Powered by Deep Web Technologies
Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

MA.+'  

Office of Legacy Management (LM)

MA.+' MA.+' t -@ . ;' OAK RIDGE NATIONAL LABORATORY i OPtRATED BY MARTIN MARIETTA ENERGY SYSTEMS, INC. FOR THE UNITE0 STATES DEPARTMENT OF ENERGY ,,y , - IhI of ORNL/TM-10053 RESULTS OF THE RADIOLOGICAL SURVEY AT THE VENTRON SITE, BEVERLY, MASSACHUSETTS W. D. Cottrell R. F. Carrier -.- _ ..-. - . . . -~~.- ~~- Printed in the United States of America. Available from National Technical Information Service U.S. Department of Commerce 5285 Port Royal Road, Springfield, Virginia 22161 NTIS price codes-Printed Copy: ~06 Microfiche A01 This report was prepared as an account of work sponsored by an agency of the United StatesGovernment. Neither the U nited StatesGovernment nor any agency thereof, nor any of their employees, makes any warranty, express or implied, or

2

Md. Saifur Rahaman Md. Saifur Rahaman  

E-Print Network (OSTI)

of Chemical and Environmental Engineering "Environmental Applications of Nanotechnology" Advisor: ProfMd. Saifur Rahaman Resume 1 Md. Saifur Rahaman Department of Chemical and Environmental Engineering from Wastewater through Struvite Crystallization in a Fluidized Bed Reactor: Kinetics, Hydrodynamics

Elimelech, Menachem

3

Local Restaurants - Gaithersburg, MD  

Science Conference Proceedings (OSTI)

... Subway 16 Bureau Dr. Gaithersburg, MD (301) 527-8988. Thai Tanium 657 Center Point Way Gaithersburg, MD (301) 990-3699. ...

2013-07-25T23:59:59.000Z

4

MA.2  

Office of Legacy Management (LM)

IS .:,I. ;' IS .:,I. ;' MA.2 0 y-AU Mr. M ichael Matt W a tertown Redevelopment Authority 319 Arlington Street W a tertown, Massachusetts 02172 Dear Mr. Matt: The Department of Energy is evaluating the radiological condition of sites that were utilized under the Manhattan Engineer District and/or the Atomic Energy C o m m ission in the early years of nuclear energy development to determine whether they need remedial action and whether the Department has authority to perform such action. As you know from information previously sent to you, portions of the W a tertown Arsenal in W a tertown, Massachusetts, were identified as possible sites. The areas investigated included those areas which were the sites of Buildings 34, 41, and 421 and the GSA site. The enclosed documents, which represent the Department's review of the

5

DOE - Office of Legacy Management -- Beverly MA Site - MA 04  

Office of Legacy Management (LM)

Beverly MA Site - MA 04 Beverly MA Site - MA 04 FUSRAP Considered Sites Beverly, MA Alternate Name(s): Metal Hydrides, Inc. Ventron Corporation MA.04-1 Location: Congress Street, Beverly, Massachusetts MA.04-4 Historical Operations: Provided uranium metal production under contract with MED. Thorium and radium contamination occurred from non-MED operations. MA.04-6 Eligibility Determination: Eligible MA.04-1 Radiological Survey(s): Assessment Survey, Verification Survey MA.04-4 MA.04-7 Site Status: Certified- Certification Basis, Federal Register Notice included MA.04-5 MA.04-6 MA.04-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP Also see Beverly, MA, Site Documents Related to Beverly, MA Beverly Site Aerial Photograph

6

Multiscale FEM-MD schema  

Science Conference Proceedings (OSTI)

... coupling finite element modeling (FEM) to atomistic Molecular Dynamics (MD) 1 ... for using extremely high (very unrealistic) indentation rates that are ...

2013-06-27T23:59:59.000Z

7

L. Lynn Ma | BNL  

NLE Websites -- All DOE Office Websites (Extended Search)

L. Lynn Ma Advanced Applications Engineer Education Xiamen University, B.S., Applied Mathematics Florida Institute of Technology, M.S., Physical Oceanography State University of...

8

Category:Baltimore, MD | Open Energy Information  

Open Energy Info (EERE)

MD MD Jump to: navigation, search Go Back to PV Economics By Location Media in category "Baltimore, MD" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Baltimore MD Baltimore Gas & Electric Co.png SVFullServiceRestauran... 69 KB SVQuickServiceRestaurant Baltimore MD Baltimore Gas & Electric Co.png SVQuickServiceRestaura... 67 KB SVHospital Baltimore MD Baltimore Gas & Electric Co.png SVHospital Baltimore M... 69 KB SVLargeHotel Baltimore MD Baltimore Gas & Electric Co.png SVLargeHotel Baltimore... 69 KB SVLargeOffice Baltimore MD Baltimore Gas & Electric Co.png SVLargeOffice Baltimor... 69 KB SVMediumOffice Baltimore MD Baltimore Gas & Electric Co.png SVMediumOffice Baltimo... 68 KB SVMidriseApartment Baltimore MD Baltimore Gas & Electric Co.png

9

DE-MA0002512  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Award No. 2. Modification No. 3. Effective Date Award No. 2. Modification No. 3. Effective Date 4. CFDA No. DE-MA0002512 03/27/2012 ASSISTANCE AGREEMENT 7. Period of Performance 6. Sponsoring Office 5. Awarded To Other Cooperative Agreement Grant test 10. Purchase Request or Funding Document No. 9. Authority 8. Type of Agreement 11. Remittance Address 12. Total Amount 13. Funds Obligated Govt. Share: $0.00 Cost Share : $0.00 Total : $0.00 This action: $0.00 Total : $0.00 test 14. Principal Investigator 15. Program Manager 16. Administrator test 19. Submit Reports To 18. Paying Office 17. Submit Payment Requests To 20. Accounting and Appropriation Data See Schedule 21. Research Title and/or Description of Project For the Recipient For the United States of America 22. Signature of Person Authorized to Sign

10

WIND DATA REPORT FALMOUTH, MA  

E-Print Network (OSTI)

WIND DATA REPORT FALMOUTH, MA June1, 2004 to August 31, 2004. Prepared for Massachusetts Technology...................................................................................................................... 8 Wind Speed Time Series............................................................................................................. 8 Wind Speed Distributions

Massachusetts at Amherst, University of

11

Discovery and utilization of sorghum genes (Ma5/Ma6)  

DOE Patents (OSTI)

Methods and composition for the production of non-flowering or late flowering sorghum hybrid. For example, in certain aspects methods for use of molecular markers that constitute the Ma5/Ma6 pathway to modulate photoperiod sensitivity are described. The invention allows the production of plants having improved productivity and biomass generation.

Mullet, John E; Rooney, William L; Klein, Patricia E; Morishige, Daryl; Murphy, Rebecca; Brady, Jeff A

2012-11-13T23:59:59.000Z

12

The ma Ni Song 1  

E-Print Network (OSTI)

ba sgrol ma Date of recording November 10th 2009. Place of recording Ci jo Village, Phu ma Township, Sde dge County, Dkar mdzes Tibetan Autonomous Prefecture, Sichuan Province, China. Name(s), age, sex, place of birth of performer(s) Bo...

Zla ba sgrol ma

2009-11-10T23:59:59.000Z

13

NREL: Energy Sciences - Jie Ma  

NLE Websites -- All DOE Office Websites (Extended Search)

Jie Ma Jie Ma Postdoctoral Researcher Photo of Jie Ma Phone: (303) 384-6511 Email: jie.ma@nrel.gov At NREL Since: 2010 Dr. Ma graduated from the University of Science and Technology of China in 2004 and received a Ph.D. degree from Institute of Physics, Chinese Academy of Sciences in 2009. Jie joined the Computational Materials Science Team at NREL as a postdoctoral researcher in March, 2010. He is currently working on computational design and characterization of nanoscale materials for doping, water splitting, and solar cells, using quantum mechanical electronic structure calculation and molecular dynamics simulation techniques. Research Interests Low-dimensional systems (quantum dots, nanotube and nanowires, and surfaces) Doping in semiconductors. Solar cell and water splitting.

14

MA Mortenson | Open Energy Information  

Open Energy Info (EERE)

Mortenson Mortenson Jump to: navigation, search Name MA Mortenson Place Minnesota Zip 55440-0710 Sector Solar, Wind energy Product Construction and building firm active in the installation of wind and solar farms. References MA Mortenson[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. MA Mortenson is a company located in Minnesota . References ↑ "MA Mortenson" Retrieved from "http://en.openei.org/w/index.php?title=MA_Mortenson&oldid=348551" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load) Error 429 Throttled (bot load)

15

M.A. Silva Dias,  

NLE Websites -- All DOE Office Websites (Extended Search)

1 a 260. 1 Modelando o Impacto Climtico Regional e Remoto do Desmatamento M.A. Silva Dias, 1 R. Avissar, 2 e P. Silva Dias 1,3 As observaes e os modelos concordam que os...

16

MA - Office of Management - Energy Conservation Plan  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MA Energy Conservation Plan MA Energy Conservation Plan January 2010 1 Office of Management Office-Level Energy Conservation Plan January 2010 I. BACKGROUND This energy conservation plan represents an effort to reduce energy consumption within Office of Management (MA) office spaces and to increase employee awareness of and participation in energy conservation measures. II. SCOPE The plan and procedures in this document apply to all Office of Management (MA) office suites in the Forrestal and Germantown Facilities as well as the 950 L'Enfant Plaza Building. The actions and procedures set forth in this plan apply to each separate MA office suite as follows: MA-1: 4A-107 MA-43: 1F-039 MA-70: 7E-074 MA-1.1: 7E-028 MA-43: 1F-037 MA-70: 7E-054 MA-30: GH-081 MA-43:

17

Category:Boston, MA | Open Energy Information  

Open Energy Info (EERE)

Boston, MA Boston, MA Jump to: navigation, search Go Back to PV Economics By Location Media in category "Boston, MA" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Boston MA Massachusetts Electric Co.png SVFullServiceRestauran... 67 KB SVHospital Boston MA Massachusetts Electric Co.png SVHospital Boston MA M... 65 KB SVLargeHotel Boston MA Massachusetts Electric Co.png SVLargeHotel Boston MA... 65 KB SVLargeOffice Boston MA Massachusetts Electric Co.png SVLargeOffice Boston M... 65 KB SVMediumOffice Boston MA Massachusetts Electric Co.png SVMediumOffice Boston ... 65 KB SVMidriseApartment Boston MA Massachusetts Electric Co.png SVMidriseApartment Bos... 65 KB SVOutPatient Boston MA Massachusetts Electric Co.png SVOutPatient Boston MA...

18

DOE - Office of Legacy Management -- Indian Orchard MA Site - MA 08  

NLE Websites -- All DOE Office Websites (Extended Search)

Indian Orchard MA Site - MA 08 Indian Orchard MA Site - MA 08 FUSRAP Considered Sites Indian Orchard, MA Alternate Name(s): Chapman Valve Manufacturing Company Chapman Valve Site Crane Company MA.08-3 MA.08-4 Location: 203 Hampshire Street, Indian Orchard, Massachusetts MA.08-2 Historical Operations: Machined extruded natural uranium rods and supplied valves and other products to MED and AEC. Also machined natural uranium rods into slugs for Brookhaven National Laboratory. MA.08-6 MA.08-7 MA.08-8 MA.08-14 Eligibility Determination: Eligible MA.08-2 Radiological Survey(s): Assessment Survey, Verification Survey MA.08-11 MA.08-12 Site Status: Certified - Certification Basis, Federal Register Notice included. MA.08-13 MA.08-14 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP

19

Harvesting graphics power for MD simulations  

E-Print Network (OSTI)

We discuss an implementation of molecular dynamics (MD) simulations on a graphic processing unit (GPU) in the NVIDIA CUDA language. We tested our code on a modern GPU, the NVIDIA GeForce 8800 GTX. Results for two MD algorithms suitable for short-ranged and long-ranged interactions, and a congruential shift random number generator are presented. The performance of the GPU's is compared to their main processor counterpart. We achieve speedups of up to 80, 40 and 150 fold, respectively. With newest generation of GPU's one can run standard MD simulations at 10^7 flops/$.

J. A. van Meel; A. Arnold; D. Frenkel; S. F. Portegies Zwart; R. G. Belleman

2007-09-20T23:59:59.000Z

20

US NE MA Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

NE MA NE MA Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 $3,000 US NE MA Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US NE MA Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US NE MA Expenditures dollars ELECTRICITY ONLY average per household * Massachusetts households use 109 million Btu of energy per home, 22% more than the U.S. average. * The higher than average site consumption results in households spending 22% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers, keeps average site electricity consumption in the state low relative to other parts of the U.S. However, spending on electricity is closer to the national average due to higher

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

US NE MA Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

NE MA NE MA Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 $3,000 US NE MA Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US NE MA Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US NE MA Expenditures dollars ELECTRICITY ONLY average per household * Massachusetts households use 109 million Btu of energy per home, 22% more than the U.S. average. * The higher than average site consumption results in households spending 22% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers, keeps average site electricity consumption in the state low relative to other parts of the U.S. However, spending on electricity is closer to the national average due to higher

22

MA  

U.S. Energy Information Administration (EIA)

Status: The State has unbundling programs for its residential gas customers, but participation is quite limited. Overview: Massachusetts used a ...

23

WIND DATA REPORT Chester, MA  

E-Print Network (OSTI)

- Map of Chester wind tower site April 11, 2007 Renewable Energy Research Laboratory Page 5 UniversityWIND DATA REPORT Chester, MA December 2006 ­ February 2007 Prepared for Massachusetts Technology April 11, 2007 Report template version 3.1 Renewable Energy Research Laboratory University

Massachusetts at Amherst, University of

24

WIND DATA REPORT Wellfleet, MA  

E-Print Network (OSTI)

from a given direction and the average wind speed in that May 2, 2007 Renewable Energy Research Wind Speed, December 1, 2006 ­ February 28, 2007 May 2, 2007 Renewable Energy Research Laboratory PageWIND DATA REPORT Wellfleet, MA December 1st , 2006 ­ February 28th , 2007 Prepared

Massachusetts at Amherst, University of

25

MA Org Chart, August 01, 2013  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MA-1 MA-1 Ingrid Kolb, Director Chief Acquisition Officer (Vacant) Laurie Morman, Chief of Staff Office of Resource Management and Planning MA-1.1 Marilyn Dillon, Director Willie Mae Ingram, Dep. Director (Acting) Office of Acquisition & Project Management Paul Bosco, Director David Boyd, Dep. Director Jay Glascock, Senior Advisor Office of Policy MA-63 Berta Schreiber Director Office of Contract Management Patrick Ferraro Director Office of Project Management Michael Peek Director Office of Headquarters Procurement Services Mark Brady Director Office of Property Management Carmelo Melendez Director MA-60 Office of Scheduling and Advance Anthony Rediger, Director James Covey, Dep. Director MA-10 MA-30 MA-40 MA-70 MA-90 Office of Aviation

26

Spontaneous fission of /sup 259/Md  

SciTech Connect

The mass and kinetic energy distributions of fission fragments from the spontaneous fission of th newly discovered nuclide /sup 259/Md were obtained. /sup 259/Md was identified as the E. C. daughter of /sup 259/No, and was found to decay entirely (> 95%) by spontaneous fission with a 95-min half-life. From the kinetic energies measured for 397 pairs of coincident fragments, a mass distribution was derived that is symmetric with sigma = 13 amu. /sup 259/Md, together with /sup 258/Fm and /sup 259/Fm, form a select group of three nuclides whose mass division in spontaneous fission is highly symmetric. Unlike the total-kinetic-energy (TKE) distributions of /sup 258/Fm and /sup 259/Fm, which peak at approx. = to 240 MeV, this distribution for /sup 259/Md is broad and is 50 MeV lower in energy. Analysis of the mass and energy distributions shows that events near mass symmetry also exhibit a broad TKE distribution, with one-third of the symmetric events having TKEs less than 200 MeV. The associated of low TKEs with symmetric mass division in the fission of very heavy actinides is anomalous and inconsistent with theories based upon the emergence of fragment shells near the scission point. Either three-body fragmentation or peculiar fragment shapes are assumed as the cause for the large consumption of Coulomb energy observed for a significant fraction of symmetric fissions in /sup 259/Md. 6 figures.

Hulet, E.K.; Wild, J.F.; Lougheed, R.W.; Baisden, P.A.; Landrum, J.H.; Dougan, R.J.; Mustafa, M.; Ghiorso, A.; Nitschke, J.M.

1979-05-04T23:59:59.000Z

27

InThrMa | Open Energy Information  

Open Energy Info (EERE)

InThrMa InThrMa Jump to: navigation, search Tool Summary LAUNCH TOOL Name: InThrMa Agency/Company /Organization: InThrMa Sector: Energy Focus Area: - HVAC Resource Type: Software/modeling tools User Interface: Website, Mobile Device Website: www.inthrma.com/ Web Application Link: www.inthrma.com/ Cost: Paid Language: English InThrMa Screenshot References: InThrMa[1] Logo: InThrMa Web based HVAC EMS for Internet connected thermostats, focusing on energy efficiency, including Auto Demand Response capabilities. Harnessing Data & Technology To Derive HVAC Efficiency Overview InThrMa's HVAC Energy Management Suite (EMS) allows users to manage and optimize their HVAC systems from any web browser or mobile phone. The InThrMa EMS provides various tools for programming, monitoring and

28

Compute Node MD3000 Storage Array  

E-Print Network (OSTI)

Compute Node MD3000 Storage Array Dell 2950 Head Node 24-Port Switch Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node 24-Port Switch Dell 2950

Weber, David J.

29

Heart Failure Jason Ryan, MD, MPH  

E-Print Network (OSTI)

1 Heart Failure Jason Ryan, MD, MPH Director, UCONN Heart Failure Center University of Connecticut,084,000 $34.8 billion Background on Heart Failure Heart failure (HF) is a major public health problem resulting in substantial morbidity and mortality 1American Heart Association.2008 Heart and Stroke

Oliver, Douglas L.

30

MA-60 Org chart | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MA-60 Org chart MA-60 Org chart Updated May 6,2013 APM Org Chart v12.pptx More Documents & Publications Office of Acquisition and Project Management (APM) Organization Chart Office...

31

Data Update for Blandford, MA November 2006  

E-Print Network (OSTI)

Data Update for Blandford, MA November 2006 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Matthew Lackner Monthly Data Summary for November 2006 This update summarizes the monthly data results for the Blandford monitoring site in Blandford, MA, at 42.223° N, 72

Massachusetts at Amherst, University of

32

Data Update for Paxton, MA September, 2004  

E-Print Network (OSTI)

Data Update for Paxton, MA September, 2004 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for September, 2004 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per

Massachusetts at Amherst, University of

33

Data Update for Paxton, MA December, 2004  

E-Print Network (OSTI)

Data Update for Paxton, MA December, 2004 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for December, 2004 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per

Massachusetts at Amherst, University of

34

Data Update for Paxton, MA October, 2004  

E-Print Network (OSTI)

Data Update for Paxton, MA October, 2004 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for October, 2004 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per

Massachusetts at Amherst, University of

35

Data Update for Paxton, MA Prepared for  

E-Print Network (OSTI)

Data Update for Paxton, MA July, 2006 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for July, 2006 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per the WSG84

Massachusetts at Amherst, University of

36

Data Update for Paxton, MA November, 2005  

E-Print Network (OSTI)

Data Update for Paxton, MA November, 2005 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for November, 2005 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per

Massachusetts at Amherst, University of

37

Data Update for Paxton, MA November, 2004  

E-Print Network (OSTI)

Data Update for Paxton, MA November, 2004 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for November, 2004 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per

Massachusetts at Amherst, University of

38

Data Update for Paxton, MA January, 2005  

E-Print Network (OSTI)

Data Update for Paxton, MA January, 2005 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for January, 2005 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per

Massachusetts at Amherst, University of

39

Data Update for Paxton, MA August, 2005  

E-Print Network (OSTI)

Data Update for Paxton, MA August, 2005 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for August, 2005 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per

Massachusetts at Amherst, University of

40

Data Update for Paxton, MA February, 2005  

E-Print Network (OSTI)

Data Update for Paxton, MA February, 2005 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for February, 2005 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per

Massachusetts at Amherst, University of

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Data Update for Paxton, MA September, 2006  

E-Print Network (OSTI)

Data Update for Paxton, MA September, 2006 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for September, 2006 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per

Massachusetts at Amherst, University of

42

Data Update for Paxton, MA Prepared for  

E-Print Network (OSTI)

Data Update for Paxton, MA June, 2006 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for June, 2006 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per the WSG84

Massachusetts at Amherst, University of

43

Data Update for Blandford, MA October 2006  

E-Print Network (OSTI)

Data Update for Blandford, MA October 2006 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Matthew Lackner Monthly Data Summary for October 2006 This update summarizes the monthly data results for the Blandford monitoring site in Blandford, MA, at 42.223° N, 72

Massachusetts at Amherst, University of

44

Data Update for Paxton, MA Prepared for  

E-Print Network (OSTI)

Data Update for Paxton, MA May, 2005 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for May, 2005 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per the WSG84

Massachusetts at Amherst, University of

45

Data Update for Paxton, MA Prepared for  

E-Print Network (OSTI)

Data Update for Paxton, MA May, 2006 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for May, 2006 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per the WSG84

Massachusetts at Amherst, University of

46

Data Update for Paxton, MA December, 2005  

E-Print Network (OSTI)

Data Update for Paxton, MA December, 2005 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for December, 2005 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per

Massachusetts at Amherst, University of

47

Data Update for Paxton, MA August, 2006  

E-Print Network (OSTI)

Data Update for Paxton, MA August, 2006 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for August, 2006 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per

Massachusetts at Amherst, University of

48

Data Update for Paxton, MA October, 2006  

E-Print Network (OSTI)

Data Update for Paxton, MA October, 2006 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for October, 2006 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per

Massachusetts at Amherst, University of

49

Data Update for Paxton, MA September, 2005  

E-Print Network (OSTI)

Data Update for Paxton, MA September, 2005 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for September, 2005 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per

Massachusetts at Amherst, University of

50

Data Update for Paxton, MA October, 2005  

E-Print Network (OSTI)

Data Update for Paxton, MA October, 2005 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for October, 2005 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per

Massachusetts at Amherst, University of

51

Data Update for Paxton, MA February, 2006  

E-Print Network (OSTI)

Data Update for Paxton, MA February, 2006 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for February, 2006 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per

Massachusetts at Amherst, University of

52

Data Update for Paxton, MA Prepared for  

E-Print Network (OSTI)

Data Update for Paxton, MA June, 2005 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for June, 2005 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per the WSG84

Massachusetts at Amherst, University of

53

Data Update for Paxton, MA Prepared for  

E-Print Network (OSTI)

Data Update for Paxton, MA July, 2005 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for July, 2005 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per the WSG84

Massachusetts at Amherst, University of

54

Data Update for Paxton, MA December, 2006  

E-Print Network (OSTI)

Data Update for Paxton, MA December, 2006 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for December, 2006 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per

Massachusetts at Amherst, University of

55

Data Update for Paxton, MA March, 2005  

E-Print Network (OSTI)

Data Update for Paxton, MA March, 2005 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for March, 2005 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per the WSG84

Massachusetts at Amherst, University of

56

Data Update for Paxton, MA January, 2006  

E-Print Network (OSTI)

Data Update for Paxton, MA January, 2006 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for January, 2006 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per

Massachusetts at Amherst, University of

57

Data Update for Paxton, MA April, 2005  

E-Print Network (OSTI)

Data Update for Paxton, MA April, 2005 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for April, 2005 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per the WSG84

Massachusetts at Amherst, University of

58

Data Update for Paxton, MA March, 2006  

E-Print Network (OSTI)

Data Update for Paxton, MA March, 2006 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for March, 2006 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per the WSG84

Massachusetts at Amherst, University of

59

Data Update for Paxton, MA November, 2006  

E-Print Network (OSTI)

Data Update for Paxton, MA November, 2006 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for November, 2006 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per

Massachusetts at Amherst, University of

60

Data Update for Paxton, MA April, 2006  

E-Print Network (OSTI)

Data Update for Paxton, MA April, 2006 Prepared for Massachusetts Technology Collaborative, 75 North Drive, Westborough, MA 01581 By Kai Wu Monthly Data Summary for April, 2006 This update summarizes the monthly data results for the Paxton MA monitoring site at 42-18-11.6 N, 71-53-50.9 W per the WSG84

Massachusetts at Amherst, University of

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

DOE - Office of Legacy Management -- Johns Hopkins University - MD 02  

Office of Legacy Management (LM)

Johns Hopkins University - MD 02 Johns Hopkins University - MD 02 FUSRAP Considered Sites Site: JOHNS HOPKINS UNIVERSITY (MD.02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Baltimore , Maryland MD.02-1 Evaluation Year: 1987 MD.02-2 Site Operations: Conducted spectroscopic studies under contract number AT(49-1)-309. MD.02-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantities of material used in a controlled environment MD.02-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Tritium MD.02-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to JOHNS HOPKINS UNIVERSITY

62

Free Energy Calculation in MD Simulation  

E-Print Network (OSTI)

Free Energy Calculation in MD Simulation #12;Basic Thermodynamics Helmoholtz free energy A = U ­ TS + i Ni dA = wrev (reversible, const N V T) eq (22.9) McQuarrie & Simon Gibbs free energy G = U;Implication of Free Energy A B Keq = [A]/[B] Keq = exp (-G0 /RT) G0 = -RT ln Keq G = G0 + RT ln Q G > 0

Nielsen, Steven O.

63

Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...

64

US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

65

US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

66

RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.

67

DOE - Office of Legacy Management -- Maryland Disposal Site - MD 05  

Office of Legacy Management (LM)

Maryland Disposal Site - MD 05 Maryland Disposal Site - MD 05 FUSRAP Considered Sites Site: MARYLAND DISPOSAL SITE (MD.05 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Baltimore - Vicinity , Maryland MD.05-1 Evaluation Year: 1989 MD.05-1 Site Operations: Proposed disposal site - never developed. MD.05-1 Site Disposition: Eliminated Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Indicated Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MARYLAND DISPOSAL SITE MD.05-1 - Report (DOE/OR/20722-131 Revision 0); Site Plan for the Maryland Disposal Site; April 1989 Historical documents may contain links which are no longer valid or to

68

M.A. Silva Dias,  

NLE Websites -- All DOE Office Websites (Extended Search)

1 a 260. 1 a 260. 1 Modelando o Impacto Climático Regional e Remoto do Desmatamento M.A. Silva Dias, 1 R. Avissar, 2 e P. Silva Dias 1,3 As observações e os modelos concordam que os níveis atuais e os padrões de desmatamento da Amazônia de fato intensificam as transferências de massa e energia entre a terra e a atmosfera por meio da criação de circulações impulsionadas termicamente com efeitos significativos sobre a precipitação, mas que variam sazonal e regionalmente. Isso também indicou a necessidade de identificar o limiar onde o aumento do desmatamento realmente implica a diminuição de pluviosidade, conforme apontado pela maioria dos modelos de circulação geral de baixa resolução. Grande parte dos estudos sobre o impacto remoto ainda é exploratória, mas indicam que

69

Ma'aden Open Mould Casting Machines  

Science Conference Proceedings (OSTI)

The paper will describe Ma'aden experience in ingot casting machines: commissioning and start-up, the challenges faced specially with De-molding machines,...

70

Rig 'dzin Tshe dbang mchog grub (1761-1829) et la constitution du rNying ma rgyud 'bum de sDe dge  

E-Print Network (OSTI)

les textes en une collection Ug palung, le fief de la ligne Zur3. Un article plus rcent encore de Mi Nyag Thubbstan chos dar fait le point sur les diverses versions existantes, mentionnantdailleurs un certain nombre dentre elles qui ne sont... and the Bai-ro- rgyud-bum, p. 9. 4 Mi nyag Thub bstan chos dar, rNying ma rgyud 'bum gyi mtshams sbyor, passim. 5 Voir Achard, La liste des Tantras du rNying mai rgyud bum selon ldition tablie par Kun mkhyen Jigs med gling pa, Revue d...

