_To_Ps_tmp 1..14  

Science Conference Proceedings (OSTI)

... essential to allow the Member States wishing to do so to ... Whereas this Directive does not affect the continued manufacture of products already on ...

2011-11-29T23:59:59.000Z

463

CPpaperCCA.ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

in magnitude where B is the base (usually 231 or 232 on a 32 bit machine) of ... a machine prime p, in order to improve the running time of our implementation, ...

464

Inclusive Cross Sections in ME+PS Merging  

E-Print Network (OSTI)

We discuss an extension of matrix element plus parton shower merging at leading and next-to-leading order. The algorithm does preserve inclusive cross sections at the respective input order. This constraint avoids potentially large logarithmic contributions, which would require approximate (N)NLO contributions to cancel against.

Plätzer, Simon

2013-01-01T23:59:59.000Z

465

Inclusive Cross Sections in ME+PS Merging  

E-Print Network (OSTI)

We discuss an extension of matrix element plus parton shower merging at leading and next-to-leading order. The algorithm does preserve inclusive cross sections at the respective input order. This constraint avoids potentially large logarithmic contributions, which would require approximate (N)NLO contributions to cancel against.

Simon Plätzer

2013-07-02T23:59:59.000Z

466

edgardoIS04.ps - CECM - Simon Fraser University  

E-Print Network (OSTI)

The form of S(F ) is particularly simple when F(x) is a power transformation and also ... Reversing the line of reasoning, through Mobius transformations one can  ...

467

JGI - Why Sequence Cichlid Fish?  

NLE Websites -- All DOE Office Websites (Extended Search)

Cichlid Fish? photo of chichlid fish The sequencing of several Lake Malawi cichlid fish will contribute to major advances in our understanding of evolution in Lake Malawi cichlids....

468

HALON ISSUES IN DEVELOPING COUNTRIES (505) 272 ...  

Science Conference Proceedings (OSTI)

... Brazil Chile Egypt Ghana Jordan Malawi Mexico Phillipines Thailand Tunisia UWWY Zambia ... inventory), Turkey Thailand, ...

2011-10-11T23:59:59.000Z

469

Donors versus dictators : the impact of multilateral aid conditionality on democratization : Kenya and Malawi in comparative context  

E-Print Network (OSTI)

Donors versus Dictators examines the "exporting democracy debate" and the related issue of "nation-building" as manifested in the foreign aid relationship in the post-Cold War era. This dissertation centers on two in-depth ...

Clinkenbeard, Steven E., 1958-

2004-01-01T23:59:59.000Z

470

Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P

2003-01-01T23:59:59.000Z

471

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...

472

Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...

473

A FUNDAMENTAL REAKTHROUGH IN HEAT TRANSFER TE HNOLOGY FOR MI ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy’s National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION

474

MI ROFA RI ATED FIELD ALI RATION ASSEM LY  

Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as

475

MI ROFA RI ATED FIELD ALI RATION ASSEM LY  

Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake

476

Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)

477

Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and… (more)

Yun, Michael

2008-01-01T23:59:59.000Z

478

NEVADA BUREAU OF MINES AND GEOLOGY SPECIAL PUBLICATION MI-1996  

E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.

479

NEVADA BUREAU OF MINES AND GEOLOGY SPECIAL PUBLICATION MI-1994  

E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.

480

Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...

Note: This page contains sample records for the topic "mi malawi ps" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...

482

Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...

483

Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...

484

Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...

485

Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...

486

Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...

487

Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...

488

Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...

489

Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...

490

St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...

491

Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...

492

Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...

493

St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...

494

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...

495

Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...

496

Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...

497

Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...

498

Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...

499

ENERGY SURETY MI ROGRID™ - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment– assists in planning and analysis of potential risks

500

miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha

2012-01-01T23:59:59.000Z