Achard, Jean-Luc

2003-01-01T23:59:59.000Z

71

WIND DATA REPORT WBZ Tower, Hull, MA  

E-Print Network (OSTI)

WIND DATA REPORT WBZ Tower, Hull, MA 9/1/06-11/30/06 Prepared for Department of Energy (DOE) Golden the closest tower leg The data from the SecondWind Nomad2 logger is emailed to the Renewable Energy Research Energy Research Laboratory Page 10 University of Massachusetts, Amherst Amherst, MA 01003 #12;Wind Speed

Massachusetts at Amherst, University of

72

DOE - Office of Legacy Management -- Shpack Landfill - MA 06  

Office of Legacy Management (LM)

Shpack Landfill - MA 06 Shpack Landfill - MA 06 FUSRAP Considered Sites Shpack Landfill, NY Alternate Name(s): Attleboro, MA Metals and Controls Site Norton Landfill area MA.06-2 MA.06-3 Location: 68 Union Road, Norton, Massachusetts MA.06-2 Historical Operations: No AEC activities were conducted on site. Contamination was suspected from disposal of materials containing uranium and zirconium ash. MA.06-2 MA.06-3 Eligibility Determination: Eligible MA.06-1 Radiological Survey(s): Assessment Surveys MA.06-4 MA.06-5 MA.06-6 Site Status: Cleanup in progress by U.S. Army Corps of Engineers. MA.06-7 MA.06-8 USACE Website Long-term Care Requirements: To be determined upon completion. Also see Documents Related to Shpack Landfill, NY MA.06-1 - DOE Memorandum; Meyers to Hart; Subject: Shpack Landfill,

73

Oral Histories: Pathologist Clarence Lushbaugh, M.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

3 HUMAN RADIATION STUDIES: REMEMBERING THE EARLY YEARS Oral History of Pathologist Clarence Lushbaugh, M.D. Conducted October 5, 1994 United States Department of Energy Office of...

74

DOE - Office of Legacy Management -- Max Zuckerman and Sons Inc - MD 04  

Office of Legacy Management (LM)

Inc - MD 04 Inc - MD 04 FUSRAP Considered Sites Site: MAX ZUCKERMAN & SONS, INC. (MD.04 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Maryland Alloys Corporation MD.04-1 Location: 5245 Fairlawn Avenue , Baltimore , Maryland MD.04-2 Evaluation Year: 1994 MD.04-1 MD.04-3 Site Operations: Scrap metals broker that arranged purchases of materials for third party buyers. MD.04-2 MD.04-4 Site Disposition: Eliminated - Potential for contamination remote MD.04-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium (Q-11) Oxide/Residue MD.04-2 MD.04-4 Radiological Survey(s): Yes MD.04-1 Site Status: Eliminated from consideration under FUSRAP MD.04-3 Also see Documents Related to MAX ZUCKERMAN & SONS, INC.

75

Net Zero Residential Test Facility Gaithersburg, MD Solar Photovoltaic Panels  

E-Print Network (OSTI)

1 Net Zero Residential Test Facility Gaithersburg, MD Solar Photovoltaic Panels Solar Thermal R-35 Rim Joist Area 5" open cell spray foam 2" mineral wool insulation blanket R-10 Basement Slab electric WH #12;NZERTF Gaithersburg, MD Solar Photovoltaic Array Roof Mounted South half of main roof

Oak Ridge National Laboratory

76

DOE - Office of Legacy Management -- Watertown Arsenal - MA 02  

Office of Legacy Management (LM)

Watertown Arsenal - MA 02 Watertown Arsenal - MA 02 FUSRAP Considered Sites Site: WATERTOWN ARSENAL (MA.02 ) Eliminated from consideration under FUSRAP - Referred to EPA, State of Massachusetts, and the NRC Designated Name: Not Designated Alternate Name: None Location: Building Site 421 , Watertown , Massachusetts MA.02-1 Evaluation Year: 1985 MA.02-2 MA.02-3 Site Operations: Building 421 was used in the late 1940's and early 1950's by M.I.T. under Contract #AT (30-1)-956 for work on African Ores, and a modified ion-exchange technique was developed. Activities at Buildings 34, 41 and the GSA Site were conducted under AEC licensed. MA.02-4 MA.02-5 MA.02-6 Site Disposition: Eliminated - No Authority MA.02-6 MA.02-7 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MA.02-4

77

DOE - Office of Legacy Management -- Englehard Industries - MA...  

Office of Legacy Management (LM)

operations - uranium metal - under AEC license. MA.0-03-1 Site Disposition: Eliminated - NRC licensed MA.0-03-1 Radioactive Materials Handled: Yes Primary Radioactive Materials...

78

DOE - Office of Legacy Management -- Armco-Rustless Iron and Steel - MD 03  

Office of Legacy Management (LM)

Armco-Rustless Iron and Steel - MD Armco-Rustless Iron and Steel - MD 03 FUSRAP Considered Sites Site: Armco-Rustless Iron & Steel (MD.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: ARMCO Baltimore Works MD.03-1 Location: Baltimore , Maryland MD.03-2 Evaluation Year: 1987 MD.03-1 Site Operations: Test rolling of uranium billets. MD.03-2 MD.03-3 Site Disposition: Eliminated - Potential for contamination remote due to limited quantity of material and duration of test MD.03-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MD.03-2 Radiological Survey(s): Health and safety monitoring conducted during operations MD.03-2 Site Status: Eliminated from consideration under FUSRAP MD.03-1 Also see

79

DOE - Office of Legacy Management -- Tracerlab Inc - MA 11  

Office of Legacy Management (LM)

Tracerlab Inc - MA 11 Tracerlab Inc - MA 11 FUSRAP Considered Sites Site: TRACERLAB, INC. (MA.11 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 130 High Street , Boston , Massachusetts MA.11-1 Evaluation Year: 1987 MA.11-3 Site Operations: Research and development regarding uranium irradiation and cesium blocks during the early 1950s. MA.11-1 MA.11-3 Site Disposition: Eliminated - NRC licensed MA.11-2 MA.11-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium, Cesium MA.11-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to TRACERLAB, INC. MA.11-1 - Tracerlab Letter; Epple to Mason; Subject: Steps to Secure

80

MD. SAIFUR RAHAMAN 9 Hillhouse Ave., Environmental Engineering Program  

E-Print Network (OSTI)

of Chemical Engineering, Yale University Project: "Environmental implications and applications of engineeredMD. SAIFUR RAHAMAN 9 Hillhouse Ave., Environmental Engineering Program Department of Chemical Crystallization in a Fluidized Bed Reactor: Kinetics, Hydrodynamics and Performance" Supervisor: Professor Donald

Elimelech, Menachem

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Cove Point, MD Natural Gas Liquefied Natural Gas Imports from...  

Gasoline and Diesel Fuel Update (EIA)

Trinidad and Tobago (Million Cubic Feet) Cove Point, MD Natural Gas Liquefied Natural Gas Imports from Trinidad and Tobago (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug...

82

Cove Point, MD Natural Gas Liquefied Natural Gas Imports from...  

Annual Energy Outlook 2012 (EIA)

Norway (Million Cubic Feet) Cove Point, MD Natural Gas Liquefied Natural Gas Imports from Norway (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011...

83

Cove Point, MD Natural Gas Liquefied Natural Gas Imports from...  

Annual Energy Outlook 2012 (EIA)

Nigeria (Million Cubic Feet) Cove Point, MD Natural Gas Liquefied Natural Gas Imports from Nigeria (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011...

84

Cove Point, MD Natural Gas Liquefied Natural Gas Imports from...  

U.S. Energy Information Administration (EIA) Indexed Site

Algeria (Million Cubic Feet) Cove Point, MD Natural Gas Liquefied Natural Gas Imports from Algeria (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6...

85

Cove Point, MD Natural Gas Liquefied Natural Gas Imports from...  

U.S. Energy Information Administration (EIA) Indexed Site

Egypt (Million Cubic Feet) Cove Point, MD Natural Gas Liquefied Natural Gas Imports from Egypt (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7...

86

DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility

87

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed

88

DOE - Office of Legacy Management -- Fenwal Inc - MA 14  

Office of Legacy Management (LM)

Fenwal Inc - MA 14 Fenwal Inc - MA 14 FUSRAP Considered Sites Site: Fenwal, Inc. (MA.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ashland , Massachusetts MA.14-1 Evaluation Year: 1994 MA.14-2 MA.14-3 Site Operations: Performed pilot scale explosion suppression tests on uranium contaminated magnesium fluoride powder in the late 1960s. MA.14-1 MA.14-3 Site Disposition: Eliminated - Potential for contamination considered remote based on the limited quantity of materials handled MA.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MA.14-1 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Fenwal, Inc.

89

DOE - Office of Legacy Management -- National Fireworks Ordnance Corp - MA  

Office of Legacy Management (LM)

Fireworks Ordnance Corp - Fireworks Ordnance Corp - MA 13 FUSRAP Considered Sites Site: NATIONAL FIREWORKS ORDNANCE CORP (MA.13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: American Potash and Chemical Corporation MA.13-3 Location: West Hanover , Massachusetts MA.13-1 Evaluation Year: 1991 MA.13-1 Site Operations: Performed bench scale research and development on uranium forming during the 1960s. MA.13-2 MA.13-3 Site Disposition: Eliminated - Potential for contamination considered remote based on the limited quantity of materials handled MA.13-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal and Powders MA.13-3 Radiological Survey(s): None Indicated MA.13-2 Site Status: Eliminated from consideration under FUSRAP

90

DOE - Office of Legacy Management -- Nuclear Metals Inc - MA 09  

Office of Legacy Management (LM)

Metals Inc - MA 09 Metals Inc - MA 09 FUSRAP Considered Sites Site: NUCLEAR METALS, INC. (MA.09) Eliminated from consideration under FUSRAP - Licensed facility - included in NRC action plan (Site Decommissioning Management Plan) in 1990 for cleanup Designated Name: Not Designated Alternate Name: None Location: 1555 Massachusetts Ave. , Cambridge , Massachusetts MA.09-2 Evaluation Year: 1987 MA.09-1 Site Operations: Produced natural uranium tubes for Savannah River reactor program and fabricated power reactor fuel elements under AEC/NRC license. MA.09-4 MA.09-3 Site Disposition: Eliminated - No Authority under FUSRAP - AEC licensed operation MA.09-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium, Thorium MA.09-1 Radiological Survey(s): None Indicated

91

Security Standards for the Global Information Grid Gary Buda, Booz Allen & Hamilton, Linthicum, MD 21090  

E-Print Network (OSTI)

, Telcordia Technologies, Morristown, NJ 07960 Chris Kubic, Department of Defense, Ft. Meade, MD, 20755

Lee, Ruby B.

92

MI  

NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)

93

TO J. A. QuigUy, M.D. NATIONALLPADCW~  

Office of Legacy Management (LM)

J. A. QuigUy, M.D. J. A. QuigUy, M.D. NATIONALLPADCW~ OF oliI0 Cincbnati 39, Ohio September 23, 1960 TRIP RBPCRT TO PIONRBR DIVISION, BENDIX AVI4TIONC~ ION, DAVBNPQRT, SOWA,oNSEPTEMBR6-9,196O F. J. Klein CENTRAL FILE The purpose of this trip was tot (1) determine if a Bendix ronic energy cleaning system can clean uranium-contaminated drums to the extent of rcduciug the @ha ccmtazuinatiou level belav that required for sale as %oa-contaminatecl** by AEC Manual Chapter 5182-0s UOOO a dMlOO& average and at peak not more than 25,OOO a d~lOOcm2, and (2) observe . the health and safety aspects of the wotk and insure the adequate decontauimtiou of the machinery, tools, equi~t, aud teat area. This waa a wet operation Md the tauk waa not ventilated; hawever, should

94

DOE - Office of Legacy Management -- Manufacturing Laboratories Inc - MA  

Office of Legacy Management (LM)

Manufacturing Laboratories Inc - MA Manufacturing Laboratories Inc - MA 0-04 FUSRAP Considered Sites Site: MANUFACTURING LABORATORIES, INC. (MA.0-04 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 272 Northampton Street , Boston , Massachusetts MA.0-04-1 Evaluation Year: 1987 MA.0-04-3 Site Operations: Developed a process for making projectiles from depleted uranium during the early 1950s. MA.0-04-3 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope of operations at the site MA.0-04-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MA.0-04-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP

95

DOE - Office of Legacy Management -- Norton Co - MA 12  

Office of Legacy Management (LM)

26, 1987 MA.12-4 - AEC Letter; White to Warde; Subject: Thorium Samples; February 19, 1954 MA.12-5 - AEC Memorandum; Morgan to Epp; Subject: Shipment of Fused Uranium Oxide...

96

MaNDi: the Macromolecular Neutron Diffractometer at SNS | ORNL...  

NLE Websites -- All DOE Office Websites (Extended Search)

The Macromolecular Neutron Diffractometer at SNS MaNDi detector Detector array for the MaNDi instrument before installation. Detector cutaway Cutaway view of detector array for the...

97

Data Update for Mt. Tom, Holyoke, MA September 2005  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA September 2005 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Melissa Ray Monthly Data Summary for September 2005 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

98

Data Update for Mt. Tom, Holyoke, MA Prepared for  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA March 2008 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Puneet Malhotra Monthly Data Summary for March 2008 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

99

Data Update for Mt. Tom, Holyoke, MA Prepared for  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA June 2006 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Melissa Elkinton Monthly Data Summary for June 2006 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

100

Data Update for Mt. Tom, Holyoke, MA February 2006  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA February 2006 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Melissa Ray Monthly Data Summary for February 2005 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Data Update for Mt. Tom, Holyoke, MA January 2007  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA January 2007 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Puneet Malhotra Monthly Data Summary for January 2007 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

102

Data Update for Mt. Tom, Holyoke, MA October 2005  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA October 2005 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Melissa Ray Monthly Data Summary for October 2005 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

103

Data Update for Mt. Tom, Holyoke, MA Prepared for  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA June 2007 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Puneet Malhotra Monthly Data Summary for June 2007 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

104

Data Update for Mt. Tom, Holyoke, MA Prepared for  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA March 2007 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Puneet Malhotra Monthly Data Summary for March 2007 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

105

Data Update for Mt. Tom, Holyoke, MA January 2006  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA January 2006 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Melissa Ray Monthly Data Summary for December 2005 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

106

Data Update for Mt. Tom, Holyoke, MA Prepared for  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA April 2008 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Puneet Malhotra Monthly Data Summary for April 2008 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

107

Data Update for Mt. Tom, Holyoke, MA January 2008  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA January 2008 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Puneet Malhotra Monthly Data Summary for January 2008 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

108

Data Update for Mt. Tom, Holyoke, MA Prepared for  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA March 2006 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Melissa Ray Monthly Data Summary for March 2006 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59.2" N, 72

Massachusetts at Amherst, University of

109

Data Update for Mt. Tom, Holyoke, MA September 2007  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA September 2007 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Puneet Malhotra Monthly Data Summary for September 2007 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

110

Data Update for Mt. Tom, Holyoke, MA Prepared for  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA July 2005 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Melissa Ray Monthly Data Summary for July 2005 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59.2" N, 72

Massachusetts at Amherst, University of

111

Data Update for Mt. Tom, Holyoke, MA August 2006  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA August 2006 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Melissa Elkinton Monthly Data Summary for August 2006 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

112

Data Update for Mt. Tom, Holyoke, MA November 2007  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA November 2007 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Puneet Malhotra Monthly Data Summary for November 2007 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

113

Data Update for Mt. Tom, Holyoke, MA Prepared for  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA April 2006 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Melissa Ray Monthly Data Summary for April 2006 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59.2" N, 72

Massachusetts at Amherst, University of

114

Data Update for Mt. Tom, Holyoke, MA Prepared for  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA July 2006 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Melissa Elkinton Monthly Data Summary for July 2006 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

115

Data Update for Mt. Tom, Holyoke, MA November 2005  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA November 2005 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Melissa Ray Monthly Data Summary for November 2005 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

116

Data Update for Mt. Tom, Holyoke, MA Prepared for  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA April 2007 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Puneet Malhotra Monthly Data Summary for April 2007 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

117

Data Update for Mt. Tom, Holyoke, MA September 2006  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA September 2006 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Melissa Elkinton Monthly Data Summary for September 2006 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

118

Data Update for Mt. Tom, Holyoke, MA Prepared for  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA May 2007 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Puneet Malhotra Monthly Data Summary for May 2007 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

119

Data Update for Mt. Tom, Holyoke, MA Prepared for  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA July 2007 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Puneet Malhotra Monthly Data Summary for July 2007 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

120

Data Update for Mt. Tom, Holyoke, MA Prepared for  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA May 2006 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Melissa Ray Monthly Data Summary for May 2006 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59.2" N, 72

Massachusetts at Amherst, University of

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Data Update for Mt. Tom, Holyoke, MA Prepared for  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA June 2005 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Melissa Ray Monthly Data Summary for June 2005 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59.2" N, 72

Massachusetts at Amherst, University of

122

Data Update for Mt. Tom, Holyoke, MA October 2007  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA October 2007 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Puneet Malhotra Monthly Data Summary for October 2007 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

123

Data Update for Mt. Tom, Holyoke, MA February 2008  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA February 2008 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Puneet Malhotra Monthly Data Summary for February 2008 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

124

Data Update for Mt. Tom, Holyoke, MA August 2007  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA August 2007 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Puneet Malhotra Monthly Data Summary for August 2007 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

125

Data Update for Mt. Tom, Holyoke, MA November 2006  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA November 2006 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Melissa Elkinton Monthly Data Summary for November 2006 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

126

Data Update for Mt. Tom, Holyoke, MA October 2006  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA October 2006 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Melissa Elkinton Monthly Data Summary for October 2006 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

127

Data Update for Mt. Tom, Holyoke, MA February 2007  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA February 2007 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Puneet Malhotra Monthly Data Summary for February 2007 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

128

Data Update for Mt. Tom, Holyoke, MA December 2005  

E-Print Network (OSTI)

Data Update for Mt. Tom, Holyoke, MA December 2005 Prepared for Massachusetts Technology Collaborative 75 North Drive, Westborough, MA 01581 By Melissa Ray Monthly Data Summary for December 2005 This update summarizes the monthly data results for the Mt. Tom monitoring site in Holyoke, MA, at 42° 14' 59

Massachusetts at Amherst, University of

129

Medical Scholars (BS/MD) Program Expectations and Requirements  

E-Print Network (OSTI)

Medical Scholars (BS/MD) Program Expectations and Requirements Undergraduate portion semester GPAs lower than 3.5 will trigger an automatic review by the Medical Scholars Committee of the Medical Scholars Committee, to delay their entry to medical school by one year to broaden their education

Fernandez, Eduardo

130

DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4

131

DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP

132

DOE - Office of Legacy Management -- Bendix Corp Frieze Division - MD 0-01  

Office of Legacy Management (LM)

Bendix Corp Frieze Division - MD Bendix Corp Frieze Division - MD 0-01 FUSRAP Considered Sites Site: BENDIX CORP., FRIEZE DIVISION (MD.0-01 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Baltimore , Maryland MD.0-01-1 Evaluation Year: 1987 MD.0-01-3 Site Operations: Produced "classified units" believed to be electronics components - no radioactive materials involved. MD.0-01-1 MD.0-01-3 Site Disposition: Eliminated - No radioactive materials handled at this site MD.0-01-3 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MD.0-01-3 Radiological Survey(s): No Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to BENDIX CORP., FRIEZE DIVISION

133

DOE - Office of Legacy Management -- Naval Ordnance Laboratory - MD 0-03  

Office of Legacy Management (LM)

Ordnance Laboratory - MD 0-03 Ordnance Laboratory - MD 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE LABORATORY (MD.0-03 ) Eliminated from further consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: Naval Ordnance Laboratory - White Oak Location: White Oak Area , Silver Spring , Maryland MD.0-03-1 MD.0-03-2 Evaluation Year: 1987 MD.0-03-2 Site Operations: Research and development - may have involved radioactive materials because the site was identified on a 1955 Accountability Station List. MD.0-03-1 Site Disposition: Eliminated - NRC licensed MD.0-03-2 Radioactive Materials Handled: None Specifically Identified Primary Radioactive Materials Handled: None specifically indicated Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DOD MD.0-03-2

134

Spectroscopic studies beyond N = 152 neutron gap : decay of {sup 255 ovr sub 101}Md and {sup 256 ovr sub 101}Md.  

Science Conference Proceedings (OSTI)

The isotopes {sup 255}Md and {sup 256}Md were produced by the irradiation of {sup 253}Es with 35-45 MeV {alpha} particles by ({alpha},n) and ({alpha},2n) reactions and were removed from the target by a helium jet system. {alpha}, {gamma}, and {alpha}-{gamma} coincidence spectra were measured with Si and Ge(Li) detectors. From the EC decays of {sup 255}Md and {sup 256}Md, levels in {sup 255}Fm and {sup 256}Fm were deduced. Favored {alpha} decay of {sup 255}Md was found to populate the 7/2{sup -}[514] single-particle state in {sup 251}Es, thus establishing the 7/2{sup -}[514] as the {sup 255}Md ground state. Several {gamma} rays were observed in the {sub 256}Md {alpha}-{gamma} coincidence spectrum. {sup 256}Fm is the heaviest nucleus in which excited intrinsic states have been identified.

Ahmad, I.; Chasman, R. R.; Fields, P. R.

2000-01-01T23:59:59.000Z

135

Spectroscopic studies beyond the N=152 neutron gap: Decay of {sub 101}{sup 255}Md and {sub 101}{sup 256}Md  

Science Conference Proceedings (OSTI)

The isotopes {sup 255}Md and {sup 256}Md were produced by the irradiation of {sup 253}Es with 35-45 MeV {alpha} particles by ({alpha},n) and ({alpha},2n) reactions and were removed from the target by a helium jet system. {alpha}, {gamma}, and {alpha}-{gamma} coincidence spectra were measured with Si and Ge(Li) detectors. From the EC decays of {sup 255}Md and {sup 256}Md, levels in {sup 255}Fm and {sup 256}Fm were deduced. Favored {alpha} decay of {sup 255}Md was found to populate the 7/2{sup -}[514] single-particle state in {sup 251}Es, thus establishing the 7/2{sup -}[514] as the {sup 255}Md ground state. Several {gamma} rays were observed in the {sup 256}Md {alpha}-{gamma} coincidence spectrum. {sup 256}Fm is the heaviest nucleus in which excited intrinsic states have been identified. (c) 2000 The American Physical Society.

Ahmad, I. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Chasman, R. R. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Fields, P. R. [Argonne National Laboratory, Argonne, Illinois 60439 (United States)

2000-04-01T23:59:59.000Z

136

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...

137

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...

138

El Ma Electronic Machining srl | Open Energy Information  

Open Energy Info (EERE)

Ma Electronic Machining srl Ma Electronic Machining srl Jump to: navigation, search Name El.Ma. Electronic Machining srl Place Riva del Garda (TN), Italy Zip 38066 Sector Hydro, Hydrogen, Solar, Wind energy Product String representation "Italy-based, in ... solar sectors." is too long. References El.Ma. Electronic Machining srl[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. El.Ma. Electronic Machining srl is a company located in Riva del Garda (TN), Italy . References ↑ "El.Ma. Electronic Machining srl" Retrieved from "http://en.openei.org/w/index.php?title=El_Ma_Electronic_Machining_srl&oldid=344591" Categories: Clean Energy Organizations Companies Organizations

139

KwanliuMa_NERSC2011.ppt  

NLE Websites -- All DOE Office Websites (Extended Search)

Analysis and Visualization Analysis and Visualization Computing Requirements A Case Study Kwan-Liu Ma University of California, Davis SciDAC Institute for Ultrascale Visualization Outline * SciDAC Institute for Ultrascale Visualization * Visualization Solutions for Turbulent Combustion Simulations * A Case Study on Particle Trajectories Data Visualization Turbulent Combustion Simulations  Jackie Chen, Sandia National Laboratory  Direct numerical simulation tools are being developed Turbulent Combustion Simulations * High fidelity modeling is required to reliably predict efficiency and pollutant emission for new engines and new fuels * The current simulation code running on a supercomputer like the Cray XT5 uses up to 48,000 cores and over 14 million CPU hours per run

140

DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either

142

Tensile Properties of Fine Grain MA956 Oxide Dispersion ...  

Science Conference Proceedings (OSTI)

Presentation Title, Tensile Properties of Fine Grain MA956 Oxide Dispersion ... Weld Overlay Claddings by Gas-metal-arc Welding Process for Extending Plant...

143

Price of Everett, MA Liquefied Natural Gas Total Imports (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Liquefied Natural Gas Total Imports (Dollars per Thousand Cubic Feet) Price of Everett, MA Liquefied Natural Gas Total Imports (Dollars per Thousand Cubic Feet) Decade Year-0...

144

A MaRIE Perspective - Programmaster.org  

Science Conference Proceedings (OSTI)

MaRIE will be an international user facility and will enable unprecedented in-situ, transient measurements of real mesoscale materials in relevant extremes,...

145

Radiation Protection Instrument Manual, Revision 1, PNL-MA-562  

Science Conference Proceedings (OSTI)

PNL-MA-562 This manual provides specific information for operating and using portable radiological monitoring instruments available for use on the Hanford Site.

Johnson, Michelle Lynn

2009-09-23T23:59:59.000Z

146

RECIPIENT:Hull Municipal Light Plant STATE: MA PROJECT TITLE...  

NLE Websites -- All DOE Office Websites (Extended Search)

Page 1 01 :L RECIPIENT:Hull Municipal Light Plant STATE: MA PROJECT TITLE: Hull Offshore Wind Research and Development Funding Opportunity Announcement Number Procurement...

147

Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...

148

DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical

149

DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated

150

PNNL-MA-530 PNNL-SA-79982  

E-Print Network (OSTI)

PNNL-MA-530 PNNL-SA-79982 Prepared for the U.S. Department of Energy under Contract DE-AC05-76RL01830 Pacific Northwest National Laboratory Flight Operations Manual August 2011 #12;#12;PNNL-MA-530 PNNL-SA-79982 Pacific Northwest National Laboratory Flight Manual August 2011 Prepared for the U

151

MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab

2008-10-01T23:59:59.000Z

152

Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)

2012-01-01T23:59:59.000Z

153

DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP

154

Everett, MA Liquefied Natural Gas Imports From Yemen (Million...  

Gasoline and Diesel Fuel Update (EIA)

Liquefied Natural Gas Imports From Yemen (Million Cubic Feet) Everett, MA Liquefied Natural Gas Imports From Yemen (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct...

155

Johnston LFG (MA RPS Biomass Facility | Open Energy Information  

Open Energy Info (EERE)

LFG (MA RPS Biomass Facility LFG (MA RPS Biomass Facility Jump to: navigation, search Name Johnston LFG (MA RPS Biomass Facility Facility Johnston LFG (MA RPS Sector Biomass Facility Type Landfill Gas Location Rhode Island Coordinates 41.5800945°, -71.4774291° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.5800945,"lon":-71.4774291,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

156

Price of Everett, MA Natural Gas LNG Imports from Australia ...  

Gasoline and Diesel Fuel Update (EIA)

Australia (Dollars per Thousand Cubic Feet) Price of Everett, MA Natural Gas LNG Imports from Australia (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4...

157

Everett, MA Natural Gas Liquefied Natural Gas Imports from Algeria...  

U.S. Energy Information Administration (EIA) Indexed Site

Algeria (Million Cubic Feet) Everett, MA Natural Gas Liquefied Natural Gas Imports from Algeria (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7...

158

Everett, MA Natural Gas Liquefied Natural Gas Imports from Egypt...  

U.S. Energy Information Administration (EIA) Indexed Site

Egypt (Million Cubic Feet) Everett, MA Natural Gas Liquefied Natural Gas Imports from Egypt (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7...

159

Everett, MA Liquefied Natural Gas Total Imports (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Liquefied Natural Gas Total Imports (Million Cubic Feet) Everett, MA Liquefied Natural Gas Total Imports (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5...

160

Everett, MA Natural Gas Liquefied Natural Gas Imports from Australia...  

U.S. Energy Information Administration (EIA) Indexed Site

Australia (Million Cubic Feet) Everett, MA Natural Gas Liquefied Natural Gas Imports from Australia (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6...

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state

162

Oral Histories: Oncologist Helen Vodopick, M.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

2 2 HUMAN RADIATION STUDIES: REMEMBERING THE EARLY YEARS Oral History of Oncologist Helen Vodopick, M.D. Conducted December 28, 1994 United States Department of Energy Office of Human Radiation Experiments August 1995 CONTENTS Foreword Short Biography Academic Fellowship at Oak Ridge Institute for Nuclear Studies (ORINS), 1960 Appointment to the Staff at ORINS Medical Division The Medium-Exposure-Rate Total Body Irradiator (METBI) ORINS Radioisotope Tracer Studies Participation by Regional Universities at Oak Ridge Associated Universities (ORAU) Treatment of Cancer Patients with the METBI Introduction of Immunotherapy Radiation Treatment for Leukemia Patients Bone Marrow Treatment of Leukemia Low-Exposure-Rate Total Body Irradiator (LETBI) Treatment of Radiation Accident Victims at ORAU

163

Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio

2010-02-01T23:59:59.000Z

164

Matter-Radiation Interactions in Extremes (MaRIE), Los Alamos...  

NLE Websites -- All DOE Office Websites (Extended Search)

MaRIE: Matter-Radiation Interactions in Extremes Experimental Facility MaRIE Home MaRIE 1.0 Fission, Fusion materials Facility Accelerator Systems Making, Measuring and Modeling...

165

Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png

166

Soham Al Snih Al Snih, MD., PhD. Curriculum Vitae CURRICULUM VITAE  

E-Print Network (OSTI)

Soham Al Snih Al Snih, MD., PhD. Curriculum Vitae 1 CURRICULUM VITAE NAME: Soham Al Snih Al Snih, M at the Sealy Center on Aging, University of Texas Medical Branch, Galveston, TX. #12;Soham Al Snih Al Snih, MD arthritis. B. Grant Support Current Grant Support: 1R03 AG029959-01A2 (Al Snih ­PI) Period: 06

Wood, James B.

167

Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls

168

EA-1942: Cove Point Liquefaction Project, Lusby, MD | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2: Cove Point Liquefaction Project, Lusby, MD 2: Cove Point Liquefaction Project, Lusby, MD EA-1942: Cove Point Liquefaction Project, Lusby, MD SUMMARY The Federal Energy Regulatory Commission (FERC) is preparing, with DOE as a cooperating agency, an EA, to analyze the potential environmental impacts of a proposal to add natural gas liquefaction and exportation capabilities to an existing Cove Point LNG Terminal located on the Chesapeake Bay in Lusby, Maryland. PUBLIC COMMENT OPPORTUNITIES None available at this time. DOCUMENTS AVAILABLE FOR DOWNLOAD September 28, 2012 EA-1942: Notice of Intent to Prepare an Environmental Assessment Cove Point Liquefaction Project, Lusby, MD September 24, 2012 EA-1942: Notice of Intent of to Prepare an Environmental Assessment Cove Point Liquefaction Project, Lusby, MD

169

SE-MA-NO Electric Coop | Open Energy Information  

Open Energy Info (EERE)

MA-NO Electric Coop MA-NO Electric Coop Jump to: navigation, search Name SE-MA-NO Electric Coop Place Missouri Utility Id 16851 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Municipal HPS 100 W Lighting Municipal HPS 250 W Lighting Residential Residential Residential/Commercial HPS 100 W Lighting Residential/Commercial HPS 250 W Lighting Average Rates Residential: $0.0804/kWh Commercial: $0.0763/kWh Industrial: $0.0649/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a"

170

PIA - Management and Administration (MA) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PIA - Management and Administration (MA) PIA - Management and Administration (MA) PIA - Management and Administration (MA) The E-Government Act of 2002 requires Federal agencies to perform Privacy Impact Assessments (PIAs), an analysis of how information is handled, in order: (i) to ensure handling conforms to applicable legal, regulatory, and policy requirements regarding privacy, (ii) to determine the risks and effects of collecting, maintaining and disseminating information in identifiable form in an electronic information system, and (iii) to examine and evaluate protections and alternative processes for handling information to mitigate potential privacy risks. The DOE PIA process helps to ensure privacy protections are considered and implemented throughout the system life cycle. Following are all PIAs that have been done for Management and

171

DOE - Office of Legacy Management -- Metals and Controls Corp FSM Dept - MA  

Office of Legacy Management (LM)

and Controls Corp FSM Dept - and Controls Corp FSM Dept - MA 21 FUSRAP Considered Sites Site: METALS AND CONTROLS CORP., FSM DEPT. ( MA.21 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: M&C Texas Instruments MA.21-1 Location: Attleboro , Massachusetts MA.21-1 Evaluation Year: Circa 1987 MA.21-4 Site Operations: Nuclear fuel fabrication during the 1950s and 1960s. MA.21-2 Site Disposition: Eliminated - NRC licensed MA.21-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MA.21-3 Radiological Survey(s): Yes MA.21-3 Site Status: Eliminated from consideration under FUSRAP MA.21-2 Also see Documents Related to METALS AND CONTROLS CORP., FSM DEPT. MA.21-1 - Texas Instruments Letter; Veale to Duffy; Subject: Further

172

Microsoft Word - MA HCM Workforce Plan.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

HUMAN CAPITAL HUMAN CAPITAL MANAGEMENT WORKFORCE PLAN September 2006 This page left blank intentionally. MA Workforce Plan - September 2006 TABLE OF CONTENTS Table of Contents ........................................................................................................................... i Executive Summary ...................................................................................................................... 1 1.0 Introduction.......................................................................................................................... 3 1.1 Mission and Business Vision .........................................................................................3 1.2 Human Capital Management Strategy ...........................................................................4

173

MA50177: Scientific Computing Nuclear Reactor Simulation Generalised Eigenvalue Problems  

E-Print Network (OSTI)

MA50177: Scientific Computing Case Study Nuclear Reactor Simulation ­ Generalised Eigenvalue of a malfunction or of an accident experimentally, the numerical simulation of nuclear reactors is of utmost balance in a nuclear reactor are the two-group neutron diffusion equations -div (K1 u1) + (a,1 + s) u1 = 1

Scheichl, Robert

174

MaRS: a macro-pipelined reconfigurable system  

Science Conference Proceedings (OSTI)

We introduce MaRS, a reconfigurable, parallel computing engine with special emphasis on scalability, lending itself to the computation-/data-intensive multimedia data processing and wireless communication. Global communication between the processing ... Keywords: 2D-mesh network, MIMD, computer graphics, multimedia, reconfigurable architectures, wireless communication

Nozar Tabrizi; Nader Bagherzadeh; Amir H. Kamalizad; Haitao Du

2004-04-01T23:59:59.000Z

175

MaGate Simulator: A Simulation Environment for a Decentralized Grid Scheduler  

Science Conference Proceedings (OSTI)

This paper presents a simulator for of a decentralized modular grid scheduler named MaGate. MaGate's design emphasizes scheduler interoperability by providing intelligent scheduling serving the grid community as a whole. Each MaGate scheduler instance ... Keywords: Grid Scheduling, MaGate Simulator, Simulation, SmartGRID

Ye Huang; Amos Brocco; Michele Courant; Beat Hirsbrunner; Pierre Kuonen

2009-08-01T23:59:59.000Z

176

,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

177

,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

178

BERAC Meeting, October 6-7, 2011, Rockville, MD| U.S. DOE Office of Science  

Office of Science (SC) Website

Meeting, October 6-7, 2011, Rockville, MD Meeting, October 6-7, 2011, Rockville, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting, October 6-7, 2011, Rockville, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting October 6-7, 2011 Rockville, MD Agenda .docx file (13KB) Presentations Sharlene Weatherwax, State of BER Report .pptx file (2.0MB) Gary Geernaert, Climate and Environmental Sciences Division Update .pptx file (24.0MB) Todd Anderson, Biological Systems Science Division Update .pptx file (8.0MB) Susan Hubbard, Science Talk - Geophysical Signatures of Subsurface Microbially-Mediated Processes: Toward Quantification of In-Situ Ecosystem

179

BERAC Meeting October 16, 2006 North Bethesda, MD | U.S. DOE Office of  

Office of Science (SC) Website

October 16, 2006 North Bethesda, MD October 16, 2006 North Bethesda, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting October 16, 2006 North Bethesda, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting October 16, 2006 North Bethesda, MD Agenda .pdf file (8KB) Presentations Jerry Elwood .ppt file (4.1MB), State of BER James Ehleringer .ppt file (6.7MB), Report on BERAC Review of FACE Experiments David Kingsbury .ppt file (10.4MB), CAMERA-Metagenomics meets the Cyberinfrastructure Chris Somerville .ppt file (59KB), Life Sciences PART Measure Progress Report Joyce Penner .ppt file (116KB), Climate Change Science PART Measure

180

BERAC Meeting February 18 - 19, 2009 North Bethesda, MD | U.S. DOE Office  

Office of Science (SC) Website

18 - 19, 2009 North Bethesda, MD 18 - 19, 2009 North Bethesda, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting February 18 - 19, 2009 North Bethesda, MD Print Text Size: A A A RSS Feeds FeedbackShare Page Biological and Environmental Research Advisory Committee Meeting February 18-19, 2009 North Bethesda, MD Meeting Agenda .pdf file (9KB) Presentations Anna Palmisano .ppt file (11.7MB), State of BER Sharlene Weatherwax .ppt file (8.7MB), Biological Systems Science Division Update Wanda Ferrell .ppt file (16.9MB), Climate and Environmental Sciences Division Update Jeff Amthor, Report on the Climate Change Research Strategic Plan

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

BERAC Meeting February 23-24, 2010 Gaithersburg, MD | U.S. DOE Office of  

Office of Science (SC) Website

February 23-24, 2010 Gaithersburg, MD February 23-24, 2010 Gaithersburg, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting February 23-24, 2010 Gaithersburg, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting February 23-24,2010 Gaithersburg MD Agenda .pdf file (8KB) Presentations Patricia Dehmer .ppt file (7.4MB), News from the Office of Science Anna Palmisano .ppt file (18.0MB), State of BER Jeff Marqusee .ppt file (5.0MB), SERDP & ESTCP Phil Robertson .pdf file (3.1MB), Bioenergy & Sustainability (pdf format) Wanda Ferrell .ppt file (5.1MB), Climate and Environmental Sciences Division Update

182

BERAC Meeting September 1-2, 2009 Gaithersburg, MD | U.S. DOE Office of  

Office of Science (SC) Website

-2, 2009 Gaithersburg, MD -2, 2009 Gaithersburg, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting September 1-2, 2009 Gaithersburg, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting September 1-2, 2009 Gaithersburg, MD Agenda .pdf file (8KB) Presentations Patricia Dehmer .ppt file (25.0MB), News from the Office of Science Anna Palmisano .pptx file (6.6MB), State of BER Barbara Alving, NIH .ppt file (6.6MB), Connecting the Nation's Researchers, Patients and Communities: Next Steps Horst Simon .pdf file (2.6MB), Future Trends in Computing Sharlene Weatherwax .pdf file (928KB), Biological Systems Science

183

BERAC Meeting May 19-20, 2008 Hilton Hotel Gaithersburg, MD | U.S. DOE  

Office of Science (SC) Website

9-20, 2008 Hilton Hotel Gaithersburg, MD 9-20, 2008 Hilton Hotel Gaithersburg, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting May 19-20, 2008 Hilton Hotel Gaithersburg, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting May 19-20, 2008 Hilton Hotel Gaithersburg, MD Agenda .pdf file (17KB) Presentations Mike Hochella .ppt file (388KB), Environmental Remediation Sciences Division Committee of Visitors Report Jim Adelstein .ppt file (1.1MB), Report on the Low Dose Radiation Research Program Himadri Pakrasi .ppt file (22.3MB), Science Talk, Membrane Biology Grand Challenge Jeff Amthor .ppt file (11.7MB), Update on BER Program for Ecosystems

184

BERAC Meeting, June 6-7, 2012 Gaithersburg, MD| U.S. DOE Office of Science  

Office of Science (SC) Website

June 6-7, 2012 Gaithersburg, MD June 6-7, 2012 Gaithersburg, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting, June 6-7, 2012 Gaithersburg, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting June 6-7, 2012 Gaithersburg, MD Agenda .pdf file (424KB) Presentations Sharlene Weatherwax, BER Associate Director State of BER Report .pdf file (482KB) Todd Anderson, Director, Biological Systems Science Division Biological Systems Science Division Update .pdf file (1.9MB) Gary Geernaert, Director, Climate and Environmental Sciences Division Climate and Environmental Sciences Division Update .pdf file (1.6MB) Jonathan Petters,

185

BERAC Meeting, February 21-22, 2013, Rockville, MD | U.S. DOE Office of  

Office of Science (SC) Website

February 21-22, 2013 BERAC Rockville, MD February 21-22, 2013 BERAC Rockville, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings February 21-22, 2013 BERAC Rockville, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting, February 21-22, 2013, Rockville, MD Agenda .pdf file (10KB) Presentations: Sharlene Weatherwax .pdf file (1.9MB) - Office of Biological and Environmental Research Update Todd Anderson .pdf file (1.7MB) - Biological Systems Science Division Update Gary Geernaert .pdf file (2.3MB) - Climate and Environmental Sciences Division Update Judy Wall .pdf file (3.5MB) - The Genetic Basis for Bacterial Mercury Methylation

186

BERAC Meeting May 14-15, 2007 North Bethesda, MD | U.S. DOE Office of  

Office of Science (SC) Website

4-15, 2007 North Bethesda, MD 4-15, 2007 North Bethesda, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting May 14-15, 2007 North Bethesda, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting May 14-15, 2007 North Bethesda, MD Agenda .pdf file (10KB) Presentations Joyce Penner .ppt file (74KB), Report on ARM Facilities Charge William Pizer .pdf file (292KB), Report on Integrated Assessment Charge John Ferrell .ppt file (2.7MB), Report on DOE Energy Efficiency and Renewable Energy Biomass Program Paul Vaska .ppt file (23.6MB), Science Talk, Advances in Instrumentation for Small-Animal PET Imaging Mike Viola .ppt file (2.3MB), State of BER

187

BERAC Meeting September 16-17, 2010 Gaithersburg, MD | U.S. DOE Office of  

Office of Science (SC) Website

6-17, 2010 Gaithersburg, MD 6-17, 2010 Gaithersburg, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting September 16-17, 2010 Gaithersburg, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting September 16-17, 2010 Gaithersburg, MD Agenda .pdf file (8KB) Presentations Anna Palmisano .pptx file (6.5MB), State of BER Judy Wall .pptx file (904KB), CESD COV Report Gary Sayler .ppt file (65.0MB), Science Lecture, "From Microbes to Man: Environmental Biosensing with Bacterial Bioluminescence" Gary Geernaert .pptx file (4.5MB), Climate and Environmental Sciences Division Update Sharlene Weatherwax .pptx file (5.6MB), Biological Systems Science

188

Price of Cove Point, MD Natural Gas LNG Imports from Algeria...  

Gasoline and Diesel Fuel Update (EIA)

Algeria (Dollars per Thousand Cubic Feet) Price of Cove Point, MD Natural Gas LNG Imports from Algeria (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4...

189

Price of Cove Point, MD Natural Gas LNG Total Imports (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Total Imports (Dollars per Thousand Cubic Feet) Price of Cove Point, MD Natural Gas LNG Total Imports (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4...

190

Price of Cove Point, MD Natural Gas LNG Imports from Egypt (Nominal...  

U.S. Energy Information Administration (EIA) Indexed Site

Egypt (Nominal Dollars per Thousand Cubic Feet) Price of Cove Point, MD Natural Gas LNG Imports from Egypt (Nominal Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2...

191

EDeMa (Smart Grid Project) | Open Energy Information  

Open Energy Info (EERE)

EDeMa EDeMa Country Germany Headquarters Location Mülheim, Germany Coordinates 51.427074°, 6.886492° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.427074,"lon":6.886492,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

192

Town of Danvers, MA Smart Grid Project | Open Energy Information  

Open Energy Info (EERE)

Smart Grid Project Smart Grid Project Jump to: navigation, search Project Lead Town of Danvers, MA Country United States Headquarters Location Danvers, Massachusetts Recovery Act Funding $8,476,800.00 Total Project Value $16,953,600.00 Coverage Area Coverage Map: Town of Danvers, MA Smart Grid Project Coordinates 42.5750946°, -70.9300507° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}

193

Experimental Physical Sciences Vistas: MaRIE (draft)  

Science Conference Proceedings (OSTI)

To achieve breakthrough scientific discoveries in the 21st century, a convergence and integration of world-leading experimental facilities and capabilities with theory, modeling, and simulation is necessary. In this issue of Experimental Physical Sciences Vistas, I am excited to present our plans for Los Alamos National Laboratory's future flagship experimental facility, MaRIE (Matter-Radiation Interactions in Extremes). MaRIE is a facility that will provide transformational understanding of matter in extreme conditions required to reduce or resolve key weapons performance uncertainties, develop the materials needed for advanced energy systems, and transform our ability to create materials by design. Our unique role in materials science starting with the Manhattan Project has positioned us well to develop a contemporary materials strategy pushing the frontiers of controlled functionality - the design and tailoring of a material for the unique demands of a specific application. Controlled functionality requires improvement in understanding of the structure and properties of materials in order to synthesize and process materials with unique characteristics. In the nuclear weapons program today, improving data and models to increase confidence in the stockpile can take years from concept to new knowledge. Our goal with MaRIE is to accelerate this process by enhancing predictive capability - the ability to compute a priori the observables of an experiment or test and pertinent confidence intervals using verified and validated simulation tools. It is a science-based approach that includes the use of advanced experimental tools, theoretical models, and multi-physics codes, simultaneously dealing with multiple aspects of physical operation of a system that are needed to develop an increasingly mature predictive capability. This same approach is needed to accelerate improvements to other systems such as nuclear reactors. MaRIE will be valuable to many national security science challenges. Our first issue of Vistas focused on our current national user facilities (the Los Alamos Neutron Science Center [LANSCE], the National High Magnetic Field Laboratory-Pulsed Field Facility, and the Center for Integrated Nanotechnologies) and the vitality they bring to our Laboratory. These facilities are a magnet for students, postdoctoral researchers, and staff members from all over the world. This, in turn, allows us to continue to develop and maintain our strong staff across the relevant disciplines and conduct world-class discovery science. The second issue of Vistas was devoted entirely to the Laboratory's materials strategy - one of the three strategic science thrusts for the Laboratory. This strategy has helped focus our thinking for MaRIE. We believe there is a bright future in cutting-edge experimental materials research, and that a 21st-century facility with unique capability is necessary to fulfill this goal. The Laboratory has spent the last several years defining MaRIE, and this issue of Vistas presents our current vision of that facility. MaRIE will leverage LANSCE and our other user facilities, as well as our internal and external materials community for decades to come, giving Los Alamos a unique competitive advantage, advancing materials science for the Laboratory's missions and attracting and recruiting scientists of international stature. MaRIE will give the international materials research community a suite of tools capable of meeting a broad range of outstanding grand challenges.

Shlachter, Jack [Los Alamos National Laboratory

2010-09-08T23:59:59.000Z

194

DOE - Office of Legacy Management -- Tufts College - MA 0-05  

Office of Legacy Management (LM)

Tufts College - MA 0-05 Tufts College - MA 0-05 FUSRAP Considered Sites Site: TUFTS COLLEGE ( MA.0-05 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Medford , Massachusetts MA.0-05-1 Evaluation Year: 1987 MA.0-05-1 Site Operations: Research and development using only small quantities of radioactive material. MA.0-05-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantities of material handled MA.0-05-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MA.0-05-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to TUFTS COLLEGE MA.0-05-1 - Aerospace Letter; Young to Wallo; Subject: Elimination

195

Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.

196

DOE - Office of Legacy Management -- E B Badger - MA 0-01  

Office of Legacy Management (LM)

E B Badger - MA 0-01 E B Badger - MA 0-01 FUSRAP Considered Sites Site: E.B. Badger (MA.0-01 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 75 Pitts Street , Boston , Massachusetts MA.0-01-1 Evaluation Year: 1987 MA.0-01-2 Site Operations: Construction contractor during the mid-1940s; constructed facility to refine pitchblende ore and produce feed materials at another location. MA.0-01-2 Site Disposition: Eliminated - No indication of radioactive materials handled at this site MA.0-01-2 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MA.0-01-2 Radiological Survey(s): No Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to E.B. Badger

197

Model for Analysis of Energy Demand (MAED-2) | Open Energy Information  

Open Energy Info (EERE)

Website http:www-pub.iaea.orgMTCDp References MAED 21 "MAED model evaluates future energy demand based on medium- to long-term scenarios of socio-economic,...

198

MaGate: An Interoperable, Decentralized and Modular High-Level Grid Scheduler  

Science Conference Proceedings (OSTI)

This work presents the design and architecture of a decentralized grid scheduler named MaGate, which is developed within the SmartGRID project and focuses on grid scheduler interoperation. The MaGate scheduler is modular structured, and emphasizes the ... Keywords: Grid Computing, MaGate Scheduler, Meta-Scheduling, Scheduling, SmartGRID

Ye Huang; Amos Brocco; Michele Courant; Beat Hirsbrunne; Pierre Kuonen

2010-07-01T23:59:59.000Z

199

BERAC Meeting September 5 2008 Gaithersburg MD | U.S. DOE Office of Science  

Office of Science (SC) Website

September 5 2008 Gaithersburg MD September 5 2008 Gaithersburg MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting September 5 2008 Gaithersburg MD Print Text Size: A A A RSS Feeds FeedbackShare Page BER September 5, 2008 Arlington, VA Agenda Presentations Peg Riley .ppt file (357KB), Life and Medical Sciences Division Committee of Visitors Report Patricia Dehmer .ppt file (2.6MB), Report from the Office of Science Todd Anderson .ppt file (1.2MB), Scientific Focus Area (SFA) Rollout & Discussion Robert Dickinson .ppt file (6.1MB), Report on Climate Research Grand Challenges Mike Kuperberg .ppt file (975KB), Climate & Environmental Sciences

200

Fusion materials irradiations at MaRIE's fission fusion facility  

SciTech Connect

Los Alamos National Laboratory's proposed signature facility, MaRIE, will provide scientists and engineers with new capabilities for modeling, synthesizing, examining, and testing materials of the future that will enhance the USA's energy security and national security. In the area of fusion power, the development of new structural alloys with better tolerance to the harsh radiation environments expected in fusion reactors will lead to improved safety and lower operating costs. The Fission and Fusion Materials Facility (F{sup 3}), one of three pillars of the proposed MaRIE facility, will offer researchers unprecedented access to a neutron radiation environment so that the effects of radiation damage on materials can be measured in-situ, during irradiation. The calculated radiation damage conditions within the F{sup 3} match, in many respects, that of a fusion reactor first wall, making it well suited for testing fusion materials. Here we report in particular on two important characteristics of the radiation environment with relevancy to radiation damage: the primary knock-on atom spectrum and the impact of the pulse structure of the proton beam on temporal characteristics of the atomic displacement rate. With respect to both of these, analyses show the F{sup 3} has conditions that are consistent with those of a steady-state fusion reactor first wall.

Pitcher, Eric J [Los Alamos National Laboratory

2010-10-06T23:59:59.000Z

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:

202

The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.

2005-05-01T23:59:59.000Z

203

DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;

204

DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP

205

DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co

206

RECIPIENT:Hull Municipal Light Plant STATE: MA PROJECT TITLE:  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

: : Page 1 01 :L RECIPIENT:Hull Municipal Light Plant STATE: MA PROJECT TITLE: Hull Offshore Wind Research and Development Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number 09EE0000326 DE-EE0000326 GFO-OO00326-001 0 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the foUowing determination: CX, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply and demand studies), and dissemination (including, but not limited to, document mailings, publication, and distribution; and

207

Mar. Drugs 2013, 11, 3350-3371; doi:10.3390/md11093350 marine drugs  

E-Print Network (OSTI)

Mar. Drugs 2013, 11, 3350-3371; doi:10.3390/md11093350 marine drugs ISSN 1660-3397 www% cytotoxicity was observed at the highest concentration tested (5 µg mL-1 ). However, OPEN ACCESS #12;Mar. Drugs Pinna had first been implicated in food poisoning in China in 1990 [1]. Pinnatoxin A (Pn

Recanati, Catherine

208

A coupled RISM/MD or MC simulation methodology for solvation free energies  

E-Print Network (OSTI)

A coupled RISM/MD or MC simulation methodology for solvation free energies Holly Freedman, Thanh N methods for determination of solvation free energies. We employ the RISM formulation of solvation free-netted chain equations. We apply this approach to determining free energies of solvation for several small

Truong, Thanh N.

209

MD Study of Phase Change of Water inside a Carbon Nanotube Tatsuto KIMURA and Shigeo MARUYAMA  

E-Print Network (OSTI)

into ice crystal at 220 K or 200 K. In the case of phase change at 220 K, octagonal ice nanotube MD Study of Phase Change of Water inside a Carbon Nanotube * Tatsuto KIMURA and Shigeo MARUYAMA Dept. of Mech. Eng., The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656 Phase change

Maruyama, Shigeo

210

Ira Helfand, MD International Physicians for the Prevention of Nuclear War  

E-Print Network (OSTI)

of studies have shown that a limited, regional nuclear war between India and Pakistan would cause significantIra Helfand, MD International Physicians for the Prevention of Nuclear War Physicians for Social Responsibility NUCLEAR FAMINE: A BILLION PEOPLE AT RISK Global Impacts of Limited Nuclear War on Agriculture

Robock, Alan

211

DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on

212

DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:

213

Hanford External Dosimetry Technical Basis Manual PNL-MA-842  

SciTech Connect

The Hanford External Dosimetry Technical Basis Manual PNL-MA-842 documents the design and implementation of the external dosimetry system used at Hanford. The manual describes the dosimeter design, processing protocols, dose calculation methodology, radiation fields encountered, dosimeter response characteristics, limitations of dosimeter design under field conditions, and makes recommendations for effective use of the dosimeters in the field. The manual describes the technical basis for the dosimetry system in a manner intended to help ensure defensibility of the dose of record at Hanford and to demonstrate compliance with 10 CFR 835, DOELAP, DOE-RL, ORP, PNSO, and Hanford contractor requirements. The dosimetry system is operated by PNNLs Hanford External Dosimetry Program which provides dosimetry services to all Hanford contractors. The primary users of this manual are DOE and DOE contractors at Hanford using the dosimetry services of PNNL. Development and maintenance of this manual is funded directly by DOE and DOE contractors. Its contents have been reviewed and approved by DOE and DOE contractors at Hanford through the Hanford Personnel Dosimetry Advisory Committee which is chartered and chaired by DOE-RL and serves as means of coordinating dosimetry practices across contractors at Hanford. This manual was established in 1996. Since inception, it has been revised many times and maintained by PNNL as a controlled document with controlled distribution. Rev. 0 marks the first revision to be released through PNNLs Electronic Records & Information Capture Architecture (ERICA) database.

Rathbone, Bruce A.

2005-02-25T23:59:59.000Z

214

MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units

215

REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

216

A rational minor actinide (MA) recycling concept based on innovative oxide fuel with high AM content  

Science Conference Proceedings (OSTI)

A rational MA recycle concept based on high Am content fuel has been proposed. A design study of an Am- MOX fabrication plant, which is a key facility for the MA recycle concept, has been done and the facility concept was clarified from the viewpoint of basic process viability. Preliminary cost estimation suggested that the total construction cost of the MA recycle facilities including Am-MOX, Np-MOX and MA recovery could be comparable with that of the large scale LWR-MOX fabrication plant required for plutonium in LWR fuel cycle. (authors)

Tanaka, Kenya; Sato, Isamu; Ishii, Tetsuya; Yoshimochi, Hiroshi; Asaga, Takeo [Japan Atomic Energy Agency, 4002 Narita-cho, O-arai-machi, Higasiibaraki-gun, Ibaraki-ken, 311-1393 (Japan); Kurosaki, Ken [Osaka University, 2-1 Yamadaoka, Suita-shi, Osaka 565-0871 (Japan)

2007-07-01T23:59:59.000Z

217

2.8-Ma Ash-Flow Caldera At Chegem River In The Northern Caucasus...  

Open Energy Info (EERE)

.8-Ma Ash-Flow Caldera At Chegem River In The Northern Caucasus Mountains (Russia), Contemporaneous Granites, And Associated Ore Deposits Jump to: navigation, search GEOTHERMAL...

218

Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper

2012-02-20T23:59:59.000Z

219

Ceramic Composites, Inc. 1110 Benfield Blvd, Ste Q, Millersville, MD 21108  

NLE Websites -- All DOE Office Websites (Extended Search)

Composites, Inc. Composites, Inc. 1110 Benfield Blvd, Ste Q, Millersville, MD 21108 A subsidiary of Technology Assessment and Transfer, Inc. 410-987-3435 fax 410-987-7172 www.techassess.com AGENCY: DOE / NETL CONTRACT: DE-FG02-03ER83627 TITLE: Enhanced Performance Carbon Foam Heat Exchanger for Power Plant Cooling REPORT: Final Technical Report PERIOD: 21 July 2003 - 13 July 2007 TPOC: Barbara Carney carney@netl.doe.gov PHONE: 304-285-4671 PI: Steven Seghi steve@techassess.com PHONE: 410-987-3435 COMPANY: Ceramic Composites, Inc. 133 Defense Hwy, Ste 212 Annapolis, MD 21401 SBIR/STTR Rights Notice These SBIR/STTR data are furnished with SBIR/STTR rights under Grant No. DE-FG02- 03ER83627. For a period of 4 years after the acceptance of all items to be delivered under this

220

NAMD - The Engine for Large-Scale Classical MD Simulations of Biomolecular  

NLE Websites -- All DOE Office Websites (Extended Search)

NAMD NAMD NAMD - The Engine for Large-Scale Classical MD Simulations of Biomolecular Systems Based on a Polarizable Force Field PI Name: Benoit Roux PI Email: roux@uchicago.edu Institution: Argonne National Laboratory & University of Chicago Allocation Program: ESP Allocation Hours at ALCF: 80 Million Year: 2010 to 2013 Research Domain: Biological Sciences Biology, at the atomic and molecular level, is governed by complex interactions involving a large number of key constituents, including water, ions, proteins, nucleic acids, and lipid membranes. The goal of this project is to develop new technologies to simulate virtual models of biomolecular systems with an unprecedented accuracy. Large-scale molecular dynamics (MD) simulations based on atomic models play an increasingly

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

FINDING OF MD SIGNIFICANT IMPACT FORMERLY UTILIZED HED/AEC SITES REMEDIAL ACTION PROGRAM:  

Office of Legacy Management (LM)

FINDING OF MD SIGNIFICANT IMPACT FINDING OF MD SIGNIFICANT IMPACT FORMERLY UTILIZED HED/AEC SITES REMEDIAL ACTION PROGRAM: BAY0 CANYONS, NEW MEXICO Under the Formerly Utilized Sites Remedial Action Program (FUSRAP), the U.S. Department of Energy (DOE) has proposed to carry out rcmedfrl action at a site located in Bayo Canyon, Los Alamos County, New Mexico. Although the site as partially decontaminated and decommissioned in the 196Os, there remain above-background amounts of radionuclides. DOE has determined that strontium-90 in excess of DDE's proposed remedial- action criterir exists in subsurface materials underlying an area of about 0.6 ha (1.5 acres) at the Bayo Canyon site. The proposed action is to demarcate this are8 and restrict its use to activities that will not disturb this sub-

222

Hanford External Dosimetry Technical Basis Manual PNL-MA-842  

SciTech Connect

The Hanford External Dosimetry Technical Basis Manual PNL-MA-842 documents the design and implementation of the external dosimetry system used at Hanford. The manual describes the dosimeter design, processing protocols, dose calculation methodology, radiation fields encountered, dosimeter response characteristics, limitations of dosimeter design under field conditions, and makes recommendations for effective use of the dosimeters in the field. The manual describes the technical basis for the dosimetry system in a manner intended to help ensure defensibility of the dose of record at Hanford and to demonstrate compliance with 10 CFR 835, DOELAP, DOE-RL, ORP, PNSO, and Hanford contractor requirements. The dosimetry system is operated by PNNLs Hanford External Dosimetry Program (HEDP) which provides dosimetry services to all Hanford contractors. The primary users of this manual are DOE and DOE contractors at Hanford using the dosimetry services of PNNL. Development and maintenance of this manual is funded directly by DOE and DOE contractors. Its contents have been reviewed and approved by DOE and DOE contractors at Hanford through the Hanford Personnel Dosimetry Advisory Committee (HPDAC) which is chartered and chaired by DOE-RL and serves as means of coordinating dosimetry practices across contractors at Hanford. This manual was established in 1996. Since inception, it has been revised many times and maintained by PNNL as a controlled document with controlled distribution. The first revision to be released through PNNLs Electronic Records & Information Capture Architecture (ERICA) database was designated Revision 0. Revision numbers that are whole numbers reflect major revisions typically involving changes to all chapters in the document. Revision numbers that include a decimal fraction reflect minor revisions, usually restricted to selected chapters or selected pages in the document.

Rathbone, Bruce A.

2009-08-28T23:59:59.000Z

223

MA57---a code for the solution of sparse symmetric definite and indefinite systems  

Science Conference Proceedings (OSTI)

We introduce a new code for the direct solution of sparse symmetric linear equations that solves indefinite systems with 2 2 pivoting for stability. This code, called MA57, is in HSL 2002 and supersedes the well used HSL code MA27. We describe ... Keywords: Augmented systems, direct sparse factorization, multifrontal method, numerical optimization, sparse definite and indefinite systems

Iain S. Duff

2004-06-01T23:59:59.000Z

224

Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-10-01T23:59:59.000Z

225

Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel

2010-01-01T23:59:59.000Z

226

MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-12-01T23:59:59.000Z

227

VIDEO SEMINAR of Ma Jun's 6/17/02 presentation: China's Water Resources:  

NLE Websites -- All DOE Office Websites (Extended Search)

VIDEO SEMINAR of Ma Jun's 6/17/02 presentation: China's Water Resources: VIDEO SEMINAR of Ma Jun's 6/17/02 presentation: China's Water Resources: Crisis and Opportunity Speaker(s): Ma Jun Date: July 3, 2002 - 12:00pm Location: 90-3122 The rivers in China, and the hundreds of millions who depend on them, are in trouble. A water crisis looms large in most parts of China. In his book, China Water Crisis, Ma Jun traces 4,000 years of the history of China's watersheds, and their mis/management. Armed with scientific data and compelling stories, Ma reveals the causes and character of the looming ecological disaster. His book has been quoted in The Economist and many western media. Limited water resources pose a major threat to social and economic development in the 21st century. Three Gorges Dam and redirecting water from south to north occupy the main focus of the efforts to increase

228

Market Acceptance of Advanced Automotive Technologies Model (MA3T) Consumer  

Open Energy Info (EERE)

Market Acceptance of Advanced Automotive Technologies Model (MA3T) Consumer Market Acceptance of Advanced Automotive Technologies Model (MA3T) Consumer Choice Model Jump to: navigation, search Tool Summary Name: Market Acceptance of Advanced Automotive Technologies Model (MA3T) Consumer Choice Model Agency/Company /Organization: Oak Ridge National Laboratory OpenEI Keyword(s): EERE tool, Market Acceptance of Advanced Automotive Technologies Model (MA3T) Consumer Choice Model, MA3T Project U.S. consumer demand for plug-in hybrid electric vehicles (PHEV) in competition among various light-duty vehicle technologies for hundreds of market segments based and multiple regions. For more information, contact the ORNL Energy and Transportation Science Division at http://www.ornl.gov/sci/ees/etsd/contactus.shtml References Retrieved from

229

Hanford External Dosimetry Technical Basis Manual PNL-MA-842  

SciTech Connect

The Hanford External Dosimetry Technical Basis Manual PNL-MA-842 documents the design and implementation of the external dosimetry system used at the U.S. Department of Energy (DOE) Hanford site. The manual describes the dosimeter design, processing protocols, dose calculation methodology, radiation fields encountered, dosimeter response characteristics, limitations of dosimeter design under field conditions, and makes recommendations for effective use of the dosimeters in the field. The manual describes the technical basis for the dosimetry system in a manner intended to help ensure defensibility of the dose of record at Hanford and to demonstrate compliance with requirements of 10 CFR 835, the DOE Laboratory Accreditation Program, the DOE Richland Operations Office, DOE Office of River Protection, DOE Pacific Northwest Office of Science, and Hanfords DOE contractors. The dosimetry system is operated by the Pacific Northwest National Laboratory (PNNL) Hanford External Dosimetry Program which provides dosimetry services to PNNL and all Hanford contractors. The primary users of this manual are DOE and DOE contractors at Hanford using the dosimetry services of PNNL. Development and maintenance of this manual is funded directly by DOE and DOE contractors. Its contents have been reviewed and approved by DOE and DOE contractors at Hanford through the Hanford Personnel Dosimetry Advisory Committee which is chartered and chaired by DOE-RL and serves as means of coordinating dosimetry practices across contractors at Hanford. This manual was established in 1996. Since its inception, it has been revised many times and maintained by PNNL as a controlled document with controlled distribution. The first revision to be released through PNNLs Electronic Records & Information Capture Architecture database was designated Revision 0. Revision numbers that are whole numbers reflect major revisions typically involving significant changes to all chapters in the document. Revision numbers that include a decimal fraction reflect minor revisions, usually restricted to selected chapters or selected pages in the document. Maintenance and distribution of controlled hard copies of the manual by PNNL was discontinued beginning with Revision 0.2.

Rathbone, Bruce A.

2010-04-01T23:59:59.000Z

230

Hanford External Dosimetry Technical Basis Manual PNL-MA-842  

SciTech Connect

The Hanford External Dosimetry Technical Basis Manual PNL-MA-842 documents the design and implementation of the external dosimetry system used at the U.S. Department of Energy (DOE) Hanford site. The manual describes the dosimeter design, processing protocols, dose calculation methodology, radiation fields encountered, dosimeter response characteristics, limitations of dosimeter design under field conditions, and makes recommendations for effective use of the dosimeters in the field. The manual describes the technical basis for the dosimetry system in a manner intended to help ensure defensibility of the dose of record at Hanford and to demonstrate compliance with requirements of 10 CFR 835, the DOE Laboratory Accreditation Program, the DOE Richland Operations Office, DOE Office of River Protection, DOE Pacific Northwest Office of Science, and Hanfords DOE contractors. The dosimetry system is operated by the Pacific Northwest National Laboratory (PNNL) Hanford External Dosimetry Program which provides dosimetry services to PNNL and all Hanford contractors. The primary users of this manual are DOE and DOE contractors at Hanford using the dosimetry services of PNNL. Development and maintenance of this manual is funded directly by DOE and DOE contractors. Its contents have been reviewed and approved by DOE and DOE contractors at Hanford through the Hanford Personnel Dosimetry Advisory Committee which is chartered and chaired by DOE-RL and serves as means of coordinating dosimetry practices across contractors at Hanford. This manual was established in 1996. Since its inception, it has been revised many times and maintained by PNNL as a controlled document with controlled distribution. The first revision to be released through PNNLs Electronic Records & Information Capture Architecture database was designated Revision 0. Revision numbers that are whole numbers reflect major revisions typically involving significant changes to all chapters in the document. Revision numbers that include a decimal fraction reflect minor revisions, usually restricted to selected chapters or selected pages in the document. Maintenance and distribution of controlled hard copies of the manual by PNNL was discontinued beginning with Revision 0.2.

Rathbone, Bruce A.

2011-04-04T23:59:59.000Z

231

Hanford External Dosimetry Technical Basis Manual PNL-MA-842  

SciTech Connect

The Hanford External Dosimetry Technical Basis Manual PNL-MA-842 documents the design and implementation of the external dosimetry system used at Hanford. The manual describes the dosimeter design, processing protocols, dose calculation methodology, radiation fields encountered, dosimeter response characteristics, limitations of dosimeter design under field conditions, and makes recommendations for effective use of the dosimeters in the field. The manual describes the technical basis for the dosimetry system in a manner intended to help ensure defensibility of the dose of record at Hanford and to demonstrate compliance with 10 CFR 835, DOELAP, DOE-RL, ORP, PNSO, and Hanford contractor requirements. The dosimetry system is operated by PNNLs Hanford External Dosimetry Program (HEDP) which provides dosimetry services to all Hanford contractors. The primary users of this manual are DOE and DOE contractors at Hanford using the dosimetry services of PNNL. Development and maintenance of this manual is funded directly by DOE and DOE contractors. Its contents have been reviewed and approved by DOE and DOE contractors at Hanford through the Hanford Personnel Dosimetry Advisory Committee (HPDAC) which is chartered and chaired by DOE-RL and serves as means of coordinating dosimetry practices across contractors at Hanford. This manual was established in 1996. Since inception, it has been revised many times and maintained by PNNL as a controlled document with controlled distribution. Rev. 0 marks the first revision to be released through PNNLs Electronic Records & Information Capture Architecture (ERICA) database. Revision numbers that are whole numbers reflect major revisions typically involving changes to all chapters in the document. Revision numbers that include a decimal fraction reflect minor revisions, usually restricted to selected chapters or selected pages in the document. Revision Log: Rev. 0 (2/25/2005) Major revision and expansion. Rev. 0.1 (3/12/2007) Minor revision. Updated Chapters 5, 6 and 9 to reflect change in default ring calibration factor used in HEDP dose calculation software. Factor changed from 1.5 to 2.0 beginning January 1, 2007. Pages on which changes were made are as follows: 5.23, 5.69, 5.78, 5.80, 5.82, 6.3, 6.5, 6.29, 9.2.

Rathbone, Bruce A.

2007-03-12T23:59:59.000Z

232

Medication Safety in Older Adults: Home-Based Practice Patterns Joshua P. Metlay, MD, PhD,wzz  

E-Print Network (OSTI)

Medication Safety in Older Adults: Home-Based Practice Patterns Joshua P. Metlay, MD, Ph-reported sources of in- formation on current medications as well as home-based practices for organizing medication

Hennessy, Sean

233

Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)

2011-12-01T23:59:59.000Z

234

Hanford External Dosimetry Technical Basis Manual PNL-MA-842  

SciTech Connect

The Hanford External Dosimetry Technical Basis Manual PNL-MA-842 documents the design and implementation of the external dosimetry system used at Hanford. The manual describes the dosimeter design, processing protocols, dose calculation methodology, radiation fields encountered, dosimeter response characteristics, limitations of dosimeter design under field conditions, and makes recommendations for effective use of the dosimeters in the field. The manual describes the technical basis for the dosimetry system in a manner intended to help ensure defensibility of the dose of record at Hanford and to demonstrate compliance with 10 CFR 835, DOELAP, DOE-RL, ORP, PNSO, and Hanford contractor requirements. The dosimetry system is operated by PNNLs Hanford External Dosimetry Program (HEDP) which provides dosimetry services to all Hanford contractors. The primary users of this manual are DOE and DOE contractors at Hanford using the dosimetry services of PNNL. Development and maintenance of this manual is funded directly by DOE and DOE contractors. Its contents have been reviewed and approved by DOE and DOE contractors at Hanford through the Hanford Personnel Dosimetry Advisory Committee (HPDAC) which is chartered and chaired by DOE-RL and serves as means of coordinating dosimetry practices across contractors at Hanford. This manual was established in 1996. Since its inception, it has been revised many times and maintained by PNNL as a controlled document with controlled distribution. The first revision to be released through PNNLs Electronic Records & Information Capture Architecture (ERICA) database was designated Revision 0. Revision numbers that are whole numbers reflect major revisions typically involving significant changes to all chapters in the document. Revision numbers that include a decimal fraction reflect minor revisions, usually restricted to selected chapters or selected pages in the document. Maintenance and distribution of controlled hard copies of the manual by PNNL was discontinued beginning with Revision 0.2. Revision Log: Rev. 0 (2/25/2005) Major revision and expansion. Rev. 0.1 (3/12/2007) Updated Chapters 5, 6 and 9 to reflect change in default ring calibration factor used in HEDP dose calculation software. Factor changed from 1.5 to 2.0 beginning January 1, 2007. Pages on which changes were made are as follows: 5.23, 5.69, 5.78, 5.80, 5.82, 6.3, 6.5, 6.29, and 9.2. Rev 0.2 (8/28/2009) Updated Chapters 3, 5, 6, 8 and 9. Chapters 6 and 8 were significantly expanded. References in the Preface and Chapters 1, 2, 4, and 7 were updated to reflect updates to DOE documents. Approved by HPDAC on 6/2/2009. Rev 1.0 (1/1/2010) Major revision. Updated all chapters to reflect the Hanford site wide implementation on January 1, 2010 of new DOE requirements for occupational radiation protection. The new requirements are given in the June 8, 2007 amendment to 10 CFR 835 Occupational Radiation Protection (Federal Register, June 8, 2007. Title 10 Part 835. U.S., Code of Federal Regulations, Vol. 72, No. 110, 31904-31941). Revision 1.0 to the manual replaces ICRP 26 dosimetry concepts and terminology with ICRP 60 dosimetry concepts and terminology and replaces external dose conversion factors from ICRP 51 with those from ICRP 74 for use in measurement of operational quantities with dosimeters. Descriptions of dose algorithms and dosimeter response characteristics, and field performance were updated to reflect changes in the neutron quality factors used in the measurement of operational quantities.

Rathbone, Bruce A.

2010-01-01T23:59:59.000Z

235

Institutions and Cross-border Mergers and Acquisitions (M&A) Value Creation  

E-Print Network (OSTI)

Cross-border Merger and Acquisitions (M&As) are an increasingly important strategy adopted by firms in order to create value in fiercely competitive global markets. Cross-border M&A value creation, that is, wealth creation for shareholders from cross-border M&As, is therefore of considerable theoretical and practical importance. However, our understanding of the sources of cross-border M&A value creation remains limited. Researchers have found that the most commonly researched variables have little effect on cross-border M&A value creation. We therefore still do not understand the processes behind cross-border M&As. In this is dissertation I examine the main effects of host country regulatory, economic and physical infrastructure institutions on cross-border M&A value creation. I further examine the moderating effects of host country political institutions on the relationship between host country regulatory institutions and cross-border M&A value creation. Moreover, I investigate the effects of institutional distance between host and home country on cross-border M&A value creation. I argue that the effects of institutional distance (regulatory and economic distance) on cross-border M&A value creation are not symmetric, but rather the effects are contingent upon the direction of the distance. My hypotheses are tested on a sample of 6141 cross-border M&As between 1995 and 2003. Results of this analysis show that acquirers are more likely to create value by acquiring targets in countries with less advanced regulatory institutions. Further, my results indicate that host country political institutions positively moderate the relationship between host country regulatory institutions and cross-border M&A value creation. Host country economic institutions have an inverted U-shaped relationship with cross-border M&A value creation, and host country physical infrastructure institutions have a positive relationship with cross-border M&A value creation. Additionally, results show that there is an inverted U-shaped relationship between institutional distance and cross-border M&A value creation. The findings suggest that the effects of regulatory and economic institutional distance on cross-border M&A value creation are not symmetric. The effects are contingent upon the direction of the distance. That is whether the level of host country institutions is higher or lower than that of home country institutions. Implications for management and public policy are discussed.

Zhu, Hong

2008-12-01T23:59:59.000Z

236

A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)

2012-07-15T23:59:59.000Z

237

2.8-Ma Ash-Flow Caldera At Chegem River In The Northern Caucasus Mountains  

Open Energy Info (EERE)

2.8-Ma Ash-Flow Caldera At Chegem River In The Northern Caucasus Mountains 2.8-Ma Ash-Flow Caldera At Chegem River In The Northern Caucasus Mountains (Russia), Contemporaneous Granites, And Associated Ore Deposits Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: 2.8-Ma Ash-Flow Caldera At Chegem River In The Northern Caucasus Mountains (Russia), Contemporaneous Granites, And Associated Ore Deposits Details Activities (0) Areas (0) Regions (0) Abstract: Diverse latest Pliocene volcanic and plutonic rocks in the north-central Caucasus Mountains of southern Russia are newly interpreted as components of a large caldera system that erupted a compositionally zoned rhyolite-dacite ash-flow sheet at 2.83 ± 0.02 Ma (sanidine and biotite 40Ar/39Ar). Despite its location within a cratonic collision zone, the Chegem system is structurally and petrologically similar to typical

238

Ma,BonzongoandGao/UniversityofFlorida Characterization and Leachability of Coal Combustion Residues  

E-Print Network (OSTI)

Ma,BonzongoandGao/UniversityofFlorida Characterization and Leachability of Coal Combustion Residues an important solid waste in Florida, i.e., coal combustion residues (CCR) detailed in #2-4 of the current

Ma, Lena

239

Price of Everett, MA Natural Gas LNG Imports from Algeria (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Algeria (Dollars per Thousand Cubic Feet) Price of Everett, MA Natural Gas LNG Imports from Algeria (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4...

240

Price of Everett, MA Natural Gas LNG Imports from Egypt (Nominal...  

Annual Energy Outlook 2012 (EIA)

Egypt (Nominal Dollars per Thousand Cubic Feet) Price of Everett, MA Natural Gas LNG Imports from Egypt (Nominal Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3...

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

VIDEO SEMINAR of Ma Jun's 6/17/02 presentation: China's Water...  

NLE Websites -- All DOE Office Websites (Extended Search)

Speaker(s): Ma Jun Date: July 3, 2002 - 12:00pm Location: 90-3122 The rivers in China, and the hundreds of millions who depend on them, are in trouble. A water crisis looms...

242

Nanocrystals for Solar Energy MaRIE--A Facility in the Making  

E-Print Network (OSTI)

During the Manhattan Project, Los Alamos National Laboratory's mission was not only secret but very for hominid fossils in Ethiopia. FEATURES MY VIEW JOHN SARRAO, MaRIE PROJECT PROGRAM DIRECTOR 2 10 18 Tiny

243

Oxide-dispersion-strengthened turbine blades, volume 1. [MA6000 alloy  

SciTech Connect

The objective of Project 4 was to develop a high-temperature, uncooled gas turbine blade using MA6000 alloy. The program objectives were achieved. Production scale up of the MA6000 alloy was achieved with a fair degree of tolerance to nonoptimum processing. The blade manufacturing process was also optimized. The mechanical, environmental, and physical property evaluations of MA6000 were conducted. The ultimate tensile strength, to about 704 C (130 F), is higher than DS MAR-M 247 but with a corresponding lower tensile elongation. Also, above 982 C (180 F) MA6000 tensile strength does not decrease as rapidly as MAR-M 247 because the ODS mechanism still remains active. Based on oxidation resistance and diffusional stability considerations, NiCrAlY coatings are recommended. CoCrAly coating should be applied on top of a thin NiCrAlY coating. Vibration tests, whirlpit tests, and a high-rotor-rig test were conducted to ensure successful completion of the engine test of the MA6000 TFE731 high pressure turbine blades. The results of these tests were acceptable. In production quantities, the cost of the Project 4 MA6000 blade is estimated to be about twice that of a cast DS MAR-M 247 blade.

Millan, P.P. Jr.; Mays, J.C.

1986-10-01T23:59:59.000Z

244

ANL/ALCF/ESP-13/14 NAMD - The Engine for Large-Scale Classical MD  

NLE Websites -- All DOE Office Websites (Extended Search)

4 4 NAMD - The Engine for Large-Scale Classical MD Simulations of Biomolecular Systems Based on a Polarizable Force Field ALCF-2 Early Science Program Technical Report Argonne Leadership Computing Facility About Argonne National Laboratory Argonne is a U.S. Department of Energy laboratory managed by UChicago Argonne, LLC under contract DE-AC02-06CH11357. The Laboratory's main facility is outside Chicago, at 9700 South Cass Avenue, Argonne, Illinois 60439. For information about Argonne and its pioneering science and technology programs, see www.anl.gov. Availability of This Report This report is available, at no cost, at http://www.osti.gov/bridge. It is also available on paper to the U.S. Department of Energy and its contractors, for a processing fee, from:

245

DOE Challenge Home Case Study, Nexus EnergyHomes, Frederick, MD, Production  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Nexus Nexus EnergyHomes Frederick, MD BUILDING TECHNOLOGIES OFFICE DOE Challenge Home builders are in the top 1% of builders in the country meeting the extraordinary levels of excellence and quality specifi ed by the U.S. Department of Energy. Every DOE Challenge Home starts with ENERGY STAR for Homes Version 3 for an energy-effi cient home built on a solid foundation of building science research. Then, even more advanced technologies are designed in for a home that goes above and beyond current code to give you the superior quality construction, HVAC, appliances, indoor air quality, safety, durability, comfort, and solar-ready components along with ultra-low or no utility bills. This provides homeowners with a quality home that will last for generations to come.

246

DEPARTMENT OF HEALTH AN~~.N~dtAN, MD. Y.P.H.  

Office of Legacy Management (LM)

,' ,...- ,' ,...- -., -.- . . we#lnty..: - DEPARTMENT OF HEALTH AN~~.N~dtAN, MD. Y.P.H. April 30, 1979 . _-- _' . U.S.E.P.A. Radiation Branch 26 Federal Plaz;a, Boom 9079 New York, N. Y. 10007 Attention: Miss Feldman:, Gentlemen: In accordance with your request to Calvin E. Weber, P.E., Assistant Commissioner of Health for Environmental Quality, I am forwarding a copy of a report prepared by him concerning a radiation survey conducted in the vicinity of the former Canadian Radium and Uranium Corpora+on plant on Railroad Avenue in the Village of Mount Kisco, Westchester County, New Yor Please transmit any comments you may have regarding this matter directly to Mr. Weber. Very truly Yours, Conmissioner of Health xc:rr cc: Sherwood Davies, P.E. lbm Cashman

247

Recipient: County of Howard, MD ENERGY EFFICIENCY AND CONSERVATION BLOCK GRANTS NEPA COMPLIANCE FORM  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2 2 Recipient: County of Howard, MD ENERGY EFFICIENCY AND CONSERVATION BLOCK GRANTS NEPA COMPLIANCE FORM Activities Determination/ Categorical Exclusion Reviewer's Specific Instructions and Rationale (Restrictions and Allowable Activity) Electric Pick-up truck for on- site use at Alpha Ridge Landfill B5.1 None Landfill Forced Draft Heater A9 This CX applies to preliminary engineering and design tasks only. Additional information is required to make a NEPA determination for construction and operation tasks. Diesel Hybrid Truck B5.1 None Home Energy Audits A9 None Park Ballfield Lights Energy Efficiency B5.1 Waste Stream Clause Energy Efficiency Analysis via Monitoring of Sub-Meters Installation B5.1 None Energy Management Consultant A9 None High Efficiency Lighting - Rec & Parks B5.1

248

Recipient. County of Baltimore, MD ENERGY EFFICIENCY AND CONSERVATION BLOCK GRANTS NEPA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

0 0 Recipient. County of Baltimore, MD ENERGY EFFICIENCY AND CONSERVATION BLOCK GRANTS NEPA COMPLIANCE FORM Activities Determination/ Categorical Exclusion Reviewer's Specific Instructions and Rationale (Restrictions and Allowable Activity) Renovation for the Green Resource Center B5.1 All administrative activities, audits, outreach, and technical advice should be CX'd. All EE activities are subject to the Waste Stream Clause, Historic Preservation clause, and Engineering clause. Energy Audits for Business & Government Structures A9, All, B5.1 None Revolving Loan Fund A9, All, B5.1 All administrative activities, audits, outreach, and technical advice should be CX'd. All EE activities are subject to the Waste Stream Clause, Historic Preservation clause, and Engineering clause.

249

Oral Histories: Dr. John W. Gofman, M.D., Ph.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

7 7 HUMAN RADIATION STUDIES: REMEMBERING THE EARLY YEARS Oral History of Dr. John W. Gofman, M.D., Ph.D. Conducted December 20, 1994 United States Department of Energy Office of Human Radiation Experiments June 1995 CONTENTS Foreword Short Biography Oberlin College, Enrollment in Western Reserve Medical School To University of California, Berkeley to Study Physical Chemistry Assisting Seaborg's Research, Discovery of Uranium-233 The Manhattan Project From Research to Laboratory Production of Plutonium Joe Hamilton's Cavalier Approach to Radiation Medical Treatments With Radioactive Phosphorus (32P) Conflict Between University of California San Francisco and Berkeley Reflections on Ernest Lawrence Heart Disease Studies AEC Support for Heart Disease Studies Heparin and Lipoprotein Research With Human Subjects

250

Oral Histories: Oral History of Radiologist Henry I. Kohn, M.D., Ph.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

1 1 HUMAN RADIATION STUDIES: REMEMBERING THE EARLY YEARS Oral History of Radiologist Henry I. Kohn, M.D., Ph.D. Conducted September 13, 1994 United States Department of Energy Office of Human Radiation Experiments June 1995 CONTENTS Foreword Short Biography Studying the Effects of X Rays on Animal Blood Chemistry at Oak Ridge Work at UCSF's Radiological Laboratory Advantages of Yeast Cells for Studying Radiation Effects Reflections on Bert Low-Beer and Joseph Hamilton Radiation Genetics Experiments on Mice Reflections on Reynold Brown and Henry Kaplan Establishment of Harvard's Joint Center for Radiation Therapy (Mid '60s) Radiological Assessment for the National Academy of Science Survey of Nuclear and Alternative Energy (1975–79) Biologist and Physicist Perspectives on Radiological Effects

251

Felix F? Camacho Governor Michael W. Cruz, M.D. Lieutenant Governor  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

O. Box 2950 Haghiia, Guam 96932 O. Box 2950 Haghiia, Guam 96932 TEL: (671) 472-8931 FAX: (671) 477-4826 EMAIL: governo@mail.gov.gu Felix F? Camacho Governor Michael W. Cruz, M.D. Lieutenant Governor 0 6 MAW 2009 The Honorable Steven Chu Secretary U.S. Department of Energy 1000 Independence Avenue, S. W. Washington, D.C. 20585 Re: State Energy Program Assurances Dear Secretary Chu: As a condition of receiving Guam's share of the $3.1 billion funding for the State Energy Program (SEP) under the American Recovery and Renewal Act of 2009 (H.R. l)(ARRA), I am providing the following assurances. I have written to the Consolidated Commission on Utilities, Guam's public utility commission, and requested that they consider additional actions to promote energy efficiency, consistent with the Federal

252

Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.

1997-10-01T23:59:59.000Z

253

U-178: VMware vMA Library Loading Error Lets Local Users Gain Elevated  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

8: VMware vMA Library Loading Error Lets Local Users Gain 8: VMware vMA Library Loading Error Lets Local Users Gain Elevated Privileges U-178: VMware vMA Library Loading Error Lets Local Users Gain Elevated Privileges May 29, 2012 - 7:00am Addthis PROBLEM: A vulnerability was reported in VMware vMA PLATFORM: Version(s): vMA 4.0, 4.1, 5 patch 1 (5.0.0.1) ABSTRACT: A local user can obtain elevated privileges on the target system. Reference Links: SecurityTracker Alert ID: 1027099 CVE-2012-2752 Vendor Advisory IMPACT ASSESSMENT: High Discussion: A local user can exploit a library loading error to cause arbitrary code to be executed on the target system with elevated privileges. Impact: Privilege escalation Solution: The vendor has issued a fix (vSphere Management Assistant 5.0 Patch 2 (5.0.0.2)). Addthis Related Articles T-591: VMware vmrun Utility Lets Local Users Gain Elevated Privileges

254

EDeMa (Smart Grid Project) (Krefeld, Germany) | Open Energy Information  

Open Energy Info (EERE)

EDeMa (Smart Grid Project) (Krefeld, Germany) EDeMa (Smart Grid Project) (Krefeld, Germany) Jump to: navigation, search Project Name EDeMa Country Germany Headquarters Location Krefeld, Germany Coordinates 50.652943°, 6.339111° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":50.652943,"lon":6.339111,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

255

Zeolitization Of Intracaldera Sediments And Rhyolitic Rocks In The 1.25 Ma  

Open Energy Info (EERE)

Zeolitization Of Intracaldera Sediments And Rhyolitic Rocks In The 1.25 Ma Zeolitization Of Intracaldera Sediments And Rhyolitic Rocks In The 1.25 Ma Lake Of Valles Caldera, New Mexico, Usa Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: Zeolitization Of Intracaldera Sediments And Rhyolitic Rocks In The 1.25 Ma Lake Of Valles Caldera, New Mexico, USA Details Activities (0) Areas (0) Regions (0) Abstract: Quantitative X-ray diffraction analysis of about 80 rhyolite and associated lacustrine rocks has characterized previously unrecognized zeolitic alteration throughout the Valles caldera resurgent dome. The alteration assemblage consists primarily of smectite-clinoptilolite-mordenite-silica, which replaces groundmass and fills voids, especially in the tuffs and lacustrine rocks. Original rock textures are routinely preserved. Mineralization typically extends to

256

U.S. DEPARTMENT OF ENERGY EERE PROJECT MA.i\IAGE\tiE~TCE~TER  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MA.i\IAGE\tiE~TCE~TER MA.i\IAGE\tiE~TCE~TER NEPA DETERMINATION Page 1 of2 RECIPIENT:Brayton Energy STATE: MA PROJECT TITLE: High-Efficiency Low-Cost Solar Receiver for use in a Supercritical C02 Recompression Cycle Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000595 DE-EE0005799 GF0-0005799-{)01 G05799 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the foUowing determination: CX, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering, analysis, and dissemination Information gathering (including, 'but not limited to, literature surveys, inventories, site vrsits, and audits}, data analysis (including, but not limited to, computer modeling}, document preparation

257

California Health eQuality Advisory Committee Kenneth W. Kizer, M.D., M.P.H. -Chair  

E-Print Network (OSTI)

California Health eQuality Advisory Committee Kenneth W. Kizer, M.D., M.P.H. - Chair Distinguished Association (IHA) Ellen Wu, M.P.H. Executive Director California Pan-Ethnic Health Network Pamela L. Lane, M.S., RHIA, CPHIMS, Ex officio Deputy Secretary, HIE California Health & Human Services Agency Linette T

California at Davis, University of

258

C:\\ANNUAL\\VENTCHAP.V8\\NGA.VP  

Gasoline and Diesel Fuel Update (EIA)

4 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99...

259

Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...

260

C:\\ANNUAL\\VENTCHAP.V8\\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

C:\\ANNUAL\\VENTCHAP.V8\\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

0 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy...

262

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA  

Gasoline and Diesel Fuel Update (EIA)

176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY...

263

NGA98fin5.vp  

Annual Energy Outlook 2012 (EIA)

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99...

264

U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)

3 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE...

265

Tracking the Sun II: The Installed Cost of Photovoltaics in the U.S. from 1998-2008  

E-Print Network (OSTI)

kW >100 kW ?10 kW PA SDF Solar PV Grant Program 10-100 kW >Renewable DG Program CT CCEF Solar PV Program MA MD MI MTCProgram MW No. Systems SDF Solar PV Grant Program MW No.

Barbose, Galen L

2010-01-01T23:59:59.000Z

266

OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown

2013-10-01T23:59:59.000Z

267

In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma

2013-06-01T23:59:59.000Z

268

NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk

269

Ma, Kockelman & Damien 1 A Multivariate Poisson-Lognormal Regression Model for Prediction  

E-Print Network (OSTI)

Analysis and Prevention, 18(1), pp.1-12. Hauer, E. (1997). Observational Before-After Studies in Road.V., Stewart, J.R., Huang, H.H., and Lagerwey, P.A. (2002). Safety Effects of Marked Vs. Unmarked Crosswalks.S. DOT. #12;Ma, Kockelman & Damien 18 List of Tables Table 1 Summary Statistics of Variables

Kockelman, Kara M.

270

The Market Acceptance of Advanced Automotive Technologies (MA3T) Model  

E-Print Network (OSTI)

to be learned about how consumers will evaluate novel vehicle technologies, such as plug-in hybrid electric vehicles (PHEV), extended-range electric vehicle (EREV), battery electric vehicles (BEV) and fuel cell-- passenger cars and light-duty trucks. MA3 T considers the U.S. household users of light- duty vehicles (LDV

271

ORIGINAL PAPER M.A. Schembri D.W. Ussery C. Workman  

E-Print Network (OSTI)

ORIGINAL PAPER M.A. Schembri ? D.W. Ussery ? C. Workman H. Hasman ? P. Klemm DNA microarray-45-252506 Fax: +45-45-932809 D.W. Ussery ? C. Workman Centre for Biological Sequence Analysis, Bio 276:9924­9930 Pedersen AG, Jensen LJ, Brunak S, Staerfeldt HH, Ussery DW (2000) A DNA structural atlas

Ussery, David W.

272

Alameda County Medical Center Beth Israel Deaconess Medical Center, Boston MA  

E-Print Network (OSTI)

Alameda County Medical Center Beth Israel Deaconess Medical Center, Boston MA California Pacific Medical Center, San Francisco Cedar Sinai Medical Center Los Angeles Children's Hospital Orange Co. City of Hope National Medical Center, Duarte CA Community Regional Medical Center, Fresno Desert Regional

Tsien, Roger Y.

273

Gravity Based Autonomous Calibration for Robot Manipulators Donghai Ma, John M. Hollerbach and Yangming Xu  

E-Print Network (OSTI)

Gravity Based Autonomous Calibration for Robot Manipulators Donghai Ma, John M. Hollerbach, the gravity torque exerted on the joint varies sinusoidally with rotation angle. By means of sinusoidal curve. The gravity vec- tor, expressed in the defined base coordinates, can also be found. Thereafter we determine

Hollerbach, John M.

274

Nano-mineralogy studies by advanced electron microscopy Chi Ma and George R. Rossman  

E-Print Network (OSTI)

Nano-mineralogy studies by advanced electron microscopy Chi Ma and George R. Rossman Division and planetary materials easier and faster down to nano-scales. Small but new minerals with important geological significance are being discovered. Nano-features are being discovered in many common minerals and gems, which

Ma, Chi

275

Oral Histories: Physician James S. Robertson, M.D., Ph.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

8 8 HUMAN RADIATION STUDIES: REMEMBERING THE EARLY YEARS Oral History of Physician James S. Robertson, M.D., Ph.D. Conducted January 20, 1995 United States Department of Energy Office of Human Radiation Experiments September 1995 CONTENTS Foreword Short Biography Education Research on Human Subjects at Berkeley Invited to Join the New Lab at Brookhaven (1950) Boron Neutron Capture Therapy Other AEC Biomedical Programs Brookhaven Human Use Committee Castle Bravo Atomic Weapon Test (March 1, 1954) Studies on Marshallese at Brookhaven Modern BNCT Treatment Leaves Brookhaven for the Mayo Clinic (1975) Joins the Department of Energy (1983) Work at the Naval Radiological Defense Laboratory (1953–55) Controversial Treatments and the "Crackpot File" FOREWORD I n December 1993, U.S. Secretary of Energy Hazel R. O'Leary announced her Openness Initiative. As part of this initiative, the Department of Energy undertook an effort to identify and catalog historical documents on radiation experiments that had used human subjects. The Office of Human Radiation Experiments coordinated the Department's search for records about these experiments. An enormous volume of historical records has been located. Many of these records were disorganized; often poorly cataloged, if at all; and scattered across the country in holding areas, archives, and records centers.

276

Simulations of the Permian (251 Ma) Monsoon Using CCSM3Simulations of the Permian (251 Ma) Monsoon Using CCSM3 (Community Climate System Model, Version 3)(Community Climate System Model, Version 3)  

E-Print Network (OSTI)

Simulations of the Permian (251 Ma) Monsoon Using CCSM3Simulations of the Permian (251 Ma) Monsoon.A. Shields and J.T.C.A. Shields and J.T. KiehlKiehl NCARNCAR The nature of monsoons has been studied and its impact on society.The nature of monsoons has been studied extensively in the scientific community

277

MA Doping Analysis on Breeding Capability and Protected Plutonium Production of Large FBR  

Science Conference Proceedings (OSTI)

Spent fuel from LWR can be seen as long-live waste if it is not recycled or as a 'new fuel' resource if it is recycled into the reactors. Uranium and plutonium have been used for 'new fuel' resources from LWR spent fuel as MOX fuel type which is loaded into thermal reactor or fast reactor types. Other actinides from the spent fuel such as neptunium, americium and curium as minor actinide (MA) are considered to be loaded into the reactors for specific purposes, recently. Those purposes such as for increasing protected plutonium production and breeding capability for protected plutonium as well as in the same time those amount of MA can be reduced to a small quantity as a burner or transmutation purpose. Some investigations and scientific approaches are performed in order to increase a material ''barrier'' in plutonium isotope composition by increasing the even mass number of plutonium isotope such as Pu-238, Pu-240 and Pu-242 as plutonium protected composition. Higher material barrier which related to intrinsic properties of plutonium isotopes with even mass number (Pu-238, Pu-240 and Pu-242), are recognized because of their intense decay heat (DH) and high spontaneous fission neutron (SFN) rates. Those even number mass of plutonium isotope contribute to some criteria of plutonium characterization which will be adopted for present study such as IAEA, Pellaud and Kessler criteria (IAEA, 1972; Pellaud, 2002; and Kessler, 2007). The present paper intends to evaluate the breeding capability as a fuel sustainability index of the reactors and to analyze the composition of protected plutonium production of large power reactor based on the FaCT FBR as reference (Ohki, et al., 2008). Three dimensional FBR core configuration has been adopted which is based on the core optimization calculation of SRAC-CITATION code as reactor core analysis and JENDL-3.3 is adopted for nuclear data library. Some MA doping materials are loaded into the blanket regions which can be considered as breeding region for protected plutonium production. Breeding capability of the reactor can be increased effectively by increasing MA doping rate while criticality condition of the reactor is reduced by doping MA. Adopting MA cycle is also effective to increase the isotopic Pu-238 production in plutonium vector composition for denaturing purpose of plutonium.

Permana, Sidik; Suzuki, Mitsutoshi; Kuno, Yusuke [Japan Atomic Energy Agency, Nuclear Non-proliferation Science and Technology Center, 2-4 Shirane Shirakata, Tokai-mura, Ibaraki, 319-1195 (Japan)

2010-06-22T23:59:59.000Z

278

Kinetic energy deficit in the symmetric fission of /sup 259/Md. [Light particle emission in /sup 256/Fm fission  

Science Conference Proceedings (OSTI)

The fragment energies of about 725 coincidence events have now been observed in the spontaneous fission (SF) decay of 105-min /sup 259/Md since its discovery in 1977. The fission of /sup 259/Md is characterized by a symmetric mass distribution, similar to those of /sup 258/Fm and /sup 259/Fm, but with a broad total kinetic energy (anti TKE) distribution which peaks at about 195 MeV, in contrast to those of /sup 258/Fm and /sup 259/Fm, for which the anti TKE is about 240 MeV. This kinetic energy deficit, approx. 40 MeV, has been postulated to be due to the emission of hydrogen-like particles by /sup 259/Md at the scission point in a large fraction of the fissions, leaving the residual fissioning nucleus with 100 protons. The residual nucleus would then be able to divide into two ultrastable tin-like fission fragments, but with less kinetic energy than that observed in the SF of /sup 258/Fm and /sup 259/Fm, because of binding-energy losses and a reduction in the Coulomb repulsion of the major fragments. To test this hypothesis, counter-telescope experiments aimed at detecting and identifying these light particles were performed. In 439 SF events 3 + 3 protons of the appropriate energy were observed, too few to account for the kinetic energy deficit in the fission of /sup 259/Md. There seems to be no explanation for this problem within the framework of current fission theory. These results are discussed along with preliminary measurements of light-particle emission in the SF of /sup 256/Fm. 5 figures.

Hulet, E.K.; Wild, J.F.; Lougheed, R.W.; Baisden, P.A.; Dougan, R.J.; Mustafa, M.G.

1980-10-01T23:59:59.000Z

279

The sGang steng-b rNying ma'i rGyud manuscript from Bhutan  

E-Print Network (OSTI)

first folios, itsimply gives the volume identification and pagination in gold ink. 6 Volumes Ka, Pa, Ra, Ha to Ki, Gi, Ci, Chi, Nyi, Thi, Ni, Pi, Bi, and Mi 7 This is unlike the Rig 'dzin edition, where...

Cathy Cantwell; Mayer, Rob

2006-01-01T23:59:59.000Z

280

Development of the East Asian monsoon: Mineralogical and sedimentologic records in the northern South China Sea since 20 Ma  

E-Print Network (OSTI)

Development of the East Asian monsoon: Mineralogical and sedimentologic records in the northern Abstract We here reconstruct the past change of the East Asian monsoon since 20 Ma using samples from Ocean monsoon evolution. The consistent variation of these independent proxies since 20 Ma shows three profound

Clift, Peter

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Third-order gas-liquid phase transition and the nature of Andrews critical Tian Ma and Shouhong Wang  

E-Print Network (OSTI)

Third-order gas-liquid phase transition and the nature of Andrews critical point Tian Ma-order gas-liquid phase transition and the nature of Andrews critical point Tian Ma1 and Shouhong Wang2 1 is to study the nature of the Andrews critical point in the gas-liquid transition in a physical

Wang, Shouhong

282

Effects of diagenesis on the Nd-isotopic composition of black shales from the 420 Ma Utica Shale Magnafacies  

E-Print Network (OSTI)

Effects of diagenesis on the Nd-isotopic composition of black shales from the 420 Ma Utica Shale Abstract The Utica black shales were deposited in the Taconic Foreland basin 420 Ma ago. The organic matter in these shales is of marine origin and the timing of deposition of these shales has been constrained

Basu, Asish R.

283

u.s. DEPARTIIIENT OF ENERGY EERE PROJECT MA N A GE M E~ T CENT  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MA N A GE M E~ T CENT MA N A GE M E~ T CENT ER NEPA DETERlIlINATION Page 1 of2 RECIPIENT:Power Environmental Energy Research Institute STATE: CO PROJECT TITLE: Novel Multidimensional Tracers for Geolhermallnter-Well Diagnostics Funding Opportunity Announcement Number DE-PS36-09G099018 Procurement Instrument Number OE·EEOOO3032 NEPA Control Number GFO-1 0-345 CID Number G03032 Based on my review orlhe Information concerning the proposed action, as NEPA Compliance Officer (authoriud under DOE Order 4SI.IA),1 have made the following determination: ex, EA, [IS APPENDIX AND NUMBER: Description: 83.1 Onsile and offsite site characterization and environmental monitoring. including siting, construction (or modification), operation, and dismantlement or closing (abandonment) of characterization and monitoring devices and siting,

284

MHK Projects/GCK Technology Cape Cod Canal MA US | Open Energy Information  

Open Energy Info (EERE)

GCK Technology Cape Cod Canal MA US GCK Technology Cape Cod Canal MA US < MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.7433,"lon":-70.6093,"alt":0,"address":"","icon":"http:\/\/prod-http-80-800498448.us-east-1.elb.amazonaws.com\/w\/images\/7\/74\/Aquamarine-marker.png","group":"","inlineLabel":"","visitedicon":""}]}

285

u.s. DEPARTMENT OF ENERGY EERE PROJECT MA->.IAGEMENT CENTER  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MA->.IAGEMENT CENTER MA->.IAGEMENT CENTER NEPA DETFRMINATION RECIPIENT;AWS Truepower, LlC Page 1 of2 STATE: NY PROJECT TITLE: National Offshore Wind Energy Resource and Design Data Campaign - Analysis and Collaboration Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CIO Number DE-FOA-0000414 DE-EEOOO5372 GF0-0005372-OO1 0 Based on my review oflhe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4S1.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering, analysis, and dissemination Information gathering (including, but not limited to, literature surveys, inventories, site visits, and audits), data analysis (including, but not limited to, computer modeling), document preparation (including, but not limited to, conceptual design,

286

MHK Projects/GCK Technology Merrimack River Amesbury MA US | Open Energy  

Open Energy Info (EERE)

River Amesbury MA US River Amesbury MA US < MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.8549,"lon":-70.9267,"alt":0,"address":"","icon":"http:\/\/prod-http-80-800498448.us-east-1.elb.amazonaws.com\/w\/images\/7\/74\/Aquamarine-marker.png","group":"","inlineLabel":"","visitedicon":""}]}

287

u.s. DEPARTMENT OF ENERGY EERE PROJECT MA:-.IAGEMENT CENTER  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MA:-.IAGEMENT CENTER MA:-.IAGEMENT CENTER NEPA DETERMINATION RECIPIENT:Utah State University PROJECT TITLE: Alternative and Unconventional Energy Research and Development Page 1 of2 STATE: UT Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number cm Number COP DE-EEOOO3114 GF0-0003114-OO2 0 Based on my review or the information concerning the proposed action, as NEPA Compliance Officer (authorized under DO E Order 45 1.1A), I have made the following determination: CX, EA, [IS APPENDIX AND NUMBER: Description: B3.6 Siting. oonstruction (or modification), operation. and decommissioning of facilities for indoor bench-scale research projects and oonventionallaboratory operations (for example. preparation of chemical standards and sample analysis):

288

U.S. DEPARTMENT OF ENERGY EERE PROJECT MA>" AGEMENT CENTER NEPA DETERMINATION  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MA>" AGEMENT CENTER MA>" AGEMENT CENTER NEPA DETERMINATION RECIPIENT:Oregon Department of Energy PROJECT TITLE: Oregon EECBG Fonnula - City of Winston Page I of3 STATE: OR Funding Opportunity Announcement Number DE-FOA-OOOOO13 Procurement Instrument Number NEPA Control Number em Number EEO Based on my review crthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4Sl.I A), I have made the (ollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description : B1.3 Routine maintenance activities and custodial services for buildings, structures, rights-of-way, infrastructures (e.g .* pathways, roads, and railroads ), vehides and eqUipment, and localized vegetatJon and pest control, dunng which operations may be suspended and resumed. Custodial services are activities to preserve facility appearance, worl

289

U.S. DEPARTMENT OF ENERGY EERE PROJECT MA,"iAGEMENTCENTER NEPADETl!RMINATION  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MA,"iAGEMENTCENTER MA,"iAGEMENTCENTER NEPADETl!RMINATION RECIPIENT:CU Cfeantech -- University of Colorado PROJECT TITLE: CU Cleantech New Venture Challenge Page 1 of2 STATE: CO Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number elD Number DE-FOAOOOOS70 EE0005600 GFO-OOO5600-OO1 0 Based on my review of the information concerning tbe proposed action, as NEPA Compliance Officer (authorized under DOE Order 4Sl.1A), I have made the (ollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering, analysis, and disseminatio n Information gathering (including, but not limited to, literature surveys, inventories, site visits, and audits). data analysis (including. but not limited to, computer modeling), document preparation (including. but not limited to, conceptual design,

290

u.s. DEPARTMENT OF ENERGY EERE PROJECT MA..\lAGEMENT CENTER  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

lAGEMENT CENTER lAGEMENT CENTER NFPA DEl'ERAllNAIION RECIPIENT:MA DEPT. OF ENERGY RESOURCES PROJECT TITLE: STATE ENERGY PROGRAM (SEP) Page 1 of2 STATE: MA Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CIO Number DE·FOA.()()()()643 R130372 GF0-0130372-OO1 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authori;.o;ed under DOE Order 45 1.lA), I have made the following de termination : ex, EA, EIS APPENDIX AND NUMBER: Description: A11 Technical advice and as sistance to o rganizations A9 Info rm at ion gathering, analysis, and d issemination Rational for detennination: Technical advice and planning assistance to international, national, state, and local organizations. Information gathering (including, but nollimited to, literature surveys, inventories, site visits, and

291

U.S. DEP.~TMENT OF ENERGY EERE PROJECT MA,\jAGEMENT CENTER  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MA,\jAGEMENT CENTER MA,\jAGEMENT CENTER NEPA DETERMINATION Page I of2 RECIPIENT: EECBG - American Samoa Government Territorial Energy Office STATE: AS PROJECT TITLE: Improving Recycling Capacity and Solid Waste Education in American Samoa Funding Opportunity Announcement Number PrO(urement Instrument Number DE-EEOOOOB34 NEPA Control Number GFO-OOOO634.Q01 em Number o Based on my review oftbe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4S1.1A), I have made the (ollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 81 .31 installation or relocation of machinery and equipment Installation or relocation and operation of machinery and equipment (including, but not limited la, laboratory equipment, electronic hardware, manufacturing machinery, maintenance equipment, and health and safety equipment), provided that

292

MaGe - a Geant4-based Monte Carlo framework for low-background experiments  

E-Print Network (OSTI)

A Monte Carlo framework, MaGe, has been developed based on the Geant4 simulation toolkit. Its purpose is to simulate physics processes in low-energy and low-background radiation detectors, specifically for the Majorana and Gerda $^{76}$Ge neutrinoless double-beta decay experiments. This jointly-developed tool is also used to verify the simulation of physics processes relevant to other low-background experiments in Geant4. The MaGe framework contains simulations of prototype experiments and test stands, and is easily extended to incorporate new geometries and configurations while still using the same verified physics processes, tunings, and code framework. This reduces duplication of efforts and improves the robustness of and confidence in the simulation output.

Yuen-Dat Chan; Jason A. Detwiler; Reyco Henning; Victor M. Gehman; Rob A. Johnson; David V. Jordan; Kareem Kazkaz; Markus Knapp; Kevin Kroninger; Daniel Lenz; Jing Liu; Xiang Liu; Michael G. Marino; Akbar Mokhtarani; Luciano Pandola; Alexis G. Schubert; Claudia Tomei

2008-02-06T23:59:59.000Z

293

On Larkin-Imry-Ma State of 3He-A in Aerogel  

E-Print Network (OSTI)

Superfluid 3He-A shares the properties of spin nematic and chiral orbital ferromagnet. Its order parameter is characterized by two vectors d and l. This doubly anisotropic superfluid, when it is confined in aerogel, represents the most interesting example of a system with continuous symmetry in the presence of random anisotropy disorder. We discuss the Larkin-Imry-Ma state, which is characterized by the short-range orientational order of the vector l, while the long-range orientational order is destroyed by the collective action of the randomly oriented aerogel strings. On the other hand, sufficiently large regular anisotropy produced either by the deformation of the aerogel or by applied superflow suppresses the Larkin-Imry-Ma effect leading to the uniform orientation of the vector l. This interplay of regular and random anisotropy allows us to study many different effects.

G. E. Volovik

2007-04-19T23:59:59.000Z

294

On Larkin-Imry-Ma State of 3He-A in Aerogel  

E-Print Network (OSTI)

Superfluid 3He-A shares the properties of spin nematic and chiral orbital ferromagnet. Its order parameter is characterized by two vectors d and l. This doubly anisotropic superfluid, when it is confined in aerogel, represents the most interesting example of a system with continuous symmetry in the presence of random anisotropy disorder. We discuss the Larkin-Imry-Ma state, which is characterized by the short-range orientational order of the vector l, while the long-range orientational order is destroyed by the collective action of the randomly oriented aerogel strings. On the other hand, sufficiently large regular anisotropy produced either by the deformation of the aerogel or by applied superflow destroys the Larkin-Imry-Ma effect leading to the uniform orientation of the vector l. This interplay of regular and random anisotropy allows us to study many different effects.

Volovik, G E

2007-01-01T23:59:59.000Z

295

mise jour: 09/12/2009 Rapport de ma mission au Pakistan  

E-Print Network (OSTI)

1 mise à jour: 09/12/2009 Rapport de ma mission au Pakistan ?cole de recherche CIMPA du 22 au 28://www.lums.edu.pk/> pour y donner une conférence dans le cadre de French Science Tour in Pakistan Science Tour in Pakistan. · Samedi 28 février, 8 exposés organisés par Juergen Herzog permettant à des

Waldschmidt, Michel

296

mise jour: 30/03/2009 Rapport de ma mission au Pakistan  

E-Print Network (OSTI)

1 mise à jour: 30/03/2009 Rapport de ma mission au Pakistan ?cole de recherche CIMPA du 22 au 28://www.lums.edu.pk/> pour y donner une conférence dans le cadre de French Science Tour in Pakistan Science Tour in Pakistan. · Samedi 28 février, 8 exposés organisés par Juergen Herzog permettant à des

Waldschmidt, Michel

297

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA

298

miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay

299

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....

300

u.s. DEPARTMENT OF ENERGY EERE PROJECT MA,'lAGEMENT CENTER NEPA DETERMINATION  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

'lAGEMENT CENTER 'lAGEMENT CENTER NEPA DETERMINATION RECIPIENT:WL Gore and Associates Page 1 of2 STATE: MD PROJECT TITLE: Manufacturing of low Cost, Durable Membrane Electrode Assemblies for Rapid Conditioning Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CIO Number DE-PS.()7G097012 G018052 GFO-1Q..383 G018052 Based on my review of the information (oncerRing tbe proposed action, as NEPA Compliance Officer (.uthori ... .ed under DOE Order4SI.IA), I bave made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 8 3.6 Siting, construction (or modification), operation, and decommissioning of facilities for indoor bench-scale research projects and oonventJonallaboratory operations (for example, preparation of dlerlllcal standards and sample analYSIS);

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

MaRIE X-Ray Free-Electron Laser Pre-Conceptual Design  

SciTech Connect

The proposed Matter-Radiation Interactions in Extremes (MaRIE) facility at the Los Alamos National Laboratory will include a 50-keV X-Ray Free-Electron Laser (XFEL), a significant extension from planned and existing XFEL facilities. To prevent an unacceptably large energy spread arsing from energy diffusion, the electron beam energy should not exceed 20 GeV, which puts a significant constraint on the beam emittance. A 100-pC baseline design is presented along with advanced technology options to increase the photon flux and to decrease the spectral bandwidth through pre-bunching the electron beam.

Carlsten, Bruce E. [Los Alamos National Laboratory; Barnes, Cris W. [Los Alamos National Laboratory; Bishofberger, Kip A. [Los Alamos National Laboratory; Duffy, Leanne D. [Los Alamos National Laboratory; Heath, Cynthia E. [Los Alamos National Laboratory; Marksteiner, Quinn R. [Los Alamos National Laboratory; Nguyen, Dinh Cong [Los Alamos National Laboratory; Russell, Steven J. [Los Alamos National Laboratory; Ryne, Robert D. [Los Alamos National Laboratory; Sheffield, Richard L. [Los Alamos National Laboratory; Simakov, Evgenya I. [Los Alamos National Laboratory; Yampolsky, Nikolai A. [Los Alamos National Laboratory

2011-01-01T23:59:59.000Z

302

An Analysis of Wind Power Development in the Town of Hull, MA  

DOE Green Energy (OSTI)

Over the past three decades the Town of Hull, MA has solidified its place in U.S. wind energy history through its leadership in community-based generation. This is illustrated by its commissioning of the first commercial-scale wind turbine on the Atlantic coastline, the first suburban-sited turbine in the continental United States, pursuit of community-based offshore wind, and its push toward creating an energy independent community. The town's history and demographics are briefly outlined, followed by experience in projects to provide wind power, including pre-construction and feasibility efforts, financial aspects, and market/industry factors.

Adams, Christopher

2013-06-30T23:59:59.000Z

303

SIMULATION AND OPTIMISATION OF A 100MA DC PHOTO-INJECTOR  

SciTech Connect

A prototype 100mA injector is presently being designed and manufactured jointly between Thomas Jefferson National Accelerator Facility (JLab) and Advanced Energy Systems (AES). This paper discusses the physics optimization and performance of the injector which has been studied using the space-charge tracking code ASTRA. The objective is to operate the 7MeV injector with 135pC electron bunches at 748.5MHz repetition rate. We show that the longitudinal and transverse electron bunch properties can be realized within the constraints of the design.

Fay Hannon; Carlos Hernandez-Garcia

2006-08-03T23:59:59.000Z

304

Addition-based exponentiation modulo 2k A. Fit-Florea, D.W. Matula and M.A. Thornton  

E-Print Network (OSTI)

Addition-based exponentiation modulo 2k A. Fit-Florea, D.W. Matula and M.A. Thornton A novel method doi: 10.1049/el:20057538 A. Fit-Florea, D.W. Matula and M.A. Thornton (Southern Methodist University', Electron. Lett., 1994, 30, (25), pp. 2115­ 2116 3 Fit-Florea, A., and Matula, D.W.: `A digit

Thornton, Mitchell

305

Impacts of Historical Land Use on Soil Nitrogen Cycles in Falmouth, MA and the Threat of Chronic N Amendment Demonstrated at the  

E-Print Network (OSTI)

Amendment Demonstrated at the Harvard Forest LTER, Petersham, MA Brook Brouwer1 Advisor: Christopher Neill2, in Petersham, MA. At each site I measured: pH, C:N ratios, extractable inorganic nitrogen pools, net N Amendment Demonstrated at the Harvard Forest LTER, Petersham, MA" Brook Brouwer Introduction

Vallino, Joseph J.

306

Everett, MA Natural Gas Liquefied Natural Gas Imports from Trinidad and  

Gasoline and Diesel Fuel Update (EIA)

Liquefied Natural Gas Imports from Trinidad and Tobago (Million Cubic Feet) Liquefied Natural Gas Imports from Trinidad and Tobago (Million Cubic Feet) Everett, MA Natural Gas Liquefied Natural Gas Imports from Trinidad and Tobago (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 10,240 11,488 7,086 8,271 8,126 8,150 7,731 7,870 5,199 5,520 9,264 4,691 2012 9,482 8,458 7,661 1,447 4,940 5,465 6,646 10,377 5,634 4,748 2,553 2,581 2013 5,126 5,003 4,629 5,171 5,626 5,173 8,023 5,961 2,995 2,674 - = No Data Reported; -- = Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Release Date: 1/7/2014 Next Release Date: 1/31/2014 Referring Pages: U.S. Liquefied Natural Gas Imports by Point of Entry Everett, MA LNG Imports from Trinidad/Tobago

307

Elemental characterization of LL-MA radioactive waste packages with the associated particle technique  

Science Conference Proceedings (OSTI)

The French Alternative Energies and Atomic Energy Commission (CEA) and National Radioactive Waste Management Agency (ANDRA) are conducting an R and D program to improve the characterization of long-lived and medium activity (LL-MA) radioactive waste packages with analytical methods and with non-destructive nuclear measurements. This paper concerns fast neutron interrogation with the associated particle technique (APT), which brings 3D information about the waste material composition. The characterization of volume elements filled with iron, water, aluminium, and PVC in bituminized and fibre concrete LL-MA waste packages has been investigated with MCNP [1] and MODAR data analysis software [2]. APT provides usable information about major elements presents in the volumes of interest. However, neutron scattering on hydrogen nuclei spreads the tagged neutron beam out of the targeted volume towards surrounding materials, reducing spatial selectivity. Simulation shows that small less than 1 L targets can be characterised up to the half-radius of a 225 L bituminized drum, the matrix of which is very rich in hydrogen. Deeper characterization in concrete is possible but limited by counting statistics due to photon attenuation in this dense matrix and, unless large inspection volumes are considered, by the lack of spatial selectivity of the tagged neutron beam due to neutron scattering. (authors)

Perot, B.; Carasco, C.; Toure, M.; El Kanawati, W.; Eleon, C. [CEA, DEN, Cadarache, Nuclear Measurement Laboratory, F-13108 Saint-Paul-lez-Durance (France)

2011-07-01T23:59:59.000Z

308

miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li

2009-01-01T23:59:59.000Z

309

DOE Challenge Home Case Study, Transformation, Inc., Production House, Devens, MA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Production House Production House Devens, MA BUILDING TECHNOLOGIES OFFICE DOE Challenge Home builders are in the top 1% of builders in the country meeting the extraordinary levels of excellence and quality specifi ed by the U.S. Department of Energy. Every DOE Challenge Home starts with ENERGY STAR for Homes Version 3 for an energy-effi cient home built on a solid foundation of building science research. Then, even more advanced technologies are designed in for a home that goes above and beyond current code to give you the superior quality construction, HVAC, appliances, indoor air quality, safety, durability, comfort, and solar-ready components along with ultra-low or no utility bills. This provides homeowners with a quality home that will last for generations to come.

310

DEPART:MENT OF ENERGY EERE PROJECT MA..'JAGEMENT CENTER NEPA DETERMINATION  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MENT OF ENERGY MENT OF ENERGY EERE PROJECT MA..'JAGEMENT CENTER NEPA DETERMINATION Page 1 of2 RI<:CIPIENT:Wyoming Business Council, State Energy Office STATE: WY PROJECT TITLE: State Energy Program (SEP) PY 2012 Forumla Grant funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000643 DE-FG26-07NT43207 GF(H)()43207-OO1 Based on my review of the information concerning the proposed aetion, as NEPA Compliance Officer (authorized under DOE Order 4SI.IA), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering, analysis, and dissemination A11 Technical advice and assistance to organizations Rational for detennination: Information gathering (including, but not limited to, literature surveys, inventories, site visits, and

311

EERE PROJECT MA.NAGEMENT CENTER NEPA DFTFIU.1INATION PROJECT  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Atchison Atchison u.s. DI!PARThIl1NT OF l?NERGY EERE PROJECT MA.NAGEMENT CENTER NEPA DFTFIU.1INATION PROJECT TITLE: EECBG DE-EEOOOO727 Atchison Library Ground Source Heat Pump Page 1 of2 STATE : KS Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE FOA 0000013 0 Based on my review of the information tORcuning the proposed action, as NEPA Compliam::e Officer (authorized under DOE Order 451.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 8 5.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical

312

Procurement Directors FROM: Office of Procurement and Assistance Policy, MA-61  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

July 25,2008 July 25,2008 Procurement Directors FROM: Office of Procurement and Assistance Policy, MA-61 Office of Procurement and Assistance Management SUBJECT: Acquisition Letter 2008-02, Audit Management SUMMARY: Attached is Acquisition Letter (AL) 2008-02, Audit Management. It provides guidance to contracting officers on effective management of contract audits for non-M&O prime ;ontracts as well as subcontracts under management and operating (M&O) contracts. This Acquisition Letter replaces AL 2006-12, Corporate Audit Management Program (CAMP), which is cancelled. This Flash and its attachment will be online within a day, at the following website: http:l/mananernent.ener~.~ov/polic~ guidance/volicv flashes-htm. Questions concerning this policy flash should be directed to Helen Oxberger at (202) 287-1332

313

U.S. DEPARTMENT OF ENERGY EERE PROJECT MA.>.JAGEMENT CENTER  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

, .* !. , .* !. U.S. DEPARTMENT OF ENERGY EERE PROJECT MA.>.JAGEMENT CENTER NEPA DETERMINATION RECIPIENT:Laram!e County Community College PROJECT TITLE: LeGe Ulilty-Scale Wind Energy Technology Page 1 of2 STATE: WY Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-PS36-09G099OO9 DE-EEOOOO538 GFO-10-052 0 Based on my review of the information concerning the proposed action, as Nt:PA Compliance Officer (autbori7.ed under DOE Order 451.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathenng (including, but not limited to, literature surveys, Inventones, audits), data analySIS (including computer modeling), document preparation (such as oonceptual des'9n or feasibility studies, analytical energy supply

314

U.S. DEP.'\RTMENT OF ENERGY EERE PROJECT MA.1II AGEMENT CENTER  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

'\RTMENT OF ENERGY '\RTMENT OF ENERGY EERE PROJECT MA.1II AGEMENT CENTER NEPA DETERMINATION RECIPIENT :Freshwater Wind I. lLC PROJECT TITLE: Shallow Water Offshore Wind System Optimization for the Great Lakes Page 1 of2 STATE: OH Funding Opportunity Announcement Number Procurement Instl"ument Number NEPA Control Number elD Number DE-FOA.Q000415 DE-EEOOOO5488 GFO-OOO5488-001 0 Based on my nview or the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4SUA),. have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathertng, analysis, and dissemination Information gathering (including, but not limited to, literature surveys, inventories, site Visits, and audits). data analysis

315

TO: Procurement Directors FROM: Office of Procurement and Assistance Policy, MA-61  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

August 23,2010 August 23,2010 TO: Procurement Directors FROM: Office of Procurement and Assistance Policy, MA-61 Office of Procurement and Assistance Management SUBJECT: Acquisition Templates SUMMARY: On March 29,2010, four draft acquisition templates (Confidentiality Certificate, Conflicts of Interest Certificate, Letter to Unsuccessful Offeror and Letter to Successful Offeror) were distributed for Procurement Director (PD) and Head of Contracting Activity (HCA) review and comment. All comments received were considered and changes were made as appropriate. The final versions of the four aforementioned acquisition templates will be e-mailed directly to the Procurement Directors and made available in the STRIPES Library. This Flash and its attachments will be available online within a day, at the following website:

316

U.S. DEPARTI\lIENT OF ENERGY EERE PROJECT MA."IAGEMENT CENTER  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

lIENT OF ENERGY lIENT OF ENERGY EERE PROJECT MA."IAGEMENT CENTER NEPA DETERMINATION RECIPIENT:Louisiana State University and A&M College Page 1 of2 STATE: LA PROJECT TITLE: Geothennal Resource Development with Zero Mass Withdrawal, Engineered Free Convection, and Wellbore Energy Conversion Funding Opportunity ADDounc:ement Number Procurement Instrument Number NEPA Control Number CID Number DE-F0-0000336 OE-EEOOO5125 GF0-0005125-001 0 Based on my review (lrtbe infor madOD concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4S1.1A),1 have' made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (induding, but not limited to, literature surveys, inventories, audits). data analysIs (including

317

U.S. DEPAR.Th.IENT OF ENERGY EERE PROJECT MA'\IAGEME~TCE~TER  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Th.IENT OF ENERGY Th.IENT OF ENERGY EERE PROJECT MA'\IAGEME~TCE~TER NEPA DETFID..ITNATION RECIPIENT:Ciemson University PROJECf TITLE: Clemson University 15MW Hardware-In-the-Loop (HIL) Grid Simulator Page 1 of2 STATE: SC Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number N/A (DNFA) DE-EE0005723 GF0-0005723-001 Based on my review of the information concerning tbe proposed action, as NEPA Compliance Officer (authorized under DOE Order 45l.1A), l have made tbe foUowing determination: CX, EA, EIS APPENDIX AND NUMBER: Description: A9 Information Information gathering (including, but not limited to, literature surveys, inventories, site visits, and audits), gathering, analysis, data analysis (including, but not limited to, computer modeling), document preparation (including, but

318

u.s. DEP.-\RTMENT OF ENERGY EERE PROJECT MA. AGEMENT CENTER  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

RTMENT OF ENERGY RTMENT OF ENERGY EERE PROJECT MA. AGEMENT CENTER NEPA DETERMINATION RECIPIENT :louisiana Department of Natural Resources PROJECT TITLE: State of louisana ARRA-EECBG-St. James Parish (Tl Page 1 of2 STATE : LA Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-OOOOO13 EEOOOO735 0 Based on my review or lhe information concerning tbe proposed action, as NEPA Compliance Officer (autborized under DOE Order 4S1.1A), I bave made the (ollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do nol increase the indoor concentrations of potentially harmful substances. These actions may involve financia

319

LDRD Final Report (08-ERD-037): Important Modes to Drive Protein MD Simulations to the Next Conformational Level  

SciTech Connect

Every action in biology is performed by dynamic proteins that convert between multiple states in order to engage their functions. Often binding to various ligands is essential for the rates of desired transitions to be enhanced. The goal of computational biology is to study these transitions and discover the different states to fully understand the protein's normal and diseased function, design drugs to target/bias specific states, and understand all of the interactions in between. We have developed a new methodology that is capable of calculating the absolute free energy of proteins while taking into account all the interactions with the solvent molecules. The efficiency of the new scheme is an order of magnitude greater than any existing technique. This method is now implemented in the massively parallel popular MD program package NAMD. This now makes it possible to calculate the relative stability of different conformational states of biological macromolecules as well as their binding free energies to various ligands.

Sadigh, B

2011-04-07T23:59:59.000Z

320

Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)

2010-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)

2012-07-01T23:59:59.000Z

322

DEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE  

E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.

323

MA FI QPR Scoring Elements 4th Qtr FY 2009 Revision v1.xls  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Reference Reference Due Date Element Measure Critical? Score > ≤ 8/15 8/15 8/22 8/22 95% 100% 80% 95% 0% 80% 2.0% 1.8% 2.0% 0.0% 1.8% 1.0% 0.5% 1.0% 0.0% 0.5% 8/30 8/30 99.9% 0.0% 99.9% 9/30 9/30 9/30 9/30 Program specific elements, negotiated with Programs: Program specific measures, negotiated with Programs: Overall Score: Green * All critical elements green, and * No more then one non-critical element yellow Yellow * Any critical element yellow, or * Any non-critical red, or * Two or more non-critical elements yellow Red * Any critical element red or * Two or more non-critical elements red TYRT September 30, 2009 Input submitted to update TYRT Submission timeliness 1 1 2 2 Enter Date or Percentage Proximity to spending target August 15, 2009 Overall Score: Yes MA F&I Quarterly Performance Report

324

?ot8rh QI ahnloal Corporation In Hart IUnover, Ma86rohusett8,  

Office of Legacy Management (LM)

GE 1 GE 1 ;" qr)-1 s?llq ' p raspy.. c" ifa K. mris I talked with Hr. Wllllm cIF(Iy, Metrllurgist, Wnlon CarbId@ Nuclear cOrp8ny, 08k B&t&$@, Tenne66ee, on April 26, 1961. He informed me th&t the #rtioMl Northern birislon, Ame~ic6.n ?ot8rh QI ahnloal Corporation In Hart IUnover, Ma86rohusett8, la pePfopn1~ lo8lve forming studier for the. ilnion olo)w Wuolem Conpmy "p l7?JHa). The work at National Northern l#rirc.- alon ir under the 6upenl6lon of Ehsll Phillpohuc4~, v of Spealrl Prcbduots. The @ox& to data ha8 been pwfonwd wlth 430 strlnle66 rteel and urma%um metal - both hot snb 0018 wor4c have been performed at pr688u~r fmm 100,000 to 900,000 prl. The shape of the pleu88 na not dlrolored. In 6<lon work ha6 been done with

325

Alcator C-Mod Experiments in Support of the ITER Baseline 15 MA Scenario  

SciTech Connect

Experiments on Alcator C-Mod have addressed several issues for the ITER 15 MA baseline scenario from 2009-2012. Rampup studies show ICRF can save significant V-s, and that an H-mode in the ramp can be utilized to save 50% more. ICRF modifications to li(1) are minimal, although the Te profile is peaked relative to ohmic in the plasma center, and alter sawtooth onset times. Rampdown studies show H-modes can be routinely sustained, avoiding an OH coil over-current associated with the H-L transition, that fast rampdowns are preferred, the density drops with Ip, and that the H-L transition occurs at Ploss/Pthr,LH ~ 1.0-1.3 at n/nGr ~ 0.85. Flattop plasmas targeting ITER baseline parameters have been sustained for 20 ?E or 8-13 ?CR, but only reach H98 ~ 0.6 at n/nGr = 0.85, rising to 0.9 at n/nGr = 0.65.

C Kessel, et al

2013-05-07T23:59:59.000Z

326

Geochemical records in the South China Sea: implications for East Asian summer monsoon evolution over the last 20 Ma  

E-Print Network (OSTI)

Geochemical records in the South China Sea: implications for East Asian summer monsoon evolution past changes in the East Asian summer monsoon over the last 20 Ma using samples from Ocean Drilling and combined review suggests that the long-term evolution of the East Asian summer monsoon is similar

Clift, Peter

327

On-Demand Information Portals for Disaster Yiming Ma, Dmitri V. Kalashnikov, Ram Hariharan, Sharad Mehrotra, Nalini Venkatasubramanian,  

E-Print Network (OSTI)

, and such information is indeed valuable to disaster managers or even citizens in their response. In this paper we in the response and planning during or after the disaster. This motivates us in the direction of an "InformationOn-Demand Information Portals for Disaster Situations Yiming Ma, Dmitri V. Kalashnikov, Ram

Kalashnikov, Dmitri V.

328

China's Energy Situation and Its Implications in the New by Hengyun Ma, Les Oxley and John Gibson  

E-Print Network (OSTI)

and the energy economy, in particular. Keywords: China; Energy; Fossil fuels; Renewable Energy JEL by an investigation and analysis of China's energy resources, including renewable energy. In the third section we1 China's Energy Situation and Its Implications in the New Millennium by Hengyun Ma, Les Oxley

Hickman, Mark

329

A review of geomagnetic cutoff rigidities for earth-orbiting spacecraft D.F. Smart *, M.A. Shea  

E-Print Network (OSTI)

A review of geomagnetic cutoff rigidities for earth-orbiting spacecraft D.F. Smart *, M.A. Shea Air Geomagnetic cutoff rigidities are a quantitative measure of the shielding provided by the earth?s magnetic field. More precisely, geomagnetic cutoff rigidities predict the energetic charged particle transmission

Shepherd, Simon

330

Decreasing Slip Rates From12.8 Ma to Present on the Solitario Canyon Fault at Yucca Mountain, Nevada  

DOE Green Energy (OSTI)

The Solitario Canyon fault, which bounds the west side of Yucca Mountain, Nevada, is the closest fault with Quaternary offset adjacent to the proposed spent nuclear fuel and high-level radioactive waste repository. Dip-slip offset between 12.8 and 10.7 Ma is determined from lithostratigraphic displacement in boreholes USW H-3 and USW WT-7, drilled in the footwall and hanging wall, respectively. The base of the 12.8-Ma Topopah Spring Tuff is interpreted to have 463.3 m of separation across the fault, an average dip slip rate of 0.036 mm/yr. Previous researchers identified a geothermal system active from 11.5 to 10.0 Ma with peak activity at 10.7 Ma that resulted in pervasive alteration of vitric rock to zeolitic minerals where the rocks were in the ground-water saturated zone. The contact between vitric (V) and pervasively zeolitic (Z) rocks cuts across the lithostratigraphic section and offset of this V-Z boundary can be used to measure slip rates between 12.8 and 10.7 Ma. In H-3, the V-Z boundary is 138.4 m below the base of the vitric, densely welded subzone of the Topopah Spring Tuff (Tptpv3). In WT-7, although the V-Z boundary is identified at the base of the Tptpv3, borehole video, cuttings, and geophysical log data indicate the Tptpv3 has well-developed zeolitic alteration along fractures, and this implies 19.5 m of the total thickness of Tptpv3 (and probably additional overlying crystallized rocks) also were in the saturated zone by 10.7 Ma. The V-Z relations across the Solitario Canyon fault in H-3 and WT-7 indicate a minimum of 157.9 m of separation before 10.7 Ma, which is 34.1 percent of the total slip of the Topopah Spring Tuff, and a minimum dip slip rate of 0.075 mm/yr from 12.8 to 10.7 Ma. These data are consistent with the broader structural history of the area near Yucca Mountain. Previous workers used angular unconformities, tilting of structural blocks, and paleomagnetic data to constrain the main period of extensional faulting between 12.7 and 8.5 Ma. Paleoseismic studies in Quaternary deposits documented slip rates on the Solitario Canyon fault from 0.01 to 0.02 mm/yr since 0.077 and 0.20 Ma. The decrease of extensional activity slip rates data on the Solitario Canyon fault provide evidence of decreasing tectonic activity from the middle Miocene to present.

D. Buesch

2006-07-11T23:59:59.000Z

331

Hille Ris Lambers 1 Curriculum vitae  

E-Print Network (OSTI)

Forest, Petersham, MA 1998: Ecological Society of America Annual Meeting. Baltimore, MD 1997: Ecological

Hille Ris Lambers, Janneke

332

Paleogene cooling (55-30 MA) as inferred from oxygen isotope variation within mollusc shells  

E-Print Network (OSTI)

Paleogene cooling (c. 50-30 Ma) started sometime in the early-middle Eocene. This was a time when high-latitude and deep-sea temperatures were significantly warmer than today. This cooling culminated during the earliest Oligocene marked by the sudden appearance of a major continental glacier on Antarctica. We examine this cooling trend by analyzing oxygen isotope variation within mollusc shells from the Gulf Coastal Plain of the southern U.S. Our records show a secular cooling trend of mean annual temperature (MAT) in the Mississippi Embayment from an early Eocene tropical climate (26-27 ?C), with a seasonal temperature range (seasonality) of ~6 ?C, to an Oligocene paratropical climate (22-23?C) with an seasonality of ~8 ?C. These temperature records agree well with terrestrial climate proxies. This secular cooling trend, combined with sea-level change, was likely one of the major causes of molluscan turnover in the Mississippi Embayment to cool-tolerant taxa along the Paleogene cooling. Winter temperatures steadily decreased from the middle Eocene to early Oligocene. This contrasts with the sudden winter cooling at Eocene-Oligocene boundary proposed by Ivany et al. (2000). We examined seasonal temperature distribution of the modern marine shelf of the present northern U.S. Gulf Coast. A deeper water temperature model fits well with isotopic temperature profiles derived from fossils shells of the Red Bluff and Yazoo Formations shells, consistent with the paleobathymetry estimates inferred from independent proxies. This reveals that depth effect is one of the major factors controlling seasonality recorded in mollusc shells, resulting in decreasing MAT estimates when temperature stratification exists as in the present ocean. Warm Eocene low-latitude temperatures derived from molluscan oxygen isotope data agree with computer modeling results incorporating higher greenhouse gas concentrations. This supports the contention that the major reason for warm earth climate is elevated concentration of the greenhouse gases, giving a new insight for future climate response to anthropogenic CO? increase.

Kobashi, Takuro

2001-01-01T23:59:59.000Z

333

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See Block 16C I  

National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)

334

File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload

335

MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.

2011-05-01T23:59:59.000Z

336

Microsoft Word - figure_8.doc  

Gasoline and Diesel Fuel Update (EIA)

T I D O R W Y ND SD C A N V U T CO NE KS A Z NM OK TX MN WI MI IA I L IN OH MO AR M S AL GA T N KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI A K J a p a n Mexico M e x...

337

U.S. DEPARTMENT OF ENERGY EERE PROJECT MA;"AGEMENT CENTER NEPA DET1!R1.IINATION  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

O". )' O". )' U.S. DEPARTMENT OF ENERGY EERE PROJECT MA;"AGEMENT CENTER NEPA DET1!R1.IINATION RECIPIENT:Resolute Marine Energy, Inc. PROJECT TITLE: Wave-Actuated Power Take Off Device for Electricity Generation Page 1 of2 STATE: MA Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE-FOA-OOOO293 DE-EEOOO4565 GFO-OOO4565-001 0 Based on my review orthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Ordtr451.IA), I have made tbe rollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including , but not limited to, literature surveys, inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply

338

Near quantitative agreement of model free DFT- MD predictions with XAFS observations of the hydration structure of highly charged transition metal ions  

Science Conference Proceedings (OSTI)

DFT-MD simulations (PBE96 and PBE0) with MD-XAFS scattering calculations (FEFF9) show near quantitative agreement with new and existing XAFS measurements for a comprehensive series of transition metal ions which interact with their hydration shells via complex mechanisms (high spin, covalency, charge transfer, etc.). This work was supported by the U.S. Department of Energy (DOE), Office of Basic Energy Sciences, Division of Chemical Sciences, Geosciences and Biosciences. Pacific Northwest National Laboratory (PNNL) is operated for the U.S. DOE by Battelle. A portion of the research was performed using EMSL, a national scientific user facility sponsored by the U.S. DOE's Office of Biological and Environmental Research and located at Pacific Northwest National Laboratory.

Fulton, John L.; Bylaska, Eric J.; Bogatko, Stuart A.; Balasubramanian, Mahalingam; Cauet, Emilie L.; Schenter, Gregory K.; Weare, John H.

2012-09-20T23:59:59.000Z

339

Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab

2007-03-01T23:59:59.000Z

340

Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A

2008-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

DOE/EIA-0131(96) Distribution Category/UC-960 Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

ID ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Interstate Movements of Natural Gas in the United States, 1996 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL KY (T) MA ME (T) AL LA MA NH (T) AL MO (T) MA NJ (T) AL SC MD DC CT RI RI MA DE MD VA DC MA CT (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 906,407 355,260 243,866 220 384,311 576,420 823,799 842,114 27,271 126,012 133 602,841 266 579,598 16,837 268,138 48,442 182,511 219,242 86,897 643,401 619,703 8,157 937,806 292,711 869,951 12,316 590,493 118,256

342

Final environment impact report supplement: Northeast corridor improvement project electrification: New Haven, CT to Boston, MA. Final report  

SciTech Connect

This document is a supplement to the final environmental impact report (FEIR) published in October 1994 on the proposal by the National Railroad Passenger Corporation (Amtrak) to complete the electrification of the Northeast Corridor main line by extending electrification from New Haven, CT, to Boston, MA. The purpose of this supplement is to provide additional information relative to: the Roxbury Substation Alternative Analysis; an expanded discussion on mitigation of potential adverse impacts; draft Section 61 findings; the Memorandum of Understanding between Amtrak and the Massachusetts Bay Transportation Authority (MBTA) for Route 128 Station; Amtrak`s draft outreach program; and to address other Massachusetts Environmental Policy Act concerns.

NONE

1995-02-01T23:59:59.000Z

343

Gluonic Higgs Scalar, Abelianization and Monopoles in QCD -- Similarity and Difference between QCD in the MA Gauge and the NAH Theory  

E-Print Network (OSTI)

We study the similarity and the difference between QCD in the maximally abelian (MA) gauge and the nonabelian Higgs (NAH) theory by introducing the ``gluonic Higgs scalar field'' $\\vec \\phi(x)$ corresponding to the ``color-direction'' of the nonabelian gauge connection. The infrared-relevant gluonic mode in QCD can be extracted by the projection along the color-direction $\\vec \\phi(x)$ like the NAH theory. This projection is manifestly gauge-invariant, and is mathematically equivalent to the ordinary MA projection. Since $\\vec \\phi(x)$ obeys the adjoint gauge transformation and is diagonalized in the MA gauge, $\\vec \\phi(x)$ behaves as the Higgs scalar in the NAH theory, and its hedgehog singularity provides the magnetic monopole in the MA gauge like the NAH theory. We observe this direct correspondence between the monopole appearing in the MA gauge and the hedgehog singularity of $\\vec \\phi(x)$ in lattice QCD, when the gluon field is continuous as in the SU($N_c$) Landau gauge. In spite of several similarities, QCD in the MA gauge largely differs from the NAH theory in the two points: one is infrared monopole condensation, and the other is infrared enhancement of the abelian correlation due to monopole condensation.

Hideo Suganuma; Hiroko Ichie

2004-07-07T23:59:59.000Z

344

Large Scale Computing Requirements for Basic Energy Sciences (An BES / ASCR / NERSC Workshop) Hilton Washington DC/Rockville Meeting Center, Rockville MD 3D Geophysical Imaging  

NLE Websites -- All DOE Office Websites (Extended Search)

Requirements Requirements for Basic Energy Sciences (An BES / ASCR / NERSC Workshop) Hilton Washington DC/Rockville Meeting Center, Rockville MD 3D Geophysical Modeling and Imaging G. A. Newman Lawrence Berkeley National Laboratory February 9 - 10 , 2010 Talk Outline * SEAM Geophysical Modeling Project - Its Really Big! * Geophysical Imaging (Seismic & EM) - Its 10 to 100x Bigger! - Reverse Time Migration - Full Waveform Inversion - 3D Imaging & Large Scale Considerations - Offshore Brazil Imaging Example (EM Data Set) * Computational Bottlenecks * Computing Alternatives - GPU's & FPGA's - Issues Why ? So that the resource industry can tackle grand geophysical challenges (Subsalt imaging, land acquisition, 4-D, CO2, carbonates ......) SEAM Mission Advance the science and technology of applied

346

U.S. DEPAR.Th:IENT OF ENERGY EERE PROJECT MA1\JAGEME~T CE~TER  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Th:IENT OF ENERGY Th:IENT OF ENERGY EERE PROJECT MA1\JAGEME~T CE~TER NEPA DETEin:ITNATION Page 1 of2 RECIPIENT:City of Henderson; Henderson; NV STATE: NV PROJECT TITLE : Henderson Solar Energy Project Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-EE0003166 GF0-0003166-003 G03166 Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.16 Solar photovoltaic systems The installation, modification, operation, and removal of commercially available solar photovoltaic systems located on a building or other structure (such as rooftop, parking lot or facility, and mounted to s1gnage,

347

U.S. DEPARTI\t.IENT OF ENERGY EERE PROJECT MA.J'\JAGE\ofENT CENTER  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

t.IENT OF ENERGY t.IENT OF ENERGY EERE PROJECT MA.J'\JAGE\ofENT CENTER NEPA DETERMINATION Page 1 of2 RECIPIENT:San Diego State University STATE: CA PROJECT TITLE: A Small Particle Solar Receiver for High Temperature Brayton Power Cycles Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CIO Number DE-SOL-0000595 DE-EE0005800 GF0-0005800-001 G05800 Based on my review oftbe information concerning tbe proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the foUowing determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 83.6 Small-scale research and development. laboratory operations, and pilot projects Rational for determination: Siting, construction, modification, operation, and decommissioning of facilities for smallscale research

348

u.s. DEP.-illThIl!NT OF ENERGY EERE PROJECT MA"IAGEMENT CENTER  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

illThIl!NT OF ENERGY illThIl!NT OF ENERGY EERE PROJECT MA"IAGEMENT CENTER NEPA DE:rJ!IU...lINATION RECIPIENT:TX STATE ENERGY CONSERVATION OFFICE PROJECT TITLE: SHARYLAND ISD Page 1 of2 STATE: TX Funding Opportunity Announcement Number Procurement Instmment Number NEPA Control Number CIO Number DE-EEOOO116 DE-EEOOO116 GFO-OOO0116-032 GOO Based OD my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination : ex, EA, EIS APPENDIX AND NUMBER: Description: 85.16 Solar photovoltaic systems The installation, modification. operation, and removal of commercially avaUable solar photovoltaic systems located on a building or other structure (such as rooftop, par1o:.ing lot or facility, and mounted to signage, lighting, gates, or fences), or if

349

U.S. DFPAR.Tl\IFNT OF ENERGY EERE PROJECT MA:'\1AGE\1ENTCEN rER  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Tl\IFNT OF ENERGY Tl\IFNT OF ENERGY EERE PROJECT MA:'\1AGE\1ENTCEN rER NEPA DETFRl\.ITNATION Page 1 of2 RECIPIENT:Southwest Research Institute STATE: TX PROJECT TITLE : Optimizing the CSP Tower Air Brayton Cycle System to meet the SunShot Objectives Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000595 DE-EE0005805 GF0-0005805-001 Based on my review oftbe information concerning tbe proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made tbe foUowing determination: CX, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering, analysis, and dissemination Information gathering (including, but not limited to, literature surveys, inventories, site visits, and

350

U.S. DEP.-illTUENT OF ENERGY EERE PROJECT MA"AG EM ENT CEN T  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

illTUENT OF ENERGY illTUENT OF ENERGY EERE PROJECT MA"AG EM ENT CEN T ER NEPA DETERl\IINATION RECIPIENT:City of San Antonio PROJECT TITLE: City of San Antonio ARRA·EECBG * Activity #7 (S) Page 1 of2 STATE: TX Funding Opportunity Announcement Number 81.128 Procurement Instrument Number DE·EEOOOO970 NEPA Control Number cm Number o Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45 I. IA), I have made the followin g determination: CX, EA , EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical

351

Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester

2012-07-01T23:59:59.000Z

352

T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab

2012-02-11T23:59:59.000Z

353

PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos

2008-06-27T23:59:59.000Z

354

LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance

355

Wa s h i n g t o n Ma r r i o t t e n Me t r o C e...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Wa s h i n g t o n Ma r r i o t t e n Me t r o C e n t e r F a c u l t a d d e D e r e c h o d e l a U n i v e r s i d a d d e H o w a r d C o n f e r e n c i a y P r o g r a ma d...

356

MaSST 2012  

Science Conference Proceedings (OSTI)

... How does the nondeterminism of scheduling ... memory use, parallelism, virtual machines, and cloud ... Jeehyun Hwang, North Carolina State University. ...

2013-05-22T23:59:59.000Z

357

Final environmental impact statement/report. Volume 4. Comment letters and public hearing transcripts. Northeast corridor improvement project electrication: New Haven, CT to Boston, MA  

Science Conference Proceedings (OSTI)

This document is the final environmental impact statement and final environmental impact report (FEIS/R) on the proposal by the National Railroad Passenger Corporation (Amtrak) to complete the electrification of the Northeast Corridor main line by extending electric traction from New Haven, CT, to Boston, MA. This document (Volume IV) reprints the comments received on the DEIS/R.

NONE

1994-10-01T23:59:59.000Z

358

Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.

2003-12-01T23:59:59.000Z

359

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Australia Australia Trinidad Qatar Malaysia Canada Mexico Interstate Movements of Natural Gas in the United States, 1999 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL TX MA NH CT RI MD DC DE MD RI MA MA CT VA DC (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 837,902 415,636 225,138 232 308,214 805,614 803,034 800,345 685 147 628,589 9,786 790,088 17,369 278,302 40,727 214,076 275,629 51,935 843,280 826,638 9,988 998,603 553,440 896,187 11,817 629,551 98,423

360

Category:Utility Rate Impacts on PV Economics By Location | Open Energy  

Open Energy Info (EERE)

Utility Rate Impacts on PV Economics By Location Utility Rate Impacts on PV Economics By Location Jump to: navigation, search Impact of Utility Rates on PV Economics Montgomery, AL Little Rock, AR Flagstaff, AZ Phoenix, AZ Tucson, AZ Arcata, CA LA, CA San Francisco, CA Boulder, CO Eagle County, CO Pueblo, CO Bridgeport, CT Wilmington, DE Miami, FL Tampa, FL Atlanta, GA Savannah, GA Des Moines, IA Mason, IA Boise, ID Chicago, IL Springfield, IL Indianapolis, IN Goodland, KS Wichita, KS Lexington, KY New Orleans, LA Shreveport, LA Boston, MA Baltimore, MD Caribou, ME Portland, ME Detroit, MI Houghton-Lake, MI Traverse City, MI International Falls, MN Minneapolis, MN Kansas City, MO Jackson, MS Billings, MT Greensboro, NC Wilmington, NC Bismarck, ND Minot, ND Omaha, NE Concord, NH Atlantic City, NJ Albuquerque, NM Las Vegas, NV Reno, NV New York, NY

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Environment assessment: allocation of petroleum feedstock, Algonquin SNG Inc. , Freetown SNG Plant, Bristol County, MA. [Effects of 100, 78, 49% allocations  

DOE Green Energy (OSTI)

The proposed administrative action to deny, grant or modify the Algonquin SNG, Inc. (Algonquin) petition for an adjusted allocation of naphtha feedstock may significantly affect the ehuman environment. The volume of feedstock requested is 4,425,571 barrels per year of naphtha to be used in Algonquin's Freetown, MA synthetic natural gas (SNG) plant. Environmental impacts of 100, 78, and 49% allocations were evaluated.

Not Available

1980-01-01T23:59:59.000Z

362

Appendix to the final environmental impact report supplement. Northeast Corridor Improvement Project electrification, New Haven, CT to Boston, MA. Final report  

SciTech Connect

This document is an appendix to the final Environmental Impact Report Supplement, published on February 15, 1995, addressing the proposal by the National Railroad Passenger Corporation (Amtrak) to complete the electrification of the Northeast Corridor main line by extending electric traction from New Haven, CT, to Boston, MA. The purpose of this document is to discuss the selection of the Boston area electrical substation site and the relocation of a paralleling station in East Foxboro.

NONE

1995-05-01T23:59:59.000Z

363

Record of decision: Final environmental impact statement/report and 4(f) statement. Northeast Corridor Improvement Project electrification, New Haven, CT to Boston, MA. Final report  

Science Conference Proceedings (OSTI)

This record of decision (ROD) completes the environmental review by the Federal Administration (FRA) of the proposal by the National Railroad Passenger Corporation (Amtrak) to extend electric train operation from New Haven, CT, to Boston, MA. In this ROD, FRA approves Amtrak`s proposal subject to the inclusion into the project of a number of measures to eliminate or minimize potential adverse environmental impacts.

NONE

1995-05-01T23:59:59.000Z

364

Final environmental impact statement/report and 4(f) statement. Volume 1. Northeast corridor improvement project electrification: New Haven, CT to Boston, MA. Final report  

SciTech Connect

This document is the final environmental impact statement and final environmental impact report (FEIS/R) on the proposal by the National Railroad Passenger Corporation (Amtrak) to complete the electrification of the Northeast Corridor main line by extending electric traction from New Haven, CT, to Boston, MA. This document (Volume I) is the main body of the FEIS/R and includes a 4(f) Statement on the proposed location of an electrification facility in the Great Swamp Wildlife Management Area.

NONE

1994-10-31T23:59:59.000Z

365

Final environmental impact statement/report. Volume 2. Technical studies. Northeast corridor improvement project electrification: New Haven, CT to Boston, MA  

SciTech Connect

This document is the final environmental impact statement and final environmental impact report (FEIS/R) on the proposal by the National Railroad Passenger Corporation (Amtrak) to complete the electrification of the Northeast Corridor main line by extending electric traction from New Haven, CT, to Boston, MA. This document (Volume II) presents additional technical studies to supplement Volume III of the DEIS/R issued in October 1993 (PB94-111838).

NONE

1994-10-01T23:59:59.000Z

366

Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available

2011-10-01T23:59:59.000Z

367

Heart DiseaseHeart Disease--Learn to Love YourLearn to Love Your Michael McKee, M.D.Michael McKee, M.D.  

E-Print Network (OSTI)

Heart DiseaseHeart Disease-- Learn to Love YourLearn to Love Your HeartHeart Michael McKee, M.D.Michael McKee, M.D. March 19, 2010March 19, 2010 #12;GoalsGoals ·· Learn more about heart disease for yourself andLearn more about heart disease for yourself and for your studentsfor your students ·· Learn

Goldman, Steven A.

368

Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.

2006-08-29T23:59:59.000Z

369

Better Buildings Neighborhood Program: Communities Throughout Oregon  

NLE Websites -- All DOE Office Websites (Extended Search)

Communities Communities Throughout Oregon to someone by E-mail Share Better Buildings Neighborhood Program: Communities Throughout Oregon on Facebook Tweet about Better Buildings Neighborhood Program: Communities Throughout Oregon on Twitter Bookmark Better Buildings Neighborhood Program: Communities Throughout Oregon on Google Bookmark Better Buildings Neighborhood Program: Communities Throughout Oregon on Delicious Rank Better Buildings Neighborhood Program: Communities Throughout Oregon on Digg Find More places to share Better Buildings Neighborhood Program: Communities Throughout Oregon on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO

370

Better Buildings Neighborhood Program: Indianapolis, Indiana  

NLE Websites -- All DOE Office Websites (Extended Search)

Indianapolis, Indianapolis, Indiana to someone by E-mail Share Better Buildings Neighborhood Program: Indianapolis, Indiana on Facebook Tweet about Better Buildings Neighborhood Program: Indianapolis, Indiana on Twitter Bookmark Better Buildings Neighborhood Program: Indianapolis, Indiana on Google Bookmark Better Buildings Neighborhood Program: Indianapolis, Indiana on Delicious Rank Better Buildings Neighborhood Program: Indianapolis, Indiana on Digg Find More places to share Better Buildings Neighborhood Program: Indianapolis, Indiana on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC

371

Better Buildings Neighborhood Program: Fayette County, Pennsylvania  

NLE Websites -- All DOE Office Websites (Extended Search)

Fayette Fayette County, Pennsylvania to someone by E-mail Share Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Facebook Tweet about Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Twitter Bookmark Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Google Bookmark Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Delicious Rank Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Digg Find More places to share Better Buildings Neighborhood Program: Fayette County, Pennsylvania on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO

372

Better Buildings Neighborhood Program: Better Buildings Partners  

NLE Websites -- All DOE Office Websites (Extended Search)

Better Better Buildings Partners to someone by E-mail Share Better Buildings Neighborhood Program: Better Buildings Partners on Facebook Tweet about Better Buildings Neighborhood Program: Better Buildings Partners on Twitter Bookmark Better Buildings Neighborhood Program: Better Buildings Partners on Google Bookmark Better Buildings Neighborhood Program: Better Buildings Partners on Delicious Rank Better Buildings Neighborhood Program: Better Buildings Partners on Digg Find More places to share Better Buildings Neighborhood Program: Better Buildings Partners on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY

373

Better Buildings Neighborhood Program: Bainbridge Island, Washington  

NLE Websites -- All DOE Office Websites (Extended Search)

Bainbridge Bainbridge Island, Washington to someone by E-mail Share Better Buildings Neighborhood Program: Bainbridge Island, Washington on Facebook Tweet about Better Buildings Neighborhood Program: Bainbridge Island, Washington on Twitter Bookmark Better Buildings Neighborhood Program: Bainbridge Island, Washington on Google Bookmark Better Buildings Neighborhood Program: Bainbridge Island, Washington on Delicious Rank Better Buildings Neighborhood Program: Bainbridge Island, Washington on Digg Find More places to share Better Buildings Neighborhood Program: Bainbridge Island, Washington on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO

374

Better Buildings Neighborhood Program: Jacksonville, Florida  

NLE Websites -- All DOE Office Websites (Extended Search)

Jacksonville, Jacksonville, Florida to someone by E-mail Share Better Buildings Neighborhood Program: Jacksonville, Florida on Facebook Tweet about Better Buildings Neighborhood Program: Jacksonville, Florida on Twitter Bookmark Better Buildings Neighborhood Program: Jacksonville, Florida on Google Bookmark Better Buildings Neighborhood Program: Jacksonville, Florida on Delicious Rank Better Buildings Neighborhood Program: Jacksonville, Florida on Digg Find More places to share Better Buildings Neighborhood Program: Jacksonville, Florida on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC

375

Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan

2008-01-01T23:59:59.000Z

376

Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-

2009-01-01T23:59:59.000Z

377

First analysis of radiative properties of moderate-atomic-number planar wire arrays on Zebra at UNR at higher current of 1.7 MA.  

Science Conference Proceedings (OSTI)

The analysis of implosions of Cu and Ag planar wire array (PWA) loads recently performed at the enhanced 1.7 MA Zebra generator at UNR is presented. Experiments were performed with a Load Current Multiplier with a 1cm anode-cathode gap (twice shorter than in a standard 1 MA mode). A full diagnostic set included more than ten different beam-lines with the major focus on time-gated and time-integrated x-ray imaging and spectra, total radiation yields, and fast, filtered x-ray detector data. In particular, the experimental results for a double PWA load consisting of twelve 10 {micro}m Cu wires in each row (total mass M {approx} 175 {micro}g) and a much heavier single PWA load consisting of ten 30 {micro}m Ag wires (M {approx} 750 {micro}g) were analyzed using a set of theoretical codes. The effects of both a decreased a-c gap and an increased current on radiative properties of these loads are discussed.

Keim, S. F. (University of Nevada, Reno, NV); Chuvatin, Alexander S. (Ecole Polytechnique, Palaiseau, France); Osborne, Glenn C. (University of Nevada, Reno, NV); Esaulov, Andrey A. (University of Nevada, Reno, NV); Presura, R. (University of Nevada, Reno, NV); Shrestha, I. (University of Nevada, Reno, NV); Kantsyrev, Victor Leonidovich (University of Nevada, Reno, NV); Shlyaptseva, V. (University of Nevada, Reno, NV); Coverdale, Christine Anne; Williamson, K. M. (University of Nevada, Reno, NV); Ouart, Nicholas D. (University of Nevada, Reno, NV); Astanovitsky, A. L. (University of Nevada, Reno, NV); Weller, M. E. (University of Nevada, Reno, NV); Safronova, Alla S. (University of Nevada, Reno, NV); LeGalloudec, B. (University of Nevada, Reno, NV)

2010-11-01T23:59:59.000Z

378

Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI

2012-06-01T23:59:59.000Z

379

Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah

2011-04-21T23:59:59.000Z

380

LA-101( ' X I -E N V~ E N V I R O N M E N T A LS U R V E I L L AA -L O. A -L A -MD U R  

E-Print Network (OSTI)

LA-101( ' X I - E N V~ E N V I R O N M E N T A LS U R V E I L L AA - &.' L_ .---. L O. A - L A - MD U R ,. ,, .". ... , . 1 ` - : . , .i * ?. .& x ` "E!E7...';: s ---- --. -- - + 4. -- sA l a m oN a t i oL a b o r L oA l a m o sN eM e x8 7 `"'l~@fO,,J~@jj~~~~.F=~Of.f~n~~~Y. - w

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.

2008-06-01T23:59:59.000Z

382

U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office

383

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental

384

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential

385

NGA98fin5.vp  

Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental

386

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural

387

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration

388

Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.

389

Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.

390

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost

391

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure

392

C:\ANNUAL\VENTCHAP.V8\NGA.VP  

Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure

393

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."

394

Project Award Spreadsheets 2010 12 21 1232.xlsx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

City HQ State City HQ State Congressional District(s) Population Recovery Act Funding* Asheville ** NC NC-011 500,000 $209,940 Aspen CO CO-003 5,902 $59,193 Aurora CO CO-007 319,057 $151,800 Baltimore MD MD-002 636,919 $200,000 Baton Rouge LA LA-6 223,689 $200,000 Boston MA MA-009 609,023 $300,000 Casper WY WY-001 54,047 $130,000 Chicago IL IL-005 2,853,114 $300,000 Chula Vista CA CA-051 219,318 $200,000 City and County of Denver CO CO-001 598,707 $210,040 Columbia MO MO-009 100,733 $200,000 Davenport IA IA-001 100,827 $200,000 Delray Beach FL FL-022 64,092 $130,000 Durango CO CO-003 16,416 $58,500 Flint MI MI-005 112,900 $199,814 Fort Wayne IN IN-003 251,591 $195,700 Hailey ID ID-002 7,883 $83,202 Hamilton OH OH-008 62,477 $130,000 Heber** UT UT-002 13,988 $100,000 Hoffman Estates IL IL-008 53,641 $98,556 Lake Worth FL FL-022 35,513

395

NGA98fin5.vp  

Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure

396

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of

397

www.eia.gov  

U.S. Energy Information Administration (EIA)

Pilgrim Nuclear Power Station Massachusetts Total MD Calvert Cliffs Nuclear Power Plant Maryland Total MI Fermi Donald C Cook Michigan Total MN Prairie Island ...

398

www.eia.gov  

U.S. Energy Information Administration (EIA)

... is through August, the latest data available",,,,, ,"Norfolk, VA","Baltimore, MD","Mobile, AL","New Orleans, LA","Detroit, MI","Seattle, ...

399

Microsoft Word - S07581_MA  

Office of Legacy Management (LM)

Groundwater and Surface Water Groundwater and Surface Water Monitoring Activities at Site A/Plot M March 2011 LMS/SAM/S07581 This page intentionally left blank LMS/SAM/S07581 Groundwater and Surface Water Monitoring Activities at Site A/Plot M March 2011 This page intentionally left blank U.S. Department of Energy Groundwater and Surface Water Monitoring Activities at Site A/Plot M March 2011 Doc. No. S07581 Page i Contents Abbreviations ................................................................................................................................. iii Executive Summary .........................................................................................................................v 1.0 Background ............................................................................................................................1

400

MA_50m_Wind  

NLE Websites -- All DOE Office Websites (Extended Search)

UnitedStatesWindHighResolutionMassachusettsWindHighResolution.zip> Description: Abstract: Annual average wind resource potential for the state of...

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

WIND DATA REPORT FALMOUTH, MA  

E-Print Network (OSTI)

by the Renewable Energy Research Laboratory (RERL) at the University of Massachusetts, Amherst. Wind monitoring/RERL_Fact_Sheet_6_Wind_resource_inter pretation.pdf * 1 m/s = 2.25 mph. #12;January 10, 2005 Renewable Energy/s, Offset ­ 0.350 m/s) · 3 - #200P Wind direction vanes Tower location #12;January 10, 2005 Renewable Energy

Massachusetts at Amherst, University of

402

WIND DATA REPORT Chester, MA  

E-Print Network (OSTI)

/RERL_Fact_Sheet_6_Wind_resource_interpretation.pdf * 1 m/s = 2.237 mph. July 14, 2007 Renewable Energy Research square. Figure 1 - Map of Chester wind tower site July 14, 2007 Renewable Energy Research Laboratory Page average wind speeds are plotted against time. July 14, 2007 Renewable Energy Research Laboratory Page 8

Massachusetts at Amherst, University of

403

WIND DATA REPORT Wellfleet, MA  

E-Print Network (OSTI)

/RERL_Fact_Sheet_6_Wind_resource_interpretation.pdf * 1 m/s = 2.237 mph. July 10, 2007 Renewable Energy Research Distributions Figure 3 - Wind Speed Distribution, March 1, 2007 ­ May 31, 2007 July 10, 2007 Renewable Energy Figure 5 - Diurnal Average Wind Speed, March 1, 2007 ­ May 31, 2007 July 10, 2007 Renewable Energy

Massachusetts at Amherst, University of

404

BUILDING MA TERIALS and STRUCTURES  

Science Conference Proceedings (OSTI)

... SALE BY THE SUPERINTENDENT OF DOCUMENTS, WASHINGTON, DC PRIC E 10 CENTS ... brands; g and k stand for gun grade and knife ~de ...

2008-01-11T23:59:59.000Z

405

Support for the delisting of decontaminated liquid chemical surety materials as listed hazardous waste from specific sources (state) MD02 in COMAR 10. 51. 02. 16-1. Technical report, December 1987-February 1988  

SciTech Connect

Maryland recently enacted regulations that listed decontaminated residues of certain chemical warfare agents as hazardous wastes. The State would consider delisting if the Army document the effects of its decontamination procedures. Army specialists at U.S. Army Chemical Research, Development and Engineering Center (CRDEC), Aberdeen Proving Ground, MD, have had exhaustive experience in this area since 1918 when chemical agents were first used in combat in World War I. Competence accrued during this 70-year legacy includes destruction of laboratory and training wastes, combat decontamination, and largescale demilitarization of unserviceable and obsolete agent-filled munitions. The facts and circumstances enumerated in this document indicate that current decontamination practices are safe, scientifically valid, and result in the total destruction of agents in questions.

Durst, H.D.; Sarver, E.W.; Yurow, H.W.; Beaudry, W.T.; D'Eramo, P.A.

1988-11-01T23:59:59.000Z

406

Analysis of Compact Cylindrical Wire Array Implosions with Brass and also by Alternating Brass and Al wires on the 1-MA COBRA Generator  

SciTech Connect

Implosions from compact cylindrical wire arrays (CCWA) with mid-Z and low-Z wires were carried out on the 1-MA COBRA generator at Cornell University. In particular, the CCWA used either Brass 310 (70% Cu, 30% Zn) wires or a combination of Brass 310 and Al 5056 (95% Al, 5% Mg) wires arranged in an alternating pattern. A total of 16 wires were used on either a 6 or 4 mm diameter array. The diagnostic suite included a bolometer, fast x-ray detectors, a time-integrated spectrometer, and a streak camera. A higher energy output was observed from bolometer measurements when alternating the brass and Al wires compared to using only the brass wires. This study will focus mainly on the spectroscopy of the brass and alternating brass and Al CCWA by applying the non-LTE kinetic models of Cu and Zn to account for the L-shell radiation. The resulting plasma parameters, electron density and electron temperature, will be discussed and compared for the CCWA with only brass wires and alternating brass and Al wires. The simulations with the novel Wire Ablation Dynamics Model that account for wire ablation will be performed to analyze the differences in implosion dynamics of the uniform and alternating compact cylindrical arrays.

Ouart, N. D.; Yilmaz, M. F.; Safronova, A. S.; Kantsyrev, V. L.; Esaulov, A. A.; Williamson, K. M.; Osborne, G. C.; Shrestha, I.; Weller, M. E. [Physics Department, University of Nevada, Reno, NV 89557 (United States); McBride, R. D.; Knapp, P. F.; Bell, K. S.; Pikuz, S. A.; Shelkovenko, T. A.; Greenly, J. B.; Hammer, D. A.; Kusse, B. R. [Cornell University, Ithaca, NY 14853 (United States)

2009-01-21T23:59:59.000Z

407

Effects of a range of machined and ground surface finishes on the simulated reactor helium corrosion of several candidate structural materials. [Inconel MA 754  

SciTech Connect

This report discusses the corrosion behavior of several candidate reactor structural alloys in a simulated advanced high-temperature gas-cooled reactor (HTGR) environment over a range of lathe-machined and centerless-ground surface finishes. The helium environment contained 50 Pa H/sub 2//5 Pa CO/5 Pa CH/sub 4//<0.05 Pa H/sub 2/O (500 ..mu..atm H/sub 2//50 ..mu..atm CO/50 ..mu..atm CH/sub 4//<0.5 ..mu..atm H/sub 2/O) at 900/sup 0/C for a total exposure of 3000 h. The test alloys included two vacuum-cast superalloys (IN 100 and IN 713LC); a centrifugally cast austenitic alloy (HK 40); three wrought high-temperature alloys (Alloy 800H, Hastelloy X, and Inconel 617); and a nickel-base oxide-dispersion-strengthened alloy (Inconel MA 754). Surface finish variations did not affect the simulated advanced-HTGR corrosion behavior of these materials. Under these conditions, the availability of reactant gaseous impurities controls the kinetics of the observed gas-metal interactions. Variations in the near-surface activities and mobilities of reactive solute elements, such as chromium, which might be expected to be affected by changes in surface finish, do not seem to greatly influence corrosion in this simulated advanced HTGR environment. 18 figures, 4 tables.

Thompson, L.D.

1981-02-01T23:59:59.000Z

408

Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan

2008-09-30T23:59:59.000Z

409

Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Mexico Trinidad Canada Canada Nigeria Oman Qatar Trinidad Gulf of Mexico Gulf of Mexico Gulf of Mexico Canada Trinidad Trinidad Gulf of Mexico Malaysia 13,623 Figure 8. Interstate Movements of Natural Gas in the United States, 2003 (Million Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Energy Information Administration / Natural Gas Annual 2003 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 366,224 655,731 666,614 633,960 144,284 43,869 536,776 63,133 36,848

410

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2008 (Million Cubic Feet) Norway Trinidad/ Tobago Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 45,772 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates.

411

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 (Million Cubic Feet) 24,891 2,895 Nigeria WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico Algeria C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada N i g e r i a O m a n Qatar Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Malaysia 2,986 Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2005 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 335,380 634,982 664,318 612,297 125,202 33,223 531,868 103,624

412

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

,833 ,833 35 Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2009 (Million Cubic Feet) Norway Trinidad/ Tobago Trinidad/ Tobago Egypt Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 111,144 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates

413

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

6 6 (Million Cubic Feet) Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 42,411 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2006 253,214 690,780 634,185 658,523 134,764 63,063 526,726 121,049 34,531 492,655 101,101 23,154 40,113 1,496,283 68,601

414

Microsoft Word - figure_14.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 14. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2010 (Million Cubic Feet) Norway India Trinidad/ Tobago Egypt Yemen Japan Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 53,122 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada Gulf of Mexico Canada Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates based on historical data. Energy Information

415

NONPROFIT ORG DETROIT, MI  

E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor

416

Final environmental impact statement/report. Volume 3. Response to comments on draft environmental impact statement/report. Northeast corridor improvement project electrification: New Haven CT to Boston, MA  

SciTech Connect

This document is the final environmental impact statement and final environmental impact report (FEIS/R) on the proposal by the National Railroad Passenger Corporation (Amtrak) to complete the electrification of the Northeast Corridor main line by extending electric traction from New Haven, CT, to Boston, MA. This document (Volume III) of the FEIS/R presents summaries of comments received on the DEIS/R and responses to these comments.

NONE

1994-10-31T23:59:59.000Z

417

Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use

418

CALL FOR PAPERS  

Science Conference Proceedings (OSTI)

Aug 15, 2004 ... NIST, Magnetic Materials, Gaithersburg, MD 20899-8552 USA T: ...... MA 02139- 4307 USA T: 617-452-2086 F: 617-253-5418 Email:.

419

JHYoon.pptx  

NLE Websites -- All DOE Office Websites (Extended Search)

Rockville, MD 1. Project Description PI: Philip J. Rasch Key Players: Ghan, Easter, Fan, Fast, Ganguly, Liu, Ma, Ovchinnikov, Qian, Singh, Smith, H. Wang, M. Wang, Yoon,...

420

Nanotechnology in Thoracic Surgery Morgan D. Schulz, MD, Onkar Khullar, MD, John V. Frangioni, MD, PhD,  

E-Print Network (OSTI)

of the lung and the preva- lence of occult micrometastatic disease within thoracic nodes which may appear be due to an increased detection of nodal disease or increased re- moval of nodes harboring occult foci

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Local Hotels/Motels - Gaithersburg, MD  

Science Conference Proceedings (OSTI)

... relationship with NIST. We provide this information as a convenience to NIST visitors and conference attendees. NIST does ...

2013-07-25T23:59:59.000Z

422

Fissile Material Disposition (MD) - Nuclear Engineering Division...  

NLE Websites -- All DOE Office Websites (Extended Search)

a legacy of surplus fissile materials (primarily weapons-grade plutonium and highly enriched uranium) in the United States and the former Soviet Union. These materials pose a...

423

Community Academic Profile Jon D. Fuller, MD  

E-Print Network (OSTI)

, Gerontology, & Metabolism ACTIVITIES 2006 Member, VHA Capacity Management Advisory Council, VA HQ. 2005 Member, VHA Clinical Advisory Council to Chief Business Office, VA HQ. 2005 VA representative to the White Forum Steering Committee Member, "Standardizing Home Health Care Performance Measures" 2004 Organizer

Ford, James

424

Student Directory yea Larry S. Tobacman, MD  

E-Print Network (OSTI)

Genetics St Louis, 2007 Andrew Czysz (2007) aczysz2@uic.edu th Year PhD logy, U. Florida, 2007 Durst (2012

Alford, Simon

425

Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.

426

Microsoft PowerPoint - APM Org Chart v11 (2)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MA MA 60 Office of Acquisition and Project Management (APM) MA-60 Paul Bosco Director David Boyd Deputy Director MA-66 D id B MA-65 C l M l d MA-64 B th T i MA-63 Mi h l P k MA-62 P t i k F MA-61 B t S h ib Jay Glascock Senior Technical Advisor David Brown, Director Sys & Prof Dev MA-661 Linda Ott Professional Development Carmelo Melendez, Director Property Mgmt MA-651 Mark Price Real Estate Beth Tomasoni, Acting Director HQ Proc Svs MA-6401 Barry Ross Corporate Services Michael Peek, Director Project Mgmt MA-631 John White Project Assessments Patrick Ferraro, Director Contract Mgmt MA-621 David Leotta Field Assistance & Berta Schreiber, Director Policy MA-611 Jacqueline Kniskern Contract & Financial p Division MA-662 John Makepeace Acting, Systems Division Division MA-652 Monja Vadnais Facilities & Infra. Mgmt

427

Acknowledgments  

Science Conference Proceedings (OSTI)

...Tim Webber, IPG Photonics, Oxford, MA Frank Brennan, Trumpf, Plymouth, MI Rainer Uhlig, ABB, Fort Collins, CO Jim Cann, Rofin Sinar, Plymouth, MI Urban Widén, Permanova, Mölndal, Sweden Robert Borgstrom, Precitec, New Hudson, MI Scott Green, LT Ultra, New Hudson, MI Mike...

428

FINAL ENVIRONMENTAL ASSESSWW LEASE OF LANDAND FACILFIlES W I  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

f a succcssfigyJI&&@ anETTPpropaty, W E T adW E signa MaMI.andumdUndct.9tanding (MOU), whichstatear thatallpartiesagreetothe objadivedaspccificpicetdpropatyfbtadctinnl...

429

Improved Modeling and Understanding of Diffusion-Media Wettability on Polymer-Electrolyte-Fuel-Cell Performance  

E-Print Network (OSTI)

M.A. Ioannidis, M.W. Fowler, M.D. Pritzker, J. PowerB1225. [31] J.T. Gostick, M.W. Fowler, M.A. Ioannidis, M.D.M.A. Ioannidis, M.W. Fowler, M.D. Pritzker, Electrochemistry

Weber, Adam

2010-01-01T23:59:59.000Z

430

Better Buildings Neighborhood Program: San Jose  

NLE Websites -- All DOE Office Websites (Extended Search)

San Jose to San Jose to someone by E-mail Share Better Buildings Neighborhood Program: San Jose on Facebook Tweet about Better Buildings Neighborhood Program: San Jose on Twitter Bookmark Better Buildings Neighborhood Program: San Jose on Google Bookmark Better Buildings Neighborhood Program: San Jose on Delicious Rank Better Buildings Neighborhood Program: San Jose on Digg Find More places to share Better Buildings Neighborhood Program: San Jose on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Jose, California San Jose Leverages Partnerships to Improve Low-Income Households' Energy

431

Wind Program: Stakeholder Engagement and Outreach  

Wind Powering America (EERE)

Outreach Outreach Printable Version Bookmark and Share The Stakeholder Engagement and Outreach initiative of the U.S. Department of Energy's Wind Program is designed to educate, engage, and enable critical stakeholders to make informed decisions about how wind energy contributes to the U.S. electricity supply. Highlights Resources Wind Resource Maps State Activities What activities are happening in my state? AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Installed wind capacity maps. Features A image of a house with a residential-scale small wind turbine. Small Wind for Homeowners, Farmers, and Businesses Stakeholder Engagement & Outreach Projects

432

Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012

433

Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central

434

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2007 (Million Cubic Feet) Nigeria Algeria 37,483 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports.

435

Better Buildings Neighborhood Program: Maine - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- SEP to - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Maine - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Maine - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Maine - SEP on Google Bookmark Better Buildings Neighborhood Program: Maine - SEP on Delicious Rank Better Buildings Neighborhood Program: Maine - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Maine - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Maine - SEP Maine Makes Multifamily Units Energy-Efficient and Cost-Effective

436

Better Buildings Neighborhood Program: Seattle, Washington  

NLE Websites -- All DOE Office Websites (Extended Search)

Seattle, Seattle, Washington to someone by E-mail Share Better Buildings Neighborhood Program: Seattle, Washington on Facebook Tweet about Better Buildings Neighborhood Program: Seattle, Washington on Twitter Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Google Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Delicious Rank Better Buildings Neighborhood Program: Seattle, Washington on Digg Find More places to share Better Buildings Neighborhood Program: Seattle, Washington on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA

437

Better Buildings Neighborhood Program: San Diego  

NLE Websites -- All DOE Office Websites (Extended Search)

Diego to Diego to someone by E-mail Share Better Buildings Neighborhood Program: San Diego on Facebook Tweet about Better Buildings Neighborhood Program: San Diego on Twitter Bookmark Better Buildings Neighborhood Program: San Diego on Google Bookmark Better Buildings Neighborhood Program: San Diego on Delicious Rank Better Buildings Neighborhood Program: San Diego on Digg Find More places to share Better Buildings Neighborhood Program: San Diego on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Diego County, California Energy Upgrade California Motivates Home Improvements in San Diego County

438

Better Buildings Neighborhood Program: Los Angeles County, California  

NLE Websites -- All DOE Office Websites (Extended Search)

Los Angeles Los Angeles County, California to someone by E-mail Share Better Buildings Neighborhood Program: Los Angeles County, California on Facebook Tweet about Better Buildings Neighborhood Program: Los Angeles County, California on Twitter Bookmark Better Buildings Neighborhood Program: Los Angeles County, California on Google Bookmark Better Buildings Neighborhood Program: Los Angeles County, California on Delicious Rank Better Buildings Neighborhood Program: Los Angeles County, California on Digg Find More places to share Better Buildings Neighborhood Program: Los Angeles County, California on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO

439

Better Buildings Neighborhood Program: Alabama - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Alabama - Alabama - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Alabama - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Alabama - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Google Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Delicious Rank Better Buildings Neighborhood Program: Alabama - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Alabama - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Alabama - SEP Alabama Program Takes a Dual Approach to Energy Efficiency Upgrades

440

Better Buildings Neighborhood Program: Virginia - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Virginia - Virginia - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Virginia - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Virginia - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Google Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Delicious Rank Better Buildings Neighborhood Program: Virginia - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Virginia - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Virginia - SEP Virginia's Regional Energy Alliances Help Forge a State Program for

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Better Buildings Neighborhood Program: Austin, Texas  

NLE Websites -- All DOE Office Websites (Extended Search)

Austin, Texas Austin, Texas to someone by E-mail Share Better Buildings Neighborhood Program: Austin, Texas on Facebook Tweet about Better Buildings Neighborhood Program: Austin, Texas on Twitter Bookmark Better Buildings Neighborhood Program: Austin, Texas on Google Bookmark Better Buildings Neighborhood Program: Austin, Texas on Delicious Rank Better Buildings Neighborhood Program: Austin, Texas on Digg Find More places to share Better Buildings Neighborhood Program: Austin, Texas on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Austin, Texas Austin Energy Accelerates Residential and Multifamily Efficiency Upgrades

442

Better Buildings Neighborhood Program: Michigan - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Michigan - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Michigan - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Google Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Delicious Rank Better Buildings Neighborhood Program: Michigan - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Michigan - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Michigan - SEP Better Buildings Means Better Business for Michigan

443

Better Buildings Neighborhood Program: Toledo, Ohio  

NLE Websites -- All DOE Office Websites (Extended Search)

Toledo, Ohio Toledo, Ohio to someone by E-mail Share Better Buildings Neighborhood Program: Toledo, Ohio on Facebook Tweet about Better Buildings Neighborhood Program: Toledo, Ohio on Twitter Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Google Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Delicious Rank Better Buildings Neighborhood Program: Toledo, Ohio on Digg Find More places to share Better Buildings Neighborhood Program: Toledo, Ohio on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Toledo, Ohio A Broad Approach to Energy Efficiency in Northwest Ohio

444

Northeast Corridor improvement project draft environmental impact statement/report for electrification of Northwest Corridor, New Haven, CT. to Boston, MA. Volume 3. Technical appendices. Final report, September 1992-September 1993  

SciTech Connect

The impacts of extending electrification on the National Railroad Passenger Corporation's (Amtrak) Northeast Corridor (NEC) from New Haven, Connecticut to Boston, Massachusetts are of direct concern to the Federal Railroad Administration (FRA). To improve rail service and increase ridership between New York and Boston, Amtrak proposes the electrification of the NEC main line between New Haven, CT and Boston, MA using an overhead 2 x 25,000 volt - 60 hertz power system. The volume Number III contains the detailed technical studies that were performed in order to identify and evaluate the environmental impacts of the proposed project. Some of these studies have been included entirely in the Draft Environmental Impact Statements-draft (DEIS/R) (Volume 1). The technical evaluations performed were based upon regulatory requirements as well as substantive issues raised by individuals and public agencies as part of the public participation program.

Not Available

1993-09-01T23:59:59.000Z

445

U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

4 4 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT

446

U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

2 2 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT

447

A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada

2005-09-01T23:59:59.000Z

448

DOE_MA0518 December 2000  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

was written in conjunction with the 50th was written in conjunction with the 50th anniversary commemoration of the Nevada Test Site. The history was released at the official celebration held in Las Vegas, Nevada, on December 18, 2000, fifty years after President Harry S. Truman formally designated the site as the location for conducting nuclear weapons tests within the continental United States. The history represents a unique partnership between a field office and two headquarters offices of the U.S. Department of Energy. The Department's Nevada Operations Office provided the initial impetus for the project and offered support and resources throughout the researching and writing of the history. The Office of Defense Programs of the Department's National Nuclear Security Administration provided funding for printing the history. The History

449

Office of Informaiton Resources (MA-90)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

08 08 Melanie Pustay Director Office of Information and Privacy U.S. Department of Justice 1425 New York Ave., Suite 11050 Washington, DC 20530 Dear Ms. Pustay: Pursuant to the requirements set forth by Title 5, United States Code, Section 552(e), enclosed is a copy of the Annual Report on the administration of the Freedom of Information Act (FOIA) by the Department of Energy. The report will be made available on the World Wide Web through the FOIA Home Page of the Department. If you have any questions, please contact Mr. Chris Morris or Ms. Sheila Jeter of my staff at (202) 586-5955. Sincerely, yerlette L. aili in, Deputy Director FOIA and Privacy Act Office Office of Information Resources Enclosure @ Printed with soy ink on recycled paper U.S. Department of Energy

450

02-01-2011 Final MA Testimony  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CONTRACTING OVERSIGHT CONTRACTING OVERSIGHT COMMITTEE ON HOMELAND SECURITY AND GOVERNMENTAL AFFAIRS U.S. SENATE FEBRUARY 1, 2011 Madam Chairman and Members of the Subcommittee, my name is Ingrid Kolb. I serve as the Director, Office of Management at the U.S. Department of Energy. I am pleased to be here today to discuss with you how the Department uses audit services to detect and prevent waste, fraud, and abuse in government contracts, to provide contracting officers reasonable assurance whether contractor submissions are free of material misstatement, and provide them assistance and advice in the establishment of fair and reasonable prices for products and services. In fiscal years 2009 and 2010, the Department spent approximately $32 billion and $26

451

TO: FILE FRml: J&-q Ma  

Office of Legacy Management (LM)

Other information (i.e., cost q Subcontract& + fixed fee, unit price, 0 Purchase Order time & material, Eftc:) v---e-- i. ContractPurchase Order OWNERSHIP: AECMED AECnED GOVT...

452

A Dissertation Javier Bernal BS MA  

Science Conference Proceedings (OSTI)

... xl x2r x3. Hence, our definlllon of area general-izes the well known ele- menlary concepts of area and volume, Intultlvely, frorn tire last two l-ernnas ...

2013-06-11T23:59:59.000Z

453

Eric Bowen, M.A. Patrick Manzi  

E-Print Network (OSTI)

fueled truck fleet of more than 100 refuse hauling vehicles and plans to add more will include exhaust from on-road vehicles and from materials handling equipment, dust from refuse renewable natural gas. CR&R plans to add 100 CNG/LNG vehicles to its fleet over the next

Mohaghegh, Shahab

454

SEQUENTIAL ORDER UNDER MA ALAN DOW  

E-Print Network (OSTI)

system t* *his sequence of random variables is tight (as N varies), while for the non-interacting parti.1)), and that b 6= 0. a) The sequence ( k(f))k~1is tight (or, bounded in probability). b) If further f variances ~oe2n;sand ~oe2n; furthermore, (3.27) and (3.28) and ff

Dow, Alan

455

UCRL-MA-110662 PT I U  

Office of Scientific and Technical Information (OSTI)

commercial products, process, or service by trade name, trademark, manufacturer, o r otherwise, does not necessarily constitute or imply its endorse- ment, recommendation,...

456

CarMA: towards personalized automotive tuning  

Science Conference Proceedings (OSTI)

Wireless sensing and actuation have been explored in many contexts, but the automotive setting has received relatively little attention. Automobiles have tens of onboard sensors and expose several hundred engine parameters which can be tuned (a ... Keywords: automobile, engine control unit, scanning, tuning

Tobias Flach; Nilesh Mishra; Luis Pedrosa; Christopher Riesz; Ramesh Govindan

2011-11-01T23:59:59.000Z

457

senseable city cambridge (ma) | 22 oct 2010  

E-Print Network (OSTI)

at a coal-fired power plant exploded, severely injuring six workers and resulting in hundreds of thousand;Accident at power plant in Connecticut, 2009 #12;The cost of accidents... "Our results show that to the continued growth of personal computing and distributed organizations advances] "cities are leftover baggage

Gabrieli, John

458

Wellesley (MA) Program Achieves 10% Participation - EERE ...  

EERE Home | Programs & Offices ... Green Power Communities must collectively use green power in amounts that meet minimum EPA percentage requirements, ...

459

MaGrann Associates | Open Energy Information  

Open Energy Info (EERE)

1 Information About Partnership with NREL Partnership with NREL Yes Partnership Type Test & Evaluation Partner Partnering Center within NREL Electricity Resources & Building...

460

ACTIVIDADES Dra. Ma. Amparo Martnez Arroyo  

E-Print Network (OSTI)

mediante convenios con entidades gubernamentales (CFE, PEMEX, SMN, INECC, SEMARNAT...) 16.Captación y marea de tormenta para PEMEX, SMN · Estudio de la dispersión de petróleo en el Golfo de México por el

Grutter, Michel

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

PNL-MA-70 QA Plan  

SciTech Connect

The Instrument and External Dosimetry Section provides the calibration service for all portable radiation monitoring measuring and test equipment used on the Hanford Site. This document outlines the quality assurance (QA) plan for the Instrument Calibration and Evaluation Program. The scope of the QA plan in outlined, requirement specifications are provided, and QA program/organization and impact level are discussed.

Ethridge, L.J.

1993-06-02T23:59:59.000Z

462

Northeast corridor improvement project draft environmental impact statement/report for electrification of Northwest Corridor, New Haven, CT. To Boston, MA. Volume 1. Final report, September 1992-September 1993  

Science Conference Proceedings (OSTI)

The impacts of extending electrification on the National Railroad Passenger Corporation's (Amtrak) Northeast Corridor (NEC) from New Haven, Connecticut to Boston, Massachusetts are of direct concern to the Federal Railroad Administration (FRA). To improve rail service and increase ridership between New York and Boston, Amtrak proposes the electrification of the NEC main line between New Haven, CT and Boston, MA using an overhead 2 X 25,000 volt - 60 hertz power system. This volume considers impacts on the Human and Natural Environment utilizing guidance as outlined in CFR Part 1500, Council on Environmental Quality, Regulations for Implementing the Procedural Requirements of NEPA as amended and the Massachusetts Environmental Policy Act (MEPA) regulations (301 CMR 11:00). Impacts analyzed include changes in the natural environment (air quality, noise and vibration, energy, electromagnetic fields, natural resources, hazardous materials and visual/aesthetics), changes in the social environment (land use and recreation, transportation and traffic), impacts on historic and archaeological sites, changes in transit service and patronage, associated changes in highway and airport congestion, capital costs, operating and maintenance costs, and financial implications. Impacts are identified both for the proposed construction period and for the long-term operation of the alternatives.

Not Available

1993-09-01T23:59:59.000Z

463

regionalmaps  

Gasoline and Diesel Fuel Update (EIA)

LNG Imports LNG Imports Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming

464

regionalmaps  

Gasoline and Diesel Fuel Update (EIA)

Specific LNG Terminals Specific LNG Terminals Generic LNG Terminals Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Specific LNG Terminals Generic LNG Terminals Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana

465

Lamps in the Leaping Over  

E-Print Network (OSTI)

dusgser gyi nya mo khor lo bskor bai rgyud chen po: /rang byung lhun grub bras bu n/ /gdod naslhun grub rang char bas/ /byung ba lnga la rag ma pas/ /sku gsung thugs la rten mi cha/ /gsalbyed rig pai sgron ma yi s/ /gter khyim phung po gsal byed... / /longs sku dang nisprul pai sku/ /chu shel sgron mai dpes mtshon kyang/da lta rang la byung ma srid/ /khyung sgoma chag phur mi nus/.14 See TTT 54, p. 504, eigthth chapter of the Byang chub kyi sems rin chen khor lo: /sems nyid rigpai sgron ma yis...

Scheidegger, Daniel

2005-01-01T23:59:59.000Z

466

Friction Stir Welding of MA956 and MA754 ODS Alloys  

Science Conference Proceedings (OSTI)

Advances in Materials Research in the Yucca Mountain Project An Investigation of Annealing Treatments For Optimizing the As-Fabricated Microstructure of...

467

Irradiation Studies on Friction Stir Welded MA956 and MA754  

Science Conference Proceedings (OSTI)

A New Model for Predicting the Oxidation/Gasification of Nuclear Graphite .... Strengthened Steels via Mechanical Alloying and Spark Plasma Sintering.

468

acs_MA_ma-2011-00986d 1..7  

NLE Websites -- All DOE Office Websites (Extended Search)

a mixture of (v:v 1:3) methanol and benzene, followed by dropwise addition of a stoichiometric amount of dimethyl sulfate needed to achieve the required degree of...

469

Figure 23. Average price of natural gas delivered to U.S. commercial...  

Annual Energy Outlook 2012 (EIA)

Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA FL NJ AL...

470

Microsoft Word - figure_22.doc  

Gasoline and Diesel Fuel Update (EIA)

Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA FL NJ AL...

471

Microsoft Word - figure_21.doc  

Annual Energy Outlook 2012 (EIA)

of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA...

472

Microsoft Word - figure_23.doc  

Annual Energy Outlook 2012 (EIA)

11.00+ Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." IN OH TN WV VA KY MD PA NY VT NH MA...

473

Microsoft Word - figure_23.doc  

Gasoline and Diesel Fuel Update (EIA)

Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." IN OH TN WV VA KY MD PA NY VT NH MA...

474

Energy Information Administration/Natural Gas Annual 2009 25  

Gasoline and Diesel Fuel Update (EIA)

700 800 2005 2006 2007 2008 2009 0 2 4 6 8 10 12 14 16 18 20 22 Everett, MA Elba Island, GA Cove Point, MD Other * "Other" includes the following points of entry: Lake Charles,...

475

Microsoft Word - Figure_11.doc  

Gasoline and Diesel Fuel Update (EIA)

2006 2007 2008 0 2 4 6 8 10 12 14 16 18 20 22 Everett, MA Cove Point, MD Elba Island, GA Lake Charles, LA * Gulf Gateway, LA, LNG volumes were (in million cubic feet): 5,198...

476

Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:

477

Microsoft Word - FY 2011 MD-715 Report.docx  

National Nuclear Security Administration (NNSA)

1 1 DOE NNSA December 14, 2011 i National Nuclear Security Administration U.S. Department of Energy ANNUAL EEO PROGRAM STATUS REPORT EEO PLAN TO ATTAIN THE ESSENTIAL ELEMENTS OF A MODEL EEO PROGRAM Table of Contents Page FORM 715-01 Part A Department or Agency Identifying Information......................1 FORM 715-01 Part B Total Employment....................................................................1 FORM 715-01 Part C Agency Official(s) Responsible for oversight of EEO Program(s)................................................................................................................1 FORM 715-01 Part D List of Subordinate Components Covered in this Report ........3 FORM 715-01 Part E Executive Summary.................................................................4

478

Oral Histories: Hematologist Karl F. Hubner, M.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

had experienced this type of accidental radiation exposure, aside from the atomic bomb in 1945; that's a different issue. Dealing with fissionable material, you take the risk...

479

Dawna M. Gilchrist MD FRCPC FCCMG DHMSA Before the University  

E-Print Network (OSTI)

by the round-about. The low-rise to the left is the Red Cross Pavilion. The building at the top left is now;New Space In the 50's and 60's more wings were added to University Hospital. This view is from

MacMillan, Andrew

480

Proceedings: 2002 Radiation Protection Technology Conference: Baltimore, MD, October 2002  

Science Conference Proceedings (OSTI)

In response to program pressures resulting from shorter outages, combined with a diminishing group of contract health physics (HP) technicians, HP professionals must continuously upgrade their programs. Demanding emergent work also requires HP technicians in the nuclear industry to use new methods and technologies. The EPRI Radiation Protection Technology Conference was directed at highlighting a number of key health physics issues and developments.

2003-04-07T23:59:59.000Z

Note: This page contains sample records for the topic "mi ma md" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Proceedings: 2002 Radiation Protection Technology Conference: Baltimore, MD, October 2002  

Science Conference Proceedings (OSTI)

In response to program pressures resulting from shorter outages, combined with a diminishing group of contract health physics (HP) technicians, HP professionals must continuously upgrade their programs. Demanding emergent work also requires HP technicians in the nuclear industry to use new methods and technologies. The EPRI Radiation Protection Technology Conference was directed at highlighting a number of key health physics issues and developments.

None

2003-04-01T23:59:59.000Z

482

100 Bureau Drive, Stop 1915 Gaithersburg, MD 20899 301 ...  

Science Conference Proceedings (OSTI)

... this employer? _____Yes _____No Start Salary: $_____ Final Salary $_____ Describe your duties ...

2012-10-27T23:59:59.000Z

483

FIRE RESEARCH October 13-15, 1992 Rockville, MD  

Science Conference Proceedings (OSTI)

... Total Radiative Heat Loss in Jet Flames porn Singe Point Radiance Measuremen< I? Dutta, YR Sivathanu and JP Gore, Purdue University ..... ...

2004-05-25T23:59:59.000Z

484

Microsoft Word - FY 2010 MD-715 Report.docx  

National Nuclear Security Administration (NNSA)

Prin. Asst. Dep. Admin. Kenneth Baker NA-20 Asst. Dep. Admin. for Science, Engineering & Production Programs W. Steven Goodrum NA-12 Asst. Dep. Admin. for Strategic Planning,...

485

Oral Histories: Dr. George Voelz, M.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

Worker Accident at Idaho's SL-1 Reactor (1961) Controlled Environmental Radioiodine Tests (19631968) Informed Consent at Idaho Tracer Studies on Human Volunteers at Los...

486

Accuracy in Powder Diffraction IV NIST, Gaithersburg MD ...  

Science Conference Proceedings (OSTI)

... iron) Steel Slag Page 5. Iron making - value chain Raw materials Coal Lumpy ore Mining Waste Slag Final product Steel (Retained Austenite) ...

2013-06-07T23:59:59.000Z

487

CURRICULUM VITAE Joseph A. Califano, III, M.D.  

E-Print Network (OSTI)

, Kowalski LP. Trends in incidence and prognosis for head and neck cancer in the United States: A site. Mithani SK, Shao C, Tan M, Smith IM, Califano JA, El-Naggar AK, Ha PK. Mitochondrial mutations in adenoid, Sankaranarayanan R, Califano J, Kowalski L. Global oral health inequalities in incidence and outcomes for oral

May, Brad

488

Oral Histories: Radiologist Earl R. Miller, M.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

Therapy Research Relations Between UC Berkeley and UC San Francisco Working for the Manhattan Project and UC Medical Center Process for Obtaining Radioactive Isotopes Human...

489

Nicolas Demanget, MSc1,2 , Ambroise Duprey, MD2  

E-Print Network (OSTI)

and fabric of current manufactured SGs. Methods Eight marketed SG limbs (Aorfix® , Anaconda® , Endurant

Recanati, Catherine

490

Radiation Resistance of Nickel, Iron, Chromium Spinels by MD ...  

Science Conference Proceedings (OSTI)

About this Abstract. Meeting, 2014 TMS Annual Meeting & Exhibition. Symposium , Radiation Effects in Oxide Ceramics and Novel LWR Fuels. Presentation Title...

491

Modelling Heat Transfer in Nanofluids Based on Coupled MD ...  

Science Conference Proceedings (OSTI)

Simulations have shown that the additional heat transfer caused by the collision of the nanoparticles with the heat source contributes significantly to the...

492

Oral Histories: Dr. Nadine Foreman, M.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

as to dosage-in other words, how many microcuries7 of radioiodine would actually enter the gland and have an effect upon it. Treatment of Hyperthyroidism BERGE: With respect...

493

Images in Neuroscience Carol A. Tamminga, M.D., Editor  

E-Print Network (OSTI)

is delivered to the brain region of interest using a fiberoptic-based system or a light-emitting diode (LED-sensitive, molecular, neu- ronal activity "switches." These "switches" are microbial, light- sensitive ion conductance-regulat- ing activity of these "switches" can be controlled externally with light pulses. ChR2 is a cation

Deisseroth, Karl

494

Materials Degradation and Detection (MD2): Deep Dive Final Report  

SciTech Connect

An effort is underway at Pacific Northwest National Laboratory (PNNL) to develop a fundamental and general framework to foster the science and technology needed to support real-time monitoring of early degradation in materials used in the production of nuclear power. The development of such a capability would represent a timely solution to the mounting issues operators face with materials degradation in nuclear power plants. The envisioned framework consists of three primary and interconnected thrust areas including 1) microstructural science, 2) behavior assessment, and 3) monitoring and predictive capabilities. A brief state-of-the-art assessment for each of these core technology areas is discussed in the paper.

McCloy, John S.; Montgomery, Robert O.; Ramuhalli, Pradeep; Meyer, Ryan M.; Hu, Shenyang Y.; Li, Yulan; Henager, Charles H.; Johnson, Bradley R.

2013-02-01T23:59:59.000Z

495

www.eia.gov  

U.S. Energy Information Administration (EIA)

PU Kenya KE Lesotho LT Liberia LI Libya LY Madagascar MA Malawi MI Mali ML Mauritania MR Mauritius MP Morocco MO Mozambique MZ Namibia WA Niger NG Nigeria NI Reunion ...

496

MONNET, Jrme: "Del urbanismo a la urbanid ad : un d ialog o ent re g eog raf a y arq ueolog a sobre la c iud ad " . P ublic ad o en: S A NDER S , W . T. , MA S TA C H E, A . G . & C OB EA N, R . H . ( ed s. ) , El urbanismo en Mesoamerica / Urbanism in  

E-Print Network (OSTI)

a sobre la c iud ad " . P ublic ad o en: S A NDER S , W . T. , MA S TA C H E, A . G . & C OB EA N, R . H A R Q U E O L O G I A S O B R E L A C I U D A D ** I n t r o d u c c i ó n : l a c i u d a d e s u n o b j e t o s o c i o e s p a c i a l i d e n t i f i c a b l e Est e ensay o p rop one un acercamient

Paris-Sud XI, Université de

497

Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997

498

MI ROPYROLIZER FOR RAPID IOIDENTIFI ATION  

POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...

499

MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2

500

Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...